Science.gov

Sample records for hypoxic transcription gene

  1. Hypoxic stress suppresses RNA polymerase III recruitment and tRNA gene transcription in cardiomyocytes

    PubMed Central

    Ernens, Isabelle; Goodfellow, Sarah J.; Innes, Fiona; Kenneth, Niall S.; Derblay, Louise E.; White, Robert J.; Scott, Pamela H.

    2006-01-01

    RNA polymerase (pol) III transcription decreases when primary cultures of rat neonatal cardiomyocytes are exposed to low oxygen tension. Previous studies in fibroblasts have shown that the pol III-specific transcription factor IIIB (TFIIIB) is bound and regulated by the proto-oncogene product c-Myc, the mitogen-activated protein kinase ERK and the retinoblastoma tumour suppressor protein, RB. The principal function of TFIIIB is to recruit pol III to its cognate gene template, an activity that is known to be inhibited by RB and stimulated by ERK. We demonstrate by chromatin immunoprecipitation (ChIP) that c-Myc also stimulates pol III recruitment by TFIIIB. However, hypoxic conditions cause TFIIIB dissociation from c-Myc and ERK, at the same time as increasing its interaction with RB. Consistent with this, ChIP assays indicate that the occupancy of tRNA genes by pol III is significantly reduced, whereas promoter binding by TFIIIB is undiminished. The data suggest that hypoxia can inhibit pol III transcription by altering the interactions between TFIIIB and its regulators and thus compromising its ability to recruit the polymerase. These effects are independent of cell cycle changes. PMID:16407335

  2. Transcriptional up-regulation of inhibitory PAS domain protein gene expression by hypoxia-inducible factor 1 (HIF-1): a negative feedback regulatory circuit in HIF-1-mediated signaling in hypoxic cells.

    PubMed

    Makino, Yuichi; Uenishi, Rie; Okamoto, Kensaku; Isoe, Tsubasa; Hosono, Osamu; Tanaka, Hirotoshi; Kanopka, Arvydas; Poellinger, Lorenz; Haneda, Masakazu; Morimoto, Chikao

    2007-05-11

    The inhibitory PAS (Per/Arnt/Sim) domain protein (IPAS), a dominant negative regulator of hypoxia-inducible transcription factors (HIFs), is potentially implicated in negative regulation of angiogenesis in such tissues as the avascular cornea of the eye. We have previously shown IPAS mRNA expression is up-regulated in hypoxic tissues, which at least in part involves hypoxia-dependent alternative splicing of the transcripts from the IPAS/HIF-3alpha locus. In the present study, we demonstrate that a hypoxia-driven transcriptional mechanism also plays a role in augmentation of IPAS gene expression. Isolation and analyses of the promoter region flanking to the first exon of IPAS gene revealed a functional hypoxia response element at position -834 to -799, whereas the sequence upstream of the HIF-3alpha first exon scarcely responded to hypoxic stimuli. A transient transfection experiment demonstrated that HIF-1alpha mediates IPAS promoter activation via the functional hypoxia response element under hypoxic conditions and that a constitutively active form of HIF-1alpha is sufficient for induction of the promoter in normoxic cells. Moreover, chromatin immunoprecipitation and electrophoretic mobility shift assays showed binding of the HIF-1 complex to the element in a hypoxia-dependent manner. Taken together, HIF-1 directly up-regulates IPAS gene expression through a mechanism distinct from RNA splicing, providing a further level of negative feedback gene regulation in adaptive responses to hypoxic/ischemic conditions. PMID:17355974

  3. Global transcription analysis of Krebs tricarboxylic acid cycle mutants reveals an alternating pattern of gene expression and effects on hypoxic and oxidative genes.

    PubMed

    McCammon, Mark T; Epstein, Charles B; Przybyla-Zawislak, Beata; McAlister-Henn, Lee; Butow, Ronald A

    2003-03-01

    To understand the many roles of the Krebs tricarboxylic acid (TCA) cycle in cell function, we used DNA microarrays to examine gene expression in response to TCA cycle dysfunction. mRNA was analyzed from yeast strains harboring defects in each of 15 genes that encode subunits of the eight TCA cycle enzymes. The expression of >400 genes changed at least threefold in response to TCA cycle dysfunction. Many genes displayed a common response to TCA cycle dysfunction indicative of a shift away from oxidative metabolism. Another set of genes displayed a pairwise, alternating pattern of expression in response to contiguous TCA cycle enzyme defects: expression was elevated in aconitase and isocitrate dehydrogenase mutants, diminished in alpha-ketoglutarate dehydrogenase and succinyl-CoA ligase mutants, elevated again in succinate dehydrogenase and fumarase mutants, and diminished again in malate dehydrogenase and citrate synthase mutants. This pattern correlated with previously defined TCA cycle growth-enhancing mutations and suggested a novel metabolic signaling pathway monitoring TCA cycle function. Expression of hypoxic/anaerobic genes was elevated in alpha-ketoglutarate dehydrogenase mutants, whereas expression of oxidative genes was diminished, consistent with a heme signaling defect caused by inadequate levels of the heme precursor, succinyl-CoA. These studies have revealed extensive responses to changes in TCA cycle function and have uncovered new and unexpected metabolic networks that are wired into the TCA cycle.

  4. Post-Transcriptional Control of the Hypoxic Response by RNA-Binding Proteins and MicroRNAs.

    PubMed

    Gorospe, Myriam; Tominaga, Kumiko; Wu, Xue; Fähling, Michael; Ivan, Mircea

    2011-01-01

    Mammalian gene expression patterns change profoundly in response to low oxygen levels. These changes in gene expression programs are strongly influenced by post-transcriptional mechanisms mediated by mRNA-binding factors: RNA-binding proteins (RBPs) and microRNAs (miRNAs). Here, we review the RBPs and miRNAs that modulate mRNA turnover and translation in response to hypoxic challenge. RBPs such as HuR (human antigen R), PTB (polypyrimidine tract-binding protein), heterogeneous nuclear ribonucleoproteins (hnRNPs), tristetraprolin, nucleolin, iron-response element-binding proteins (IRPs), and cytoplasmic polyadenylation-element-binding proteins (CPEBs), selectively bind to numerous hypoxia-regulated transcripts and play a major role in establishing hypoxic gene expression patterns. MiRNAs including miR-210, miR-373, and miR-21 associate with hypoxia-regulated transcripts and further modulate the levels of the encoded proteins to implement the hypoxic gene expression profile. We discuss the potent regulation of hypoxic gene expression by RBPs and miRNAs and their integrated actions in the cellular hypoxic response.

  5. NF-κB-dependent transcriptional upregulation of cyclin D1 exerts cytoprotection against hypoxic injury upon EGFR activation.

    PubMed

    Chen, Zhi-Dong; Xu, Liang; Tang, Kan-Kai; Gong, Fang-Xiao; Liu, Jing-Quan; Ni, Yin; Jiang, Ling-Zhi; Hong, Jun; Han, Fang; Li, Qian; Yang, Xiang-Hong; Sun, Ren-Hua; Mo, Shi-Jing

    2016-09-10

    Apoptosis of neural cells is one of the main pathological features in hypoxic/ischemic brain injury. Nuclear factor-κB (NF-κB) might be a potential therapeutic target for hypoxic/ischemic brain injury since NF-κB has been found to be inactivated after hypoxia exposure, yet the underlying molecular mechanisms of NF-κB inactivation are largely unknown. Here we report that epidermal growth factor receptor (EGFR) activation prevents neuron-like PC12 cells apoptosis in response to hypoxia via restoring NF-κB-dependent transcriptional upregulation of cyclin D1. Functionally, EGFR activation by EGF stimulation mitigates hypoxia-induced PC12 cells apoptosis in both dose- and time-dependent manner. Of note, EGFR activation elevates IKKβ phosphorylation, increases IκBα ubiquitination, promotes P65 nuclear translocation and recruitment at cyclin D1 gene promoter as well as upregulates cyclin D1 expression. EGFR activation also abrogates the decrease of IKKβ phosphorylation, reduction of IκBα ubiquitination, blockade of P65 nuclear translocation and recruitment at cyclin D1 gene promoter as well as downregulation of cyclin D1 expression induced by hypoxia. Furthermore, NF-κB-dependent upregulation of cyclin D1 is instrumental for the EGFR-mediated cytoprotection against hypoxic apoptosis. In addition, the dephosphorylation of EGFR induced by either EGF siRNA transfection or anti-HB-EGF neutralization antibody treatment enhances hypoxic cytotoxicity, which are attenuated by EGF administration. Our results highlight the essential role of NF-κB-dependent transcriptional upregulation of cyclin D1 in EGFR-mediated cytoprotective effects under hypoxic preconditioning and support further investigation of EGF in clinical trials of patients with hypoxic/ischemic brain injury.

  6. Transcriptional Profiling of Hypoxic Neural Stem Cells Identifies Calcineurin-NFATc4 Signaling as a Major Regulator of Neural Stem Cell Biology.

    PubMed

    Moreno, Marta; Fernández, Virginia; Monllau, Josep M; Borrell, Víctor; Lerin, Carles; de la Iglesia, Núria

    2015-08-11

    Neural stem cells (NSCs) reside in a hypoxic microenvironment within the brain. However, the crucial transcription factors (TFs) that regulate NSC biology under physiologic hypoxia are poorly understood. Here we have performed gene set enrichment analysis (GSEA) of microarray datasets from hypoxic versus normoxic NSCs with the aim of identifying pathways and TFs that are activated under oxygen concentrations mimicking normal brain tissue microenvironment. Integration of TF target (TFT) and pathway enrichment analysis identified the calcium-regulated TF NFATc4 as a major candidate to regulate hypoxic NSC functions. Nfatc4 expression was coordinately upregulated by top hypoxia-activated TFs, while NFATc4 target genes were enriched in hypoxic NSCs. Loss-of-function analyses further revealed that the calcineurin-NFATc4 signaling axis acts as a major regulator of NSC self-renewal and proliferation in vitro and in vivo by promoting the expression of TFs, including Id2, that contribute to the maintenance of the NSC state.

  7. The Transcription Factor ZNF395 Is Required for the Maximal Hypoxic Induction of Proinflammatory Cytokines in U87-MG Cells

    PubMed Central

    Herwartz, Christine; Castillo-Juárez, Paola; Schröder, Linda; Barron, Blanca L.; Steger, Gertrud

    2015-01-01

    Hypoxia activates the expression of proangiogenic and survival promoting factors as well as proinflammatory cytokines that support tissue inflammation. Hypoxia and inflammation are associated with tumor progression. The identification of the factors participating in the hypoxia associated inflammation is essential to develop strategies to control tumor hypoxia. The transcription factor ZNF395 was found to be overexpressed in various tumors including glioblastomas particularly in the network of a hypoxic response pointing to a functional role of ZNF395. On the other hand, ZNF395 was suggested to have tumor suppressor activities which may rely on its repression of proinflammatory factors. To address these conflictive observations, we investigated the role of ZNF395 in the expression of proinflammatory cytokines in the astrocytoma cell line U87-MG under hypoxia. We show that ZNF395 is a target gene of the hypoxia inducible factor HIF-1α. By gene expression analysis, RT-PCR and ELISA, we demonstrated that the siRNA-mediated suppression of ZNF395 impairs the hypoxic induction of IL-1β, IL-6, IL-8, and LIF in U87-MG cells. At ambient oxygen concentrations, ZNF395 had no enhancing effect, indicating that this transcriptional activation by ZNF395 is restricted to hypoxic conditions. Our results suggest that ZNF395 contributes to hypoxia associated inflammation by superactivating proinflammatory cytokines. PMID:26229239

  8. Transcriptional signature of human adipose tissue-derived stem cells (hASCs) preconditioned for chondrogenesis in hypoxic conditions

    SciTech Connect

    Pilgaard, L.; Lund, P.; Duroux, M.; Lockstone, H.; Taylor, J.; Emmersen, J.; Fink, T.; Ragoussis, J.; Zachar, V.

    2009-07-01

    Hypoxia is an important factor involved in the control of stem cells. To obtain a better insight into the phenotypical changes brought about by hypoxic preconditioning prior to chondrogenic differentiation; we have investigated growth, colony-forming and chondrogenic capacity, and global transcriptional responses of six adipose tissue-derived stem cell lines expanded at oxygen concentrations ranging from ambient to 1%. The assessment of cell proliferation and colony-forming potential revealed that the hypoxic conditions corresponding to 1% oxygen played a major role. The chondrogenic inducibility, examined by high-density pellet model, however, did not improve on hypoxic preconditioning. While the microarray analysis revealed a distinctive inter-donor variability, the exposure to 1% hypoxia superseded the biological variability and produced a specific expression profile with 2581 significantly regulated genes and substantial functional enrichment in the pathways of cell proliferation and apoptosis. Additionally, exposure to 1% oxygen resulted in upregulation of factors related to angiogenesis and cell growth. In particular, leptin (LEP), the key regulator of body weight and food intake was found to be highly upregulated. In conclusion, the results of this investigation demonstrate the significance of donor demographics and the importance of further studies into the use of regulated oxygen tension as a tool for preparation of ASCs in order to exploit their full potential.

  9. Differential gene expression of phosphoglyceric kinase (PGK) and hypoxic adaptation in chicken.

    PubMed

    Wang, CunFang; Yuan, CunZhong; Zhang, Lao; Wu, ChangXin; Li, Ning

    2007-06-01

    Four single-nucleotide polymorphisms (SNP) of the Phosphoglyceric Kinase (PGK) gene were discovered based on comparison of the sequences from an altiplano chicken breed (Tibetan chicken) and two lowland breeds (White Leghorn and Shouguang chicken). Gel-shift results indicate that one of these SNPs, an A-->G mutation at position 59 in exon10, is able to bind hypoxia-induced factor-l (HIF-1), functioning as a hypoxia response element (HRE). The mutant gene results in M-->T mutation at position 379 amino acid. The combined activity of this HRE and HIF-1 could increase correspondingly under a hypoxic stimulus. Hypoxia leads to increased death rates of chicken embryos; while the M-->T mutation described herein is prevalent in healthy embryos grown under hypoxic conditions, thus it may represent an adaptation to hypoxia. Fluorescence quantitative reverse transcription PCR results revealed that HIF-1 upregulates the transcript level of the glycolytic enzyme PGK in the brain and skeletal muscle of animals subjected to hypoxia. Thus, a large amount of ATP is produced by increased glycolysis, allowing the organism to meet energy metabolism demands. As such, we believe this SNP to be an adaptation to the external anoxic environment.

  10. Developmental Expression and Hypoxic Induction of Hypoxia Inducible Transcription Factors in the Zebrafish.

    PubMed

    Köblitz, Louise; Fiechtner, Birgit; Baus, Katharina; Lussnig, Rebecca; Pelster, Bernd

    2015-01-01

    The hypoxia inducible transcription factor (HIF) has been shown to coordinate the hypoxic response of vertebrates and is expressed in three different isoforms, HIF-1α, HIF-2α and HIF-3α. Knock down of either Hif-1α or Hif-2α in mice results in lethality in embryonic or perinatal stages, suggesting that this transcription factor is not only controlling the hypoxic response, but is also involved in developmental phenomena. In the translucent zebrafish embryo the performance of the cardiovascular system is not essential for early development, therefore this study was designed to analyze the expression of the three Hif-isoforms during zebrafish development and to test the hypoxic inducibility of these transcription factors. To complement the existing zfHif-1α antibody we expressed the whole zfHif-2α protein and used it for immunization and antibody generation. Similarly, fragments of the zfHif-3α protein were used for immunization and generation of a zfHif-3α specific antibody. To demonstrate presence of the Hif-isoforms during development [between 1 day post fertilization (1 dpf) and 9 dpf] affinity-purified antibodies were used. Hif-1α protein was present under normoxic conditions in all developmental stages, but no significant differences between the different developmental stages could be detected. Hif-2α was also present from 1 dpf onwards, but in post hatching stages (between 5 and 9 dpf) the expression level was significantly higher than prior to hatching. Similarly, Hif-3α was expressed from 1 dpf onwards, and the expression level significantly increased until 5 dpf, suggesting that Hif-2α and Hif-3α play a particular role in early development. Hypoxic exposure (oxygen partial pressure = 5 kPa) in turn caused a significant increase in the level of Hif-1α protein even at 1 dpf and in later stages, while neither Hif-2α nor Hif-3α protein level were affected. In these early developmental stages Hif-1α therefore appears to be more important for

  11. Transcriptional Profiling of Hypoxic Neural Stem Cells Identifies Calcineurin-NFATc4 Signaling as a Major Regulator of Neural Stem Cell Biology

    PubMed Central

    Moreno, Marta; Fernández, Virginia; Monllau, Josep M.; Borrell, Víctor; Lerin, Carles; de la Iglesia, Núria

    2015-01-01

    Summary Neural stem cells (NSCs) reside in a hypoxic microenvironment within the brain. However, the crucial transcription factors (TFs) that regulate NSC biology under physiologic hypoxia are poorly understood. Here we have performed gene set enrichment analysis (GSEA) of microarray datasets from hypoxic versus normoxic NSCs with the aim of identifying pathways and TFs that are activated under oxygen concentrations mimicking normal brain tissue microenvironment. Integration of TF target (TFT) and pathway enrichment analysis identified the calcium-regulated TF NFATc4 as a major candidate to regulate hypoxic NSC functions. Nfatc4 expression was coordinately upregulated by top hypoxia-activated TFs, while NFATc4 target genes were enriched in hypoxic NSCs. Loss-of-function analyses further revealed that the calcineurin-NFATc4 signaling axis acts as a major regulator of NSC self-renewal and proliferation in vitro and in vivo by promoting the expression of TFs, including Id2, that contribute to the maintenance of the NSC state. PMID:26235896

  12. DNA methylation impacts gene expression and ensures hypoxic survival of Mycobacterium tuberculosis.

    PubMed

    Shell, Scarlet S; Prestwich, Erin G; Baek, Seung-Hun; Shah, Rupal R; Sassetti, Christopher M; Dedon, Peter C; Fortune, Sarah M

    2013-01-01

    DNA methylation regulates gene expression in many organisms. In eukaryotes, DNA methylation is associated with gene repression, while it exerts both activating and repressive effects in the Proteobacteria through largely locus-specific mechanisms. Here, we identify a critical DNA methyltransferase in M. tuberculosis, which we term MamA. MamA creates N⁶-methyladenine in a six base pair recognition sequence present in approximately 2,000 copies on each strand of the genome. Loss of MamA reduces the expression of a number of genes. Each has a MamA site located at a conserved position relative to the sigma factor -10 binding site and transcriptional start site, suggesting that MamA modulates their expression through a shared, not locus-specific, mechanism. While strains lacking MamA grow normally in vitro, they are attenuated in hypoxic conditions, suggesting that methylation promotes survival in discrete host microenvironments. Interestingly, we demonstrate strikingly different patterns of DNA methyltransferase activity in different lineages of M. tuberculosis, which have been associated with preferences for distinct host environments and different disease courses in humans. Thus, MamA is the major functional adenine methyltransferase in M. tuberculosis strains of the Euro-American lineage while strains of the Beijing lineage harbor a point mutation that largely inactivates MamA but possess a second functional DNA methyltransferase. Our results indicate that MamA influences gene expression in M. tuberculosis and plays an important but strain-specific role in fitness during hypoxia.

