Science.gov

Sample records for hypoxic transcription gene

  1. Global transcription analysis of Krebs tricarboxylic acid cycle mutants reveals an alternating pattern of gene expression and effects on hypoxic and oxidative genes.

    PubMed

    McCammon, Mark T; Epstein, Charles B; Przybyla-Zawislak, Beata; McAlister-Henn, Lee; Butow, Ronald A

    2003-03-01

    To understand the many roles of the Krebs tricarboxylic acid (TCA) cycle in cell function, we used DNA microarrays to examine gene expression in response to TCA cycle dysfunction. mRNA was analyzed from yeast strains harboring defects in each of 15 genes that encode subunits of the eight TCA cycle enzymes. The expression of >400 genes changed at least threefold in response to TCA cycle dysfunction. Many genes displayed a common response to TCA cycle dysfunction indicative of a shift away from oxidative metabolism. Another set of genes displayed a pairwise, alternating pattern of expression in response to contiguous TCA cycle enzyme defects: expression was elevated in aconitase and isocitrate dehydrogenase mutants, diminished in alpha-ketoglutarate dehydrogenase and succinyl-CoA ligase mutants, elevated again in succinate dehydrogenase and fumarase mutants, and diminished again in malate dehydrogenase and citrate synthase mutants. This pattern correlated with previously defined TCA cycle growth-enhancing mutations and suggested a novel metabolic signaling pathway monitoring TCA cycle function. Expression of hypoxic/anaerobic genes was elevated in alpha-ketoglutarate dehydrogenase mutants, whereas expression of oxidative genes was diminished, consistent with a heme signaling defect caused by inadequate levels of the heme precursor, succinyl-CoA. These studies have revealed extensive responses to changes in TCA cycle function and have uncovered new and unexpected metabolic networks that are wired into the TCA cycle.

  2. Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods.

    PubMed

    Kast, Brigitte; Schori, Christian; Grimm, Christian

    2016-05-01

    Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors.

  3. Transcriptional Network Analysis in Muscle Reveals AP-1 as a Partner of PGC-1α in the Regulation of the Hypoxic Gene Program

    PubMed Central

    Baresic, Mario; Salatino, Silvia; Kupr, Barbara

    2014-01-01

    Skeletal muscle tissue shows an extraordinary cellular plasticity, but the underlying molecular mechanisms are still poorly understood. Here, we use a combination of experimental and computational approaches to unravel the complex transcriptional network of muscle cell plasticity centered on the peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), a regulatory nexus in endurance training adaptation. By integrating data on genome-wide binding of PGC-1α and gene expression upon PGC-1α overexpression with comprehensive computational prediction of transcription factor binding sites (TFBSs), we uncover a hitherto-underestimated number of transcription factor partners involved in mediating PGC-1α action. In particular, principal component analysis of TFBSs at PGC-1α binding regions predicts that, besides the well-known role of the estrogen-related receptor α (ERRα), the activator protein 1 complex (AP-1) plays a major role in regulating the PGC-1α-controlled gene program of the hypoxia response. Our findings thus reveal the complex transcriptional network of muscle cell plasticity controlled by PGC-1α. PMID:24912679

  4. Transcriptional network analysis in muscle reveals AP-1 as a partner of PGC-1α in the regulation of the hypoxic gene program.

    PubMed

    Baresic, Mario; Salatino, Silvia; Kupr, Barbara; van Nimwegen, Erik; Handschin, Christoph

    2014-08-01

    Skeletal muscle tissue shows an extraordinary cellular plasticity, but the underlying molecular mechanisms are still poorly understood. Here, we use a combination of experimental and computational approaches to unravel the complex transcriptional network of muscle cell plasticity centered on the peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), a regulatory nexus in endurance training adaptation. By integrating data on genome-wide binding of PGC-1α and gene expression upon PGC-1α overexpression with comprehensive computational prediction of transcription factor binding sites (TFBSs), we uncover a hitherto-underestimated number of transcription factor partners involved in mediating PGC-1α action. In particular, principal component analysis of TFBSs at PGC-1α binding regions predicts that, besides the well-known role of the estrogen-related receptor α (ERRα), the activator protein 1 complex (AP-1) plays a major role in regulating the PGC-1α-controlled gene program of the hypoxia response. Our findings thus reveal the complex transcriptional network of muscle cell plasticity controlled by PGC-1α.

  5. The metal-responsive transcription factor-1 contributes to HIF-1 activation during hypoxic stress

    SciTech Connect

    Murphy, Brian J. . E-mail: brian.murphy@sri.com; Sato, Barbara G.; Dalton, Timothy P.; Laderoute, Keith R.

    2005-11-25

    Hypoxia-inducible factor-1 (HIF-1), the major transcriptional regulator of the mammalian cellular response to low oxygen (hypoxia), is embedded within a complex network of signaling pathways. We have been investigating the importance of another stress-responsive transcription factor, MTF-1, for the adaptation of cells to hypoxia. This article reports that MTF-1 plays a central role in hypoxic cells by contributing to HIF-1 activity. Loss of MTF-1 in transformed Mtf1 null mouse embryonic fibroblasts (MEFs) results in an attenuation of nuclear HIF-1{alpha} protein accumulation, HIF-1 transcriptional activity, and expression of an established HIF-1 target gene, glucose transporter-1 (Glut1). Mtf1 null (Mtf1 KO) MEFs also have constitutively higher levels of both glutathione (GSH) and the rate-limiting enzyme involved in GSH synthesis-glutamate cysteine ligase catalytic subunit-than wild type cells. The altered cellular redox state arising from increased GSH may perturb oxygen-sensing mechanisms in hypoxic Mtf1 KO cells and decrease the accumulation of HIF-1{alpha} protein. Together, these novel findings define a role for MTF-1 in the regulation of HIF-1 activity.

  6. Enhanceosomes as integrators of hypoxia inducible factor (HIF) and other transcription factors in the hypoxic transcriptional response.

    PubMed

    Pawlus, Matthew R; Hu, Cheng-Jun

    2013-09-01

    Hypoxia is a prevalent attribute of the solid tumor microenvironment that promotes the expression of genes through posttranslational modifications and stabilization of alpha subunits (HIF1α and HIF2α) of hypoxia-inducible factors (HIFs). Despite significant similarities, HIF1 (HIF1α/ARNT) and HIF2 (HIF2α/ARNT) activate common as well as unique target genes and exhibit different functions in cancer biology. More surprisingly, accumulating data indicates that the HIF1- and/or HIF2-mediated hypoxia responses can be oncogenic as well as tumor suppressive. While the role of HIF in the hypoxia response is well established, recent data support the concept that HIF is necessary, but not sufficient for the hypoxic response. Other transcription factors that are activated by hypoxia are also required for the HIF-mediated hypoxia response. HIFs, other transcription factors, co-factors and RNA poll II recruited by HIF and other transcription factors form multifactorial enhanceosome complexes on the promoters of HIF target genes to activate hypoxia inducible genes. Importantly, HIF1 or HIF2 requires distinct partners in activating HIF1 or HIF2 target genes. Because HIF enhanceosome formation is required for the gene activation and distinct functions of HIF1 and HIF2 in tumor biology, disruption of the HIF1 or HIF2 specific enhanceosome complex may prove to be a beneficial strategy in tumor treatment in which tumor growth is specifically dependent upon HIF1 or HIF2 activity.

  7. Mechanisms of Hypoxic Up-Regulation of Versican Gene Expression in Macrophages

    PubMed Central

    Sotoodehnejadnematalahi, Fattah; Staples, Karl J.; Chrysanthou, Elvina; Pearson, Helen; Ziegler-Heitbrock, Loems; Burke, Bernard

    2015-01-01

    Hypoxia is a hallmark of many pathological tissues. Macrophages accumulate in hypoxic sites and up-regulate a range of hypoxia-inducible genes. The matrix proteoglycan versican has been identified as one such gene, but the mechanisms responsible for hypoxic induction are not fully characterised. Here we investigate the up-regulation of versican by hypoxia in primary human monocyte-derived macrophages (HMDM), and, intriguingly, show that versican mRNA is up-regulated much more highly (>600 fold) by long term hypoxia (5 days) than by 1 day of hypoxia (48 fold). We report that versican mRNA decay rates are not affected by hypoxia, demonstrating that hypoxic induction of versican mRNA is mediated by increased transcription. Deletion analysis of the promoter identified two regions required for high level promoter activity of luciferase reporter constructs in human macrophages. The hypoxia-inducible transcription factor HIF-1 has previously been implicated as a key potential regulator of versican expression in hypoxia, however our data suggest that HIF-1 up-regulation is unlikely to be principally responsible for the high levels of induction observed in HMDM. Treatment of HMDM with two distinct specific inhibitors of Phosphoinositide 3-kinase (PI3K), LY290042 and wortmannin, significantly reduced induction of versican mRNA by hypoxia and provides evidence of a role for PI3K in hypoxic up-regulation of versican expression. PMID:26057378

  8. NF-kappaB links innate immunity to the hypoxic response through transcriptional regulation of HIF-1alpha.

    PubMed

    Rius, Jordi; Guma, Monica; Schachtrup, Christian; Akassoglou, Katerina; Zinkernagel, Annelies S; Nizet, Victor; Johnson, Randall S; Haddad, Gabriel G; Karin, Michael

    2008-06-05

    The hypoxic response is an ancient stress response triggered by low ambient oxygen (O2) (ref. 1) and controlled by hypoxia-inducible transcription factor-1 (HIF-1), whose alpha subunit is rapidly degraded under normoxia but stabilized when O2-dependent prolyl hydroxylases (PHDs) that target its O2-dependent degradation domain are inhibited. Thus, the amount of HIF-1alpha, which controls genes involved in energy metabolism and angiogenesis, is regulated post-translationally. Another ancient stress response is the innate immune response, regulated by several transcription factors, among which NF-kappaB plays a central role. NF-kappaB activation is controlled by IkappaB kinases (IKK), mainly IKK-beta, needed for phosphorylation-induced degradation of IkappaB inhibitors in response to infection and inflammation. IKK-beta is modestly activated in hypoxic cell cultures when PHDs that attenuate its activation are inhibited. However, defining the relationship between NF-kappaB and HIF-1alpha has proven elusive. Using in vitro systems, it was reported that HIF-1alpha activates NF-kappaB, that NF-kappaB controls HIF-1alpha transcription and that HIF-1alpha activation may be concurrent with inhibition of NF-kappaB. Here we show, with the use of mice lacking IKK-beta in different cell types, that NF-kappaB is a critical transcriptional activator of HIF-1alpha and that basal NF-kappaB activity is required for HIF-1alpha protein accumulation under hypoxia in cultured cells and in the liver and brain of hypoxic animals. IKK-beta deficiency results in defective induction of HIF-1alpha target genes including vascular endothelial growth factor. IKK-beta is also essential for HIF-1alpha accumulation in macrophages experiencing a bacterial infection. Hence, IKK-beta is an important physiological contributor to the hypoxic response, linking it to innate immunity and inflammation.

  9. Transcriptional Profiling of Hypoxic Neural Stem Cells Identifies Calcineurin-NFATc4 Signaling as a Major Regulator of Neural Stem Cell Biology.

    PubMed

    Moreno, Marta; Fernández, Virginia; Monllau, Josep M; Borrell, Víctor; Lerin, Carles; de la Iglesia, Núria

    2015-08-11

    Neural stem cells (NSCs) reside in a hypoxic microenvironment within the brain. However, the crucial transcription factors (TFs) that regulate NSC biology under physiologic hypoxia are poorly understood. Here we have performed gene set enrichment analysis (GSEA) of microarray datasets from hypoxic versus normoxic NSCs with the aim of identifying pathways and TFs that are activated under oxygen concentrations mimicking normal brain tissue microenvironment. Integration of TF target (TFT) and pathway enrichment analysis identified the calcium-regulated TF NFATc4 as a major candidate to regulate hypoxic NSC functions. Nfatc4 expression was coordinately upregulated by top hypoxia-activated TFs, while NFATc4 target genes were enriched in hypoxic NSCs. Loss-of-function analyses further revealed that the calcineurin-NFATc4 signaling axis acts as a major regulator of NSC self-renewal and proliferation in vitro and in vivo by promoting the expression of TFs, including Id2, that contribute to the maintenance of the NSC state.

  10. The Transcription Factor ZNF395 Is Required for the Maximal Hypoxic Induction of Proinflammatory Cytokines in U87-MG Cells.

    PubMed

    Herwartz, Christine; Castillo-Juárez, Paola; Schröder, Linda; Barron, Blanca L; Steger, Gertrud

    2015-01-01

    Hypoxia activates the expression of proangiogenic and survival promoting factors as well as proinflammatory cytokines that support tissue inflammation. Hypoxia and inflammation are associated with tumor progression. The identification of the factors participating in the hypoxia associated inflammation is essential to develop strategies to control tumor hypoxia. The transcription factor ZNF395 was found to be overexpressed in various tumors including glioblastomas particularly in the network of a hypoxic response pointing to a functional role of ZNF395. On the other hand, ZNF395 was suggested to have tumor suppressor activities which may rely on its repression of proinflammatory factors. To address these conflictive observations, we investigated the role of ZNF395 in the expression of proinflammatory cytokines in the astrocytoma cell line U87-MG under hypoxia. We show that ZNF395 is a target gene of the hypoxia inducible factor HIF-1α. By gene expression analysis, RT-PCR and ELISA, we demonstrated that the siRNA-mediated suppression of ZNF395 impairs the hypoxic induction of IL-1β, IL-6, IL-8, and LIF in U87-MG cells. At ambient oxygen concentrations, ZNF395 had no enhancing effect, indicating that this transcriptional activation by ZNF395 is restricted to hypoxic conditions. Our results suggest that ZNF395 contributes to hypoxia associated inflammation by superactivating proinflammatory cytokines.

  11. The Transcription Factor ZNF395 Is Required for the Maximal Hypoxic Induction of Proinflammatory Cytokines in U87-MG Cells

    PubMed Central

    Herwartz, Christine; Castillo-Juárez, Paola; Schröder, Linda; Barron, Blanca L.; Steger, Gertrud

    2015-01-01

    Hypoxia activates the expression of proangiogenic and survival promoting factors as well as proinflammatory cytokines that support tissue inflammation. Hypoxia and inflammation are associated with tumor progression. The identification of the factors participating in the hypoxia associated inflammation is essential to develop strategies to control tumor hypoxia. The transcription factor ZNF395 was found to be overexpressed in various tumors including glioblastomas particularly in the network of a hypoxic response pointing to a functional role of ZNF395. On the other hand, ZNF395 was suggested to have tumor suppressor activities which may rely on its repression of proinflammatory factors. To address these conflictive observations, we investigated the role of ZNF395 in the expression of proinflammatory cytokines in the astrocytoma cell line U87-MG under hypoxia. We show that ZNF395 is a target gene of the hypoxia inducible factor HIF-1α. By gene expression analysis, RT-PCR and ELISA, we demonstrated that the siRNA-mediated suppression of ZNF395 impairs the hypoxic induction of IL-1β, IL-6, IL-8, and LIF in U87-MG cells. At ambient oxygen concentrations, ZNF395 had no enhancing effect, indicating that this transcriptional activation by ZNF395 is restricted to hypoxic conditions. Our results suggest that ZNF395 contributes to hypoxia associated inflammation by superactivating proinflammatory cytokines. PMID:26229239

  12. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response

    PubMed Central

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D.; Hossian, A. K. M. Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J.

    2016-01-01

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. PMID:27883312

  13. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.

    PubMed

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J

    2017-01-05

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen.

  14. The effects of mitochondrial genotype on hypoxic survival and gene expression in a hybrid population of the killifish, Fundulus heteroclitus.

    PubMed

    Flight, Patrick A; Nacci, Diane; Champlin, Denise; Whitehead, Andrew; Rand, David M

    2011-11-01

    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study, we draw on a population of the teleost fish, Fundulus heteroclitus, where functionally distinct subspecies hybridize, likely as a result of past glacial events. We had two specific aims: (i) to determine the effect of mtDNA genotype on survivorship of male and female fish under hypoxic stress and (ii) to determine the effect of hypoxic stress, sex and mtDNA genotype on gene expression. We found an unexpected and highly significant effect of sex on survivorship under hypoxic conditions, but no significant effect of mtDNA genotype. Gene expression analyses revealed hundreds of transcripts differentially regulated by sex and hypoxia. Mitochondrial transcripts and other predicted pathways were among those influenced by hypoxic stress, and a transcript corresponding to the mtDNA control region was the most highly suppressed transcript under the conditions of hypoxia. An RT-PCR experiment on the control region was consistent with microarray results. Effects of mtDNA sequence variation on genome expression were limited; however, a potentially important epistasis between mtDNA sequence and expression of a nuclear-encoded mitochondrial translation protein was discovered. Overall, these results confirm that mitochondrial regulation is a major component of hypoxia tolerance and further suggest that purifying selection has been the predominant selective force on mitochondrial genomes in these two subspecies.

  15. Developmental Expression and Hypoxic Induction of Hypoxia Inducible Transcription Factors in the Zebrafish

    PubMed Central

    Köblitz, Louise; Fiechtner, Birgit; Baus, Katharina; Lussnig, Rebecca; Pelster, Bernd

    2015-01-01

    The hypoxia inducible transcription factor (HIF) has been shown to coordinate the hypoxic response of vertebrates and is expressed in three different isoforms, HIF-1α, HIF-2α and HIF-3α. Knock down of either Hif-1α or Hif-2α in mice results in lethality in embryonic or perinatal stages, suggesting that this transcription factor is not only controlling the hypoxic response, but is also involved in developmental phenomena. In the translucent zebrafish embryo the performance of the cardiovascular system is not essential for early development, therefore this study was designed to analyze the expression of the three Hif-isoforms during zebrafish development and to test the hypoxic inducibility of these transcription factors. To complement the existing zfHif-1α antibody we expressed the whole zfHif-2α protein and used it for immunization and antibody generation. Similarly, fragments of the zfHif-3α protein were used for immunization and generation of a zfHif-3α specific antibody. To demonstrate presence of the Hif-isoforms during development [between 1 day post fertilization (1 dpf) and 9 dpf] affinity-purified antibodies were used. Hif-1α protein was present under normoxic conditions in all developmental stages, but no significant differences between the different developmental stages could be detected. Hif-2α was also present from 1 dpf onwards, but in post hatching stages (between 5 and 9 dpf) the expression level was significantly higher than prior to hatching. Similarly, Hif-3α was expressed from 1 dpf onwards, and the expression level significantly increased until 5 dpf, suggesting that Hif-2α and Hif-3α play a particular role in early development. Hypoxic exposure (oxygen partial pressure = 5 kPa) in turn caused a significant increase in the level of Hif-1α protein even at 1 dpf and in later stages, while neither Hif-2α nor Hif-3α protein level were affected. In these early developmental stages Hif-1α therefore appears to be more important for

  16. Transcriptional Profiling of Hypoxic Neural Stem Cells Identifies Calcineurin-NFATc4 Signaling as a Major Regulator of Neural Stem Cell Biology

    PubMed Central

    Moreno, Marta; Fernández, Virginia; Monllau, Josep M.; Borrell, Víctor; Lerin, Carles; de la Iglesia, Núria

    2015-01-01

    Summary Neural stem cells (NSCs) reside in a hypoxic microenvironment within the brain. However, the crucial transcription factors (TFs) that regulate NSC biology under physiologic hypoxia are poorly understood. Here we have performed gene set enrichment analysis (GSEA) of microarray datasets from hypoxic versus normoxic NSCs with the aim of identifying pathways and TFs that are activated under oxygen concentrations mimicking normal brain tissue microenvironment. Integration of TF target (TFT) and pathway enrichment analysis identified the calcium-regulated TF NFATc4 as a major candidate to regulate hypoxic NSC functions. Nfatc4 expression was coordinately upregulated by top hypoxia-activated TFs, while NFATc4 target genes were enriched in hypoxic NSCs. Loss-of-function analyses further revealed that the calcineurin-NFATc4 signaling axis acts as a major regulator of NSC self-renewal and proliferation in vitro and in vivo by promoting the expression of TFs, including Id2, that contribute to the maintenance of the NSC state. PMID:26235896

  17. Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.

    PubMed

    Sherman, D R; Voskuil, M; Schnappinger, D; Liao, R; Harrell, M I; Schoolnik, G K

    2001-06-19

    Unlike many pathogens that are overtly toxic to their hosts, the primary virulence determinant of Mycobacterium tuberculosis appears to be its ability to persist for years or decades within humans in a clinically latent state. Since early in the 20th century latency has been linked to hypoxic conditions within the host, but the response of M. tuberculosis to a hypoxic signal remains poorly characterized. The M. tuberculosis alpha-crystallin (acr) gene is powerfully and rapidly induced at reduced oxygen tensions, providing us with a means to identify regulators of the hypoxic response. Using a whole genome microarray, we identified >100 genes whose expression is rapidly altered by defined hypoxic conditions. Numerous genes involved in biosynthesis and aerobic metabolism are repressed, whereas a high proportion of the induced genes have no known function. Among the induced genes is an apparent operon that includes the putative two-component response regulator pair Rv3133c/Rv3132c. When we interrupted expression of this operon by targeted disruption of the upstream gene Rv3134c, the hypoxic regulation of acr was eliminated. These results suggest a possible role for Rv3132c/3133c/3134c in mycobacterial latency.

  18. Novel Genes Critical for Hypoxic Preconditioning in Zebrafish Are Regulators of Insulin and Glucose Metabolism

    PubMed Central

    Manchenkov, Tania; Pasillas, Martina P.; Haddad, Gabriel G.; Imam, Farhad B.

    2015-01-01

    Severe hypoxia is a common cause of major brain, heart, and kidney injury in adults, children, and newborns. However, mild hypoxia can be protective against later, more severe hypoxia exposure via “hypoxic preconditioning,” a phenomenon that is not yet fully understood. Accordingly, we have established and optimized an embryonic zebrafish model to study hypoxic preconditioning. Using a functional genomic approach, we used this zebrafish model to identify and validate five novel hypoxia-protective genes, including irs2, crtc3, and camk2g2, which have been previously implicated in metabolic regulation. These results extend our understanding of the mechanisms of hypoxic preconditioning and affirm the discovery potential of this novel vertebrate hypoxic stress model. PMID:25840431

  19. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.

    2016-01-01

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  20. Identification of hypoxia-inducible target genes of Aspergillus fumigatus by transcriptome analysis reveals cellular respiration as an important contributor to hypoxic survival.

    PubMed

    Kroll, Kristin; Pähtz, Vera; Hillmann, Falk; Vaknin, Yakir; Schmidt-Heck, Wolfgang; Roth, Martin; Jacobsen, Ilse D; Osherov, Nir; Brakhage, Axel A; Kniemeyer, Olaf

    2014-09-01

    Aspergillus fumigatus is an opportunistic, airborne pathogen that causes invasive aspergillosis in immunocompromised patients. During the infection process, A. fumigatus is challenged by hypoxic microenvironments occurring in inflammatory, necrotic tissue. To gain further insights into the adaptation mechanism, A. fumigatus was cultivated in an oxygen-controlled chemostat under hypoxic and normoxic conditions. Transcriptome analysis revealed a significant increase in transcripts associated with cell wall polysaccharide metabolism, amino acid and metal ion transport, nitrogen metabolism, and glycolysis. A concomitant reduction in transcript levels was observed with cellular trafficking and G-protein-coupled signaling. To learn more about the functional roles of hypoxia-induced transcripts, we deleted A. fumigatus genes putatively involved in reactive nitrogen species detoxification (fhpA), NAD(+) regeneration (frdA and osmA), nitrogen metabolism (niaD and niiA), and respiration (rcfB). We show that the nitric oxygen (NO)-detoxifying flavohemoprotein gene fhpA is strongly induced by hypoxia independent of the nitrogen source but is dispensable for hypoxic survival. By deleting the nitrate reductase gene niaD, the nitrite reductase gene niiA, and the two fumarate reductase genes frdA and osmA, we found that alternative electron acceptors, such as nitrate and fumarate, do not have a significant impact on growth of A. fumigatus during hypoxia, but functional mitochondrial respiratory chain complexes are essential under these conditions. Inhibition studies indicated that primarily complexes III and IV play a crucial role in the hypoxic growth of A. fumigatus.

  1. In vivo profiling of hypoxic gene expression in gliomas using the hypoxia marker EF5 and laser-capture microdissection

    PubMed Central

    Marotta, Diane; Karar, Jayashree; Jenkins, W. Timothy; Kumanova, Monika; Jenkins, Kevin W.; Tobias, John W.; Baldwin, Donald; Hatzigeorgiou, Artemis; Alexiou, Panagiotis; Evans, Sydney M.; Alarcon, Rodolfo; Maity, Amit; Koch, Cameron; Koumenis, Constantinos

    2010-01-01

    Hypoxia is a key determinant of tumor aggressiveness, yet little is known regarding hypoxic global gene regulation in vivo. We have employed the hypoxia marker EF5 coupled with laser capture microdissection to isolate RNA from viable hypoxic and normoxic regions of 9L experimental gliomas. Through microarray analysis, we have identified several mRNAs (including the HIF targets Vegf, Glut-1 and Hsp27) with increased levels under hypoxia compared to normoxia both in vitro and in vivo. However, we also found striking differences between the global in vitro and in vivo hypoxic mRNA profiles. Intriguingly, the mRNA levels of a substantial number of immunomodulatory and DNA repair proteins including CXCL9, CD3D and RAD51 were found to be downregulated in hypoxic areas in vivo, consistent with a pro-tumorigenic role of hypoxia in solid tumors. Immunohistochemical staining verified increased HSP27 and decreased RAD51 protein levels in hypoxic vs. normoxic tumor regions. Moreover, CD8+ T cells which are recruited to tumors upon stimulation by CXCL9 and CXCL10, were largely excluded from viable hypoxic areas in vivo. This is the first study to analyze the influence of hypoxia on mRNA levels in vivo and can be readily adapted to obtain a comprehensive picture of hypoxic regulation of gene expression and its influence on biological functions in solid tumors. PMID:21266355

  2. Field study of cyclic hypoxic effects on gene expression in grass shrimp hepatopancreas.

    PubMed

    Li, Tiandao; Brouwer, Marius

    2013-12-01

    Grass shrimp, Palaemonetes pugio, are widely used for ecological and toxicological research. They commonly experience cyclic hypoxia in their natural habitats. The response of grass shrimp to laboratory-controlled cyclic hypoxia has been studied in detail, but little is known about how field acclimatized grass shrimp regulate the gene expression and response to cyclic hypoxia. In this study we examined morphometric parameters, relative fecundity and gene expression of grass shrimp collected from two areas in Weeks Bay (Mobile, Alabama). One is a traditionally normoxic location (WBM), and the other is a traditionally cyclic hypoxic location (WC). In the week preceding grass shrimp collection dissolved oxygen (DO) at the field sites was measured continuously. DO was <2 (mg/L DO) and between 2 and 3 (mg/L DO) for 0 and 255min at WBM, and for 285 and 1035min at WC, respectively. Weight and length of WBM grass shrimp were significantly greater than weight and length of WC shrimp. WBM shrimp had more eggs than WC shrimp, but the difference was not significant. Shrimp from WC had a significant higher number of parasites than those from WBM. A cDNA microarray was utilized to investigate the changes in gene expression in grass shrimp hepatopancreas. Five genes, previously identified as hypoxia/cyclic hypoxia-responsive genes in laboratory exposure studies, were significantly up-regulated in WC shrimp relative to WBM. A total of 5 genes were significantly down-regulated in the field study. Only one of those genes, vitellogenin, has been previously found in chronic and cyclic hypoxic studies. Up and down-regulation of 7 selected genes was confirmed by qPCR. The overall pattern of gene expression in wild shrimp from cyclic DO sites in Weeks Bay showed only weak correlations with gene expression in shrimp from chronic and cyclic hypoxic laboratory studies. It appears therefore that transcriptome profiles of laboratory acclimated animals are of limited utility for understanding

  3. Ixr1p and the control of the Saccharomyces cerevisiae hypoxic response.

    PubMed

    Vizoso-Vázquez, Angel; Lamas-Maceiras, Mónica; Becerra, Manuel; González-Siso, M Isabel; Rodríguez-Belmonte, Esther; Cerdán, M Esperanza

    2012-04-01

    In Saccharomyces cerevisiae, adaptation to hypoxia/anaerobiosis requires the transcriptional induction or derepression of multiple genes organized in regulons controlled by specific transcriptional regulators. Ixr1p is a transcriptional regulatory factor that causes aerobic repression of several hypoxic genes (COX5B, TIR1, and HEM13) and also the activation of HEM13 during hypoxic growth. Analysis of the transcriptome of the wild-type strain BY4741 and its isogenic derivative Δixr1, grown in aerobic and hypoxic conditions, reveals differential regulation of genes related not only to the hypoxic and oxidative stress responses but also to the re-adaptation of catabolic and anabolic fluxes in response to oxygen limitation. The function of Ixr1p in the transcriptional regulation of genes from the sulfate assimilation pathway and other pathways producing α-keto acids is of biotechnological importance for industries based on yeast-derived fermentation products.

  4. Thyrotropin controls transcription of the thyroglobulin gene.

    PubMed

    Van Heuverswyn, B; Streydio, C; Brocas, H; Refetoff, S; Dumont, J; Vassart, G

    1984-10-01

    The availability of rat thyroglobulin cDNA clones was exploited to study the regulation of thyroglobulin gene transcription by thyrotropin (TSH). Groups of rats were subjected to treatments leading to reduction or increase in the rat serum TSH (rTSH) levels. Thyroid gland nuclei were isolated, incubated in vitro in the presence of 32P-labeled uridine triphosphate, and thyroglobulin transcripts were quantitated by hybridization to immobilized rat thyroglobulin cDNA clones. Transcription of the thyroglobulin gene was found to be very active in thyroid nuclei from control animals. It represented about 10% of total RNA polymerase II activity. Chronic hyperstimulation of the thyroid glands with endogenous rTSH was achieved in rats treated with the goitrogen propylthiouracil. No significant increase of thyroglobulin gene transcription could be measured in thyroid nuclei from these animals. On the contrary, a dramatic decrease in thyroglobulin gene transcription was observed in those animals in which endogenous rTSH levels had been suppressed by hypophysectomy or by the administration of triiodothyronine. Injection of exogenous bovine TSH in such animals readily restored transcriptional activity of the gene. Our results identify transcription as an important regulatory step involved in TSH action. They suggest that normal TSH levels induce close to maximal expression of the thyroglobulin gene but that continuous presence of TSH is required in order to maintain the gene in an activated state.

  5. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  6. Characteristics of post-transcriptional gene silencing.

    PubMed

    Chicas, A; Macino, G

    2001-11-01

    A number of gene silencing phenomena that inactivate genes at the post-transcriptional level have been identified. Due to its potential for studying gene function, post-transcriptional gene silencing (PTGS) has become an intense area of research. In this review we describe the different means of inducing PTGS and discuss the possible biological roles of these artificially induced phenomena. We also discuss other features of PTGS such as the mechanism of mRNA degradation, the nature of the silencing signal and the mechanism of PTGS inhibition by viral proteins.

  7. Characteristics of post-transcriptional gene silencing

    PubMed Central

    Chicas, Agustin; Macino, Giuseppe

    2001-01-01

    A number of gene silencing phenomena that inactivate genes at the post-transcriptional level have been identified. Due to its potential for studying gene function, post-transcriptional gene silencing (PTGS) has become an intense area of research. In this review we describe the different means of inducing PTGS and discuss the possible biological roles of these artificially induced phenomena. We also discuss other features of PTGS such as the mechanism of mRNA degradation, the nature of the silencing signal and the mechanism of PTGS inhibition by viral proteins. PMID:11713190

  8. Reverse engineering transcriptional gene networks.

    PubMed

    Belcastro, Vincenzo; di Bernardo, Diego

    2014-01-01

    The aim of this chapter is a step-by-step guide on how to infer gene networks from gene expression profiles. The definition of a gene network is given in Subheading 1, where the different types of networks are discussed. The chapter then guides the readers through a data-gathering process in order to build a compendium of gene expression profiles from a public repository. Gene expression profiles are then discretized and a statistical relationship between genes, called mutual information (MI), is computed. Gene pairs with insignificant MI scores are then discarded by applying one of the described pruning steps. The retained relationships are then used to build up a Boolean adjacency matrix used as input for a clustering algorithm to divide the network into modules (or communities). The gene network can then be used as a hypothesis generator for discovering gene function and analyzing gene signatures. Some case studies are presented, and an online web-tool called Netview is described.

  9. Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin.

    PubMed

    Chandel, N S; Trzyna, W C; McClintock, D S; Schumacker, P T

    2000-07-15

    The transcription factor NF-kappa B stimulates the transcription of proinflammatory cytokines including TNF-alpha. LPS (endotoxin) and hypoxia both induce NF-kappa B activation and TNF-alpha gene transcription. Furthermore, hypoxia augments LPS induction of TNF-alpha mRNA. Previous reports have indicated that antioxidants abolish NF-kappa B activation in response to LPS or hypoxia, which suggests that reactive oxygen species (ROS) are involved in NF-kappa B activation. This study tested whether mitochondrial ROS are required for both NF-kappaB activation and the increase in TNF-alpha mRNA levels during hypoxia and LPS. Our results indicate that hypoxia (1.5% O2) stimulates NF-kappa B and TNF-alpha gene transcription and increases ROS generation as measured by the oxidant sensitive dye 2',7'-dichlorofluorescein diacetate in murine macrophage J774.1 cells. The antioxidants N-acetylcysteine and pyrrolidinedithiocarbamic acid abolished the hypoxic activation of NF-kappa B, TNF-alpha gene transcription, and increases in ROS levels. Rotenone, an inhibitor of mitochondrial complex I, abolished the increase in ROS signal, the activation of NF-kappa B, and TNF-alpha gene transcription during hypoxia. LPS stimulated NF-kappa B and TNF-alpha gene transcription but not ROS generation in J774.1 cells. Rotenone, pyrrolidinedithiocarbamic acid, and N-acetylcysteine had no effect on the LPS stimulation of NF-kappa B and TNF-alpha gene transcription, indicating that LPS activates NF-kappa B and TNF-alpha gene transcription through a ROS-independent mechanism. These results indicate that mitochondrial ROS are required for the hypoxic activation of NF-kappa B and TNF-alpha gene transcription, but not for the LPS activation of NF-kappa B.

  10. Transcriptional Control of the TNF Gene

    PubMed Central

    Falvo, James V.; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2016-01-01

    The cytokine TNF is a critical mediator of immune and inflammatory responses. The TNF gene is an immediate early gene, rapidly transcribed in a variety of cell types following exposure to a broad range of pathogens and signals of inflammation and stress. Regulation of TNF gene expression at the transcriptional level is cell type- and stimulus-specific, involving the recruitment of distinct sets of transcription factors to a compact and modular promoter region. In this review, we describe our current understanding of the mechanisms through which TNF transcription is specifically activated by a variety of extracellular stimuli in multiple cell types, including T cells, B cells, macrophages, mast cells, dendritic cells, and fibroblasts. We discuss the role of nuclear factor of activated T cells and other transcription factors and coactivators in enhanceosome formation, as well as the contradictory evidence for a role for nuclear factor κB as a classical activator of the TNF gene. We describe the impact of evolutionarily conserved cis-regulatory DNA motifs in the TNF locus upon TNF gene transcription, in contrast to the neutral effect of single nucleotide polymorphisms. We also assess the regulatory role of chromatin organization, epigenetic modifications, and long-range chromosomal interactions at the TNF locus. PMID:20173386

  11. Topologies for perfect adaptation in gene transcription

    NASA Astrophysics Data System (ADS)

    Shi, Wenjia; Tang, Chao

    2014-03-01

    Adaptation is commonly used in sensory systems and signaling networks to allow the detection of further stimuli. Despite enzymatic network topologies for adaptation have been investigated systematically, the topology of transcriptional network that could perform adaptation still remains unclear, due to the complexity of transcriptional regulation. Here, we systematically investigated all three-node transcriptional networks, and found the topologies of transcriptional networks for adaptation are different from that of enzymatic ones. While both negative feedback loop (NFBL) and incoherent feed forward loop (IFFL) are capable of performing adaptation analytically, a positive self-regulation on buffer node is necessary for NFBL topology and more flexible structures emerge for IFFL than that of enzymatic networks. Most of the simulation results agree with analytical predictions. This study may explain the mechanism of adapted gene regulation behavior and supply a design table for gene regulatory adaptation.

  12. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  13. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana

    2013-01-01

    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  14. BRG1 and BRM chromatin-remodeling complexes regulate the hypoxia response by acting as coactivators for a subset of hypoxia-inducible transcription factor target genes.

    PubMed

    Sena, Johnny A; Wang, Liyi; Hu, Cheng-Jun

    2013-10-01

    Chromatin remodeling is an active process, which represses or enables the access of transcription machinery to genes in response to external stimuli, including hypoxia. However, in hypoxia, the specific requirement, as well as the molecular mechanism by which the chromatin-remodeling complexes regulate gene expression, remains unclear. In this study, we report that the Brahma (BRM) and Brahma-related gene 1 (BRG1) ATPase-containing SWI/SNF chromatin-remodeling complexes promote the expression of the hypoxia-inducible transcription factor 1α (HIF1α) and HIF2α genes and also promote hypoxic induction of a subset of HIF1 and HIF2 target genes. We show that BRG1 or BRM knockdown in Hep3B and RCC4T cells reduces hypoxic induction of HIF target genes, while reexpression of BRG1 or BRM in BRG1/BRM-deficient SW13 cells increases HIF target gene activation. Mechanistically, HIF1 and HIF2 increase the hypoxic induction of HIF target genes by recruiting BRG1 complexes to HIF target gene promoters, which promotes nucleosome remodeling of HIF target gene promoters in a BRG1 ATPase-dependent manner. Importantly, we found that the function of BRG1 complexes in hypoxic SW13 and RCC4T cells is dictated by the HIF-mediated hypoxia response and could be opposite from their function in normoxic SW13 and RCC4T cells.

  15. The Archipelago Ubiquitin Ligase Subunit Acts in Target Tissue to Restrict Tracheal Terminal Cell Branching and Hypoxic-Induced Gene Expression

    PubMed Central

    Mortimer, Nathan T.; Moberg, Kenneth H.

    2013-01-01

    The Drosophila melanogaster gene archipelago (ago) encodes the F-box/WD-repeat protein substrate specificity factor for an SCF (Skp/Cullin/F-box)-type polyubiquitin ligase that inhibits tumor-like growth by targeting proteins for degradation by the proteasome. The Ago protein is expressed widely in the fly embryo and larva and promotes degradation of pro-proliferative proteins in mitotically active cells. However the requirement for Ago in post-mitotic developmental processes remains largely unexplored. Here we show that Ago is an antagonist of the physiologic response to low oxygen (hypoxia). Reducing Ago activity in larval muscle cells elicits enhanced branching of nearby tracheal terminal cells in normoxia. This tracheogenic phenotype shows a genetic dependence on sima, which encodes the HIF-1α subunit of the hypoxia-inducible transcription factor dHIF and its target the FGF ligand branchless (bnl), and is enhanced by depletion of the Drosophila Von Hippel Lindau (dVHL) factor, which is a subunit of an oxygen-dependent ubiquitin ligase that degrades Sima/HIF-1α protein in metazoan cells. Genetic reduction of ago results in constitutive expression of some hypoxia-inducible genes in normoxia, increases the sensitivity of others to mild hypoxic stimulus, and enhances the ability of adult flies to recover from hypoxic stupor. As a molecular correlate to these genetic data, we find that Ago physically associates with Sima and restricts Sima levels in vivo. Collectively, these findings identify Ago as a required element of a circuit that suppresses the tracheogenic activity of larval muscle cells by antagonizing the Sima-mediated transcriptional response to hypoxia. PMID:23459416

  16. Transcriptional effects of gene dose reduction

    PubMed Central

    2014-01-01

    Large-scale gene dose reductions usually lead to abnormal phenotypes or death. However, male mammals, Drosophila, and Caenorhabditis elegans have only one X chromosome and thus can be considered as monosomic for a major chromosome. Despite the deleterious effects brought about by such gene dose reduction in the case of an autosome, X chromosome monosomy in males is natural and innocuous. This is because of the nearly full transcriptional compensation for X chromosome genes in males, as opposed to no or partial transcriptional compensation for autosomal one-dose genes arising due to deletions. Buffering, the passive absorption of disturbance due to enzyme kinetics, and feedback responses triggered by expression change contribute to partial compensation. Feed-forward mechanisms, which are active responses to genes being located on the X, rather than actual gene dose are important contributors to full X chromosome compensation. In the last decade, high-throughput techniques have provided us with the tools to effectively and quantitatively measure the small-fold transcriptional effects of dose reduction. This is leading to a better understanding of compensatory mechanisms. PMID:24581086

  17. Transcriptional enhancer from milk protein genes

    DOEpatents

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  18. Transcriptional enhancer from milk protein genes

    SciTech Connect

    Casperson, G.F.; Schmidhauser, C.T.; Bissell, M.J.

    1999-12-21

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  19. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  20. Transcriptional Targeting in Cancer Gene Therapy

    PubMed Central

    2003-01-01

    Cancer gene therapy has been one of the most exciting areas of therapeutic research in the past decade. In this review, we discuss strategies to restrict transcription of transgenes to tumour cells. A range of promoters which are tissue-specific, tumour-specific, or inducible by exogenous agents are presented. Transcriptional targeting should prevent normal tissue toxicities associated with other cancer treatments, such as radiation and chemotherapy. In addition, the specificity of these strategies should provide improved targeting of metastatic tumours following systemic gene delivery. Rapid progress in the ability to specifically control transgenes will allow systemic gene delivery for cancer therapy to become a real possibility in the near future. PMID:12721516

  1. Hypoxic culture conditions induce increased metabolic rate and collagen gene expression in ACL-derived cells.

    PubMed

    Kowalski, Tomasz J; Leong, Natalie L; Dar, Ayelet; Wu, Ling; Kabir, Nima; Khan, Adam Z; Eliasberg, Claire D; Pedron, Andrew; Karayan, Ashant; Lee, Siyoung; Di Pauli von Treuheim, Theodor; Jiacheng, Jin; Wu, Ben M; Evseenko, Denis; McAllister, David R; Petrigliano, Frank A

    2016-06-01

    There has been substantial effort directed toward the application of bone marrow and adipose-derived mesenchymal stromal cells (MSCs) in the regeneration of musculoskeletal tissue. Recently, resident tissue-specific stem cells have been described in a variety of mesenchymal structures including ligament, tendon, muscle, cartilage, and bone. In the current study, we systematically characterize three novel anterior cruciate ligament (ACL)-derived cell populations with the potential for ligament regeneration: ligament-forming fibroblasts (LFF: CD146(neg) , CD34(neg) CD44(pos) , CD31(neg) , CD45(neg) ), ligament perivascular cells (LPC: CD146(pos) CD34(neg) CD44(pos) , CD31(neg) , CD45(neg) ) and ligament interstitial cells (LIC: CD34(pos) CD146(neg) , CD44(pos) , CD31(neg) , CD45(neg) )-and describe their proliferative and differentiation potential, collagen gene expression and metabolism in both normoxic and hypoxic environments, and their trophic potential in vitro. All three groups of cells (LIC, LPC, and LFF) isolated from adult human ACL exhibited progenitor cell characteristics with regard to proliferation and differentiation potential in vitro. Culture in low oxygen tension enhanced the collagen I and III gene expression in LICs (by 2.8- and 3.3-fold, respectively) and LFFs (by 3- and 3.5-fold, respectively) and increased oxygen consumption rate and extracellular acidification rate in LICs (by 4- and 3.5-fold, respectively), LFFs (by 5.5- and 3-fold, respectively), LPCs (by 10- and 4.5-fold, respectively) as compared to normal oxygen concentration. In summary, this study demonstrates for the first time the presence of three novel progenitor cell populations in the adult ACL that demonstrate robust proliferative and matrix synthetic capacity; these cells may play a role in local ligament regeneration, and consequently represent a potential cell source for ligament engineering applications. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc

  2. Effect of selenium deficiency on gene transcription

    SciTech Connect

    Christensen, M.J.; Burgener, K.W. )

    1991-03-11

    To investigate the general effects of dietary selenium (Se) deficiency on gene transcription, weanling male Sprague-Dawley rats were fed a basal Se-deficient Torula yeast-based diet or the same diet supplemented with 0.5 ppm Se as sodium selenite for 40 days. At that time three rats in each dietary group were sacrificed. Livers were excised and divided into two portions for isolation of nuclei and for assay of cytosolic Se-glutathione peroxidase (Se-GPX) activity. Se-GPX activity was 279 {plus minus} 4 (mean {plus minus} SEM) mUnits/mg protein in Se-adequate livers, and 10 {plus minus} 2 mUnits/mg protein in Se-deficient livers. One aliquot of nuclei from each dietary group was used in a run-on transcription assay, employing {alpha}-{sup 32}P-UTP to label nascent transcripts. Equal quantities of radioactivity from these nuclei were hybridized with cDNA probes bound to nitrocellulose. Message bound to each probe was quantitated by laser densitometry of autoradiographs, and by scintillation counting of dot blotted nitrocellulose. Transcription of most genes tested, including Se-GPX, was not significantly affected by dietary Se intake. However, the amount of hybridization to a murine oncogene probe (v-fos) was increased in Se deficiency.

  3. Drosophilia alpha-tubulin genes and their transcription patterns.

    PubMed

    Kalfayan, L; Loewenberg, J; Wensink, P C

    1982-01-01

    There are four different alpha-tubulin genes in D. melanogaster DNA; three of them appear as single copies and the other is present as either one or two copies in the haploid genome. The transcripts of three of these genes were examined. Each of them is complementary to a transcript of different length, implying that each is transcribed. Since these transcripts are found on polysomes, it is likely that they are translated. At least two of the genes are complementary to several transcripts, indicating that each of them has more than one transcription start or stop site or perhaps that there are alternative paths of posttranscriptional processing. There is a different developmental pattern of concentrations for transcripts from each of these genes, and different RNAs from the same gene also have different patterns. We conclude that the concentration of transcripts from each gene appears to be independently controlled and that even different transcription products from the same gene appear to independently controlled.

  4. The "fourth dimension" of gene transcription.

    PubMed

    O'Malley, Bert W

    2009-05-01

    The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators.

  5. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  6. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.

    PubMed

    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G

    2016-01-01

    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  7. Reference genes for quantitative real-time polymerase chain reaction studies in soybean plants under hypoxic conditions.

    PubMed

    Nakayama, T J; Rodrigues, F A; Neumaier, N; Marcelino-Guimarães, F C; Farias, J R B; de Oliveira, M C N; Borém, A; de Oliveira, A C B; Emygdio, B M; Nepomuceno, A L

    2014-02-13

    Quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful tool used to measure gene expression. However, because of its high sensitivity, the method is strongly influenced by the quality and concentration of the template cDNA and by the amplification efficiency. Relative quantification is an effective strategy for correcting random and systematic errors by using the expression level of reference gene(s) to normalize the expression level of the genes of interest. To identify soybean reference genes for use in studies of flooding stress, we compared 5 candidate reference genes (CRGs) with the NormFinder and GeNorm programs to select the best internal control. The expression stability of the CRGs was evaluated in root tissues from soybean plants subjected to hypoxic conditions. Elongation factor 1-beta and actin-11 were identified as the most appropriate genes for RT-qPCR normalization by both the NormFinder and GeNorm analyses. The expression profiles of the genes for alcohol dehydrogenase 1, sucrose synthase 4, and ascorbate peroxidase 2 were analyzed by comparing different normalizing combinations (including no normalization) of the selected reference genes. Here, we have identified potential genes for use as references for RT-qPCR normalization in experiments with soybean roots growing in O2-depleted environments, such as flooding-stressed plants.

  8. Transcription-coupled changes to chromatin underpin gene silencing by transcriptional interference.

    PubMed

    Ard, Ryan; Allshire, Robin C

    2016-12-15

    Long non-coding RNA (lncRNA) transcription into a downstream promoter frequently results in transcriptional interference. However, the mechanism of this repression is not fully understood. We recently showed that drug tolerance in fission yeast Schizosaccharomyces pombe is controlled by lncRNA transcription upstream of the tgp1(+) permease gene. Here we demonstrate that transcriptional interference of tgp1(+) involves several transcription-coupled chromatin changes mediated by conserved elongation factors Set2, Clr6CII, Spt6 and FACT. These factors are known to travel with RNAPII and establish repressive chromatin in order to limit aberrant transcription initiation from cryptic promoters present in gene bodies. We therefore conclude that conserved RNAPII-associated mechanisms exist to both suppress intragenic cryptic promoters during genic transcription and to repress gene promoters by transcriptional interference. Our analyses also demonstrate that key mechanistic features of transcriptional interference are shared between S. pombe and the highly divergent budding yeast Saccharomyces cerevisiae Thus, transcriptional interference is an ancient, conserved mechanism for tightly controlling gene expression. Our mechanistic insights allowed us to predict and validate a second example of transcriptional interference involving the S. pombe pho1(+) gene. Given that eukaryotic genomes are pervasively transcribed, transcriptional interference likely represents a more general feature of gene regulation than is currently appreciated.

  9. RNA Activation of the Vascular Endothelial Growth Factor Gene (VEGF) Promoter by Double-Stranded RNA and Hypoxia: Role of Noncoding VEGF Promoter Transcripts

    PubMed Central

    Wagner, Kay-Dietrich; Hofman, Paul; Van Obberghen, Emmanuel

    2016-01-01

    RNA activation (RNAa) is a gene regulation process in which promoter-targeted short double-stranded RNAs (dsRNAs) or microRNAs (miRs) induce target gene expression at the transcriptional level. Here, we investigate the presence of cryptic promoter transcripts within the VEGF promoter. Single-strand sense and antisense noncoding vascular endothelial growth factor (NcVEGF) promoter transcripts are identified, and their respective expression is studied in cells transfected with a VEGF promoter targeted dsRNA, namely, dsVEGF706, in hypoxic cells and in human malignant lung tissues. Interestingly, in dsVEGF706-transfected, as well as in hypoxic cells, NcVEGF expression levels increase coordinately with coding VEGF expression. Ago2 interaction with both sense and antisense NcVEGFs is increased in hypoxic cells, whereas in dsVEGF706-transfected cells, Ago2 and the antisense strand of the dsRNA interact specifically with the sense NcVEGF transcript. Furthermore, both dsVEGF706 and ectopic NcVEGF transcripts are able to activate the VEGF promoter endogenously present or in a reporter construct. Finally, using small interfering RNA targeting Ago2, we show that RNAa plays a role in the maintenance of increased VEGF and NcVEGF expression after hypoxia. Given the central role of VEGF in major human diseases, including cancer, this novel molecular mechanism is poised to reveal promising possibilities for therapeutic interventions. PMID:26976645

  10. Regulation of hypoxia-inducible genes by ETS1 transcription factor.

    PubMed

    Salnikow, Konstantin; Aprelikova, Olga; Ivanov, Sergey; Tackett, Sean; Kaczmarek, Monika; Karaczyn, Aldona; Yee, Herman; Kasprzak, Kazimierz S; Niederhuber, John

    2008-08-01

    Hypoxia-inducible factor (HIF-1) regulates the expression of genes that facilitate tumor cell survival by making them more resistant to therapeutic intervention. Recent evidence suggests that the activation of other transcription factors, in cooperation with HIF-1 or acting alone, is involved in the upregulation of hypoxia-inducible genes. Here we report that high cell density, a condition that might mimic the physiologic situation in growing tumor and most probably representing nutritional starvation, upregulates hypoxia-inducible genes. This upregulation can occur in HIF-independent manner since hypoxia-inducible genes carbonic anhydrase 9 (CA9), lysyloxidase like 2 (LOXL2) and n-myc-down regulated 1 (NDRG1)/calcium activated protein (Cap43) can be upregulated by increased cell density under both normoxic and hypoxic conditions in both HIF-1 alpha-proficient and -deficient mouse fibroblasts. Moreover, cell density upregulates the same genes in 1HAEo- and A549 human lung epithelial cells. Searching for other transcription factors involved in the regulation of hypoxia-inducible genes by cell density, we focused our attention on ETS1. As reported previously, members of v-ets erythroblastosis virus E26 oncogene homolog (ETS) family transcription factors participate in the upregulation of hypoxia-inducible genes. Here, we provide evidence that ETS1 protein is upregulated at high cell density in both human and mouse cells. The involvement of ETS1 in the upregulation of hypoxia-inducible genes was further confirmed in a luciferase reporter assay using cotransfection of ETS1 expression vector with NDRG1/Cap43 promoter construct. The downregulation of ETS1 expression with small interfering RNA (siRNA) inhibited the upregulation of CA9 and NDRG1/Cap43 caused by increased cell density. Collectively, our data indicate the involvement of ETS1 along with HIF-1 in regulating hypoxia-inducible genes.

  11. Effects of hemorrhage on cytokine gene transcription.

    PubMed

    Shenkar, R; Abraham, E

    1993-08-01

    Injury and blood loss are often followed by infection and the rapid development of organ system dysfunction, frequently involving mucosal sites, such as the lung and intestine. To examine possible mechanisms contributing to these conditions, we used semiquantitative polymerase chain reactions to determine cytokine mRNA expression among cellular populations isolated from mucosal and systemic anatomic sites of mice at predetermined time points following 30% blood volume hemorrhage with resuscitation 1 hr later. Within 1 hr after hemorrhage, significant increases were observed in mRNA levels for IL-1 alpha, IL-1 beta, IL-5, and TGF-beta in intraparenchymal pulmonary mononuclear cells. The levels of TGF-beta transcripts among alveolar macrophages were increased 1 hr following blood loss, and increase in IL-1 alpha transcripts was found starting 2 hr posthemorrhage. Cells from Peyer's patches showed significant increases in mRNA levels for IL-1 beta, IL-2, IL-5, IL-6, IFN-gamma, and TGF-beta during the 4 hr following hemorrhage. Significant increases in mRNA levels for IL-1 beta, TNF-alpha, and TGF-beta were present within 4 hr of blood loss among cells isolated from mesenteric lymph nodes. The expression of mRNA for most cytokines was not significantly altered in splenocytes or peripheral blood mononuclear cells at any time point following hemorrhage. These experiments demonstrate that blood loss, even if resuscitated, produces significant increases in proinflammatory and immunoregulatory cytokine gene transcription as early as 1 hr following hemorrhage. These posthemorrhage alterations in cytokine mRNA expression were particularly prominent at mucosal sites, suggesting a mechanism for the increased incidence of pulmonary and intestinal involvement in organ system failure following severe blood loss and injury.

  12. Transcriptional regulation of the uncoupling protein-1 gene.

    PubMed

    Villarroya, Francesc; Peyrou, Marion; Giralt, Marta

    2017-03-01

    Regulated transcription of the uncoupling protein-1 (UCP1) gene, and subsequent UCP1 protein synthesis, is a hallmark of the acquisition of the differentiated, thermogenically competent status of brown and beige/brite adipocytes, as well as of the responsiveness of brown and beige/brite adipocytes to adaptive regulation of thermogenic activity. The 5' non-coding region of the UCP1 gene contains regulatory elements that confer tissue specificity, differentiation dependence, and neuro-hormonal regulation to UCP1 gene transcription. Two main regions-a distal enhancer and a proximal promoter region-mediate transcriptional regulation through interactions with a plethora of transcription factors, including nuclear hormone receptors and cAMP-responsive transcription factors. Co-regulators, such as PGC-1α, play a pivotal role in the concerted regulation of UCP1 gene transcription. Multiple interactions of transcription factors and co-regulators at the promoter region of the UCP1 gene result in local chromatin remodeling, leading to activation and increased accessibility of RNA polymerase II and subsequent gene transcription. Moreover, a commonly occurring A-to-G polymorphism in close proximity to the UCP1 gene enhancer influences the extent of UCP1 gene transcription. Notably, it has been reported that specific aspects of obesity and associated metabolic diseases are associated with human population variability at this site. On another front, the unique properties of the UCP1 promoter region have been exploited to develop brown adipose tissue-specific gene delivery tools for experimental purposes.