  13. Selective enhancement of hypoxic cell killing by tempol-regulated suicide gene expression

    PubMed Central

    KAGIYA, GO; OGAWA, RYOHEI; CHOUDHURI, RAJANI; COOK, JOHN A; HATASHITA, MASANORI; TANAKA, YOSHIKAZU; KODA, KANA; YAMASHITA, KEI; KUBO, MAKOTO; KAWAKAMI, FUMITAKA; MITCHELL, JAMES B

    2015-01-01

    The presence of hypoxic regions within solid tumors is caused by an imbalance between cell proliferation and angiogenesis. Such regions may facilitate the onset of recurrence after radiation therapy and chemotherapy, as hypoxic cells show resistance to these treatments. We found that tempol, a nitroxide, strongly induces the accumulation of hypoxia-inducible factor (HIF)-1α, particularly under conditions of hypoxia. We, therefore, evaluated whether tempol enhances the gene expression via HIF-1α, potentially leading to various applications for cancer gene therapy targeting hypoxic cells. Consequently, following treatment with tempol under hypoxia, the luciferase (Luc) activity in the cells transfected with the plasmid containing the luc gene with the oxygen-dependent degradation domain and a promoter composed of hypoxia-responsive elements increased up to approximately 10-fold compared to that observed in cells treated identically with the exception of tempol. The plasmid constructed by replacing the luc gene with the fcy::fur fusion gene as a suicide gene, strongly induced the accumulation of the Fcy::Fur fusion protein, only when incubated in the presence of the hypoxic mimic CoCl2 and tempol. The transfected cells were successfully killed with the addition of 5-fluorocytosine to the cell culture according to the fcy::fur fusion gene expression. As similar but lesser enhancement of the Luc activity was also observed in solid tumor tissues in nude mice, this strategy may be applied for hypoxic cancer eradication. PMID:26034980

  14. Selective enhancement of hypoxic cell killing by tempol-regulated suicide gene expression.

    PubMed

    Kagiya, Go; Ogawa, Ryohei; Choudhuri, Rajani; Cook, John A; Hatashita, Masanori; Tanaka, Yoshikazu; Koda, Kana; Yamashita, Kei; Kubo, Makoto; Kawakami, Fumitaka; Mitchell, James B

    2015-08-01

    The presence of hypoxic regions within solid tumors is caused by an imbalance between cell proliferation and angiogenesis. Such regions may facilitate the onset of recurrence after radiation therapy and chemotherapy, as hypoxic cells show resistance to these treatments. We found that tempol, a nitroxide, strongly induces the accumulation of hypoxia-inducible factor (HIF)-1α, particularly under conditions of hypoxia. We, therefore, evaluated whether tempol enhances the gene expression via HIF-1α, potentially leading to various applications for cancer gene therapy targeting hypoxic cells. Consequently, following treatment with tempol under hypoxia, the luciferase (Luc) activity in the cells transfected with the plasmid containing the luc gene with the oxygen-dependent degradation domain and a promoter composed of hypoxia-responsive elements increased up to approximately 10-fold compared to that observed in cells treated identically with the exception of tempol. The plasmid constructed by replacing the luc gene with the fcy::fur fusion gene as a suicide gene, strongly induced the accumulation of the Fcy::Fur fusion protein, only when incubated in the presence of the hypoxic mimic CoCl2 and tempol. The transfected cells were successfully killed with the addition of 5-fluorocytosine to the cell culture according to the fcy::fur fusion gene expression. As similar but lesser enhancement of the Luc activity was also observed in solid tumor tissues in nude mice, this strategy may be applied for hypoxic cancer eradication. PMID:26034980

  15. [Transcriptional control of ciliary genes].

    PubMed

    Vieillard, Jennifer; Jerber, Julie; Durand, Bénédicte

    2014-11-01

    Cilia are found in many eukaryotic species and share a common microtubule architecture that can nonetheless show very diverse features within one animal. The genesis of cilia and their diversity require the expression of different specific genes. At least two classes of transcription factors are involved in ciliogenesis: the RFX family, essential for the assembly of most cilia and the FOXJ1 transcription factors that are key regulators of motile cilia assembly. These two different families of transcription factors have both specific and common target genes and they can also cooperate for the formation of cilia. In collaboration with cell type specific factors, they also contribute to the specialisation of cilia. As a consequence, the identification of RFX and FOXJ1 target genes has emerged as an efficient strategy to identify novel ciliary genes, and in particular genes potentially implicated in ciliopathies.

  16. DNA Methylation Impacts Gene Expression and Ensures Hypoxic Survival of Mycobacterium tuberculosis

    PubMed Central

    Shell, Scarlet S.; Prestwich, Erin G.; Baek, Seung-Hun; Shah, Rupal R.; Sassetti, Christopher M.; Dedon, Peter C.; Fortune, Sarah M.

    2013-01-01

    DNA methylation regulates gene expression in many organisms. In eukaryotes, DNA methylation is associated with gene repression, while it exerts both activating and repressive effects in the Proteobacteria through largely locus-specific mechanisms. Here, we identify a critical DNA methyltransferase in M. tuberculosis, which we term MamA. MamA creates N6-methyladenine in a six base pair recognition sequence present in approximately 2,000 copies on each strand of the genome. Loss of MamA reduces the expression of a number of genes. Each has a MamA site located at a conserved position relative to the sigma factor −10 binding site and transcriptional start site, suggesting that MamA modulates their expression through a shared, not locus-specific, mechanism. While strains lacking MamA grow normally in vitro, they are attenuated in hypoxic conditions, suggesting that methylation promotes survival in discrete host microenvironments. Interestingly, we demonstrate strikingly different patterns of DNA methyltransferase activity in different lineages of M. tuberculosis, which have been associated with preferences for distinct host environments and different disease courses in humans. Thus, MamA is the major functional adenine methyltransferase in M. tuberculosis strains of the Euro-American lineage while strains of the Beijing lineage harbor a point mutation that largely inactivates MamA but possess a second functional DNA methyltransferase. Our results indicate that MamA influences gene expression in M. tuberculosis and plays an important but strain-specific role in fitness during hypoxia. PMID:23853579

  17. Identification of Hypoxia-Inducible Target Genes of Aspergillus fumigatus by Transcriptome Analysis Reveals Cellular Respiration as an Important Contributor to Hypoxic Survival

    PubMed Central

    Kroll, Kristin; Pähtz, Vera; Hillmann, Falk; Vaknin, Yakir; Schmidt-Heck, Wolfgang; Roth, Martin; Jacobsen, Ilse D.; Osherov, Nir; Brakhage, Axel A.

    2014-01-01

    Aspergillus fumigatus is an opportunistic, airborne pathogen that causes invasive aspergillosis in immunocompromised patients. During the infection process, A. fumigatus is challenged by hypoxic microenvironments occurring in inflammatory, necrotic tissue. To gain further insights into the adaptation mechanism, A. fumigatus was cultivated in an oxygen-controlled chemostat under hypoxic and normoxic conditions. Transcriptome analysis revealed a significant increase in transcripts associated with cell wall polysaccharide metabolism, amino acid and metal ion transport, nitrogen metabolism, and glycolysis. A concomitant reduction in transcript levels was observed with cellular trafficking and G-protein-coupled signaling. To learn more about the functional roles of hypoxia-induced transcripts, we deleted A. fumigatus genes putatively involved in reactive nitrogen species detoxification (fhpA), NAD+ regeneration (frdA and osmA), nitrogen metabolism (niaD and niiA), and respiration (rcfB). We show that the nitric oxygen (NO)-detoxifying flavohemoprotein gene fhpA is strongly induced by hypoxia independent of the nitrogen source but is dispensable for hypoxic survival. By deleting the nitrate reductase gene niaD, the nitrite reductase gene niiA, and the two fumarate reductase genes frdA and osmA, we found that alternative electron acceptors, such as nitrate and fumarate, do not have a significant impact on growth of A. fumigatus during hypoxia, but functional mitochondrial respiratory chain complexes are essential under these conditions. Inhibition studies indicated that primarily complexes III and IV play a crucial role in the hypoxic growth of A. fumigatus. PMID:25084861

  18. Identification of hypoxia-inducible target genes of Aspergillus fumigatus by transcriptome analysis reveals cellular respiration as an important contributor to hypoxic survival.

    PubMed

    Kroll, Kristin; Pähtz, Vera; Hillmann, Falk; Vaknin, Yakir; Schmidt-Heck, Wolfgang; Roth, Martin; Jacobsen, Ilse D; Osherov, Nir; Brakhage, Axel A; Kniemeyer, Olaf

    2014-09-01

    Aspergillus fumigatus is an opportunistic, airborne pathogen that causes invasive aspergillosis in immunocompromised patients. During the infection process, A. fumigatus is challenged by hypoxic microenvironments occurring in inflammatory, necrotic tissue. To gain further insights into the adaptation mechanism, A. fumigatus was cultivated in an oxygen-controlled chemostat under hypoxic and normoxic conditions. Transcriptome analysis revealed a significant increase in transcripts associated with cell wall polysaccharide metabolism, amino acid and metal ion transport, nitrogen metabolism, and glycolysis. A concomitant reduction in transcript levels was observed with cellular trafficking and G-protein-coupled signaling. To learn more about the functional roles of hypoxia-induced transcripts, we deleted A. fumigatus genes putatively involved in reactive nitrogen species detoxification (fhpA), NAD(+) regeneration (frdA and osmA), nitrogen metabolism (niaD and niiA), and respiration (rcfB). We show that the nitric oxygen (NO)-detoxifying flavohemoprotein gene fhpA is strongly induced by hypoxia independent of the nitrogen source but is dispensable for hypoxic survival. By deleting the nitrate reductase gene niaD, the nitrite reductase gene niiA, and the two fumarate reductase genes frdA and osmA, we found that alternative electron acceptors, such as nitrate and fumarate, do not have a significant impact on growth of A. fumigatus during hypoxia, but functional mitochondrial respiratory chain complexes are essential under these conditions. Inhibition studies indicated that primarily complexes III and IV play a crucial role in the hypoxic growth of A. fumigatus.

  19. Change of genes in calcium transport channels caused by hypoxic stress in the placenta, duodenum, and kidney of pregnant rats.

    PubMed

    Yang, Hyun; An, Beum-Soo; Choi, Kyung-Chul; Jeung, Eui-Bae

    2013-02-01

    Preeclampsia is a pregnancy-specific disease characterized by concurrent development of hypertension, proteinuria, and oxidative stress in the placenta. In this study, we induced hypoxic stress in rats during pregnancy to reproduce physiological conditions associated with preeclampsia. The maternal weight of hypoxic pregnant rats was lower than that of normoxic animals. The level of calcium ions were also increased in urine collected from the hypoxic animals. In contrast, urinary concentrations of sodium, chloride, and potassium ions declined in hypoxic rats, and developed to proteinuria. The expression of genes known as two biomarkers, sFLT1 (for preeclampsia) and HIF-1alpha (for hypoxia), were highly induced in the placenta, duodenum, and kidney by hypoxic stress. The overexpression of sFLT1 and HIF-1alpha demonstrated that our experimental conditions closely mimicked ones that are associated with preeclampsia. In the present study, we measured the expression of calcium transporters (TRPV5, TRPV6, PMCA1, NCKX3, NCX1, and CaBP-9k) in the placenta, duodenum, and kidney under hypoxic conditions on Gestational Day 19.5 in rats. Placental TRPV5, TRPV6, and PMCA1 expression was up-regulated in the hypoxic rats, whereas the levels of NCX1 and CaBP-9k were unchanged. In addition, NCKX3 expression was increased in the placenta of hypoxic rats. Duodenal expression of CaBP-9k, TRPV5, TRPV 6, and PMCA1 was decreased in the hypoxic rats, whereas levels of NCXs were not altered. Renal expression of NCKX3 and TRPV6 was increased, whereas NCX1 was decreased in the hypoxic rats compared to the normoxic controls. Taken together, these results indicate that physiological changes observed in the hypoxic rats were similar to ones associated with preeclampsia. Expression of calcium transport genes in the placenta, duodenum, and kidney perturbed by hypoxic stress during pregnancy may cause calcium loss in the urine, and thereby induce calcium-deficient characteristics of preeclampsia.

  20. Hydrogen peroxide controls transcriptional responses of ERF73/HRE1 and ADH1 via modulation of ethylene signaling during hypoxic stress.

    PubMed

    Yang, Chin-Ying

    2014-04-01

    Hypoxia, or oxygen deficiency, is an abiotic stress that plants are subjected to during soil flooding. Therefore, plants have evolved adaptive mechanisms to sense oxygen deficiency and make coordinated changes at the transcriptional level. The results of this study show that the interplay between hydrogen peroxide and ethylene affected the transcriptional responses of ERF73/HRE1 and ADH1 during hypoxia signaling. H₂O₂ affected the abundance of ERF73/HRE1 and ADH1 mRNAs in both wild-type Arabidopsis and the ethylene-insensitive mutant, ein2-5. Promoter analysis was conducted using transgenic plants expressing an ERF73/HRE1 promoter-β-glucuronidase reporter gene construct. GUS staining observations and activity assays showed that GUS was regulated similarly to, and showed a similar accumulation pattern as, H₂O₂ during hypoxia. The transcript levels of ERF73/HRE1 and ADH1 were significantly decreased in the WT by combined hypoxia and diphenylene iodonium chloride (DPI, an NADPH oxidase inhibitor) treatment. In ein2-5, induction of ERF73/HRE1 was also reduced significantly by the combined hypoxia and DPI treatment. In contrast, ADH1 mRNA levels only slightly decreased after this treatment. When DPI was supplied at different time points during hypoxia treatment, H₂O₂ had critical effects on regulating the transcript levels of ERF73/HRE1 and ADH1 during the early stages of hypoxia signaling. The induction of hypoxia-inducible genes encoding peroxidases and cytochrome P450s was affected, and accumulation of H₂O₂ was reduced, in ein2-5 during hypoxic stress. Together, these results demonstrate that H₂O₂ plays an important role during primary hypoxia signaling to control the transcriptional responses of ERF73/HRE1 and ADH1 via modulation of ethylene signaling. PMID:24395201

  1. A dual signalling pathway for the hypoxic expression of lipid genes, dependent on the glucose sensor Rag4, is revealed by the analysis of the KlMGA2 gene in Kluyveromyces lactis.

    PubMed

    Micolonghi, Chiara; Ottaviano, Daniela; Di Silvio, Eva; Damato, Giuseppe; Heipieper, Hermann J; Bianchi, Michele M

    2012-07-01

    In the respiratory yeast Kluyveromyces lactis, little is known about the factors regulating the metabolic response to oxygen shortage. After searching for homologues of characterized Saccharomyces cerevisiae regulators of the hypoxic response, we identified a gene that we named KlMGA2, which is homologous to MGA2. The deletion of KlMGA2 strongly reduced both the fermentative and respiratory growth rate and altered fatty acid composition and the unsaturation index of membranes. The reciprocal heterologous expression of MGA2 and KlMGA2 in the corresponding deletion mutant strains suggested that Mga2 and KlMga2 are functional homologues. KlMGA2 transcription was induced by hypoxia and the glucose sensor Rag4 mediated the hypoxic induction of KlMGA2. Transcription of lipid biosynthetic genes KlOLE1, KlERG1, KlFAS1 and KlATF1 was induced by hypoxia and was dependent on KlMga2, except for KlOLE1. Rag4 was required for hypoxic induction of transcription for both KlMga2-dependent (KlERG1) and KlMga2-independent (KlOLE1) structural genes.

  2. Neurotoxocarosis alters myelin protein gene transcription and expression.

    PubMed

    Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina

    2015-06-01

    Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas.

  3. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias

    2015-01-01

    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  4. Field study of cyclic hypoxic effects on gene expression in grass shrimp hepatopancreas.

    PubMed

    Li, Tiandao; Brouwer, Marius

    2013-12-01

    Grass shrimp, Palaemonetes pugio, are widely used for ecological and toxicological research. They commonly experience cyclic hypoxia in their natural habitats. The response of grass shrimp to laboratory-controlled cyclic hypoxia has been studied in detail, but little is known about how field acclimatized grass shrimp regulate the gene expression and response to cyclic hypoxia. In this study we examined morphometric parameters, relative fecundity and gene expression of grass shrimp collected from two areas in Weeks Bay (Mobile, Alabama). One is a traditionally normoxic location (WBM), and the other is a traditionally cyclic hypoxic location (WC). In the week preceding grass shrimp collection dissolved oxygen (DO) at the field sites was measured continuously. DO was <2 (mg/L DO) and between 2 and 3 (mg/L DO) for 0 and 255min at WBM, and for 285 and 1035min at WC, respectively. Weight and length of WBM grass shrimp were significantly greater than weight and length of WC shrimp. WBM shrimp had more eggs than WC shrimp, but the difference was not significant. Shrimp from WC had a significant higher number of parasites than those from WBM. A cDNA microarray was utilized to investigate the changes in gene expression in grass shrimp hepatopancreas. Five genes, previously identified as hypoxia/cyclic hypoxia-responsive genes in laboratory exposure studies, were significantly up-regulated in WC shrimp relative to WBM. A total of 5 genes were significantly down-regulated in the field study. Only one of those genes, vitellogenin, has been previously found in chronic and cyclic hypoxic studies. Up and down-regulation of 7 selected genes was confirmed by qPCR. The overall pattern of gene expression in wild shrimp from cyclic DO sites in Weeks Bay showed only weak correlations with gene expression in shrimp from chronic and cyclic hypoxic laboratory studies. It appears therefore that transcriptome profiles of laboratory acclimated animals are of limited utility for understanding

  5. Massive transcriptional start site analysis of human genes in hypoxia cells

    PubMed Central

    Tsuchihara, Katsuya; Suzuki, Yutaka; Wakaguri, Hiroyuki; Irie, Takuma; Tanimoto, Kousuke; Hashimoto, Shin-ichi; Matsushima, Kouji; Mizushima-Sugano, Junko; Yamashita, Riu; Nakai, Kenta; Bentley, David; Esumi, Hiroyasu; Sugano, Sumio

    2009-01-01

    Combining our full-length cDNA method and the massively parallel sequencing technology, we developed a simple method to collect precise positional information of transcriptional start sites (TSSs) together with digital information of the gene-expression levels in a high throughput manner. We applied this method to observe gene-expression changes in a colon cancer cell line cultured in normoxic and hypoxic conditions. We generated more than 100 million 36-base TSS-tag sequences and revealed comprehensive features of hypoxia responsive alterations in the transcriptional landscape of the human genome. The features include presence of inducible ‘hot regions’ in 54 genomic regions, 220 novel hypoxia inducible promoters that may drive non-protein-coding transcripts, 191 hypoxia responsive alternative promoters and detailed views of 120 novel as well as known hypoxia responsive genes. We further analyzed hypoxic response of different cells using additional 60 million TSS-tags and found that the degree of the gene-expression changes were different among cell lines, possibly reflecting cellular robustness against hypoxia. The novel dynamic figure of the human gene transcriptome will deepen our understanding of the transcriptional program of the human genome as well as bringing new insights into the biology of cancer cells in hypoxia. PMID:19237398

  6. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.

    2015-01-01

    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  7. The transcription of the alarmin cytokine interleukin-1 alpha is controlled by hypoxia inducible factors 1 and 2 alpha in hypoxic cells.

    PubMed

    Rider, Peleg; Kaplanov, Irena; Romzova, Marianna; Bernardis, Liora; Braiman, Alex; Voronov, Elena; Apte, Ron N

    2012-01-01

    During hypoxia, cells undergo transcriptional changes to adjust to metabolic stress, to promote cell survival, and to induce pro-angiogenic factors. Hypoxia-induced factors (HIFs) regulate these transcriptional alterations. Failure to restore oxygen levels results in cell death by necrosis. IL-1α is one of the most important mediators of sterile inflammation following hypoxia-mediated necrosis. During hypoxia, IL-1α is up-regulated and released from necrotic cells, promoting the initiation of sterile inflammation. This study examined the role of IL-1α transcription in initiation of hypoxic stress and the correlation between IL-1α transcription and HIFα factors. In an epithelial cell line cultured under hypoxic conditions, IL-1α transcription was up-regulated in a process mediated and promoted by HIFα factors. IL-1α transcription was also up-regulated in hypoxia in a fibroblast cell line, however, in these cells, HIFα factors inhibited the elevation of transcription. These data suggest that HIFα factors play a significant role in initiating sterile inflammation by controlling IL-1α transcription during hypoxia in a differential manner, depending on the cell type.

  8. The transcription of the alarmin cytokine interleukin-1 alpha is controlled by hypoxia inducible factors 1 and 2 alpha in hypoxic cells

    PubMed Central

    Rider, Peleg; Kaplanov, Irena; Romzova, Marianna; Bernardis, Liora; Braiman, Alex; Voronov, Elena; Apte, Ron N.

    2012-01-01

    During hypoxia, cells undergo transcriptional changes to adjust to metabolic stress, to promote cell survival, and to induce pro-angiogenic factors. Hypoxia-induced factors (HIFs) regulate these transcriptional alterations. Failure to restore oxygen levels results in cell death by necrosis. IL-1α is one of the most important mediators of sterile inflammation following hypoxia-mediated necrosis. During hypoxia, IL-1α is up-regulated and released from necrotic cells, promoting the initiation of sterile inflammation. This study examined the role of IL-1α transcription in initiation of hypoxic stress and the correlation between IL-1α transcription and HIFα factors. In an epithelial cell line cultured under hypoxic conditions, IL-1α transcription was up-regulated in a process mediated and promoted by HIFα factors. IL-1α transcription was also up-regulated in hypoxia in a fibroblast cell line, however, in these cells, HIFα factors inhibited the elevation of transcription. These data suggest that HIFα factors play a significant role in initiating sterile inflammation by controlling IL-1α transcription during hypoxia in a differential manner, depending on the cell type. PMID:23049530

  9. Neurotoxocarosis alters myelin protein gene transcription and expression.

    PubMed

    Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina

    2015-06-01

    Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas. PMID:25773181

  10. Hypoxic Induction of the Regulator of G-Protein Signalling 4 Gene Is Mediated by the Hypoxia-Inducible Factor Pathway

    PubMed Central

    Olechnowicz, Sam W. Z.; Fedele, Anthony O.; Peet, Daniel J.

    2012-01-01

    The transcriptional response to hypoxia is largely dependent on the Hypoxia Inducible Factors (HIF-1 and HIF-2) in mammalian cells. Many target genes have been characterised for these heterodimeric transcription factors, yet there is evidence that the full range of HIF-regulated genes has not yet been described. We constructed a TetON overexpression system in the rat pheochromocytoma PC-12 cell line to search for novel HIF and hypoxia responsive genes. The Rgs4 gene encodes the Regulator of G-Protein Signalling 4 (RGS4) protein, an inhibitor of signalling from G-protein coupled receptors, and dysregulation of Rgs4 is linked to disease states such as schizophrenia and cardiomyopathy. Rgs4 was found to be responsive to HIF-2α overexpression, hypoxic treatment, and hypoxia mimetic drugs in PC-12 cells. Similar responses were observed in human neuroblastoma cell lines SK-N-SH and SK-N-BE(2)C, but not in endothelial cells, where Rgs4 transcript is readily detected but does not respond to hypoxia. Furthermore, this regulation was found to be dependent on transcription, and occurs in a manner consistent with direct HIF transactivation of Rgs4 transcription. However, no HIF binding site was detectable within 32 kb of the human Rgs4 gene locus, leading to the possibility of regulation by long-distance genomic interactions. Further research into Rgs4 regulation by hypoxia and HIF may result in better understanding of disease states such as schizophrenia, and also shed light on the other roles of HIF yet to be discovered. PMID:22970249

  11. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana

    2013-01-01

    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  12. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.

    1992-01-01

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  13. Hypoxic stress inhibits multiple aspects of the potato tuber wound response. [Solanum tuberosum L

    SciTech Connect

    Butler, W.; Cook, L.; Vayda, M.E. )

    1990-05-01

    Potato (Solanum tuberosum L.) tubers subjected to wounding under hypoxic stress do not synthesize RNA species that are induced in response to wounding in aerobic conditions. Further, wound-response proteins fail to be synthesized when wounded tubers are transferred to hypoxic conditions although messenger RNAs which encode them persist for many hours after transfer. Hypoxic stress also prevents the incorporation of ({sup 3}H)thymidine by wounded tubers that occurs in aerobic conditions. In contrast, hypoxic tubers accumulate and translate transcripts of genes whose products are involved in anaerobic metabolism whether or not they are wounded. Both the hypoxic response and the aerobic wound response preclude the synthesis of proteins encoded by messenger RNAs which accumulated during the tuberization process and which can be translated in vitro. Finally, wounding elicits the degradation of a subset of these tuberization-associated transcripts. These data indicate a complex and precise regulation of gene expression at several levels of macromolecular synthesis.

  14. Transcriptional enhancer from milk protein genes

    DOEpatents

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  15. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.

    1994-09-01

    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  16. Angiotensinogen Gene Transcription in Pulmonary Fibrosis

    PubMed Central

    Uhal, Bruce D.; Dang, My-Trang T.; Li, Xiaopeng; Abdul-Hafez, Amal

    2012-01-01

    An established body of literature supports the hypothesis that activation of a local tissue angiotensin (ANG) system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis. Transcriptional activation of the angiotensinogen (AGT) gene is believed to be a critical and necessary step in this activation. This paper summarizes the data in support of this theory and discusses transcriptional regulation of AGT, with an emphasis on lung AGT synthesis as a determinant of fibrosis severity. Genetic data linking AGT polymorphisms to the severity of disease in Idiopathic Pulmonary Fibrosis are also discussed. PMID:22500179

  17. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano

    2015-01-01

    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  18. Effect of selenium deficiency on gene transcription

    SciTech Connect

    Christensen, M.J.; Burgener, K.W. )

    1991-03-11

    To investigate the general effects of dietary selenium (Se) deficiency on gene transcription, weanling male Sprague-Dawley rats were fed a basal Se-deficient Torula yeast-based diet or the same diet supplemented with 0.5 ppm Se as sodium selenite for 40 days. At that time three rats in each dietary group were sacrificed. Livers were excised and divided into two portions for isolation of nuclei and for assay of cytosolic Se-glutathione peroxidase (Se-GPX) activity. Se-GPX activity was 279 {plus minus} 4 (mean {plus minus} SEM) mUnits/mg protein in Se-adequate livers, and 10 {plus minus} 2 mUnits/mg protein in Se-deficient livers. One aliquot of nuclei from each dietary group was used in a run-on transcription assay, employing {alpha}-{sup 32}P-UTP to label nascent transcripts. Equal quantities of radioactivity from these nuclei were hybridized with cDNA probes bound to nitrocellulose. Message bound to each probe was quantitated by laser densitometry of autoradiographs, and by scintillation counting of dot blotted nitrocellulose. Transcription of most genes tested, including Se-GPX, was not significantly affected by dietary Se intake. However, the amount of hybridization to a murine oncogene probe (v-fos) was increased in Se deficiency.

  19. Combinatorial Transcription Control in Gene Regulation

    NASA Astrophysics Data System (ADS)

    Hwa, Terence; Buchler, Nicolas E.; Gerland, Ulrich

    2003-03-01

    We develop a simple thermodynamic model for the regulation of gene transcription and explore the limits of combinatorial control. Our model is based on the ``regulated recruitment'' mechanism [M. Ptashne and A. Gann, Nature 386 (1997) 569], assuming weak contact interaction between the regulatory proteins together with specific protein-DNA interactions. We further assume "programmability" in the strengths of these interactions within a biophysically allowed range [U. Gerland, J.D. Moroz, and T.Hwa, PNAS 99 (2002) 12015], through the choices and the locations of the protein-binding DNA sequences in the regulatory region. Within our thermodynamic model, we demonstrate the implementability of various binary logic functions (including XOR) by computing the degree of gene transcription (output) for all combinations of regulatory protein concentrations (input).

  20. Negative regulation of miRNA-9 on oligodendrocyte lineage gene 1 during hypoxic-ischemic brain damage

    PubMed Central

    Yang, Lijun; Cui, Hong; Cao, Ting

    2014-01-01

    Oligodendrocyte lineage gene 1 plays a key role in hypoxic-ischemic brain damage and myelin repair. miRNA-9 is involved in the occurrence of many related neurological disorders. Bioinformatics analysis demonstrated that miRNA-9 complementarily, but incompletely, bound oligodendrocyte lineage gene 1, but whether miRNA-9 regulates oligodendrocyte lineage gene 1 remains poorly understood. Whole brain slices of 3-day-old Sprague-Dawley rats were cultured and divided into four groups: control group; oxygen-glucose deprivation group (treatment with 8% O2 + 92% N2 and sugar-free medium for 60 minutes); transfection control group (after oxygen and glucose deprivation for 60 minutes, transfected with control plasmid) and miRNA-9 transfection group (after oxygen and glucose deprivation for 60 minutes, transfected with miRNA-9 plasmid). From the third day of transfection, and with increasing culture days, oligodendrocyte lineage gene 1 expression increased in each group, peaked at 14 days, and then decreased at 21 days. Real-time quantitative PCR results, however, demonstrated that oligodendrocyte lineage gene 1 expression was lower in the miRNA-9 transfection group than that in the transfection control group at 1, 3, 7, 14, 21 and 28 days after transfection. Results suggested that miRNA-9 possibly negatively regulated oligodendrocyte lineage gene 1 in brain tissues during hypoxic-ischemic brain damage. PMID:25206848

  1. Bidirectional Transcription Directs Both Transcriptional Gene Activation and Suppression in Human Cells

    PubMed Central

    Morris, Kevin V.; Santoso, Sharon; Turner, Anne-Marie; Pastori, Chiara; Hawkins, Peter G.

    2008-01-01

    Small RNAs targeted to gene promoters in human cells have been shown to modulate both transcriptional gene suppression and activation. However, the mechanism involved in transcriptional activation has remained poorly defined, and an endogenous RNA trigger for transcriptional gene silencing has yet to be identified. Described here is an explanation for siRNA-directed transcriptional gene activation, as well as a role for non-coding antisense RNAs as effector molecules driving transcriptional gene silencing. Transcriptional activation of p21 gene expression was determined to be the result of Argonaute 2–dependent, post-transcriptional silencing of a p21-specific antisense transcript, which functions in Argonaute 1–mediated transcriptional control of p21 mRNA expression. The data presented here suggest that in human cells, bidirectional transcription is an endogenous gene regulatory mechanism whereby an antisense RNA directs epigenetic regulatory complexes to a sense promoter, resulting in RNA-directed epigenetic gene regulation. The observations presented here support the notion that epigenetic silencing of tumor suppressor genes, such as p21, may be the result of an imbalance in bidirectional transcription levels. This imbalance allows the unchecked antisense RNA to direct silent state epigenetic marks to the sense promoter, resulting in stable transcriptional gene silencing. PMID:19008947

  2. Notch1 is associated with the multidrug resistance of hypoxic osteosarcoma by regulating MRP1 gene expression.

    PubMed

    Li, C; Guo, D; Tang, B; Zhang, Y; Zhang, K; Nie, L

    2016-01-01

    Hypoxia and Notch signaling pathway are closely related and both participate in cell proliferation and drug resistance of tumors. However, the molecular mechanisms of hypoxia and Notch signaling pathway in cell proliferation and drug resistance of osteosarcoma (OS) remain unclear. In this study, to further evaluate the role of hypoxia and Notch1 on drug resistance of OS, we investigated the influence of inhibiting Notch1 pathway by Notch1 small interference RNA (siRNA) on human MG-63 OS cells in hypoxia. Our data showed that hypoxia promoted OS cell proliferation, induced the G0/G1-S-G2/M phase transition, and increased multidrug resistance of human OS cells. Western blot analysis suggested that hypoxia increased the expression of HIF-1α, Notch1, and multidrug resistance protein-1 (MRP1) in human OS cells. Notch1 siRNA inhibits proliferation and increases apoptosis of hypoxic OS cells. Finally, these hypoxic OS cells can be sensitized to multidrug treatment through inhibition of the Notch protein expression by siRNA. Repression of the Notch protein expression resulted in down-regulation of MRP1 protein. These data support the conclusion that Notch signaling is up-regulated in human OS cells under hypoxia and Notch1 may represent a viable target to overcome chemoresistant OS cells in a hypoxic niche by regulating MRP1 gene expression. PMID:27468877

  3. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.