  13. Gene expression in plant mitochondria: transcriptional and post-transcriptional control.

    PubMed Central

    Binder, Stefan; Brennicke, Axel

    2003-01-01

    The informational content of the mitochondrial genome in plants is, although small, essential for each cell. Gene expression in these organelles involves a number of distinct transcriptional and post-transcriptional steps. The complex post-transcriptional processes of plant mitochondria such as 5' and 3' RNA processing, intron splicing, RNA editing and controlled RNA stability extensively modify individual steady-state RNA levels and influence the mRNA quantities available for translation. In this overview of the processes in mitochondrial gene expression, we focus on confirmed and potential sites of regulatory interference and discuss the evolutionary origins of the transcriptional and post-transcriptional processes. PMID:12594926

  14. Transcriptional regulation of bacterial virulence gene expression by molecular oxygen and nitric oxide

    PubMed Central

    Green, Jeffrey; Rolfe, Matthew D; Smith, Laura J

    2014-01-01

    Molecular oxygen (O2) and nitric oxide (NO) are diatomic gases that play major roles in infection. The host innate immune system generates reactive oxygen species and NO as bacteriocidal agents and both require O2 for their production. Furthermore, the ability to adapt to changes in O2 availability is crucial for many bacterial pathogens, as many niches within a host are hypoxic. Pathogenic bacteria have evolved transcriptional regulatory systems that perceive these gases and respond by reprogramming gene expression. Direct sensors possess iron-containing co-factors (iron–sulfur clusters, mononuclear iron, heme) or reactive cysteine thiols that react with O2 and/or NO. Indirect sensors perceive the physiological effects of O2 starvation. Thus, O2 and NO act as environmental cues that trigger the coordinated expression of virulence genes and metabolic adaptations necessary for survival within a host. Here, the mechanisms of signal perception by key O2- and NO-responsive bacterial transcription factors and the effects on virulence gene expression are reviewed, followed by consideration of these aspects of gene regulation in two major pathogens, Staphylococcus aureus and Mycobacterium tuberculosis. PMID:25603427

  15. Spatially coordinated dynamic gene transcription in living pituitary tissue.

    PubMed

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael R H; Davis, Julian R E

    2016-02-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary 'on-off' process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour.

  16. Transcription of functionally related constitutive genes is not coordinated.

    PubMed

    Gandhi, Saumil J; Zenklusen, Daniel; Lionnet, Timothée; Singer, Robert H

    2011-01-01

    Expression of an individual gene can vary considerably among genetically identical cells because of stochastic fluctuations in transcription. However, proteins comprising essential complexes or pathways have similar abundances and lower variability. It is not known whether coordination in the expression of subunits of essential complexes occurs at the level of transcription, mRNA abundance or protein expression. To directly measure the level of coordination in the expression of genes, we used highly sensitive fluorescence in situ hybridization (FISH) to count individual mRNAs of functionally related and unrelated genes within single Saccharomyces cerevisiae cells. Our results revealed that transcript levels of temporally induced genes are highly correlated in individual cells. In contrast, transcription of constitutive genes encoding essential subunits of complexes is not coordinated because of stochastic fluctuations. The coordination of these functional complexes therefore must occur post-transcriptionally, and likely post-translationally.

  17. Modular composition of gene transcription networks.

    PubMed

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-03-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems.

  18. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  19. A Complete Set of Nascent Transcription Rates for Yeast Genes

    PubMed Central

    Pelechano, Vicent; Chávez, Sebastián; Pérez-Ortín, José E.

    2010-01-01

    The amount of mRNA in a cell is the result of two opposite reactions: transcription and mRNA degradation. These reactions are governed by kinetics laws, and the most regulated step for many genes is the transcription rate. The transcription rate, which is assumed to be exercised mainly at the RNA polymerase recruitment level, can be calculated using the RNA polymerase densities determined either by run-on or immunoprecipitation using specific antibodies. The yeast Saccharomyces cerevisiae is the ideal model organism to generate a complete set of nascent transcription rates that will prove useful for many gene regulation studies. By combining genomic data from both the GRO (Genomic Run-on) and the RNA pol ChIP-on-chip methods we generated a new, more accurate nascent transcription rate dataset. By comparing this dataset with the indirect ones obtained from the mRNA stabilities and mRNA amount datasets, we are able to obtain biological information about posttranscriptional regulation processes and a genomic snapshot of the location of the active transcriptional machinery. We have obtained nascent transcription rates for 4,670 yeast genes. The median RNA polymerase II density in the genes is 0.078 molecules/kb, which corresponds to an average of 0.096 molecules/gene. Most genes have transcription rates of between 2 and 30 mRNAs/hour and less than 1% of yeast genes have >1 RNA polymerase molecule/gene. Histone and ribosomal protein genes are the highest transcribed groups of genes and other than these exceptions the transcription of genes is an infrequent phenomenon in a yeast cell. PMID:21103382

  20. Transcriptional Regulation of Gene Expression in C. elegans

    PubMed Central

    Reinke, Valerie; Krause, Michael; Okkema, Peter

    2013-01-01

    Protein coding gene sequences are converted to mRNA by the highly regulated process of transcription. The precise temporal and spatial control of transcription for many genes is an essential part of development in metazoans. Thus, understanding the molecular mechanisms underlying transcriptional control is essential to understanding cell fate determination during embryogenesis, post-embryonic development, many environmental interactions, and disease-related processes. Studies of transcriptional regulation in C. elegans exploit its genomic simplicity and physical characteristics to define regulatory events with single cell and minute time scale resolution. When combined with the genetics of the system, C. elegans offers a unique and powerful vantage point from which to study how chromatin-associated protein and their modifications interact with transcription factors and their binding sites to yield precise control of gene expression through transcriptional regulation. PMID:23801596

  1. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  2. Natural antisense transcripts of Alzheimer's disease associated genes.

    PubMed

    Guo, Jin-Hu; Cheng, Hai-Peng; Yu, Long; Zhao, Shouyuan

    2006-04-01

    Natural antisense transcripts (NATs), also named endogenous antisense transcripts, are a class of genes whose role in controlling gene expression is becoming more and more relevant. NATs might play important roles in gene expression and translation regulation. Present work investigated the presence of NATs of Alzheimer's disease associated genes including PRESENILIN1, PRESENILIN2, BACE1, BACE2, APP, APOE, TAU (MAPT), PRION, alpha-SYNUCLEIN (SNCA), NICASTRIN, PEN2, APH1A, APH1B as well as CD147 (BASIGIN), and the results revealed that APP, BACE2, APH1A, TAU, CD147 and alpha-SYNUCLEIN contain natural antisense transcripts. These NATs were characterized according to the sense-antisense overlapping information and potential functional mechanisms were proposed. Present findings provide preliminary but important information about transcription regulation of AD associated genes, which would further our understanding of the gene expression regulation of AD, and also suggest a novel potential strategy for the therapy of AD.

  3. The Association between NOS3 Gene Polymorphisms and Hypoxic-Ischemic Encephalopathy Susceptibility and Symptoms in Chinese Han Population

    PubMed Central

    Wu, Yongqin; Fang, Xiaoxia; Yin, Ling; Liu, Yuxia; Xu, Shouxia; Li, Aixue

    2016-01-01

    Endothelial NOS (NOS3) has a potential role in the prevention of neuronal injury in hypoxic-ischemic encephalopathy (HIE). Thus, we aimed to explore the association between NOS3 gene polymorphisms and HIE susceptibility and symptoms in a Chinese Han population. Three single nucleotide polymorphisms (SNPs) in the NOS3 gene, rs1800783, rs1800779, and rs2070744, were detected in 226 children with HIE and 212 healthy children in a Chinese Han population. Apgar scores and magnetic resonance image scans were used to estimate the symptoms and brain damage. The association analyses were conducted by using SNPStats and SPSS 18.0 software. The genotype and allele distributions of rs1800779 and rs1799983 displayed no significant differences between the patients and the controls, while the rs2070744 allele distribution was significantly different (corrected P = 0.009). For clinical characteristics, the rs2070744 genotype distribution was significantly different in patients with different Apgar scores (≤5, TT/TC/CC = 6/7/5; 6~7, TT/TC/CC = 17/0/0; 8~9, TT/TC/CC = 6/2/0; 10, TT/TC/CC = 7/1/0; corrected P = 0.006) in the 1001 to 1449 g birth weight subgroup. The haplotype test did not show any associations with the risk and clinical characteristics of HIE. The results suggest that NOS3 gene SNP rs2070744 was significantly associated with HIE susceptibility and symptom expression in Chinese Han population. PMID:28070505

  4. N-myc Downstream-Regulated Gene 1 (NDRG1) mediates pomegranate juice protection from apoptosis in hypoxic BeWo cells but not in primary human trophoblasts

    PubMed Central

    Chen, Baosheng; Zaveri, Parul G.; Longtine, Mark S.; Nelson, D. Michael

    2015-01-01

    Introduction N-Myc downstream-regulated gene 1 (NDRG1) expression is increased in placentas of human pregnancies with intrauterine growth restriction and in hypoxic cultured primary trophoblasts. We previously showed that elevated NDRG1 decreases trophoblast apoptosis induced by hypoxia. Separately, we found that pomegranate juice (PJ) decreases cell death induced by hypoxia in trophoblasts. Here, we test the hypothesis that PJ protects trophoblasts from hypoxia-induced apoptosis by modulating NDRG1 expression. Methods Quantitative rtPCR was used to investigate the effects of PJ treatment on mRNA levels of 22 candidate genes involved in apoptosis, oxidative stress, and differentiation in trophoblasts. Western blotting and immunofluorescence were used to analyze NDRG1 protein levels. siRNA-mediated NDRG1 knockdown was used to investigate the role of NDRG1 in response to PJ in hypoxic BeWo choriocarcinoma cells and hypoxic cultured primary human trophoblasts. Results The mRNA levels of eight genes were altered, with NDRG1 showing the largest response to PJ and thus, we pursued the role of NDRG1 here. PJ significantly increased NDRG1 protein expression in primary trophoblasts and in BeWo cells. Knockdown of NDRG1 in hypoxic BeWo cells in the presence of PJ yielded increased apoptosis. In contrast, knockdown of NDRG1 in hypoxic primary trophoblasts in the presence of PJ did not increase apoptosis. Discussion We conclude that the PJ-mediated decrease in cell death in hypoxia is partially mediated by NDRG1 in BeWo cells but not in primary trophoblasts. The disparate effects of NDRG1 between BeWo cells and primary trophoblasts indicate caution is required when extrapolating from results obtained with cell lines to primary trophoblasts. PMID:26028238

  5. Lentiviral vector PLV-PI3KCG gene transfer inhibits hypoxic cardiomyocytes apoptosis

    PubMed Central

    Li, Yan-Yan; Zhang, Hui; Lu, Xin-Zheng

    2015-01-01

    The PI3K/Akt signal pathway was suggested to be associated with apoptosis. However, it was still unclear whether activated PI3K/Akt signaling pathway could inhibit hypoxic cardiomyocytes apoptosis. In this research, the recombinant PI3KCG lentiviral vector plasmid (PLV-PI3KCG) was constructed and transfected into neonatal rat hypoxia/reoxygenation (H/R) injury cardiomyocytes models which were randomly divided into five groups as the normal control group, H/R group, HR empty plasmid group (HRE group), HR PLV-PI3KCG transfection preconditioning group (HRP group), and HR PLV-PI3KCG transfection + LY294002 group (HRPL group). Compared with the H/R, HRE and HRPL groups, the cardiomyocytes beat frequency and survival rate in the HRP group were significantly increased (P<0.05) and the released LDH were significantly decreased (P<0.05). The Bcl-2/Bax ratio was significantly lower in H/R, HRE and HRPL groups than that in HRP group (P<0.05). Activated PI3K/Akt signaling pathway could play a protection role in the cardiomyocytes H/R injury process which could be inhibited by LY294002. PMID:26884933

  6. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-01-01

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: http://dx.doi.org/10.7554/eLife.03635.001 PMID:25407679

  7. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene

    SciTech Connect

    Johnson, P.J.; Kooter, J.M.; Borst, P.

    1987-10-23

    We have used inactivation of transcription by UV irradiation to map transcription units in trypanosomes. The relative inactivation rate of the transcription of mini-exon, 5S, and rRNA genes was inversely proportional to the previously estimated lengths of these transcription units. The telomeric transcription unit containing the gene for variant-specific surface glycoprotein (VSG) 221 was inactivated as a single unit of 60 kb. This long transcription unit comprises at least one other protein-coding gene and yields seven other stable mRNAs. These data thus provide evidence for a multicistronic transcription unit for cellular genes in a eukaryote.

  8. [Transcription start site determination in Stylonychia lemnae tubulin genes].

    PubMed

    Pimenov, A Iu

    2008-01-01

    Contemporary experimental literature concerning transcription regulation study contains a lot of inconsistencies between data on precise transcription start site position in tubulin genes of hypotrychious ciliates. We have revealed that the reason of these inconsistencies lies in the methods applied by scientists. In present study, the basic methods of transcription start site identification were analyzed. The modification of transcription start site identification method based on the analysis of sequencing and primer extension reactions products on the same PAA gel was elaborated using Stylonychia lemnae tubulin genes as a model object. The use ofnon-phosphorylated primers in sequencing reaction (in accordance with standard procedure) leads to the appearance of band shifting which causes mistakes in results evaluation. This band shifting can be eliminated by the use of primers phosphorylated by non-radioactive phosphorus. In present study we applied this method to redetermine transcription start sites in alpha1-, alpha2-, beta1- and beta2-tubulin genes of S. lemnae.

  9. Marine Natural Products as Inhibitors of Hypoxic Signaling in Tumors

    PubMed Central

    Nagle, Dale G.; Zhou, Yu-Dong

    2010-01-01

    Marine natural products have become a major source of new chemical entities in the discovery of potential anticancer agents that potently suppress various antitumor molecular targets. As a consequence of insufficient vascularization, hypoxic regions form within rapidly growing solid tumor masses. Specific alterations of gene expression in these hypoxic tumor cells help facilitate the survival and metastatic spread of solid tumors. The transcriptional response to cellular hypoxia is primarily mediated by the transcription factor hypoxia-inducible factor-1 (HIF-1) that regulates the expression of more than 100 genes involved in cellular adaptation and survival under hypoxic stress. Clinical studies in cancer patients indicate that HIF-1 activation is directly correlated with advanced disease stages and treatment resistance. HIF-1 has emerged as an important tumor-selective molecular target for anticancer drug discovery. As a result, natural product-based inhibitors of HIF-1 activation have been identified from plants and microorganisms. Recently, structurally unique natural products from marine sponges, crinoids, and algae have been identified as HIF-1 activation inhibitors. The US National Cancer Institute’s Open Repository of marine invertebrate and algae extracts has proven to be a valuable source of natural product HIF-1 inhibitors. Among the active compounds identified, certain marine natural products have also been shown to suppress the hypoxic induction of HIF-1 target genes such as vascular endothelial growth factor (VEGF). Some of these marine HIF-1 inhibitors act by interfering with the generation of mitochondrial signaling molecules in hypoxic cells. However, the precise mechanisms of action for many newly identified marine natural product HIF-1 inhibitors remain unresolved. PMID:20622986

  10. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    SciTech Connect

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-05-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. /sup 32/P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA.

  11. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available

    1986-01-01

    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  12. Modulation of Elk-dependent-transcription by Gene33.

    PubMed

    Keeton, Adam B; Messina, Joseph L

    2005-04-15

    Gene33 is a cytoplasmic protein expressed in many cell types, including those of renal and hepatic origin. Its expression is regulated by a large number of mitogenic and stressful stimuli, both in cultured cells and in vivo. Gene33 protein possesses binding domains for ErbB receptors, 14-3-3 proteins, SH-3 domains, and GTP bound Cdc42, suggesting that it may play a role in signal transduction. Indeed, these regions of Gene33 have been reported to modulate signaling through the ERK, JNK, and NFkappaB pathways. In the present work, epitope-tagged full-length and truncation mutants, as well as wild-type Gene33, were overexpressed in 293 cells. The expression of these proteins was compared to the level of endogenous Gene33 by Western blot using a newly developed polyclonal antibody. As proxies for activity of the ERK and JNK pathways, Elk- and c-Jun-dependent transcription were measured by a luciferase reporter gene. Moderate expression levels of full-length Gene33 caused a twofold increase in Elk-dependent transcription, while at higher levels, c-Jun-dependent transcription was partially inhibited. The C-terminal half of Gene33 significantly increased both Elk- and c-Jun-dependent transcription when expressed at approximately threefold above control levels. This effect on Elk-dependent transcription was lost at higher levels of Gene33 expression. In contrast, higher levels of the C-terminal half of Gene33 caused a progressively greater effect on c-Jun-dependent transcription. These findings suggest that Gene33 may increase ERK activity, and that the C-terminal half of Gene33 may act less specifically in the absence of the N-terminal half, inducing JNK activity.

  13. TransFind—predicting transcriptional regulators for gene sets

    PubMed Central

    Kiełbasa, Szymon M.; Klein, Holger; Roider, Helge G.; Vingron, Martin; Blüthgen, Nils

    2010-01-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/. PMID:20511592

  14. Rampant polyuridylylation of plastid gene transcripts in the dinoflagellate Lingulodinium

    PubMed Central

    Wang, Yunling; Morse, David

    2006-01-01

    Dinoflagellate plastid genes are believed to be encoded on small generally unigenic plasmid-like minicircles. The minicircle gene complement has reached saturation with an incomplete set of plastid genes (18) compared with typical functional plastids (60–200). While some of the missing plastid genes have recently been found in the nucleus, it is still unknown if additional genes, not located on minicircles, might also contribute to the plastid genome. Sequencing of tailed RNA showed that transcripts derived from the known minicircle genes psbA and atpB contained a homogenous 3′ polyuridine tract of 25–40 residues. This unusual modification suggested that random sequencing of a poly(dA) primed cDNA library could be used to characterize the plastid transcriptome. We have recovered only 12 different polyuridylylated transcripts from our library, all of which are encoded on minicircles in several dinoflagellate species. The correspondence of all polyuridylylated transcripts with previously described minicircle genes thus supports the dinoflagellate plastid as harbouring the smallest genome of any functional chloroplast. Interestingly, northern blots indicate that the majority of transcripts are modified, suggesting that polyuridylylation is unlikely to act as a degradation signal as do the heterogeneous poly(A)-rich extensions of transcripts in cyanobacteria and other plastids. PMID:16434702

  15. Regulation of cytokine gene transcription in the immune system.

    PubMed

    Holloway, A F; Rao, S; Shannon, M F

    2002-01-01

    The controlled expression of cytokine genes is an essential component of an immune response. The specific types of cytokines as well as the time and place of their production is important in generating an appropriate immune response to an infectious agent. Aberrant expression is associated with pathological conditions of the immune system such as autoimmunity, atopy and chronic inflammation. Cytokine gene transcription is generally induced in a cell-specific manner. Over the last 15 years, a large amount of information has been generated describing the transcriptional controls that are exerted on cytokine genes. Recently, efforts have been directed at understanding how these genes are transcribed in a chromatin context. This review will discuss the mechanisms by which cytokine genes become available for transcription in a cell-restricted manner as well as the mechanisms by which these genes sense their environment and activate high level transcription in a transient manner. Particular attention will be paid to the role of chromatin in allowing transcription factor access to appropriate genes.

  16. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  17. Widespread transcription of a Qa region gene in adult mice

    PubMed Central

    1987-01-01

    The mouse MHC class I family includes genes encoded in four regions: H- 2K, H-2D, Qa and Tla. While K/D genes are well characterized, relatively little is known about Qa or Tla genes. We have studied the transcription of a B10.P Qa region gene. DNA sequence comparisons of the transmembrane region, supported by Southern blot analysis of cosmid and genomic DNAs from BALB/c and C57BL/10, demonstrate the lambda 3a gene corresponds to Q4p. In both Northern blots and RNA protection experiments using probes derived from the 3' noncoding region, we found that Q4, like the H-2K and H-2D genes, is widely transcribed in B10.P tissues. These data demonstrate for the first time widespread transcription of a Qa gene. PMID:2439640

  18. Antisense transcription as a tool to tune gene expression.

    PubMed

    Brophy, Jennifer A N; Voigt, Christopher A

    2016-01-14

    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  19. Heterodimeric Drosophila gap gene protein complexes acting as transcriptional repressors.

    PubMed Central

    Sauer, F; Jäckle, H

    1995-01-01

    The Drosophila gap gene Krüppel (Kr) encodes a transcriptional regulator. It acts both as an integral part of the Drosophila segmentation gene in the early blastoderm and in a variety of tissues and organs at later stages of embryogenesis. In transfected tissue culture cells, the Kr protein (Kr) was shown to both activate and repress gene expression in a concentration-dependent manner when acting from a single binding site close to the promoter. Here we show that KR can associate with the transcription factors encoded by the gap genes knirps (kni) and hunchback (hb) which affect KR-dependent gene expression in Drosophila tissue culture cells. The association of DNA-bound hb protein or free kni protein with distinct but different regions of KR results in the formation of DNA-bound transcriptional repressor complexes. Our results suggest that individual transcription factors can associate to form protein complexes which act as direct repressors of transcription. The interactions shown here add an unexpected level of complexity to the control of gene expression. Images PMID:7588607

  20. The murine Sry gene encodes a nuclear transcriptional activator

    SciTech Connect

    Dubin, R.A.; Ostrer, H.

    1994-09-01

    The Sry gene functions as a genetic switch in gonadal ridge initiating testis determination. The murine Sry and human SRY open reading frames (ORF) share a conserved 79 amino acid motif, the HMG-box, that binds DNA. Outside this region the two genes share no additional homology. These studies were undertaken to determine whether the Sry/SRY genes encode nuclear transcriptional regulators. As judged by the accumulation of lacZ-SRY hybrid proteins in the nucleus, both the human and murine SRY ORFs contain a nuclear localization signal. The murine Sry HMG-box selectively binds the sequence NACAAT in vitro when presented with a random pool of oligonucleotides and binds AACAAT with the highest affinity. The murine Sry ORF, when expressed in HeLa cells, activates transcription of a reporter gene containing multiple copies of the AACAAT binding site. Activation was observed for a GAL4-responsive gene when the murine Sry ORF was linked to the DNA-binding domain of GAL4. Using this system, the activation function was mapped to a C-terminal glutamine/histidine-rich domain. In addition, LexA-Sry fusion genes activated a LexA-responsive gene in yeast. In contrast, a GAL4-human SRY fusion gene did not cause transcriptional activation. These studies suggest that both the human and mouse SRY ORFs encode nuclear, DNA-binding proteins, and that the mouse Sry ORF can function as a transcriptional activator with separable DNA-binding and activator domains.

  1. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  2. Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization

    PubMed Central

    Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.

    2014-01-01

    In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria. PMID

  3. Gene Expression Suggests Spontaneously Hypertensive Rats May Have Altered Metabolism and Reduced Hypoxic Tolerance

    PubMed Central

    Ritz, Marie-Françoise; Grond-Ginsbach, Caspar; Engelter, Stefan; Lyrer, Philippe

    2012-01-01

    Cerebral small vessel disease (SVD) is an important cause of stroke, cognitive decline and vascular dementia (VaD). It is associated with diffuse white matter abnormalities and small deep cerebral ischemic infarcts. The molecular mechanisms involved in the development and progression of SVD are unclear. As hypertension is a major risk factor for developing SVD, Spontaneously Hypertensive Rats (SHR) are considered an appropriate experimental model for SVD. Prior work suggested an imbalance between the number of blood microvessels and astrocytes at the level of the neurovascular unit in 2-month-old SHR, leading to neuronal hypoxia in the brain of 9-month-old animals. To identify genes and pathways involved in the development of SVD, we compared the gene expression profile in the cortex of 2 and 9-month-old of SHR with age-matched normotensive Wistar Kyoto (WKY) rats using microarray-based technology. The results revealed significant differences in expression of genes involved in energy and lipid metabolisms, mitochondrial functions, oxidative stress and ischemic responses between both groups. These results strongly suggest that SHR suffer from chronic hypoxia, and therefore are unable to tolerate ischemia-like conditions, and are more vulnerable to high-energy needs than WKY. This molecular analysis gives new insights about pathways accounting for the development of SVD. PMID:22272763

  4. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.

    PubMed

    Matys, V; Kel-Margoulis, O V; Fricke, E; Liebich, I; Land, S; Barre-Dirrie, A; Reuter, I; Chekmenev, D; Krull, M; Hornischer, K; Voss, N; Stegmaier, P; Lewicki-Potapov, B; Saxel, H; Kel, A E; Wingender, E

    2006-01-01

    The TRANSFAC database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match and Patch provides increased functionality for TRANSFAC. The list of databases which are linked to the common GENE table of TRANSFAC and TRANSCompel has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD and TRANSPRO. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC 7.0 and TRANSCompel 7.0, are accessible under http://www.gene-regulation.com/pub/databases.html.

  5. Gene looping facilitates TFIIH kinase-mediated termination of transcription

    PubMed Central

    Medler, Scott; Ansari, Athar

    2015-01-01

    TFIIH is a general transcription factor with kinase and helicase activities. The kinase activity resides in the Kin28 subunit of TFIIH. The role of Kin28 kinase in the early steps of transcription is well established. Here we report a novel role of Kin28 in the termination of transcription. We show that RNAPII reads through a termination signal upon kinase inhibition. Furthermore, the recruitment of termination factors towards the 3′ end of a gene was compromised in the kinase mutant, thus confirming the termination defect. A concomitant decrease in crosslinking of termination factors near the 5′ end of genes was also observed in the kinase-defective mutant. Simultaneous presence of termination factors towards both the ends of a gene is indicative of gene looping; while the loss of termination factor occupancy from the distal ends suggest the abolition of a looped gene conformation. Accordingly, CCC analysis revealed that the looped architecture of genes was severely compromised in the Kin28 kinase mutant. In a looping defective sua7-1 mutant, even the enzymatically active Kin28 kinase could not rescue the termination defect. These results strongly suggest a crucial role of Kin28 kinase-dependent gene looping in the termination of transcription in budding yeast. PMID:26286112

  6. The ORD1 gene encodes a transcription factor involved in oxygen regulation and is identical to IXR1, a gene that confers cisplatin sensitivity to Saccharomyces cerevisiae.

    PubMed Central

    Lambert, J R; Bilanchone, V W; Cumsky, M G

    1994-01-01

    The yeast COX5a and COX5b genes encode isoforms of subunit Va of the mitochondrial inner membrane protein complex cytochrome c oxidase. These genes have been shown to be inversely regulated at the level of transcription by oxygen, which functions through the metabolic coeffector heme. In earlier studies we identified several regulatory elements that control transcriptional activation and aerobic repression of one of these genes, COX5b. Here, we report the isolation of trans-acting mutants that are defective in the aerobic repression of COX5b transcription. The mutants fall into two complementation groups. One group specifies ROX1, which encodes a product reported to be involved in transcriptional repression. The other group identified the gene we have designated ORD1. Mutations in ORD1 cause overexpression of COX5b aerobically but do not affect the expression of the hypoxic genes CYC7, HEM13, and ANB1. ORD1 mutations also do not affect the expression of the aerobic genes COX5a, CYC1, ROX1, ROX3, and TIF51A. The yeast genome contains a single ORD1 gene that resides on chromosome XI. Strains carrying chromosomal deletions of the ORD1 locus are viable and exhibit phenotypes similar to, but less severe than, that of the original mutant. The nucleotide sequence of ORD1 revealed that it is identical to IXR1, a yeast gene whose product contains two high mobility group boxes, binds to platinated DNA, and confers sensitivity to the antitumor drug cisplatin. Consistent with the latter observations, we found that the ORD1 product could bind to both the upstream region of COX5b and to DNA modified with cisplatin. Images PMID:8041793

  7. Spatially coordinated dynamic gene transcription in living pituitary tissue

    PubMed Central

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE

    2016-01-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110

  8. Combinatorial Gene Regulation through Kinetic Control of the Transcription Cycle.

    PubMed

    Scholes, Clarissa; DePace, Angela H; Sánchez, Álvaro

    2017-01-25

    Cells decide when, where, and to what level to express their genes by "computing" information from transcription factors (TFs) binding to regulatory DNA. How is the information contained in multiple TF-binding sites integrated to dictate the rate of transcription? The dominant conceptual and quantitative model is that TFs combinatorially recruit one another and RNA polymerase to the promoter by direct physical interactions. Here, we develop a quantitative framework to explore kinetic control, an alternative model in which combinatorial gene regulation can result from TFs working on different kinetic steps of the transcription cycle. Kinetic control can generate a wide range of analog and Boolean computations without requiring the input TFs to be simultaneously bound to regulatory DNA. We propose experiments that will illuminate the role of kinetic control in transcription and discuss implications for deciphering the cis-regulatory "code."

  9. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  10. Transcriptional regulation of the novobiocin biosynthetic gene cluster.

    PubMed

    Dangel, Volker; Härle, Johannes; Goerke, Christiane; Wolz, Christiane; Gust, Bertolt; Pernodet, Jean-Luc; Heide, Lutz

    2009-12-01

    The aminocoumarin antibiotic novobiocin is a gyrase inhibitor formed by a Streptomyces strain. The biosynthetic gene cluster of novobiocin spans 23.4 kb and contains 20 coding sequences, among them the two regulatory genes novE and novG. We investigated the location of transcriptional promoters within this cluster by insertion of transcriptional terminator cassettes and RT-PCR analysis of the resulting mutants. The cluster was found to contain eight DNA regions with promoter activity. The regulatory protein NovG binds to a previously identified binding site within the promoter region located upstream of novH, but apparently not to any of the other seven promoters. Quantitative real-time PCR was used to compare the number of transcripts in a strain carrying an intact novobiocin cluster with strains carrying mutated clusters. Both in-frame deletion of the regulatory gene novG and insertion of a terminator cassette into the biosynthetic gene novH led to a strong reduction of the number of transcripts of the genes located between novH and novW. This suggested that these 16 biosynthetic genes form a single operon. Three internal promoters are located within this operon but appear to be of minor importance, if any, under our experimental conditions. Transcription of novG was found to depend on the presence of NovE, suggesting that the two regulatory genes, novE and novG, act in a cascade-like mechanism. The resistance gene gyrB(R), encoding an aminocoumarin-resistant gyrase B subunit, may initially be co-transcribed with the genes from novH to novW. However, when the gyrase inhibitor novobiocin accumulates in the cultures, gyrB(R) is transcribed from its own promoter. Previous work has suggested that this promoter is controlled by the superhelical density of chromosomal DNA.

  11. The SCL gene is formed from a transcriptionally complex locus.

    PubMed Central

    Aplan, P D; Begley, C G; Bertness, V; Nussmeier, M; Ezquerra, A; Coligan, J; Kirsch, I R

    1990-01-01

    We describe the structural organization of the human SCL gene, a helix-loop-helix family member which we believe plays a fundamental role in hematopoietic differentiation. The SCL locus is composed of eight exons distributed over 16 kb. SCL shows a pattern of expression quite restricted to early hematopoietic tissues, although in malignant states expression of the gene may be somewhat extended into later developmental stages. A detailed analysis of the transcript(s) arising from the SCL locus revealed that (i) the 5' noncoding portion of the SCL transcript, which resides within a CpG island, has a complex pattern of alternative exon utilization as well as two distinct transcription initiation sites; (ii) the 5' portions of the SCL transcript contain features that suggest a possible regulatory role for these segments; (iii) the pattern of utilization of the 5' exons is cell lineage dependent; and (iv) all of the currently studied chromosomal aberrations that affect the SCL locus either structurally or functionally eliminate the normal 5' transcription initiation sites. These data suggest that the SCL gene, and specifically its 5' region, may be a target for regulatory interactions during early hematopoietic development. Images PMID:2247063

  12. Transcription of Inflammatory Genes: Long Noncoding RNA and Beyond

    PubMed Central

    Carpenter, Susan

    2015-01-01

    The innate immune system must coordinate elaborate signaling pathways to turn on expression of hundreds of genes to provide protection against pathogens and resolve acute inflammation. Multiple genes within distinct functional categories are coordinately and temporally regulated by transcriptional on and off switches in response to distinct external stimuli. Three classes of transcription factors act together with transcriptional coregulators and chromatin-modifying complexes to control these programs. In addition, newer studies implicate long noncoding RNA (lncRNA) as additional regulators of these responses. LncRNAs promote, fine-tune, and restrain the inflammatory program. In this study, we provide an overview of gene regulation and the emerging importance of lncRNAs in the immune system. PMID:25250698

  13. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-05

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  14. Transcriptional targeting of tumor endothelial cells for gene therapy

    PubMed Central

    Dong, Zhihong; Nör, Jacques E.

    2009-01-01

    It is well known that angiogenesis plays a critical role in the pathobiology of tumors. Recent clinical trials have shown that inhibition of angiogenesis can be an effective therapeutic strategy for patients with cancer. However, one of the outstanding issues in anti-angiogenic treatment for cancer is the development of toxicities related to off-target effects of drugs. Transcriptional targeting of tumor endothelial cells involves the use of specific promoters for selective expression of therapeutic genes in the endothelial cells lining the blood vessels of tumors. Recently, several genes that are expressed specifically in tumor-associated endothelial cells have been identified and characterized. These discoveries have enhanced the prospectus of transcriptionaly targeting tumor endothelial cells for cancer gene therapy. In this manuscript, we review the promoters, vectors, and therapeutic genes that have been used for transcriptional targeting of tumor endothelial cells, and discuss the prospects of such approaches for cancer gene therapy. PMID:19393703

  15. Human DJ-1-specific Transcriptional Activation of Tyrosine Hydroxylase Gene*

    PubMed Central

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M. M.

    2010-01-01

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-l-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice. PMID:20938049

  16. Human DJ-1-specific transcriptional activation of tyrosine hydroxylase gene.

    PubMed

    Ishikawa, Shizuma; Taira, Takahiro; Takahashi-Niki, Kazuko; Niki, Takeshi; Ariga, Hiroyoshi; Iguchi-Ariga, Sanae M M

    2010-12-17

    Loss-of-function mutation in the DJ-1 gene causes a subset of familial Parkinson disease. The mechanism underlying DJ-1-related selective vulnerability in the dopaminergic pathway is, however, not known. DJ-1 has multiple functions, including transcriptional regulation, and one of transcriptional target genes for DJ-1 is the tyrosine hydroxylase (TH) gene, the product of which is a key enzyme for dopamine biosynthesis. It has been reported that DJ-1 is a neuroprotective transcriptional co-activator that sequesters a transcriptional co-repressor polypyrimidine tract-binding protein-associated splicing factor (PSF) from the TH gene promoter. In this study, we found that knockdown of human DJ-1 by small interference RNA in human dopaminergic cell lines attenuated TH gene expression and 4-dihydroxy-L-phenylalanine production but that knockdown or knock-out of mouse DJ-1 in mouse cell lines or in mice did not affect such expression and TH activity. In reporter assays using the human TH gene promoter linked to the luciferase gene, stimulation of TH promoter activity was observed in human cells, but not mouse cells, that had been transfected with DJ-1. Although human DJ-1 and mouse DJ-1 were associated either with human or with mouse PSF, TH promoter activity inhibited by PSF was restored by human DJ-1 but not by mouse DJ-1. Chromatin immunoprecipitation assays revealed that the complex of PSF with DJ-1 bound to the human but not the mouse TH gene promoter. These results suggest a novel species-specific transcriptional regulation of the TH promoter by DJ-1 and one of the mechanisms for no reduction of TH in DJ-1-knock-out mice.

  17. Gene duplication of type-B ARR transcription factors systematically extends transcriptional regulatory structures in Arabidopsis

    PubMed Central

    Choi, Seung Hee; Hyeon, Do Young; Lee, ll Hwan; Park, Su Jin; Han, Seungmin; Lee, In Chul; Hwang, Daehee; Nam, Hong Gil

    2014-01-01

    Many of duplicated genes are enriched in signaling pathways. Recently, gene duplication of kinases has been shown to provide genetic buffering and functional diversification in cellular signaling. Transcription factors (TFs) are also often duplicated. However, how duplication of TFs affects their regulatory structures and functions of target genes has not been explored at the systems level. Here, we examined regulatory and functional roles of duplication of three major ARR TFs (ARR1, 10, and 12) in Arabidopsis cytokinin signaling using wild-type and single, double, and triple deletion mutants of the TFs. Comparative analysis of gene expression profiles obtained from Arabidopsis roots in wild-type and these mutants showed that duplication of ARR TFs systematically extended their transcriptional regulatory structures, leading to enhanced robustness and diversification in functions of target genes, as well as in regulation of cellular networks of target genes. Therefore, our results suggest that duplication of TFs contributes to robustness and diversification in functions of target genes by extending transcriptional regulatory structures. PMID:25425016

  18. Gene duplication of type-B ARR transcription factors systematically extends transcriptional regulatory structures in Arabidopsis.

    PubMed

    Choi, Seung Hee; Hyeon, Do Young; Lee, Ll Hwan; Park, Su Jin; Han, Seungmin; Lee, In Chul; Hwang, Daehee; Nam, Hong Gil

    2014-11-26

    Many of duplicated genes are enriched in signaling pathways. Recently, gene duplication of kinases has been shown to provide genetic buffering and functional diversification in cellular signaling. Transcription factors (TFs) are also often duplicated. However, how duplication of TFs affects their regulatory structures and functions of target genes has not been explored at the systems level. Here, we examined regulatory and functional roles of duplication of three major ARR TFs (ARR1, 10, and 12) in Arabidopsis cytokinin signaling using wild-type and single, double, and triple deletion mutants of the TFs. Comparative analysis of gene expression profiles obtained from Arabidopsis roots in wild-type and these mutants showed that duplication of ARR TFs systematically extended their transcriptional regulatory structures, leading to enhanced robustness and diversification in functions of target genes, as well as in regulation of cellular networks of target genes. Therefore, our results suggest that duplication of TFs contributes to robustness and diversification in functions of target genes by extending transcriptional regulatory structures.

  19. Reference genes for normalizing transcription in diploid and tetraploid Arabidopsis.

    PubMed

    Wang, Haibin; Wang, Jingjing; Jiang, Jiafu; Chen, Sumei; Guan, Zhiyong; Liao, Yuan; Chen, Fadi

    2014-10-27

    Published transcription data from a set of 19 diploid Arabidopsis thaliana and 5 tetraploid (3 allo- and 2 auto- tetraploid) Arabidopsis accessions were re-analysed to identify reliable reference genes for normalization purposes. Five conventional and 16 novel reference genes previously derived from microarray data covering a wide range of abundance in absolute expression levels in diploid A. thaliana Col-0 were employed. Transcript abundance was well conserved for all 21 potential reference genes in the diploid A. thaliana accessions, with geNorm and NormFinder analysis indicating that AT5G46630, AT1G13320, AT4G26410, AT5G60390 and AT5G08290 were the most stable. However, conservation was less good among the tetraploid accessions, with the transcription of seven of the 21 genes being undetectable in all allotetraploids. The most stable gene was AT5G46630, while AT1G13440 was the unstable one. Hence, the choice of reference gene(s) for A. thaliana is quite wide, but with respect to the analysis of transcriptomic data derived from the tetraploids, it is probably necessary to select more than one reference gene.

  20. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  1. Transcription, chromatin condensation, and gene migration

    PubMed Central

    2009-01-01

    The binding of fluorescently tagged proteins to tandem DNA arrays has been instrumental in understanding nuclear organization and function. Through the use of more natural tandem DNA arrays, Hu et al. (Hu, Y., I. Kireev, M. Plutz, N. Ashourian, and A.S. Belmont. 2009. J. Cell Biol. 185:87–100) gain new insights into chromatin organization and dynamics, and into the association of splicing factors with active genes. PMID:19349577

  2. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  3. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

    PubMed Central

    Naito, Yuki; Bono, Hidemasa

    2012-01-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

  4. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    PubMed

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  5. BRCA1 transcriptionally regulates genes involved in breast tumorigenesis

    PubMed Central

    Welcsh, Piri L.; Lee, Ming K.; Gonzalez-Hernandez, Rachel M.; Black, Daniel J.; Mahadevappa, Mamatha; Swisher, Elizabeth M.; Warrington, Janet A.; King, Mary-Claire

    2002-01-01

    Loss of function of BRCA1 caused by inherited mutation and tissue-specific somatic mutation leads to breast and ovarian cancer. Nearly all BRCA1 germ-line mutations involve truncation or loss of the C-terminal BRCT transcriptional activation domain, suggesting that transcriptional regulation is a critical function of the wild-type gene. The purpose of this project was to determine whether there is a link between the role of BRCA1 in transcriptional regulation and its role in tumor suppression. We developed a cell line (in which BRCA1 can be induced) and used microarray analysis to compare transcription profiles of epithelial cells with low endogenous levels of BRCA1 vs. transcription profiles of cells with 2–4-fold higher induced levels of expression of BRCA1. At these levels of expression, BRCA1 did not induce apoptosis. Undirected cluster analysis of six paired experiments revealed 373 genes, the expression of which was altered significantly and consistently by BRCA1 induction. Expression of 62 genes was altered more than 2-fold. BRCA1-regulated genes associated with breast tumorigenesis included the estrogen-responsive genes MYC and cyclin D1, which are overexpressed in many breast tumors; STAT1 and JAK1, key components of the cytokine signal transduction pathway; the extracellular matrix protein laminin 3A; ID4, an inhibitor of DNA-binding transcriptional activators, which in turn negatively regulates BRCA1 expression; and the prohormone stanniocalcin, expression of which is lost in breast tumor cells. Coordinated expression of BRCA1 with ID4 and with stanniocalcin was confirmed in primary breast and ovarian tumors. PMID:12032322

  6. Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

    PubMed

    Thiel, Gerald; Rössler, Oliver G

    2017-03-01

    Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems.

  7. Transcript analysis of 250 novel yeast genes from chromosome XIV.

    PubMed

    Planta, R J; Brown, A J; Cadahia, J L; Cerdan, M E; de Jonge, M; Gent, M E; Hayes, A; Kolen, C P; Lombardia, L J; Sefton, M; Oliver, S G; Thevelein, J; Tournu, H; van Delft, Y J; Verbart, D J; Winderickx, J

    1999-03-15

    The European Functional Analysis Network (EUROFAN) is systematically analysing the function of novel Saccharomyces cerevisiae genes revealed by genome sequencing. As part of this effort our consortium has performed a detailed transcript analysis for 250 novel ORFs on chromosome XIV. All transcripts were quantified by Northern analysis under three quasi-steady-state conditions (exponential growth on rich fermentative, rich non-fermentative, and minimal fermentative media) and eight transient conditions (glucose derepression, glucose upshift, stationary phase, nitrogen starvation, osmo-stress, heat-shock, and two control conditions). Transcripts were detected for 82% of the 250 ORFs, and only one ORF did not yield a transcript of the expected length (YNL285w). Transcripts ranged from low (62%), moderate (16%) to high abundance (2%) relative to the ACT1 mRNA. The levels of 73% of the 206 chromosome XIV transcripts detected fluctuated in response to the transient states tested. However, only a small number responded strongly to the transients: eight ORFs were induced upon glucose upshift; five were repressed by glucose; six were induced in response to nitrogen starvation; three were induced in stationary phase; five were induced by osmo-stress; four were induced by heat-shock. These data provide useful clues about the general function of these ORFs and add to our understanding of gene regulation on a genome-wide basis.

  8. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  9. Tracing the dynamics of gene transcripts after organismal death

    PubMed Central

    2017-01-01

    In life, genetic and epigenetic networks precisely coordinate the expression of genes—but in death, it is not known if gene expression diminishes gradually or abruptly stops or if specific genes and pathways are involved. We studied this by identifying mRNA transcripts that apparently increase in relative abundance after death, assessing their functions, and comparing their abundance profiles through postmortem time in two species, mouse and zebrafish. We found mRNA transcript profiles of 1063 genes became significantly more abundant after death of healthy adult animals in a time series spanning up to 96 h postmortem. Ordination plots revealed non-random patterns in the profiles by time. While most of these transcript levels increased within 0.5 h postmortem, some increased only at 24 and 48 h postmortem. Functional characterization of the most abundant transcripts revealed the following categories: stress, immunity, inflammation, apoptosis, transport, development, epigenetic regulation and cancer. The data suggest a step-wise shutdown occurs in organismal death that is manifested by the apparent increase of certain transcripts with various abundance maxima and durations. PMID:28123054

  10. Most "dark matter" transcripts are associated with known genes.

    PubMed

    van Bakel, Harm; Nislow, Corey; Blencowe, Benjamin J; Hughes, Timothy R

    2010-05-18

    A series of reports over the last few years have indicated that a much larger portion of the mammalian genome is transcribed than can be accounted for by currently annotated genes, but the quantity and nature of these additional transcripts remains unclear. Here, we have used data from single- and paired-end RNA-Seq and tiling arrays to assess the quantity and composition of transcripts in PolyA+ RNA from human and mouse tissues. Relative to tiling arrays, RNA-Seq identifies many fewer transcribed regions ("seqfrags") outside known exons and ncRNAs. Most nonexonic seqfrags are in introns, raising the possibility that they are fragments of pre-mRNAs. The chromosomal locations of the majority of intergenic seqfrags in RNA-Seq data are near known genes, consistent with alternative cleavage and polyadenylation site usage, promoter- and terminator-associated transcripts, or new alternative exons; indeed, reads that bridge splice sites identified 4,544 new exons, affecting 3,554 genes. Most of the remaining seqfrags correspond to either single reads that display characteristics of random sampling from a low-level background or several thousand small transcripts (median length = 111 bp) present at higher levels, which also tend to display sequence conservation and originate from regions with open chromatin. We conclude that, while there are bona fide new intergenic transcripts, their number and abundance is generally low in comparison to known exons, and the genome is not as pervasively transcribed as previously reported.

  11. Angiotensin II-regulated transcription regulatory genes in adrenal steroidogenesis.

    PubMed

    Romero, Damian G; Gomez-Sanchez, Elise P; Gomez-Sanchez, Celso E

    2010-11-29

    Transcription regulatory genes are crucial modulators of cell physiology and metabolism whose intracellular levels are tightly controlled in response to extracellular stimuli. We previously reported a set of 29 transcription regulatory genes modulated by angiotensin II in H295R human adrenocortical cells and their roles in regulating the expression of the last and unique enzymes of the glucocorticoid and mineralocorticoid biosynthetic pathways, 11β-hydroxylase and aldosterone synthase, respectively, using gene expression reporter assays. To study the effect of this set of transcription regulatory genes on adrenal steroidogenesis, H295R cells were transfected by high-efficiency nucleofection and aldosterone and cortisol were measured in cell culture supernatants under basal and angiotensin II-stimulated conditions. BCL11B, BHLHB2, CITED2, ELL2, HMGA1, MAFF, NFIL3, PER1, SERTAD1, and VDR significantly stimulated aldosterone secretion, while EGR1, FOSB, and ZFP295 decreased aldosterone secretion. BTG2, HMGA1, MITF, NR4A1, and ZFP295 significantly increased cortisol secretion, while BCL11B, NFIL3, PER1, and SIX2 decreased cortisol secretion. We also report the effect of some of these regulators on the expression of endogenous aldosterone synthase and 11β-hydroxylase under basal and angiotensin II-stimulated conditions. In summary, this study reports for the first time the effects of a set of angiotensin II-modulated transcription regulatory genes on aldosterone and cortisol secretion and the expression levels of the last and unique enzymes of the mineralocorticoid and glucocorticoid biosynthetic pathways. Abnormal regulation of mineralocorticoid or glucocorticoid secretion is involved in several pathophysiological conditions. These transcription regulatory genes may be involved in adrenal steroidogenesis pathologies; thus they merit additional study as potential candidates for therapeutic intervention.

  12. The transcriptional regulation of the human CYP2C genes

    PubMed Central

    Chen, Yuping; Goldstein, Joyce A.

    2010-01-01

    In humans, four members of the CYP2C subfamily (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) metabolize more than 20% of all therapeutic drugs as well as a number of endogenous compounds. The CYP2C enzymes are found predominantly in the liver, where they comprise ∼20% of the total cytochrome P450. A variety of xenobiotics such as phenobarbital, rifampicin, and hyperforin have been shown to induce the transcriptional expression of CYP2C genes in primary human hepatocytes and to increase the metabolism of CYP2C substrates in vivo in man. This induction can result in drug-drug interactions, drug tolerance, and therapeutic failure. Several drug-activated nuclear receptors including CAR, PXR, VDR, and GR recognize drug responsive elements within the 5′ flanking promoter region of CYP2C genes to mediate the transcriptional upregulation of these genes in response to xenobiotics and steroids. Other nuclear receptors and transcriptional factors including HNF4α, HNF3γ, C/EBPα and more recently RORs, have been reported to regulate the constitutive expression of CYP2C genes in liver. The maximum transcriptional induction of CYP2C genes appears to be achieved through a coordinative cross-talk between drug responsive nuclear receptors, hepatic factors, and coactivators. The transcriptional regulatory mechanisms of the expression of CYP2C genes in extrahepatic tissues has received less study, but these may be altered by perturbations from pathological conditions such as ischemia as well as some of the receptors mentioned above. PMID:19702536

  13. Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions

    PubMed Central

    Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa

    2007-01-01

    Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological

  14. Gene Isoform Specificity through Enhancer-Associated Antisense Transcription

    PubMed Central

    Onodera, Courtney S.; Underwood, Jason G.; Katzman, Sol; Jacobs, Frank; Greenberg, David; Salama, Sofie R.; Haussler, David

    2012-01-01

    Enhancers and antisense RNAs play key roles in transcriptional regulation through differing mechanisms. Recent studies have demonstrated that enhancers are often associated with non-coding RNAs (ncRNAs), yet the functional role of these enhancer:ncRNA associations is unclear. Using RNA-Sequencing to interrogate the transcriptomes of undifferentiated mouse embryonic stem cells (mESCs) and their derived neural precursor cells (NPs), we identified two novel enhancer-associated antisense transcripts that appear to control isoform-specific expression of their overlapping protein-coding genes. In each case, an enhancer internal to a protein-coding gene drives an antisense RNA in mESCs but not in NPs. Expression of the antisense RNA is correlated with expression of a shorter isoform of the associated sense gene that is not present when the antisense RNA is not expressed. We demonstrate that expression of the antisense transcripts as well as expression of the short sense isoforms correlates with enhancer activity at these two loci. Further, overexpression and knockdown experiments suggest the antisense transcripts regulate expression of their associated sense genes via cis-acting mechanisms. Interestingly, the protein-coding genes involved in these two examples, Zmynd8 and Brd1, share many functional domains, yet their antisense ncRNAs show no homology to each other and are not present in non-murine mammalian lineages, such as the primate lineage. The lack of homology in the antisense ncRNAs indicates they have evolved independently of each other and suggests that this mode of lineage-specific transcriptional regulation may be more widespread in other cell types and organisms. Our findings present a new view of enhancer action wherein enhancers may direct isoform-specific expression of genes through ncRNA intermediates. PMID:22937057

  15. Transient Phenomena in Gene Expression after Induction of Transcription

    PubMed Central

    Deneke, Carlus; Rudorf, Sophia; Valleriani, Angelo

    2012-01-01

    When transcription of a gene is induced by a stimulus, the number of its mRNA molecules changes with time. Here we discuss how this time evolution depends on the shape of the mRNA lifetime distribution. Analysis of the statistical properties of this change reveals transient effects on polysomes, ribosomal profiles, and rate of protein synthesis. Our studies reveal that transient phenomena in gene expression strongly depend on the specific form of the mRNA lifetime distribution. PMID:22558114

  16. Transcriptional gene silencing as a tool for uncovering gene function in maize.

    PubMed

    Cigan, A Mark; Unger-Wallace, Erica; Haug-Collet, Kristin

    2005-09-01

    Transcriptional gene silencing has broad applications for studying gene function in planta. In maize, a large number of genes have been identified as tassel-preferred in their expression pattern, both by traditional genetic methods and by recent high-throughput expression profiling platforms. Approaches using RNA suppression may provide a rapid alternative means to identify genes directly related to pollen development in maize. The male fertility gene Ms45 and several anther-expressed genes of unknown function were used to evaluate the efficacy of generating male-sterile plants by transcriptional gene silencing. A high frequency of male-sterile plants was obtained by constitutively expressing inverted repeats (IR) of the Ms45 promoter. These sterile plants lacked MS45 mRNA due to transcriptional inactivity of the target promoter. Moreover, fertility was restored to these promoter IR-containing plants by expressing the Ms45 coding region using heterologous promoters. Transcriptional silencing of other anther-expressed genes also significantly affected male fertility phenotypes and led to increased methylation of the target promoter DNA sequences. These studies provide evidence of disruption of gene activity in monocots by RNA interference constructs directed against either native or transformed promoter regions. This approach not only enables the correlation of monocot anther-expressed genes with functions that are important for reproduction in maize, but may also provide a tool for studying gene function and identifying regulatory components unique to transcriptional gene control.

  17. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  18. Inferring transcription factor collaborations in gene regulatory networks

    PubMed Central

    2014-01-01

    Background Living cells are realized by complex gene expression programs that are moderated by regulatory proteins called transcription factors (TFs). The TFs control the differential expression of target genes in the context of transcriptional regulatory networks (TRNs), either individually or in groups. Deciphering the mechanisms of how the TFs control the expression of target genes is a challenging task, especially when multiple TFs collaboratively participate in the transcriptional regulation. Results We model the underlying regulatory interactions in terms of the directions (activation or repression) and their logical roles (necessary and/or sufficient) with a modified association rule mining approach, called mTRIM. The experiment on Yeast discovered 670 regulatory interactions, in which multiple TFs express their functions on common target genes collaboratively. The evaluation on yeast genetic interactions, TF knockouts and a synthetic dataset shows that our algorithm is significantly better than the existing ones. Conclusions mTRIM is a novel method to infer TF collaborations in transcriptional regulation networks. mTRIM is available at http://www.msu.edu/~jinchen/mTRIM. PMID:24565025

  19. Transcript profiling of Eucalyptus xylem genes during tension wood formation.

    PubMed

    Paux, Etienne; Carocha, Víctor; Marques, Cristina; Mendes de Sousa, António; Borralho, Nuno; Sivadon, Pierre; Grima-Pettenati, Jacqueline

    2005-07-01

    Tension wood formed in response to gravitational force is a striking example of the plasticity of angiosperm wood. In this study our goal was to characterize the early changes in gene expression during tension wood formation in Eucalyptus. Using cDNA array technology, transcript profiling of 231 genes preferentially expressed in differentiating Eucalyptus xylem was followed from 6 h to 1 wk of a tension time course of artificially bent Eucalyptus trees. 196 genes were differentially regulated between control and bent trees, some exhibiting distinctive expression patterns related to changes in secondary cell wall structure and composition. For instance, expression of a cellulose synthase gene was well correlated with the appearance of the G-layers. Cluster correlation analysis revealed differential regulation of lignin biosynthetic genes and may also be used to help infer the function of unknown gene products. Eucalyptus wood transcriptome analysis during tension wood formation not only provided new clues into the transcriptional regulatory network of genes preferentially expressed in xylem, but also highlighted candidate genes responsible for the genetic and environmentally induced variation of wood quality traits.