    PubMed

    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G

    2016-01-01

    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  4. Altered Stra13 and Dec2 circadian gene expression in hypoxic cells

    SciTech Connect

    Guillaumond, Fabienne; Lacoche, Samuel; Dulong, Sandrine; Grechez-Cassiau, Aline; Filipski, Elisabeth; Li, Xiao-Mei; Levi, Francis; Berra, Edurne; Delaunay, Franck; Teboul, Michele

    2008-05-16

    The circadian system regulates rhythmically most of the mammalian physiology in synchrony with the environmental light/dark cycle. Alteration of circadian clock gene expression has been associated with tumour progression but the molecular links between the two mechanisms remain poorly defined. Here we show that Stra13 and Dec2, two circadian transcriptional regulators which play a crucial role in cell proliferation and apoptosis are overexpressed and no longer rhythmic in serum shocked fibroblasts treated with CoCl{sub 2,} a substitute of hypoxia. This effect is associated with a loss of circadian expression of the clock genes Rev-erb{alpha} and Bmal1, and the clock-controlled gene Dbp. Consistently, cotransfection assays demonstrate that STRA13 and DEC2 both antagonize CLOCK:BMAL1 dependent transactivation of the Rev-erb{alpha} and Dbp promoters. Using a transplantable osteosarcoma tumour model, we show that hypoxia is associated with altered circadian expression of Stra13, Dec2, Rev-erb{alpha}, Bmal1 and Dbp in vivo. These observations collectively support the notion that overexpression of Stra13 and Dec2 links hypoxia signalling to altered circadian clock gene expression.

  5. Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus

    PubMed Central

    Méndez, Catalina; Ahlenstiel, Chantelle L; Kelleher, Anthony D

    2015-01-01

    While human immunodeficiency virus 1 (HIV-1) infection is controlled through continuous, life-long use of a combination of drugs targeting different steps of the virus cycle, HIV-1 is never completely eradicated from the body. Despite decades of research there is still no effective vaccine to prevent HIV-1 infection. Therefore, the possibility of an RNA interference (RNAi)-based cure has become an increasingly explored approach. Endogenous gene expression is controlled at both, transcriptional and post-transcriptional levels by non-coding RNAs, which act through diverse molecular mechanisms including RNAi. RNAi has the potential to control the turning on/off of specific genes through transcriptional gene silencing (TGS), as well as fine-tuning their expression through post-transcriptional gene silencing (PTGS). In this review we will describe in detail the canonical RNAi pathways for PTGS and TGS, the relationship of TGS with other silencing mechanisms and will discuss a variety of approaches developed to suppress HIV-1 via manipulation of RNAi. We will briefly compare RNAi strategies against other approaches developed to target the virus, highlighting their potential to overcome the major obstacle to finding a cure, which is the specific targeting of the HIV-1 reservoir within latently infected cells. PMID:26279984

  6. Transcriptional interference among the murine β-like globin genes

    PubMed Central

    Hu, Xiao; Eszterhas, Susan; Pallazzi, Nicolas; Bouhassira, Eric E.; Fields, Jennifer; Tanabe, Osamu; Gerber, Scott A.; Bulger, Michael; Engel, James Douglas; Groudine, Mark

    2007-01-01

    Mammalian β-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other β-like genes, we generated mice with deletions of the promoter regions of Ey and βh1 and measured transcription of the remaining genes. Deletion of the Ey and βh1 promoters increased transcription of βmajor and βminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect βh1 nor did deletion of βh1 affect Ey, but Ey deletion uniquely activated transcription from βh0, a β-like globin gene immediately downstream of Ey. Protein analysis showed that βh0 encodes a translatable β-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and βh1 and the gene-specific repression of βh0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed βh0. PMID:17077320

  7. Correlation of gene expression with physiological functions: Examples of pulmonary blood vessel rheology, hypoxic hypertension, and tissue remodeling.

    PubMed

    Huang, W; Sher, Y P; Peck, K; Fung, Y C

    2001-01-01

    Microarray gene chip technology is a powerful invention looking for applications. A general principle is proposed here to direct the power of the technology toward physiology, medicine, and pharmacology. Our principle is to match quantitative measures of gene expression with the trend of mathematical parameters that describe biological functions. Mathematical parameterization is the heart. The procedure is illustrated by lung physiology, including the hypoxic hypertension, rheological properties of the tissues, and the remodeling of the pulmonary arterial wall under hypertensive stress. We show first how to reduce the experimental results on these physiological functions into mathematical formulas, and how the parameters of these formulas describe the functional trends precisely. Then under the assumption that the microarray reveals gene activities quantitatively, we match the trends of the gene activity with the trends of the functional parameters. Genes whose trends do match are interpreted as relevant to the functions. Those that do not match are considered irrelevant to the functions. The more functions we consider, the fewer will be the number of genes that are relevant to all functions. Thus we learn about the generality and specificity of the influence of genes on physiology. PMID:11381166

  8. Hypoxic and Anoxic Induction of Alcohol Dehydrogenase in Roots and Shoots of Seedlings of Zea mays (Adh Transcripts and Enzyme Activity).

    PubMed Central

    Andrews, D. L.; Cobb, B. G.; Johnson, J. R.; Drew, M. C.

    1993-01-01

    Alcohol dehydrogenase (ADH) is one of a number of enzymes of glycolysis and fermentation known to be synthesized preferentially under low O2 conditions. We examined levels of Adh1 transcripts and of ADH activity in 5-mm root tips, root axes (the remainder of the seminal root), and shoots of maize (Zea mays L. cv TX 5855) seedlings. Seedlings with roots averaging about 60-mm long were transferred from fully aerobic conditions (solutions sparged with 40% [v/v] O2) to anaerobic (O2-free) conditions, or to an intermediate O2 concentration. There was no prior acclimation to low O2. In root tips, anoxia induced Adh1 transcripts and enzyme activity at 6 h, but this was followed by a rapid decline so that at 12 to 18 h neither were detectable and the root tips were dead. In contrast, higher levels of Adh1 transcripts and enzyme activity were maintained for at least 48 h in root axes and shoots. When induction at 6 h was measured over a wide range of O2 concentrations, a peak in ADH activity occurred in all tissues at 4% (v/v) O2. Maximum levels of transcripts, however, were in the range of 0 to 4% O2, depending on the tissue. The time course of hypoxic induction (at 4% O2) in root tips showed a peak in transcript levels at 6 h, whereas ADH activity continued to rise throughout the 24-h experiment. These results show that in root tips, ADH induction by anoxia was small and transient relative to induction by hypoxia. PMID:12231696

  9. SUMO Signaling by Hypoxic Inactivation of SUMO-Specific Isopeptidases.

    PubMed

    Kunz, Kathrin; Wagner, Kristina; Mendler, Luca; Hölper, Soraya; Dehne, Nathalie; Müller, Stefan

    2016-09-13

    Post-translational modification of proteins with ubiquitin-like SUMO modifiers is a tightly regulated and highly dynamic process. The SENP family of SUMO-specific isopeptidases comprises six cysteine proteases. They are instrumental in counterbalancing SUMO conjugation, but their regulation is not well understood. We demonstrate that in hypoxic cell extracts, the catalytic activity of SENP family members, in particular SENP1 and SENP3, is inhibited in a rapid and fully reversible process. Comparative mass spectrometry from normoxic and hypoxic cells defines a subset of hypoxia-induced SUMO1 targets, including SUMO ligases RanBP2 and PIAS2, glucose transporter 1, and transcriptional regulators. Among the most strongly induced targets, we identified the transcriptional co-repressor BHLHE40, which controls hypoxic gene expression programs. We provide evidence that SUMOylation of BHLHE40 is reversed by SENP1 and contributes to transcriptional repression of the metabolic master regulator gene PGC-1α. We propose a pathway that connects oxygen-controlled SENP activity to hypoxic reprogramming of metabolism. PMID:27626674

  10. Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription.

    PubMed

    Rauen, Thomas; Frye, Bjoern C; Wang, Jialin; Raffetseder, Ute; Alidousty, Christina; En-Nia, Abdelaziz; Floege, Jürgen; Mertens, Peter R

    2016-09-16

    Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3' enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3' adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPO production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. PMID:27524241

  11. INHIBITION OF ERN1 SIGNALING ENZYME AFFECTS HYPOXIC REGULATION OF THE EXPRESSION OF E2F8, EPAS1, HOXC6, ATF3, TBX3 AND FOXF1 GENES IN U87 GLIOMA CELLS.

    PubMed

    Minchenko, O H; Tsymbal, D O; Minchenko, D O; Kovalevska, O V; Karbovskyi, L L; Bikfalvi, A

    2015-01-01

    Hypoxia as well as the endoplasmic reticulum stress are important factors of malignant tumor growth and control of the expression of genes, which regulate numerous metabolic processes and cell proliferation. Furthermore, blockade of ERN1 (endoplasmic reticulum to nucleus 1) suppresses cell proliferation and tumor growth. We studied the effect of hypoxia on the expression of genes encoding the transcription factors such as E2F8 (E2F transcription factor 8), EPAS1 (endothelial PAS domain protein 1), TBX3 (T-box 3), ATF3 (activating transcription factor 3), FOXF1 (forkhead box F), and HOXC6 (homeobox C6) in U87 glioma cells with and without ERN1 signaling enzyme function. We have established that hypoxia enhances the expression of HOXC6, E2F8, ATF3, and EPAS1 genes but does not change TBX3 and FOXF1 gene expression in glioma cells with ERNI function. At the same time, the expression level of all studied genes is strongly decreased, except for TBX3 gene, in glioma cells without ERN1 function. Moreover, the inhibition of ERN1 signaling enzyme function significantly modifies the effect of hypoxia on the expression of these transcription factor genes. removes or introduces this regulation as well as changes a direction or magnitude of hypoxic regulation. Present study demonstrates that fine-tuning of the expression of proliferation related genes depends upon hypoxia and ERN1-mediated endoplasmic reticulum stress signaling and correlates with slower proliferation rate of glioma cells without ERN1 function. PMID:26255341

  12. Modular composition of gene transcription networks.

    PubMed

    Gyorgy, Andras; Del Vecchio, Domitilla

    2014-03-01

    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems.

  13. Transcription dynamics of inducible genes modulated by negative regulations.

    PubMed

    Li, Yanyan; Tang, Moxun; Yu, Jianshe

    2015-06-01

    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  14. Cohesin modulates transcription of estrogen-responsive genes.

    PubMed

    Antony, Jisha; Dasgupta, Tanushree; Rhodes, Jenny M; McEwan, Miranda V; Print, Cristin G; O'Sullivan, Justin M; Horsfield, Julia A

    2015-03-01

    The cohesin complex has essential roles in cell division, DNA damage repair and gene transcription. The transcriptional function of cohesin is thought to derive from its ability to connect distant regulatory elements with gene promoters. Genome-wide binding of cohesin in breast cancer cells frequently coincides with estrogen receptor alpha (ER), leading to the hypothesis that cohesin facilitates estrogen-dependent gene transcription. We found that cohesin modulates the expression of only a subset of genes in the ER transcription program, either activating or repressing transcription depending on the gene target. Estrogen-responsive genes most significantly influenced by cohesin were enriched in pathways associated with breast cancer progression such as PI3K and ErbB1. In MCF7 breast cancer cells, cohesin depletion enhanced transcription of TFF1 and TFF2, and was associated with increased ER binding and increased interaction between TFF1 and its distal enhancer situated within TMPRSS3. In contrast, cohesin depletion reduced c-MYC mRNA and was accompanied by reduced interaction between a distal enhancer of c-MYC and its promoters. Our data indicates that cohesin is not a universal facilitator of ER-induced transcription and can even restrict enhancer-promoter communication. We propose that cohesin modulates transcription of estrogen-dependent genes to achieve appropriate directionality and amplitude of expression.

  15. Transcriptional and post-transcriptional regulation of chloroplast gene expression in Petunia hybrida.

    PubMed

    van Grinsven, M Q; Gielen, J J; Zethof, J L; Nijkamp, H J; Kool, A J

    1986-11-01

    To study the control of differential gene expression during plastid biogenesis in Petunia hybrida, we have investigated the in vivo translation and transcription of the rbc L gene, coding for the large subunit of ribulose bisphosphate carboxylase (LSU), and the psa A gene, coding for P700 chlorophyll-a apoprotein (AP700). Differential expression of these plastid-encoded genes was studied in two developmentally different plastid systems, proplastid-like organelles from the green cell suspension AK2401 and mature chloroplasts from green leaves. In vivo translation of rbc L and psa A transcripts was analysed using specific antibodies. Specific transcript levels were analysed using internal fragments of the rbc L and psa A genes. A standardization procedure was used so that a direct correlation could be made between the amount of products and gene copy number. In Petunia hybrida the amount of LSU polypeptides present in both plastid types does not correspond to the amount of specific mRNA for the gene. Although the rbc L transcripts are present in both plastid types, the LSU protein is only present in green leaf plastids and not in cell culture plastids. In vitro translation of isolated rbc L transcripts give similar results, thereby suggesting that differences in the primary structure of the transcripts are responsible for the observed discrepancy. In contrast to this, the amount of AP700 polypeptides does correspond to the amount of the psa A transcripts. Therefore, our results indicate that the expression of chloroplast genes during plastid biogenesis takes place on at least two different levels: expression of the rbc L gene is regulated post-transcriptionally while expression of the psa A gene is regulated at the transcriptional level.

  16. MicroRNA regulation of DNA repair gene expression in hypoxic stress.

    PubMed

    Crosby, Meredith E; Kulshreshtha, Ritu; Ivan, Mircea; Glazer, Peter M

    2009-02-01

    Genetic instability is a hallmark of cancer; the hypoxic tumor microenvironment has been implicated as a cause of this phenomenon. MicroRNAs (miR) are small nonprotein coding RNAs that can regulate various cellular pathways. We report here that two miRs, miR-210 and miR-373, are up-regulated in a hypoxia-inducible factor-1alpha-dependent manner in hypoxic cells. Bioinformatics analyses suggested that these miRs could regulate factors implicated in DNA repair pathways. Forced expression of miR-210 was found to suppress the levels of RAD52, which is a key factor in homology-dependent repair (HDR); the forced expression of miR-373 led to a reduction in the nucleotide excision repair (NER) protein, RAD23B, as well as in RAD52. Consistent with these results, both RAD52 and RAD23B were found to be down-regulated in hypoxia, but in both cases, the hypoxia-induced down-regulation could be partially reversed by antisense inhibition of miR-210 and miR-373. Importantly, luciferase reporter assays indicated that miR-210 is capable of interacting with the 3' untranslated region (UTR) of RAD52 and that miR-373 can act on the 3' UTR of RAD23B. These results indicate that hypoxia-inducible miR-210 and miR-373 play roles in modulating the expression levels of key proteins involved in the HDR and NER pathways, providing new mechanistic insight into the effect of hypoxia on DNA repair and genetic instability in cancer.

  17. A Complete Set of Nascent Transcription Rates for Yeast Genes

    PubMed Central

    Pelechano, Vicent; Chávez, Sebastián; Pérez-Ortín, José E.

    2010-01-01

    The amount of mRNA in a cell is the result of two opposite reactions: transcription and mRNA degradation. These reactions are governed by kinetics laws, and the most regulated step for many genes is the transcription rate. The transcription rate, which is assumed to be exercised mainly at the RNA polymerase recruitment level, can be calculated using the RNA polymerase densities determined either by run-on or immunoprecipitation using specific antibodies. The yeast Saccharomyces cerevisiae is the ideal model organism to generate a complete set of nascent transcription rates that will prove useful for many gene regulation studies. By combining genomic data from both the GRO (Genomic Run-on) and the RNA pol ChIP-on-chip methods we generated a new, more accurate nascent transcription rate dataset. By comparing this dataset with the indirect ones obtained from the mRNA stabilities and mRNA amount datasets, we are able to obtain biological information about posttranscriptional regulation processes and a genomic snapshot of the location of the active transcriptional machinery. We have obtained nascent transcription rates for 4,670 yeast genes. The median RNA polymerase II density in the genes is 0.078 molecules/kb, which corresponds to an average of 0.096 molecules/gene. Most genes have transcription rates of between 2 and 30 mRNAs/hour and less than 1% of yeast genes have >1 RNA polymerase molecule/gene. Histone and ribosomal protein genes are the highest transcribed groups of genes and other than these exceptions the transcription of genes is an infrequent phenomenon in a yeast cell. PMID:21103382

  18. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu

    2012-09-01

    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  19. Enhanced hypoxic preconditioning by isoflurane: signaling gene expression and requirement of intracellular Ca2+ and inositol triphosphate receptors

    PubMed Central

    Bickler, Philip E.; Fahlman, Christian S.

    2012-01-01

    Neurons preconditioned with non-injurious hypoxia or the anesthetic isoflurane express different genes but are equally protected against severe hypoxia/ischemia. We hypothesized that neuroprotection would be augmented when preconditioning with isoflurane and hypoxic preconditioning are combined. We also tested if preconditioning requires intracellular Ca2+ and the inositol triphosphate receptor, and if gene expression is similar in single agent and combined preconditioning. Hippocampal slice cultures prepared from 9 day-old rats were preconditioned with hypoxia (95% N2, 5% CO2 for 15 min, HPC), 1% isoflurane for 15 min (APC) or their combination (CPC) for 15 min. A day later cultures were deprived of O2 and glucose (OGD) to produce neuronal injury. Cell death was assessed 48 hr after OGD. mRNA encoding 119 signal transduction genes was quantified with cDNA micro arrays. Intracellular Ca2+ in CA1 region was measured with fura-2 during preconditioning. The cell-permeable Ca2+ buffer BAPTA-AM, the IP3 receptor antagonist Xestospongin C and RNA silencing were used to investigate preconditioning mechanisms. CPC decreased CA1, CA3 and dentate region death by 64–86% following OGD, more than HPC or APC alone (P<0.01). Gene expression following CPC was an amalgam of gene expression in HPC and APC, with simultaneous increases in growth/development and survival/apoptosis regulation genes. Intracellular Ca2+ chelation and RNA silencing of IP3 receptors prevented preconditioning neuroprotection and gene responses. We conclude that combined isoflurane-hypoxia preconditioning augments neuroprotection compared to single agents in immature rat hippocampal slice cultures. The mechanism involves genes for growth, development, apoptosis regulation and cell survival as well as IP3 receptors and intracellular Ca2+. PMID:20434434

  20. Enhanced hypoxic preconditioning by isoflurane: signaling gene expression and requirement of intracellular Ca2+ and inositol triphosphate receptors.

    PubMed

    Bickler, Philip E; Fahlman, Christian S

    2010-06-22

    Neurons preconditioned with non-injurious hypoxia or the anesthetic isoflurane express different genes but are equally protected against severe hypoxia/ischemia. We hypothesized that neuroprotection would be augmented when preconditioning with isoflurane and hypoxic preconditioning are combined. We also tested if preconditioning requires intracellular Ca(2+) and the inositol triphosphate receptor, and if gene expression is similar in single agent and combined preconditioning. Hippocampal slice cultures prepared from 9 day old rats were preconditioned with hypoxia (95% N(2), 5% CO(2) for 15 min, HPC), 1% isoflurane for 15 min (APC) or their combination (CPC) for 15 min. A day later cultures were deprived of O(2) and glucose (OGD) to produce neuronal injury. Cell death was assessed 48 h after OGD. mRNA encoding 119 signal transduction genes was quantified with cDNA micro arrays. Intracellular Ca(2+) in CA1 region was measured with fura-2 during preconditioning. The cell-permeable Ca(2+) buffer BAPTA-AM, the IP(3) receptor antagonist Xestospongin C and RNA silencing were used to investigate preconditioning mechanisms. CPC decreased CA1, CA3 and dentate region death by 64-86% following OGD, more than HPC or APC alone (P<0.01). Gene expression following CPC was an amalgam of gene expression in HPC and APC, with simultaneous increases in growth/development and survival/apoptosis regulation genes. Intracellular Ca(2+) chelation and RNA silencing of IP(3) receptors prevented preconditioning neuroprotection and gene responses. We conclude that combined isoflurane-hypoxia preconditioning augments neuroprotection compared to single agents in immature rat hippocampal slice cultures. The mechanism involves genes for growth, development, apoptosis regulation and cell survival as well as IP(3) receptors and intracellular Ca(2+).

  1. Transcript length mediates developmental timing of gene expression across Drosophila.

    PubMed

    Artieri, Carlo G; Fraser, Hunter B

    2014-11-01

    The time required to transcribe genes with long primary transcripts may limit their ability to be expressed in cells with short mitotic cycles, a phenomenon termed intron delay. As such short cycles are a hallmark of the earliest stages of insect development, we tested the impact of intron delay on the Drosophila developmental transcriptome. We find that long zygotically expressed genes show substantial delay in expression relative to their shorter counterparts, which is not observed for maternally deposited transcripts. Patterns of RNA-seq coverage along transcripts show that this delay is consistent with their inability to completely transcribe long transcripts, but not with transcriptional initiation-based regulatory control. We further show that highly expressed zygotic genes maintain compact transcribed regions across the Drosophila phylogeny, allowing conservation of embryonic expression patterns. We propose that the physical constraints of intron delay affect patterns of expression and the evolution of gene structure of a substantial portion of the Drosophila transcriptome.

  2. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2014-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  3. Transcription mediated insulation and interference direct gene cluster expression switches.

    PubMed

    Nguyen, Tania; Fischl, Harry; Howe, Françoise S; Woloszczuk, Ronja; Serra Barros, Ana; Xu, Zhenyu; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-11-19

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change.

  4. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane

    2014-01-01

    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: http://dx.doi.org/10.7554/eLife.03635.001 PMID:25407679

  5. Somatic hypermutation of immunoglobulin genes is linked to transcription initiation.

    PubMed

    Peters, A; Storb, U

    1996-01-01

    To identify DNA sequences that target the somatic hypermutation process, the immunoglobulin gene promoter located upstream of the variable (V) region was duplicated upstream of the constant (C) region of a kappa transgene. Normally, kappa genes are somatically mutated only in the VJ region, but not in the C region. In B cell hybridomas from mice with this kappa transgene (P5'C), both the VJ region and the C region, but not the region between them, were mutated at similar frequencies, suggesting that the mutation mechanism is related to transcription. The downstream promoter was not occluded by transcripts from the upstream promoter. In fact, the levels of transcripts originating from the two promoters were similar, supporting a mutation model based on initiation of transcripts. Several "hot-spots" of somatic mutation were noted, further demonstrating that this transgene has the hallmarks of somatic mutation of endogenous immunoglobulin genes. A model linking somatic mutation to transcription-coupled DNA repair is proposed.

  6. Characterizing transcriptional heterogeneity through pathway and gene set overdispersion analysis

    PubMed Central

    Fan, Jean; Salathia, Neeraj; Liu, Rui; Kaeser, Gwendolyn E.; Yung, Yun C.; Herman, Joseph L.; Kaper, Fiona; Fan, Jian-Bing; Zhang, Kun; Chun, Jerold; Kharchenko, Peter V.

    2016-01-01

    The transcriptional state of a cell reflects a variety of biological factors, from persistent cell-type specific features to transient processes such as cell cycle. Depending on biological context, all such aspects of transcriptional heterogeneity may be of interest, but detecting them from noisy single-cell RNA-seq data remains challenging. We developed PAGODA to resolve multiple, potentially overlapping aspects of transcriptional heterogeneity by testing gene sets for coordinated variability amongst measured cells. PMID:26780092

  7. Carrot and stick: HIF-alpha engages c-Myc in hypoxic adaptation.

    PubMed

    Huang, L E

    2008-04-01

    The past decade of research on hypoxic responses has provided a considerable understanding of how cells respond to hypoxic stress at the molecular level, thanks to the identification and molecular cloning of the hypoxia-inducible transcription factor, HIF-1alpha. Numerous target genes have since been identified to account for various aspects of the hypoxic response, including angiogenesis and glycolysis. Yet, fundamental questions remain regarding the mechanisms by which hypoxia controls cell proliferation, genetic instability, mitochondrial biogenesis, and oxidative respiration in cancer cells. Although the proto-oncoprotein c-Myc appears to be the diametrical opposite of HIF-1alpha in most of these processes, recent studies indicate that c-Myc is an integral part of the HIF-alpha-c-Myc molecular pathway in the hypoxic response. It has been shown that HIF-alpha engages with Myc by various mechanisms to achieve oxygen homeostasis for cell survival. This article focuses on the intricate roles of c-Myc in the hypoxic response, discusses various mechanisms controlling c-Myc activity by HIF-alpha for the regulation of hypoxia-responsive genes, and emphasizing the outcome of gene expression apparently dependent upon hypoxic conditions, cellular context, and gene promoter.

  8. Gene Transcription Profile of the Detached Retina (An AOS Thesis)

    PubMed Central

    Zacks, David N.

    2009-01-01

    Purpose: Separation of the neurosensory retina from the retinal pigment epithelium (RPE) yields many morphologic and functional consequences, including death of the photoreceptor cells, Müller cell hypertrophy, and inner retinal rewiring. Many of these changes are due to the separation-induced activation of specific genes. In this work, we define the gene transcription profile within the retina as a function of time after detachment. We also define the early activation of kinases that might be responsible for the detachment-induced changes in gene transcription. Methods: Separation of the retina from the RPE was induced in Brown-Norway rats by the injection of 1% hyaluronic acid into the subretinal space. Retinas were harvested at 1, 7, and 28 days after separation. Gene transcription profiles for each time point were determined using the Affymetrix Rat 230A gene microarray chip. Transcription levels in detached retinas were compared to those of nondetached retinas with the BRB-ArrayTools Version 3.6.0 using a random variance analysis of variance (ANOVA) model. Confirmation of the significant transcriptional changes for a subset of the genes was performed using microfluidic quantitative real-time polymerase chain reaction (qRT-PCR) assays. Kinase activation was explored using Western blot analysis to look for early phosphorylation of any of the 3 main families of mitogen-activated protein kinases (MAPK): the p38 family, the Janus kinase family, and the p42/p44 family. Results: Retinas separated from the RPE showed extensive alterations in their gene transcription profile. Many of these changes were initiated as early as 1 day after separation, with significant increases by 7 days. ANOVA analysis defined 144 genes that had significantly altered transcription levels as a function of time after separation when setting a false discovery rate at ≤0.1. Confirmatory RT-PCR was performed on 51 of these 144 genes. Differential transcription detected on the microarray

  9. Stochastic models of gene expression and post-transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Pendar, Hodjat; Kulkarni, Rahul; Jia, Tao

    2011-10-01

    The intrinsic stochasticity of gene expression can give rise to phenotypic heterogeneity in a population of genetically identical cells. Correspondingly, there is considerable interest in understanding how different molecular mechanisms impact the 'noise' in gene expression. Of particular interest are post-transcriptional regulatory mechanisms involving genes called small RNAs, which control important processes such as development and cancer. We propose and analyze general stochastic models of gene expression and derive exact analytical expressions quantifying the noise in protein distributions [1]. Focusing on specific regulatory mechanisms, we analyze a general model for post-transcriptional regulation of stochastic gene expression [2]. The results obtained provide new insights into the role of post-transcriptional regulation in controlling the noise in gene expression. [4pt] [1] T. Jia and R. V. Kulkarni, Phys. Rev. Lett.,106, 058102 (2011) [0pt] [2] T. Jia and R. V. Kulkarni, Phys. Rev. Lett., 105, 018101 (2010)

  10. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.

  11. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available

    1986-01-01

    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  12. Lactase gene transcription is activated in response to hypoxia in intestinal epithelial cells.

    PubMed

    Lee, So Young; Madan, Ashima; Furuta, Glenn T; Colgan, Sean P; Sibley, Eric

    2002-01-01

    Lactase-phlorizin hydrolase, a brush-border membrane disaccharidase, is a marker of intestinal epithelial cell differentiation and digestive function. The intestine is susceptible to conditions of hypoxia resulting from vascular perfusion deficits. We hypothesized that lactase gene induction may provide a mechanism to efficiently increase nutrient energy substrates during gut hypoxia. These studies sought to characterize expression of the lactase gene in response to hypoxia and to characterize a role for hypoxia-inducible factor (HIF-1) in mediating the hypoxic response. Microarray analysis and confirmatory RT-PCR identified a 4-fold induction of lactase mRNA abundance in intestinal epithelial Caco-2 cells exposed to hypoxia. Lactase promoter activity was similarly induced by hypoxia in cells stably transfected with a 2.0-kb 5' flanking region of the rat lactase gene linked to a reporter gene. Transient cotransfection with HIF-1alpha and beta stimulated lactase promoter activity 2.4- and 3.5-fold under conditions of normoxia and hypoxia, respectively. We conclude that HIF-1 can activate the lactase promoter in intestinal epithelial cells exposed to hypoxia. Induction of lactase transcription may represent an adaptive response to gut hypoxia.

  13. TransFind--predicting transcriptional regulators for gene sets.

    PubMed

    Kiełbasa, Szymon M; Klein, Holger; Roider, Helge G; Vingron, Martin; Blüthgen, Nils

    2010-07-01

    The analysis of putative transcription factor binding sites in promoter regions of coregulated genes allows to infer the transcription factors that underlie observed changes in gene expression. While such analyses constitute a central component of the in-silico characterization of transcriptional regulatory networks, there is still a lack of simple-to-use web servers able to combine state-of-the-art prediction methods with phylogenetic analysis and appropriate multiple testing corrected statistics, which returns the results within a short time. Having these aims in mind we developed TransFind, which is freely available at http://transfind.sys-bio.net/.

  14. Genomewide Identification of Genes Under Directional Selection: Gene Transcription QST Scan in Diverging Atlantic Salmon Subpopulations

    PubMed Central

    Roberge, C.; Guderley, H.; Bernatchez, L.

    2007-01-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a “transcriptome scan” approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h2 estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the QST values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average QST estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  15. Transcriptional landscape and essential genes of Neisseria gonorrhoeae

    PubMed Central

    Remmele, Christian W.; Xian, Yibo; Albrecht, Marco; Faulstich, Michaela; Fraunholz, Martin; Heinrichs, Elisabeth; Dittrich, Marcus T.; Müller, Tobias; Reinhardt, Richard; Rudel, Thomas

    2014-01-01

    The WHO has recently classified Neisseria gonorrhoeae as a super-bacterium due to the rapid spread of antibiotic resistant derivatives and an overall dramatic increase in infection incidences. Genome sequencing has identified potential genes, however, little is known about the transcriptional organization and the presence of non-coding RNAs in gonococci. We performed RNA sequencing to define the transcriptome and the transcriptional start sites of all gonococcal genes and operons. Numerous new transcripts including 253 potentially non-coding RNAs transcribed from intergenic regions or antisense to coding genes were identified. Strikingly, strong antisense transcription was detected for the phase-variable opa genes coding for a family of adhesins and invasins in pathogenic Neisseria, that may have regulatory functions. Based on the defined transcriptional start sites, promoter motifs were identified. We further generated and sequenced a high density Tn5 transposon library to predict a core of 827 gonococcal essential genes, 133 of which have no known function. Our combined RNA-Seq and Tn-Seq approach establishes a detailed map of gonococcal genes and defines the first core set of essential gonococcal genes. PMID:25143534

  16. Glial Cell Missing 1 Regulates Placental Growth Factor (PGF) Gene Transcription in Human Trophoblast1

    PubMed Central

    Chang, Miao; Mukherjea, Debashree; Gobble, Ryan M.; Groesch, Kathleen A.; Torry, Ronald J.; Torry, Donald S.

    2008-01-01

    Placental growth factor (PGF, previously known as PlGF) is prominently expressed by trophoblasts in human placenta, whereas most nontrophoblast cells express low levels of PGF mRNA under normal physiological conditions. We have shown that hypoxia decreases PGF expression in the trophoblast, but little is known about transcriptional regulation of PGF gene expression. We sought to determine promoter regions of the human PGF gene that contribute to its restricted high constitutive expression in the trophoblast. Overlapping putative promoter regions of human PGF gene encompassing −1.5 kb were cloned into reporter vectors and co-transfected into trophoblast and nontrophoblast cell lines. Promoter activity generated by a −1.5-kb clone was significantly higher in trophoblasts than in nontrophoblasts. Selective deletion mutants showed that a clone encompassing the PGF (−828/+34) region generated promoter activity similar to the −1.5-kb region in the trophoblast. However, deletion of another 131 bp from this subclone (−698/+34) resulted in significantly less promoter activity in the trophoblast. The (−828/−698) region significantly enhanced activity of a minimal promoter construct in trophoblast but not in nontrophoblast cells, suggesting that this region contributes to regulating PGF transcription in the trophoblast. Site-directed mutagenesis of a glial cell missing 1 (GCM1) motif in the 131-bp region significantly decreased enhancer activity in the trophoblast. Furthermore, overexpression of GCM1 significantly increased PGF −1.5-kb promoter activity and PGF mRNA expression in trophoblast and nontrophoblast cells. Forced overexpression of GCM1 restored PGF expression in the hypoxic trophoblast. These data support a functional role for GCM1 contributing to constitutively high trophoblast PGF expression and is the first direct evidence of an oxygen-responsive, trophoblast-specific transcription factor contributing to the regulation of PGF expression. PMID

  17. Transcriptional analysis of Penaeus stylirostris densovirus genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Penaeus stylirostris densovirus (PstDNV) genome contains three open reading frames (ORFs), left, middle, and right, which encode a non-structural (NS) protein, an unknown protein, and a capsid protein (CP), respectively. Transcription mapping revealed that P2, P11 and P61 promoters transcribe the le...