  20. Transcriptional activation of virulence genes of Rhizobium etli.

    PubMed

    Wang, Luyao; Lacroix, Benoît; Guo, Jianhua; Citovsky, Vitaly

    2017-01-09

    Recently, Rhizobium etli has emerged, in addition to Agrobacterium spp., as a prokaryotic species that encodes a functional machinery for DNA transfer to plant cells. To understand this R. etli-mediated genetic transformation, it would be useful to define how its vir genes respond to the host plants. Here, we explored the transcriptional activation of the vir genes contained on the R. etli p42a plasmid. Using a reporter construct harboring lacZ under the control of the R. etli virE promoter, we showed that the signal phenolic molecule acetosyringone (AS) induced R. etli vir gene expression both in R. etli and in A. tumefaciens background. Furthermore, in both bacterial backgrounds, the p42a plasmid also promoted plant genetic transformation with a reporter T-DNA. Importantly, the R. etli vir genes were transcriptionally activated by AS in a bacterial species-specific fashion in regard to the VirA/VirG signal sensor system, and this activation was induced by signals from the natural host species of this bacterium, but not from non-host plants. Early kinetics of transcriptional activation of the major vir genes of R. etli also revealed several features distinct from those known for A. tumefaciens: the expression of the virG gene reached saturation relatively quickly, and virB2, which in R. etli is located outside of the virB operon, was expressed only at low levels and did not respond to AS. These differences in vir gene transcription may contribute to the lower efficiency of T-DNA transfer of R. etli p42a versus pTiC58 of A. tumefaciens IMPORTANCE: The region encoding homologs of Agrobacterium tumefaciens virulence genes in the Rhizobium etli CE3 p42a plasmid was the first endogenous virulence system encoded by a non-Agrobacterium species demonstrated to be functional in DNA transfer and stable integration into plant cell genome. In this study, we explore the transcriptional regulation and induction of virulence genes in R. etli and show similarities and differences

  1. NELF Potentiates Gene Transcription in the Drosophila Embryo

    PubMed Central

    Wang, Xiaoling; Hang, Saiyu; Prazak, Lisa; Gergen, J. Peter

    2010-01-01

    A hallmark of genes that are subject to developmental regulation of transcriptional elongation is association of the negative elongation factor NELF with the paused RNA polymerase complex. Here we use a combination of biochemical and genetic experiments to investigate the in vivo function of NELF in the Drosophila embryo. NELF associates with different gene promoter regions in correlation with the association of RNA polymerase II (Pol II) and the initial activation of gene expression during the early stages of embryogenesis. Genetic experiments reveal that maternally provided NELF is required for the activation, rather than the repression of reporter genes that emulate the expression of key developmental control genes. Furthermore, the relative requirement for NELF is dictated by attributes of the flanking cis-regulatory information. We propose that NELF-associated paused Pol II complexes provide a platform for high fidelity integration of the combinatorial spatial and temporal information that is central to the regulation of gene expression during animal development. PMID:20634899

  2. Structure and in vitro transcription of human globin genes.

    PubMed

    Proudfoot, N J; Shander, M H; Manley, J L; Gefter, M L; Maniatis, T

    1980-09-19

    The alpha-like and beta-like subunits of human hemoglobin are encoded by a small family of genes that are differentially expressed during development. Through the use of molecular cloning procedures, each member of this gene family has been isolated and extensively characterized. Although the alpha-like and beta-like globin genes are located on different chromosomes, both sets of genes are arranged in closely linked clusters. In both clusters, each of the genes is transcribed from the same DNA strand, and the genes are arranged in the order of their expressions during development. Structural comparisons of immediately adjacent genes within each cluster have provided evidence for the occurrence of gene duplication and correction during evolution and have led to the discovery of pseudogenes, genes that have acquired numerous mutations that prevent their normal expression. Recently, in vivo and in vitro systems for studying the expression of cloned eukaryotic genes have been developed as a means of identifying DNA sequences that are necessary for normal gene function. This article describes the application of an in vitro transcription procedure to the study of human globin gene expression.

  3. Gene transcription in polar bears (Ursus maritimus) from disparate populations

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Waters, Shannon C.; Meyerson, Randi; Rode, Karyn D.; Atwood, Todd C.

    2015-01-01

    Polar bears in the Beaufort (SB) and Chukchi (CS) Seas experience different environments due primarily to a longer history of sea ice loss in the Beaufort Sea. Ecological differences have been identified as a possible reason for the generally poorer body condition and reproduction of Beaufort polar bears compared to those from the Chukchi, but the influence of exposure to other stressors remains unknown. We use molecular technology, quantitative PCR, to identify gene transcription differences among polar bears from the Beaufort and Chukchi Seas as well as captive healthy polar bears. We identified significant transcriptional differences among a priori groups (i.e., captive bears, SB 2012, SB 2013, CS 2013) for ten of the 14 genes of interest (i.e., CaM, HSP70, CCR3, TGFβ, COX2, THRα, T-bet, Gata3, CD69, and IL17); transcription levels of DRβ, IL1β, AHR, and Mx1 did not differ among groups. Multivariate analysis also demonstrated separation among the groups of polar bears. Specifically, we detected transcript profiles consistent with immune function impairment in polar bears from the Beaufort Sea, when compared with Chukchi and captive polar bears. Although there is no strong indication of differential exposure to contaminants or pathogens between CS and SB bears, there are clearly differences in important transcriptional responses between populations. Further investigation is warranted to refine interpretation of potential effects of described stress-related conditions for the SB population.

  4. Transcriptional regulation of steroid hydroxylase genes by corticotropin.

    PubMed Central

    John, M E; John, M C; Boggaram, V; Simpson, E R; Waterman, M R

    1986-01-01

    Maintenance of optimal steroidogenic capacity in the adrenal cortex is the result of a cAMP-dependent response to the peptide hormone corticotropin (ACTH). The molecular mechanism of this action of ACTH has been examined by using five recombinant DNA clones specific for enzymes of the steroidogenic pathway (P-450scc, P-45011 beta, P-450C21, P-45017 alpha, and adrenodoxin). The presence of nuclear precursors in steady-state RNA samples derived from cultured bovine adrenocortical cells and moderate increases in the number of RNA chain initiations, as determined by in vitro nuclear run-off assays, indicate that ACTH controls the expression of the gene(s) for each of these proteins at the transcriptional level. The ACTH-mediated increase in accumulation of transcripts specific for steroid hydroxylases in nuclear RNA can be specifically blocked by inhibiting protein synthesis in bovine adrenocortical cell cultures. The steady-state concentrations of nuclear RNA for control genes show no decrease upon cycloheximide treatment. These studies suggest that a primary action of ACTH in the adrenal cortex is to activate (via cAMP) the synthesis of rapidly turning over protein factors that in turn mediate increased initiation of transcription of steroid hydroxylase genes. We propose that these protein factors impart specificity of induction to genes encoding components of this pathway in steroidogenic tissues. Images PMID:3014507

  5. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  6. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  7. Mechanisms of post-transcriptional gene regulation in bacterial biofilms

    PubMed Central

    Martínez, Luary C.; Vadyvaloo, Viveka

    2014-01-01

    Biofilms are characterized by a dense multicellular community of microorganisms that can be formed by the attachment of bacteria to an inert surface and to each other. The development of biofilm involves the initial attachment of planktonic bacteria to a surface, followed by replication, cell-to-cell adhesion to form microcolonies, maturation, and detachment. Mature biofilms are embedded in a self-produced extracellular polymeric matrix composed primarily of bacterial-derived exopolysaccharides, specialized proteins, adhesins, and occasionally DNA. Because the synthesis and assembly of biofilm matrix components is an exceptionally complex process, the transition between its different phases requires the coordinate expression and simultaneous regulation of many genes by complex genetic networks involving all levels of gene regulation. The finely controlled intracellular level of the chemical second messenger molecule, cyclic-di-GMP is central to the post-transcriptional mechanisms governing the switch between the motile planktonic lifestyle and the sessile biofilm forming state in many bacteria. Several other post-transcriptional regulatory mechanisms are known to dictate biofilm development and assembly and these include RNA-binding proteins, small non-coding RNAs, toxin-antitoxin systems, riboswitches, and RNases. Post-transcriptional regulation is therefore a powerful molecular mechanism employed by bacteria to rapidly adjust to the changing environment and to fine tune gene expression to the developmental needs of the cell. In this review, we discuss post-transcriptional mechanisms that influence the biofilm developmental cycle in a variety of pathogenic bacteria. PMID:24724055

  8. The RNA polymerase flow model of gene transcription.

    PubMed

    Edri, Shlomit; Gazit, Eran; Cohen, Eyal; Tuller, Tamir

    2014-02-01

    Gene expression is a fundamental cellular process by which proteins are synthesized based on the information coded in the genes. The two major steps of this process are the transcription of the DNA segment corresponding to a gene to mRNA molecules and the translation of the mRNA molecules to proteins by the ribosome. Thus, understanding, modeling and engineering the different stages of this process have both important biotechnological applications and contributions to basic life science. In previous studies we have introduced the Homogenous Ribosome Flow Model (HRFM) and demonstrated its advantages in analyses of the translation process. In this study we introduce the RNA Polymerase Flow Model (RPFM), a non trivial extension of the HRFM, which also includes a backward flow and can be used for modeling transcription and maybe other similar processes. We compare the HRFM and the RPFM in the three regimes of the transcription process: rate limiting initiation, rate limiting elongation and rate limiting termination via a simulative and analytical analysis. In addition, based on experimental data, we show that RPFM is a better choice for modeling transcription process.

  9. TRANSCRIPTIONAL REGULATION OF THE HUMAN KiSS1 GENE

    PubMed Central

    Mueller, Johanna K.; Dietzel, Anja; Lomniczi, Alejandro; Loche, Alberto; Tefs, Katrin; Kiess, Wieland; Danne, Thomas; Ojeda, Sergio R.; Heger, Sabine

    2011-01-01

    Kisspeptin, the product of the KiSS1 gene, has emerged as a key component of the mechanism by which the hypothalamus controls puberty and reproductive development. It does so by stimulating the secretion of gonadotropin releasing hormone (GnRH). Little is known about the transcriptional control of the KiSS1 gene. Here we show that a set of proteins postulated to be upstream components of a hypothalamic network involved in controlling female puberty regulates KiSS1 transcriptional activity. Using RACE-PCR we determined that transcription of KiSS1 mRNA is initiated at a single transcription start site (TSS) located 153–156 bp upstream of the ATG translation initiation codon. Promoter assays performed using 293 MSR cells showed that the KiSS1 promoter is activated by TTF1 and CUX1-p200, and repressed by EAP1, YY1, and CUX1-p110. EAP1 and CUX-110 were also repressive in GT1-7 cells. All four TFs are recruited in vivo to the KiSS1 promoter and are expressed in kisspeptin neurons. These results suggest that expression of the KiSS1 gene is regulated by trans-activators and repressors involved in the system-wide control of mammalian puberty. PMID:21672609

  10. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  11. Stochastic model of transcription factor-regulated gene expression

    NASA Astrophysics Data System (ADS)

    Karmakar, Rajesh; Bose, Indrani

    2006-09-01

    We consider a stochastic model of transcription factor (TF)-regulated gene expression. The model describes two genes, gene A and gene B, which synthesize the TFs and the target gene proteins, respectively. We show through analytic calculations that the TF fluctuations have a significant effect on the distribution of the target gene protein levels when the mean TF level falls in the highest sensitive region of the dose-response curve. We further study the effect of reducing the copy number of gene A from two to one. The enhanced TF fluctuations yield results different from those in the deterministic case. The probability that the target gene protein level exceeds a threshold value is calculated with the knowledge of the probability density functions associated with the TF and target gene protein levels. Numerical simulation results for a more detailed stochastic model are shown to be in agreement with those obtained through analytic calculations. The relevance of these results in the context of the genetic disorder haploinsufficiency is pointed out. Some experimental observations on the haploinsufficiency of the tumour suppressor gene, Nkx 3.1, are explained with the help of the stochastic model of TF-regulated gene expression.

  12. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  13. Nuclear actin activates human transcription factor genes including the OCT4 gene.

    PubMed

    Yamazaki, Shota; Yamamoto, Koji; Tokunaga, Makio; Sakata-Sogawa, Kumiko; Harata, Masahiko

    2015-01-01

    RNA microarray analyses revealed that nuclear actin activated many human transcription factor genes including OCT4, which is required for gene reprogramming. Oct4 is known to be activated by nuclear actin in Xenopus oocytes. Our findings imply that this process of OCT4 activation is conserved in vertebrates and among cell types and could be used for gene reprogramming of human cells.

  14. Demonstration of transcriptional regulation of specific genes by phytochrome action

    PubMed Central

    Silverthorne, Jane; Tobin, Elaine M.

    1984-01-01

    We have developed an in vitro transcription system that uses nuclei isolated from Lemna gibba G-3. The in vitro transcripts include sequences homologous to hybridization probes for the small subunit of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39], the light-harvesting chlorophyll a/b-protein, and rRNA. Light-harvesting chlorophyll a/b-protein sequences are transcribed to a greater extent in nuclei isolated from plants grown in darkness with 2 min of red light every 8 hr than in nuclei isolated from dark-treated plants. Furthermore, the amount of these transcripts measured in plants given a single minute of red light after dark treatment is increased over the amount measured in dark-treated plants. The effect of red light is at least partially reversible by 10 min of far-red light given immediately after the red light pulse. Transcription of both rRNA and small subunit sequences is also stimulated by a single minute of red light as compared to dark-treated tissue. However, the relative magnitudes of the increases compared to the dark levels are smaller than the increase seen for the chlorophyll a/b-protein, possibly because of the higher level of transcription of these sequences in the dark. The effect of red light on the transcription of small subunit and rRNA sequences is also reversible by immediate treatment with 10 min of far-red light. Pulse chase studies of dark-treated nuclei for up to 110 min do not show substantial turnover of in vitro labeled small subunit and chlorophyll a/b-protein transcripts. We therefore conclude that phytochrome action has induced specific changes in transcription of these genes. Images PMID:16593420

  15. Transcriptional activation of cloned human beta-globin genes by viral immediate-early gene products.

    PubMed

    Green, M R; Treisman, R; Maniatis, T

    1983-11-01

    When the human beta-globin gene is transfected into Hela cells, no beta-globin RNA is detected unless the gene is linked to a viral transcription enhancer. In this paper we show that trans-acting adenovirus and herpesvirus (pseudorabies) transcriptional regulatory proteins can circumvent this enhancer requirement for detectable beta-globin transcription in transient expression assays. The viral gene products can be provided by constitutively expressed, integrated viral genes in established cell lines, by viral infection of permissive cells, or by transfection of cells with bacterial plasmids carrying the viral immediate-early genes. These results demonstrate the utility of transient expression assays for studying regulatory mechanisms involving trans-acting factors. Analysis of beta-globin promoter mutants indicates that between 75 and 128 bp of sequence 5' to the mRNA cap site is required for enhancer-dependent transcription in Hela cells. In contrast, beta-globin transcription in the presence of viral immediate-early gene products requires only 36 bp of 5'-flanking sequence, which includes the TATA box. Thus both cis and trans-acting viral factors activate beta-globin gene transcription in transient expression experiments, but the mechanisms by which they act appear to be fundamentally different.

  16. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes

    PubMed Central

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L.; Folch, Josep M.; Rodríguez, M. Carmen; Óvilo, Cristina; Silió, Luis; Fernández, Ana I.

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  17. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  18. Dynamic Post-Transcriptional Regulation of HIV-1 Gene Expression

    PubMed Central

    Kula, Anna; Marcello, Alessandro

    2012-01-01

    Gene expression of the human immunodeficiency virus type 1 (HIV-1) is a highly regulated process. Basal transcription of the integrated provirus generates early transcripts that encode for the viral products Tat and Rev. Tat promotes the elongation of RNA polymerase while Rev mediates the nuclear export of viral RNAs that contain the Rev-responsive RNA element (RRE). These RNAs are exported from the nucleus to allow expression of Gag-Pol and Env proteins and for the production of full-length genomic RNAs. A balance exists between completely processed mRNAs and RRE-containing RNAs. Rev functions as an adaptor that recruits cellular factors to re-direct singly spliced and unspliced viral RNAs to nuclear export. The aim of this review is to address the dynamic regulation of this post-transcriptional pathway in light of recent findings that implicate several novel cellular cofactors of Rev function. PMID:24832221

  19. Post-Transcriptional Control of Chloroplast Gene Expression

    PubMed Central

    del Campo, Eva M.

    2009-01-01

    Chloroplasts contain their own genome, organized as operons, which are generally transcribed as polycistronic transcriptional units. These primary transcripts are processed into smaller RNAs, which are further modified to produce functional RNAs. The RNA processing mechanisms remain largely unknown and represent an important step in the control of chloroplast gene expression. Such mechanisms include RNA cleavage of pre-existing RNAs, RNA stabilization, intron splicing, and RNA editing. Recently, several nuclear-encoded proteins that participate in diverse plastid RNA processing events have been characterised. Many of them seem to belong to the pentatricopeptide repeat (PPR) protein family that is implicated in many crucial functions including organelle biogenesis and plant development. This review will provide an overview of current knowledge of the post-transcriptional processing in chloroplasts. PMID:19838333

  20. Noninvasive tracking of gene transcript and neuroprotection after gene therapy.

    PubMed

    Ren, J; Chen, Y I; Liu, C H; Chen, P-C; Prentice, H; Wu, J-Y; Liu, P K

    2016-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) complimentary DNA (cDNA) encoded in self-complementary adeno-associated virus-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer's dementia, Parkinson's disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine.

  1. Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

    PubMed

    Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

    2016-04-01

    Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

  2. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  3. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  4. Analysis of gene order conservation in eukaryotes identifies transcriptionally and functionally linked genes.

    PubMed

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-05-14

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control.

  5. Analysis of Gene Order Conservation in Eukaryotes Identifies Transcriptionally and Functionally Linked Genes

    PubMed Central

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-01-01

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control. PMID:20498846

  6. Land use type significantly affects microbial gene transcription in soil.

    PubMed

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  7. Synaptic, transcriptional and chromatin genes disrupted in autism.

    PubMed

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D

    2014-11-13

    The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.

  8. A gene transcription signature of obesity in breast cancer.

    PubMed

    Creighton, Chad J; Sada, Yvonne H; Zhang, Yiqun; Tsimelzon, Anna; Wong, Helen; Dave, Bhuvanesh; Landis, Melissa D; Bear, Harry D; Rodriguez, Angel; Chang, Jenny C

    2012-04-01

    Obesity is thought to contribute to worse disease outcome in breast cancer as a result of increased levels of adipocyte-secreted endocrine factors, insulin, and insulin-like growth factors (IGFs) that accelerate tumor cell proliferation and impair treatment response. We examined the effects of patient obesity on primary breast tumor gene expression, by profiling transcription of a set of 103 tumors for which the patients' body mass index (BMI) was ascertained. Sample profiles were stratified according to patients' obesity phenotype defined as normal (BMI < 25), overweight (BMI 25-29.9), or obese (BMI ≥ 30). Widespread gene expression alterations were evident in breast tumors from obese patients as compared to other tumors, allowing us to define an obesity-associated cancer transcriptional signature of 662 genes. In multiple public expression data sets of breast cancers (representing > 1,500 patients), manifestation of the obesity signature patterns correlated with manifestation of a gene signature for IGF signaling and (to a lesser extent) with lower levels of estrogen receptor. In one patient cohort, manifestation of the obesity signature correlated with shorter time to metastases. A number of small molecules either induced or suppressed the obesity-associated transcriptional program in vitro; estrogens alpha-estradiol, levonorgestrel, and hexestrol induced the program, while several anti-parkinsonian agents targeting neurotransmitter receptor pathways repressed the program. Obesity in breast cancer patients appears to impact the gene expression patterns of the tumor (perhaps as a result of altered body chemistry). These results warrant further investigation of obesity-associated modifiers of breast cancer risk and disease outcome.

  9. Quantitative characterization of gene regulation by Rho dependent transcription termination.

    PubMed

    Hussein, Razika; Lee, Tiffany Y; Lim, Han N

    2015-08-01

    Rho factor dependent transcription termination (RTT) is common within the coding sequences of bacterial genes and it acts to couple transcription and translation levels. Despite the importance of RTT for gene regulation, its effects on mRNA and protein concentrations have not been quantitatively characterized. Here we demonstrate that the exogenous cfp gene encoding the cyan fluorescent protein can serve as a model for gene regulation by RTT. This was confirmed by showing that Psu and bicyclomycin decrease RTT and increase full length cfp mRNAs (but remarkably they have little effect on protein production). We then use cfp to characterize the relationship between its protein and full length mRNA concentrations when the translation initiation rate is varied by sequence modifications of the translation initiation region (TIR). These experiments reveal that the fold change in protein concentration (RP) and the fold change in full length mRNA concentration (Rm) have the relationship RP≈Rm(b), where b is a constant. The average value of b was determined from three separate data sets to be ~3.6. We demonstrate that the above power law function can predict how altering the translation initiation rate of a gene in an operon will affect the mRNA concentrations of downstream genes and specify a lower bound for the associated changes in protein concentrations. In summary, this study defines a simple phenomenological model to help program expression from single genes and operons that are regulated by RTT, and to guide molecular models of RTT.

  10. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  11. WRKY transcription factor genes in wild rice Oryza nivara.

    PubMed

    Xu, Hengjian; Watanabe, Kenneth A; Zhang, Liyuan; Shen, Qingxi J

    2016-08-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara.

  12. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.

    2016-01-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  13. In vitro transcription of a cloned mouse ribosomal RNA gene.

    PubMed Central

    Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

    1981-01-01

    An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

  14. The transcription analysis of duck enteritis virus UL49.5 gene using real-time quantitative reverse transcription PCR.

    PubMed

    Lin, Meng; Jia, Renyong; Wang, Mingshu; Gao, Xinghong; Zhu, Dekang; Chen, Shun; Yin, Zhongqiong; Wang, Yin; Chen, Xiaoyue; Cheng, Anchun

    2013-10-01

    Duck enteritis virus (DEV) UL49.5 encoding glycoprotein N was a conserved gene. The transcription dynamic process of UL49.5 homologous genes in herpesviruses was reported. However, the transcription dynamic process of DEV UL49.5 gene has not yet been established. In this study, a real-time quantitative reverse transcription PCR (real-time qRT-PCR) assay was established to test the transcription dynamic process of DEV UL49.5 gene, and the recombinant plasmid pUCm-T/UL49.5 was constructed as the standard DNA. The samples prepared from DEV-infected (at different time points) and uninfected cell were detected and calculated. The results demonstrated that the real-time qRT-PCR assay was successfully established. The transcription product of DEV UL49.5 gene was first detected at 0.5 h post infection (p.i.), increased at 8 h p.i. and reached a peak at 60 h p.i. Our results illustrated that DEV UL49.5 gene could be regarded as a late gene. The transcription dynamic process of DEV UL49.5 gene may provide a significant clue for further studies of DEV UL49.5 gene.

  15. V-src-induced-transcription of the avian clusterin gene.

    PubMed Central

    Herault, Y; Chatelain, G; Brun, G; Michel, D

    1992-01-01

    We have isolated the avian gene T64 corresponding to the mammalian clusterin, on the basis of high accumulation of its template mRNA in cells infected with oncogenic retroviruses. Since the clusterin was shown to have a protective effect against the immune system, its induction by oncogenic viruses is of major biological importance. The unique, short 5 kb-long T64 genomic locus is inactive in normal quail embryo fibroblasts in primary culture whereas it shows a high transcriptional activity after transformation by the Rous sarcoma virus. The 963 bp-long 5' flanking region is sufficient to drive the transcription of the chloramphenicol acetyltransferase reporter gene in a thermodependent manner when a thermosensitive version of pp60v-src is used. Deletion and point mutation analyses of the promoter show that the v-src response requires at least two separate elements: PUR and AP-1, located respectively at positions -167 to -152 and -25 to -19 relative to the single transcription initiation site. In addition, the binding of specific nuclear factors to these responsive elements correlates with the T64 promoter activation. Images PMID:1475199

  16. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing

    2015-01-01

    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  17. Extreme Hypoxic Conditions Induce Selective Molecular Responses and Metabolic Reset in Detached Apple Fruit

    PubMed Central

    Cukrov, Dubravka; Zermiani, Monica; Brizzolara, Stefano; Cestaro, Alessandro; Licausi, Francesco; Luchinat, Claudio; Santucci, Claudio; Tenori, Leonardo; Van Veen, Hans; Zuccolo, Andrea; Ruperti, Benedetto; Tonutti, Pietro

    2016-01-01

    The ripening physiology of detached fruit is altered by low oxygen conditions with profound effects on quality parameters. To study hypoxia-related processes and regulatory mechanisms, apple (Malus domestica, cv Granny Smith) fruit, harvested at commercial ripening, were kept at 1°C under normoxic (control) and hypoxic (0.4 and 0.8 kPa oxygen) conditions for up to 60 days. NMR analyses of cortex tissue identified eight metabolites showing significantly different accumulations between samples, with ethanol and alanine displaying the most pronounced difference between hypoxic and normoxic treatments. A rapid up-regulation of alcohol dehydrogenase and pyruvate-related metabolism (lactate dehydrogenase, pyruvate decarboxylase, alanine aminotransferase) gene expression was detected under both hypoxic conditions with a more pronounced effect induced by the lowest (0.4 kPa) oxygen concentration. Both hypoxic conditions negatively affected ACC synthase and ACC oxidase transcript accumulation. Analysis of RNA-seq data of samples collected after 24 days of hypoxic treatment identified more than 1000 genes differentially expressed when comparing 0.4 vs. 0.8 kPa oxygen concentration samples. Genes involved in cell-wall, minor and major CHO, amino acid and secondary metabolisms, fermentation and glycolysis as well as genes involved in transport, defense responses, and oxidation-reduction appeared to be selectively affected by treatments. The lowest oxygen concentration induced a higher expression of transcription factors belonging to AUX/IAA, WRKY, HB, Zinc-finger families, while MADS box family genes were more expressed when apples were kept under 0.8 kPa oxygen. Out of the eight group VII ERF members present in apple genome, two genes showed a rapid up-regulation under hypoxia, and western blot analysis showed that apple MdRAP2.12 proteins were differentially accumulated in normoxic and hypoxic samples, with the highest level reached under 0.4 kPa oxygen. These data suggest

  18. Gene transcriptional networks integrate microenvironmental signals in human breast cancer.

    PubMed

    Xu, Ren; Mao, Jian-Hua

    2011-04-01

    A significant amount of evidence shows that microenvironmental signals generated from extracellular matrix (ECM) molecules, soluble factors, and cell-cell adhesion complexes cooperate at the extra- and intracellular level. This synergetic action of microenvironmental cues is crucial for normal mammary gland development and breast malignancy. To explore how the microenvironmental genes coordinate in human breast cancer at the genome level, we have performed gene co-expression network analysis in three independent microarray datasets and identified two microenvironment networks in human breast cancer tissues. Network I represents crosstalk and cooperation of ECM microenvironment and soluble factors during breast malignancy. The correlated expression of cytokines, chemokines, and cell adhesion proteins in Network II implicates the coordinated action of these molecules in modulating the immune response in breast cancer tissues. These results suggest that microenvironmental cues are integrated with gene transcriptional networks to promote breast cancer development.

  19. Transcriptional regulation of the bovine oxytocin receptor gene.

    PubMed

    Telgmann, Ralph; Bathgate, Ross A D; Jaeger, Stefanie; Tillmann, Gina; Ivell, Richard

    2003-03-01

    The oxytocin receptor (OTR) is expressed in the cow uterus at high levels at estrus and at term of pregnancy. This expression appears to be controlled mostly at the transcriptional level and correlates with increasing estrogen concentration and progesterone withdrawal. Approximately 3200 base pairs of the upstream region of the bovine OTR gene were cloned and analyzed using a combination of bioinformatic, electrophoretic mobility shift (EMSA), and transfection analyses. Using nuclear proteins from high- and low-expressing tissues, EMSA indicated no significant quantitative or qualitative changes in specific DNA-protein binding, suggesting that transcription is probably controlled by signalling systems targeting constitutive factors. Using various cell types, including primary and immortalized ruminant endometrial epithelial cells, as hosts for transfection of promoter-reporter constructs showed that endogenous activity resided only in the longest, i.e., 3.2-kb, construct but not in those shorter than 1.0 kb. While estrogen appears to be important in vivo, no effect of estradiol was found on any construct directly; only when the longest 3.2-kb construct was used in combination with some cotransfected steroid receptor cofactors, e.g., SRC1e, was an estradiol-dependent effect observed. A putative interferon-responsive element (IRE) was found at approximately -2,400 from the transcription start site. This element was shown to bind mouse IRF1 and IRF2 as well as similar proteins from bovine endometrial and myometrial nuclear extracts. This element also responded to these factors when cotransfected into various cell types. The bovine equivalents to IRF1 and IRF2 were molecularly cloned from endometrial tissue and shown to be expressed in a temporal fashion, supporting the role of interferon-tau in maternal recognition of pregnancy. Of many factors tested or analyzed, these components of the IFN system are the only ones found to significantly influence the transcription

  20. Transcription of antifreeze protein genes in Choristoneura fumiferana.

    PubMed

    Qin, W; Doucet, D; Tyshenko, M G; Walker, V K

    2007-08-01

    Antifreeze proteins (AFPs) are encoded by approximately 17 genes in the spruce budworm, Choristoneura fumiferana. Northern analysis using 6 different cDNA probes showed isoform-specific patterns that varied during development. Transcripts for the majority of isoforms were most abundant in the second instar overwintering stage, but some were also detected in first instar and even in egg stages. In situ hybridization using riboprobes corresponding to two 9 kDa protein isoforms showed differential AFP expression even in second instars; CfAFP10 RNA was detected in all tissues, but CfAFP337 RNA distribution was more limited. Two genomic regions encoding three AFP genes have been isolated. Presumptive regulatory regions conferred transcriptional activity when placed upstream of a luciferase reporter sequence and transfected into a C. fumiferana cell line. The CfAFP2.26 core promoter is an 87 bp sequence containing a TATA box, whereas the CfAFP2.7 core promoter is a 76 bp sequence with both a TATA box and CAAT box, which directed higher reporter activities when tested in vitro. Reporter activity was not enhanced with five different hormones, although lower activities were observed with all intron-containing constructs. AFP message half-life, as assessed using reporter assays, was not appreciably influenced by isoform-specific-3'UTRs. These studies successfully demonstrate the temporal and spatial diversity of AFP expression encoded by this small gene family, and underscore the complexity of their regulation.

  1. Current insights into the molecular mechanisms of hypoxic pre- and postconditioning using hypobaric hypoxia

    PubMed Central

    Rybnikova, Elena; Samoilov, Mikhail

    2015-01-01

    Exposure of organisms to repetitive mild hypoxia results in development of brain hypoxic/ischemic tolerance and cross-tolerance to injurious factors of a psycho-emotional nature. Such preconditioning by mild hypobaric hypoxia functions as a “warning” signal which prepares an organism, and in particular the brain, to subsequent more harmful conditions. The endogenous defense processes which are mobilized by hypoxic preconditioning and result in development of brain tolerance are based on evolutionarily acquired gene-determined mechanisms of adaptation and neuroprotection. They involve an activation of intracellular cascades including kinases, transcription factors and changes in expression of multiple regulatory proteins in susceptible areas of the brain. On the other hand they lead to multilevel modifications of the hypothalamic-pituitary-adrenal endocrine axis regulating various functions in the organism. All these components are engaged sequentially in the initiation, induction and expression of hypoxia-induced tolerance. A special role belongs to the epigenetic regulation of gene expression, in particular of histone acetylation leading to changes in chromatin structure which ensure access of pro-adaptive transcription factors activated by preconditioning to the promoters of target genes. Mechanisms of another, relatively novel, neuroprotective phenomenon termed hypoxic postconditioning (an application of mild hypoxic episodes after severe insults) are still largely unknown but according to recent data they involve apoptosis-related proteins, hypoxia-inducible factor and neurotrophins. The fundamental data accumulated to date and discussed in this review open new avenues for elaboration of the effective therapeutic applications of hypoxic pre- and postconditioning. PMID:26557049

  2. Characterization of transcript processing of the gene encoding precerebellin-1.

    PubMed

    Kavety, B; Morgan, J I

    1998-12-10

    Precerebellin-1 (Cbln1) is a cerebellum-specific protein that shares significant sequence identity with the globular domains of the complement components C1qA, B and C, suggesting some common aspects of function and/or structure. As the C1q complex is composed of heterotrimers of C1qA, B and C it was hypothesized that multiple precerebellins may exist in a ternary complex. Northern blotting for cbln1 revealed multiple bands that could represent further family members or alternatively spliced variants. To discriminate these alternatives, probes derived from different regions of the cbln1 gene were used to identify and clone the transcripts detected on Northern blots. Four independent transcripts were repeatedly cloned from an adult mouse cerebellum cDNA library. Upon sequencing, all of these clones were found to be derived from the cbln1 gene and no additional precerebellin-related genes were isolated. Moreover, these clones accounted for the four cbln1-hybridizing bands (1.9, 2. 2, 3.2 and 5.5 kb) detected on Northern blots of adult cerebellum RNA. With one possible exception, these clones were all derived through alterations in the 3'-untranslated region (3'-UTR) of cbln1 that did not affect the coding sequence. This was achieved by the use of two polyadenylation sites and alternative (non-canonical) splicing in the 3'-UTR. Some additional variation in mRNA structure is provided by the use of alternative transcription start sites in cbln1. The possible significance of this level of diversity in the 3'-UTR is discussed.

  3. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo

    2006-01-01

    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  4. Precisely modulated pathogenicity island interference with late phage gene transcription.

    PubMed

    Ram, Geeta; Chen, John; Ross, Hope F; Novick, Richard P

    2014-10-07

    Having gone to great evolutionary lengths to develop resistance to bacteriophages, bacteria have come up with resistance mechanisms directed at every aspect of the bacteriophage life cycle. Most genes involved in phage resistance are carried by plasmids and other mobile genetic elements, including bacteriophages and their relatives. A very special case of phage resistance is exhibited by the highly mobile phage satellites, staphylococcal pathogenicity islands (SaPIs), which carry and disseminate superantigen and other virulence genes. Unlike the usual phage-resistance mechanisms, the SaPI-encoded interference mechanisms are carefully crafted to ensure that a phage-infected, SaPI-containing cell will lyse, releasing the requisite crop of SaPI particles as well as a greatly diminished crop of phage particles. Previously described SaPI interference genes target phage functions that are not required for SaPI particle production and release. Here we describe a SaPI-mediated interference system that affects expression of late phage gene transcription and consequently is required for SaPI and phage. Although when cloned separately, a single SaPI gene totally blocks phage production, its activity in situ is modulated accurately by a second gene, achieving the required level of interference. The advantage for the host bacteria is that the SaPIs curb excessive phage growth while enhancing their gene transfer activity. This activity is in contrast to that of the clustered regularly interspaced short palindromic repeats (CRISPRs), which totally block phage growth at the cost of phage-mediated gene transfer. In staphylococci the SaPI strategy seems to have prevailed during evolution: The great majority of Staphylococcus aureus strains carry one or more SaPIs, whereas CRISPRs are extremely rare.

  5. Gene Transcript Abundance Profiles Distinguish Kawasaki Disease from Adenovirus Infection

    PubMed Central

    Popper, Stephen J.; Watson, Virginia E.; Shimizu, Chisato; Kanegaye, John T.; Burns, Jane C.; Relman, David A.

    2010-01-01

    Background Acute Kawasaki disease (KD) is difficult to distinguish from other illnesses that involve acute rash or fever, in part because the etiologic agent(s) and pathophysiology remain poorly characterized. As a result, diagnosis and critical therapies may be delayed. Methods We used DNA microarrays to identify possible diagnostic features of KD. We compared gene expression patterns in the blood of 23 children with acute KD and 18 age-matched febrile children with 3 illnesses that resemble KD. Results Genes associated with platelet and neutrophil activation were expressed at higher levels in patients with KD than in patients with acute adenovirus infections or systemic adverse drug reactions, but levels in patients with KD were not higher than those in patients with scarlet fever. Genes associated with B cell activation were also expressed at higher levels in patients with KD than in control subjects. A striking absence of interferon-stimulated gene expression in patients with KD was confirmed in an independent cohort of patients with KD. Using a set of 38 gene transcripts, we successfully predicted the diagnosis for 21 of 23 patients with KD and 7 of 8 patients with adenovirus infection. Conclusions These findings provide insight into the molecular features that distinguish KD from other febrile illnesses and support the feasibility of developing novel diagnostic reagents for KD based on the host response. PMID:19583510

  6. Unsaturated fatty acids-dependent linkage between respiration and fermentation revealed by deletion of hypoxic regulatory KlMGA2 gene in the facultative anaerobe-respiratory yeast Kluyveromyces lactis.

    PubMed

    Ottaviano, Daniela; Montanari, Arianna; De Angelis, Lorenzo; Santomartino, Rosa; Visca, Andrea; Brambilla, Luca; Rinaldi, Teresa; Bello, Cristiano; Reverberi, Massimo; Bianchi, Michele M

    2015-08-01

    In the yeast Kluyveromyces lactis, the inactivation of structural or regulatory glycolytic and fermentative genes generates obligate respiratory mutants which can be characterized by sensitivity to the mitochondrial drug antimycin A on glucose medium (Rag(-) phenotype). Rag(-) mutations can occasionally be generated by the inactivation of genes not evidently related to glycolysis or fermentation. One such gene is the hypoxic regulatory gene KlMGA2. In this work, we report a study of the many defects, in addition to the Rag(-) phenotype, generated by KlMGA2 deletion. We analyzed the fermentative and respiratory metabolism, mitochondrial functioning and morphology in the Klmga2Δ strain. We also examined alterations in the regulation of the expression of lipid biosynthetic genes, in particular fatty acids, ergosterol and cardiolipin, under hypoxic and cold stress and the phenotypic suppression by unsaturated fatty acids of the deleted strain. Results indicate that, despite the fact that the deleted mutant strain had a typical glycolytic/fermentative phenotype and KlMGA2 is a hypoxic regulatory gene, the deletion of this gene generated defects linked to mitochondrial functions suggesting new roles of this protein in the general regulation and cellular fitness of K. lactis. Supplementation of unsaturated fatty acids suppressed or modified these defects suggesting that KlMga2 modulates membrane functioning or membrane-associated functions, both cytoplasmic and mitochondrial.

  7. A Weakened Transcriptional Enhancer Yields Variegated Gene Expression

    PubMed Central

    Collins, Cathy; Azmi, Peter; Berru, Maribel; Zhu, Xiaofu; Shulman, Marc J.

    2006-01-01

    Identical genes in the same cellular environment are sometimes expressed differently. In some cases, including the immunoglobulin heavy chain (IgH) locus, this type of differential gene expression has been related to the absence of a transcriptional enhancer. To gain additional information on the role of the IgH enhancer, we examined expression driven by enhancers that were merely weakened, rather than fully deleted, using both mutations and insulators to impair enhancer activity. For this purpose we used a LoxP/Cre system to place a reporter gene at the same genomic site of a stable cell line. Whereas expression of the reporter gene was uniformly high in the presence of the normal, uninsulated enhancer and undetectable in its absence, weakened enhancers yielded variegated expression of the reporter gene; i.e., the average level of expression of the same gene differed in different clones, and expression varied significantly among cells within individual clones. These results indicate that the weakened enhancer allows the reporter gene to exist in at least two states. Subtle aspects of the variegation suggest that the IgH enhancer decreases the average duration (half-life) of the silent state. This analysis has also tested the conventional wisdom that enhancer activity is independent of distance and orientation. Thus, our analysis of mutant (truncated) forms of the IgH enhancer revealed that the 250 bp core enhancer was active in its normal position, ∼1.4 kb 3′ of the promoter, but inactive ∼6 kb 3′, indicating that the activity of the core enhancer was distance-dependent. A longer segment – the core enhancer plus ∼1 kb of 3′ flanking material, including the 3′ matrix attachment region – was active, and the activity of this longer segment was orientation-dependent. Our data suggest that this 3′ flank includes binding sites for at least two activators. PMID:17183661

  8. The transcriptional repressor DREAM is involved in thyroid gene expression

    SciTech Connect

    D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella . E-mail: stella@szn.it

    2005-04-15

    Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca{sup 2+} interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function.

  9. Magnetic resonance imaging of hypoxic injury to the murine placenta.

    PubMed

    Tomlinson, Tracy M; Garbow, Joel R; Anderson, Jeff R; Engelbach, John A; Nelson, D Michael; Sadovsky, Yoel

    2010-02-01

    We assessed the use of magnetic resonance imaging (MRI) to define placental hypoxic injury associated with fetal growth restriction. On embryonic day 18.5 (E18.5) we utilized dynamic contrast-enhanced (DCE)-MRI on a 4.7-tesla small animal scanner to examine the uptake and distribution of gadolinium-based contrast agent. Quantitative DCE parameter analysis was performed for the placenta and fetal kidneys of three groups of pregnant C57BL/6 mice: 1) mice that were exposed to Fi(O(2)) = 12% between E15.5 and E18.5, 2) mice in normoxia with food restriction similar to the intake of hypoxic mice between E15.5 and E18.5, and 3) mice in normoxia that were fed ad libitum. After imaging, we assessed fetoplacental weight, placental histology, and gene expression. We found that dams exposed to hypoxia exhibited fetal growth restriction (weight reduction by 28% and 14%, respectively, P < 0.05) with an increased placental-to-fetal ratio. By using MRI-based assessment of placental contrast agent kinetics, referenced to maternal paraspinous muscle, we found decreased placental clearance of contrast media in hypoxic mice, compared with either control group (61%, P < 0.05). This was accompanied by diminished contrast accumulation in the hypoxic fetal kidneys (23%, P < 0.05), reflecting reduced transplacental gadolinium transport. These changes were associated with increased expression of placental Phlda2 and Gcm1 transcripts. Exposure to hypoxia near the end of mouse pregnancy reduces placental perfusion and clearance of contrast. MRI-based DCE imaging provides a novel tool for dynamic, in vivo assessment of placental function.

  10. Sequence requirements for transcriptional arrest in exon 1 of the murine adenosine deaminase gene.

    PubMed Central

    Ramamurthy, V; Maa, M C; Harless, M L; Wright, D A; Kellems, R E

    1990-01-01

    We have previously shown that a transcription arrest site near the 5' end of the murine adenosine deaminase (ADA) gene is significantly involved in the regulation of ADA gene expression. To facilitate the analysis of this transcription arrest site, we have analyzed the transcription products from cloned ADA gene fragments injected into Xenopus laevis oocytes. When genomic fragments spanning the 5' end of the ADA gene were injected into oocytes, a 96-nucleotide (nt) ADA RNA was the major transcription product. The 5' end of this RNA mapped to the transcription initiation site for the ADA gene, and its 3' terminus mapped 7 nt downstream of the translation initiation codon within exon 1. A 300-base-pair fragment of genomic DNA spanning the 5' end of the ADA gene was sufficient to generate the 96-nt transcript which accounted for approximately one-half of the transcription products from injected templates. Deletion of a segment of approximately 65 base pairs, located immediately downstream of the 3' terminus of the 96-nt transcript, resulted in a substantial reduction in the synthesis of the 96-nt transcript and a corresponding increase in the production of larger transcripts. These studies show that the transcriptional apparatus of X. laevis oocytes responds to the transcription arrest site associated with exon 1 of the murine ADA gene and that oocyte injections provide a convenient functional assay for additional mechanistic studies. Images PMID:1690842

  11. VITELLOGENIN GENE TRANSCRIPTION: A RELATIVE QUANTITATIVE EXPOSURE INDICATOR OF ENVIRONMENTAL ESTROGENS

    EPA Science Inventory

    We report the development of a quantifiable exposure indicator for measuring the presence of environmental estrogens in aquatic systems. Synthetic oligonucleotides, designed specifically for the vitellogenin gene (Vg) transcription product, were used in a Reverse Transcription Po...

  12. Genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30

    PubMed Central

    Taylor, John M; Ghorbel, Sofiane; Nicot, Christophe

    2009-01-01

    Background Human T-cell leukemia virus type 1 (HTLV-I) is a human retrovirus that is etiologically linked to adult T-cell leukemia (ATL), an aggressive and fatal lymphoproliferative disease. The viral transactivator, Tax, is thought to play an important role during the initial stages of CD4+ T-cell immortalization by HTLV-1. Tax has been shown to activate transcription through CREB/ATF and NF-KB, and to alter numerous signaling pathways. These pleiotropic effects of Tax modify the expression of a wide array of cellular genes. Another viral protein encoded by HTLV-I, p30, has been shown to affect virus replication at the transcriptional and posttranscriptional levels. Little is currently known regarding the effect of p30 on the expression and nuclear export of cellular host mRNA transcripts. Identification of these RNA may reveal new targets and increase our understanding of HTLV-I pathogenesis. In this study, using primary peripheral blood mononuclear cells, we report a genome wide analysis of human genes transcriptionally and post-transcriptionally regulated by the HTLV-I protein p30. Results Using microarray analysis, we analyzed total and cytoplasmic cellular mRNA transcript levels isolated from PBMCs to assess the effect of p30 on cellular RNA transcript expression and their nuclear export. We report p30-dependent transcription resulting in the 2.5 fold up-regulation of 15 genes and the down-regulation of 65 human genes. We further tested nuclear export of cellular mRNA and found that p30 expression also resulted in a 2.5 fold post-transcriptional down-regulation of 90 genes and the up-regulation of 33 genes. Conclusion Overall, our study describes that expression of the HTLV-I protein p30 both positively and negatively alters the expression of cellular transcripts. Our study identifies for the first time the cellular genes for which nuclear export is affected by p30. These results suggest that p30 may possess a more global function with respect to m

  13. Forkhead Transcription Factor 3a (FOXO3a) Modulates Hypoxia Signaling via Up-regulation of the von Hippel-Lindau Gene (VHL).

    PubMed

    Liu, Xing; Cai, Xiaolian; Hu, Bo; Mei, Zhichao; Zhang, Dawei; Ouyang, Gang; Wang, Jing; Zhang, Wei; Xiao, Wuhan

    2016-12-02

    FOXO3a, a member of the forkhead homeobox type O (FOXO) family of transcriptional factors, regulates cell survival in response to DNA damage, caloric restriction, and oxidative stress. The von Hippel-Lindau (VHL) tumor suppressor gene encodes a component of the E3 ubiquitin ligase complex that mediates hypoxia-inducible factor α degradation under aerobic conditions, thus acting as one of the key regulators of hypoxia signaling. However, whether FOXO3a impacts cellular hypoxia stress remains unknown. Here we show that FOXO3a directly binds to the VHL promoter and up-regulates VHL expression. Using a zebrafish model, we confirmed the up-regulation of vhl by foxo3b, an ortholog of mammalian FOXO3a Furthermore, by employing the clustered regularly interspaced short palindromic repeats (CRISPR)-associated RNA-guided endonuclease Cas9 (CRISPR/Cas9) technology, we deleted foxo3b in zebrafish and determined that expression of hypoxia-inducible genes was affected under hypoxia. Moreover, foxo3b-null zebrafish exhibited impaired acute hypoxic tolerance, resulting in death. In conclusion, our findings suggest that, by modulating hypoxia-inducible factor activity via up-regulation of VHL, FOXO3a (foxo3b) plays an important role in survival in response to hypoxic stress.

  14. Structure and transcription of the Drosophila mulleri alcohol dehydrogenase genes.

    PubMed

    Fischer, J A; Maniatis, T

    1985-10-11

    The D. melanogaster Adh gene is transcribed from two different promoters; a proximal (larval) promoter is active during late embryonic and larval stages, and a distal (adult) promoter is active primarily in third instar larvae and in adult flies (1). Genetic analyses suggest that several species of the mulleri subgroup (distant relatives of D. melanogaster) have two closely-linked Adh genes, Adh-1 and Adh-2, each of which expresses a different ADH protein (2). The temporal pattern of expression of Adh-1 and Adh-2 is similar to the expression of D. melanogaster Adh from the proximal and distal promoters (2,3,4). We are interested in the molecular basis for the pattern of Adh expression in the mulleri subgroup species and in the mechanism of the switch in Adh promoter utilization. For these reasons, we have studied the structure and transcription of the Adh locus of D. mulleri, a species of the mulleri subgroup. We show that the ADH-1 and ADH-2 proteins are expressed from two distinct genes separated by 2 kilobase pairs, and that Adh-1 and Adh-2 are transcribed in the expected temporal pattern. In addition, we find a pseudogene 1.2 kb upstream from Adh-2, which is transcribed in a temporal pattern similar to Adh-2.

  15. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  16. Modulation of Aanat gene transcription in the rat pineal gland.

    PubMed

    Ho, Anthony K; Chik, Constance L

    2010-01-01

    The main function of the rat pineal gland is to transform the circadian rhythm generated in the suprachiasmatic nucleus into a rhythmic signal of circulating melatonin characterized by a large nocturnal increase that closely reflects the duration of night period. This is achieved through the tight coupling between environmental lighting and the expression of arylalkylamine-N-acetyltransferase, the rhythm-controlling enzyme in melatonin synthesis. The initiation of Aanat transcription at night is controlled largely by the norepinephrine-stimulated phosphorylation of cAMP response element-binding protein by protein kinase A. However, to accurately reflect the duration of darkness, additional signaling mechanisms also participate to fine-tune the temporal profile of adrenergic-induced Aanat transcription. Here, we reviewed some of these signaling mechanisms, with emphasis on the more recent findings. These signaling mechanisms can be divided into two groups: those involving modification of constitutively expressed proteins and those requiring synthesis of new proteins. This review highlights the pineal gland as an excellent model system for studying neurotransmitter-regulated rhythmic gene expression.

  17. Nuclear actin-binding proteins as modulators of gene transcription.

    PubMed

    Gettemans, Jan; Van Impe, Katrien; Delanote, Veerle; Hubert, Thomas; Vandekerckhove, Joël; De Corte, Veerle

    2005-10-01

    Dynamic transformations in the organization of the cellular microfilament system are the driving force behind fundamental biological processes such as cellular motility, cytokinesis, wound healing and secretion. Eukaryotic cells express a plethora of actin-binding proteins (ABPs) allowing cells to control the organization of the actin cytoskeleton in a flexible manner. These structural proteins were, not surprisingly, originally described as (major) constituents of the cytoplasm. However, in recent years, there has been a steady flow of reports detailing not only translocation of ABPs into and out of the nucleus but also describing their role in the nuclear compartment. This review focuses on recent developments pertaining to nucleocytoplasmic transport of ABPs, including their mode of translocation and nuclear function. In particular, evidence that structurally and functionally unrelated cytoplasmic ABPs regulate transcription activation by various nuclear (steroid hormone) receptors is steadily accruing. Furthermore, the recent finding that actin is a necessary component of the RNA polymerase II-containing preinitiation complex opens up new opportunities for nuclear ABPs in gene transcription regulation.

  18. The novel hypoxic cytotoxin, TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and hypoxia inducible factor-1{alpha} targeted gene expression

    SciTech Connect

    Miyake, Kotaro; Nishioka, Masanori; Imura, Satoru; Batmunkh, Erdenebulgan; Uto, Yoshihiro; Nagasawa, Hideko; Hori, Hitoshi; Shimada, Mitsuo

    2012-08-01

    Tumor hypoxia has been considered to be a potential therapeutic target, because hypoxia is a common feature of solid tumors and is associated with their malignant phenotype. In the present study, we investigated the antitumor effect of a novel hypoxic cytotoxin, 3-[2-hydroxyethyl(methyl)amino]-2-quinoxalinecarbonitrile 1,4-dioxide (TX-2098) in inhibiting the expression of hypoxia inducible factor-1{alpha} (HIF-1{alpha}), and consequently vascular endothelial cell growth factor (VEGF) expression in pancreatic cancer. The antitumor effects of TX-2098 under hypoxia were tested against various human pancreatic cancer cell lines using WST-8 assay. VEGF protein induced pancreatic cancer was determined on cell-free supernatant by ELISA. Moreover, nude mice bearing subcutaneously (s.c.) or orthotopically implanted human SUIT-2 were treated with TX-2098. Tumor volume, survival and expression of HIF-1 and associated molecules were evaluated in treatment versus control groups. In vitro, TX-2098 inhibited the proliferation of various pancreatic cancer cell lines. In s.c model, tumors from nude mice injected with pancreatic cancer cells and treated with TX-2098 showed significant reductions in volume (P < 0.01 versus control). Quantitative real-time reverse transcription-PCR analysis revealed that TX-2098 significantly inhibited mRNA expression of the HIF-1 associated molecules, VEGF, glucose transporter 1 and Aldolase A (P < 0.01 versus control). These treatments also prolong the survival in orthotopic models. These results suggest that the effect of TX-2098 in pancreatic cancer might be correlated with the expression of VEGF and HIF-1 targeted molecules. -- Highlights: Black-Right-Pointing-Pointer We designed and synthesized novel hypoxic cytoxin, TX-2098. Black-Right-Pointing-Pointer TX-2098 inhibited the proliferation of human pancreatic cancer cells than TPZ. Black-Right-Pointing-Pointer TX-2098 reduced VEGF protein level than TPZ. Black-Right-Pointing-Pointer TX-2098

  19. Post-transcriptional gene regulation by mRNA modifications

    PubMed Central

    Zhao, Boxuan Simen; Roundtree, Ian A.; He, Chuan

    2016-01-01

    The recent discovery of reversible mRNA methylation has opened a new realm of post-transcriptional gene regulation in eukaryotes. The identification and functional characterization of proteins that specifically recognize RNA N6-methyladenosine (m6A) unveiled it as a modification that cells utilize to accelerate mRNA metabolism and translation. N6-adenosine methylation directs mRNAs to distinct fates by grouping them for differential processing, translation and decay in processes such as cell differentiation, embryonic development and stress responses. Other mRNA modifications, including N1-methyladenosine (m1A), 5-methylcytosine (m5C) and pseudouridine, together with m6A form the epitranscriptome and collectively code a new layer of information that controls protein synthesis. PMID:27808276

  20. Transcription factors and target genes of pre-TCR signaling.

    PubMed

    López-Rodríguez, Cristina; Aramburu, Jose; Berga-Bolaños, Rosa

    2015-06-01

    Almost 30 years ago pioneering work by the laboratories of Harald von Boehmer and Susumo Tonegawa provided the first indications that developing thymocytes could assemble a functional TCRβ chain-containing receptor complex, the pre-TCR, before TCRα expression. The discovery and study of the pre-TCR complex revealed paradigms of signaling pathways in control of cell survival and proliferation, and culminated in the recognition of the multifunctional nature of this receptor. As a receptor integrated in a dynamic developmental process, the pre-TCR must be viewed not only in the light of the biological outcomes it promotes, but also in context with those molecular processes that drive its expression in thymocytes. This review article focuses on transcription factors and target genes activated by the pre-TCR to drive its different outcomes.

  1. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  2. 5' sequences are important positive and negative determinants of the longevity of Chlamydomonas chloroplast gene transcripts.