  18. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman

    2010-01-01

    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  19. Antisense transcription as a tool to tune gene expression.

    PubMed

    Brophy, Jennifer A N; Voigt, Christopher A

    2016-01-14

    A surprise that has emerged from transcriptomics is the prevalence of genomic antisense transcription, which occurs counter to gene orientation. While frequent, the roles of antisense transcription in regulation are poorly understood. We built a synthetic system in Escherichia coli to study how antisense transcription can change the expression of a gene and tune the response characteristics of a regulatory circuit. We developed a new genetic part that consists of a unidirectional terminator followed by a constitutive antisense promoter and demonstrate that this part represses gene expression proportionally to the antisense promoter strength. Chip-based oligo synthesis was applied to build a large library of 5,668 terminator-promoter combinations that was used to control the expression of three repressors (PhlF, SrpR, and TarA) in a simple genetic circuit (NOT gate). Using the library, we demonstrate that antisense promoters can be used to tune the threshold of a regulatory circuit without impacting other properties of its response function. Finally, we determined the relative contributions of antisense RNA and transcriptional interference to repressing gene expression and introduce a biophysical model to capture the impact of RNA polymerase collisions on gene repression. This work quantifies the role of antisense transcription in regulatory networks and introduces a new mode to control gene expression that has been previously overlooked in genetic engineering.

  20. Transcriptional wiring of cell wall-related genes in Arabidopsis.

    PubMed

    Mutwil, Marek; Ruprecht, Colin; Giorgi, Federico M; Bringmann, Martin; Usadel, Björn; Persson, Staffan

    2009-09-01

    Transcriptional coordination, or co-expression, of genes may signify functional relatedness of the corresponding proteins. For example, several genes involved in secondary cell wall cellulose biosynthesis are co-expressed with genes engaged in the synthesis of xylan, which is a major component of the secondary cell wall. To extend these types of analyses, we investigated the co-expression relationships of all Carbohydrate-Active enZYmes (CAZy)-related genes for Arabidopsis thaliana. Thus, the intention was to transcriptionally link different cell wall-related processes to each other, and also to other biological functions. To facilitate easy manual inspection, we have displayed these interactions as networks and matrices, and created a web-based interface (http://aranet.mpimp-golm.mpg.de/corecarb) containing downloadable files for all the transcriptional associations.

  1. Stochasticity of gene products from transcriptional pulsing

    NASA Astrophysics Data System (ADS)

    Iyer-Biswas, Srividya; Hayot, F.; Jayaprakash, C.

    2009-03-01

    Transcriptional pulsing has been observed in both prokaryotes and eukaryotes and plays a crucial role in cell-to-cell variability of protein and mRNA numbers. An important issue is how the time constants associated with episodes of transcriptional bursting and mRNA and protein degradation rates lead to different cellular mRNA and protein distributions, starting from the transient regime leading to the steady state. We address this by deriving and then investigating the exact time-dependent solution of the master equation for a transcriptional pulsing model of mRNA distributions. We find a plethora of results. We show that, among others, bimodal and long-tailed (power-law) distributions occur in the steady state as the rate constants are varied over biologically significant time scales. Since steady state may not be reached experimentally we present results for the time evolution of the distributions. Because cellular behavior is determined by proteins, we also investigate the effect of the different mRNA distributions on the corresponding protein distributions using numerical simulations.

  2. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    SciTech Connect

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcanii was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb

  3. Localization of dystrophin gene transcripts during mouse embryogenesis

    PubMed Central

    1992-01-01

    The spatial and temporal expression of the dystrophin gene has been examined during mouse embryogenesis, using in situ hybridization on tissue sections with a probe from the 5' end of the dystrophin coding sequence. In striated muscle, dystrophin transcripts are detectable from about 9 d in the heart and slightly later in skeletal muscle. However, there is an important difference between the two types of muscle: the heart is already functional as a contractile organ before the appearance of dystrophin transcripts, whereas this is not the case in skeletal muscle, where dystrophin and myosin heavy chain transcripts are first detectable at the same time. In the heart, dystrophin transcripts accumulate initially in the outflow tract and, at later stages, in both the atria and ventricles. In skeletal muscle, the gene is expressed in all myocytes irrespective of fiber type. In smooth muscle dystrophin transcripts are first detectable from 11 d post coitum in blood vessels, and subsequently in lung bronchi and in the digestive tract. The other major tissue where the dystrophin gene is expressed is the brain, where transcripts are clearly detectable in the cerebellum from 13 d. High-level expression of the gene is also seen in particular regions of the forebrain involved in the regulation of circadian rhythms, the endocrine system, and olfactory function, not previously identified in this context. The findings are discussed in the context of the pathology of Duchenne muscular dystrophy. PMID:1429837

  4. Identification of a Tibetan-specific mutation in the hypoxic gene EGLN1 and its contribution to high-altitude adaptation.

    PubMed

    Xiang, Kun; Ouzhuluobu; Peng, Yi; Yang, Zhaohui; Zhang, Xiaoming; Cui, Chaoying; Zhang, Hui; Li, Ming; Zhang, Yanfeng; Bianba; Gonggalanzi; Basang; Ciwangsangbu; Wu, Tianyi; Chen, Hua; Shi, Hong; Qi, Xuebin; Su, Bing

    2013-08-01

    Tibetans are well adapted to high-altitude hypoxic conditions, and in recent genome-wide scans, many candidate genes have been reported involved in the physiological response to hypoxic conditions. However, the limited sequence variations analyzed in previous studies would not be sufficient to identify causal mutations. Here we conducted resequencing of the entire genomic region (59.4 kb) of the hypoxic gene EGLN1 (one of the top candidates from the genome-wide scans) in Tibetans and identified 185 sequence variations, including 13 novel variations (12 substitutions and 1 insertion or deletion). There is a nonsynonymous mutation (rs186996510, D4E) showing surprisingly deep divergence between Tibetans and lowlander populations (Fst = 0.709 between Tibetans and Han Chinese). It is highly prevalent in Tibetans (70.9% on average) but extremely rare in Han Chinese, Japanese, Europeans, and Africans (0.56-2.27%), suggesting that it might be the causal mutation of EGLN1 contributing to high-altitude hypoxic adaptation. Neutrality test confirmed the signal of Darwinian positive selection on EGLN1 in Tibetans. Haplotype network analysis revealed a Tibetan-specific haplotype, which is absent in other world populations. The estimated selective intensity (0.029 for the C allele of rs186996510) puts EGLN1 among the known genes that have undergone the strongest selection in human populations, and the onset of selection was estimated to have started at the early Neolithic (∼8,400 years ago). Finally, we detected a significant association between rs186996510 and hemoglobin levels in Tibetans, suggesting that EGLN1 contributes to the adaptively low hemoglobin level of Tibetans compared with acclimatized lowlanders at high altitude.

  5. Transcription of genes involved in sulfolipid and polyacyltrehalose biosynthesis of Mycobacterium tuberculosis in experimental latent tuberculosis infection.

    PubMed

    Rodríguez, Jimmy E; Ramírez, Ana S; Salas, Laura P; Helguera-Repetto, Cecilia; Gonzalez-y-Merchand, Jorge; Soto, Carlos Y; Hernández-Pando, Rogelio

    2013-01-01

    The Influence of trehalose-based glycolipids in the virulence of Mycobacterium tuberculosis (Mtb) is recognised; however, the actual role of these cell-wall glycolipids in latent infection is unknown. As an initial approach, we determined by two-dimensional thin-layer chromatography the sulfolipid (SL) and diacyltrehalose/polyacyltrehalose (DAT/PAT) profile of the cell wall of hypoxic Mtb. Then, qRT-PCR was extensively conducted to determine the transcription profile of genes involved in the biosynthesis of these glycolipids in non-replicating persistent 1 (NRP1) and anaerobiosis (NRP2) models of hypoxia (Wayne model), and murine models of chronic and progressive pulmonary tuberculosis. A diminished content of SL and increased amounts of glycolipids with chromatographic profile similar to DAT were detected in Mtb grown in the NRP2 stage. A striking decrease in the transcription of mmpL8 and mmpL10 transporter genes and increased transcription of the pks (polyketidesynthase) genes involved in SL and DAT biosynthesis were detected in both the NRP2 stage and the murine model of chronic infection. All genes were found to be up-regulated in the progressive disease. These results suggest that SL production is diminished during latent infection and the DAT/PAT precursors can be accumulated inside tubercle bacilli and are possibly used in reactivation processes.

  6. Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

    PubMed Central

    Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

    2013-01-01

    The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

  7. Spatially coordinated dynamic gene transcription in living pituitary tissue

    PubMed Central

    Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE

    2016-01-01

    Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110

  8. Towards resolving the transcription factor network controlling myelin gene expression

    PubMed Central

    Fulton, Debra L.; Denarier, Eric; Friedman, Hana C.; Wasserman, Wyeth W.; Peterson, Alan C.

    2011-01-01

    In the central nervous system (CNS), myelin is produced from spirally-wrapped oligodendrocyte plasma membrane and, as exemplified by the debilitating effects of inherited or acquired myelin abnormalities in diseases such as multiple sclerosis, it plays a critical role in nervous system function. Myelin sheath production coincides with rapid up-regulation of numerous genes. The complexity of their subsequent expression patterns, along with recently recognized heterogeneity within the oligodendrocyte lineage, suggest that the regulatory networks controlling such genes drive multiple context-specific transcriptional programs. Conferring this nuanced level of control likely involves a large repertoire of interacting transcription factors (TFs). Here, we combined novel strategies of computational sequence analyses with in vivo functional analysis to establish a TF network model of coordinate myelin-associated gene transcription. Notably, the network model captures regulatory DNA elements and TFs known to regulate oligodendrocyte myelin gene transcription and/or oligodendrocyte development, thereby validating our approach. Further, it links to numerous TFs with previously unsuspected roles in CNS myelination and suggests collaborative relationships amongst both known and novel TFs, thus providing deeper insight into the myelin gene transcriptional network. PMID:21729871

  9. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  10. Bidirectional transcription of lipooligosaccharide synthesis genes from Campylobacter jejuni.

    PubMed

    Phongsisay, Vongsavanh; Fry, Benjamin N

    2007-10-01

    The lipooligosaccharide (LOS) molecules of Campylobacter jejuni are involved in virulence and induction of the Guillain-Barré syndrome (GBS). This study analysed the transcription of the LOS synthesis genes from the GBS-inducing C. jejuni strain HB 93-13 under microaerobic conditions. Fourteen consecutive genes Cj1132c, waaC, htrB, wlaNC, wlaND, cgtA, cgtB, cstII, neuB, neuC, neuA, wlaVA, wlaQA, and waaF were included. The results of rapid amplification of cDNA ends and single-stranded ligation of complementary ends showed initiation sites with potential promoter regions on both DNA strands in the Cj1132c/waaC, cgtB/cstII, and wlaQA/waaF strand-switch regions. Other termini without recognisable promoter region were also found throughout the LOS gene cluster, suggesting a low specificity of the polymerase during transcription. In addition, all gene junction regions were cloned into the shuttle vector pMW10 carrying the promoterless lacZ gene to identify functional promoter sites. Bidirectional active promoters were found in the strand-switch regions. The results of RT-PCR and cDNA blotting indicated that transcriptional linkage occurred between different operons, indicating a lack of transcription termination within the LOS gene cluster. Moreover, the results of semi-quantitative RT-PCR and real-time RT-PCR showed that both DNA strands were transcribed but transcription of the coding strand was at a higher rate. The results presented here provide an insight into transcription of the LOS synthesis gene cluster of C. jejuni.

  11. Transcriptional activation of heat-shock genes in eukaryotes.

    PubMed

    Tanguay, R M

    1988-06-01

    Prokaryotes and eukaryotes respond to thermal or various chemical stresses by the rapid induction of a group of genes collectively referred to as the heat shock genes. In eucaryotes, the expression of these genes is primarily regulated at the transcriptional level. The early observations that transfected heat shock genes were inducible in heterologous systems suggested the existence of common regulatory elements in these ubiquitous genes. Sequence analysis of cloned Drosophila heat shock genes revealed a conserved 14 base pair (bp) inverted repeat, which is essential for heat induction. This regulatory sequence, referred to as the heat shock element (HSE), is found in multiple imperfect copies upstream of the TATA box of all heat shock genes. While studies in heterologous systems indicated that a single copy of HSE was sufficient for inducibility, further analysis in homologous assays suggests that multiple HSE can act in a cooperative way and that the efficiency of transcriptional activation is related, within limits, to the number of HSE. Comparative analysis of heat shock genes reveals that HSE can be positioned at different distances from the TATA box in either orientation, a behavior reminiscent of enhancer elements. However, the presence of HSE does not necessarily confer heat inducibility, as shown by their presence in the constitutively expressed but non-heat-inducible homologous cognate genes. Footprinting and nuclease mapping have been used to show that a protein factor (HSTF: heat shock transcription factor) binds to the HSE element, activating heat shock gene transcription in a dose-dependent manner. The recent progress in the isolation and characterization of HSTF in Drosophila, yeast, and human cells is reviewed. Finally, different models suggested to account for the positive regulation of heat shock genes by the HSTF are presented.

  12. Transcriptional targeting of tumor endothelial cells for gene therapy

    PubMed Central

    Dong, Zhihong; Nör, Jacques E.

    2009-01-01

    It is well known that angiogenesis plays a critical role in the pathobiology of tumors. Recent clinical trials have shown that inhibition of angiogenesis can be an effective therapeutic strategy for patients with cancer. However, one of the outstanding issues in anti-angiogenic treatment for cancer is the development of toxicities related to off-target effects of drugs. Transcriptional targeting of tumor endothelial cells involves the use of specific promoters for selective expression of therapeutic genes in the endothelial cells lining the blood vessels of tumors. Recently, several genes that are expressed specifically in tumor-associated endothelial cells have been identified and characterized. These discoveries have enhanced the prospectus of transcriptionaly targeting tumor endothelial cells for cancer gene therapy. In this manuscript, we review the promoters, vectors, and therapeutic genes that have been used for transcriptional targeting of tumor endothelial cells, and discuss the prospects of such approaches for cancer gene therapy. PMID:19393703

  13. Synaptic, transcriptional, and chromatin genes disrupted in autism

    PubMed Central

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P.; Poultney, Christopher S.; Samocha, Kaitlin; Cicek, A Ercument; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarjinder; Klei, Lambertus; Kosmicki, Jack; Fu, Shih-Chen; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F.; Brownfeld, Jessica M.; Cai, Jinlu; Campbell, Nicholas J.; Carracedo, Angel; Chahrour, Maria H.; Chiocchetti, Andreas G.; Coon, Hilary; Crawford, Emily L.; Crooks, Lucy; Curran, Sarah R.; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A.; Gallagher, Louise; Geller, Evan; Guter, Stephen J.; Hill, R. Sean; Ionita-Laza, Iuliana; Gonzalez, Patricia Jimenez; Kilpinen, Helena; Klauck, Sabine M.; Kolevzon, Alexander; Lee, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R.; McInnes, Alison L.; Neale, Benjamin; Owen, Michael J.; Ozaki, Norio; Parellada, Mara; Parr, Jeremy R.; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J.; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Wang, Li-San; Weiss, Lauren A.; Willsey, A. Jeremy; Yu, Timothy W.; Yuen, Ryan K.C.; Cook, Edwin H.; Freitag, Christine M.; Gill, Michael; Hultman, Christina M.; Lehner, Thomas; Palotie, Aarno; Schellenberg, Gerard D.; Sklar, Pamela; State, Matthew W.; Sutcliffe, James S.; Walsh, Christopher A.; Scherer, Stephen W.; Zwick, Michael E.; Barrett, Jeffrey C.; Cutler, David J.; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J.; Buxbaum, Joseph D.

    2014-01-01

    Summary The genetic architecture of autism spectrum disorder involves the interplay of common and rare variation and their impact on hundreds of genes. Using exome sequencing, analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, and a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic, transcriptional, and chromatin remodeling pathways. These include voltage-gated ion channels regulating propagation of action potentials, pacemaking, and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodelers, prominently histone post-translational modifications involving lysine methylation/demethylation. PMID:25363760

  14. [Immunoglobulin genes in lymphoid cells and regulation of their transcription].

    PubMed

    Stepchenko, A G; Urakov, D N; Luchina, N N; Deev, S M; Polianovskiĭ, O L

    1990-01-01

    The hybridoma genomes contain polyploid sets of immunoglobulin genes. We have shown, that the hybridoma PTF-02 genome contains three genes of heavy chains and two genes of light chains. The genes responsible for antibody synthesis were cloned and their structure were determined. Investigation of the kappa gene transcription and its fragments which contain regulatory sequences revealed a nuclear factor. The latter interacts with the octanucleotide localized at the promoter region of the kappa gene. The purified factor activates the transcription of the kappa gene in a heterologous cell-free system. Together with the tissue-specific factor there is also an universal factor interacting with the octanucleotide sequence. We have shown an additional factor in lymphoid cells interact with the protein which binds to the octanucleotide sequence. We have shown an additional factor in lymphoid cells interacting with the protein which binds to the octanucleotide sequence. As a result, there is a family of factors which interact with ATTTGCAT sequence. One major factor (m.w. 60 +/- 2 kDa) is an obligatory component for the initiation of immunoglobulin genes transcription.