    PubMed Central

    Salvador, M L; Klein, U; Bogorad, L

    1993-01-01

    We have found that sequences in the 5' leader of the Chlamydomonas chloroplast rbcL gene, when fused 5' to foreign genes, destabilize transcripts of these chimeric genes in the chloroplast of transgenic Chlamydomonas but that 5' sequences of the rbcL structural gene prevent this destabilization. Transcripts of the chloroplast rbcL gene are about equally abundant at all times in Chlamydomonas reinhardtii growing on an alternating 12-h light/12-h dark cycle. However, Chlamydomonas chloroplast transformants, harboring chimeric genes containing the same rbcL promoter with 63 or 92 bp of the rbcL 5' leader sequence fused upstream of the Escherichia coli uidA (beta-glucuronidase, GUS) gene, accumulated GUS transcripts only in the dark. Transcripts disappeared rapidly upon illumination of the cells. The same phenomenon was exhibited by transcripts of chimeric genes in which the GUS gene coding sequence was replaced by other unrelated genes. The precipitous light-induced drop in GUS transcript abundance was found to be due to an approximately 16-fold increase in the rate of degradation of GUS transcripts in light rather than to a decrease in the rate of transcription of the GUS gene. Transcripts of a chimeric rbcL-GUS construct in which the leader sequence of the rbcL gene was replaced by 103 bp of the leader sequence of the atpB gene were stable in illuminated cells. The destabilizing effect of the rbcL 5' leader sequence was reversed by adding 257 bp of the 5' coding region of the rbcL gene. The results show that chloroplast transcript levels in illuminated Chlamydomonas cells--and perhaps in other cases--can be determined, at least to some extent, by sequences and interactions of sequences transcribed from the 5' ends of genes. Images PMID:8434017

  3. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context.

  4. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    EPA Science Inventory

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  5. Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    PubMed Central

    Campos-Sandoval, José A.; Manzanares, Elisa; Lobo, Carolina; Segura, J. A.; Alonso, Francisco J.; Matés, José M.; Márquez, Javier

    2012-01-01

    Background Glutaminase is expressed in most mammalian tissues and cancer cells, but the regulation of its expression is poorly understood. An essential step to accomplish this goal is the characterization of its species- and cell-specific isoenzyme pattern of expression. Our aim was to identify and characterize transcript variants of the mammalian glutaminase Gls2 gene. Methodology/Principal Findings We demonstrate for the first time simultaneous expression of two transcript variants from the Gls2 gene in human, rat and mouse. A combination of RT-PCR, primer-extension analysis, bioinformatics, real-time PCR, in vitro transcription and translation and immunoblot analysis was applied to investigate GLS2 transcripts in mammalian tissues. Short (LGA) and long (GAB) transcript forms were isolated in brain and liver tissue of human, rat and mouse. The short LGA transcript arises by a combination of two mechanisms of transcriptional modulation: alternative transcription initiation and alternative promoter. The LGA variant contains both the transcription start site (TSS) and the alternative promoter in the first intron of the Gls2 gene. The full human LGA transcript has two in-frame ATGs in the first exon, which are missing in orthologous rat and mouse transcripts. In vitro transcription and translation of human LGA yielded two polypeptides of the predicted size, but only the canonical full-length protein displayed catalytic activity. Relative abundance of GAB and LGA transcripts showed marked variations depending on species and tissues analyzed. Conclusions/Significance This is the first report demonstrating expression of alternative transcripts of the mammalian Gls2 gene. Transcriptional mechanisms giving rise to GLS2 variants and isolation of novel GLS2 transcripts in human, rat and mouse are presented. Results were also confirmed at the protein level, where catalytic activity was demonstrated for the human LGA protein. Relative abundance of GAB and LGA transcripts was

  6. Comprehensive analysis of the transcription of starch synthesis genes and the transcription factor RSR1 in wheat (Triticum aestivum) endosperm.

    PubMed

    Kang, Guo-Zhang; Xu, Wei; Liu, Guo-Qin; Peng, Xiao-Qi; Guo, Tian-Cai

    2013-02-01

    The cDNA sequences of 26 starch synthesis genes were identified in common wheat (Triticum aestivum L.), and their transcript levels were measured using quantitative real-time RT-PCR to assess the function of individual genes and the regulatory mechanism in wheat endosperm. The expression patterns of 26 genes in wheat endosperm were classified into three groups. The genes in group 1 were richly expressed in the early stage of grain development and may be involved in the construction of fundamental cell machinery, synthesis of glucan primers, and initiation of starch granules. The genes in group 2 were highly expressed during the middle and late stages of grain development, and their expression profiles were similar to the accumulation rate of endosperm starch; these genes are presumed to play a crucial role in starch production. The genes in group 3 were scantily expressed throughout the grain development period and might be associated with transitory starch synthesis. Transcripts of the negative transcription factor TaRSR1 were high at the early and late stages of grain development but low during the middle stage. The expression pattern of TaRSR1 was almost opposite to those of the group 2 starch synthesis genes, indicating that TaRSR1 might negatively regulate the expression of many endosperm starch synthesis genes during grain development.

  7. Adenovirus E1A protein activates transcription of the E1A gene subsequent to transcription complex formation.

    PubMed Central

    Schaack, J; Logan, J; Vakalopoulou, E; Shenk, T

    1991-01-01

    The mechanism of transcriptional activation of the adenovirus E1A and E3 genes by E1A protein during infection was examined by using transcription-competition assays. Infection of HeLa cells with one virus led to inhibition of mRNA accumulation from a superinfecting virus. Synthesis of the E1A 289R protein by the first virus to infect reduced inhibition of transcription of the superinfecting virus, indicating that the E1A 289R protein was limiting for E1A-activated transcription. Infection with an E1A- virus, followed 6 h later by superinfection with a wild-type virus, led to preferential transcriptional activation of the E1A gene of the first virus, suggesting that a host transcription component(s) stably associated with the E1A promoter in the absence of E1A protein and that this complex was the substrate for transcriptional activation by E1A protein. The limiting host transcription component(s) bound to the E1A promoter to form a complex with a half-life greater than 24 h in the absence of E1A 289R protein, as demonstrated in a challenge assay with a large excess of superinfecting virus. In the presence of the E1A 289R protein, the E1A gene of the superinfecting virus was gradually activated with a reduction in E1A mRNA accumulation from the first virus. The kinetics of the activation suggest that this was due to an indirect effect rather than to destabilization of stable transcription complexes by the 289R protein. Images PMID:1825853

  8. Expression of a Mutant kcnj2 Gene Transcript in Zebrafish

    PubMed Central

    Leong, Ivone U. S.; Skinner, Jonathan R.; Shelling, Andrew N.; Love, Donald R.

    2013-01-01

    Long QT 7 syndrome (LQT7, also known as Andersen-Tawil syndrome) is a rare autosomal-dominant disorder that causes cardiac arrhythmias, periodic paralysis, and dysmorphic features. Mutations in the human KCNJ2 gene, which encodes for the subunit of the potassium inwardly-rectifying channel (IK1), have been associated with the disorder. The majority of mutations are considered to be dominant-negative as mutant proteins interact to limit the function of wild type KCNJ2 proteins. Several LQT7 syndrome mouse models have been created that vary in the physiological similarity to the human disease. To complement the LQT7 mouse models, we investigated the usefulness of the zebrafish as an alternative model via a transient approach. Initial bioinformatic analysis identified the zebrafish orthologue of the human KCNJ2 gene, together with a spatial expression profile that was similar to that of human. The expression of a kcnj2-12 transcript carrying an in-frame deletion of critical amino acids identified in human studies resulted in embryos that exhibited defects in muscle development, thereby affecting movement, a decrease in jaw size, pupil-pupil distance, and signs of scoliosis. These defects correspond to some phenotypes expressed by human LQT7 patients. PMID:27335675

  9. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  10. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  11. NDRG1 deficiency attenuates fetal growth and the intrauterine response to hypoxic injury.

    PubMed

    Larkin, Jacob; Chen, Baosheng; Shi, Xiao-Hua; Mishima, Takuya; Kokame, Koichi; Barak, Yaacov; Sadovsky, Yoel

    2014-03-01

    Intrauterine mammalian development depends on the preservation of placental function. The expression of the protein N-myc downstream-regulated gene 1 (NDRG1) is increased in placentas of human pregnancies affected by fetal growth restriction and in hypoxic primary human trophoblasts, where NDRG1 attenuates cell injury. We sought to assess the function of placental NDRG1 in vivo and tested the hypothesis that NDRG1 deficiency in the mouse embryo impairs placental function and consequently intrauterine growth. We found that Ndrg1 knock-out embryos were growth restricted in comparison to wild-type or heterozygous counterparts. Furthermore, hypoxia reduced the survival of female, but not male, knock-out embryos. Ndrg1 deletion caused significant alterations in placental gene expression, with a marked reduction in transcription of several lipoproteins in the placental labyrinth. These transcriptional changes were associated with reduced fetal:maternal serum cholesterol ratio exclusively in hypoxic female embryos. Collectively, our findings indicate that NDRG1 promotes fetal growth and regulates the metabolic response to intrauterine hypoxic injury in a sexually dichotomous manner.

  12. Introns and gene expression: Cellular constraints, transcriptional regulation, and evolutionary consequences

    PubMed Central

    Heyn, Patricia; Kalinka, Alex T; Tomancak, Pavel; Neugebauer, Karla M

    2015-01-01

    A gene's “expression profile” denotes the number of transcripts present relative to all other transcripts. The overall rate of transcript production is determined by transcription and RNA processing rates. While the speed of elongating RNA polymerase II has been characterized for many different genes and organisms, gene-architectural features – primarily the number and length of exons and introns – have recently emerged as important regulatory players. Several new studies indicate that rapidly cycling cells constrain gene-architecture toward short genes with a few introns, allowing efficient expression during short cell cycles. In contrast, longer genes with long introns exhibit delayed expression, which can serve as timing mechanisms for patterning processes. These findings indicate that cell cycle constraints drive the evolution of gene-architecture and shape the transcriptome of a given cell type. Furthermore, a tendency for short genes to be evolutionarily young hints at links between cellular constraints and the evolution of animal ontogeny. PMID:25400101

  13. Understanding the Role of Housekeeping and Stress-Related Genes in Transcription-Regulatory Networks

    NASA Astrophysics Data System (ADS)

    Heath, Allison; Kavraki, Lydia; Balázsi, Gábor

    2008-03-01

    Despite the increasing number of completely sequenced genomes, much remains to be learned about how living cells process environmental information and respond to changes in their surroundings. Accumulating evidence indicates that eukaryotic and prokaryotic genes can be classified in two distinct categories that we will call class I and class II. Class I genes are housekeeping genes, often characterized by stable, noise resistant expression levels. In contrast, class II genes are stress-related genes and often have noisy, unstable expression levels. In this work we analyze the large scale transcription-regulatory networks (TRN) of E. coli and S. cerevisiae and preliminary data on H. sapien. We find that stable, housekeeping genes (class I) are preferentially utilized as transcriptional inputs while stress related, unstable genes (class II) are utilized as transcriptional integrators. This might be the result of convergent evolution that placed the appropriate genes in the appropriate locations within transcriptional networks according to some fundamental principles that govern cellular information processing.

  14. Maternal transfer and transcriptional onset of immune genes during ontogenesis in Atlantic cod.

    PubMed

    Seppola, Marit; Johnsen, Hanne; Mennen, Saskia; Myrnes, Bjørnar; Tveiten, Helge

    2009-11-01

    The immune system in teleosts is not completely developed during embryonic and larval stages and immune competence is assumed to be restricted. This study is the first to address whether immune transcripts are maternally transferred to offspring and when immune genes are transcriptionally active in Atlantic cod (Gadus morhua). In unfertilised eggs, transcripts encoding lysozyme and cathelicidin were found indicating maternal transfer of antibacterial transcripts. Lysozyme activity was also present at this stage suggesting the presence of a functional protein. Transcripts of two other putative antibacterial genes (hepcidin and pentraxin) and antiviral genes (ISG15 and LGP2) were absent in unfertilised eggs. The transcriptional onset of these genes occurred during the gastrula period. Transcripts of the heavy chain constant regions of the immunoglobulin (Ig) D, membrane-associated and secreted form of IgM were absent in unfertilised eggs. Transcription of the heavy chain locus commenced at low levels during the segmentation period indicating the onset of B-cell development. Most innate immune genes showed an increase in transcription around hatch and first feeding, indicating a preparation for increased pathogen exposure at this time. Prior to and during metamorphosis all genes showed a pronounced elevation in transcript levels indicating a further maturation of the immune system during this period.

  15. Induction of AhR-Mediated Gene Transcription by Coffee

    PubMed Central

    Ishikawa, Toshio; Takahashi, Satoshi; Morita, Koji; Okinaga, Hiroko; Teramoto, Tamio

    2014-01-01

    Background Aryl hydrocarbon receptor (AhR) is classically known to be activated by xenobiotics such as dioxins and polycyclic aromatic hydrocarbons (PAHs). Although it has been reported that PAHs are contained in roasted coffee beans, in general coffee beverages are not considered to be AhR activators. We tested whether exposure to coffee would activate AhR in cultured cells. Methods HepG2 cells stably expressing an AhR-responsive reporter gene were treated with coffee samples. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was quantitated by RT-PCR and Western blotting in HepG2, Caco-2, and MCF-7 cells, after treatment with coffee. In order to obtain sensitive and reproducible results, all the experiments were performed with the cells placed in either phosphate-buffered saline (PBS) or pure serum, instead of routinely-used culture medium, whose intrinsic AhR-stimulating activity turned out to be so strong as to interfere with the analyses. Results All the coffee samples tested robustly stimulated AhR-mediated transcription in the reporter gene assays. Of note, to what extent coffee and other AhR agonists activated AhR was different, depending on whether the experiments were done in PBS or serum. CYP1A1 mRNA was induced by coffee, in HepG2, Caco-2, and MCF-7 cells placed in either PBS or serum. CYP1A1 protein expression, which was not detected in these cells incubated in PBS, was also increased by coffee in cells placed in serum. Conclusions By using culture medium-free experimental settings, we have shown that coffee is a strong AhR activator. Our observation may help elucidate as-yet-unrecognized effects of coffee on human health. PMID:25007155

  16. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  17. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  18. Metabolic and hypoxic adaptation to anti-angiogenic therapy: a target for induced essentiality

    PubMed Central

    McIntyre, Alan; Harris, Adrian L

    2015-01-01

    Anti-angiogenic therapy has increased the progression-free survival of many cancer patients but has had little effect on overall survival, even in colon cancer (average 6–8 weeks) due to resistance. The current licensed targeted therapies all inhibit VEGF signalling (Table1). Many mechanisms of resistance to anti-VEGF therapy have been identified that enable cancers to bypass the angiogenic blockade. In addition, over the last decade, there has been increasing evidence for the role that the hypoxic and metabolic responses play in tumour adaptation to anti-angiogenic therapy. The hypoxic tumour response, through the transcription factor hypoxia-inducible factors (HIFs), induces major gene expression, metabolic and phenotypic changes, including increased invasion and metastasis. Pre-clinical studies combining anti-angiogenics with inhibitors of tumour hypoxic and metabolic adaptation have shown great promise, and combination clinical trials have been instigated. Understanding individual patient response and the response timing, given the opposing effects of vascular normalisation versus reduced perfusion seen with anti-angiogenics, provides a further hurdle in the paradigm of personalised therapeutic intervention. Additional approaches for targeting the hypoxic tumour microenvironment are being investigated in pre-clinical and clinical studies that have potential for producing synthetic lethality in combination with anti-angiogenic therapy as a future therapeutic strategy. PMID:25700172

  19. Hypoxic preconditioning decreases nuclear factor κB activity via Disrupted in Schizophrenia-1.

    PubMed

    Liu, Jia-Ren; Liu, Qian; Khoury, Joseph; Li, Yue-Jin; Han, Xiao-Hui; Li, Jing; Ibla, Juan C

    2016-01-01

    Nuclear factor κB is a key mediator of inflammation during conditions of hypoxia. Here, we used models of hypoxic pre-conditioning as mechanism to decrease nuclear factor κB activity induced by hypoxia. Our initial studies suggested that Disrupted in Schizophrenia-1 may be induced by hypoxic pre-conditioning and possibly involved in the regulation of nuclear factor κB. In this study we used Disrupted in Schizophrenia-1 exogenous over-expression and knock-down to determine its effect on ataxia telangiectasia mutated--nuclear factor κB activation cascade. Our results demonstrated that hypoxic pre-conditioning significantly increased the expression of Disrupted in Schizophrenia-1 at mRNA and protein levels both in vitro and in vivo. Over-expression of Disrupted in Schizophrenia-1 significantly attenuated the hypoxia-mediated ataxia telangiectasia mutated phosphorylation and prevented its cytoplasm translocation where it functions to activate nuclear factor κB. We further determined that Disrupted in Schizophrenia-1 activated the protein phosphatase 2A, preventing the phosphorylation of ataxia telangiectasia mutated serine-1981, the main regulatory site of ataxia telangiectasia mutated activity. Cellular levels of Disrupted in Schizophrenia-1 protein significantly decreased nuclear factor κB activation profiles and pro-inflammatory gene expression. Taken together, these results demonstrate that hypoxic pre-conditioning decreases the activation of nuclear factor κB through the transcriptional induction of Disrupted in Schizophrenia-1.

  20. Insight into transcription factor gene duplication from Caenorhabditis elegans Promoterome-driven expression patterns

    PubMed Central

    Reece-Hoyes, John S; Shingles, Jane; Dupuy, Denis; Grove, Christian A; Walhout, Albertha JM; Vidal, Marc; Hope, Ian A

    2007-01-01

    Background The C. elegans Promoterome is a powerful resource for revealing the regulatory mechanisms by which transcription is controlled pan-genomically. Transcription factors will form the core of any systems biology model of genome control and therefore the promoter activity of Promoterome inserts for C. elegans transcription factor genes was examined, in vivo, with a reporter gene approach. Results Transgenic C. elegans strains were generated for 366 transcription factor promoter/gfp reporter gene fusions. GFP distributions were determined, and then summarized with reference to developmental stage and cell type. Reliability of these data was demonstrated by comparison to previously described gene product distributions. A detailed consideration of the results for one C. elegans transcription factor gene family, the Six family, comprising ceh-32, ceh-33, ceh-34 and unc-39 illustrates the value of these analyses. The high proportion of Promoterome reporter fusions that drove GFP expression, compared to previous studies, led to the hypothesis that transcription factor genes might be involved in local gene duplication events less frequently than other genes. Comparison of transcription factor genes of C. elegans and Caenorhabditis briggsae was therefore carried out and revealed very few examples of functional gene duplication since the divergence of these species for most, but not all, transcription factor gene families. Conclusion Examining reporter expression patterns for hundreds of promoters informs, and thereby improves, interpretation of this data type. Genes encoding transcription factors involved in intrinsic developmental control processes appear acutely sensitive to changes in gene dosage through local gene duplication, on an evolutionary time scale. PMID:17244357

  1. Hypoxic regulation of the noncoding genome and NEAT1

    PubMed Central

    Choudhry, Hani

    2016-01-01

    Activation of hypoxia pathways is both associated with and contributes to an aggressive phenotype across multiple types of solid cancers. The regulation of gene transcription by hypoxia-inducible factor (HIF) is a key element in this response. HIF directly upregulates the expression of many hundreds of protein-coding genes, which act to both improve oxygen delivery and to reduce oxygen demand. However, it is now becoming apparent that many classes of noncoding RNAs are also regulated by hypoxia, with several (e.g. micro RNAs, long noncoding RNAs and antisense RNAs) under direct transcriptional regulation by HIF. These hypoxia-regulated, noncoding RNAs may act as effectors of the indirect response to HIF by acting on specific coding transcripts or by affecting generic RNA-processing pathways. In addition, noncoding RNAs may also act as modulators of the HIF pathway, either by integrating other physiological responses or, in the case of HIF-regulated, noncoding RNAs, by providing negative or positive feedback and feedforward loops that affect upstream or downstream components of the HIF cascade. These hypoxia-regulated, noncoding transcripts play important roles in the aggressive hypoxic phenotype observed in cancer. PMID:26590207

  2. Isopentenyl transferase gene (ipt) downstream transcriptionally fused with gene expression improves the growth of transgenic plants.

    PubMed

    Guo, Jian-Chun; Duan, Rui-Jun; Hu, Xin-Wen; Li, Kai-Mian; Fu, Shao-Ping

    2010-04-01

    This research reports a promising approach to increase a plant's physiological cytokinin content. This approach also enables the increase to play a role in plant growth and development by introducing the ipt gene to downstream transcriptionally fuse with other genes under the control of a CaMV35S promoter, in which the ipt gene is far from the 35S promoter. According to Kozak's ribosome screening model, expression of the ipt gene is reduced by the terminal codon of the first gene and the internal untranslated nucleotides between the fused genes. In the transgenic plants pVKH35S-GUS-ipt, pVKH35S-AOC-ipt, and pVKH35S-AtGolS2-ipt, cytokinins were increased only two to threefold, and the plants grew more vigorously than the pVKH35S-AOC or pVKH35S-AtGolS2 transgenic plants lacking the ipt gene. The vigorous growth was reflected in rapid plant growth, a longer flowering period, a greater number of flowers, more seed product, and increased chlorophyll synthesis. The AOC and AtGolS2 genes play a role in a plant's tolerance of salt or cold, respectively. When the ipt gene transcriptionally fuses with AOC or AtGolS2 in the frame of AOC-ipt and AtGolS2-ipt, slight cytokinin increases were obtained in their transgenic plants; furthermore, those increases played a positive role in improvements of plant growth. Notably, an increased cytokinin volume at the physiological level, in concert with AtGolS2 expression, enhances a plant's tolerance to cold.

  3. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  4. A Photo-Degradable Gene Delivery System for Enhanced Nuclear Gene Transcription

    PubMed Central

    Hoyoung, Lee; Yeji, Kim; Patrick G., Schweickert; Stephen F., Konieczny; You-Yeon, Won

    2013-01-01

    There currently exists a significant gap in our understanding of how the detailed chemical characteristics of polycation gene carriers influence their delivery performances in overcoming an important cellular-level transport barrier, i.e., intranuclear gene transcription. In this study, a UV-degradable gene carrier material (ENE4-1) was synthesized by crosslinking low molecular weight branched polyethylenimine (bPEI-2k) molecules using UV-cleavable o-nitrobenzyl urethane (NBU) as the linker molecule. NBU degrades upon exposure to mild UV irradiation. Therefore, this UV-degradable carrier allows us to control the chemical characteristics of the polymer/DNA complex (polyplex) particles at desired locations within the intracellular environment. By using this photolytic DNA carrier, we found that the exact timing of the UV degradation significantly influences the gene transfection efficiencies of ENE4-1/DNA(pGL2) polyplexes in HeLa cells. Interestingly, even if the polyplexes were UV-degraded at different intracellular locations/times, their nuclear entry efficiency was not influenced by the location/timing of UV degradation. The UV treatment did not influence the size or binding strength of the polyplexes. However, we confirmed that the degradation of the carrier molecules impacts the chemical characteristics of the polyplexes (it produces carbamic acid and nitrosobenzyl aldehyde groups on ENE4-1). We believe that these anionic acid groups enhance the interaction of the polyplexes with nuclear transcription proteins and thus the final gene expression levels; this effect was found to occur, even though UV irradiation itself has a general effect of reducing transfection efficiencies. Excess (uncomplexed) ENE4-1 polymers appear to not play any role in the UV-enhanced gene transcription phenomenon. PMID:24172855

  5. Effect of Soil Clay Content on RNA Isolation and on Detection and Quantification of Bacterial Gene Transcripts in Soil by Quantitative Reverse Transcription-PCR ▿†

    PubMed Central

    Novinscak, A.; Filion, M.

    2011-01-01

    In this study, we evaluated the effect of soil clay content on RNA isolation and on quantitative reverse transcription-PCR (qRT-PCR) quantification of microbial gene transcripts. The amount of clay significantly altered RNA isolation yields and qRT-PCR analyses. Recommendations are made for quantifying microbial gene transcripts in soil samples varying in clay content. PMID:21724880

  6. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent.

  7. Transcription factor regulation can be accurately predicted from the presence of target gene signatures in microarray gene expression data

    PubMed Central

    Essaghir, Ahmed; Toffalini, Federica; Knoops, Laurent; Kallin, Anders; van Helden, Jacques; Demoulin, Jean-Baptiste

    2010-01-01

    Deciphering transcription factor networks from microarray data remains difficult. This study presents a simple method to infer the regulation of transcription factors from microarray data based on well-characterized target genes. We generated a catalog containing transcription factors associated with 2720 target genes and 6401 experimentally validated regulations. When it was available, a distinction between transcriptional activation and inhibition was included for each regulation. Next, we built a tool (www.tfacts.org) that compares submitted gene lists with target genes in the catalog to detect regulated transcription factors. TFactS was validated with published lists of regulated genes in various models and compared to tools based on in silico promoter analysis. We next analyzed the NCI60 cancer microarray data set and showed the regulation of SOX10, MITF and JUN in melanomas. We then performed microarray experiments comparing gene expression response of human fibroblasts stimulated by different growth factors. TFactS predicted the specific activation of Signal transducer and activator of transcription factors by PDGF-BB, which was confirmed experimentally. Our results show that the expression levels of transcription factor target genes constitute a robust signature for transcription factor regulation, and can be efficiently used for microarray data mining. PMID:20215436

  8. Sequence requirements for transcriptional arrest in exon 1 of the human adenosine deaminase gene

    SciTech Connect

    Zhi Chen; Kellems, R.E.; Innis, J.W. ); Sun, Minghua; Wright, D.A. )

    1991-12-01

    The authors have previously demonstrated that a transcriptional arrest site exists in exon 1 of the human adenosine deaminase (ADA) gene and that this site may play a role in ADA gene expression. Sequences involved in this process are not known precisely. To further define the template requirements for transcriptional arrest within exon 1 of the human ADA gene, various ADA templates were constructed and their abilities to confer transcriptional arrest were determined following injection into Xenopus oocytes. The exon 1 transcriptional arrest signal functioned downstream of several RNA polymerase II promoters and an RNA polymerase II promoter, implying that the transcriptional arrest site in exon 1 of the ADA gene is promoter independent. They identified a 43-bp DNA fragment which functions as a transcriptional arrest signal. Additional studies showed that the transcriptional arrest site functioned only in the naturally occurring orientation. Therefore, they have identified a 43-bp DNA fragment which functions as a transcriptional arrest signal in an orientation-dependent and promoter-independent manner. On the basis of the authors findings, they hypothesize that tissue-specific expression of the ADA gene is governed by factors that function as antiterminators to promote transcriptional readthrough of the exon 1 transcriptional arrest site.

  9. Correcting Transcription Factor Gene Sets for Copy Number and Promoter Methylation Variations

    PubMed Central

    Rathi, Komal S.; Gaykalova, Daria A.; Hennesey, Patrick; Califano, Joseph A.; Ochs, Michael F.

    2014-01-01

    Gene set analysis provides a method to generate statistical inferences across sets of linked genes, primarily using high-throughput expression data. Common gene sets include biological pathways, operons, and targets of transcriptional regulators. In higher eukaryotes, especially when dealing with diseases with strong genetic and epigenetic components such as cancer, copy number loss and gene silencing through promoter methylation can eliminate the possibility that a gene is transcribed. This, in turn, can adversely affect the estimation of transcription factor or pathway activity from a set of target genes, since some of the targets may not be responsive to transcriptional regulation. Here we introduce a simple filtering approach that removes genes from consideration if they show copy number loss or promoter methylation and demonstrate the improvement in inference of transcription factor activity in a simulated data set based on the background expression observed in normal head and neck tissue. PMID:25195578

  10. Correcting transcription factor gene sets for copy number and promoter methylation variations.

    PubMed

    Rathi, Komal S; Gaykalova, Daria A; Hennessey, Patrick; Califano, Joseph A; Ochs, Michael F

    2014-09-01

    Gene set analysis provides a method to generate statistical inferences across sets of linked genes, primarily using high-throughput expression data. Common gene sets include biological pathways, operons, and targets of transcriptional regulators. In higher eukaryotes, especially when dealing with diseases with strong genetic and epigenetic components such as cancer, copy number loss and gene silencing through promoter methylation can eliminate the possibility that a gene is transcribed. This, in turn, can adversely affect the estimation of transcription factor or pathway activity from a set of target genes, as some of the targets may not be responsive to transcriptional regulation. Here we introduce a simple filtering approach that removes genes from consideration if they show copy number loss or promoter methylation, and demonstrate the improvement in inference of transcription factor activity in a simulated dataset based on the background expression observed in normal head and neck tissue.

  11. The effects of transcription on the nucleosome structure of four Dictyostelium genes.

    PubMed Central

    Pavlovic, J; Banz, E; Parish, R W

    1989-01-01

    Micrococcal nuclease digestion of Dictyostelium discoideum nuclei from various developmental stages was used to investigate transcription-related changes in the chromatin structure of the coding region of four genes. Gene activity was determined by Northern blotting and nuclear run on experiments. During strong transcription of the developmentally regulated cysteine proteinase I gene, a smear superimposed on a nucleosomal ladder was observed, indicating perturbation of nucleosomal structure was occurring. However, two other developmentally regulated genes, discoidin I and pSC253, showed only slight nucleosome disruption during high levels of transcription. The chromatin structure of a fourth gene (pCZ22) was disrupted throughout development, even at those stages where transcription was greatly reduced. We suggest that although nucleosome structure can be transiently perturbed by the passage of the transcription complex in vivo, the degree of perturbation and the speed with which nucleosomes reassemble is also influenced by the DNA sequence. Images PMID:2704621

  12. Assessment of reference genes for reliable analysis of gene transcription by RT-qPCR in ovine leukocytes.

    PubMed

    Mahakapuge, T A N; Scheerlinck, J-P Y; Rojas, C A Alvarez; Every, A L; Hagen, J

    2016-03-01

    With the availability of genetic sequencing data, quantitative reverse transcription PCR (RT-qPCR) is increasingly being used for the quantification of gene transcription across species. Too often there is little regard to the selection of reference genes and the impact that a poor choice has on data interpretation. Indeed, RT-qPCR provides a snapshot of relative gene transcription at a given time-point, and hence is highly dependent on the stability of the transcription of the reference gene(s). Using ovine efferent lymph cells and peripheral blood mono-nuclear cells (PBMCs), the two most frequently used leukocytes in immunological studies, we have compared the stability of transcription of the most commonly used ovine reference genes: YWHAZ, RPL-13A, PGK1, B2M, GAPDH, HPRT, SDHA and ACTB. Using established algorithms for reference gene normalization "geNorm" and "Norm Finder", PGK1, GAPDH and YWHAZ were deemed the most stably transcribed genes for efferent leukocytes and PGK1, YWHAZ and SDHA were optimal in PBMCs. These genes should therefore be considered for accurate and reproducible RT-qPCR data analysis of gene transcription in sheep.

  13. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity

    PubMed Central

    Ahmed, Afsar U.; Williams, Bryan R. G.; Hannigan, Gregory E.

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  14. Transcriptional regulation of the Drosophila glial gene repo.

    PubMed

    Lee, Bruce P; Jones, Bradley W

    2005-06-01

    reversed polarity (repo) is a putative target gene of glial cells missing (gcm), the primary regulator of glial cell fate in Drosophila. Transient expression of Gcm is followed by maintained expression of repo. Multiple Gcm binding sites are found in repo upstream DNA. However, while repo is expressed in Gcm positive glia, it is not expressed in Gcm positive hemocytes. These observations suggest factors in addition to Gcm are required for repo expression. Here we have undertaken an analysis of the cis-regulatory DNA elements of repo using lacZ reporter activity in transgenic embryos. We have found that a 4.2 kb DNA region upstream of the repo start site drives the wild-type repo expression pattern. We show that expression is dependent on multiple Gcm binding sites. By ectopically expressing Repo, we show that Repo can regulate its own enhancer. Finally, by systematically analyzing fragments of repo upstream DNA, we show that expression is dependent on multiple elements that are responsible for activity in subsets of glia, as well as repressing inappropriate expression in the epidermis. Our results suggest that Gcm acts synergistically with other factors to control repo transcription in glial cells.

  15. [Association of schizophrenia with variations in genes encoding transcription factors].

    PubMed

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  16. VEGF Gene Expression in Adult Human Thymus Fat: A Correlative Study with Hypoxic Induced Factor and Cyclooxigenase-2

    PubMed Central

    Tinahones, Francisco; Salas, Julian; Mayas, María Dolores; Ruiz-Villalba, Adrian; Macias-Gonzalez, Manuel; Garrido-Sanchez, Lourdes; DeMora, Manuel; Moreno-Santos, Inmaculada; Bernal, Rosa; Cardona, Fernando; Bekay, Rajaa El

    2009-01-01

    It is well known that the adult human thymus degenerates into fat tissue; however, it has never been considered as a potential source of angiogenic factors. Recently, we have described that this fat (TAT) produces angiogenic factors and induces human endothelial cell proliferation and migration, indicating its potential angiogenic properties. Design Adult thymus fat and subcutaneous adipose tissue specimens were obtained from 28 patients undergoing cardiac surgery, making this tissue readily available as a prime source of adipose tissue. We focused our investigation on determining VEGF gene expression and characterizing the different genes, mediators of inflammation and adipogenesis, and which are known to play a relevant role in angiogenesis regulation. Results We found that VEGF-A was the isoform most expressed in TAT. This expression was accompanied by an upregulation of HIF-1α, COX-2 and HO-1 proteins, and by increased HIF-1 DNA binding activity, compared to SAT. Furthermore, we observed that TAT contains a high percentage of mature adipocytes, 0.25% of macrophage cells, 15% of endothelial cells and a very low percentage of thymocyte cells, suggesting the cellular variability of TAT, which could explain the differences in gene expression observed in TAT. Subsequently, we showed that the expression of genes known as adipogenic mediators, including PPARγ1/γ2, FABP-4 and adiponectin was similar in both TAT and SAT. Moreover the expression of these latter genes presented a significantly positive correlation with VEGF, suggesting the potential association between VEGF and the generation of adipose tissue in adult thymus. Conclusion Here we suggest that this fat has a potential angiogenic function related to ongoing adipogenesis, which substitutes immune functions within the adult thymus. The expression of VEGF seems to be associated with COX-2, HO-1 and adipogenesis related genes, suggesting the importance that this new fat has acquired in research in relation to

  17. Transcriptional and post-transcriptional control of PHO8 expression by PHO regulatory genes in Saccharomyces cerevisiae.

    PubMed Central

    Kaneko, Y; Tamai, Y; Toh-e, A; Oshima, Y

    1985-01-01

    A DNA fragment bearing the PHO8 gene, which encodes repressible alkaline phosphatase of Saccharomyces cerevisiae, was cloned. Northern hybridizations with the PHO8 DNA as probe indicated that the PHO8 transcript is 1.8 kilobases in length and is more abundant in cells grown in low-phosphate medium than in high-phosphate medium. The pho9 mutant, whose phenotype is defective in the activity of repressible alkaline phosphatase, produced as much of the PHO8 transcript as did the PHO9+ cells. Hence, the PHO9 product should act at the post-transcriptional level. The pho4 mutant could not derepress the PHO8 transcript, whereas the pho80 mutant could, irrespective of the amount of Pi in the medium, as has been suggested by genetic study. Images PMID:2984552

  18. Nested transcripts of gap junction gene have distinct expression patterns.

    PubMed

    Zhang, Z; Curtin, K D; Sun, Y A; Wyman, R J

    1999-09-05

    The shaking B locus (shakB, or Passover) codes for structural molecules of gap junctions in Drosophila. This report describes the complex set of transcripts from the shakB locus. A nested set of five transcripts is described. The transcripts share 3' exons, but each has its own 5' exon. The transcripts are arrayed as a series in the genomic DNA stretching over 60 kb. The 5' end of each successive transcript lies further proximal on the chromosome. Each new transcript shares all the 3' exons with the one preceding it, but adds one or two more 5' exons. The different transcripts are expressed in a wide variety of locations in the nervous system and in non-neural tissues. Some tissues express more than one transcript, and the expression pattern of each is developmentally regulated. Within the adult central nervous system (CNS), these transcripts have an expression pattern that is restricted to the giant fiber system (GFS). The GFS is a small set of neurons which mediates the visually induced escape jump. shakB is required for function of the GFS electrical synapses. The transcript previously defined as active in the giant fiber is not, in fact, expressed in that cell. Instead, we find that another transcript, shakB(N3), and perhaps shakB(N4) as well, is expressed in the GFS; this transcript is not expressed elsewhere in the adult CNS. Two other transcripts, shakB(N1) and shakB(N2), are expressed in the optic lamina but not elsewhere in the CNS. This expression pattern explains the neurophysiological and behavioral defects in escape exhibited in mutants of shakB.

  19. DNA methylation profiling of transcription factor genes in normal lymphocyte development and lymphomas.

    PubMed

    Ivascu, Claudia; Wasserkort, Reinhold; Lesche, Ralf; Dong, Jun; Stein, Harald; Thiel, Andreas; Eckhardt, Florian

    2007-01-01

    Transcription factors play a crucial role during hematopoiesis by orchestrating lineage commitment and determining cellular fate. Although tight regulation of transcription factor expression appears to be essential, little is known about the epigenetic mechanisms involved in transcription factor gene regulation. We have analyzed DNA methylation profiles of 13 key transcription factor genes in primary cells of the hematopoietic cascade, lymphoma cell lines and lymph node biopsies of diffuse large B-cell- and T-cell-non-Hodgkin lymphoma patients. Several of the transcription factor genes (SPI1, GATA3, TCF-7, Etv5, c-maf and TBX21) are differentially methylated in specific cell lineages and stages of the hematopoietic cascade. For some genes, such as SPI1, Etv5 and Eomes, we found an inverse correlation between the methylation of the 5' untranslated region and expression of the associated gene suggesting that these genes are regulated by DNA methylation. Differential methylation is not limited to cells of the healthy hematopoietic cascade, as we observed aberrant methylation of c-maf, TCF7, Eomes and SPI1 in diffuse large B-cell lymphomas. Our results suggest that epigenetic remodelling of transcription factor genes is a frequent mechanism during hematopoietic development. Aberrant methylation of transcription factor genes is frequently observed in diffuse large B-cell lymphomas and might have a functional role during tumorigenesis.

  20. SUMO functions in constitutive transcription and during activation of inducible genes in yeast.

    PubMed

    Rosonina, Emanuel; Duncan, Sarah M; Manley, James L

    2010-06-15

    Transcription factors represent one of the largest groups of proteins regulated by SUMO (small ubiquitin-like modifier) modification, and their sumoylation is usually associated with transcriptional repression. To investigate whether sumoylation plays a general role in regulating transcription in yeast, we determined the occupancy of sumoylated proteins at a variety of genes by chromatin immunoprecipitation (ChIP) using an antibody that recognizes the yeast SUMO peptide. Surprisingly, we detected sumoylated proteins at all constitutively transcribed genes tested but not at repressed genes. Ubc9, the SUMO conjugation enzyme, was not present on these genes, but its inactivation reduced SUMO at the constitutive promoters and modestly decreased RNA polymerase II levels. In contrast, activation of the inducible GAL1, STL1, and ARG1 genes caused not only a striking accumulation of SUMO at all three promoter regions, but also recruitment of Ubc9, indicating that gene activation involves sumoylation of promoter-bound factors. However, Ubc9 inactivation, while reducing sumoylation at the induced promoters, paradoxically resulted in increased transcription. Providing an explanation for this, the reduced sumoylation impaired the cell's ability to appropriately shut off transcription of the induced ARG1 gene, indicating that SUMO can facilitate transcriptional silencing. Our findings thus establish unexpected roles for sumoylation in both constitutive and activated transcription, and provide a novel mechanism for regulating gene expression.

  1. Early-late genes of the ecdysone cascade as models for transcriptional studies

    PubMed Central

    Mazina, Marina Yu; Nikolenko, Julia V; Fursova, Nadezda A; Nedil'ko, Petr N; Krasnov, Aleksey N; Vorobyeva, Nadezhda E

    2015-01-01

    The DHR3 and Hr4 early-late genes of the ecdysone cascade are described as models for transcriptional studies in Drosophila cells. In a set of experiments, it became clear that these genes are a convenient and versatile system for research into the physiological conditions upon 20-hydroxyecdysone induction. DHR3 and Hr4 gene transcription is characterized by fast activation kinetics, which enables transcriptional studies without the influence of indirect effects. A limited number of activated genes (only 73 genes are induced one hour after treatment) promote the selectivity of transcriptional studies via 20-hydroxyecdysone induction. DHR3 and Hr4 gene expression is dose dependent, is completely controlled by the hormone titer and decreases within hours of 20-hydroxyecdysone withdrawal. The DHR3 and Hr4 gene promoters become functional within 20 minutes after induction, which makes them useful tools for investigation if the early activation process. Their transcription is controlled by the RNA polymerase II pausing mechanism, which is widespread in the genome of Drosophila melanogaster but is still underinvestigated. Uniform expression activation of the DHR3 and Hr4 genes in a cell population was confirmed at both the RNA and protein levels. Homogeneity of the transcription response makes DHR3/Hr4 system valuable for investigation of the protein dynamics during transcription induction. PMID:26506480

  2. Hypoxic repression of CYP7A1 through a HIF-1α- and SHP-independent mechanism

    PubMed Central

    Moon, Yunwon; Park, Bongju; Park, Hyunsung

    2016-01-01

    Liver cells experience hypoxic stress when drug-metabolizing enzymes excessively consume O2 for hydroxylation. Hypoxic stress changes the transcription of several genes by activating a heterodimeric transcription factor called hypoxia-inducible factor-1α/β (HIF-1α/β). We found that hypoxic stress (0.1% O2) decreased the expression of cytochrome P450 7A1 (CYP7A1), a rate-limiting enzyme involved in bile acid biosynthesis. Chenodeoxycholic acid (CDCA), a major component of bile acids, represses CYP7A1 by activating a transcriptional repressor named small heterodimer partner (SHP). We observed that hypoxia decreased the levels of both CDCA and SHP, suggesting that hypoxia repressed CYP7A1 without inducing SHP. The finding that overexpression of HIF-1α increased the activity of the CYP7A1 promoter suggested that hypoxia decreased the expression of CYP7A1 in a HIF-1-independent manner. Thus, the results of this study suggested that hypoxia decreased the activity of CYP7A1 by limiting its substrate O2, and by decreasing the transcription of CYP7A1. [BMB Reports 2016; 49(3): 173-178] PMID:26521940

  3. Hypoxic repression of CYP7A1 through a HIF-1α- and SHP-independent mechanism.

    PubMed

    Moon, Yunwon; Park, Bongju; Park, Hyunsung

    2016-03-01

    Liver cells experience hypoxic stress when drug-metabolizing enzymes excessively consume O2 for hydroxylation. Hypoxic stress changes the transcription of several genes by activating a heterodimeric transcription factor called hypoxia-inducible factor- 1α/β (HIF-1α/β). We found that hypoxic stress (0.1% O2) decreased the expression of cytochrome P450 7A1 (CYP7A1), a rate-limiting enzyme involved in bile acid biosynthesis. Chenodeoxycholic acid (CDCA), a major component of bile acids, represses CYP7A1 by activating a transcriptional repressor named small heterodimer partner (SHP). We observed that hypoxia decreased the levels of both CDCA and SHP, suggesting that hypoxia repressed CYP7A1 without inducing SHP. The finding that overexpression of HIF-1α increased the activity of the CYP7A1 promoter suggested that hypoxia decreased the expression of CYP7A1 in a HIF-1-independent manner. Thus, the results of this study suggested that hypoxia decreased the activity of CYP7A1 by limiting its substrate O2, and by decreasing the transcription of CYP7A1. [BMB Reports 2016; 49(3): 173-178].

  4. Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells

    PubMed Central

    Sigova, Alla A.; Mullen, Alan C.; Molinie, Benoit; Gupta, Sumeet; Orlando, David A.; Guenther, Matthew G.; Almada, Albert E.; Lin, Charles; Sharp, Phillip A.; Giallourakis, Cosmas C.; Young, Richard A.

    2013-01-01

    Many long noncoding RNA (lncRNA) species have been identified in mammalian cells, but the genomic origin and regulation of these molecules in individual cell types is poorly understood. We have generated catalogs of lncRNA species expressed in human and murine embryonic stem cells and mapped their genomic origin. A surprisingly large fraction of these transcripts (>60%) originate from divergent transcription at promoters of active protein-coding genes. The divergently transcribed lncRNA/mRNA gene pairs exhibit coordinated changes in transcription when embryonic stem cells are differentiated into endoderm. Our results reveal that transcription of most lncRNA genes is coordinated with transcription of protein-coding genes. PMID:23382218

  5. A genome-wide view of transcription factor gene diversity in chordate evolution: less gene loss in amphioxus?

    PubMed

    Paps, Jordi; Holland, Peter W H; Shimeld, Sebastian M

    2012-03-01

    Previous studies of gene diversity in the homeobox superclass have shown that the Florida amphioxus Branchiostoma floridae has undergone remarkably little gene family loss. Here we use a combined BLAST and HMM search strategy to assess the family level diversity of four other transcription factor superclasses: the Paired/Pax genes, Tbx genes, Fox genes and Sox genes. We apply this across genomes from five chordate taxa, including B. floridae and Ciona intestinalis, plus two outgroup taxa. Our results show scattered gene family loss. However, as also found for homeobox genes, B. floridae has retained all ancient Pax, Tbx, Fox and Sox gene families that were present in the common ancestor of living chordates. We conclude that, at least in terms of transcription factor gene complexity, the genome of amphioxus has experienced remarkable stasis compared to the genomes of other chordates.

  6. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms.

  7. Transcriptional activation of Xenopus class III genes in chromatin isolated from sperm and somatic nuclei.

    PubMed Central

    Wolffe, A P

    1989-01-01

    Xenopus sperm chromatin lacks class III transcription complexes and somatic histone H1. Inactive class III genes in sperm chromatin are easily programmed with transcription complexes de novo and transcribed in Xenopus oocyte nuclear extract. In contrast, repressed class III genes in somatic chromatin are not transcribed in the oocyte nuclear extract. Class III genes that are initially inactive or repressed in both types of chromatin can be efficiently transcribed in a cell free preparation of Xenopus eggs. Chromatin mediated repression of class III genes in somatic nuclei is reversible in Xenopus egg extract, but not in the oocyte nuclear extract. Any inhibition of transcription attributed to chromatin assembly onto a gene, will therefore depend on the extract in which transcription is assayed. Images PMID:2915929

  8. Trypanosoma brucei: Enrichment by UV of intergenic transcripts from the variable surface glycoprotein gene expression site

    SciTech Connect

    Coquelet, H.; Tebabi, P.; Pays, A.; Steinert, M.; Pays, E. )

    1989-09-01

    The expression site for the variable surface glycoprotein (VSG) gene AnTat 1.3A of Trypanosoma brucei is 45 kilobases long and encompasses seven expression site-associated genes (ESAGs). After UV irradiation, several large transcripts from the putative promoter region were strongly enriched. We report that one such major transcript starts near the poly(A) addition site of the first gene (ESAG 7), spans the intergenic region, and extends to the poly(A) addition site of the second gene (ESAG 6), thus bypassing the normal 3' splice site of the ESAG 6 mRNA. Since this transcript is spliced, we conclude that UV irradiation does not inhibit splicing but stabilizes unstable processing products. This demonstrates that at least some intergenic regions of the VSG gene expression site are continuously transcribed in accordance with a polycistronic transcription model.

  9. Identification of sequences regulating the transcription of a Dictyostelium gene selectively expressed in prespore cells.

    PubMed Central

    Early, A E; Williams, J G

    1989-01-01

    There has been considerable debate about the relative contributions of transcriptional and post-transcriptional mechanisms to the regulation of prespore gene expression in Dictyostelium. We have determined the DNA sequence upstream of D19, the Dictyostelium gene encoding PsA, a prespore-specific, cell surface protein of unknown function. Our analysis of gene fusions, in which D19 upstream sequences are placed adjacent to a heterologous reporter gene, indicates that transcriptional signals alone are sufficient for the correct temporal and cell-type specific expression of this gene. We also show that the 5' and 3' boundaries of the minimal sequences necessary for correct developmental regulation lie within the region 338 to 122 nucleotides upstream of the start site of transcription but that flanking sequences seem to be necessary for optimal expression. Images PMID:2550894

  10. Inferring biological functions and associated transcriptional regulators using gene set expression coherence analysis

    PubMed Central

    Kim, Tae-Min; Chung, Yeun-Jun; Rhyu, Mun-Gan; Ho Jung, Myeong

    2007-01-01

    Background Gene clustering has been widely used to group genes with similar expression pattern in microarray data analysis. Subsequent enrichment analysis using predefined gene sets can provide clues on which functional themes or regulatory sequence motifs are associated with individual gene clusters. In spite of the potential utility, gene clustering and enrichment analysis have been used in separate platforms, thus, the development of integrative algorithm linking both methods is highly challenging. Results In this study, we propose an algorithm for discovery of molecular functions and elucidation of transcriptional logics using two kinds of gene information, functional and regulatory motif gene sets. The algorithm, termed gene set expression coherence analysis first selects functional gene sets with significantly high expression coherences. Those candidate gene sets are further processed into a number of functionally related themes or functional clusters according to the expression similarities. Each functional cluster is then, investigated for the enrichment of transcriptional regulatory motifs using modified gene set enrichment analysis and regulatory motif gene sets. The method was tested for two publicly available expression profiles representing murine myogenesis and erythropoiesis. For respective profiles, our algorithm identified myocyte- and erythrocyte-related molecular functions, along with the putative transcriptional regulators for the corresponding molecular functions. Conclusion As an integrative and comprehensive method for the analysis of large-scaled gene expression profiles, our method is able to generate a set of testable hypotheses: the transcriptional regulator X regulates function Y under cellular condition Z. GSECA algorithm is implemented into freely available software package. PMID:18021416

  11. Mechanistic basis for transcriptional bursting of ribosomal genes in E. coli

    NASA Astrophysics Data System (ADS)

    Choubey, Sandeep; Sanchez, Alvaro; Kondev, Jane

    2012-02-01

    Upon adding more ribosomal genes to the E. coli cell, it adjusts the overall transcription of these genes by reducing the average transcription rate per gene, so as to keep constant the level of ribosomal RNA in the cell. It was observed that this reduction in the average transcription level per gene is accompanied by the generation of transcriptional bursts. The biophysical mechanism responsible for this type of transcriptional control is not yet known. We consider three possible mechanisms suggested in the literature: proximal pausing by RNA polymerase, cooperative recruitment of RNA polymerase by DNA supercoiling, and competition between RNA polymerase and a transcription factor for binding to regulatory DNA. We compute the expected statistical properties of transcription initiation for each one of these models,and compare our predictions with published distributions of distances between the polymerases transcribing the ribosomal genes, obtained from electron micrographs.We use this data to estimate the rates of transcription initiation, which are found to be in good agreement with independent measurements. We also show that the three mechanisms considered here can be discriminated by comparing their predictions for the mean and the variance of interpolymerase distances.

  12. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  13. Honey dilution impact on in vitro wound healing: Normoxic and hypoxic condition.

    PubMed

    Chaudhary, Amrita; Bag, Swarnendu; Barui, Ananya; Banerjee, Provas; Chatterjee, Jyotirmoy

    2015-01-01

    Honey is known as a popular healing agent against tropical infections and wounds. However, the effects of honey dilutions on keratinocyte (HaCaT) wound healing under hypoxic condition is still not explored. In this study, we examined whether honey dilution have wound healing potential under hypoxic stress. The antioxidant potential and healing efficacy of honey dilution on in vitro wound of human epidermal keratinocyte (HaCaT cells) under hypoxia (3% O2 ), and normoxia is explored by nitro blue tetrazolium assay. The cell survival % quantified by MTT assay to select four honey dilutions like 10, 1, 0.1, and 0.01 v/v% and the changes in cellular function was observed microscopically. Further, the cell proliferation, migration, cell-cell adhesion, and relevant gene expression were studied by flow cytometry, migration/scratch assay, immunocytochemistry, and reverse transcription-polymerase chain reaction, respectively. The expression pattern of cardinal molecular features viz. E-cadherin, cytoskeletal protein F-actin, p63, and hypoxia marker Hif 1α were examined. Honey dilution in 0.1% v/v combat wound healing limitations in vitro under normoxia and hypoxia (3%). Its wound healing potential was quantified by immunocytochemistry and real-time PCR for the associated molecular features that were responsible for cell proliferation and migration. Our data showed that honey dilution can be effective in hypoxic wound healing. Additionally, it reduced superoxide generation and supplied favorable bioambience for cell proliferation, migration, and differentiation during hypoxic wound healing. These findings may reveal the importance of honey as an alternative and cost effective therapeutic natural product for wound healing in hypoxic condition.

  14. Methoprene-tolerant 1 regulates gene transcription to maintain insect larval status.

    PubMed

    Zhao, Wen-Li; Liu, Chun-Yan; Liu, Wen; Wang, Di; Wang, Jin-Xing; Zhao, Xiao-Fan

    2014-08-01

    Insect molting and metamorphosis are regulated by two hormones: 20-hydroxyecdysone (20E) and juvenile hormone (JH). The hormone 20E regulates gene transcription via the nuclear receptor EcR to promote metamorphosis, whereas JH regulates gene transcription via its intracellular receptor methoprene-tolerant (Met) to prevent larval-pupal transition. However, the function and mechanism of Met in various insect developments are not well understood. We propose that Met1 plays a key role in maintaining larval status not only by promoting JH-responsive gene transcription but also by repressing 20E-responsive gene transcription in the Lepidopteran insect Helicoverpa armigera. Met1 protein is increased during feeding stage and decreased during molting and metamorphic stages. Met1 is upregulated by JH III and a low concentration of 20E independently, but is downregulated by a high concentration of 20E. Knockdown of Met1 in larvae causes precocious pupation, decrease in JH pathway gene expression, and increase in 20E pathway gene expression. Met1 interacts with heat shock protein 90 and binds to JH response element to regulate Krüppel homolog 1 transcription in JH III induction. Met1 interacts with ultraspiracle protein 1 (USP1) to repress 20E transcription complex EcRB1/USP1 formation and binding to ecdysone response element. These data indicate that JH via Met1 regulates JH pathway gene expression and represses 20E pathway gene expression to maintain the larval status.

  15. Intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions.

    PubMed

    Leister, Dario; Wang, Xi; Haberer, Georg; Mayer, Klaus F X; Kleine, Tatjana

    2011-09-01

    Genes for mitochondrial and chloroplast proteins are distributed between the nuclear and organellar genomes. Organelle biogenesis and metabolism, therefore, require appropriate coordination of gene expression in the different compartments to ensure efficient synthesis of essential multiprotein complexes of mixed genetic origin. Whereas organelle-to-nucleus signaling influences nuclear gene expression at the transcriptional level, organellar gene expression (OGE) is thought to be primarily regulated posttranscriptionally. Here, we show that intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions. Nearly 1,300 ATH1 microarray-based transcriptional profiles of nuclear and organellar genes for mitochondrial and chloroplast proteins in the model plant Arabidopsis (Arabidopsis thaliana) were analyzed. The activity of genes involved in organellar energy production (OEP) or OGE in each of the organelles and in the nucleus is highly coordinated. Intracompartmental networks that link the OEP and OGE gene sets serve to synchronize the expression of nucleus- and organelle-encoded proteins. At a higher regulatory level, coexpression of organellar and nuclear OEP/OGE genes typically modulates chloroplast functions but affects mitochondria only when chloroplast functions are perturbed. Under conditions that induce energy shortage, the intercompartmental coregulation of photosynthesis genes can even override intracompartmental networks. We conclude that dynamic intracompartmental and intercompartmental transcriptional networks for OEP and OGE genes adjust the activity of organelles in response to the cellular energy state and environmental stresses, and we identify candidate cis-elements involved in the transcriptional coregulation of nuclear genes. Regarding the transcriptional regulation of chloroplast genes, novel tentative target genes of σ factors are identified.

  16. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    PubMed Central

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  17. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  18. Identifying Novel Transcriptional and Epigenetic Features of Nuclear Lamina-associated Genes.

    PubMed

    Wu, Feinan; Yao, Jie

    2017-12-01

    Because a large portion of the mammalian genome is associated with the nuclear lamina (NL), it is interesting to study how native genes resided there are transcribed and regulated. In this study, we report unique transcriptional and epigenetic features of nearly 3,500 NL-associated genes (NL genes). Promoter regions of active NL genes are often excluded from NL-association, suggesting that NL-promoter interactions may repress transcription. Active NL genes with higher RNA polymerase II (Pol II) recruitment levels tend to display Pol II promoter-proximal pausing, while Pol II recruitment and Pol II pausing are not correlated among non-NL genes. At the genome-wide scale, NL-association and H3K27me3 distinguishes two large gene classes with low transcriptional activities. Notably, NL-association is anti-correlated with both transcription and active histone mark levels among genes not significantly enriched with H3K9me3 or H3K27me3, suggesting that NL-association may represent a novel gene repression pathway. Interestingly, an NL gene subgroup is not significantly enriched with H3K9me3 or H3K27me3 and is transcribed at higher levels than the rest of NL genes. Furthermore, we identified distal enhancers associated with active NL genes and reported their epigenetic features.

  19. Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†

    PubMed Central

    Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane

    2010-01-01

    A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

  20. Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

    PubMed

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

  1. Differential transcription of multiple copies of a silk worm gene encoding tRNA(Gly1).

    PubMed

    Fournier, A; Taneja, R; Gopalkrishnan, R; Prudhomme, J C; Gopinathan, K P

    1993-12-08

    Ten different tRNA(Gly1) genes from the silk worm, Bombyx mori, have been cloned and characterized. These genes were transcribed in vitro in homologous nuclear extracts from the posterior silk gland (PSG) or nuclear extracts derived from the middle silk gland or ovarian tissues. Although the transcription levels were much higher in the PSG nuclear extracts, the transcriptional efficiency of the individual genes followed a similar pattern in all the extracts. Based on the levels of in vitro transcription, the ten tRNA(Gly1) genes could be divided into three groups, viz., those which were transcribed at very high levels (e.g., clone pR8), high to medium levels (e.g., pBmi1, pBmp1, pBmh1, pBmt1) and low to barely detectable levels (e.g., pBms1, pBmj1 and pBmk1). The coding sequences of all these tRNA genes being identical, the differential transcription suggested that the flanking sequences modulate their transcriptional efficiency. The presence of positive and negative regulatory elements in the 5' flanking regions of these genes was confirmed by transcription competition experiments. A positive element was present in the immediate upstream A+T-rich sequences in all the genes, but no consensus sequences correlating to the transcriptional status could be generated. The presence of negative elements on the other hand was indicated only in some of the genes and therefore may have a role in the differential transcription of these tRNA(Gly1) genes in vivo.

  2. Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

    PubMed Central

    Onnis, Barbara; Fer, Nicole; Rapisarda, Annamaria; Perez, Victor S.; Melillo, Giovanni

    2013-01-01

    IL-11 and its receptor, IL-11Ra, are expressed in human cancers; however, the functional role of IL-11 in tumor progression is not known. We found that IL11 is a hypoxia-inducible, VHL-regulated gene in human cancer cells and that expression of IL11 mRNA was dependent, at least in part, on HIF-1. A cooperative interaction between HIF-1 and AP-1 mediated transcriptional activation of the IL11 promoter. Additionally, we found that human cancer cells expressed a functional IL-11Ra subunit, which triggered signal transduction either by exogenous recombinant human IL-11 or by autocrine production of IL-11 in cells cultured under hypoxic conditions. Silencing of IL11 dramatically abrogated the ability of hypoxia to increase anchorage-independent growth and significantly reduced tumor growth in xenograft models. Notably, these results were phenocopied by partial knockdown of STAT1 in a human prostate cancer cell line (PC3), suggesting that this pathway may play an important role in mediating the effects of IL-11 under hypoxic conditions. In conclusion, these results identify IL11 as an oxygen- and VHL-regulated gene and provide evidence of a pathway “hijacked” by hypoxic cancer cells that may contribute to tumor progression. PMID:23549086

  3. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.

    1995-01-01

    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  4. CrBPF1 overexpression alters transcript levels of terpenoid indole alkaloid biosynthetic and regulatory genes

    PubMed Central

    Li, Chun Yao; Leopold, Alex L.; Sander, Guy W.; Shanks, Jacqueline V.; Zhao, Le; Gibson, Susan I.

    2015-01-01

    Terpenoid indole alkaloid (TIA) biosynthesis in Catharanthus roseus is a complex and highly regulated process. Understanding the biochemistry and regulation of the TIA pathway is of particular interest as it may allow the engineering of plants to accumulate higher levels of pharmaceutically important alkaloids. Toward this end, we generated a transgenic C. roseus hairy root line that overexpresses the CrBPF1 transcriptional activator under the control of a β-estradiol inducible promoter. CrBPF1 is a MYB-like protein that was previously postulated to help regulate the expression of the TIA biosynthetic gene STR. However, the role of CrBPF1 in regulation of the TIA and related pathways had not been previously characterized. In this study, transcriptional profiling revealed that overexpression of CrBPF1 results in increased transcript levels for genes from both the indole and terpenoid biosynthetic pathways that provide precursors for TIA biosynthesis, as well as for genes in the TIA biosynthetic pathway. In addition, overexpression of CrBPF1 causes increases in the transcript levels for 11 out of 13 genes postulated to act as transcriptional regulators of genes from the TIA and TIA feeder pathways. Interestingly, overexpression of CrBPF1 causes increased transcript levels for both TIA transcriptional activators and repressors. Despite the fact that CrBPF1 overexpression affects transcript levels of a large percentage of TIA biosynthetic and regulatory genes, CrBPF1 overexpression has only very modest effects on the levels of the TIA metabolites analyzed. This finding may be due, at least in part, to the up-regulation of both transcriptional activators and repressors in response to CrBPF1 overexpression, suggesting that CrBPF1 may serve as a “fine-tune” regulator for TIA biosynthesis, acting to help regulate the timing and amplitude of TIA gene expression. PMID:26483828

  5. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.

    PubMed

    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha

    2015-06-01

    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  6. Joint immobilization induced hypoxic and inflammatory conditions in rat knee joints.

    PubMed

    Yabe, Yutaka; Hagiwara, Yoshihiro; Suda, Hideaki; Ando, Akira; Onoda, Yoshito; Tsuchiya, Masahiro; Hatori, Kouki; Itoi, Eiji

    2013-01-01

    The purpose of this study was to examine the hypoxic and inflammatory conditions after immobilization in the joint capsule of rat knees. The unilateral knee joints of adult male rats were immobilized with an internal fixator (Im group) for 1 day, 3 days, and 1, 2, 4, 8, and 16 weeks. Sham-operated animals had holes drilled in the femur and tibia and screws inserted without a plate (control group). The number of cells and blood vessels in the capsule were histologically examined. The hypoxic condition in the capsule was histologically examined with a Hypoxyprobe™-1. The gene expressions related to the hypoxic (hypoxia inducible factor-1α, vascular endothelial growth factor, and fibroblast growth factor 2) and inflammatory conditions [interleukin-6 (IL-6), IL-1α, IL-1β, tumor necrosis factor-α, and tumor necrosis factor-β] were evaluated by quantitative reverse transcription polymerase chain reaction. The number of cells was unchanged at 1 day in the two groups; however, the number significantly increased at 3 days in the Im group. The number of blood vessels in the Im group gradually decreased. Strong immunostaining of Hypoxyprobe™-1 around the blood vessels was observed in the Im group. The gene expressions of hypoxia inducible factor-1α and fibroblast growth factor 2 were significantly higher in the Im group compared with those in the control group. The gene expressions of IL-6, IL-1α, IL-1β, and tumor necrosis factor-β were significantly higher in the Im group compared with those in the control group. These data indicated that joint immobilization induced hypoxic and inflammatory conditions in the joint capsule, which might be an initiating factor for joint contracture.

  7. The WRKY Transcription Factor WRKY71/EXB1 Controls Shoot Branching by Transcriptionally Regulating RAX Genes in Arabidopsis

    PubMed Central

    Guo, Dongshu; Zhang, Jinzhe; Wang, Xinlei; Han, Xiang; Wei, Baoye; Yu, Hao; Huang, Qingpei

    2015-01-01

    Plant shoot branching is pivotal for developmental plasticity and crop yield. The formation of branch meristems is regulated by several key transcription factors including REGULATOR OF AXILLARY MERISTEMS1 (RAX1), RAX2, and RAX3. However, the regulatory network of shoot branching is still largely unknown. Here, we report the identification of EXCESSIVE BRANCHES1 (EXB1), which affects axillary meristem (AM) initiation and bud activity. Overexpression of EXB1 in the gain-of-function mutant exb1-D leads to severe bushy and dwarf phenotypes, which result from excessive AM initiation and elevated bud activities. EXB1 encodes the WRKY transcription factor WRKY71, which has demonstrated transactivation activities. Disruption of WRKY71/EXB1 by chimeric repressor silencing technology leads to fewer branches, indicating that EXB1 plays important roles in the control of shoot branching. We demonstrate that EXB1 controls AM initiation by positively regulating the transcription of RAX1, RAX2, and RAX3. Disruption of the RAX genes partially rescues the branching phenotype caused by EXB1 overexpression. We further show that EXB1 also regulates auxin homeostasis in control of shoot branching. Our data demonstrate that EXB1 plays pivotal roles in shoot branching by regulating both transcription of RAX genes and auxin pathways. PMID:26578700

  8. Acetylation of RNA polymerase II regulates growth-factor-induced gene transcription in mammalian cells.

    PubMed

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S; Capra, John A; Schnölzer, Martina; Cole, Philip A; Geyer, Matthias; Bruneau, Benoit G; Adelman, Karen; Ott, Melanie

    2013-11-07

    Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes.

  9. VITELLOGENIN GENE TRANSCRIPTION AS AN INDICATOR OF EXPOSURE TO 17-ALPHA-ETHYNYLESTRADIOL IN FATHEAD MINNOWS

    EPA Science Inventory

    Environmentally persistent chemicals that functionally mimic estrogen are ubiquitous in surface waters and have been shown to effect reproductive health of species living in these habitats. Toxicant induced transcription of specific genes is a sensitive indicator of exposure and ...

  10. Transcriptional effects on double-strand break-induced gene conversion tracts.

    PubMed

    Weng, Y S; Xing, D; Clikeman, J A; Nickoloff, J A

    2000-10-16

    Transcription stimulates spontaneous homologous recombination, but prior studies have not investigated the effects of transcription on double-strand break (DSB)-induced recombination in yeast. We examined products of five ura3 direct repeat substrates in yeast using alleles that were transcribed at low or high levels. In each strain, recombination was stimulated by DSBs created in vivo at an HO site in one copy of ura3. Increasing transcription levels in donor or recipient alleles did not further stimulate DSB-induced recombination, nor did it alter the relative frequencies of conversion and deletion (pop-out) events. This result is consistent with the idea that transcription enhances spontaneous recombination by increasing initiation. Gene conversion tracts were measured using silent restriction fragment length polymorphisms (RFLPs) at approximately 100bp intervals. Transcription did not alter average tract lengths, but increased transcription in donor alleles increased both the frequency of promoter-proximal (5') unidirectional tracts and conversion of 5' markers. Increased transcription in recipient alleles increased the frequency of bidirectional tracts. We demonstrate that these effects are due to transcription per se, and not just transcription factor binding. These results suggest that transcription influences aspects of gene conversion after initiation, such as strand invasion and/or mismatch repair (MMR).

  11. The transcription factor SOX17 is involved in the transcriptional control of the uteroglobin gene in rabbit endometrium.

    PubMed

    Garcia, Carlos; Calvo, Enrique; Nieto, Antonio

    2007-10-15

    The transcription of the uteroglobin gene (ug) is induced by progesterone in the rabbit endometrium, primarily through the binding of the progesterone receptor to the distal region of the ug promoter. However, other transcription factors participate in the progesterone action. The proximal ug promoter contains several putative consensus sequences for the binding of various progesterone-dependent endometrial nuclear factors (Perez Martinez et al. [1996] Arch Biochem Biophys 333: 12-18), suggesting that several transcription factors might be implicated in the hormonal induction of ug. We report here that one of these progesterone-dependent factors specifically binds to the sequence CACAATG (-183/-177) of the rabbit ug promoter. This sequence (hereafter called element G') is very similar to the consensus sequence for binding of the SOX family of transcription factors. Mutation of the element G' reduced transcription from the ug promoter in transient expression experiments. The endometrial factor was purified and analyzed by nano-liquid chromatography and ion trap coupled mass spectrometry yielding two partial amino acid sequences corresponding to a region of SOX17 that is highly conserved inter-species. This identification was confirmed by immunological techniques using a specific anti-SOX17 antibody. In agreement with the above findings, overexpression of SOX17 in transfected endometrial cells increased transcription from the ug promoter. SOX17 gradually accumulated in the nucleus in vivo concomitant with the induction of ug expression by progesterone in the endometrium. Thus, these findings implicate, for the first time, SOX17 in the transcriptional control of rabbit ug.

  12. Transcriptional and post-transcriptional regulation of SPAST, the gene most frequently mutated in hereditary spastic paraplegia.

    PubMed

    Henson, Brian J; Zhu, Wan; Hardaway, Kelsey; Wetzel, Jaime L; Stefan, Mihaela; Albers, Kathryn M; Nicholls, Robert D

    2012-01-01

    Hereditary spastic paraplegias (HSPs) comprise a group of neurodegenerative disorders that are characterized by progressive spasticity of the lower extremities, due to axonal degeneration in the corticospinal motor tracts. HSPs are genetically heterogeneous and show autosomal dominant inheritance in ∼70-80% of cases, with additional cases being recessive or X-linked. The most common type of HSP is SPG4 with mutations in the SPAST gene, encoding spastin, which occurs in 40% of dominantly inherited cases and in ∼10% of sporadic cases. Both loss-of-function and dominant-negative mutation mechanisms have been described for SPG4, suggesting that precise or stoichiometric levels of spastin are necessary for biological function. Therefore, we hypothesized that regulatory mechanisms controlling expression of SPAST are important determinants of spastin biology, and if altered, could contribute to the development and progression of the disease. To examine the transcriptional and post-transcriptional regulation of SPAST, we used molecular phylogenetic methods to identify conserved sequences for putative transcription factor binding sites and miRNA targeting motifs in the SPAST promoter and 3'-UTR, respectively. By a variety of molecular methods, we demonstrate that SPAST transcription is positively regulated by NRF1 and SOX11. Furthermore, we show that miR-96 and miR-182 negatively regulate SPAST by effects on mRNA stability and protein level. These transcriptional and miRNA regulatory mechanisms provide new functional targets for mutation screening and therapeutic targeting in HSP.

  13. Transcriptional regulation of fucosyltransferase 1 gene expression in colon cancer cells.

    PubMed

    Taniuchi, Fumiko; Higai, Koji; Tanaka, Tomomi; Azuma, Yutaro; Matsumoto, Kojiro

    2013-01-01

    The α 1,2-fucosyltransferase I (FUT1) enzyme is important for the biosynthesis of H antigens, Lewis B, and Lewis Y. In this study, we clarified the transcriptional regulation of FUT1 in the DLD-1 colon cancer cell line, which has high expression of Lewis B and Lewis Y antigens, expresses the FUT1 gene, and shows α 1,2-fucosyltransferase (FUT) activity. 5'-rapid amplification of cDNA ends revealed a FUT1 transcriptional start site -10 nucleotides upstream of the site registered at NM_000148 in the DataBase of Human Transcription Start Sites (DBTSS). Using the dual luciferase assay, FUT1 gene expression was shown to be regulated at the region -91 to -81 nt to the transcriptional start site, which contains the Elk-1 binding site. Site-directed mutagenesis of this region revealed the Elk-1 binding site to be essential for FUT1 transcription. Furthermore, transfection of the dominant negative Elk-1 gene, and the chromatin immunoprecipitation (CHIp) assay, supported Elk-1-dependent transcriptional regulation of FUT1 gene expression in DLD-1 cells. These results suggest that a defined region in the 5'-flanking region of FUT1 is critical for FUT1 transcription and that constitutive gene expression of FUT1 is regulated by Elk-1 in DLD-1 cells.

  14. The transcription factor ultraspiracle influences honey bee social behavior and behavior-related gene expression.

    PubMed

    Ament, Seth A; Wang, Ying; Chen, Chieh-Chun; Blatti, Charles A; Hong, Feng; Liang, Zhengzheng S; Negre, Nicolas; White, Kevin P; Rodriguez-Zas, Sandra L; Mizzen, Craig A; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily "nursing" brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP-chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH- and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how "single gene effects" on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues.

  15. The Transcription Factor Ultraspiracle Influences Honey Bee Social Behavior and Behavior-Related Gene Expression

    PubMed Central

    Chen, Chieh-Chun; Blatti, Charles A.; Hong, Feng; Liang, Zhengzheng S.; Negre, Nicolas; White, Kevin P.; Rodriguez-Zas, Sandra L.; Mizzen, Craig A.; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E.

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily “nursing” brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP–chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH– and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how “single gene effects” on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues. PMID:22479195

  16. Changes in cell wall polysaccharide composition, gene transcription and alternative splicing in germinating barley embryos.

    PubMed

    Zhang, Qisen; Zhang, Xiaoqi; Pettolino, Filomena; Zhou, Gaofeng; Li, Chengdao

    2016-02-01

    Barley (Hordeum vulgare L.) seed germination initiates many important biological processes such as DNA, membrane and mitochondrial repairs. However, little is known on cell wall modifications in germinating embryos. We have investigated cell wall polysaccharide composition change, gene transcription and alternative splicing events in four barley varieties at 24h and 48 h germination. Cell wall components in germinating barley embryos changed rapidly, with increases in cellulose and (1,3)(1,4)-β-D-glucan (20-100%) within 24h, but decreases in heteroxylan and arabinan (3-50%). There were also significant changes in the levels of type I arabinogalactans and heteromannans. Alternative splicing played very important roles in cell wall modifications. At least 22 cell wall transcripts were detected to undergo either alternative 3' splicing, alternative 5' splicing or intron retention type of alternative splicing. These genes coded enzymes catalyzing synthesis and degradation of cellulose, heteroxylan, (1,3)(1,4)-β-D-glucan and other cell wall polymers. Furthermore, transcriptional regulation also played very important roles in cell wall modifications. Transcript levels of primary wall cellulase synthase, heteroxylan synthesizing and nucleotide sugar inter-conversion genes were very high in germinating embryos. At least 50 cell wall genes changed transcript levels significantly. Expression patterns of many cell wall genes coincided with changes in polysaccharide composition. Our data showed that cell wall polysaccharide metabolism was very active in germinating barley embryos, which was regulated at both transcriptional and post-transcriptional levels.

  17. Possible role of lysophosphatidic acid in rat model of hypoxic pulmonary vascular remodeling

    PubMed Central

    2014-01-01

    Abstract Pulmonary hypertension is characterized by cellular and structural changes in the vascular wall of pulmonary arteries. We hypothesized that lysophosphatidic acid (LPA), a bioactive lipid, is implicated in this vascular remodeling in a rat model of hypoxic pulmonary hypertension. Exposure of Wistar rats to 10% O2 for 3 weeks induced an increase in the mean serum levels of LPA, to 40.9 (log-detransformed standard deviations: 23.4–71.7) μM versus 21.6 (11.0–42.3) μM in a matched control animal group (P = 0.037). We also observed perivascular LPA immunohistochemical staining in lungs of hypoxic rats colocalized with the secreted lysophospholipase D autotaxin (ATX). Moreover, ATX colocalized with mast cell tryptase, suggesting implication of these cells in perivascular LPA production. Hypoxic rat lungs expressed more ATX transcripts (2.4-fold) and more transcripts of proteins implicated in cell migration: β2 integrin (1.74-fold), intracellular adhesion molecule 1 (ICAM-1; 1.84-fold), and αM integrin (2.70-fold). Serum from the hypoxic group of animals had significantly higher chemoattractant properties toward rat primary lung fibroblasts, and this increase in cell migration could be prevented by the LPA receptor 1 and 3 antagonists. LPA also increased adhesive properties of human pulmonary artery endothelial cells as well as those of human peripheral blood mononuclear cells, via the activation of LPA receptor 1 or 3 followed by the stimulation of gene expression of ICAM-1, β-1, E-selectin, and vascular cell adhesion molecule integrins. In conclusion, chronic hypoxia increases circulating and tissue levels of LPA, which might induce fibroblast migration and recruitment of mononuclear cells in pulmonary vasculature, both of which contribute to pulmonary vascular remodeling. PMID:25621161

  18. Phytoglobins Improve Hypoxic Root Growth by Alleviating Apical Meristem Cell Death1[OPEN

    PubMed Central

    Stasolla, Claudio

    2016-01-01

    Hypoxic root growth in maize (Zea mays) is influenced by the expression of phytoglobins (ZmPgbs). Relative to the wild type, suppression of ZmPgb1.1 or ZmPgb1.2 inhibits the growth of roots exposed to 4% oxygen, causing structural abnormalities in the root apical meristems. These effects were accompanied by increasing levels of reactive oxygen species (ROS), possibly through the transcriptional induction of four Respiratory Burst Oxidase Homologs. TUNEL-positive nuclei in meristematic cells indicated the involvement of programmed cell death (PCD) in the process. These cells also accumulated nitric oxide and stained heavily for ethylene biosynthetic transcripts. A sharp increase in the expression level of several 1-aminocyclopropane synthase (ZmAcs2, ZmAcs6, and ZmAcs7), 1-aminocyclopropane oxidase (Aco15, Aco20, Aco31, and Aco35), and ethylene-responsive (ZmErf2 and ZmEbf1) genes was observed in hypoxic ZmPgb-suppressing roots, which overproduced ethylene. Inhibiting ROS synthesis with diphenyleneiodonium or ethylene perception with 1-methylcyclopropene suppressed PCD, increased BAX inhibitor-1, an effective attenuator of the death programs in eukaryotes, and restored root growth. Hypoxic roots overexpressing ZmPgbs had the lowest level of ethylene and showed a reduction in ROS staining and TUNEL-positive nuclei in the meristematic cells. These roots retained functional meristems and exhibited the highest growth performance when subjected to hypoxic conditions. Collectively, these results suggest a novel function of Pgbs in protecting root apical meristems from hypoxia-induced PCD through mechanisms initiated by nitric oxide and mediated by ethylene via ROS. PMID:27702845

  19. Transcription of novel genes, including a gene linked to the mating-type locus, induced by Chlamydomonas fertilization.

    PubMed Central

    Ferris, P J; Goodenough, U W

    1987-01-01

    Six cDNA clones have been identified that are complementary to transcripts present in young zygotes of Chlamydomonas reinhardtii but absent from vegetative and gametic cells. Five early transcripts are synthesized within 5 to 10 min of fertilization; the sixth, late, transcript is not synthesized until 90 min following fertilization. Synthesis of both classes requires cell fusion between gametes. Cycloheximide fails to inhibit early mRNA synthesis, indicating that transcription factors must preexist in the gametes and be activated by cytoplasmic confluence. By contrast, cycloheximide blocks synthesis of the late transcript, suggesting that an early protein product(s) is required for expression of the late gene. Restriction fragment length polymorphism analysis of inter- and intraspecific genetic crosses demonstrates that one of the early genes is very tightly linked to the mating-type locus. Images PMID:3614194

  20. DAL82, a second gene required for induction of allantoin system gene transcription in Saccharomyces cerevisiae.

    PubMed Central

    Olive, M G; Daugherty, J R; Cooper, T G

    1991-01-01

    Several highly inducible enzyme activities are required for the degradation of allantoin in Saccharomyces cerevisiae. Induction of these pathway enzymes has been shown to be regulated at transcription, and response to inducer is lost in dal81 and dal82/durM mutants. The similar phenotypes generated by dal81 and dal82 mutations prompted the question of whether they were allelic. We demonstrated that the DAL81 and DAL82 loci are distinct, unlinked genes situated on chromosomes IX and XIV. DAL82 gene expression did not respond to induction by the allantoin pathway inducer or to nitrogen catabolite repression. Expression was also not significantly affected by mutation of the dal80 locus. From the nucleotide sequence of the DAL82 gene, we deduced that it encodes a protein with a mass of 29,079 Da that may possess the structural motifs expected of a regulatory protein. This protein was shown to be required for the function mediated by the cis-acting upstream induction sequence situated in the 5'-flanking regions of the inducible allantoin pathway genes. Images PMID:1898922

  1. Transcription termination between polo and snap, two closely spaced tandem genes of D. melanogaster.

    PubMed

    Henriques, Telmo; Ji, Zhe; Tan-Wong, Sue Mei; Carmo, Alexandre M; Tian, Bin; Proudfoot, Nicholas J; Moreira, Alexandra

    2012-01-01

    Transcription termination of RNA polymerase II between closely spaced genes is an important, though poorly understood, mechanism. This is true, in particular, in the Drosophila genome, where approximately 52% of tandem genes are separated by less than 1 kb. We show that a set of Drosophila tandem genes has a negative correlation of gene expression and display several molecular marks indicative of promoter pausing. We find that an intergenic spacing of 168 bp is sufficient for efficient transcription termination between the polo-snap tandem gene pair, by a mechanism that is independent of Pcf11 and Xrn2. In contrast, analysis of a tandem gene pair containing a longer intergenic region reveals that termination occurs farther downstream of the poly(A) signal and is, in this case, dependent on Pcf11 and Xrn2. For polo-snap, displacement of poised polymerase from the snap promoter by depletion of the initiation factor TFIIB results in an increase of polo transcriptional read-through. This suggests that poised polymerase is necessary for transcription termination. Interestingly, we observe that polo forms a TFIIB dependent gene loop between its promoter and terminator regions. Furthermore, in a plasmid containing the polo-snap locus, deletion of the polo promoter causes an increase in snap expression, as does deletion of polo poly(A) signals. Taken together, our results indicate that polo forms a gene loop and polo transcription termination occurs by an Xrn2 and Pcf11 independent mechanism that requires TFIIB.

  2. Checks and balances between cohesin and polycomb in gene silencing and transcription.

    PubMed

    Dorsett, Dale; Kassis, Judith A

    2014-06-02

    The cohesin protein complex was discovered for its roles in sister chromatid cohesion and segregation, and the Polycomb group (PcG) proteins for their roles in epigenetic gene silencing during development. Cohesin also controls gene transcription via multiple mechanisms. Genetic and molecular evidence from Drosophila argue that cohesin and the PRC1 PcG complex interact to control transcription of many active genes that are critical for development, and that via these interactions cohesin also controls the availability of PRC1 for gene silencing.

  3. Structures of Mycobacterium tuberculosis DosR and DosR-DNA Complex Involved in Gene Activation during Adaptation to Hypoxic Latency

    SciTech Connect

    Wisedchaisri, Goragot; Wu, Meiting; Rice, Adrian E; Roberts, David M; Sherman, David R; Hol, Wim G.J.

    2010-07-20

    On encountering low oxygen conditions, DosR activates the transcription of 47 genes, promoting long-term survival of Mycobacterium tuberculosis in a non-replicating state. Here, we report the crystal structures of the DosR C-terminal domain and its complex with a consensus DNA sequence of the hypoxia-induced gene promoter. The DosR C-terminal domain contains four {alpha}-helices and forms tetramers consisting of two dimers with non-intersecting dyads. In the DNA-bound structure, each DosR C-terminal domain in a dimer places its DNA-binding helix deep into the major groove, causing two bends in the DNA. DosR makes numerous protein-DNA base contacts using only three amino acid residues per subunit: Lys179, Lys182, and Asn183. The DosR tetramer is unique among response regulators with known structures.

  4. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

    PubMed Central

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  5. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  6. Genome-wide identification and characterization of reference genes with different transcript abundances for Streptomyces coelicolor

    PubMed Central

    Li, Shanshan; Wang, Weishan; Li, Xiao; Fan, Keqiang; Yang, Keqian

    2015-01-01

    The lack of reliable reference genes (RGs) in the genus Streptomyces hampers effort to obtain the precise data of transcript levels. To address this issue, we aimed to identify reliable RGs in the model organism Streptomyces coelicolor. A pool of potential RGs containing 1,471 genes was first identified by determining the intersection of genes with stable transcript levels from four time-series transcriptome microarray datasets of S. coelicolor M145 cultivated in different conditions. Then, following a strict rational selection scheme including homology analysis, disturbance analysis, function analysis and transcript abundance analysis, 13 candidates were selected from the 1,471 genes. Based on real-time quantitative reverse transcription PCR assays, SCO0710, SCO6185, SCO1544, SCO3183 and SCO4758 were identified as the top five genes with the most stable transcript levels among the 13 candidates. Further analyses showed these five genes also maintained stable transcript levels in different S. coelicolor strains, as well as in Streptomyces avermitilis MA-4680 and Streptomyces clavuligerus NRRL 3585, suggesting they could fulfill the requirements of accurate data normalization in streptomycetes. Moreover, the systematic strategy employed in this work could be used for reference in other microorganism to select reliable RGs. PMID:26527303

  7. Tandem transcription termination sites in the dnaN gene of Escherichia coli.

    PubMed

    Armengod, M E; García-Sogo, M; Pérez-Roger, I; Macián, F; Navarro-Aviñó, J P

    1991-10-15

    The dnaN gene of Escherichia coli encodes the beta-subunit of DNA polymerase III and maps between the dnaA and recF genes. We demonstrated previously that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. However, the recF gene has its own promoter region located in the middle of the dnaN structural gene. In this report, we use S1 mapping of mRNAs, transcriptional and translational fusions to the galK and lacZ genes, and in vitro mutagenesis to identify and characterize three tandem transcription termination sites responsible for transcriptional polarity in the dnaN-recF operon. These sites are located in the dnaN gene, downstream from the recF promoter region. Cumulatively, they terminate about 80% of the untranslated transcripts started at the recF promoters. As expected, they do not reduce transcription coming from the dnaN promoters unless dnaN translation was prematurely disrupted by the presence of a nonsense codon. The particular arrangement of regulatory elements (promoters and terminators) in the dnaN-recF region provides an exceptional in vivo system to confirm the latent termination site model of transcriptional polarity. In addition, our results contribute to the understanding of the complex regulation of the dnaA, dnaN, and recF genes. We propose that these three genes constitute an operon and that the terminators described in this work could be used to reduce expression of the distal genes of the operon under circumstances in which the dnaN translation happens to be slowed down.

  8. Identification of Gene Transcription Start Sites and Enhancers Responding to Pulmonary Carbon Nanotube Exposure in Vivo.

    PubMed

    Bornholdt, Jette; Saber, Anne Thoustrup; Lilje, Berit; Boyd, Mette; Jørgensen, Mette; Chen, Yun; Vitezic, Morana; Jacobsen, Nicklas Raun; Poulsen, Sarah Søs; Berthing, Trine; Bressendorff, Simon; Vitting-Seerup, Kristoffer; Andersson, Robin; Hougaard, Karin Sørig; Yauk, Carole L; Halappanavar, Sabina; Wallin, Håkan; Vogel, Ulla; Sandelin, Albin

    2017-03-31

    Increased use of nanomaterials in industry, medicine, and consumer products has raised concerns over their toxicity. To ensure safe use of nanomaterials, understanding their biological effects at the molecular level is crucial. In particular, the regulatory mechanisms responsible for the cascade of genes activated by nanomaterial exposure are not well-characterized. To this end, we profiled the genome-wide usage of gene transcription start sites and linked active enhancer regions in lungs of C57BL/6 mice 24 h after intratracheal instillation of a single dose of the multiwalled carbon nanotube (MWCNT) Mitsui-7. Our results revealed a massive gene regulatory response, where expression of key inflammatory genes (e.g., Csf3, Il24, and Fgf23) was increased >100-fold 24 h after Mitsui-7 exposure. Many of the Mitsui-7-responsive transcription start sites were alternative transcription start sites for known genes, and the number of alternative transcription start sites used in a given gene was correlated with overall Mitsui-7 response. Strikingly, genes that were up-regulated after Mitsui-7 exposure only through their main annotated transcription start site were linked to inflammatory and defense responses, while genes up-regulated only through alternative transcription start sites were functionally heterogeneous and not inflammation-associated. Furthermore, we identified almost 12 000 active enhancers, many of which were Mitsui-7-responsive, and we identified similarly responding putative target genes. Overall, our study provides the location and activity of Mitsui-7-induced enhancers and transcription start sites, providing a useful resource for targeted experiments elucidating the biological effects of nanomaterials and the identification of biomarkers for early detection of MWCNT-induced inflammation.

  9. Transcription Profiling and Mutation Detection of Soybean Homoeologous Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The soybean genome maintains numerous gene duplications, many of which are derived from ancient large-scale duplication. We are interested in exploring the evolutionary fate of duplicated genes and the extent to which gene duplication affects selectable trait variation. We are applying quantitative ...

  10. Towards a Quantitative Understanding of Single-Gene Transcription

    NASA Astrophysics Data System (ADS)

    O'Maoiléidigh, Dáibhid

    2008-03-01

    The transcription of the genetic information in DNA into RNA is the first step in protein synthesis. This process is highly regulated and is carried out by RNA polymerase (RNAP), a complex molecular motor. Here we discuss some of the consequences of a Brownian ratchet model of transcription, which incorporates internal structural degrees of freedom of RNAP and kinetic barriers to backtracking of RNAP resulting from steric clashes with co-transcriptionally folded RNA. This approach was previously used (a) to successfully predict sequence dependent positions of pauses during the elongation process [1,2]; (b) to study the behavior of a number of mutants of RNAP, with different elongation behaviors, believed to involve different internal motions of the enzyme [3]; and (c) to gain insight into the interpretation of single-molecule transcription elongation experiments [2]. The same model can be used to characterize the stability of the elongation complex at specific termination sequences, places along DNA where, with high probability, RNAP releases the RNA transcript and disengages from the template. Recent experimental results on termination reinforce a picture of the elongation complex as a flexible structure, not a rigid body [4]. In more general terms, some of the modeling to be presented raises fundamental issues related to ``model comparison'' and ``model selection,'' the problem of identifying and characterizing quantitative models on the basis of limited sets of experimental data [5]. [1] Tadigotla V. R., 'O Maoil'eidigh D., Sengupta A. M., Epshtein V., Ebright R. H., Nudler E., Ruckenstein A. E., Thermodynamic and Kinetic Modeling of Transcriptional Pausing. Proc Natl Acad Sci U S A,03:4439-4444 (2006). [2] D. 'O Maoil'eidigh, Ph.D. Thesis, Rutgers University, 2006 [3] Bar-Nahum, G., Epshtein, V., Ruckenstein, A. E., Rafikov, R., Mustaev, A. and Nudler E., A Ratchet Mechanism of Transcription Elongation and its Control. Cell, 120:183-193 (2005). [4] Epshtein, V

  11. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast.

    PubMed

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y; Brem, Rachel B

    2016-06-27

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1 Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1 Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them.

  12. Transcription factor co-localization patterns affect human cell type-specific gene expression

    PubMed Central

    2012-01-01

    Background Cellular development requires the precise control of gene expression states. Transcription factors are involved in this regulatory process through their combinatorial binding with DNA. Information about transcription factor binding sites can help determine which combinations of factors work together to regulate a gene, but it is unclear how far the binding data from one cell type can inform about regulation in other cell types. Results By integrating data on co-localized transcription factor binding sites in the K562 cell line with expression data across 38 distinct hematopoietic cell types, we developed regression models to describe the relationship between the expression of target genes and the transcription factors that co-localize nearby. With K562 binding sites identifying the predictors, the proportion of expression explained by the models is statistically significant only for monocytic cells (p-value< 0.001), which are closely related to K562. That is, cell type specific binding patterns are crucial for choosing the correct transcription factors for the model. Comparison of predictors obtained from binding sites in the GM12878 cell line with those from K562 shows that the amount of difference between binding patterns is directly related to the quality of the prediction. By identifying individual genes whose expression is predicted accurately by the binding sites, we are able to link transcription factors FOS, TAF1 and YY1 to a sparsely studied gene LRIG2. We also find that the activity of a transcription factor may be different depending on the cell type and the identity of other co-localized factors. Conclusion Our approach shows that gene expression can be explained by a modest number of co-localized transcription factors, however, information on cell-type specific binding is crucial for understanding combinatorial gene regulation. PMID:22721266

  13. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast

    PubMed Central

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y.; Brem, Rachel B.

    2016-01-01

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1. Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1. Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them. PMID:27190003

  14. Human cytomegalovirus decreases constitutive transcription of MHC class II genes in mature Langerhans cells by reducing CIITA transcript levels.

    PubMed

    Lee, Andrew W; Wang, Nan; Hornell, Tara M C; Harding, James J; Deshpande, Chetan; Hertel, Laura; Lacaille, Vashti; Pashine, Achal; Macaubas, Claudia; Mocarski, Edward S; Mellins, Elizabeth D

    2011-05-01

    Human cytomegalovirus (HCMV) productively infects CD34(+) progenitor-derived, mature Langerhans-type dendritic cells (matLC) and reduces surface expression of MHC class II complexes (MHC II) by increasing intracellular retention of these molecules. To determine whether HCMV also inhibits MHC II expression by other mechanisms, we assessed mRNA levels of the class II transcriptional regulator, CIITA, and several of its target genes in infected matLC. Levels of CIITA, HLA-DRA (DRA) and DRB transcripts, and new DR protein synthesis were compared in mock-infected and HCMV-infected cells by quantitative PCR and pulse-chase immunoprecipitation analyses, respectively. CIITA mRNA levels were significantly lower in HCMV-infected matLC as compared to mock-infected cells. When assessed in the presence of Actinomycin D, the stability of CIITA transcripts was not diminished by HCMV. Analysis of promoter-specific CIITA isoforms revealed that types I, III and IV all were decreased by HCMV, a result that differs from changes after incubation of these cells with lipopolysaccharide (LPS). Exposure to UV-inactivated virus failed to reduce CIITA mRNA levels, implicating de novo viral gene expression in this effect. HCMV-infected matLC also expressed lower levels of DR transcripts and reduced DR protein synthesis rates compared to mock-infected matLC. In summary, we demonstrate that HCMV infection of a human dendritic cell subset inhibits constitutive CIITA expression, most likely at the transcriptional level, resulting in reduced MHC II biosynthesis. We suggest this represents a new mechanism of modulation of mature LC by HCMV.

  15. Landscape of post-transcriptional gene regulation during hepatitis C virus infection

    PubMed Central

    Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram

    2015-01-01

    Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

  16. FoxO1 deacetylation regulates thyroid hormone-induced transcription of key hepatic gluconeogenic genes.

    PubMed

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-10-18

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD(+)-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ(-/-)) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status.

  17. Histone ADP-Ribosylation Facilitates Gene Transcription by Directly Remodeling Nucleosomes

    PubMed Central

    Martinez-Zamudio, Ricardo

    2012-01-01

    The packaging of DNA into nucleosomes imposes obstacles on gene transcription, and histone-modifying and nucleosome-remodeling complexes work in concert to alleviate these obstacles so as to facilitate transcription. Emerging evidence shows that chromatin-associated poly(ADP-ribose) polymerase 1 (PARP-1) and its enzymatic activity facilitate inflammatory gene transcription and modulate the inflammatory response in animal models. However, the molecular mechanisms by which PARP-1 enzymatic activity facilitates transcription are not well understood. Here we show that through an intracellular signaling pathway, lipopolysaccharide (LPS) stimulation induces PARP-1 enzymatic activity and the ADP-ribosylation of histones at transcriptionally active and accessible chromatin regions in macrophages. In vitro DNase I footprinting and restriction endonuclease accessibility assays reveal that histone ADP-ribosylation directly destabilizes histone-DNA interactions in the nucleosome and increases the site accessibility of the nucleosomal DNA to nucleases. Consistent with this, LPS stimulation-induced ADP-ribosylation at the nucleosome-occupied promoters of il-1β, mip-2, and csf2 facilitates NF-κB recruitment and the transcription of these genes in macrophages. Therefore, our data suggest that PARP-1 enzymatic activity facilitates gene transcription through increasing promoter accessibility by histone ADP-ribosylation. PMID:22547677

  18. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    SciTech Connect

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  19. Transcription Profile of Aging and Cognition-Related Genes in the Medial Prefrontal Cortex

    PubMed Central

    Ianov, Lara; Rani, Asha; Beas, Blanca S.; Kumar, Ashok; Foster, Thomas C.

    2016-01-01

    Cognitive function depends on transcription; however, there is little information linking altered gene expression to impaired prefrontal cortex function during aging. Young and aged F344 rats were characterized on attentional set shift and spatial memory tasks. Transcriptional differences associated with age and cognition were examined using RNA sequencing to construct transcriptomic profiles for the medial prefrontal cortex (mPFC), white matter, and region CA1 of the hippocampus. The results indicate regional differences in vulnerability to aging. Age-related gene expression in the mPFC was similar to, though less robust than, changes in the dorsolateral PFC of aging humans suggesting that aging processes may be similar. Importantly, the pattern of transcription associated with aging did not predict cognitive decline. Rather, increased mPFC expression of genes involved in regulation of transcription, including transcription factors that regulate the strength of excitatory and inhibitory inputs, and neural activity-related immediate-early genes was observed in aged animals that exhibit delayed set shift behavior. The specificity of impairment on a mPFC-dependent task, associated with a particular mPFC transcriptional profile indicates that impaired executive function involves altered transcriptional regulation and neural activity/plasticity processes that are distinct from that described for impaired hippocampal function. PMID:27242522

  20. Glucocorticoid receptor represses proinflammatory genes at distinct steps of the transcription cycle.

    PubMed

    Gupte, Rebecca; Muse, Ginger W; Chinenov, Yurii; Adelman, Karen; Rogatsky, Inez

    2013-09-03

    Widespread anti-inflammatory actions of glucocorticoid hormones are mediated by the glucocorticoid receptor (GR), a ligand-dependent transcription factor of the nuclear receptor superfamily. In conjunction with its corepressor GR-interacting protein-1 (GRIP1), GR tethers to the DNA-bound activator protein-1 and NF-κB and represses transcription of their target proinflammatory cytokine genes. However, these target genes fall into distinct classes depending on the step of the transcription cycle that is rate-limiting for their activation: Some are controlled through RNA polymerase II (PolII) recruitment and initiation, whereas others undergo signal-induced release of paused elongation complexes into productive RNA synthesis. Whether these genes are differentially regulated by GR is unknown. Here we report that, at the initiation-controlled inflammatory genes in primary macrophages, GR inhibited LPS-induced PolII occupancy. In contrast, at the elongation-controlled genes, GR did not affect PolII recruitment or transcription initiation but promoted, in a GRIP1-dependent manner, the accumulation of the pause-inducing negative elongation factor. Consistently, GR-dependent repression of elongation-controlled genes was abolished specifically in negative elongation factor-deficient macrophages. Thus, GR:GRIP1 use distinct mechanisms to repress inflammatory genes at different stages of the transcription cycle.

  1. 3' Untranslated regions mediate transcriptional interference between convergent genes both locally and ectopically in Saccharomyces cerevisiae.

    PubMed

    Wang, Luwen; Jiang, Ning; Wang, Lin; Fang, Ou; Leach, Lindsey J; Hu, Xiaohua; Luo, Zewei

    2014-01-01

    Paired sense and antisense (S/AS) genes located in cis represent a structural feature common to the genomes of both prokaryotes and eukaryotes, and produce partially complementary transcripts. We used published genome and transcriptome sequence data and found that over 20% of genes (645 pairs) in the budding yeast Saccharomyces cerevisiae genome are arranged in convergent pairs with overlapping 3'-UTRs. Using published microarray transcriptome data from the standard laboratory strain of S. cerevisiae, our analysis revealed that expression levels of convergent pairs are significantly negatively correlated across a broad range of environments. This implies an important role for convergent genes in the regulation of gene expression, which may compensate for the absence of RNA-dependent mechanisms such as micro RNAs in budding yeast. We selected four representative convergent gene pairs and used expression assays in wild type yeast and its genetically modified strains to explore the underlying patterns of gene expression. Results showed that convergent genes are reciprocally regulated in yeast populations and in single cells, whereby an increase in expression of one gene produces a decrease in the expression of the other, and vice-versa. Time course analysis of the cell cycle illustrated the functional significance of this relationship for the three pairs with relevant functional roles. Furthermore, a series of genetic modifications revealed that the 3'-UTR sequence plays an essential causal role in mediating transcriptional interference, which requires neither the sequence of the open reading frame nor the translation of fully functional proteins. More importantly, transcriptional interference persisted even when one of the convergent genes was expressed ectopically (in trans) and therefore does not depend on the cis arrangement of convergent genes; we conclude that the mechanism of transcriptional interference cannot be explained by the transcriptional collision

  2. Nucleotide sequence and transcriptional analysis of the type A2 neurotoxin gene cluster in Clostridium botulinum.

    PubMed

    Dineen, Sean S; Bradshaw, Marite; Karasek, Charles E; Johnson, Eric A

    2004-06-01

    The nucleotide sequences of the upstream regions of the botulinum neurotoxin type A1 (BoNT/A1) cluster of Clostridium botulinum strain NCTC 2916 and the BoNT/A2 cluster of strain Kyoto-F were determined. A novel gene, designated orfx3, was identified following the orfx2 gene in both clusters. ORF-X2 and ORF-X3 exhibit similarity to the BoNT cluster associated P-47 protein. The BoNT/A1 and BoNT/A2 clusters share a similar gene arrangement, but exhibit differences in the spacing between certain genes. Sequences with similarity to transposases were identified in these intergenic regions, suggesting that these differences arose from an ancestral insertion event. Transcriptional analysis of the BoNT/A2 cluster revealed that the genes of the cluster are primarily synthesized as three polycistronic transcripts. Two divergent polycistronic transcripts, one encoding the orfx1, orfx2, and orfx3 genes, the second encoding the p47, ntnh, and bont/a2 genes, are transcribed from conserved BoNT cluster promoters. The third polycistronic transcript, expressed at low levels, encodes the positive regulatory botR gene and the orfx genes. This is the first complete analysis of a botulinum toxin A2 cluster.

  3. Gene loops function to maintain transcriptional memory through interaction with the nuclear pore complex

    PubMed Central

    Tan-Wong, Sue Mei; Wijayatilake, Hashanthi D.; Proudfoot, Nick J.

    2009-01-01

    Inducible genes in yeast retain a “memory” of recent transcriptional activity during periods of short-term repression, allowing them to be reactivated faster when reinduced. This confers a rapid and versatile gene expression response to the environment. We demonstrate that this memory mechanism is associated with gene loop interactions between the promoter and 3′ end of the responsive genes HXK1 and GAL1∷FMP27. The maintenance of these memory gene loops (MGLs) during intervening periods of transcriptional repression is required for faster RNA polymerase II (Pol II) recruitment to the genes upon reinduction, thereby facilitating faster mRNA accumulation. Notably, a sua7-1 mutant or the endogenous INO1 gene that lacks this MGL does not display such faster reinduction. Furthermore, these MGLs interact with the nuclear pore complex through association with myosin-like protein 1 (Mlp1). An mlp1Δ strain does not maintain MGLs, and concomitantly loses transcriptional memory. We predict that gene loop conformations enhance gene expression by facilitating rapid transcriptional response to changing environmental conditions. PMID:19933151

  4. Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

    PubMed Central

    Ronander, Elena; Bengtsson, Dominique C.; Joergensen, Louise; Jensen, Anja T. R.; Arnot, David E.

    2012-01-01

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1. Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types. PMID:23070076

  5. Analysis of single-cell gene transcription by RNA fluorescent in situ hybridization (FISH).

    PubMed

    Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise; Jensen, Anja T R; Arnot, David E

    2012-10-07

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System(2) (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

  6. Human glycolipid transfer protein (GLTP) genes: organization, transcriptional status and evolution

    PubMed Central

    Zou, Xianqiong; Chung, Taeowan; Lin, Xin; Malakhova, Margarita L; Pike, Helen M; Brown, Rhoderick E

    2008-01-01

    Background Glycolipid transfer protein is the prototypical and founding member of the new GLTP superfamily distinguished by a novel conformational fold and glycolipid binding motif. The present investigation provides the first insights into the organization, transcriptional status, phylogenetic/evolutionary relationships of GLTP genes. Results In human cells, single-copy GLTP genes were found in chromosomes 11 and 12. The gene at locus 11p15.1 exhibited several features of a potentially active retrogene, including a highly homologous (~94%), full-length coding sequence containing all key amino acid residues involved in glycolipid liganding. To establish the transcriptional activity of each human GLTP gene, in silico EST evaluations, RT-PCR amplifications of GLTP transcript(s), and methylation analyses of regulator CpG islands were performed using various human cells. Active transcription was found for 12q24.11 GLTP but 11p15.1 GLTP was transcriptionally silent. Heterologous expression and purification of the GLTP paralogs showed glycolipid intermembrane transfer activity only for 12q24.11 GLTP. Phylogenetic/evolutionary analyses indicated that the 5-exon/4-intron organizational pattern and encoded sequence of 12q24.11 GLTP were highly conserved in therian mammals and other vertebrates. Orthologs of the intronless GLTP gene were observed in primates but not in rodentiates, carnivorates, cetartiodactylates, or didelphimorphiates, consistent with recent evolutionary development. Conclusion The results identify and characterize the gene responsible for GLTP expression in humans and provide the first evidence for the existence of a GLTP pseudogene, while demonstrating the rigorous approach needed to unequivocally distinguish transcriptionally-active retrogenes from silent pseudogenes. The results also rectify errors in the Ensembl database regarding the organizational structure of the actively transcribed GLTP gene in Pan troglodytes and establish the intronless GLTP as

  7. Transcript RNA supports precise repair of its own DNA gene.

    PubMed

    Keskin, Havva; Meers, Chance; Storici, Francesca

    2016-01-01

    The transfer of genetic information from RNA to DNA is considered an extraordinary process in molecular biology. Despite the fact that cells transcribe abundant amount of RNA with a wide range of functions, it has been difficult to uncover whether RNA can serve as a template for DNA repair and recombination. An increasing number of experimental evidences suggest a direct role of RNA in DNA modification. Recently, we demonstrated that endogenous transcript RNA can serve as a template to repair a DNA double-strand break (DSB), the most harmful DNA lesion, not only indirectly via formation of a DNA copy (cDNA) intermediate, but also directly in a homology driven mechanism in budding yeast. These results point out that the transfer of genetic information from RNA to DNA is more general than previously thought. We found that transcript RNA is more efficient in repairing a DSB in its own DNA (in cis) than in a homologous but ectopic locus (in trans). Here, we summarize current knowledge about the process of RNA-driven DNA repair and recombination, and provide further data in support of our model of DSB repair by transcript RNA in cis. We show that a DSB is precisely repaired predominately by transcript RNA and not by residual cDNA in conditions in which formation of cDNA by reverse transcription is inhibited. Additionally, we demonstrate that defects in ribonuclease (RNase) H stimulate precise DSB repair by homologous RNA or cDNA sequence, and not by homologous DNA sequence carried on a plasmid. These results highlight an antagonistic role of RNase H in RNA-DNA recombination. Ultimately, we discuss several questions that should be addressed to better understand mechanisms and implications of RNA-templated DNA repair and recombination.

  8. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    PubMed

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  9. Metformin increases PDH and suppresses HIF-1α under hypoxic conditions and induces cell death in oral squamous cell carcinoma

    PubMed Central

    Guimarães, Talita Antunes; Farias, Lucyana Conceição; Santos, Eliane Sobrinho; de Carvalho Fraga, Carlos Alberto; Orsini, Lissur Azevedo; de Freitas Teles, Leandro; Feltenberger, John David; de Jesus, Sabrina Ferreira; de Souza, Marcela Gonçalves; Sousa Santos, Sérgio Henrique; de Paula, Alfredo Maurício Batista

    2016-01-01

    Background Metformin is a biguanide, belonging to the oral hypoglycemic agents and is a widely used in the treatment of type 2 diabetes. Evidence indicate that Metformin inhibits cell proliferation in several human cancers and inhibits the Warburg phenomenon in tumor cells. Results Low PDH levels were observed in OSCC, and Metformin promotes an increase in PDH levels in hypoxic conditions. Metformin also reduced HIF-1α mRNA and protein levels. Metformin demonstrated antiproliferative effects, inhibited migration, increased the number of apoptotic cells and increased the transcription of caspase 3. Objective The present study aims to explore the effects of Metformin in hypoxic conditions. Specifically, we focused on pyruvate dehydrogenase (PDH), (hypoxia-inducible factor 1α) HIF-1α levels and the oral squamous cell carcinoma (OSCC) cell phenotype. Additionally, we also investigated a theoretical consequence of Metformin treatment. Methods PDH levels in patients with OSCC and oral dysplasia were evaluated. Metformin was administered in vitro to test the effect of Metformin under hypoxic conditions. The results were complemented by Bioinformatics analyses. Conclusions In conclusion, our current findings show that Metformin reduces HIF-1α gene expression and increases PDH expression. Metformin inhibits cell proliferation and migration in the OSCC cell line model. Additionally, Metformin enhances the number of apoptotic cells and caspase 3 levels. Interestingly enough, Metformin did not increase the mutant p53 levels under hypoxic conditions. PMID:27474170

  10. Gene length may contribute to graded transcriptional responses in the Drosophila embryo

    PubMed Central

    McHale, Peter; Mizutani, Claudia M.; Kosman, David; MacKay, Danielle L.; Belu, Mirela; Hermann, Anita; McGinnis, William; Bier, Ethan; Hwa, Terence

    2011-01-01

    An important question in developmental biology is how relatively shallow gradients of morphogens can reliably establish a series of distinct transcriptional readouts. Current models emphasize interactions between transcription factors binding in distinct modes to cis-acting sequences of target genes. Another recent idea is that the cis-acting interactions may amplify preexisting biases or prepatterns to establish robust transcriptional responses. In this study, we examine the possible contribution of one such source of prepattern, namely gene length. We developed quantitative imaging tools to measure gene expression levels for several loci at a time on a single-cell basis and applied these quantitative imaging tools to dissect the establishment of a gene expression border separating the mesoderm and neuroectoderm in the early Drosophila embryo. We first characterized the formation of a transient ventral-to-dorsal gradient of the Snail (Sna) repressor and then examined the relationship between this gradient and repression of neural target genes in the mesoderm. We found that neural genes are repressed in a nested pattern within a zone of the mesoderm abutting the neuroectoderm, where Sna levels are graded. While several factors may contribute to the transient graded response to the Sna gradient, our analysis suggests that gene length may play an important, albeit transient, role in establishing these distinct transcriptional responses. One prediction of the gene-length-dependent transcriptional patterning model is that the co-regulated genes knirps (a short gene) and knirps-related (a long gene) should be transiently expressed in domains of differing widths, which we confirmed experimentally. These findings suggest that gene length may contribute to establishing graded responses to morphogen gradients by providing transient prepatterns that are subsequently amplified and stabilized by traditional cis-regulatory interactions. PMID:21920356

  11. Rgt1, a glucose sensing transcription factor, is required for transcriptional repression of the HXK2 gene in Saccharomyces cerevisiae

    PubMed Central

    2005-01-01

    Expression of HXK2, a gene encoding a Saccharomyces cerevisiae bifunctional protein with catalytic and regulatory functions, is controlled by glucose availability, being activated in the presence of glucose and inhibited when the levels of the sugar are low. In the present study, we identified Rgt1 as a transcription factor that, together with the Med8 protein, is essential for repression of the HXK2 gene in the absence of glucose. Rgt1 represses HXK2 expression by binding specifically to the motif (CGGAAAA) located at −395 bp relative to the ATG translation start codon in the HXK2 promoter. Disruption of the RGT1 gene causes an 18-fold increase in the level of HXK2 transcript in the absence of glucose. Rgt1 binds to the RGT1 element of HXK2 promoter in a glucose-dependent manner, and the repression of target gene depends on binding of Rgt1 to DNA. The physiological significance of the connection between two glucose-signalling pathways, the Snf3/Rgt2 that causes glucose induction and the Mig1/Hxk2 that causes glucose repression, was also analysed. PMID:15705057

  12. A primer on molecular biology for imagers: II. Transcription and gene expression.

    PubMed

    Pandit, Sunil D; Li, King C P

    2004-03-01

    The process of gene expression is complex and highly regulated to ensure that the right gene is expressed at the right place, at the right time, and in regulated amounts. The cell has multiple levels at which it controls the expression of a transcript including gene expression, alternate splicing, and stability of the transcript. Alternate splicing to generate different RNA species from a given gene and DNA rearrangements where genes are rearranged during cellular differentiation (eg, immunoglobulin genes) are additional mechanisms used to generate diversity in complex organisms. Epigenetic mechanisms such as methylation where CpG-rich islands in the promoter region depending on their methylation status can also modulate gene expression. The reader is requested to refer to the books, review articles, and web sites for additional information.