  15. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  16. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.

    PubMed

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  17. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor

    PubMed Central

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio

    2016-01-01

    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light–oxygen–voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na+-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na+ currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  18. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo

    2016-01-01

    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  19. Post-Transcriptional Regulation of Gene Expression in Yersinia Species

    PubMed Central

    Schiano, Chelsea A.; Lathem, Wyndham W.

    2012-01-01

    Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host. PMID:23162797

  20. GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

    PubMed

    Naito, Yuki; Bono, Hidemasa

    2012-07-01

    GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

  1. Conditional enhancement of liver-specific gene transcription.

    PubMed Central

    Zaret, K S; DiPersio, C M; Jackson, D A; Montigny, W J; Weinstat, D L

    1988-01-01

    We sought to develop a cell line in which liver-specific transcription could be induced at will, to facilitate the study of factors that cause hepatocyte-specific transcription of the serum albumin gene in mice. We therefore created the H2.35 cell line from mouse hepatocytes infected with a temperature-sensitive strain of simian virus 40. During routine propagation at the permissive temperature, H2.35 cells exhibit extremely low levels of albumin transcription and mRNA. Albumin mRNA increases at least 100-fold when H2.35 cells are cultured at the restrictive temperature and in serum-free medium on a collagen substratum; the two latter conditions maintain the differentiated state of primary hepatocyte cultures. Although a major cause of the mRNA increase is posttranscriptional, the transcription rates of albumin and other liver-specific genes increase significantly. Transient-transfection experiments demonstrated that an induction of transcription is caused by activation of an albumin upstream sequence that was previously shown to enhance liver-specific transcription in transgenic mice. Thus, hepatocyte differentiation appears to be maintained in part by extracellular signals that stimulate the activity of a tissue-specific enhancer element. Images PMID:3194409

  2. Asymmetric Regulation of Peripheral Genes by Two Transcriptional Regulatory Networks

    PubMed Central

    Li, Jing-Ru; Suzuki, Takahiro; Nishimura, Hajime; Kishima, Mami; Maeda, Shiori; Suzuki, Harukazu

    2016-01-01

    Transcriptional regulatory network (TRN) reconstitution and deconstruction occur simultaneously during reprogramming; however, it remains unclear how the starting and targeting TRNs regulate the induction and suppression of peripheral genes. Here we analyzed the regulation using direct cell reprogramming from human dermal fibroblasts to monocytes as the platform. We simultaneously deconstructed fibroblastic TRN and reconstituted monocytic TRN; monocytic and fibroblastic gene expression were analyzed in comparison with that of fibroblastic TRN deconstruction only or monocytic TRN reconstitution only. Global gene expression analysis showed cross-regulation of TRNs. Detailed analysis revealed that knocking down fibroblastic TRN positively affected half of the upregulated monocytic genes, indicating that intrinsic fibroblastic TRN interfered with the expression of induced genes. In contrast, reconstitution of monocytic TRN showed neutral effects on the majority of fibroblastic gene downregulation. This study provides an explicit example that demonstrates how two networks together regulate gene expression during cell reprogramming processes and contributes to the elaborate exploration of TRNs. PMID:27483142

  3. Estrogen-dependent transcriptional activation and vitellogenin gene memory.

    PubMed

    Edinger, R S; Mambo, E; Evans, M I

    1997-12-01

    The concept of hepatic memory suggests that a gene responds more rapidly to a second exposure of an inducer than it does during the initial activation. To determine how soon estrogen-dependent DNA/protein interactions occur during the primary response, in vivo dimethylsulfate footprinting was carried out using genomic DNA amplified by ligation-mediated PCR. When estrogen was added to disrupted cells from a hormone-naive liver, changes within and around the estrogen response elements occurred within seconds, indicating a direct and rapid effect on this estrogen-responsive promoter that had never before been activated. Because this effect was so rapid relative to the delayed onset of mRNA accumulation during the primary response, run-on transcription assays were used to determine the transcription profiles for four of the yolk protein genes during the primary and secondary responses to estrogen. As with the accumulation of mRNA, the onset of transcription was delayed for all of these genes after a primary exposure to estrogen. Interestingly, after the secondary exposure to estrogen, the vitellogenin I, vitellogenin II, and very low density apolipoprotein II genes displayed a more rapid onset of transcription, whereas the primary and secondary profiles of apolipoprotein B transcription in response to estrogen were identical. Because the apoB gene is constitutively expressed in the absence of estrogen, and the vitellogenins are quiescent before the administration of the hormone, hepatic memory most likely represents a relatively stable event in the transition to an active state of a gene that is committed for tissue-specific expression.

  4. The transcription factor titration effect dictates level of gene expression.

    PubMed

    Brewster, Robert C; Weinert, Franz M; Garcia, Hernan G; Song, Dan; Rydenfelt, Mattias; Phillips, Rob

    2014-03-13

    Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number-in multiple identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally, we use these experiments to dynamically measure plasmid copy number through the cell cycle.

  5. The Transcription Factor Titration Effect Dictates Level of Gene Expression

    PubMed Central

    Brewster, Robert C.; Weinert, Franz M.; Garcia, Hernan G.; Song, Dan; Rydenfelt, Mattias; Phillips, Rob

    2014-01-01

    Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number; in multiple, identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally we use these experiments to dynamically measure plasmid copy number through the cell cycle. PMID:24612990

  6. Thermodynamics-based models of transcriptional regulation with gene sequence.

    PubMed

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  7. Acute Targeting of General Transcription Factor IIB Restricts Cardiac Hypertrophy via Selective Inhibition of Gene Transcription

    PubMed Central

    Sayed, Danish; Yang, Zhi; He, Minzhen; Pfleger, Jessica M.; Abdellatif, Maha

    2014-01-01

    Background We previously reported that specialized and housekeeping genes are differentially regulated via de novo recruitment and pause-release of RNA polymerase II (pol II), respectively, during cardiac hypertrophy. However, the significance of this finding remains to be examined. Therefore, the purpose of this study was to determine the mechanisms that differentially regulate these gene groups and exploit them for therapeutic targeting. Methods and Results Here we show that general transcription factor IIB (TFIIB) and cyclin-dependent kinase 9 are upregulated during hypertrophy, both targeted by miR-1, and play preferential roles in regulating those two groups of genes. Chromatin immunoprecipitation-sequencing reveals that TFIIB is constitutively bound to all paused, housekeeping, promoters, whereas, de novo recruitment of TFIIB and pol II is required for specialized genes that are induced during hypertrophy. We exploited this dichotomy to acutely inhibit induction of the latter set, which encompasses cardiomyopathy, immune reaction, and extracellular matrix genes, using locked nucleic acid (LNA)-modified antisense TFIIB oligonucleotide treatment. This resulted in suppression of all specialized genes, while sparing the housekeeping ones, and, thus, attenuated pathological hypertrophy. Conclusions The data for the first time reveal distinct general transcription factor IIB dynamics that regulate specialized vs. housekeeping genes during cardiac hypertrophy. Thus, by acutely targeting TFIIB we were able to selectively inhibit the former set of genes and ameliorate pressure overload hypertrophy. We also demonstrate the feasibility of acutely and reversibly targeting cardiac mRNA for therapeutic purposes using LNA-modified antisense oligonucleotides. PMID:25398966

  8. Immunoglobulin genes and their transcriptional control in teleosts.

    PubMed

    Hikima, Jun-ichi; Jung, Tae-Sung; Aoki, Takashi

    2011-09-01

    Immunoglobulin (Ig), which exists only in jawed vertebrates, is one of the most important molecules in adaptive immunity. In the last two decades, many teleost Ig genes have been identified by in silico data mining from the enormous gene and EST databases of many fish species. In this review, the organization of Ig gene segments, the expressed Ig isotypes and their transcriptional controls are discussed. The Ig heavy chain (IgH) locus in teleosts encodes the variable (V), the diversity (D), the joining (J) segments and three different isotypic constant (C) regions including Cμ, Cδ, and Cζ/τ genes, and is organized as a "translocon" type like the IgH loci of higher vertebrates. In contrast, the Ig light (L) chain locus is arranged in a "multicluster" or repeating set of VL, JL, and CL segments. The IgL chains have four isotypes; two κ L1/G and L3/F), σ (L2) and λ. The transcription of IgH genes in teleosts is regulated by a VH promoter and the Eμ3' enhancer, which both function in a B cell-specific manner. The location of the IgH locus, structure and transcriptional function of the Eμ3' enhancer are important to our understanding of the evolutional changes that have occurred in the IgH gene locus.

  9. The myxoma virus thymidine kinase gene: sequence and transcriptional mapping.

    PubMed

    Jackson, R J; Bults, H G

    1992-02-01

    The myxoma virus thymidine kinase (TK) gene is encoded on a 1.6 kb SacI-SalI restriction fragment located between 57.7 and 59.3 kb on the 163 kb genomic map. The nucleotide sequence of this fragment as well as 228 bp from the adjacent SalI-AA2 fragment was determined and found to encode four major open reading frames (ORFs). Three of these ORFs are similar in nucleotide sequence to ORFs L5R and J1R, and the TK gene of vaccinia virus (VV). The fourth ORF, MF8a, shows similarity to the ORFs found in the same position relative to the TK genes of Shope fibroma virus, Kenya sheep-1 virus and swine-pox virus. A search of the complete VV nucleotide sequence for regions of similarity to MF8a identified the host specificity gene C7L. Northern blot analysis of early viral RNA identified transcripts of approximately 700 nucleotides for both the TK gene and ORF MF8a. The 5' ends of the TK gene and ORF MF8a early mRNAs were mapped by primer extension to initiation sites 13 nucleotides downstream of sequences with similarity to the VV early promoter consensus. The sizes of the TK and MF8a mRNAs are consistent with transcription termination and polyadenylation occurring downstream of the sequence TTTTTNT, which is identical to the consensus sequence for the VV transcription termination signal.

  10. Cis and trans activation of adenovirus IVa2 gene transcription.

    PubMed Central

    Natarajan, V; Salzman, N P

    1985-01-01

    The transcriptional control region of the adenovirus IVa2 promoter was analyzed by cloning this promoter in front of a gene coding for bacterial chloramphenicol acetyl transferase (CATase) and estimating levels of CATase and IVa2 promoter specific RNA synthesized after transfection. To produce detectable amounts of CATase with the IVa2 promoter, an enhancer has to be present in cis. In the absence of enhancer sequences, the adenovirus E1A gene can not stimulate CATase synthesis. When cells were transfected with plasmids containing enhancer sequences and various IVa2 mutant promoters upstream of the CAT gene, we observed that CATase activity was not reduced significantly even after deletion of all sequences upstream of the RNA initiation site. Synthesis of IVa2 specific RNA was dependent on plasmids containing an enhancer (SV40 72 bp repeat) that was present in cis. In the absence of enhancer sequences, co-transfection to provide the adenovirus E1A gene in trans also stimulated IVa2 RNA synthesis. When HeLa cells were transfected with various deletion mutants with an enhancer in cis it was seen that sequences -38 to -64 base pairs upstream of the RNA initiation site are necessary for efficient transcription. The E1A gene in trans and an enhancer in cis have an additive effect on RNA synthesis from both IVa2 and major late promoters. The basis for the conflicting results between transcription and CATase synthesis is discussed. Images PMID:2989786

  11. Gene transcription in polar bears (Ursus maritimus) from disparate populations

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Waters, Shannon C.; Meyerson, Randi; Rode, Karyn D.; Atwood, Todd C.

    2015-01-01

    Polar bears in the Beaufort (SB) and Chukchi (CS) Seas experience different environments due primarily to a longer history of sea ice loss in the Beaufort Sea. Ecological differences have been identified as a possible reason for the generally poorer body condition and reproduction of Beaufort polar bears compared to those from the Chukchi, but the influence of exposure to other stressors remains unknown. We use molecular technology, quantitative PCR, to identify gene transcription differences among polar bears from the Beaufort and Chukchi Seas as well as captive healthy polar bears. We identified significant transcriptional differences among a priori groups (i.e., captive bears, SB 2012, SB 2013, CS 2013) for ten of the 14 genes of interest (i.e., CaM, HSP70, CCR3, TGFβ, COX2, THRα, T-bet, Gata3, CD69, and IL17); transcription levels of DRβ, IL1β, AHR, and Mx1 did not differ among groups. Multivariate analysis also demonstrated separation among the groups of polar bears. Specifically, we detected transcript profiles consistent with immune function impairment in polar bears from the Beaufort Sea, when compared with Chukchi and captive polar bears. Although there is no strong indication of differential exposure to contaminants or pathogens between CS and SB bears, there are clearly differences in important transcriptional responses between populations. Further investigation is warranted to refine interpretation of potential effects of described stress-related conditions for the SB population.

  12. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  13. Transcriptional Regulation of the p16 Tumor Suppressor Gene.

    PubMed

    Kotake, Yojiro; Naemura, Madoka; Murasaki, Chihiro; Inoue, Yasutoshi; Okamoto, Haruna

    2015-08-01

    The p16 tumor suppressor gene encodes a specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 and is found altered in a wide range of human cancers. p16 plays a pivotal role in tumor suppressor networks through inducing cellular senescence that acts as a barrier to cellular transformation by oncogenic signals. p16 protein is relatively stable and its expression is primary regulated by transcriptional control. Polycomb group (PcG) proteins associate with the p16 locus in a long non-coding RNA, ANRIL-dependent manner, leading to repression of p16 transcription. YB1, a transcription factor, also represses the p16 transcription through direct association with its promoter region. Conversely, the transcription factors Ets1/2 and histone H3K4 methyltransferase MLL1 directly bind to the p16 locus and mediate p16 induction during replicative and premature senescence. In the present review, we discuss the molecular mechanisms by which these factors regulate p16 transcription.

  14. Myc post-transcriptionally induces HIF1 protein and target gene expression in normal and cancer cells

    PubMed Central

    Doe, Megan R.; Ascano, Janice; Kaur, Mandeep; Cole, Michael D.

    2012-01-01

    c-Myc is frequently overexpressed in tumors and plays an important role in the regulation of cancer metabolism. Hypoxia-inducible factor-1 (HIF1), the master regulator of the hypoxic response, enhances tumorigenesis and influences metabolism via upregulation of the glycolytic pathway and suppression of mitochondrial respiration. Together, deregulated Myc and HIF1 cooperate to lend metabolic advantages to proliferating cancer cells and contribute to the Warburg Effect. Here we show that overexpression of Myc significantly stabilizes the alpha subunit of HIF1 (HIF1alpha) under normoxic conditions and enhances HIF1alpha accumulation under hypoxic conditions in cells. Post-transcriptional regulation of HIF1α by Myc led to the induction of HIF1α gene targets. Normoxic HIF1α protein expression was also dependent on Myc. Functionally; HIF1α expression was required for Myc-induced anchorage-independent growth and cell proliferation. Myc-dependent stabilization of HIF1α involved either disruption of binding to the VHL complex or post-translational protein modifications. Taken together, our findings uncover a previously uncharacterized regulatory relationship between Myc and HIF1 that has important implications for cancer metabolism and development. PMID:22186139

  15. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription.

    PubMed

    Takai, Hideki; Mezawa, Masaru; Choe, Jin; Nakayama, Yohei; Ogata, Yorimasa

    2013-09-01

    Runt homeodomain protein 2 (Runx2), distalless 5 (Dlx5) and Smad1 are transcription factors that play critical roles in controlling the differentiation of osteoblasts and mineralization of bone. Proto-oncogene tyrosine-protein kinase, Src, is an enzyme encoded by the Src gene. The normal cellular gene is called cellular-Src (c-Src). Bone sialoprotein (BSP), a protein implicated in the initial mineralization of newly formed bone, is an early phenotypic marker of differentiated osteoblasts. In this study, we used overexpression plasmids with Runx2, Dlx5, Smad1 or c-Src inserts to search for the effects of these transcription factors and proto-oncogene on BSP gene expression using rat osteoblast-like ROS 17/2.8. When we used Runx2, Dlx5 or c-Src overexpression plasmids for the transfection, BSP and Runx2 mRNA levels were increased in ROS 17/2.8 cells. However, overexpression of Smad1 did not induce BSP and Runx2 mRNA. Transient transfection analyses were performed using chimeric constructs of the rat BSP gene promoter linked to a luciferase reporter gene. Transfection of ROS 17/2.8 cells with Runx2, Dlx5 or c-Src overexpression plasmid increased the luciferase activities of the constructs, pLUC3 (-116 to +60), pLUC4 (-425 to +60) and pLUC5 (-801 to +60). However, Smad1 overexpression had no effect on the luciferase activities. These results demonstrate that overexpression of Runx2, Dlx5 or c-Src stimulates BSP transcription, and suggest that Runx2, Dlx5 and c-Src might be crucial transcriptional regulators of mineralization and bone formation.