  13. Hypoxic regulation of lactate dehydrogenase A. Interaction between hypoxia-inducible factor 1 and cAMP response elements.

    PubMed

    Firth, J D; Ebert, B L; Ratcliffe, P J

    1995-09-08

    The oxygen-regulated control system responsible for the induction of erythropoietin (Epo) by hypoxia is present in most (if not all) cells and operates on other genes, including those involved in energy metabolism. To understand the organization of cis-acting sequences that are responsible for oxygen-regulated gene expression, we have studied the 5' flanking region of the mouse gene encoding the hypoxically inducible enzyme lactate dehydrogenase A (LDH). Deletional and mutational analysis of the function of mouse LDH-reporter fusion gene constructs in transient transfection assays defined three domains, between -41 and -84 base pairs upstream of the transcription initiation site, which were crucial for oxygen-regulated expression. The most important of these, although not capable of driving hypoxic induction in isolation, had the consensus of a hypoxia-inducible factor 1 (HIF-1) site, and cross-competed for the binding of HIF-1 with functionally active Epo and phosphoglycerate kinase-1 sequences. The second domain was positioned close to the HIF-1 site, in an analogous position to one of the critical regions in the Epo 3' hypoxic enhancer. The third domain had the motif of a cAMP response element (CRE). Activation of cAMP by forskolin had no effect on the level of LDH mRNA in normoxia, but produced a magnified response to hypoxia that was dependent upon the integrity of the CRE, indicating an interaction between inducible factors binding the HIF-1 and CRE sites.

  14. Scaling of Gene Expression with Transcription-Factor Fugacity

    PubMed Central

    Weinert, Franz M.; Brewster, Robert C.; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K.

    2015-01-01

    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve. PMID:25554908

  15. Scaling of gene expression with transcription-factor fugacity.

    PubMed

    Weinert, Franz M; Brewster, Robert C; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K

    2014-12-19

    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve.

  16. Interval hypoxic training.

    PubMed

    Bernardi, L

    2001-01-01

    Interval hypoxic training (IHT) is a technique developed in the former Soviet Union, that consists of repeated exposures to 5-7 minutes of steady or progressive hypoxia, interrupted by equal periods of recovery. It has been proposed for training in sports, to acclimatize to high altitude, and to treat a variety of clinical conditions, spanning from coronary heart disease to Cesarean delivery. Some of these results may originate by the different effects of continuous vs. intermittent hypoxia (IH), which can be obtained by manipulating the repetition rate, the duration and the intensity of the hypoxic stimulus. The present article will attempt to examine some of the effects of IH, and, whenever possible, compare them to those of typical IHT. IH can modify oxygen transport and energy utilization, alter respiratory and blood pressure control mechanisms, induce permanent modifications in the cardiovascular system. IHT increases the hypoxic ventilatory response, increase red blood cell count and increase aerobic capacity. Some of these effects might be potentially beneficial in specific physiologic or pathologic conditions. At this stage, this technique appears interesting for its possible applications, but still largely to be explored for its mechanisms, potentials and limitations.

  17. Discovery of Inhibitors of Aberrant Gene Transcription from Libraries of DNA Binding Molecules: Inhibition of LEF-1 Mediated Gene Transcription and Oncogenic Transformation

    PubMed Central

    Stover, James S.; Shi, Jin; Jin, Wei; Vogt, Peter K.; Boger, Dale L.

    2009-01-01

    The screening of a >9000 compound library of synthetic DNA binding molecules for selective binding to the consensus sequence of the transcription factor LEF-1 followed by assessment of the candidate compounds in a series of assays that characterized functional activity (disruption of DNA–LEF-1 binding) at the intended target and site (inhibition of intracellular LEF-1 mediated gene transcription) resulting in a desired phenotypic cellular change (inhibit LEF-1 driven cell transformation) provided two lead compounds: lefmycin-1 and lefmycin-2. The sequence of screens defining the approach assures that activity in the final functional assay may be directly related to the inhibition of gene transcription and DNA binding properties of the identified molecules. Central to the implementation of this generalized approach to the discovery of DNA binding small molecule inhibitors of gene transcription was: (1) the use of a technically non-demanding fluorescent intercalator displacement (FID) assay for initial assessment of the DNA binding affinity and selectivity of a library of compounds for any sequence of interest, and (2) the technology used to prepare a sufficiently large library of DNA binding compounds. PMID:19216569

  18. Discovery of inhibitors of aberrant gene transcription from Libraries of DNA binding molecules: inhibition of LEF-1-mediated gene transcription and oncogenic transformation.

    PubMed

    Stover, James S; Shi, Jin; Jin, Wei; Vogt, Peter K; Boger, Dale L

    2009-03-11

    The screening of a >9000 compound library of synthetic DNA binding molecules for selective binding to the consensus sequence of the transcription factor LEF-1 followed by assessment of the candidate compounds in a series of assays that characterized functional activity (disruption of DNA-LEF-1 binding) at the intended target and site (inhibition of intracellular LEF-1-mediated gene transcription) resulting in a desired phenotypic cellular change (inhibit LEF-1-driven cell transformation) provided two lead compounds: lefmycin-1 and lefmycin-2. The sequence of screens defining the approach assures that activity in the final functional assay may be directly related to the inhibition of gene transcription and DNA binding properties of the identified molecules. Central to the implementation of this generalized approach to the discovery of DNA binding small molecule inhibitors of gene transcription was (1) the use of a technically nondemanding fluorescent intercalator displacement (FID) assay for initial assessment of the DNA binding affinity and selectivity of a library of compounds for any sequence of interest, and (2) the technology used to prepare a sufficiently large library of DNA binding compounds.

  19. Cell contacts are required for induction by cortisol of glutamine synthetase gene transcription in the retina.

    PubMed Central

    Vardimon, L; Fox, L L; Degenstein, L; Moscona, A A

    1988-01-01

    In embryonic neural retina the enzyme glutamine synthetase [GS; L-glutamate:ammonia ligase (ADP-forming), EC 6.3.1.2] is a glia-specific differentiation marker inducible with cortisol. We show that cortisol elicits GS mRNA accumulation by stimulating transcription of the GS gene and that this stimulation requires cell contacts: in dissociated and separated retina cells GS gene transcription was not induced; when the separated cells were reassembled into multicellular aggregates, restoring cell contacts, accumulation of GS mRNA was again inducible. In cells dissociated from retina tissue that had been preinduced with cortisol, GS gene transcription rapidly declined, despite continued hormone availability. In the separated cells transcription of the histone H3.3 gene and accumulation of carbonic anhydrase II mRNA were unaffected; therefore, cell separation selectively precluded induction of the GS gene. These findings provide direct evidence for the regulatory role of cell contacts in hormonal control of gene transcription. Images PMID:2901094

  20. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.

    2003-01-01

    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  1. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  2. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  3. Circular RNAs Are the Predominant Transcript Isoform from Hundreds of Human Genes in Diverse Cell Types

    PubMed Central

    Wang, Peter Lincoln; Lacayo, Norman; Brown, Patrick O.

    2012-01-01

    Most human pre-mRNAs are spliced into linear molecules that retain the exon order defined by the genomic sequence. By deep sequencing of RNA from a variety of normal and malignant human cells, we found RNA transcripts from many human genes in which the exons were arranged in a non-canonical order. Statistical estimates and biochemical assays provided strong evidence that a substantial fraction of the spliced transcripts from hundreds of genes are circular RNAs. Our results suggest that a non-canonical mode of RNA splicing, resulting in a circular RNA isoform, is a general feature of the gene expression program in human cells. PMID:22319583

  4. Transcriptional start and MetR binding sites on the Escherichia coli metH gene.

    PubMed

    Marconi, R; Wigboldus, J; Weissbach, H; Brot, N

    1991-03-29

    The 5' upstream region of the Escherichia coli metH gene has been sequenced. Primer extension analysis revealed a transcription start site at 324 bases upstream of the initiator codon. An 8 base sequence homologous to the MetR binding region on the E. coli metE gene is present 217 bp downstream of the transcription start site. Gel retardation experiments showed that purified MetR protein could bind to a 30 base oligonucleotide containing the putative MetR binding region. No "met box" was present which explains the relative lack of regulation of the expression of the metH gene by methionine.

  5. Genetic effects of an air discharge plasma on Staphylococcus aureus at the gene transcription level

    NASA Astrophysics Data System (ADS)

    Xu, Zimu; Wei, Jun; Shen, Jie; Liu, Yuan; Ma, Ronghua; Zhang, Zelong; Qian, Shulou; Ma, Jie; Lan, Yan; Zhang, Hao; Zhao, Ying; Xia, Weidong; Sun, Qiang; Cheng, Cheng; Chu, Paul K.

    2015-05-01

    The dynamics of gene expression regulation (at transcription level) in Staphylococcus aureus after different doses of atmospheric-pressure room-temperature air plasma treatments are investigated by monitoring the quantitative real-time polymerase chain reaction. The plasma treatment influences the transcription of genes which are associated with several important bio-molecular processes related to the environmental stress resistance of the bacteria, including oxidative stress response, biofilm formation, antibiotics resistance, and DNA damage protection/repair. The reactive species generated by the plasma discharge in the gas phase and/or induced in the liquid phase may account for these gene expression changes.

  6. Inferring gene correlation networks from transcription factor binding sites.

    PubMed

    Mahdevar, Ghasem; Nowzari-Dalini, Abbas; Sadeghi, Mehdi

    2013-01-01

    Gene expression is a highly regulated biological process that is fundamental to the existence of phenotypes of any living organism. The regulatory relations are usually modeled as a network; simply, every gene is modeled as a node and relations are shown as edges between two related genes. This paper presents a novel method for inferring correlation networks, networks constructed by connecting co-expressed genes, through predicting co-expression level from genes promoter's sequences. According to the results, this method works well on biological data and its outcome is comparable to the methods that use microarray as input. The method is written in C++ language and is available upon request from the corresponding author.

  7. Partially phosphorylated Pho4 activates transcription of a subset of phosphate-responsive genes.

    PubMed

    Springer, Michael; Wykoff, Dennis D; Miller, Nicole; O'Shea, Erin K

    2003-11-01

    A cell's ability to generate different responses to different levels of stimulus is an important component of an adaptive environmental response. Transcriptional responses are frequently controlled by transcription factors regulated by phosphorylation. We demonstrate that differential phosphorylation of the budding yeast transcription factor Pho4 contributes to differential gene expression. When yeast cells are grown in high-phosphate growth medium, Pho4 is phosphorylated on four critical residues by the cyclin-CDK complex Pho80-Pho85 and is inactivated. When yeast cells are starved for phosphate, Pho4 is dephosphorylated and fully active. In intermediate-phosphate conditions, a form of Pho4 preferentially phosphorylated on one of the four sites accumulates and activates transcription of a subset of phosphate-responsive genes. This Pho4 phosphoform binds differentially to phosphate-responsive promoters and helps to trigger differential gene expression. Our results demonstrate that three transcriptional outputs can be generated by a pathway whose regulation is controlled by one kinase, Pho80-Pho85, and one transcription factor, Pho4. Differential phosphorylation of Pho4 by Pho80-Pho85 produces phosphorylated forms of Pho4 that differ in their ability to activate transcription, contributing to multiple outputs.

  8. Partially Phosphorylated Pho4 Activates Transcription of a Subset of Phosphate-Responsive Genes

    PubMed Central

    Miller, Nicole

    2003-01-01

    A cell's ability to generate different responses to different levels of stimulus is an important component of an adaptive environmental response. Transcriptional responses are frequently controlled by transcription factors regulated by phosphorylation. We demonstrate that differential phosphorylation of the budding yeast transcription factor Pho4 contributes to differential gene expression. When yeast cells are grown in high-phosphate growth medium, Pho4 is phosphorylated on four critical residues by the cyclin–CDK complex Pho80–Pho85 and is inactivated. When yeast cells are starved for phosphate, Pho4 is dephosphorylated and fully active. In intermediate-phosphate conditions, a form of Pho4 preferentially phosphorylated on one of the four sites accumulates and activates transcription of a subset of phosphate-responsive genes. This Pho4 phosphoform binds differentially to phosphate-responsive promoters and helps to trigger differential gene expression. Our results demonstrate that three transcriptional outputs can be generated by a pathway whose regulation is controlled by one kinase, Pho80–Pho85, and one transcription factor, Pho4. Differential phosphorylation of Pho4 by Pho80–Pho85 produces phosphorylated forms of Pho4 that differ in their ability to activate transcription, contributing to multiple outputs. PMID:14624238

  9. Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat.

    PubMed

    Blake, W L; Clarke, S D

    1990-12-01

    The objective of this research was to determine whether dietary polyunsaturated fatty acids suppress hepatic fatty acid synthase (FAS) mRNA levels by altering FAS gene transcription. Male Sprague-Dawley rats were meal-fed for 10 d a high glucose diet supplemented with 20% digestible energy as menhaden oil or tripalmitin. The transcription rate for FAS was determined by nuclear run-on analysis in hepatic nuclei isolated from rats 2 h postmeal. The values for transcription rates of FAS and S14 (a putative lipogenic protein) in rats fed menhaden oil were only 6 and 21%, respectively, of the rates in rats fed the tripalmitin diet (p less than 0.02). Gene transcription for beta-actin and phosphoenolpyruvate carboxykinase did not differ between treatments. The reduction in hepatic FAS mRNA levels caused by dietary polyunsaturated fats appears to be caused primarily by an inhibition of FAS transcription. The control of transcription by polyunsaturated fats appears not to be mediated by cAMP because the transcription rate for phosphoenolpyruvate carboxykinase (whose gene is very sensitive to cAMP stimulation) was unaffected by the source of dietary fat.

  10. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa

    2017-01-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  11. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.

    PubMed

    Leśniewska, Ewa; Boguta, Magdalena

    2017-02-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  12. Ethylene and pollination decrease transcript abundance of an ethylene receptor gene in Dendrobium petals.

    PubMed

    Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G

    2015-03-15

    We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects.

  13. The transcription factor RFX5 is a transcriptional activator of the TPP1 gene in hepatocellular carcinoma.

    PubMed

    Zhao, Yangjing; Xie, Xingwang; Liao, Weijia; Zhang, Henghui; Cao, Hui; Fei, Ran; Wang, Xueyan; Wei, Lai; Shao, Qixiang; Chen, Hongsong

    2017-01-01

    Regulatory factor X-5 (RFX5) was previously characterized as an essential and highly specific regulator of major histocompatibility class II (MHCII) gene expression in the immune system. We found that RFX5 is significantly upregulated in hepatocellular carcinoma (HCC) tumors and cell lines compared with non-tumor tissues in mRNA expression levels, but it fails to induce the expression of MHCII. However, RFX5 can strongly bind to the tripeptidyl peptidase 1 (TPP1) promoter region and then increase its transcriptional activity. We also found that manipulation the expression of RFX5 can significantly affect the expression of TPP1 in HepG2, which suggested that RFX5 can transcriptionally activate TPP1 in HCC. Moreover, TPP1 is overexpressed in HCC tissues and significantly correlated with poor prognosis of HCC patients, suggesting that it may have potential biological implications in HCC.

  14. Transcription factor Sp1 is necessary for basal calmodulin gene transcription and for its selective stimulation by insulin.

    PubMed

    Solomon, S S; Palazzolo, M R; Takahashi, T; Raghow, R

    1997-11-01

    Insulin positively regulates transcription of rat calmodulin (CaM) I gene and activates the low Km cyclic AMP (cAMP) phosphodiesterase (PDE). To elucidate the mechanism of transcriptional regulation, rat hepatoma (H-411E) cells were transfected with DNA constructs containing the putative CaM promoters coupled to a luciferase reporter and challenged with insulin. Activation of the full length 1835 bp rat CaM I promoter containing all three Sp1 sites or truncated promoters with combinations of one to three of the Sp1 sites was studied in Sp1 deficient Drosophilia SL2 cells and in SL2 cells co-transfected with an Sp1 expression vector and re-challenged with insulin. Our results demonstrate that Sp1 is obligatory for basal activation of the CaM promoter. The maximal insulin stimulation of CaM promoter is elicited only if it contains at least two Sp1 sites.

  15. T-Cell Activation under Hypoxic Conditions Enhances IFN-γ Secretion

    PubMed Central

    Roman, Jessica; Rangasamy, Tirumalai; Guo, Jia; Sugunan, Siva; Meednu, Nida; Packirisamy, Gopinath; Shimoda, Larissa A.; Golding, Amit; Semenza, Gregg; Georas, Steve N.

    2010-01-01

    Secondary lymphoid organs and peripheral tissues are characterized by hypoxic microenvironments, both in the steady state and during inflammation. Although hypoxia regulates T-cell metabolism and survival, very little is known about whether or how hypoxia influences T-cell activation. We stimulated mouse CD4+ T cells in vitro with antibodies directed against the T-cell receptor (CD3) and CD28 under normoxic (20% O2) and hypoxic (1% O2) conditions. Here we report that stimulation under hypoxic conditions augments the secretion of effector CD4+ T-cell cytokines, especially IFN-γ. The enhancing effects of hypoxia on IFN-γ secretion were independent of mouse strain, and were also unaffected using CD4+ T cells from mice lacking one copy of the gene encoding hypoxia-inducible factor-1α. Using T cells from IFN-γ receptor–deficient mice and promoter reporter studies in transiently transfected Jurkat T cells, we found that the enhancing effects of hypoxia on IFN-γ expression were not due to effects on IFN-γ consumption or proximal promoter activity. In contrast, deletion of the transcription factor, nuclear erythroid 2 p45–related factor 2 attenuated the enhancing effect of hypoxia on IFN-γ secretion and other cytokines. We conclude that hypoxia is a previously underappreciated modulator of effector cytokine secretion in CD4+ T cells. PMID:19372249

  16. Action of SNAIL1 in Cardiac Myofibroblasts Is Important for Cardiac Fibrosis following Hypoxic Injury

    PubMed Central

    Biswas, Hirak; Longmore, Gregory D.

    2016-01-01

    Hypoxic injury to the heart results in cardiac fibrosis that leads to cardiac dysfunction and heart failure. SNAIL1 is a zinc finger transcription factor implicated in fibrosis following organ injury and cancer. To determine if the action of SNAIL1 contributed to cardiac fibrosis following hypoxic injury, we used an endogenous SNAIL1 bioluminescence reporter mice, and SNAIL1 knockout mouse models. Here we report that SNAIL1 expression is upregulated in the infarcted heart, especially in the myofibroblasts. Utilizing primary cardiac fibroblasts in ex vivo cultures we find that pro-fibrotic factors and collagen I increase SNAIL1 protein level. SNAIL1 is required in cardiac fibroblasts for the adoption of myofibroblast fate, collagen I expression and expression of fibrosis-related genes. Taken together this data suggests that SNAIL1 expression is induced in the cardiac fibroblasts after hypoxic injury and contributes to myofibroblast phenotype and a fibrotic scar formation. Resultant collagen deposition in the scar can maintain elevated SNAIL1 expression in the myofibroblasts and help propagate fibrosis. PMID:27706205

  17. Upstream stimulatory factor 2 and hypoxia-inducible factor 2α (HIF2α) cooperatively activate HIF2 target genes during hypoxia.

    PubMed

    Pawlus, Matthew R; Wang, Liyi; Ware, Katie; Hu, Cheng-Jun

    2012-11-01

    While the functions of hypoxia-inducible factor 1α (HIF1α)/aryl hydrocarbon receptor nuclear translocator (ARNT) and HIF2α/ARNT (HIF2) proteins in activating hypoxia-inducible genes are well established, the role of other transcription factors in the hypoxic transcriptional response is less clear. We report here for the first time that the basic helix-loop-helix-leucine-zip transcription factor upstream stimulatory factor 2 (USF2) is required for the hypoxic transcriptional response, specifically, for hypoxic activation of HIF2 target genes. We show that inhibiting USF2 activity greatly reduces hypoxic induction of HIF2 target genes in cell lines that have USF2 activity, while inducing USF2 activity in cells lacking USF2 activity restores hypoxic induction of HIF2 target genes. Mechanistically, USF2 activates HIF2 target genes by binding to HIF2 target gene promoters, interacting with HIF2α protein, and recruiting coactivators CBP and p300 to form enhanceosome complexes that contain HIF2α, USF2, CBP, p300, and RNA polymerase II on HIF2 target gene promoters. Functionally, the effect of USF2 knockdown on proliferation, motility, and clonogenic survival of HIF2-dependent tumor cells in vitro is phenocopied by HIF2α knockdown, indicating that USF2 works with HIF2 to activate HIF2 target genes and to drive HIF2-depedent tumorigenesis.

  18. Identification of Novel Short C-Terminal Transcripts of Human SERPINA1 Gene

    PubMed Central

    Matamala, Nerea; Aggarwal, Nupur; Iadarola, Paolo; Fumagalli, Marco; Gomez-Mariano, Gema; Lara, Beatriz; Martinez, Maria Teresa; Cuesta, Isabel; Stolk, Jan

    2017-01-01

    Human SERPINA1 gene is located on chromosome 14q31-32.3 and is organized into three (IA, IB, and IC) non-coding and four (II, III, IV, V) coding exons. This gene produces α1-antitrypsin (A1AT), a prototypical member of the serpin superfamily of proteins. We demonstrate that human peripheral blood leukocytes express not only a product corresponding to the transcript coding for the full-length A1AT protein but also two short transcripts (ST1C4 and ST1C5) of A1AT. In silico sequence analysis revealed that the last exon of the short transcripts contains an Open Reading Frame (ORF) and thus putatively can produce peptides. We found ST1C4 expression across different human tissues whereas ST1C5 was mainly restricted to leukocytes, specifically neutrophils. A high up-regulation (10-fold) of short transcripts was observed in isolated human blood neutrophils after activation with lipopolysaccharide. Parallel analyses by liquid chromatography-mass spectrometry identified peptides corresponding to C-terminal region of A1AT in supernatants of activated but not naïve neutrophils. Herein we report for the first time a tissue specific expression and regulation of short transcripts of SERPINA1 gene, and the presence of C-terminal peptides in supernatants from activated neutrophils, in vitro. This gives a novel insight into the studies on the transcription of SERPINA1 gene. PMID:28107454

  19. Histones are required for transcription of yeast rRNA genes by RNA polymerase I.

    PubMed

    Tongaonkar, Prasad; French, Sarah L; Oakes, Melanie L; Vu, Loan; Schneider, David A; Beyer, Ann L; Nomura, Masayasu

    2005-07-19

    Nucleosomes and their histone components have generally been recognized to act negatively on transcription. However, purified upstream activating factor (UAF), a transcription initiation factor required for RNA polymerase (Pol) I transcription in Saccharomyces cerevisiae, contains histones H3 and H4 and four nonhistone protein subunits. Other studies have shown that histones H3 and H4 are associated with actively transcribed rRNA genes. To examine their functional role in Pol I transcription, we constructed yeast strains in which synthesis of H3 is achieved from the glucose-repressible GAL10 promoter. We found that partial depletion of H3 (approximately 50% depletion) resulted in a strong inhibition (>80%) of Pol I transcription. A combination of biochemical analysis and electron microscopic (EM) analysis of Miller chromatin spreads indicated that initiation and elongation steps and rRNA processing were compromised upon histone depletion. A clear decrease in relative amounts of UAF, presumably caused by reduced stability, was also observed under the conditions of H3 depletion. Therefore, the observed inhibition of initiation can be explained, in part, by the decrease in UAF concentration. In addition, the EM results suggested that the defects in rRNA transcript elongation and processing may be a result of loss of histones from rRNA genes rather than (or in addition to) an indirect consequence of effects of histone depletion on expression of other genes. Thus, these results show functional importance of histones associated with actively transcribed rRNA genes.

  20. Identification of Novel Short C-Terminal Transcripts of Human SERPINA1 Gene.

    PubMed

    Matamala, Nerea; Aggarwal, Nupur; Iadarola, Paolo; Fumagalli, Marco; Gomez-Mariano, Gema; Lara, Beatriz; Martinez, Maria Teresa; Cuesta, Isabel; Stolk, Jan; Janciauskiene, Sabina; Martinez-Delgado, Beatriz

    2017-01-01

    Human SERPINA1 gene is located on chromosome 14q31-32.3 and is organized into three (IA, IB, and IC) non-coding and four (II, III, IV, V) coding exons. This gene produces α1-antitrypsin (A1AT), a prototypical member of the serpin superfamily of proteins. We demonstrate that human peripheral blood leukocytes express not only a product corresponding to the transcript coding for the full-length A1AT protein but also two short transcripts (ST1C4 and ST1C5) of A1AT. In silico sequence analysis revealed that the last exon of the short transcripts contains an Open Reading Frame (ORF) and thus putatively can produce peptides. We found ST1C4 expression across different human tissues whereas ST1C5 was mainly restricted to leukocytes, specifically neutrophils. A high up-regulation (10-fold) of short transcripts was observed in isolated human blood neutrophils after activation with lipopolysaccharide. Parallel analyses by liquid chromatography-mass spectrometry identified peptides corresponding to C-terminal region of A1AT in supernatants of activated but not naïve neutrophils. Herein we report for the first time a tissue specific expression and regulation of short transcripts of SERPINA1 gene, and the presence of C-terminal peptides in supernatants from activated neutrophils, in vitro. This gives a novel insight into the studies on the transcription of SERPINA1 gene.

  1. Transcription of interferon stimulated genes in response to Porcine rubulavirus infection in vitro

    PubMed Central

    Flores-Ocelotl, María del Rosario; Rosas-Murrieta, Nora Hilda; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Herrera-Camacho, Irma; Santos-López, Gerardo

    2011-01-01

    Porcine rubulavirus (PoRV) is an emerging virus causing meningo-encephalitis and reproductive failures in pigs. Little is known about the pathogenesis and immune evasion of this virus; therefore research on the mechanisms underlying tissue damage during infection is essential. To explore these mechanisms, the effect of PoRV on the transcription of interferon (IFN) pathway members was analyzed in vitro by semi-quantitative RT-PCR. Ten TCID50 of PoRV stimulated transcription of IFNα, IFNβ, STAT1, STAT2, p48 and OAS genes in neuroblastoma cells, whereas infection with 100 TCID50 did not stimulate transcription levels more than non-infected cells. When the cells were primed with IFNα, infection with 1 TCDI50 of PoRV sufficed to stimulate the transcription of the same genes, but 10 and 100 TCID50 did not modify the transcription level of those genes as compared with non-infected and primed controls. MxA gene transcription was observed only when the cells were primed with IFNα and stimulated with 10 TCID50, whereas 100 TCID50 of PoRV did not modify the MxA transcription level as compared to non-infected and primed cells. Our results show that PoRV replication at low titers stimulates the expression of IFN-responsive genes in neuroblastoma cells, and suggest that replication of PoRV at higher titers inhibits the transcription of several members of the IFN pathway. These findings may contribute to the understanding of the pathogenesis of PoRV. PMID:24031738

  2. Transcription of interferon stimulated genes in response to Porcine rubulavirus infection in vitro.

    PubMed

    Flores-Ocelotl, María Del Rosario; Rosas-Murrieta, Nora Hilda; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Herrera-Camacho, Irma; Santos-López, Gerardo

    2011-07-01

    Porcine rubulavirus (PoRV) is an emerging virus causing meningo-encephalitis and reproductive failures in pigs. Little is known about the pathogenesis and immune evasion of this virus; therefore research on the mechanisms underlying tissue damage during infection is essential. To explore these mechanisms, the effect of PoRV on the transcription of interferon (IFN) pathway members was analyzed in vitro by semi-quantitative RT-PCR. Ten TCID50 of PoRV stimulated transcription of IFNα, IFNβ, STAT1, STAT2, p48 and OAS genes in neuroblastoma cells, whereas infection with 100 TCID50 did not stimulate transcription levels more than non-infected cells. When the cells were primed with IFNα, infection with 1 TCDI50 of PoRV sufficed to stimulate the transcription of the same genes, but 10 and 100 TCID50 did not modify the transcription level of those genes as compared with non-infected and primed controls. MxA gene transcription was observed only when the cells were primed with IFNα and stimulated with 10 TCID50, whereas 100 TCID50 of PoRV did not modify the MxA transcription level as compared to non-infected and primed cells. Our results show that PoRV replication at low titers stimulates the expression of IFN-responsive genes in neuroblastoma cells, and suggest that replication of PoRV at higher titers inhibits the transcription of several members of the IFN pathway. These findings may contribute to the understanding of the pathogenesis of PoRV.

  3. Effects of transcription induction homogeneity and transcript stability on expression of two genes in a constructed operon.

    PubMed

    Smolke, C D; Khlebnikov, A; Keasling, J D

    2001-12-01

    A synthetic operon was constructed using the reporter genes gfp and lacZ and the arabinose-inducible araBAD promoter. DNA cassettes encoding mRNA secondary structures were placed at the 3' and 5' ends of the genes and a putative RNase E site was placed between the genes. These mRNA control elements have been shown to affect transcript processing and decay, resulting in altered protein levels. These constructs were transformed into cells harboring the native arabinose-inducible araE gene encoding the arabinose transport protein and engineered cells harboring a constitutively expressed araE. In the strains with arabinose-dependent transport the linear response in the production of both reporter proteins to inducer concentration occurred over a narrow range of arabinose concentrations. In the strains with constitutive transport the linear range of gene expression occurred over a much larger arabinose concentration range than in strains with the arabinose-inducible transport. Strains with the arabinose-inducible transport harboring different operon constructs produced the two reporter proteins at very different levels at low arabinose concentrations; as inducer concentrations increased, differences in relative expression levels decreased. In contrast, strains with constitutive transport harboring different operon constructs produced the reporter proteins at very different levels across the entire range of inducer concentrations, pointing to the importance of optimizing gene expression control at various levels to control the production of heterologous proteins.

  4. Transcriptional profiles of drought-responsive genes in modulating transcription signal transduction, and biochemical pathways in tomato

    PubMed Central

    Gong, Pengjuan; Zhang, Junhong; Li, Hanxia; Yang, Changxian; Zhang, Chanjuan; Zhang, Xiaohui; Khurram, Ziaf; Zhang, Yuyang; Wang, Taotao; Fei, Zhangjun; Ye, Zhibiao

    2010-01-01

    To unravel the molecular mechanisms of drought responses in tomato, gene expression profiles of two drought-tolerant lines identified from a population of Solanum pennellii introgression lines, and the recurrent parent S. lycopersicum cv. M82, a drought-sensitive cultivar, were investigated under drought stress using tomato microarrays. Around 400 genes identified were responsive to drought stress only in the drought-tolerant lines. These changes in genes expression are most likely caused by the two inserted chromosome segments of S. pennellii, which possibly contain drought-tolerance quantitative trait loci (QTLs). Among these genes are a number of transcription factors and signalling proteins which could be global regulators involved in the tomato responses to drought stress. Genes involved in organism growth and development processes were also specifically regulated by drought stress, including those controlling cell wall structure, wax biosynthesis, and plant height. Moreover, key enzymes in the pathways of gluconeogenesis (fructose-bisphosphate aldolase), purine and pyrimidine nucleotide biosynthesis (adenylate kinase), tryptophan degradation (aldehyde oxidase), starch degradation (β-amylase), methionine biosynthesis (cystathionine β-lyase), and the removal of superoxide radicals (catalase) were also specifically affected by drought stress. These results indicated that tomato plants could adapt to water-deficit conditions through decreasing energy dissipation, increasing ATP energy provision, and reducing oxidative damage. The drought-responsive genes identified in this study could provide further information for understanding the mechanisms of drought tolerance in tomato. PMID:20643807

  5. Regulation of transcription of cell division genes in the Escherichia coli dcw cluster.

    PubMed

    Vicente, M; Gomez, M J; Ayala, J A

    1998-04-01

    The Escherichia coli dcw cluster contains cell division genes, such as the phylogenetically ubiquitous ftsZ, and genes involved in peptidoglycan synthesis. Transcription in the cluster proceeds in the same direction as the progress of the replication fork along the chromosome. Regulation is exerted at the transcriptional and post-transcriptional levels. The absence of transcriptional termination signals may, in principle, allow extension of the transcripts initiated at the up-stream promoter (mraZ1p) even to the furthest down-stream gene (envA). Complementation tests suggest that they extend into ftsW in the central part of the cluster. In addition, the cluster contains other promoters individually regulated by cis- and trans-acting signals. Dissociation of the expression of the ftsZ gene, located after ftsQ and A near the 3' end of the cluster, from its natural regulatory signals leads to an alteration in the physiology of cell division. The complexities observed in the regulation of gene expression in the cluster may then have an important biological role. Among them, LexA-binding SOS boxes have been found at the 5' end of the cluster, preceding promoters which direct the expression of ftsI (coding for PBP3, the penicillin-binding protein involved in septum formation). A gearbox promoter, ftsQ1p, forms part of the signals regulating the transcription of ftsQ, A and Z. It is an inversely growth-dependent mechanism driven by RNA polymerase containing sigma s, the factor involved in the expression of stationary phase-specific genes. Although the dcw cluster is conserved to a different extent in a variety of bacteria, the regulation of gene expression, the presence or absence of individual genes, and even the essentiality of some of them, show variations in the phylogenetic scale which may reflect adaptation to specific life cycles.

  6. Global irradiation effects, stem cell genes and rare transcripts in the planarian transcriptome.

    PubMed

    Galloni, Mireille

    2012-01-01

    Stem cells are the closest relatives of the totipotent primordial cell, which is able to spawn millions of daughter cells and hundreds of cell types in multicellular organisms. Stem cells are involved in tissue homeostasis and regeneration, and may play a major role in cancer development. Among animals, planarians host a model stem cell type, called the neoblast, which essentially confers immortality. Gaining insights into the global transcriptional landscape of these exceptional cells takes an unprecedented turn with the advent of Next Generation Sequencing methods. Two Digital Gene Expression transcriptomes of Schmidtea mediterranea planarians, with or without neoblasts lost through irradiation, were produced and analyzed. Twenty one bp NlaIII tags were mapped to transcripts in the Schmidtea and Dugesia taxids. Differential representation of tags in normal versus irradiated animals reflects differential gene expression. Canonical and non-canonical tags were included in the analysis, and comparative studies with human orthologs were conducted. Transcripts fell into 3 categories: invariant (including housekeeping genes), absent in irradiated animals (potential neoblast-specific genes, IRDOWN) and induced in irradiated animals (potential cellular stress response, IRUP). Different mRNA variants and gene family members were recovered. In the IR-DOWN class, almost all of the neoblast-specific genes previously described were found. In irradiated animals, a larger number of genes were induced rather than lost. A significant fraction of IRUP genes behaved as if transcript versions of different lengths were produced. Several novel potential neoblast-specific genes have been identified that varied in relative abundance, including highly conserved as well as novel proteins without predicted orthologs. Evidence for a large body of antisense transcripts, for example regulated antisense for the Smed-piwil1 gene, and evidence for RNA shortening in irradiated animals is presented

  7. The Igκ Gene Enhancers, E3′ and Ed, Are Essential for Triggering Transcription

    PubMed Central

    Zhou, Xiaorong; Xiang, Yougui; Garrard, William T.

    2010-01-01

    The mouse Igκ gene locus has three known transcriptional enhancers: an intronic enhancer (Ei), a 3′ enhancer (E3′), and a further downstream enhancer (Ed). Previous studies on B lymphocytes derived from mutant ES cells have shown that deletion of either Ei or E3′ significantly reduces Igκ gene rearrangement, whereas the combined deletion of both Ei and E3′ eliminates such recombination. Furthermore, deletion of either E3′ or Ed significantly reduces rearranged Igκ gene transcription. To determine whether the combined presence of both E3′ and Ed are essential for Igκ gene expression, we generated homozygous double knockout mice (DKO) with targeted deletions in both elements. Significantly, homozygous DKO mice were unable to generate κ+ B cells both in bone marrow and the periphery, and exhibited surface expression almost exclusively of Igλ chains, in spite of the fact that they possessed potentially functional rearranged Igκ genes. Compared with their single-enhancer-deleted counterparts, Igκ loci in homozygous DKO mice exhibited dramatically reduced germline and rearranged gene transcription, lower levels of gene rearrangement and histone H3 acetylation, and markedly increased DNA methylation. This contributed to a partial developmental block at the pre-B cell stage of development. We conclude that the two downstream enhancers are essential in Igκ gene expression and that Ei in homozygous DKO mice is incapable of triggering Igκ gene transcription. Furthermore, these results reveal unexpected compensatory roles for Ed in E3′ knockout mice in triggering germline transcription, and Vκ gene rearrangements to both Jκ and RS elements. PMID:21076060

  8. Structure and ANR-dependent transcription of the nir genes for denitrification from Pseudomonas aeruginosa.

    PubMed

    Arai, H; Igarashi, Y; Kodama, T

    1994-07-01

    In the denitrification gene cluster from Pseudomonas aeruginosa, an operon encoding three open reading frames (nirQ, ORF2, ORF3) was upstream of the structural gene for nitrite reductase (nirS) as a divergent transcriptional organization. A nucleotide-binding protein encoded by nirQ was 76% identical to the Pseudomonas stutzeri nirQ gene product, which was shown to be necessary for activating nitrite and nitric oxide reductases. The gene product of ORF2 was homologous to subunit III of cytochrome oxidases. The nirQ gene was transcribed under denitrifying conditions. The intergenic region of nirS and nirQ has only one binding motif for ANR, a regulatory protein for anaerobic gene expression correspond to FNR in E. coli. Complementation analyses showed that the transcription of both nirS and nirQ completely depended on ANR.

  9. Organization and transcription of the dnaA and dnaN genes of Escherichia coli.

    PubMed

    Sakakibara, Y; Tsukano, H; Sako, T

    1981-01-01

    The locations of the linked dnaA and dnaN genes of Escherichia coli in a specialized transducing lambda phage genome have been determined by electron microscopic heteroduplex analysis, using phages with deletions or insertions in the dnaA or dnaN gene. The transcription initiation sites for the dna genes were also localized by electron microscopic analysis of DNA-RBA heteroduplex molecules formed between the E. coli DNA fragment of the phage genome and the in vitro transcription products of the fragment. The dnaN gene was found to be transcribed in the same direction as the dnaA gene, and predominantly from the promoter of the dnaA gene.

  10. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family

    PubMed Central

    Antin, Parker B.; Pier, Maricela; Sesepasara, Terry; Yatskievych, Tatiana A; Darnell, Diana K.

    2010-01-01

    The Krüppel-like transcription factors are zinc finger proteins that activate and suppress target gene transcription. Although KLF factors have been implicated in regulating many developmental processes, a comprehensive gene expression analysis has not been reported. Here we present the chicken KLF gene family and expression during the first five days of embryonic development. Fourteen chicken KLF genes or expressed sequences have been previously identified. Through synteny analysis and cDNA mapping we have identified the KLF9 gene and determined that the gene presently named KLF1 is the true ortholog of KLF17 in other species. In situ hybridization expression analyses show that in general KLFs are broadly expressed in multiple cell and tissue types. Expression of KLFs 3, 7, 8, and 9, is widespread at all stages examined. KLFs 2, 4, 5, 6, 10, 11, 15 and 17 show more restricted patterns that suggest multiple functions during early stages of embryonic development. PMID:20503383

  11. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    PubMed

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  12. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    NASA Astrophysics Data System (ADS)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  13. DNA context represents transcription regulation of the gene in mouse embryonic stem cells.

    PubMed

    Ha, Misook; Hong, Soondo

    2016-04-14

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  14. Identification, localization, transcription, and sequence analysis of the Choristoneura fumiferana nuclear polyhedrosis virus DNA polymerase gene.

    PubMed

    Liu, J J; Carstens, E B

    1995-06-01

    The location of the Choristoneura fumiferana baculovirus DNA polymerase gene was determined by hybridization analysis using a probe prepared from the previously identified polymerase gene from the Autographa californica multiple nuclear polyhedrosis virus. DNA sequence analysis revealed that the Choristoneura fumiferana baculovirus DNA polymerase gene consists of 2970 base pairs encoding 990 amino acids (114.2 kDa). Transcriptional analysis demonstrated that overlapping transcripts of 3.2 and 4.6 kb, first detected at 6 hr postinfection, potentially coded for the DNA polymerase gene. The major transcription starts sites, identified at 6 hr postinfection, mapped to baculovirus consensus early start sites CGTGCTCA and CAGT. The relatively low level and late initiation of the DNA polymerase gene coupled with our previous data on the temporal control of DNA replication and late gene synthesis (Liu and Carstens, 1993) suggests that the low virulence of the spruce budworm baculovirus may be related to the regulation of its gene expression at the transcriptional level.

  15. p21 as a Transcriptional Co-Repressor of S-Phase and Mitotic Control Genes

    PubMed Central

    Ferrándiz, Nuria; Caraballo, Juan M.; García-Gutierrez, Lucía; Devgan, Vikram; Rodriguez-Paredes, Manuel; Lafita, M. Carmen; Bretones, Gabriel; Quintanilla, Andrea; Muñoz-Alonso, M. Jose; Blanco, Rosa; Reyes, Jose C.; Agell, Neus; Delgado, M. Dolores; Dotto, G. Paolo; León, Javier

    2012-01-01

    It has been previously described that p21 functions not only as a CDK inhibitor but also as a transcriptional co-repressor in some systems. To investigate the roles of p21 in transcriptional control, we studied the gene expression changes in two human cell systems. Using a human leukemia cell line (K562) with inducible p21 expression and human primary keratinocytes with adenoviral-mediated p21 expression, we carried out microarray-based gene expression profiling. We found that p21 rapidly and strongly repressed the mRNA levels of a number of genes involved in cell cycle and mitosis. One of the most strongly down-regulated genes was CCNE2 (cyclin E2 gene). Mutational analysis in K562 cells showed that the N-terminal region of p21 is required for repression of gene expression of CCNE2 and other genes. Chromatin immunoprecipitation assays indicated that p21 was bound to human CCNE2 and other p21-repressed genes gene in the vicinity of the transcription start site. Moreover, p21 repressed human CCNE2 promoter-luciferase constructs in K562 cells. Bioinformatic analysis revealed that the CDE motif is present in most of the promoters of the p21-regulated genes. Altogether, the results suggest that p21 exerts a repressive effect on a relevant number of genes controlling S phase and mitosis. Thus, p21 activity as inhibitor of cell cycle progression would be mediated not only by the inhibition of CDKs but also by the transcriptional down-regulation of key genes. PMID:22662213

  16. Computational design and application of endogenous promoters for transcriptionally targeted gene therapy for rheumatoid arthritis.

    PubMed

    Geurts, Jeroen; Joosten, Leo A B; Takahashi, Nozomi; Arntz, Onno J; Glück, Anton; Bennink, Miranda B; van den Berg, Wim B; van de Loo, Fons A J

    2009-11-01

    The promoter regions of genes that are differentially regulated in the synovial membrane during the course of rheumatoid arthritis (RA) represent attractive candidates for application in transcriptionally targeted gene therapy. In this study, we applied an unbiased computational approach to define proximal-promoters from a gene expression profiling study of murine experimental arthritis. Synovium expression profiles from progressing stages of collagen-induced arthritis (CIA) were classified into six distinct groups using k-means clustering. Using an algorithm based on local over-representation and comparative genomics, we identified putatively functional transcription factor-binding sites (TFBS) in TATA-dependent proximal-promoters. Applying a filter based on spacing between TATA box and transcription start site (TSS) combined with the presence of over-represented nuclear factor kappaB (NFkappaB), AP-1, or CCAAT/enhancer-binding protein beta (C/EBPbeta) sites, 382 candidate murine and human promoters were reduced to 66, corresponding to 45 genes. In vitro, 9 out of 10 computationally defined promoter regions conferred cytokine-inducible expression in murine cells and human synovial fibroblasts. Under these conditions, the serum amyloid A3 (Saa3) promoter showed the strongest transcriptional induction and strength. We applied this promoter for driving therapeutically efficacious levels of the interleukin-1 receptor antagonist (Il1rn) in a disease-regulated fashion. These results demonstrate the value of bioinformatics for guiding the selection of endogenous promoters for transcriptionally targeted gene therapy.

  17. Gastrointestinal Fibroblasts Have Specialized, Diverse Transcriptional Phenotypes: A Comprehensive Gene Expression Analysis of Human Fibroblasts

    PubMed Central

    Ishii, Genichiro; Aoyagi, Kazuhiko; Sasaki, Hiroki; Ochiai, Atsushi

    2015-01-01

    Background Fibroblasts are the principal stromal cells that exist in whole organs and play vital roles in many biological processes. Although the functional diversity of fibroblasts has been estimated, a comprehensive analysis of fibroblasts from the whole body has not been performed and their transcriptional diversity has not been sufficiently explored. The aim of this study was to elucidate the transcriptional diversity of human fibroblasts within the whole body. Methods Global gene expression analysis was performed on 63 human primary fibroblasts from 13 organs. Of these, 32 fibroblasts from gastrointestinal organs (gastrointestinal fibroblasts: GIFs) were obtained from a pair of 2 anatomical sites: the submucosal layer (submucosal fibroblasts: SMFs) and the subperitoneal layer (subperitoneal fibroblasts: SPFs). Using hierarchical clustering analysis, we elucidated identifiable subgroups of fibroblasts and analyzed the transcriptional character of each subgroup. Results In unsupervised clustering, 2 major clusters that separate GIFs and non-GIFs were observed. Organ- and anatomical site-dependent clusters within GIFs were also observed. The signature genes that discriminated GIFs from non-GIFs, SMFs from SPFs, and the fibroblasts of one organ from another organ consisted of genes associated with transcriptional regulation, signaling ligands, and extracellular matrix remodeling. Conclusions GIFs are characteristic fibroblasts with specific gene expressions from transcriptional regulation, signaling ligands, and extracellular matrix remodeling related genes. In addition, the anatomical site- and organ-dependent diversity of GIFs was also discovered. These features of GIFs contribute to their specific physiological function and homeostatic maintenance, and create a functional diversity of the gastrointestinal tract. PMID:26046848

  18. Transcription factor AP-2α regulates acute myeloid leukemia cell proliferation by influencing Hoxa gene expression.

    PubMed

    Ding, Xiaofeng; Yang, Zijian; Zhou, Fangliang; Wang, Fangmei; Li, Xinxin; Chen, Cheng; Li, Xiaofeng; Hu, Xiang; Xiang, Shuanglin; Zhang, Jian

    2013-08-01

    Transcription factor AP-2α mediates transcription of a number of genes implicated in mammalian development, cell proliferation and carcinogenesis. In the current study, we identified Hoxa7, Hoxa9 and Hox cofactor Meis1 as AP-2α target genes, which are involved in myeloid leukemogenesis. Luciferase reporter assays revealed that overexpression of AP-2α activated transcription activities of Hoxa7, Hoxa9 and Meis1, whereas siRNA of AP-2α inhibited their transcription activities. We found that AP-2 binding sites in regulatory regions of three genes activated their transcription by mutant analysis and AP-2α could interact with AP-2 binding sites in vivo by chromatin immunoprecipitation (ChIP). Further results showed that the AP-2α shRNA efficiently inhibited mRNA and protein levels of Hoxa7, Hoxa9 and Meis1 in AML cell lines U937 and HL60. Moreover, decreased expression of AP-2α resulted in a significant reduction in the growth and proliferation of AML cells in vitro. Remarkably, AP-2α knockdown leukemia cells exhibit decreased tumorigenicity in vivo compared with controls. Finally, AP-2α and target genes in clinical acute myeloid leukemia samples of M5b subtype revealed variable expression levels and broadly paralleled expression. These data support a role of AP-2α in mediating the expression of Hoxa genes in acute myeloid leukemia to influence the proliferation and cell survival.

  19. Post-transcriptional mending of gene sequences: Looking under the hood of mitochondrial gene expression in diplonemids.

    PubMed

    Valach, Matus; Moreira, Sandrine; Faktorová, Drahomíra; Lukeš, Julius; Burger, Gertraud

    2016-12-01

    The instructions to make proteins and structural RNAs are laid down in gene sequences. Yet, in certain instances, these primary instructions need to be modified considerably during gene expression, most often at the transcript level. Here we review a case of massive post-transcriptional revisions via trans-splicing and RNA editing, a phenomenon occurring in mitochondria of a recently recognized protist group, the diplonemids. As of now, the various post-transcriptional steps have been cataloged in detail, but how these processes function is still unknown. Since genetic manipulation techniques such as gene replacement and RNA interference have not yet been established for these organisms, alternative strategies have to be deployed. Here, we discuss the experimental and bioinformatics approaches that promise to unravel the molecular machineries of trans-splicing and RNA editing in Diplonema mitochondria.

  20. The mean first passage time and stochastic resonance in gene transcriptional system with time delay

    NASA Astrophysics Data System (ADS)

    Feng, Y. L.; Zhu, J.; Zhang, M.; Gao, L. L.; Liu, Y. F.; Dong, J. M.

    2016-04-01

    In this paper, the gene transcriptional dynamics driven by correlated noises are investigated, where the time delay for the synthesis of transcriptional factor is introduced. The effects of the noise correlation strength and time delay on the stationary probability distribution (SPD), the mean first passage time and the stochastic resonance (SR) are analyzed in detail based on the delay Fokker-Planck equation. It is found that both the time delay and noise correlation strength play important roles in the bistable transcriptional system. The effect of the correlation strength reduces but the time delay enhances the mean first passage time (MFPT). Finally, the SR for this gene transcriptional system is found to be enhanced by the time delay.

  1. Gene regulation by the act of long non-coding RNA transcription

    PubMed Central

    2013-01-01

    Long non-protein-coding RNAs (lncRNAs) are proposed to be the largest transcript class in the mouse and human transcriptomes. Two important questions are whether all lncRNAs are functional and how they could exert a function. Several lncRNAs have been shown to function through their product, but this is not the only possible mode of action. In this review we focus on a role for the process of lncRNA transcription, independent of the lncRNA product, in regulating protein-coding-gene activity in cis. We discuss examples where lncRNA transcription leads to gene silencing or activation, and describe strategies to determine if the lncRNA product or its transcription causes the regulatory effect. PMID:23721193

  2. Gene expression of herpes simplex virus. II. Uv radiological analysis of viral transcription units

    SciTech Connect

    Millette, R. L.; Klaiber, R.

    1980-06-01

    The transcriptional organization of the genome of herpes simplex virus type 1 was analyzed by measuring the sensitivity of viral polypeptide synthesis to uv irradiation of the infecting virus. Herpes simplex virus type 1 was irradiated with various doses of uv light and used to infect xeroderma pigmentosum fibroblasts. Immediate early transcription units were analyzed by having cycloheximide present throughout the period of infection, removing the drug at 8 h postinfection, and pulse-labeling proteins with (355)methionine. Delayed early transcription units were analyzed in similar studies by having 9-beta-D-arabinofuranosyladenine present during the experiment to block replication of the input irradiated genome. The results indicate that none of the immediate early genes analyzed can be cotranscribed, whereas some of the delayed early genes might be cotranscribed. No evidence was found for the existence of large, multigene transcription units.

  3. Expression of E2F transcription factor family genes during chick wing development.

    PubMed

    Towers, Matthew; Fisunov, Gleb; Tickle, Cheryll

    2009-10-01

    The E2F family of transcriptional regulators activate or repress gene expression during specific phases of the cell cycle and control various processes including proliferation, apoptosis and differentiation. However, little is known about the developmental roles of E2F transcription factors in higher vertebrates. The chick wing is an excellent system for studying these processes because, in addition to having a rich classical embryology, it is increasingly amenable to molecular and genomic approaches. We show that the human and mouse complement of eight E2F transcription factors is conserved in the chicken and that chicken E2F genes are expressed in different spatial and temporal patterns during wing development. We discuss how the expression patterns of the eight chicken E2F transcription factors might be related to important morphogenetic events.

  4. [The analysis of rbcS gene function by post-transcription gene silencing in Nicotiana benthamiana].

    PubMed

    Zhou, Xiao-Fu; Ma, Peng-Da; Wang, Ren-Hou; Zhu, Xiao-Juan; Liu, Bao; Wang, Xing-Zhi

    2005-06-01

    A system of virus-induced post-transcriptional gene silencing for studying rbcS gene function was established and optimized using tobacco rattle virus vector and Nicotiana benthamiana as experimental materiaes. The following analyses were conducted: phenotypic characterization of rbcS gene silenced plants, transcription levels of rbcS gene by RT-PCR; protein levels of rbcS by the antibodies of rbcS and rbcL and photosynthetic pigments wntents in rbcS silenced plants by HPLC method. The results showed that the seedlings at 21-24-day-old and Agrobacterium concentration at OD600 = 1-1.5 gave the best results for gene silencing. The expression level of rbcL was very likely regulated by rbcS, and rbcS gene did not relate to the collection of photosynthetic energy. Probability analysis showed that the tobacco rattle virus vector system is a useful and effective technique to study rbcS gene function via post-transcriptional gene silencing.

  5. Patterns of Gene-Specific and Total Transcriptional Activity during the Plasmodium falciparum Intraerythrocytic Developmental Cycle ▿ †

    PubMed Central

    Sims, Jennifer S.; Militello, Kevin T.; Sims, Peter A.; Patel, Vishal P.; Kasper, Jacob M.; Wirth, Dyann F.

    2009-01-01

    The relationships among gene regulatory mechanisms in the malaria parasite Plasmodium falciparum throughout its asexual intraerythrocytic developmental cycle (IDC) remain poorly understood. To investigate the level and nature of transcriptional activity and its role in controlling gene expression during the IDC, we performed nuclear run-on on whole-transcriptome samples from time points throughout the IDC and found a peak in RNA polymerase II-dependent transcriptional activity related to both the number of nuclei per parasite and variable transcriptional activity per nucleus over time. These differential total transcriptional activity levels allowed the calculation of the absolute transcriptional activities of individual genes from gene-specific nuclear run-on hybridization data. For half of the genes analyzed, sense-strand transcriptional activity peaked at the same time point as total activity. The antisense strands of several genes were substantially transcribed. Comparison of the transcriptional activity of the sense strand of each gene to its steady-state RNA abundance across the time points assayed revealed both correlations and discrepancies, implying transcriptional and posttranscriptional regulation, respectively. Our results demonstrate that such comparisons can effectively indicate gene regulatory mechanisms in P. falciparum and suggest that genes with diverse transcriptional activity levels and patterns combine to produce total transcriptional activity levels tied to parasite development during the IDC. PMID:19151330

  6. Analysis of transcriptional responses of normalizing genes on Crassostrea brasiliana under different experimental conditions.

    PubMed

    Müller, Gabrielle do Amaral E Silva; de Lima, Daína; Zacchi, Flávia Lucena; Piazza, Rômi Sharon; Lüchmann, Karim Hahn; Mattos, Jacó Joaquim; Schlenk, Daniel; Bainy, Afonso Celso Dias

    2017-02-04

    Bivalves show remarkable plasticity to environmental changes and have been proposed as sentinel organisms in biomonitoring. Studies related to transcriptional analysis using quantitative real-time PCR (qRT-PCR) in these organisms have notably increased, imposing a need to identify and validate adequate reference genes for an accurate and reliable analysis. In the present study, nine reference genes were selected from transcriptome data of Crassostrea brasiliana in order to identify their suitability as qRT-PCR normalizer genes. The transcriptional patterns were analyzed in gills of oysters under three different conditions: different temperatures (18°C, 24°C or 32°C) and phenanthrene (PHE) (100 µg.L(-1) ) combined exposure; different salinities (10, 25 or 35 ‰) and PHE combined exposure and 10% of diesel fuel water-accommodated fraction (diesel-WAF) exposure. Reference gene stability was calculated using five algorithms (geNorm, NormFinder, BestKeeper, ΔCt, RefFinder). Transcripts of ankyrin-like (ANK), GAPDH-like and α tubulin-like (TUBA) genes showed minor changes in different temperature/PHE treatment. Transcripts of ANK, β actin-like and β tubulin-like genes showed better stability at salinity/PHE treatment, and ANK, TUBA and 28S ribosomal protein-like genes showed the most stable transcription pattern in oysters exposed to diesel-WAF exposure. This study constitutes the first systematic analysis on reference gene selection for qRT-PCR normalization in C. brasiliana. These genes could be employed in studies using qRT-PCR analysis under similar experimental conditions. This article is protected by copyright. All rights reserved.

  7. A transcription factor active on the epidermal growth factor receptor gene.

    PubMed Central

    Kageyama, R; Merlino, G T; Pastan, I

    1988-01-01

    We have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. We found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO4/polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I "footprinting" and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR. Images PMID:3393529

  8. Gene transcription and electromagnetic fields. Final progress report

    SciTech Connect

    Henderson, A.S.

    1992-12-31

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  9. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    PubMed

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  10. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    PubMed Central

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  11. A possible mechanism for the inhibition of ribosomal RNA gene transcription during mitosis.

    PubMed

    Weisenberger, D; Scheer, U

    1995-05-01

    When cells enter mitosis, RNA synthesis ceases. Yet the RNA polymerase I (pol I) transcription machinery involved in the production of pre-rRNA remains bound to the nucleolus organizing region (NOR), the chromosome site harboring the tandemly repeated rRNA genes. Here we examine whether rDNA transcription units are transiently blocked or "frozen" during mitosis. By using fluorescent in situ hybridization we were unable to detect nascent pre-rRNA chains on the NORs of mouse 3T3 and rat kangaroo PtK2 cells. Appropriate controls showed that our approach was sensitive enough to visualize, at the light microscopic level, individual transcriptionally active rRNA genes both in situ after experimental unfolding of nucleoli and in chromatin spreads ("Miller spreads"). Analysis of the cell cycle-dependent redistribution of transcript-associated components also revealed that most transcripts are released from the rDNA at mitosis. Upon disintegration of the nucleolus during mitosis, U3 small nucleolar RNA (snoRNA) and the nucleolar proteins fibrillarin and nucleolin became dispersed throughout the cytoplasm and were excluded from the NORs. Together, our data rule out the presence of "frozen Christmas-trees" at the mitotic NORs but are compatible with the view that inactive pol I remains on the rDNA. We propose that expression of the rRNA genes is regulated during mitosis at the level of transcription elongation, similarly to what is known for a number of genes transcribed by pol II. Such a mechanism may explain the decondensed state of the NOR chromatin and the immediate transcriptional reactivation of the rRNA genes following mitosis.

  12. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae

    PubMed Central

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  13. Involvement of in situ conformation of ribosomal genes and selective distribution of upstream binding factor in rRNA transcription.

    PubMed Central

    Junéra, H R; Masson, C; Géraud, G; Suja, J; Hernandez-Verdun, D

    1997-01-01

    The distribution of the ribosomal genes (rDNA) and the upstream binding factor (UBF), correlatively with their RNA transcripts, was investigated in G1, S-phase, and G2. rDNA was distributed in nucleoli, with alternate sites of clustered and dispersed genes. UBF was found associated with some but not all clustered genes and proportionally more with dispersed genes. It was distributed in several foci that were more numerous and heterogeneous in size during G2 than G1. We suggest that UBF associated with rDNA during S-phase because its nucleolar amount increased during that time and remained stable in G2. 5,6-Dichloro-1-beta-D-ribofuranosylbenzimidazole treatment indicated a similar amount of UBF per transcription unit, and consequently heterogeneous size of the UBF foci can represent a variable number of transcription units per foci. Direct visualization of the transcripts demonstrated that only part of UBF is associated with active transcription and that rDNA distribution varied with transcription. We propose that in the same rDNA locus three types of configuration coexist that are correlated with gene activity: 1) clustered genes without UBF; 2) clustered genes with UBF, of which some are associated with transcription; and 3) dispersed genes with UBF and transcription. These results support the hypothesis that rDNA transcription involved several steps of regulation acting successively and locally in the same locus to promote the repressed clustered genes to become actively transcribed dispersed genes. Images PMID:9017602

  14. Analysis of gene transcription in cells lacking DNA-PK activity.

    PubMed

    Bryntesson, F; Regan, J C; Jeggo, P A; Taccioli, G E; Hubank, M

    2001-08-01

    The DNA-dependent protein kinase (DNA-PK), comprised of the Ku70/Ku80 (now known as G22p1/Xrcc5) heterodimer and the catalytic subunit DNA-PKcs (now known as Prkdc), is required for the nonhomologous end joining (NHEJ) pathway of DNA double-strand break repair. The mechanism of action of DNA-PK remains unclear. We have investigated whether DNA-PK regulates gene transcription in vivo after DNA damage using the subtractive hybridization technique of cDNA representational difference analysis (cDNA RDA). Differential transcription, both radiation-dependent and independent, was detected and confirmed in primary mouse embryo fibroblasts from DNA-PKcs(-/-) and DNA-PKcs(+/+) mice. We present evidence that transcription of the extracellular matrix gene laminin alpha 4 (Lama4) is regulated by DNA-PK in a radiation-independent manner. However, screening of both primary and immortalized DNA-PKcs-deficient cell lines demonstrates that the majority of differences were not consistently dependent on DNA-PK status. Similar results were obtained in experiments using KU mutant hamster cell lines, indicating heterogeneity of transcription between closely related cell lines. Our results suggest that while DNA-PK may be involved in limited gene-specific transcription, it does not play a major role in the transcriptional response to DNA damage.

  15. The fur transcription regulator and fur-regulated genes in Clostridium botulinum A ATCC 3502.

    PubMed

    Zhang, Weibin; Ma, Junhua; Zang, Chengyuan; Song, Yingying; Liu, Peipei

    2011-01-01

    Clostridium botulinum is a spore-forming bacterium that can produce a very powerful neurotoxin that causes botulism. In this study, we have investigated the Fur transcription regulators in Clostridium botulinum and Fur-regulated genes in Clostridium botulinum A ATCC 3502. We found that gene loss may be the main cause leading to the different numbers of Fur transcription regulators in different Clostridium botulinum strains. Meanwhile, 46 operons were found to be regulated by the Fur transcription regulator in Clostridium botulinum A ATCC 3502, involved in several functional classifications, including iron acquisition, iron utilization, iron transport, and transcription regulator. Under an iron-restricted medium, we experimentally found that a Fur transcription regulator (CBO1372) and two operons (DedA, CBO2610-CBO2614 and ABC transporter, CBO0845-CBO0847) are shown to be differentially expressed in Clostridium botulinum A ATCC 3502. This study has provided-us novel insights into the diversity of Fur transcription regulators in different Clostridium botulinum strains and diversity of Fur-targeted genes, as well as a better understanding of the dynamic changes in iron restriction occurring in response to this stress.

  16. Growth phase-dependent transcription of the Streptomyces ramocissimus tuf1 gene occurs from two promoters.

    PubMed Central

    Tieleman, L N; van Wezel, G P; Bibb, M J; Kraal, B

    1997-01-01

    The str operon of Streptomyces ramocissimus contains the genes for ribosomal proteins S12 (rpsL) and S7 (rpsG) and for the polypeptide chain elongation factors G (EF-G) (fus) and Tu (EF-Tu) (tuf). This kirromycin producer contains three tuf or tuf-like genes; tuf1 encodes the regular EF-Tu and is located immediately downstream of fus. In vivo and in vitro transcription analysis revealed a transcription start site directly upstream of S. ramocissimus tuf1, in addition to the operon promoter rpsLp. Transcription from these promoters appeared to be growth phase dependent, diminishing drastically upon entry into stationary phase and at the onset of production of the EF-Tu-targeted antibiotic kirromycin. In surface-grown cultures, a second round of tuf1 transcription, coinciding with aerial mycelium formation and kirromycin production, was observed. The tuf1-specific promoter (tuf1p) was located in the intercistronic region between fus and tuf1 by high-resolution S1 mapping, in vitro transcription, and in vivo promoter probing. During logarithmic growth, the tuf1p and rpsLp transcripts are present at comparable levels. In contrast to Escherichia coli, which has two almost identical tuf genes, the gram-positive S. ramocissimus contains only tuf1 for its regular EF-Tu. High levels of EF-Tu may therefore be achieved by the compensatory activity of tuf1p. PMID:9171408

  17. Transcriptional rewiring over evolutionary timescales changes quantitative and qualitative properties of gene expression

    PubMed Central

    Dalal, Chiraj K; Zuleta, Ignacio A; Mitchell, Kaitlin F; Andes, David R; El-Samad, Hana; Johnson, Alexander D

    2016-01-01

    Evolutionary changes in transcription networks are an important source of diversity across species, yet the quantitative consequences of network evolution have rarely been studied. Here we consider the transcriptional ‘rewiring’ of the three GAL genes that encode the enzymes needed for cells to convert galactose to glucose. In Saccharomyces cerevisiae, the transcriptional regulator Gal4 binds and activates these genes. In the human pathogen Candida albicans (which last shared a common ancestor with S. cerevisiae some 300 million years ago), we show that different regulators, Rtg1 and Rtg3, activate the three GAL genes. Using single-cell dynamics and RNA-sequencing, we demonstrate that although the overall logic of regulation is the same in both species—the GAL genes are induced by galactose—there are major differences in both the quantitative response of these genes to galactose and in the position of these genes in the overall transcription network structure of the two species. DOI: http://dx.doi.org/10.7554/eLife.18981.001 PMID:27614020

  18. Integrating Gene Transcription-Based Biomarkers to Understand Desert Tortoise and Ecosystem Health.

    PubMed

    Bowen, Lizabeth; Miles, A Keith; Drake, K Kristina; Waters, Shannon C; Esque, Todd C; Nussear, Kenneth E

    2015-09-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal's habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcription C T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

  19. TRANSFAC® and its module TRANSCompel®: transcriptional gene regulation in eukaryotes

    PubMed Central

    Matys, V.; Kel-Margoulis, O. V.; Fricke, E.; Liebich, I.; Land, S.; Barre-Dirrie, A.; Reuter, I.; Chekmenev, D.; Krull, M.; Hornischer, K.; Voss, N.; Stegmaier, P.; Lewicki-Potapov, B.; Saxel, H.; Kel, A. E.; Wingender, E.

    2006-01-01

    The TRANSFAC® database on transcription factors, their binding sites, nucleotide distribution matrices and regulated genes as well as the complementing database TRANSCompel® on composite elements have been further enhanced on various levels. A new web interface with different search options and integrated versions of Match™ and Patch™ provides increased functionality for TRANSFAC®. The list of databases which are linked to the common GENE table of TRANSFAC® and TRANSCompel® has been extended by: Ensembl, UniGene, EntrezGene, HumanPSD™ and TRANSPRO™. Standard gene names from HGNC, MGI and RGD, are included for human, mouse and rat genes, respectively. With the help of InterProScan, Pfam, SMART and PROSITE domains are assigned automatically to the protein sequences of the transcription factors. TRANSCompel® contains now, in addition to the COMPEL table, a separate table for detailed information on the experimental EVIDENCE on which the composite elements are based. Finally, for TRANSFAC®, in respect of data growth, in particular the gain of Drosophila transcription factor binding sites (by courtesy of the Drosophila DNase I footprint database) and of Arabidopsis factors (by courtesy of DATF, Database of Arabidopsis Transcription Factors) has to be stressed. The here described public releases, TRANSFAC® 7.0 and TRANSCompel® 7.0, are accessible under . PMID:16381825

  20. Mitotic retention of gene expression patterns by the cell fate-determining transcription factor Runx2

    PubMed Central

    Young, Daniel W.; Hassan, Mohammad Q.; Yang, Xiao-Qing; Galindo, Mario; Javed, Amjad; Zaidi, Sayyed K.; Furcinitti, Paul; Lapointe, David; Montecino, Martin; Lian, Jane B.; Stein, Janet L.; van Wijnen, Andre J.; Stein, Gary S.

    2007-01-01

    During cell division, cessation of transcription is coupled with mitotic chromosome condensation. A fundamental biological question is how gene expression patterns are retained during mitosis to ensure the phenotype of progeny cells. We suggest that cell fate-determining transcription factors provide an epigenetic mechanism for the retention of gene expression patterns during cell division. Runx proteins are lineage-specific transcription factors that are essential for hematopoietic, neuronal, gastrointestinal, and osteogenic cell fates. Here we show that Runx2 protein is stable during cell division and remains associated with chromosomes during mitosis through sequence-specific DNA binding. Using siRNA-mediated silencing, mitotic cell synchronization, and expression profiling, we identify Runx2-regulated genes that are modulated postmitotically. Novel target genes involved in cell growth and differentiation were validated by chromatin immunoprecipitation. Importantly, we find that during mitosis, when transcription is shut down, Runx2 selectively occupies target gene promoters, and Runx2 deficiency alters mitotic histone modifications. We conclude that Runx proteins have an active role in retaining phenotype during cell division to support lineage-specific control of gene expression in progeny cells. PMID:17360627

  1. Integrating gene transcription-based biomarkers to understand desert tortoise and ecosystem health

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Drake, Karla K.; Waters, Shannon C.; Esque, Todd C.; Nussear, Kenneth E.

    2015-01-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal’s habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcriptionC T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

  2. The warts gene as a novel target of the Drosophila DRE/DREF transcription pathway.

    PubMed

    Fujiwara, Shunsuke; Ida, Hiroyuki; Yoshioka, Yasuhide; Yoshida, Hideki; Yamaguchi, Masamitsu

    2012-01-01

    The Hippo tumor suppressor pathway in Drosophila represses expression of DIAP1 and Cyclin E via inactivation of the transcription co-activator Yorkie, resulting in cell cycle arrest and induction of apoptosis. The warts (wts) gene is well known as a core kinase in this pathway, but its transcriptional regulation has yet to be clarified. In Drosophila, DREF binds to a target sequence named DRE (5'-TATCGATA) and regulates transcription of cell proliferation-related genes containing the DRE sequence in their promoter regions. Here we found half reduction of the wts gene dose to enhance the DREF-induced rough eye phenotype, suggesting a DREF genetic interaction with the Hippo pathway in vivo. Three DREs indentified in the wts gene promoter region exhibited strong promoter activity with a luciferase transient expression assay in Drosophila S2 cells, this decreasing under DREF-RNAi conditions. In addition, knockdown of DREF in S2 cells reduced the level of endogenous wts mRNA. Chromatin immunoprecipitation assays with anti-DREF antibody revealed that DREF binds specifically to the wts gene promoter region containing DREs in vivo. These results indicate that the DRE/DREF pathway is required for transcriptional regulation of the wts gene, indicating a novel link between the DRE/DREF and the Hippo pathways.

  3. High initiation rates at the ribosomal gene promoter do not depend upon spacer transcription.

    PubMed Central

    Labhart, P; Reeder, R H

    1989-01-01

    We report experiments that test the model that in Xenopus laevis, RNA polymerase I is "handed over" in a conservative fashion from the T3 terminator to the adjacent gene promoter. We have introduced transcription-terminating lesions into the ribosomal DNA repeat by irradiating cultured cells with ultraviolet light. We used isolated nuclei to measure the effect of such lesions on transcription. UV damage sufficient to prevent all elongating RNA polymerase from reaching T3 from upstream had no adverse effect on the density of RNA polymerase at the very 5' end of the gene. We conclude that high rates of transcription initiation at the gene promoter do not depend upon polymerase passing from one repeat to the next or on polymerase initiating at the spacer promoters. Images PMID:2470092

  4. Promoter sequences required for transcription of Xenopus laevis histone genes in injected frog oocyte nuclei.

    PubMed Central

    Heindl, L M; Weil, T S; Perry, M

    1988-01-01

    Amphibian oogenesis is accompanied by the accumulation of histone mRNA and proteins in the absence of ongoing DNA replication. To begin an analysis of the mechanisms by which histone gene expression is regulated during frog oogenesis and embryogenesis, we used oocyte injection to examine the upstream sequences required for transcription of genes encoding each of the five histone classes. We found that sequences necessary for maximal levels of transcription are located 100 to 200 base pairs upstream of the corresponding start sites. In this region, each promoter examined contains conserved sequence elements, several of which seem to be histone gene class specific, in addition to other, more common sequence elements believed to be used by general transcription factors. Images PMID:3221862

  5. Knockdown of Maternal Homeobox Transcription Factor SEBOX Gene Impaired Early Embryonic Development in Porcine Parthenotes

    PubMed Central

    ZHENG, Zhong; ZHAO, Ming-Hui; JIA, Jia-Lin; HEO, Young-Tae; CUI, Xiang-Shun; OH, Jeong Su; KIM, Nam-Hyung

    2013-01-01

    Abstract A number of germ cell-specific transcription factors essential for ovarian formation and folliculogenesis have been identified and studied. However, the role of these factors during early embryonic development has been poorly explored. In the present study, we investigated the role of SEBOX, a maternal homeobox transcription factor, during early embryonic development in porcine parthenotes. mRNA for SEBOX is preferentially expressed in oocytes, and expression persists until embryonic genome activation (EGA). Knockdown of SEBOX by siRNA disrupted early embryonic development, but not oocyte maturation. Many maternal genes essential for early embryonic development were upregulated in SEBOX-depleted embryos. Moreover, some pluripotency-associated genes, including SOX2 and NANOG, were upregulated when SEBOX was knocked down. Therefore, our data demonstrate that SEBOX is required for early embryonic development in pigs and appears to regulate the degradation of maternal transcripts and the expression of pluripotency genes. PMID:24018616

  6. Knockdown of maternal homeobox transcription factor SEBOX gene impaired early embryonic development in porcine parthenotes.

    PubMed

    Zheng, Zhong; Zhao, Ming-Hui; Jia, Jia-Lin; Heo, Young-Tae; Cui, Xiang-Shun; Oh, Jeong Su; Kim, Nam-Hyung

    2013-12-17

    A number of germ cell-specific transcription factors essential for ovarian formation and folliculogenesis have been identified and studied. However, the role of these factors during early embryonic development has been poorly explored. In the present study, we investigated the role of SEBOX, a maternal homeobox transcription factor, during early embryonic development in porcine parthenotes. mRNA for SEBOX is preferentially expressed in oocytes, and expression persists until embryonic genome activation (EGA). Knockdown of SEBOX by siRNA disrupted early embryonic development, but not oocyte maturation. Many maternal genes essential for early embryonic development were upregulated in SEBOX-depleted embryos. Moreover, some pluripotency-associated genes, including SOX2 and NANOG, were upregulated when SEBOX was knocked down. Therefore, our data demonstrate that SEBOX is required for early embryonic development in pigs and appears to regulate the degradation of maternal transcripts and the expression of pluripotency genes.

  7. Integrated pathway-based transcription regulation network mining and visualization based on gene expression profiles.

    PubMed

    Kibinge, Nelson; Ono, Naoaki; Horie, Masafumi; Sato, Tetsuo; Sugiura, Tadao; Altaf-Ul-Amin, Md; Saito, Akira; Kanaya, Shigehiko

    2016-06-01

    Conventionally, workflows examining transcription regulation networks from gene expression data involve distinct analytical steps. There is a need for pipelines that unify data mining and inference deduction into a singular framework to enhance interpretation and hypotheses generation. We propose a workflow that merges network construction with gene expression data mining focusing on regulation processes in the context of transcription factor driven gene regulation. The pipeline implements pathway-based modularization of expression profiles into functional units to improve biological interpretation. The integrated workflow was implemented as a web application software (TransReguloNet) with functions that enable pathway visualization and comparison of transcription factor activity between sample conditions defined in the experimental design. The pipeline merges differential expression, network construction, pathway-based abstraction, clustering and visualization. The framework was applied in analysis of actual expression datasets related to lung, breast and prostrate cancer.

  8. Murine chromosomal location of five bHLH-Zip transcription factor genes

    SciTech Connect

    Steingrimsson, E.; Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A.

    1995-07-20

    The genes for the bHLH-Zip transcription factors Tfap4, Mxi1, Tcfeb, Usf1, and Usf2 have been mapped in mouse by interspecific backcross analysis. Mxi1, Usf1, and Usf2 have been mapped previously by in situ hybridization, but their positions on the meiotic linkage map had not been determined. The other two genes have not previously been mapped in mouse. These transcription factors belong to a growing family of transcriptional regulators, some of which are known to form a complex network of interacting proteins that control cell proliferation and apoptosis. As expected, based on mapping studies of other bHLH-Zip genes, these loci were well distributed among mouse chromosomes. In addition, some of the probes used in this study detected multiple, independently segregating loci, suggesting the possible existence of additional family members or species-specific pseudogenes. 34 refs., 1 fig., 1 tab.

  9. Gene deregulation and chronic activation in natural killer cells deficient in the transcription factor ETS1.

    PubMed

    Ramirez, Kevin; Chandler, Katherine J; Spaulding, Christina; Zandi, Sasan; Sigvardsson, Mikael; Graves, Barbara J; Kee, Barbara L

    2012-06-29

    Multiple transcription factors guide the development of mature functional natural killer (NK) cells, yet little is known about their function. We used global gene expression and genome-wide binding analyses combined with developmental and functional studies to unveil three roles for the ETS1 transcription factor in NK cells. ETS1 functions at the earliest stages of NK cell development to promote expression of critical transcriptional regulators including T-BET and ID2, NK cell receptors (NKRs) including NKp46, Ly49H, and Ly49D, and signaling molecules essential for NKR function. As a consequence, Ets1(-/-) NK cells fail to degranulate after stimulation through activating NKRs. Nonetheless, these cells are hyperresponsive to cytokines and have characteristics of chronic stimulation including increased expression of inhibitory NKRs and multiple activation-associated genes. Therefore, ETS1 regulates a broad gene expression program in NK cells that promotes target cell recognition while limiting cytokine-driven activation.

  10. Simultaneous live imaging of the transcription and nuclear position of specific genes

    PubMed Central

    Ochiai, Hiroshi; Sugawara, Takeshi; Yamamoto, Takashi

    2015-01-01

    The relationship between genome organization and gene expression has recently been established. However, the relationships between spatial organization, dynamics, and transcriptional regulation of the genome remain unknown. In this study, we developed a live-imaging method for simultaneous measurements of the transcriptional activity and nuclear position of endogenous genes, which we termed the ‘Real-time Observation of Localization and EXpression (ROLEX)’ system. We demonstrated that ROLEX is highly specific and does not affect the expression level of the target gene. ROLEX enabled detection of sub-genome-wide mobility changes that depended on the state of Nanog transactivation in embryonic stem cells. We believe that the ROLEX system will become a powerful tool for exploring the relationship between transcription and nuclear dynamics in living cells. PMID:26092696

  11. Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes.

    PubMed

    Treisman, R; Orkin, S H; Maniatis, T

    1983-04-14

    Transcriptional analysis of five different cloned beta-thalassaemia genes introduced into cultured mammalian cells revealed specific defects in transcription and RNA splicing. A single base change 87 base pairs to the 5' side of the mRNA cap site significantly lowers the level of transcription and therefore appears to represent a promoter mutation. Three genes contain different single base changes in the first intervening sequence (IVS) 5' splice site. One mutation, at IVS1 position 1, inactivates the splice site completely; the other two, at IVS1 positions 5 and 6, reduce its activity. Each mutation activates the same three cryptic splice sites. The fifth gene contains a single base change within IVS2 at position 745, which results in the formation of abnormal beta-globin RNA that contains an extra exon.

  12. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central

    2009-01-01

    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  13. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  14. TET2 promotes histone O-GlcNAcylation during gene transcription

    PubMed Central

    Chen, Qiang; Chen, Yibin; Bian, Chunjing; Fujiki, Ryoji; Yu, Xiaochun

    2012-01-01

    Summary TET enzymes including TET1, 2 and 3 convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC)1 and regulate gene transcription2-5. However, this molecular mechanism by which TET family enzymes regulate gene transcription remains elusive5-6. Here, using protein affinity purification, we searched for functional partners of TET proteins, and found that TET2 and TET3 associate with OGT, an enzyme that by itself catalyzes O-GlcNAcylation in vivo7-8. TET2 directly interacts with OGT, which is important for the chromatin association of OGT in vivo. Although this specific interaction does not regulate the enzymatic activity of TET2, it facilitates OGT-dependent histone O-GlcNAcylation. Moreover, OGT associates with TET2 at transcription starting sites (TSS). Down-regulation of TET2 reduces the amount of H2B S112 GlcNAc marks in vivo, which are associated with gene transcription regulation. Taken together, these results reveal a TET2-dependent O-GlcNAcylation of chromatin. The double epigenetic modifications on both DNA and histones by TET2 and OGT coordinate together for the gene transcription regulation. PMID:23222540

  15. High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

    PubMed Central

    Sidarovich, Viktoryia; Adami, Valentina; Quattrone, Alessandro

    2015-01-01

    Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3' untranslated region (3’ UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3’ UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3’ UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3’ UTR. PMID:25867708

  16. Polycomb recruitment attenuates retinoic acid-induced transcription of the bivalent NR2F1 gene.

    PubMed

    Laursen, Kristian B; Mongan, Nigel P; Zhuang, Yong; Ng, Mary M; Benoit, Yannick D; Gudas, Lorraine J

    2013-07-01

    Polycomb proteins play key roles in mediating epigenetic modifications that occur during cell differentiation. The Polycomb repressive complex 2 (PRC2) mediates the tri-methylation of histone H3 lysine 27 (H3K27me3). In this study, we identify a distinguishing feature of two classes of PRC2 target genes, represented by the Nr2F1 (Coup-TF1) and the Hoxa5 gene, respectively. Both genes are transcriptionally activated by all-trans retinoic acid (RA) and display increased levels of the permissive H3K9/K14ac and tri-methylated histone H3 lysine 4 epigenetic marks in response to RA. However, while in response to RA the PRC2 and H3K27me3 marks are greatly decreased at the Hoxa5 promoter, these marks are initially increased at the Nr2F1 promoter. Functional depletion of the essential PRC2 protein Suz12 by short hairpin RNA (shRNA) technology enhanced the RA-associated transcription of Nr2F1, Nr2F2, Meis1, Sox9 and BMP2, but had no effect on the Hoxa5, Hoxa1, Cyp26a1, Cyp26b1 and RARβ2 transcript levels in wild-type embryonic stem cells. We propose that PRC2 recruitment attenuates the RA-associated transcriptional activation of a subset of genes. Such a mechanism would permit the fine-tuning of transcriptional networks during differentiation.

  17. Stochastic models of gene transcription with upstream drives: exact solution and sample path characterization

    PubMed Central

    2017-01-01

    Gene transcription is a highly stochastic and dynamic process. As a result, the mRNA copy number of a given gene is heterogeneous both between cells and across time. We present a framework to model gene transcription in populations of cells with time-varying (stochastic or deterministic) transcription and degradation rates. Such rates can be understood as upstream cellular drives representing the effect of different aspects of the cellular environment. We show that the full solution of the master equation contains two components: a model-specific, upstream effective drive, which encapsulates the effect of cellular drives (e.g. entrainment, periodicity or promoter randomness) and a downstream transcriptional Poissonian part, which is common to all models. Our analytical framework treats cell-to-cell and dynamic variability consistently, unifying several approaches in the literature. We apply the obtained solution to characterize different models of experimental relevance, and to explain the influence on gene transcription of synchrony, stationarity, ergodicity, as well as the effect of time scales and other dynamic characteristics of drives. We also show how the solution can be applied to the analysis of noise sources in single-cell data, and to reduce the computational cost of stochastic simulations. PMID:28053113

  18. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ

    2005-01-01

    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  19. Genetic and Transcriptional Analyses of the Flagellar Gene Cluster in Actinoplanes missouriensis

    PubMed Central

    Jang, Moon-Sun; Mouri, Yoshihiro; Uchida, Kaoru; Aizawa, Shin-Ichi; Hayakawa, Masayuki; Fujita, Nobuyuki; Tezuka, Takeaki

    2016-01-01

    ABSTRACT Actinoplanes missouriensis, a Gram-positive and soil-inhabiting bacterium, is a member of the rare actinomycetes. The filamentous cells produce sporangia, which contain hundreds of flagellated spores that can swim rapidly for a short period of time until they find niches for germination. These swimming cells are called zoospores, and the mechanism of this unique temporal flagellation has not been elucidated. Here, we report all of the flagellar genes in the bacterial genome and their expected function and contribution for flagellar morphogenesis. We identified a large flagellar gene cluster composed of 33 genes that encode the majority of proteins essential for assembling the functional flagella of Gram-positive bacteria. One noted exception to the cluster was the location of the fliQ gene, which was separated from the cluster. We examined the involvement of four genes in flagellar biosynthesis by gene disruption, fliQ, fliC, fliK, and lytA. Furthermore, we performed a transcriptional analysis of the flagellar genes using RNA samples prepared from A. missouriensis grown on a sporangium-producing agar medium for 1, 3, 6, and 40 days. We demonstrated that the transcription of the flagellar genes was activated in conjunction with sporangium formation. Eleven transcriptional start points of the flagellar genes were determined using the rapid amplification of cDNA 5′ ends (RACE) procedure, which revealed the highly conserved promoter sequence CTCA(N15–17)GCCGAA. This result suggests that a sigma factor is responsible for the transcription of all flagellar genes and that the flagellar structure assembles simultaneously. IMPORTANCE The biology of a zoospore is very interesting from the viewpoint of morphogenesis, survival strategy, and evolution. Here, we analyzed flagellar genes in A. missouriensis, which produces sporangia containing hundreds of flagellated spores each. Zoospores released from the sporangia swim for a short time before germination occurs

  20. RNA editing of androgen receptor gene transcripts in prostate cancer cells.

    PubMed

    Martinez, Harryl D; Jasavala, Rohini J; Hinkson, Izumi; Fitzgerald, Latricia D; Trimmer, James S; Kung, Hsing-Jien; Wright, Michael E

    2008-10-31

    Reactivation of the androgen receptor (AR) signaling pathway represents a critical step in the growth and survival of androgen-independent (AI) prostate cancer (CaP). In this study we show the DU145 and PC3 AI human CaP cell lines respond to androgens and require AR expression for optimal proliferation in vitro. Interestingly, AR gene transcripts in DU145 and PC3 cells harbored a large number of single base pair nucleotide transitions that resulted in missense mutations in selected AR codons. The most notable lesion detected in AR gene transcripts included the oncogenic codon 877T-->A gain-of-function mutation. Surprisingly, AR gene transcript nucleotide transitions were not genome-encoded substitutions, but instead the mutations co-localized to putative A-to-I, U-to-C, C-to-U, and G-to-A RNA editing sites, suggesting the lesions were mediated through RNA editing mechanisms. Higher levels of mRNA encoding the A-to-I RNA editing enzymes ADAR1 and ADARB1 were observed in DU145 and PC3 cells relative to the androgen-responsive LNCaP and 22Rv1 human CaP cell lines, which correlated with higher levels of AR gene transcript A-to-I editing detected in DU145 and PC3 cells. Our results suggest that AR gene transcripts are targeted by different RNA editing enzymes in DU145 and PC3 cells. Thus RNA editing of AR gene transcripts may contribute to the etiology of hormone-refractory phenotypes in advanced stage AI CaP.

  1. Overexpression of mitochondrial uncoupling protein 1 (UCP1) induces a hypoxic response in Nicotiana tabacum leaves

    PubMed Central

    Barreto, Pedro; Okura, Vagner; Pena, Izabella A.; Maia, Renato; Maia, Ivan G.; Arruda, Paulo

    2016-01-01

    Mitochondrial uncoupling protein 1 (UCP1) decreases reactive oxygen species production under stress conditions by uncoupling the electrochemical gradient from ATP synthesis. This study combined transcriptome profiling with experimentally induced hypoxia to mechanistically dissect the impact of Arabidopsis thaliana UCP1 (AtUCP1) overexpression in tobacco. Transcriptomic analysis of AtUCP1-overexpressing (P07) and wild-type (WT) plants was carried out using RNA sequencing. Metabolite and carbohydrate profiling of hypoxia-treated plants was performed using 1H-nuclear magnetic resonance spectroscopy and high-performance anion-exchange chromatography with pulsed amperometric detection. The transcriptome of P07 plants revealed a broad induction of stress-responsive genes that were not strictly related to the mitochondrial antioxidant machinery, suggesting that overexpression of AtUCP1 imposes a strong stress response within the cell. In addition, transcripts that mapped into carbon fixation and energy expenditure pathways were broadly altered. It was found that metabolite markers of hypoxic adaptation, such as alanine and tricarboxylic acid intermediates, accumulated in P07 plants under control conditions at similar rates to WT plants under hypoxia. These findings indicate that constitutive overexpression of AtUCP1 induces a hypoxic response. The metabolites that accumulated in P07 plants are believed to be important in signalling for an improvement in carbon assimilation and induction of a hypoxic response. Under these conditions, mitochondrial ATP production is less necessary and fermentative glycolysis becomes critical to meet cell energy demands. In this scenario, the more flexible energy metabolism along with an intrinsically activated hypoxic response make these plants better adapted to face several biotic and abiotic stresses. PMID:26494730

  2. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  3. Identification of positive and negative transcriptional regulatory elements of the rabbit angiotensin-converting enzyme gene.

    PubMed Central

    Goraya, T Y; Kessler, S P; Kumar, R S; Douglas, J; Sen, G C

    1994-01-01

    The two tissue-specific mRNAs encoding the isozymes of rabbit angiotensin-converting enzyme (ACE) are generated from the same gene by alternative choice of two transcription initiation sites 5.7 kb apart. In the current study, we have characterized the regulatory sites controlling the transcription of the larger pulmonary isozyme mRNA. For this purpose, reporter genes driven by varying lengths of upstream region of the ACE gene were transfected into ACE-producing cells. Our results demonstrated that the transcription of this gene is primarily driven by positive elements within the first 274 bp DNA upstream of the transcription initiation site. The reporter gene driven by this region was expressed in two ACE-producing cells but not in two ACE-non-producing cells thereby establishing its tissue specificity. Our experiments also revealed the existence of a strong negative element located between -692 and -610 positions. This element suppressed the expression of the reporter gene in a dose-dependent and position and orientation-independent fashion thus suggesting that it is a true silencer element. It could also repress the expression of a reporter gene driven by the heterologous strong promoter of the beta-actin gene. The repressing effects of the negative element could be partially overcome by cotransfecting the isolated negative element along with the reporter gene containing the negative element. This result was possibly due to the functional removal of a limiting trans-acting factor which binds to this element. Electrophoretic mobility shift assays revealed that the negative element can form several complexes with proteins present in the nuclear extract of an ACE-producing cell line. At least part of the negative element is strongly conserved in the upstream regions of the human and mouse ACE genes. Images PMID:8165133

  4. Mechanical control of cyclic AMP signalling and gene transcription through integrins

    NASA Technical Reports Server (NTRS)

    Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

    2000-01-01

    This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

  5. Conditional knockdown of target gene expression by tetracycline regulated transcription of double strand RNA.

    PubMed

    Hou, Xubin; Omi, Minoru; Harada, Hidekiyo; Ishii, Shunsuke; Takahashi, Yoshiko; Nakamura, Harukazu

    2011-01-01

    In vivo electroporation has served as an effective tool for the study of developmental biology. Here we report tetracycline inducible gene knockdown by electroporation. Our system consists of genome integration of a cassette encoding long double strand RNA (dsRNA) of a gene of interest by electroporation, transcription of which is assured by RNA polymerase II, and induction of transcription of dsRNA by tetracyclin. Long dsRNA decapped by ribozyme in the cassette and without poly A tail is processed into siRNA within nuclei. We could successfully induce knockdown of En2 and Coactosin by Dox administration.

  6. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  7. Quantitative transcription dynamic analysis reveals candidate genes and key regulators for ethanol tolerance in Saccharomyces cerevisiae

    PubMed Central

    2010-01-01

    Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance and enhanced expressions of

  8. ORTI: An Open-Access Repository of Transcriptional Interactions for Interrogating Mammalian Gene Expression Data

    PubMed Central

    Ma, Xiuquan; Burykin, Timur; James, David E.; Kuncic, Zdenka

    2016-01-01

    Transcription factors (TFs) play a fundamental role in coordinating biological processes in response to stimuli. Consequently, we often seek to determine the key TFs and their regulated target genes (TGs) amidst gene expression data. This requires a knowledge-base of TF-TG interactions, which would enable us to determine the topology of the transcriptional network and predict novel regulatory interactions. To address this, we generated an Open-access Repository of Transcriptional Interactions, ORTI, by integrating available TF-TG interaction databases. These databases rely on different types of experimental evidence, including low-throughput assays, high-throughput screens, and bioinformatics predictions. We have subsequently categorised TF-TG interactions in ORTI according to the quality of this evidence. To demonstrate its capabilities, we applied ORTI to gene expression data and identified modulated TFs using an enrichment analysis. Combining this with pairwise TF-TG interactions enabled us to visualise temporal regulation of a transcriptional network. Additionally, ORTI enables the prediction of novel TF-TG interactions, based on how well candidate genes co-express with known TGs of the target TF. By filtering out known TF-TG interactions that are unlikely to occur within the experimental context, this analysis predicts context-specific TF-TG interactions. We show that this can be applied to experimental designs of varying complexities. In conclusion, ORTI is a rich and publicly available database of experimentally validated mammalian transcriptional interactions which is accompanied with tools that can identify and predict transcriptional interactions, serving as a useful resource for unravelling the topology of transcriptional networks. PMID:27723773

  9. Functional divergence and convergence between the transcript network and gene network in lung adenocarcinoma

    PubMed Central

    Hsu, Min-Kung; Pan, Chia-Lin; Chen, Feng-Chi

    2016-01-01

    Introduction Alternative RNA splicing is a critical regulatory mechanism during tumorigenesis. However, previous oncological studies mainly focused on the splicing of individual genes. Whether and how transcript isoforms are coordinated to affect cellular functions remain underexplored. Also of great interest is how the splicing regulome cooperates with the transcription regulome to facilitate tumorigenesis. The answers to these questions are of fundamental importance to cancer biology. Results Here, we report a comparative study between the transcript-based network (TN) and the gene-based network (GN) derived from the transcriptomes of paired tumor–normal tissues from 77 lung adenocarcinoma patients. We demonstrate that the two networks differ significantly from each other in terms of patient clustering and the number and functions of network modules. Interestingly, the majority (89.5%) of multi-transcript genes have their transcript isoforms distributed in at least two TN modules, suggesting regulatory and functional divergences between transcript isoforms. Furthermore, TN and GN modules share onlŷ50%–60% of their biological functions. TN thus appears to constitute a regulatory layer separate from GN. Nevertheless, our results indicate that functional convergence and divergence both occur between TN and GN, implying complex interactions between the two regulatory layers. Finally, we report that the expression profiles of module members in both TN and GN shift dramatically yet concordantly during tumorigenesis. The mechanisms underlying this coordinated shifting remain unclear yet are worth further explorations. Conclusion We show that in lung adenocarcinoma, transcript isoforms per se are coordinately regulated to conduct biological functions not conveyed by the network of genes. However, the two networks may interact closely with each other by sharing the same or related biological functions. Unraveling the effects and mechanisms of such interactions will

  10. Transcriptional sexual dimorphism in elongating bovine embryos: implications for XCI and sex determination genes.

    PubMed

    Bermejo-Alvarez, P; Rizos, D; Lonergan, P; Gutierrez-Adan, A

    2011-06-01

    Sex chromosome transcripts can lead to a broad transcriptional sexual dimorphism in the absence of concomitant or previous exposure to sex hormones, especially when X-chromosome inactivation (XCI) is not complete. XCI timing has been suggested to differ greatly among species, and in bovine, most of the X-linked transcripts are upregulated in female blastocysts. To determine the timing of XCI, we analyzed in day 14 bovine embryos the sexual dimorphic transcription of seven X-linked genes known to be upregulated in female blastocysts (X24112, brain-expressed X-linked 2 (BEX2), ubiquitin-conjugating enzyme E2A (UBE2A), glucose-6-phosphate dehydrogenase (G6PD), brain-expressed X-linked 1 (BEX1), calpain 6 (CAPN6), and spermidine/spermine N-acetyltransferase 1 (SAT1)). The transcription of five genes whose expression differs between sexes at the blastocyst stage (DNMT3A, interferon tau (IFNT2), glutathione S-transferase mu 3 (GSTM3), progesterone receptor membrane component 1 (PGRMC1), and laminin alpha 1 (LAMA1)) and four genes related with sex determination (Wilms tumor 1 (WT1), gata binding protein 4 (GATA4), zinc finger protein multitype 2 (ZFPM2), and DMRT1) was also analyzed to determine the evolution of transcriptional sexual dimorphism. The expression level of five X-linked transcripts was effectively equalized among sexes suggesting that, in cattle, a substantial XCI occurs during the period between blastocyst hatching and initiation of elongation, although UBE2A and SAT1 displayed significant transcriptional differences. Similarly, sexual dimorphism was also reduced for autosomal genes with only DNMT3A and IFNT2 exhibiting sex-related differences. Among the genes potentially involved in sex determination, Wilms tumor 1 (WT1) was significantly upregulated in males and GATA4 in females, whereas no differences were observed for ZFPM2 and DMRT1. In conclusion, a major XCI occurred between the blastocyst and early elongation stages leading to a reduction in the

  11. Transcript abundance supercedes editing efficiency as a factor in developmental variation of chloroplast gene expression.

    PubMed Central

    Peeters, Nemo M; Hanson, Maureen R

    2002-01-01

    In maize plastids, transcripts are known to be modified at 27 C-to-U RNA editing sites, affecting the expression-of 15 different genes. The relative contribution of editing efficiency versus transcript abundance in regulation of chloroplast gene expression has previously been analyzed for only a few genes. We undertook a comprehensive analysis of the editing efficiency of each of the 27 maize editing sites in 10 different maize tissues, which contain a range of plastid types including chloroplasts, etioplasts, and amyloplasts. Using a reproducible poisoned primer extension assay, we detected variation between RNA editing extent of different sites in the same transcript in the same tissue, and between the same site in different tissues. The most striking editing deficiency is in an editing site in ndhB that is edited at only 8% and 1% in roots and callus plastids respectively, whereas green leaf chloroplasts edit this site at 100%. Editing efficiencies of some sites are not affected by the developmental stages we examined and are always edited close to 80-100%. The relative amounts of transcripts of each of the 10 genes that exhibited variable editing extents were determined by real-time PCR. Seven genes exhibited over 100 times lower transcript abundance in either roots or tissue-cultured cells relative to green leaf tissue. The quantitative analysis indicates that a particular editing site can be efficiently edited over a large range of transcript abundance, resulting in no general correlation of transcript abundance and editing extent. The independent variation of editing efficiency of different sites within the same transcript fits with a model that postulates individual trans-acting factors specific to each editing site. Because tissues where editing efficiency at certain sites is low invariably also exhibited greatly decreased abundance of the transcripts carrying those sites, decrease in the amounts of particular RNAs rather than a lack of editing is

  12. E2F Transcription Factors Control the Roller Coaster Ride of Cell Cycle Gene Expression.

    PubMed

    Thurlings, Ingrid; de Bruin, Alain

    2016-01-01

    Initially, the E2F transcription factor was discovered as a factor able to bind the adenovirus E2 promoter and activate viral genes. Afterwards it was shown that E2F also binds to promoters of nonviral genes such as C-MYC and DHFR, which were already known at that time to be important for cell growth and DNA metabolism, respectively. These findings provided the first clues that the E2F transcription factor might be an important regulator of the cell cycle. Since this initial discovery in 1987, several additional E2F family members have been identified, and more than 100 targets genes have been shown to be directly regulated by E2Fs, the majority of these are important for controlling the cell cycle. The progression of a cell through the cell cycle is accompanied with the increased expression of a specific set of genes during one phase of the cell cycle and the decrease of the same set of genes during a later phase of the cell cycle. This roller coaster ride, or oscillation, of gene expression is essential for the proper progression through the cell cycle to allow accurate DNA replication and cell division. The E2F transcription factors have been shown to be critical for the temporal expression of the oscillating cell cycle genes. This review will focus on how the oscillation of E2Fs and their targets is regulated by transcriptional, post-transcriptional and post-translational mechanism in mammals, yeast, flies, and worms. Furthermore, we will discuss the functional impact of E2Fs on the cell cycle progression and outline the consequences when E2F expression is disturbed.

  13. Abundances of crenarchaeal amoA genes and transcripts in the Pacific Ocean

    PubMed Central

    Church, Matthew J; Wai, Brenner; Karl, David M; DeLong, Edward F

    2010-01-01

    Planktonic Crenarchaea are thought to play a key role in chemolithotrophic ammonia oxidation, a critical step of the marine nitrogen (N) cycle. In this study, we examined the spatial distributions of ammonia-oxidizing Crenarchaea across a large (∼5200 km) region of the central Pacific Ocean. Examination of crenarchaeal 16S rRNA, ammonia monooxygenase subunit A (amoA) genes, and amoA transcript abundances provided insight into their spatial distributions and activities. Crenarchaeal gene abundances increased three to four orders of magnitude with depth between the upper ocean waters and dimly lit waters of the mesopelagic zone. The resulting median value of the crenarchaeal amoA: 16S rRNA gene ratio was 1.3, suggesting the majority of Crenarchaea in the epi- and mesopelagic regions of the Pacific Ocean have the metabolic machinery for ammonia oxidation. Crenarchaeal amoA transcript abundances typically increased one to two orders of magnitude in the transitional zone separating the epipelagic waters from the mesopelagic (100–200 m), before decreasing into the interior of the mesopelagic zone. The resulting gene copy normalized transcript abundances revealed elevated amoA expression in the upper ocean waters (0–100 m) where crenarchaeal abundances were low, with transcripts decreasing into the mesopelagic zone as crenarchaeal gene abundances increased. These results suggest ammonia-oxidizing Crenarchaea are active contributors to the N cycle throughout the epi- and mesopelagic waters of the Pacific Ocean. PMID:20002133

  14. Activation of tissue plasminogen activator gene transcription by Neovastat, a multifunctional antiangiogenic agent.

    PubMed

    Gingras, Denis; Nyalendo, Carine; Di Tomasso, Geneviève; Annabi, Borhane; Béliveau, Richard

    2004-07-16

    We recently reported that Neovastat, an antiangiogenic drug that is currently undergoing Phase III clinical trials for the treatment of non-small cell lung cancer, may inhibit angiogenesis through an increase in tPA activity. Here, we show that Neovastat also stimulates tPA gene transcription in endothelial cells, in a TNFalpha-like manner. RT-PCR analysis and gene reporter assays using the human tPA promoter indicated that upregulation of the tPA gene transcription by both Neovastat and TNFalpha was correlated with the phosphorylation of JNK1/2 and of IkappaB and that SP600125 and BAY11-7082, inhibitors of JNK and IkappaK, respectively, inhibit the increase of tPA gene transcription induced by Neovastat and TNFalpha. These results suggest that Neovastat induces tPA gene transcription through activation of the JNK and NFkappaB signaling pathways, leading to an increase of tPA secretion by endothelial cells. This may lead to the localized destruction of the fibrin provisional matrix that is necessary for neovessel formation and thus contribute to the reported antiangiogenic properties of this compound.

  15. Restriction of histone gene transcription to S phase by phosphorylation of a chromatin boundary protein

    PubMed Central

    Kurat, Christoph F.; Lambert, Jean-Philippe; van Dyk, Dewald; Tsui, Kyle; van Bakel, Harm; Kaluarachchi, Supipi; Friesen, Helena; Kainth, Pinay; Nislow, Corey; Figeys, Daniel; Fillingham, Jeffrey; Andrews, Brenda J.

    2011-01-01

    The cell cycle-regulated expression of core histone genes is required for DNA replication and proper cell cycle progression in eukaryotic cells. Although some factors involved in histone gene transcription are known, the molecular mechanisms that ensure proper induction of histone gene expression during S phase remain enigmatic. Here we demonstrate that S-phase transcription of the model histone gene HTA1 in yeast is regulated by a novel attach–release mechanism involving phosphorylation of the conserved chromatin boundary protein Yta7 by both cyclin-dependent kinase 1 (Cdk1) and casein kinase 2 (CK2). Outside S phase, integrity of the AAA-ATPase domain is required for Yta7 boundary function, as defined by correct positioning of the histone chaperone Rtt106 and the chromatin remodeling complex RSC. Conversely, in S phase, Yta7 is hyperphosphorylated, causing its release from HTA1 chromatin and productive transcription. Most importantly, abrogation of Yta7 phosphorylation results in constitutive attachment of Yta7 to HTA1 chromatin, preventing efficient transcription post-recruitment of RNA polymerase II (RNAPII). Our study identified the chromatin boundary protein Yta7 as a key regulator that links S-phase kinases with RNAPII function at cell cycle-regulated histone gene promoters. PMID:22156209

  16. Restriction of histone gene transcription to S phase by phosphorylation of a chromatin boundary protein.

    PubMed

    Kurat, Christoph F; Lambert, Jean-Philippe; van Dyk, Dewald; Tsui, Kyle; van Bakel, Harm; Kaluarachchi, Supipi; Friesen, Helena; Kainth, Pinay; Nislow, Corey; Figeys, Daniel; Fillingham, Jeffrey; Andrews, Brenda J

    2011-12-01

    The cell cycle-regulated expression of core histone genes is required for DNA replication and proper cell cycle progression in eukaryotic cells. Although some factors involved in histone gene transcription are known, the molecular mechanisms that ensure proper induction of histone gene expression during S phase remain enigmatic. Here we demonstrate that S-phase transcription of the model histone gene HTA1 in yeast is regulated by a novel attach-release mechanism involving phosphorylation of the conserved chromatin boundary protein Yta7 by both cyclin-dependent kinase 1 (Cdk1) and casein kinase 2 (CK2). Outside S phase, integrity of the AAA-ATPase domain is required for Yta7 boundary function, as defined by correct positioning of the histone chaperone Rtt106 and the chromatin remodeling complex RSC. Conversely, in S phase, Yta7 is hyperphosphorylated, causing its release from HTA1 chromatin and productive transcription. Most importantly, abrogation of Yta7 phosphorylation results in constitutive attachment of Yta7 to HTA1 chromatin, preventing efficient transcription post-recruitment of RNA polymerase II (RNAPII). Our study identified the chromatin boundary protein Yta7 as a key regulator that links S-phase kinases with RNAPII function at cell cycle-regulated histone gene promoters.

  17. 20-Hydroxyecdysone stimulates the accumulation of translatable yolk polypeptide gene transcript in adult male Drosophila melanogaster.

    PubMed

    Shirk, P D; Minoo, P; Postlethwait, J H

    1983-01-01

    Yolk polypeptide (YP) synthesis is hormonally stimulated during maturation of adult female Drosophila melanogaster. Synthesis of the three YPs is sex specific and occurs in fat body cells and follicle cells of adult females. However, males have been shown to produce YPs when treated with the steroid hormone 20-hydroxyecdysone (20-HE). By using a cell-free translation system as an assay for YP mRNA, we found that 20-HE also causes the accumulation of translatable YP message in males. In addition, hybridization of cloned copies of genes for both YP1 and YP3 to total RNA from males showed that 20-HE caused the appearance of YP gene transcripts in males. Eight hours after treatment of males with 20-HE, YP gene transcript levels had increased at least 25-fold to approximately 2.7 x 10(6) copies of YP1 gene transcript per adult male fly. In normal adult females, there were 42 x 10(6) copies per fly by 24 hr. There was neither detectable YP synthesis nor translatable YP gene transcript in either normal 1- to 3-day-old males or 24-hr-old males treated with a juvenile hormone analogue. This evidence shows that 20-HE acts to regulate the levels of translatable YP mRNA in male Drosophila.

  18. Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition

    PubMed Central

    Deniaud, Emmanuelle; Baguet, Joël; Chalard, Roxane; Blanquier, Bariza; Brinza, Lilia; Meunier, Julien; Michallet, Marie-Cécile; Laugraud, Aurélie; Ah-Soon, Claudette; Wierinckx, Anne; Castellazzi, Marc; Lachuer, Joël; Gautier, Christian

    2009-01-01

    Background The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. Methodology and Principal Findings We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. Conclusion This study shows that the binding to DNA of overexpressed Sp1

  19. Cloning, sequencing and transcriptional analysis of the Choristoneura fumiferana entomopoxvirus spheroidin gene.

    PubMed

    Li, X; Barrett, J W; Yuen, L; Arif, B M

    1997-02-01

    The Choristoneura fumiferana entomopoxvirus (CfEPV) spheroidin gene was identified and localized on three XbaI restriction fragments (total size 4.73 kb). The fragments were cloned and sequenced. The spheroidin gene had an open reading frame of 2997 nucleotides encoding a putative protein with a predicted size of 115 kDa. Sequence analysis indicated that the putative protein contained 14 potential N-glycosylation sites (Asn-X-Thr; Asn-X-Ser), that are probably not used since the protein migrates on SDS-PAGE as a 115 kDa band. The protein is rich in cysteine residues (34), which explains the need for reducing agents when dissolving the occlusion bodies with alkali. The spheroidin gene sequence contains motifs characteristic of the late genes of poxviruses. These include the typical TAAATG sequence at the beginning of the coding region and two early gene termination signals (TTTTTNT) in the untranslated region of the gene. The promoter region has three TAA termination signals immediately upstream of the ATG start site. Spheroidin (SPH) appears to be conserved among different EPVs. There was 82.2% identity and 97.2% similarity at the amino acid level between the SPHs of CfEPV and Amsacta moorei EPV. Less conservation was seen with the SPH from Melolontha melolontha EPV (39.8% identity and 73.4% similarity). Transcriptional analyses of the spheroidin gene by Northern blots showed that the transcript had a size of approximately 3 kb, which is in agreement with the length of the ORF. Primer extension results, anchor PCR and sequencing confirmed that there was a poly (A)17 tract at the 5' end of the spheroidin gene transcript, a structure typical of late gene transcripts of poxviruses.

  20. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.

    PubMed

    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M

    2016-11-01

    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp.

  1. Cloning and transcriptional regulation of genes responsible for synthesis of gangliosides.

    PubMed

    Zeng, Guichao; Yu, Robert K

    2008-04-01

    Ganglioside synthases are glycosyltransferases involved in the biosynthesis of glycoconjugates. A number of ganglioside synthase genes have been cloned and characterized. They are classified into different families of glycosyltransferases based on similarities of their amino acid sequences. Tissue-specific expression of these genes has been analyzed by hybridization using cDNA fragments. Enzymatic characterization with the expressed recombinant enzymes showed these enzymes differ in their donor and acceptor substrate specificities and other biochemical parameters. In vitro enzymatic analysis also showed that one linkage can be synthesized by multiple enzymes and one enzyme may be responsible for synthesis of multiple gangliosides. Following the cloning of the ganglioside synthase genes, the promoters of the key synthase genes in the ganglioside biosynthetic pathway have been cloned and analyzed. All of the promoters are TATA-less, lacking a CCAAT box but containing GC-rich boxes, characteristic of the house-keeping genes, although transcription of ganglioside synthase genes is subject to complex developmental and tissue-specific regulation. A set of cis-acting elements and transcription factors, including Sp1, AP2, and CREB, function in the proximal promoters. Negative-regulatory regions have also been defined in most of the promoters. We present here an overview of these genes and their transcriptional regulation.

  2. Targetfinder.org: a resource for systematic discovery of transcription factor target genes

    PubMed Central

    Kiełbasa, Szymon M.; Blüthgen, Nils; Fähling, Michael

    2010-01-01

    Targetfinder.org (http://targetfinder.org/) provides a web-based resource for finding genes that show a similar expression pattern to a group of user-selected genes. It is based on a large-scale gene expression compendium (>1200 experiments, >13 000 genes). The primary application of Targetfinder.org is to expand a list of known transcription factor targets by new candidate target genes. The user submits a group of genes (the ‘seed’), and as a result the web site provides a list of other genes ranked by similarity of their expression to the expression of the seed genes. Additionally, the web site provides information on a recovery/cross-validation test to check for consistency of the provided seed and the quality of the ranking. Furthermore, the web site allows to analyse affinities of a selected transcription factor to the promoter regions of the top-ranked genes in order to select the best new candidate target genes for further experimental analysis. PMID:20460454

  3. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    Eichenberger, Patrick; Fujita, Masaya; Jensen, Shane T; Conlon, Erin M; Rudner, David Z; Wang, Stephanie T; Ferguson, Caitlin; Haga, Koki; Sato, Tsutomu; Liu, Jun S

    2004-01-01

    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK . Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  4. Concurrent Growth Rate and Transcript Analyses Reveal Essential Gene Stringency in Escherichia coli

    PubMed Central

    Goh, Shan; Boberek, Jaroslaw M.; Nakashima, Nobutaka; Stach, Jem; Good, Liam

    2009-01-01

    Background Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. Methodology/Principal Findings Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA) and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL50). When applied to four growth essential genes, both RNA silencing methods resulted in MTL50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. Conclusions RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement. PMID:19557168

  5. Transcriptional dysregulation of coding and non-coding genes in cellular models of Huntington's disease.

    PubMed

    Bithell, Angela; Johnson, Rory; Buckley, Noel J

    2009-12-01

    HD (Huntington's disease) is a late onset heritable neurodegenerative disorder that is characterized by neuronal dysfunction and death, particularly in the cerebral cortex and medium spiny neurons of the striatum. This is followed by progressive chorea, dementia and emotional dysfunction, eventually resulting in death. HD is caused by an expanded CAG repeat in the first exon of the HD gene that results in an abnormally elongated polyQ (polyglutamine) tract in its protein product, Htt (Huntingtin). Wild-type Htt is largely cytoplasmic; however, in HD, proteolytic N-terminal fragments of Htt form insoluble deposits in both the cytoplasm and nucleus, provoking the idea that mutHtt (mutant Htt) causes transcriptional dysfunction. While a number of specific transcription factors and co-factors have been proposed as mediators of mutHtt toxicity, the causal relationship between these Htt/transcription factor interactions and HD pathology remains unknown. Previous work has highlighted REST [RE1 (repressor element 1)-silencing transcription factor] as one such transcription factor. REST is a master regulator of neuronal genes, repressing their expression. Many of its direct target genes are known or suspected to have a role in HD pathogenesis, including BDNF (brain-derived neurotrophic factor). Recent evidence has also shown that REST regulates transcription of regulatory miRNAs (microRNAs), many of which are known to regulate neuronal gene expression and are dysregulated in HD. Thus repression of miRNAs constitutes a second, indirect mechanism by which REST can alter the neuronal transcriptome in HD. We will describe the evidence that disruption to the REST regulon brought about by a loss of interaction between REST and mutHtt may be a key contributory factor in the widespread dysregulation of gene expression in HD.

  6. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  7. Precision of Readout at the hunchback Gene: Analyzing Short Transcription Time Traces in Living Fly Embryos

    PubMed Central

    Tran, Huy; Ferraro, Teresa; Lucas, Tanguy; Guillou, Aurelien; Coppey, Mathieu; Dostatni, Nathalie

    2016-01-01

    The simultaneous expression of the hunchback gene in the numerous nuclei of the developing fly embryo gives us a unique opportunity to study how transcription is regulated in living organisms. A recently developed MS2-MCP technique for imaging nascent messenger RNA in living Drosophila embryos allows us to quantify the dynamics of the developmental transcription process. The initial measurement of the morphogens by the hunchback promoter takes place during very short cell cycles, not only giving each nucleus little time for a precise readout, but also resulting in short time traces of transcription. Additionally, the relationship between the measured signal and the promoter state depends on the molecular design of the reporting probe. We develop an analysis approach based on tailor made autocorrelation functions that overcomes the short trace problems and quantifies the dynamics of transcription initiation. Based on live imaging data, we identify signatures of bursty transcription initiation from the hunchback promoter. We show that the precision of the expression of the hunchback gene to measure its position along the anterior-posterior axis is low both at the boundary and in the anterior even at cycle 13, suggesting additional post-transcriptional averaging mechanisms to provide the precision observed in fixed embryos. PMID:27942043

  8. Regulation of gene expression by manipulating transcriptional repressor activity using a novel CoSRI technology.

    PubMed

    Xu, Yue; Li, Song Feng; Parish, Roger W

    2016-12-20

    Targeted gene manipulation is a central strategy for studying gene function and identifying related biological processes. However, a methodology for manipulating the regulatory motifs of transcription factors is lacking as these factors commonly possess multiple motifs (eg. repression and activation motifs) which collaborate with each other to regulate multiple biological processes. We describe a novel approach designated Conserved Sequence-guided Repressor Inhibition (CoSRI) that can specifically reduce or abolish the repressive activities of transcription factors in vivo. The technology was evaluated using the chimeric MYB80-EAR transcription factor and subsequently the endogenous WUS transcription factor. The technology was employed to develop a reversible male sterility system applicable to hybrid seed production. In order to determine the capacity of the technology to regulate the activity of endogenous transcription factors, the WUS repressor was chosen. The WUS repression motif could be inhibited in vivo and the transformed plants exhibited the wus-1 phenotype. Consequently, the technology can be used to manipulate the activities of transcriptional repressor motifs regulating beneficial traits in crop plants and other eukaryotic organisms. This article is protected by copyright. All rights reserved.

  9. Role of EctR as transcriptional regulator of ectoine biosynthesis genes in Methylophaga thalassica.

    PubMed

    Mustakhimov, I I; Reshetnikov, A S; Fedorov, D N; Khmelenina, V N; Trotsenko, Y A

    2012-08-01

    In the halophilic aerobic methylotrophic bacterium Methylophaga thalassica, the genes encoding the enzymes for biosynthesis of the osmoprotectant ectoine were shown to be located in operon ectABC-ask. Transcription of the ect-operon was started from the two promoters homologous to the σ(70)-dependent promoter of Escherichia coli and regulated by protein EctR, whose encoding gene, ectR, is transcribed from three promoters. Genes homologous to ectR of methylotrophs were found in clusters of ectoine biosynthesis genes in some non-methylotrophic halophilic bacteria. EctR proteins of methylotrophic and heterotrophic halophiles belong to the MarR-family of transcriptional regulators but form a separate branch on the phylogenetic tree of the MarR proteins.

  10. Wnt signaling induces transcription, spatial proximity, and translocation of fusion gene partners in human hematopoietic cells.

    PubMed

    Ugarte, Giorgia D; Vargas, Macarena F; Medina, Matías A; León, Pablo; Necuñir, David; Elorza, Alvaro A; Gutiérrez, Soraya E; Moon, Randall T; Loyola, Alejandra; De Ferrari, Giancarlo V

    2015-10-08

    Chromosomal translocations are frequently associated with a wide variety of cancers, particularly hematologic malignancies. A recurrent chromosomal abnormality in acute myeloid leukemia is the reciprocal translocation t(8;21) that fuses RUNX1 and ETO genes. We report here that Wnt/β-catenin signaling increases the expression of ETO and RUNX1 genes in human hematopoietic progenitors. We found that β-catenin is rapidly recruited into RNA polymerase II transcription factories (RNAPII-Ser5) and that ETO and RUNX1 genes are brought into close spatial proximity upon Wnt3a induction. Notably, long-term treatment of cells with Wnt3a induces the generation a frequent RUNX1-ETO translocation event. Thus, Wnt/β-catenin signaling induces transcription and translocation of RUNX1 and ETO fusion gene partners, opening a novel window to understand the onset/development of leukemia.

  11. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway.

  12. CITA/NLRC5: A critical transcriptional regulator of MHC class I gene expression.

    PubMed

    Downs, Isaac; Vijayan, Saptha; Sidiq, Tabasum; Kobayashi, Koichi S

    2016-07-08

    Major histocompatibility complex (MHC) class I and class II molecules play essential roles in the development and activation of the human adaptive immune system. An NLR protein, CIITA (MHC class II transactivator) has been recognized as a master regulator of MHC class II gene expression, albeit knowledge about the regulatory mechanism of MHC class I gene expression had been limited. Recently identified MHC class I transactivator (CITA), or NLRC5, also belongs to the NLR protein family and constitutes a critical regulator for the transcriptional activation of MHC class I genes. In addition to MHC class I genes, CITA/NLRC5 induces the expression of β2 -microglobulin, TAP1 and LMP2, essential components of the MHC class I antigen presentation pathway. Therefore, CITA/NLRC5 and CIITA are transcriptional regulators that orchestrate the concerted expression of critical components in the MHC class I and class II pathways, respectively. © 2016 BioFactors, 42(4):349-357, 2016.

  13. Restarting Lytic Gene Transcription at the Onset of Herpes Simplex Virus Reactivation.

    PubMed

    Cliffe, Anna R; Wilson, Angus C

    2017-01-15

    Herpes simplex virus (HSV) establishes a latent reservoir in neurons of human peripheral nerves. In this quiescent state, the viral genome persists as a circular, histone-associated episome, and transcription of viral lytic cycle genes is largely suppressed through epigenetic processes. Periodically, latent virus undergoes reactivation whereby lytic genes are activated and viral replication occurs. In this Gem, we review recent evidence that mechanisms governing the initial transcription of lytic genes are distinct from those of de novo infection and directly link reactivation to neuronal stress response pathways. We also discuss evidence that lytic cycle gene expression can be uncoupled from the full reactivation program, arguing for a less sharply bimodal definition of latency.

  14. Synchronous activation of gonadotropin-releasing hormone gene transcription and secretion by pulsatile kisspeptin stimulation

    PubMed Central

    Choe, Han Kyoung; Kim, Hee-Dae; Park, Sung Ho; Lee, Han-Woong; Park, Jae-Yong; Seong, Jae Young; Lightman, Stafford L.; Son, Gi Hoon; Kim, Kyungjin

    2013-01-01

    Pulsatile release of hypothalamic gonadotropin-releasing hormone (GnRH) is essential for pituitary gonadotrope function. Although the importance of pulsatile GnRH secretion has been recognized for several decades, the mechanisms underlying GnRH pulse generation in hypothalamic neural networks remain elusive. Here, we demonstrate the ultradian rhythm of GnRH gene transcription in single GnRH neurons using cultured hypothalamic slices prepared from transgenic mice expressing a GnRH promoter-driven destabilized luciferase reporter. Although GnRH promoter activity in each GnRH neuron exhibited an ultradian pattern of oscillations with a period of ∼10 h, GnRH neuronal cultures exhibited partially synchronized bursts of GnRH transcriptional activity at ∼2-h intervals. Surprisingly, pulsatile administration of kisspeptin, a potent GnRH secretagogue, evoked dramatic synchronous activation of GnRH gene transcription with robust stimulation of pulsatile GnRH secretion. We also addressed the issue of hierarchical interaction between the circadian and ultradian rhythms by using Bmal1-deficient mice with defective circadian clocks. The circadian molecular oscillator barely affected basal ultradian oscillation of GnRH transcription but was heavily involved in kisspeptin-evoked responses of GnRH neurons. In conclusion, we have clearly shown synchronous bursts of GnRH gene transcription in the hypothalamic GnRH neuronal population in association with episodic neurohormone secretion, thereby providing insight into GnRH pulse generation. PMID:23509283

  15. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences

    PubMed Central

    Soneson, Charlotte; Love, Michael I.; Robinson, Mark D.

    2016-01-01

    High-throughput sequencing of cDNA (RNA-seq) is used extensively to characterize the transcriptome of cells. Many transcriptomic studies aim at comparing either abundance levels or the transcriptome composition between given conditions, and as a first step, the sequencing reads must be used as the basis for abundance quantification of transcriptomic features of interest, such as genes or transcripts. Various quantification approaches have been proposed, ranging from simple counting of reads that overlap given genomic regions to more complex estimation of underlying transcript abundances. In this paper, we show that gene-level abundance estimates and statistical inference offer advantages over transcript-level analyses, in terms of performance and interpretability. We also illustrate that the presence of differential isoform usage can lead to inflated false discovery rates in differential gene expression analyses on simple count matrices but that this can be addressed by incorporating offsets derived from transcript-level abundance estimates. We also show that the problem is relatively minor in several real data sets. Finally, we provide an R package ( tximport) to help users integrate transcript-level abundance estimates from common quantification pipelines into count-based statistical inference engines. PMID:26925227

  16. TRIM33 switches off Ifnb1 gene transcription during the late phase of macrophage activation

    PubMed Central

    Ferri, Federica; Parcelier, Aude; Petit, Vanessa; Gallouet, Anne-Sophie; Lewandowski, Daniel; Dalloz, Marion; van den Heuvel, Anita; Kolovos, Petros; Soler, Eric; Squadrito, Mario Leonardo; De Palma, Michele; Davidson, Irwin; Rousselet, Germain; Romeo, Paul-Henri

    2015-01-01

    Despite its importance during viral or bacterial infections, transcriptional regulation of the interferon-β gene (Ifnb1) in activated macrophages is only partially understood. Here we report that TRIM33 deficiency results in high, sustained expression of Ifnb1 at late stages of toll-like receptor-mediated activation in macrophages but not in fibroblasts. In macrophages, TRIM33 is recruited by PU.1 to a conserved region, the Ifnb1 Control Element (ICE), located 15 kb upstream of the Ifnb1 transcription start site. ICE constitutively interacts with Ifnb1 through a TRIM33-independent chromatin loop. At late phases of lipopolysaccharide activation of macrophages, TRIM33 is bound to ICE, regulates Ifnb1 enhanceosome loading, controls Ifnb1 chromatin structure and represses Ifnb1 gene transcription by preventing recruitment of CBP/p300. These results characterize a previously unknown mechanism of macrophage-specific regulation of Ifnb1 transcription whereby TRIM33 is critical for Ifnb1 gene transcription shutdown. PMID:26592194

  17. TRIM33 switches off Ifnb1 gene transcription during the late phase of macrophage activation.

    PubMed

    Ferri, Federica; Parcelier, Aude; Petit, Vanessa; Gallouet, Anne-Sophie; Lewandowski, Daniel; Dalloz, Marion; van den Heuvel, Anita; Kolovos, Petros; Soler, Eric; Squadrito, Mario Leonardo; De Palma, Michele; Davidson, Irwin; Rousselet, Germain; Romeo, Paul-Henri

    2015-11-23

    Despite its importance during viral or bacterial infections, transcriptional regulation of the interferon-β gene (Ifnb1) in activated macrophages is only partially understood. Here we report that TRIM33 deficiency results in high, sustained expression of Ifnb1 at late stages of toll-like receptor-mediated activation in macrophages but not in fibroblasts. In macrophages, TRIM33 is recruited by PU.1 to a conserved region, the Ifnb1 Control Element (ICE), located 15 kb upstream of the Ifnb1 transcription start site. ICE constitutively interacts with Ifnb1 through a TRIM33-independent chromatin loop. At late phases of lipopolysaccharide activation of macrophages, TRIM33 is bound to ICE, regulates Ifnb1 enhanceosome loading, controls Ifnb1 chromatin structure and represses Ifnb1 gene transcription by preventing recruitment of CBP/p300. These results characterize a previously unknown mechanism of macrophage-specific regulation of Ifnb1 transcription whereby TRIM33 is critical for Ifnb1 gene transcription shutdown.

  18. Signal-dependent Elk-1 target genes involved in transcript processing and cell migration.

    PubMed

    Kasza, Aneta

    2013-10-01

    Elk-1 was regarded as a transcription factor engaged mainly in the regulation of cell growth, differentiation, and survival. Recent findings show the engagement of Elk-1 in the control of expression of genes encoding proteins involved in transcript turnover, such as MCPIP1/ZC3H12A and tristetraprolin (TTP/ZFP36). Thus, Elk-1 plays an important role in the control of gene expression not only through the stimulation of expression of transcription factors, but also through regulation of transcript half-live. Moreover, Elk-1 is engaged in the regulation of expression of genes encoding proteins that control proteolytic activity, such as inhibitor of plasminogen activator-1 (PAI-1) and metalloproteinases-2 and -9 (MMP-2 and MMP-9). This review summarizes the biological roles of proteins with expression regulated by Elk-1, involved in transcripts turnover or in cell migration. The broad range of function of these proteins illustrates the complex role of Elk-1 in the regulation of cancer and inflammation.

  19. Regulating expression of cell and tissue-specific genes by modifying transcription

    SciTech Connect

    Beachy, Roger N; Dai, Shunhong

    2010-06-14

    Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Rice bZIP transcription factors RF2a, RF2b and RLP1 play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV), through their interactions with the Box II essential cis element located in the promoter (Dai et al., 2006., Dai et al., 2004., Yin et al., 1997). RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. It is equally as important to recognize that these proteins control plant development by regulating differentiation and/or function of the vascular tissues. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins will not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants. We have proposed characterize the function domains of RF2a, RF2b and RLP1 and explore the biological function of the transcription repressor RLP1.

  20. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases.

    PubMed

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-03-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals.

  1. Targeted Editing of Myostatin Gene in Sheep by Transcription Activator-like Effector Nucleases

    PubMed Central

    Zhao, Xinxia; Ni, Wei; Chen, Chuangfu; Sai, Wujiafu; Qiao, Jun; Sheng, Jingliang; Zhang, Hui; Li, Guozhong; Wang, Dawei; Hu, Shengwei

    2016-01-01

    Myostatin (MSTN) is a secreted growth factor expressed in skeletal muscle and adipose tissue that negatively regulates skeletal muscle mass. Gene knockout of MSTN can result in increasing muscle mass in sheep. The objectives were to investigate whether myostatin gene can be edited in sheep by transcription activator-like effector nucleases (TALENs) in tandem with single-stranded DNA oligonucleotides (ssODNs). We designed a pair of TALENs to target a highly conserved sequence in the coding region of the sheep MSTN gene. The activity of the TALENs was verified by using luciferase single-strand annealing reporter assay in HEK 293T cell line. Co-transfection of TALENs and ssODNs oligonucleotides induced precise gene editing of myostatin gene in sheep primary fibroblasts. MSTN gene-edited cells were successfully used as nuclear donors for generating cloned embryos. TALENs combined with ssDNA oligonucleotides provide a useful approach for precise gene modification in livestock animals. PMID:26950874

  2. Transformation by homeobox genes can be mediated by selective transcriptional repression.

    PubMed Central

    Qin, X F; Luo, Y; Suh, H; Wayne, J; Misulovin, Z; Roeder, R G; Nussenzweig, M C

    1994-01-01

    Altered transcription is a recurrent theme in the field of cancer biology. But despite the central role of transcription in transformation, little is known about the mechanism by which dominant nuclear oncogenes induce malignancies. Homeobox family proteins are prominent examples of transcriptional regulators which control development and can function as oncogenes. Here we explore the molecular basis for transformation by this class of regulators using Oct-2 and Oct-1. We show that the DNA binding POU domains of these proteins are selective and sequence-specific transcriptional repressors that produce malignant lymphomas when they are expressed in T cells of transgenic mice. Mutagenesis experiments identified a specific set of promoters, those containing octamer regulatory elements, as the targets for transformation by selective inhibition of gene expression. Images PMID:7813434

  3. Space exploration by the promoter of a long human gene during one transcription cycle.

    PubMed

    Larkin, Joshua D; Papantonis, Argyris; Cook, Peter R; Marenduzzo, Davide

    2013-02-01

    An RNA polymerase has been thought to transcribe by seeking out a promoter, initiating and then tracking down the template. We add tumor necrosis factor α to primary human cells, switch on transcription of a 221-kb gene and monitor promoter position during the ensuing transcription cycle (using RNA fluorescence in situ hybridization coupled to super-resolution localization, chromosome conformation capture and Monte Carlo simulations). Results are consistent with a polymerase immobilized in a 'factory' capturing a promoter and reeling in the template, as the transcript and promoter are extruded. Initially, the extruded promoter is tethered close to the factory and so likely to re-initiate; later, the tether becomes long enough to allow re-initiation in another factory. We suggest close tethering underlies enhancer function and transcriptional 'bursting'.

  4. Transcriptional heterogeneity in the lactase gene within cell-type is linked to the epigenome

    PubMed Central

    Oh, Edward; Jeremian, Richie; Oh, Gabriel; Groot, Daniel; Susic, Miki; Lee, KwangHo; Foy, Kelly; Laird, Peter W.; Petronis, Arturas; Labrie, Viviane

    2017-01-01

    Transcriptional variation in histologically- and genetically- identical cells is a widespread phenomenon in tissues, yet the processes conferring this heterogeneity are not well understood. To identify contributing factors, we analyzed epigenetic profiles associated with the in vivo transcriptional gradient of the mouse lactase gene (Lct), which occurs in enterocytes along the proximal-to-distal axis of the small intestine. We found that epigenetic signatures at enhancer and promoter elements aligns with transcriptional variation of Lct in enterocytes. Age and phenotype-specific environmental cues (lactose exposure after weaning) induced changes to epigenetic modifications and CTCF binding at select regulatory elements, which corresponded to the alterations in the intestinal Lct mRNA gradient. Thus, epigenetic modifications in combination with CTCF binding at regulatory elements account for the transcriptional gradient in Lct in cells of the same type. Epigenetic divergence within enterocytes may contribute to the functional specialization of intestinal subregions. PMID:28139744

  5. Rhodobacter sphaeroides LexA has dual activity: optimising and repressing recA gene transcription

    PubMed Central

    Tapias, Angels; Fernández, Silvia; Alonso, Juan C.; Barbé, Jordi

    2002-01-01

    Transcription of the Rhodobacter sphaeroides recA promoter (PrecA) is induced upon DNA damage in a lexA-dependent manner. In vivo experiments demonstrate that LexA protein represses and might also activate transcription of PrecA. Purified R.sphaeroides LexA protein specifically binds the SOS boxes located within the PrecA region. In vitro transcription analysis, using Escherichia coli RNA polymerase (RNAP), indicated that the presence of LexA may stimulate and repress transcription of PrecA. EMSA and DNase I footprinting experiments show that LexA and RNAP can bind simultaneously to PrecA. At low LexA concentrations it enhances RNAP binding to PrecA, stimulates open complex formation and strand separation beyond the transcription start site. At high LexA concentrations, however, RNAP-promoted strand separation is not observed beyond the +5 region. LexA might repress transcription by interfering with the clearance process instead of blocking the access of RNAP to the promoter region. Based on these findings we propose that the R.sphaeroides LexA protein performs fine tuning of the SOS response, which might provide a physiological advantage by enhancing transcription of SOS genes and delaying full activation of the response. PMID:11917014

  6. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria × ananassa) defense responses.

    PubMed

    Amil-Ruiz, Francisco; Garrido-Gala, José; Blanco-Portales, Rosario; Folta, Kevin M; Muñoz-Blanco, Juan; Caballero, José L

    2013-01-01

    Strawberry (Fragaria spp) is an emerging model for the development of basic genomics and recombinant DNA studies among rosaceous crops. Functional genomic and molecular studies involve relative quantification of gene expression under experimental conditions of interest. Accuracy and reliability are dependent upon the choice of an optimal reference control transcript. There is no information available on validated endogenous reference genes for use in studies testing strawberry-pathogen interactions. Thirteen potential pre-selected strawberry reference genes were tested against different tissues, strawberry cultivars, biotic stresses, ripening and senescent conditions, and SA/JA treatments. Evaluation of reference candidate's suitability was analyzed by five different methodologies, and information was merged to identify best reference transcripts. A combination of all five methods was used for selective classification of reference genes. The resulting superior reference genes, FaRIB413, FaACTIN, FaEF1α and FaGAPDH2 are strongly recommended as control genes for relative quantification of gene expression in strawberry. This report constitutes the first systematic study to identify and validate optimal reference genes for accurate normalization of gene expression in strawberry plant defense response studies.

  7. Identification and Validation of Reference Genes for Transcript Normalization in Strawberry (Fragaria × ananassa) Defense Responses

    PubMed Central

    Amil-Ruiz, Francisco; Garrido-Gala, José; Blanco-Portales, Rosario; Folta, Kevin M.; Muñoz-Blanco, Juan; Caballero, José L.

    2013-01-01

    Strawberry (Fragaria spp) is an emerging model for the development of basic genomics and recombinant DNA studies among rosaceous crops. Functional genomic and molecular studies involve relative quantification of gene expression under experimental conditions of interest. Accuracy and reliability are dependent upon the choice of an optimal reference control transcript. There is no information available on validated endogenous reference genes for use in studies testing strawberry-pathogen interactions. Thirteen potential pre-selected strawberry reference genes were tested against different tissues, strawberry cultivars, biotic stresses, ripening and senescent conditions, and SA/JA treatments. Evaluation of reference candidate’s suitability was analyzed by five different methodologies, and information was merged to identify best reference transcripts. A combination of all five methods was used for selective classification of reference genes. The resulting superior reference genes, FaRIB413, FaACTIN, FaEF1α and FaGAPDH2 are strongly recommended as control genes for relative quantification of gene expression in strawberry. This report constitutes the first systematic study to identify and validate optimal reference genes for accurate normalization of gene expression in strawberry plant defense response studies. PMID:23940602

  8. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  9. Altered activities of transcription factors and their related gene expression in cardiac tissues of diabetic rats.

    PubMed

    Nishio, Y; Kashiwagi, A; Taki, H; Shinozaki, K; Maeno, Y; Kojima, H; Maegawa, H; Haneda, M; Hidaka, H; Yasuda, H; Horiike, K; Kikkawa, R

    1998-08-01

    Gene regulation in the cardiovascular tissues of diabetic subjects has been reported to be altered. To examine abnormal activities in transcription factors as a possible cause of this altered gene regulation, we studied the activity of two redox-sensitive transcription factors--nuclear factor-kappaB (NF-kappaB) and activating protein-1 (AP-1)--and the change in the mRNA content of heme oxygenase-1, which is regulated by these transcription factors in the cardiac tissues of rats with streptozotocin-induced diabetes. Increased activity of NF-kappaB and AP-1 but not nuclear transcription-activating factor, as determined by an electrophoretic mobility shift assay, was found in the hearts of 4-week diabetic rats. Glycemic control by a subcutaneous injection of insulin prevented these diabetes-induced changes in transcription factor activity. In accordance with these changes, the mRNA content of heme oxygenase-1 was increased fourfold in 4-week diabetic rats and threefold in 24-week diabetic rats as compared with control rats (P < 0.01 and P < 0.05, respectively). Insulin treatment also consistently prevented changes in the mRNA content of heme oxygenase-1. The oral administration of an antioxidant, probucol, to these diabetic rats partially prevented the elevation of the activity of both NF-kappaB and AP-1, and normalized the mRNA content of heme oxygenase-1 without producing any change in the plasma glucose concentration. These results suggest that elevated oxidative stress is involved in the activation of the transcription factors NF-kappaB and AP-1 in the cardiac tissues of diabetic rats, and that these abnormal activities of transcription factors could be associated with the altered gene regulation observed in the cardiovascular tissues of diabetic rats.

  10. Nicotinamide mononucleotide adenylyltransferase promotes hypoxic survival by activating the mitochondrial unfolded protein response

    PubMed Central

    Mao, X R; Kaufman, D M; Crowder, C M

    2016-01-01

    Gain-of-function mutations in the mouse nicotinamide mononucleotide adenylyltransferase type 1 (Nmnat1) produce two remarkable phenotypes: protection against traumatic axonal degeneration and reduced hypoxic brain injury. Despite intensive efforts, the mechanism of Nmnat1 cytoprotection remains elusive. To develop a new model to define this mechanism, we heterologously expressed a mouse Nmnat1 non-nuclear-localized gain-of-function mutant gene (m-nonN-Nmnat1) in the nematode Caenorhabditis elegans and show that it provides protection from both hypoxia-induced animal death and taxol-induced axonal pathology. Additionally, we find that m-nonN-Nmnat1 significantly lengthens C. elegans lifespan. Using the hypoxia-protective phenotype in C. elegans, we performed a candidate screen for genetic suppressors of m-nonN-Nmnat1 cytoprotection. Loss of function in two genes, haf-1 and dve-1, encoding mitochondrial unfolded protein response (mitoUPR) factors were identified as suppressors. M-nonN-Nmnat1 induced a transcriptional reporter of the mitoUPR gene hsp-6 and provided protection from the mitochondrial proteostasis toxin ethidium bromide. M-nonN-Nmnat1 was also protective against axonal degeneration in C. elegans induced by the chemotherapy drug taxol. Taxol markedly reduced basal expression of a mitoUPR reporter; the expression was restored by m-nonN-Nmnat1. Taken together, these data implicate the mitoUPR as a mechanism whereby Nmnat1 protects from hypoxic and axonal injury. PMID:26913604

  11. A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination.

    PubMed Central

    Piruat, J I; Aguilera, A

    1998-01-01

    We have identified two novel yeast genes, THO1 and THO2, that partially suppress the transcription defects of hpr1Delta mutants by overexpression. We show by in vivo transcriptional and recombinational analysis of tho2Delta cells that THO2 plays a role in RNA polymerase II (RNA pol II)-dependent transcription and is required for the stability of DNA repeats, as previously shown for HPR1. The tho2Delta mutation reduces the transcriptional efficiency of yeast DNA sequences down to 25% of the wild-type levels and abolishes transcription of the lacZ sequence. In addition, tho2Delta causes a strong increase in the frequency of recombination between direct repeats (>2000-fold above wild-type levels). Some DNA repeats cannot even be maintained in the cell. This hyper-recombination phenotype is dependent on transcription and is not observed in DNA repeats that are not transcribed. The higher the impairment of transcription caused by tho2Delta, the higher the frequency of recombination of a particular DNA region. The tho2Delta mutation also increases the frequency of plasmid loss. Our work not only identifies a novel yeast gene, THO2, with similar function to HPR1, but also provides new evidence for transcriptional blocks as a source of recombination. We propose that there is a set of proteins including Hpr1p and Tho2p, in the absence of which RNA pol II transcription is stalled or blocked, causing genetic instability. PMID:9707445

  12. Identification of suitable reference genes for investigating gene expression in human gallbladder carcinoma using reverse transcription quantitative polymerase chain reaction.

    PubMed

    Yu, Shan; Yang, Qiwei; Yang, Jing Hui; Du, Zhenwu; Zhang, Guizhen

    2015-04-01

    Reverse transcription quantitative polymerase chain reaction (RT‑qPCR) has become a frequently used strategy in gene expression studies. The relative quantification method is an important and commonly used method for the evaluation of RT‑qPCR data. The key aim of this method is to identify an applicable internal reference gene, however, there are currently no suitable reference genes for gene analysis in gallbladder carcinoma. In the present study, screening was performed using 12 common reference genes, which were selected in order to provide an experimental basis for the investigation of gene expression in gallbladder carcinoma. A total of 16 tissue samples of gallbladder carcinoma and their matched normal gallbladder tissues were used. The gene expression stability and applicability of the 12 reference gene candidates were determined using the geNorm, NormFinder and BestKeeper software programs. Following comparison of the results of the three software programs, HPRT1 was identified as the most stably expressed reference gene. In the normal gallbladder group, the relative stably expressed reference gene was PPIA and in the entire sample group, the relatively stably expressed reference gene was PPIA. The present study also demonstrated that the combination of the three reference genes was the most appropriate. The recommended combinations were PPIA + PUM1 + ACTB for the total sample group, GAPDH + PBGD + ALAS1 for the gallbladder carcinoma group and PPIA + PUM1 + TBP for the paired normal gallbladder group.

  13. ZmMADS47 Regulates Zein Gene Transcription through Interaction with Opaque2

    PubMed Central

    Qiao, Zhenyi; Qi, Weiwei; Wang, Qian; Feng, Ya’nan; Yang, Qing; Zhang, Nan; Wang, Shanshan; Tang, Yuanping; Song, Rentao

    2016-01-01

    Zeins, the predominent storage proteins in maize endosperm, are encoded by multiple genes and gene families. However, only a few transcriptional factors for zein gene regulation have been functionally characterized. In this study, a MADS-box protein, namely ZmMADS47, was identified as an Opaque2 (O2) interacting protein via yeast two-hybrid screening. The N-terminal portion of ZmMADS47 contains a nuclear localization signal (NLS), and its C-terminal portion contains a transcriptional activation domain (AD). Interestingly, the transcriptional activation activity is blocked in its full length form, suggesting conformational regulation of the AD. Molecular and RNA-seq analyses of ZmMADS47 RNAi lines revealed down regulation of α-zein and 50-kD γ-zein genes. ZmMADS47 binds the CATGT motif in promoters of these zein genes, but ZmMADS47 alone is not able to transactivate the promoters. However, when both O2 and ZmMADS47 are present, the transactivation of these promoters was greatly enhanced. This enhancement was dependent on the AD function of ZmMADS47 and the interaction between ZmMADS47 and O2, but it was independent from the AD function of O2. Therefore, it appears interaction with O2 activates ZmMADS47 on zein gene promoters. PMID:27077660

  14. Dynamic control of gene regulatory logic by seemingly redundant transcription factors

    PubMed Central

    AkhavanAghdam, Zohreh; Sinha, Joydeb; Tabbaa, Omar P; Hao, Nan

    2016-01-01

    Many transcription factors co-express with their homologs to regulate identical target genes, however the advantages of such redundancies remain elusive. Using single-cell imaging and microfluidics, we study the yeast general stress response transcription factor Msn2 and its seemingly redundant homolog Msn4. We find that gene regulation by these two factors is analogous to logic gate systems. Target genes with fast activation kinetics can be fully induced by either factor, behaving as an 'OR' gate. In contrast, target genes with slow activation kinetics behave as an 'AND' gate, requiring distinct contributions from both factors, upon transient stimulation. Furthermore, such genes become an 'OR' gate when the input duration is prolonged, suggesting that the logic gate scheme is not static but rather dependent on the input dynamics. Therefore, Msn2 and Msn4 enable a time-based mode of combinatorial gene regulation that might be applicable to homologous transcription factors in other organisms. DOI: http://dx.doi.org/10.7554/eLife.18458.001 PMID:27690227

  15. Transcript profiling reveals rewiring of iron assimilation gene expression in Candida albicans and C. dubliniensis.

    PubMed

    Moran, Gary P

    2012-12-01

    Hyphal growth is repressed in Candida albicans and Candida dubliniensis by the transcription factor Nrg1. Transcript profiling of a C. dubliniensis NRG1 mutant identified a common group of 28 NRG1-repressed genes in both species, including the hypha-specific genes HWP1, ECE1 and the regulator of cell elongation UME6. Unexpectedly, C. dubliniensis NRG1 was required for wild-type levels of expression of 10 genes required for iron uptake including seven ferric reductases, SIT1, FTR1 and RBT5. However, at alkaline pH and during filamentous growth in 10% serum, most of these genes were highly induced in C. dubliniensis. Conversely, RBT5, PGA10, FRE10 and FRP1 did not exhibit induction during hyphal growth when NRG1 is downregulated, indicating that in C. dubliniensis NRG1 is also required for optimal expression of these genes in alkaline environments. In iron-depleted medium at pH 4.5, reduced growth of the NRG1 mutant relative to wild type was observed; however, growth was restored to wild-type levels or greater at pH 6.5, indicating that alkaline induction of iron assimilation gene expression could rescue this phenotype. These data indicate that transcriptional control of iron assimilation and pseudohypha formation has been separated in C. albicans, perhaps promoting growth in a wider range of niches.

  16. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

    SciTech Connect

    Tsai, Fongying; Coruzzi, G. )

    1991-10-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

  17. The ubiquitous octamer-binding protein(s) is sufficient for transcription of immunoglobulin genes.

    PubMed Central

    Johnson, D G; Carayannopoulos, L; Capra, J D; Tucker, P W; Hanke, J H

    1990-01-01

    All immunoglobulin genes contain a conserved octanucleotide promoter element, ATGCAAAT, which has been shown to be required for their normal B-cell-specific transcription. Proteins that bind this octamer have been purified, and cDNAs encoding octamer-binding proteins have been cloned. Some of these proteins (referred to as OTF-2) are lymphoid specific, whereas at least one other, and possibly more (referred to as OTF-1), is found ubiquitously in all cell types. The exact role of these different proteins in directing the tissue-specific expression of immunoglobulin genes is unclear. We have identified two human pre-B-cell lines that contain extremely low levels of OTF-2 yet still express high levels of steady-state immunoglobulin heavy-chain mRNA in vivo and efficiently transcribe an immunoglobulin gene in vitro. Addition of a highly enriched preparation of OTF-1 made from one of these pre-B cells or from HeLa cells specifically stimulated in vitro transcription of an immunoglobulin gene. Furthermore, OFT-1 appeared to have approximately the same transactivation ability as OTF-2 when normalized for binding activity. These results suggest that OTF-1, without OTF-2, is sufficient for transcription of immunoglobulin genes and that OTF-2 alone is not responsible for the B-cell-specific regulation of immunoglobulin gene expression. Images PMID:2304473

  18. Gene Expression Under the Influence: Transcriptional Profiling of Ethanol in the Brain

    PubMed Central

    Contet, Candice

    2013-01-01

    Sensitivity to ethanol intoxication, propensity to drink ethanol and vulnerability to develop alcoholism are all influenced by genetic factors. Conversely, exposure to ethanol or subsequent withdrawal produce gene expression changes, which, in combination with environmental variables, may participate in the emergence of compulsive drinking and relapse. The present review offers an integrated perspective on brain gene expression profiling in rodent models of predisposition to differential ethanol sensitivity or consumption, in rats and mice subjected to acute or chronic ethanol exposure, as well as in human alcoholics. The functional categories over-represented among differentially expressed genes suggest that the transcriptional effects of chronic ethanol consumption contribute to the neuroplasticity and neurotoxicity characteristic of alcoholism. Importantly, ethanol produces distinct transcriptional changes within the different brain regions involved in intoxication, reinforcement and addiction. Special emphasis is put on recent profiling studies that have provided some insights into the molecular mechanisms potentially mediating genome-wide regulation of gene expression by ethanol. In particular, current evidence for a role of transcription factors, chromatin remodeling and microRNAs in coordinating the expression of large sets of genes in animals predisposed to excessive ethanol drinking or exposed to protracted abstinence, as well as in human alcoholics, is presented. Finally, studies that have compared ethanol with other drugs of abuse have highlighted common gene expression patterns that may play a central role in drug addiction. The availability of novel technologies and a focus on mechanistic approaches are shaping the future of ethanol transcriptomics. PMID:24078902

  19. Developmental transcription of genes putatively associated with growth in two sturgeon species of different growth rate.

    PubMed

    Miandare, Hamed Kolangi; Farahmand, Hamid; Akbarzadeh, Arash; Ramezanpour, Sanaz; Kaiya, Hiroyuki; Miyazato, Mikiya; Rytkönen, Kalle T; Nikinmaa, Mikko

    2013-02-01

    In the present study, we surveyed developmental changes in the transcription of growth hormone (gh), insulin-like growth factor-I (igf-I), ghrelin (ghrl) and vascular endothelial growth factor (vegf) genes in the largest freshwater fish, European sturgeon (Beluga, Huso huso) and compared the same parameters to that of its phylogenically close moderate-sized species, Persian sturgeon (Acipenser persicus). The transcripts of gh, igf-I, ghrl and vegf were detected at all developmental time-points of Persian sturgeon and Beluga from embryos to juvenile fish. Changes in normalized gh, igf-I, ghrl and vegf transcription by using the geometric average of genes encoding ribosomal protein L6 (RPL6) and elongation factor (EF1A) over the time of development of Persian sturgeon and Beluga were statistically significant (P<0.05). Our results showed that the mRNA expression levels of both igf-I and ghrl were low during early larval development and then increased significantly to the late larval time-points when larvae started exogenous feeding. In both Beluga and Persian sturgeon, after a low mRNA expression during the embryonic stage, the transcript levels of vegf displayed an increasing trend during yolk-sac fry, consistent with organogenesis. The vegf level remained constantly high in the time of exogenous feeding. The highest detection of gh transcripts coincided with the end of the embryonic stage (hatching time) in Persian sturgeon and 3 days-post-hatching (dph) in Beluga. In Persian sturgeon, the gh transcript started to decrease to the rest of the developmental time-points, whereas in Beluga gh transcript had a marked second increase from the time of exogenous feeding (20-dph). This Beluga specific increase in gh transcription may be associated with the marked growth rate and extraordinary size of this fish species.

  20. Description and analysis of the Bovine Gene Atlas - An extensive compendium of bovine transcript profiles

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bovine Gene Atlas (BGA) is a compendium of over 7.2 million unique 20-base transcript tags profiled from 81 tissues acquired from the cow “L1 Dominette 01449” (L1D), her male fetus, her 255-day-old heifer calf, and her father. The BGA tags were generated on a next-generation massively parallel ...

  1. Control of transcription elongation by GreA determines rate of gene expression in Streptococcus pneumoniae

    PubMed Central

    Yuzenkova, Yulia; Gamba, Pamela; Herber, Martijn; Attaiech, Laetitia; Shafeeq, Sulman; Kuipers, Oscar P.; Klumpp, Stefan; Zenkin, Nikolay; Veening, Jan-Willem

    2014-01-01

    Transcription by RNA polymerase may be interrupted by pauses caused by backtracking or misincorporation that can be resolved by the conserved bacterial Gre-factors. However, the consequences of such pausing in the living cell remain obscure. Here, we developed molecular biology and transcriptome sequencing tools in the human pathogen Streptococcus pneumoniae and provide evidence that transcription elongation is rate-limiting on highly expressed genes. Our results suggest that transcription elongation may be a highly regulated step of gene expression in S. pneumoniae. Regulation is accomplished via long-living elongation pauses and their resolution by elongation factor GreA. Interestingly, mathematical modeling indicates that long-living pauses cause queuing of RNA polymerases, which results in ‘transcription traffic jams’ on the gene and thus blocks its expression. Together, our results suggest that long-living pauses and RNA polymerase queues caused by them are a major problem on highly expressed genes and are detrimental for cell viability. The major and possibly sole function of GreA in S. pneumoniae is to prevent formation of backtracked elongation complexes. PMID:25190458

  2. Validation of an algorithm for delay stochastic simulation of transcription and translation in prokaryotic gene expression

    NASA Astrophysics Data System (ADS)

    Roussel, Marc R.; Zhu, Rui

    2006-12-01

    The quantitative modeling of gene transcription and translation requires a treatment of two key features: stochastic fluctuations due to the limited copy numbers of key molecules (genes, RNA polymerases, ribosomes), and delayed output due to the time required for biopolymer synthesis. Recently proposed algorithms allow for efficient simulations of such systems. However, it is critical to know whether the results of delay stochastic simulations agree with those from more detailed models of the transcription and translation processes. We present a generalization of previous delay stochastic simulation algorithms which allows both for multiple delays and for distributions of delay times. We show that delay stochastic simulations closely approximate simulations of a detailed transcription model except when two-body effects (e.g. collisions between polymerases on a template strand) are important. Finally, we study a delay stochastic model of prokaryotic transcription and translation which reproduces observations from a recent experimental study in which a single gene was expressed under the control of a repressed lac promoter in E. coli cells. This demonstrates our ability to quantitatively model gene expression using these new methods.

  3. Genetic characterization and transcription analyses of the European sea bass (Dicentrarchus labrax) isg15 gene.

    PubMed

    Moreno, Patricia; Garcia-Rosado, Esther; Borrego, Juan J; Alonso, M Carmen

    2016-08-01

    Fish interferons are cytokines involved in its resistance to viral infections by inducing the transcription of several interferon-induced genes, such as isg15. The aim of the present study was the genetic characterization of the European sea bass isg15 gene, describing the regulatory motifs found in its sequence. In addition, an in vivo analysis of transcription in response to betanodavirus (RGNNV genotype) and poly I:C has been performed. The analysis of the resulting sequences showed that sea bass isg15 gene is composed of two exons and a single 276-bp intron located at the 5'-UTR region. The full length cDNA is 1143-bp, including a 102-bp 5'-UTR region, a 474-bp ORF, and a 291-bp 3'-UTR region. Several mRNA-regulatory elements, including three unusual ATTTA instability motifs in the intron, and four ATTTA motifs along with a cytoplasmic polyadenylation element in the 3'-UTR region, have been found in this sequence. The in vivo analyses revealed a similar kinetics and level of transcription in fish brain and head kidney after poly I:C inoculation; however, the induction caused by RGNNV started earlier in brain, where the upregulation of isg15 gene transcription was high. The present study contributes to further characterize the European sea bass IFN I response against RGNNV infections.

  4. Transcriptional analysis of the acid-inducible asr gene in enterobacteria.

    PubMed

    Seputiene, Vaida; Suziedelis, Kestutis; Normark, Staffan; Melefors, Ojar; Suziedeliene, Edita

    2004-09-01

    We show here that transcription of the asr gene in Escherichia coli, Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae and Enterobacter cloacae is strongly dependent on the acidification level of the growth medium, with maximal induction at pH 4.0-4.5 as determined by Northern hybridization analysis. Previous gene array analyses have also shown that asr is the most acid-induced gene in the E. coli genome. Sequence alignment of the asr promoters from different enterobacterial species identified a highly conserved region located at position -70 to -30 relative to the asr transcriptional start site. By deletion of various segments of this region in the E. coli asr promoter it was shown that sequences upstream from the -40 position were important for induction. Transcription from the E. coli asr promoter was demonstrated to be growth-phase-dependent and to require the alternative sigma factor RpoS (sigma(S)) in stationary phase. Transcription of the asr gene was also found to be subject to negative control by the nucleoid protein H-NS.

  5. Transcriptional regulation of human novel gene SPATA12 promoter by AP-1 and HSF.

    PubMed

    Li, Dan; Lin, Yiting; Liu, Zhiwen; Zhang, Yunsheng; Rong, Zhuoxian; Liu, Xuanming

    2012-12-10

    Human SPATA12 is a spermatogenesis associated gene and is supposed to function as an inhibitor during male germ cell development. SPATA12 is specifically expressed in spermatocytes, spermatids, and spermatozoa of human testis. In order to understand the regulation mechanism of SPATA12 gene expression, we identified and characterized the SPATA12 gene core promoter region and transcription factor binding sites by using reporter gene assays. AP-1 is founded to be a potential transcriptional activator of SPATA12. The promoter activity of SPATA12 was drastically declined after AP-1 binding site mutation or deletion. We also demonstrated that AP-1 combined with Smad3/4 contributes to the transcriptional regulation of SPATA12 in response to TGF-β1. The expression of SPATA12 could be induced by TGF-β1 in a dose-dependent manner, suggesting that AP-1 as an activator plays a role in the regulation of SPATA12 promoter. We have also shown that heat shock treatment could activate the expression of SPATA12 and transcription factor HSF binding sites in the SPATA12 promoter might be responsible for this heat-induction. These results suggested that AP-1 and HSF may play an important role in regulating SPATA12 promoter activity.

  6. Transcriptional profiling of candidate genes induced by Marek's disease virus during cytolytic and latency infections

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The role of cytokines and other related proteins in Marek’s disease pathogenesis and immunity is poorly understood. The aim of this study was to examine the transcriptional profiling of a panel of cytokines and other immune-related genes in the spleen tissues of chickens infected with rMd5, rMd5-de...

  7. STAT4-mediated transcriptional repression of the IL5 gene in human memory Th2 cells.

    PubMed

    Gonzales-van Horn, Sarah R; Estrada, Leonardo D; van Oers, Nicolai S C; Farrar, J David

    2016-06-01

    Type I interferon (IFN-α/β) plays a critical role in suppressing viral replication by driving the transcription of hundreds of interferon-sensitive genes (ISGs). While many ISGs are transcriptionally activated by the ISGF3 complex, the significance of other signaling intermediates in IFN-α/β-mediated gene regulation remains elusive, particularly in rare cases of gene silencing. In human Th2 cells, IFN-α/β signaling suppressed IL5 and IL13 mRNA expression during recall responses to T-cell receptor (TCR) activation. This suppression occurred through a rapid reduction in the rate of nascent transcription, independent of de novo expression of ISGs. Further, IFN-α/β-mediated STAT4 activation was required for repressing the human IL5 gene, and disrupting STAT4 dimerization reversed this effect. This is the first demonstration of STAT4 acting as a transcriptional repressor in response to IFN-α/β signaling and highlights the unique activity of this cytokine to acutely block the expression of an inflammatory cytokine in human T cells.

  8. Transcription-coupled repair in RNA polymerase I-transcribed genes of yeast

    PubMed Central

    Conconi, Antonio; Bespalov, Vyacheslav A.; Smerdon, Michael J.

    2002-01-01

    Nucleotide excision repair (NER) of UV-induced cyclobutane pyrimidine dimers (CPDs) was measured in the individual strands of transcriptionally active and inactive ribosomal genes of yeast. Ribosomal genes (rDNA) are present in multiple copies, but only a fraction of them is actively transcribed. Restriction enzyme digestion was used to specifically release the transcriptionally active fraction from yeast nuclei, and selective psoralen crosslinking was used to distinguish between active and inactive rDNA chromatin. Removal of CPDs was followed in both rDNA populations, and the data clearly show that strand-specific repair occurs in transcriptionally active rDNA while being absent in the inactive rDNA fraction. Thus, transcription-coupled repair occurs in RNA polymerase I-transcribed genes in yeast. Moreover, the nontranscribed strand of active rDNA is repaired faster than either strand of inactive rDNA, implying that NER has preferred access to the active, non-nucleosomal rDNA chromatin. Finally, restriction enzyme accessibility to active rDNA varies during NER, suggesting that there is a change in ribosomal gene chromatin structure during or soon after CPD removal. PMID:11782531

  9. Distribution of fiber development genes and transcription factors between At and Dt subgenomes in tetraploid cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As the worlds leading natural material used in the manufacture of textiles, cotton fibers are important seed trichomes derived from individual cells of the epidermal layer of the seed coat. Cotton fiber development is determined by large numbers of genes and transcription factors. However, little ...

  10. Nurr1 enhances transcription of the human dopamine transporter gene through a novel mechanism.

    PubMed

    Sacchetti, P; Mitchell, T R; Granneman, J G; Bannon, M J

    2001-03-01

    The importance of the nuclear receptor nurr1 for the appropriate development of mesencephalic dopamine-synthesizing neurons has been clearly demonstrated through the targeted disruption of the nurr1 gene. The persistence of nurr1 expression in adult tissue suggests a possible role for this transcription factor in the maintenance, as well as development, of the dopaminergic phenotype. To address this issue, we analyzed the effects of nurr1 on the transcriptional expression of the human dopamine transporter gene (hDAT), one of the most specific phenotypic markers for dopaminergic neurons. Nurr1 enhanced the transcriptional activity of hDAT gene constructs transiently transfected into a newly described cell line (SN4741) that expresses a dopaminergic phenotype, whereas other members of the NGFI-B subfamily of nuclear receptors had lesser or no effects. Nurr1 activation of hDAT was not dependent upon heterodimerization with the retinoid X receptor. Unexpectedly, functional analysis of a series of gene constructs revealed that a region of the hDAT 5'-flanking sequence devoid of NGFI-B response element (NBRE)-like sites mediated nurr1 activation. Additional experiments using a nurr1 mutant construct suggest that nurr1 activates hDAT transcription via a novel NBRE-independent mechanism.

  11. Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression.

    PubMed

    Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A

    2014-05-02

    To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division.

  12. Gene Regulation by the AGL15 Transcription Factor Reveals Hormone Interactions in Somatic Embryogenesis1[OPEN

    PubMed Central

    Zheng, Qiaolin; Zheng, Yumei; Ji, Huihua; Burnie, Whitney

    2016-01-01

    The MADS box transcription factor Arabidopsis (Arabidopsis thaliana) AGAMOUS-LIKE15 (AGL15) and a putative ortholog from soybean (Glycine max), GmAGL15, are able to promote somatic embryogenesis (SE) in these plants when ectopically expressed. SE is an important means of plant regeneration, but many plants, or even particular cultivars, are recalcitrant for this process. Understanding how (Gm)AGL15 promotes SE by identifying and characterizing direct and indirect downstream regulated genes can provide means to improve regeneration by SE for crop improvement and to perform molecular tests of genes. Conserved transcription factors and the genes they regulate in common between species may provide the most promising avenue to identify targets for SE improvement. We show that (Gm)AGL15 negatively regulates auxin signaling in both Arabidopsis and soybean at many levels of the pathway, including the repression of AUXIN RESPONSE FACTOR6 (ARF6) and ARF8 and TRANSPORT INHIBITOR RESPONSE1 as well as the indirect control of components via direct expression of a microRNA-encoding gene. We demonstrate interaction between auxin and gibberellic acid in the promotion of SE and document an inverse correlation between bioactive gibberellic acid and SE in soybean, a difficult crop to transform. Finally, we relate hormone accumulation to transcript accumulation of important soybean embryo regulatory factors such as ABSCISIC ACID INSENSITIVE3 and FUSCA3 and provide a working model of hormone and transcription factor interaction in the control of SE. PMID:27794101

  13. Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.

    PubMed

    Wang, Qingfeng; Harshey, Rasika M

    2009-10-01

    In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence.

  14. An Improved Canine Genome and a Comprehensive Catalogue of Coding Genes and Non-Coding Transcripts

    PubMed Central

    Hoeppner, Marc P.; Lundquist, Andrew; Pirun, Mono; Meadows, Jennifer R. S.; Zamani, Neda; Johnson, Jeremy; Sundström, G