  16. Sperm is epigenetically programmed to regulate gene transcription in embryos.

    PubMed

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M; Zegerman, Philip; Bradshaw, Charles R; Peters, Antoine H F M; Gurdon, John B; Jullien, Jerome

    2016-08-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  17. Sperm is epigenetically programmed to regulate gene transcription in embryos

    PubMed Central

    Teperek, Marta; Simeone, Angela; Gaggioli, Vincent; Miyamoto, Kei; Allen, George E.; Erkek, Serap; Kwon, Taejoon; Marcotte, Edward M.; Zegerman, Philip; Bradshaw, Charles R.; Peters, Antoine H.F.M.; Gurdon, John B.; Jullien, Jerome

    2016-01-01

    For a long time, it has been assumed that the only role of sperm at fertilization is to introduce the male genome into the egg. Recently, ideas have emerged that the epigenetic state of the sperm nucleus could influence transcription in the embryo. However, conflicting reports have challenged the existence of epigenetic marks on sperm genes, and there are no functional tests supporting the role of sperm epigenetic marking on embryonic gene expression. Here, we show that sperm is epigenetically programmed to regulate embryonic gene expression. By comparing the development of sperm- and spermatid-derived frog embryos, we show that the programming of sperm for successful development relates to its ability to regulate transcription of a set of developmentally important genes. During spermatid maturation into sperm, these genes lose H3K4me2/3 and retain H3K27me3 marks. Experimental removal of these epigenetic marks at fertilization de-regulates gene expression in the resulting embryos in a paternal chromatin-dependent manner. This demonstrates that epigenetic instructions delivered by the sperm at fertilization are required for correct regulation of gene expression in the future embryos. The epigenetic mechanisms of developmental programming revealed here are likely to relate to the mechanisms involved in transgenerational transmission of acquired traits. Understanding how parental experience can influence development of the progeny has broad potential for improving human health. PMID:27034506

  18. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  19. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    PubMed Central

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim Ø.; Usheva, Anny

    2010-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA contacts. We use this effect to establish the separate contributions of transcription factor binding and DNA dynamics to transcriptional activity. Our results argue against a purely ‘transcription factor-centric’ view of transcription initiation, suggesting that both DNA dynamics and transcription factor binding are necessary conditions for transcription initiation. PMID:20019064

  20. ULTRAPETALA trxG genes interact with KANADI transcription factor genes to regulate Aradopsis Gynoecium patterning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin remodeling factors cont...

  1. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes

    PubMed Central

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L.; Folch, Josep M.; Rodríguez, M. Carmen; Óvilo, Cristina; Silió, Luis; Fernández, Ana I.

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  2. Identification of the simian foamy virus transcriptional transactivator gene (taf).

    PubMed Central

    Mergia, A; Shaw, K E; Pratt-Lowe, E; Barry, P A; Luciw, P A

    1991-01-01

    Simian foamy virus type 1 (SFV-1), a member of spumavirus subfamily of retroviruses, encodes a transcriptional transactivator that functions to strongly augment gene expression directed by the viral long terminal repeat (LTR). The objective of this study was to identify the viral gene responsible for transactivation. Nucleotide sequences between the env gene and the LTR of SFV-1 were determined. The predicted amino acid sequence revealed two large open reading frames (ORFs), designated ORF-1 (311 amino acids) and ORF-2 (422 amino acids). In the corresponding region of the human foamy virus, three ORFs (bel-1, bel-2, and bel-3) have been identified (R. M. Flugel, A. Rethwilm, B. Maurer, and G. Darai, EMBO J. 6:2077-2084, 1987). Pairwise comparisons of the ORF-1 and ORF-2 with bel-1 and bel-2 show small clusters of homology; less than 39% overall homology of conserved amino acids is observed. A counterpart for human foamy virus bel-3 is not present in the SFV-1 sequence. Three species of viral RNA have been identified in cells infected with SFV-1; an 11.5-kb RNA representing full-length transcripts, a 6.5-kb RNA representing the env message, and a 2.8-kb RNA from the ORF region. Analysis of a cDNA clone encoding the ORF region of SFV-1 reveals that the 2.8-kb message is generated by complex splicing events involving the 3' end of the env gene. In transient expression assays in cell lines representing several species. ORF-1 was shown to be necessary and sufficient for transactivating viral gene expression directed by the SFV-1 LTR. The target for transactivation is located in the U3 domain of the LTR, upstream from position - 125 (+ 1 represents the transcription initiation site). We propose that OFF-1 of SFV-1 be designated the transcriptional transactivator of foamy virus (taf). Images PMID:1851862

  3. Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes.

    PubMed

    Pérez-Montarelo, Dafne; Fernández, Almudena; Barragán, Carmen; Noguera, Jose L; Folch, Josep M; Rodríguez, M Carmen; Ovilo, Cristina; Silió, Luis; Fernández, Ana I

    2013-01-01

    The leptin (LEP) and its receptor (LEPR) regulate food intake and energy balance through hypothalamic signaling. However, the LEP-LEPR axis seems to be more complex and its expression regulation has not been well described. In pigs, LEP and LEPR genes have been widely studied due to their relevance. Previous studies reported significant effects of SNPs located in both genes on growth and fatness traits. The aim of this study was to determine the expression profiles of LEP and LEPR across hypothalamic, adipose, hepatic and muscle tissues in Iberian x Landrace backcrossed pigs and to analyze the effects of gene variants on transcript abundance. To our knowledge, non porcine LEPR isoforms have been described rather than LEPRb. A short porcine LEPR isoform (LEPRa), that encodes a protein lacking the intracellular residues responsible of signal transduction, has been identified for the first time. The LEPRb isoform was only quantifiable in hypothalamus while LEPRa appeared widely expressed across tissues, but at higher levels in liver, suggesting that both isoforms would develop different roles. The unique LEP transcript showed expression in backfat and muscle. The effects of gene variants on transcript expression revealed interesting results. The LEPRc.1987C>T polymorphism showed opposite effects on LEPRb and LEPRa hypothalamic expression. In addition, one out of the 16 polymorphisms identified in the LEPR promoter region revealed high differential expression in hepatic LEPRa. These results suggest a LEPR isoform-specific regulation at tissue level. Conversely, non-differential expression of LEP conditional on the analyzed polymorphisms could be detected, indicating that its regulation is likely affected by other mechanisms rather than gene sequence variants. The present study has allowed a transcriptional characterization of LEP and LEPR isoforms on a range of tissues. Their expression patterns seem to indicate that both molecules develop peripheral roles apart from

  4. Transcriptional regulation of genes related to progesterone production.

    PubMed

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production. PMID:26135521

  5. Post-Transcriptional Control of Chloroplast Gene Expression

    PubMed Central

    del Campo, Eva M.

    2009-01-01

    Chloroplasts contain their own genome, organized as operons, which are generally transcribed as polycistronic transcriptional units. These primary transcripts are processed into smaller RNAs, which are further modified to produce functional RNAs. The RNA processing mechanisms remain largely unknown and represent an important step in the control of chloroplast gene expression. Such mechanisms include RNA cleavage of pre-existing RNAs, RNA stabilization, intron splicing, and RNA editing. Recently, several nuclear-encoded proteins that participate in diverse plastid RNA processing events have been characterised. Many of them seem to belong to the pentatricopeptide repeat (PPR) protein family that is implicated in many crucial functions including organelle biogenesis and plant development. This review will provide an overview of current knowledge of the post-transcriptional processing in chloroplasts. PMID:19838333

  6. Methylation-dependent regulation of hypoxia inducible factor-1 alpha gene expression by the transcription factor Kaiso.

    PubMed

    Pierre, Christina C; Longo, Joseph; Bassey-Archibong, Blessing I; Hallett, Robin M; Milosavljevic, Snezana; Beatty, Laura; Hassell, John A; Daniel, Juliet M

    2015-12-01

    Low oxygen tension (hypoxia) is a common characteristic of solid tumors and strongly correlates with poor prognosis and resistance to treatment. In response to hypoxia, cells initiate a cascade of transcriptional events regulated by the hypoxia inducible factor-1 (HIF-1) heterodimer. Since the oxygen-sensitive HIF-1α subunit is stabilized during hypoxia, it functions as the regulatory subunit of the protein. To date, while the mechanisms governing HIF-1α protein stabilization and function have been well studied, those governing HIF1A gene expression are not fully understood. However, recent studies have suggested that methylation of a HIF-1 binding site in the HIF1A promoter prevents its autoregulation. Here we report that the POZ-ZF transcription factor Kaiso modulates HIF1A gene expression by binding to the methylated HIF1A promoter in a region proximal to the autoregulatory HIF-1 binding site. Interestingly, Kaiso's regulation of HIF1A occurs primarily during hypoxia, which is consistent with the finding that Kaiso protein levels peak after 4 h of hypoxic incubation and return to normoxic levels after 24 h. Our data thus support a role for Kaiso in fine-tuning HIF1A gene expression after extended periods of hypoxia.

  7. Cloning and transcriptional control of a eucaryotic permease gene.

    PubMed Central

    Chevallier, M R

    1982-01-01

    The uracil permease gene of the yeast Saccharomyces cerevisiae was cloned on a hybrid plasmid which replicates autonomously in both yeast and Escherichia coli. Cloning was carried out by complementation in yeast. The smallest DNA fragment found to complement the uracil permease deficiency in recipient yeast cells measured approximately 2.3 kilobases. In strains transformed by the plasmid with the uracil permease gene inserted, initial rates of uracil uptake increased up to 25 times more than the rates found in the wild type. Using DNA probes carrying several regions of the cloned gene, I showed that a strain carrying the dhul-I mutation, which is not linked to the permease structural gene and is responsible for enhanced uptake velocity of uracil, had enhanced transcription of the permease gene. By using DNA probes recloned in phage M13 mp7, the direction of transcription of the permease gene relative to the restriction map was deduced. A half-life of 2 min was found for the permease mRNA in labeling kinetics experiments. PMID:6290876

  8. Low-dose radiation suppresses Pokemon expression under hypoxic conditions.

    PubMed

    Kim, Seung-Whan; Yu, Kweon; Shin, Kee-Sun; Kwon, Kisang; Hwang, Tae-Sik; Kwon, O-Yu

    2014-01-01

    Our previous data demonstrated that CoCl2-induced hypoxia controls endoplasmic reticulum (ER) stress-associated and other intracellular factors. One of them, the transcription factor Pokemon, was differentially regulated by low-dose radiation (LDR). There are limited data regarding how this transcription factor is involved in expression of the unfolded protein response (UPR) under hypoxic conditions. The purpose of this study was to obtain clues on how Pokemon is involved in the UPR. Pokemon was selected as a differentially expressed gene under hypoxic conditions; however, its regulation was clearly repressed by LDR. It was also demonstrated that both expression of ER chaperones and ER stress sensors were affected by hypoxic conditions, and the same results were obtained when cells in which Pokemon was up- or down-regulated were used. The current state of UPR and LDR research associated with the Pokemon pathway offers an important opportunity to understand the oncogenesis, senescence, and differentiation of cells, as well as to facilitate introduction of new therapeutic radiopharmaceuticals. PMID:24772825

  9. Low-dose radiation suppresses Pokemon expression under hypoxic conditions.

    PubMed

    Kim, Seung-Whan; Yu, Kweon; Shin, Kee-Sun; Kwon, Kisang; Hwang, Tae-Sik; Kwon, O-Yu

    2014-01-01

    Our previous data demonstrated that CoCl2-induced hypoxia controls endoplasmic reticulum (ER) stress-associated and other intracellular factors. One of them, the transcription factor Pokemon, was differentially regulated by low-dose radiation (LDR). There are limited data regarding how this transcription factor is involved in expression of the unfolded protein response (UPR) under hypoxic conditions. The purpose of this study was to obtain clues on how Pokemon is involved in the UPR. Pokemon was selected as a differentially expressed gene under hypoxic conditions; however, its regulation was clearly repressed by LDR. It was also demonstrated that both expression of ER chaperones and ER stress sensors were affected by hypoxic conditions, and the same results were obtained when cells in which Pokemon was up- or down-regulated were used. The current state of UPR and LDR research associated with the Pokemon pathway offers an important opportunity to understand the oncogenesis, senescence, and differentiation of cells, as well as to facilitate introduction of new therapeutic radiopharmaceuticals.

  10. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

    PubMed Central

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-01-01

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

  11. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus.

    PubMed

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

    2015-03-18

    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer-promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them.

  12. Noninvasive Tracking of Gene Transcript and Neuroprotection after Gene Therapy

    PubMed Central

    Ren, Jiaqian; Chen, Y. Iris; Liu, Christina H.; Chen, Po-Chih; Prentice, Howard; Wu, Jang-Yen; Liu, Philip K.

    2015-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) cDNA encoded in scAAV-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy, and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer’s dementia, Parkinson’s disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine. PMID:26207935

  13. Glucocorticoid modulation of casein gene transcription in mouse mammary gland.

    PubMed Central

    Ganguly, R; Mehta, N M; Ganguly, N; Banerjee, M R

    1979-01-01

    The influence of cortisol and prolactin on casein gene expression in the mammary gland of lactating BALB/c mice was measured by using a specific cDNA probe to 15S casein mRNA (cDNAcsn). Casein mRNA (mRNAcsn) level in the mammary gland was decreased by 85% 5 days after adrenal ablation, but then was increased 4.4-fold 12 hr after a single injection of hydrocortisone-21-acetate. An 80% decrease in serum prolactin level, induced by the prolactin inhibitor 2-bromo-alpha-ergocryptin (CB-154), did not alter the level of mRNAcsn in the gland. Specific transcription of the casein gene in nuclei isolated from lactating mammary glands was measured by cDNAcsn hybridization to the in vitro synthesized Hg-CTP-containing RNA (Hg-RNA), which was purified by SH-agarose chromatography. The level of the mRNAcsn in Hg-RNA synthesized in the isolated nuclei was 0.09% and this was decreased 85% by alpha-amanitin, indicating that the mRNAcsn sequences in the Hg-RNA were the products of RNA polymerase II-directed DNA-dependent RNA synthesis. Transcription of the mRNAcsn in isolated nuclei was decreased by 70% 5 days after adrenalectomy and a single injection of the glucocorticoid then increased the transcription level 2-fold at 6 hr. Essentially no alteration of the level of transcription was detectable in mammary nuclei isolated from lactating mice with 80% decreased serum prolactin level, induced by CB-154 treatment. The results thus demonstrate a glucocorticoid involvement on the modulation of casein gene expression at the transcriptional level of control. PMID:293734

  14. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  15. Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

    PubMed

    Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

    2016-04-01

    Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

  16. Nongenic transcription, gene regulation and action at a distance.

    PubMed

    Cook, Peter R

    2003-11-15

    In eukaryotes, motifs such as silencers, enhancers and locus control regions act over thousands of base pairs to regulate adjacent genes; insulators limit such effects, and barriers confine repressive heterochromatin to particular chromosomal segments. Recent results show that many of these motifs are nongenic transcription units, and two of them directly contact their targets lying further down the chromosome to loop the intervening DNA: the barriers (scs and scs') flanking the 87A7 heat-shock locus in the fly contact each other, and a locus control region touches the beta-globin gene in the mouse. I hypothesize that the act of transcription underlies the function of these regulators; active polymerizing complexes tend to cluster into 'factories' and this facilitates molecular contact between the transcribed regulator and its distant (and transcribed) target. PMID:14576342

  17. Hypoxic control of metastasis

    PubMed Central

    Rankin, Erinn B.; Giaccia, Amato J.

    2016-01-01

    Metastatic disease is the leading cause of cancer-related deaths and involves critical interactions between tumor cells and the microenvironment. Hypoxia is a potent microenvironmental factor promoting metastatic progression. Clinically, hypoxia and the expression of the hypoxia-inducible transcription factors HIF-1 and HIF-2 are associated with increased distant metastasis and poor survival in a variety of tumor types. Moreover, HIF signaling in malignant cells influences multiple steps within the metastatic cascade. Here we review research focused on elucidating the mechanisms by which the hypoxic tumor microenvironment promotes metastatic progression. These studies have identified potential biomarkers and therapeutic targets regulated by hypoxia that could be incorporated into strategies aimed at preventing and treating metastatic disease. PMID:27124451

  18. Transcriptional Regulation of Tlr11 Gene Expression in Epithelial Cells*

    PubMed Central

    Cai, Zhenyu; Shi, Zhongcheng; Sanchez, Amir; Zhang, Tingting; Liu, Mingyao; Yang, Jianghua; Wang, Fen; Zhang, Dekai

    2009-01-01

    As sensors of invading microorganisms, Toll-like receptors (TLRs) are expressed not only on macrophages and dendritic cells (DCs) but also on epithelial cells. In the TLR family, Tlr11 appears to have the unique feature in that it is expressed primarily on epithelial cells, although it is also expressed on DCs and macrophages. Here, we demonstrate that transcription of the Tlr11 gene is regulated through two cis-acting elements, one Ets-binding site and one interferon regulatory factor (IRF)-binding site. The Ets element interacts with the epithelium-specific transcription factors, ESE-1 and ESE-3, and the IRF motif interacts with IRF-8. Thus, Tlr11 expression on epithelial cells is regulated by the transcription factors that are presumably distinct from transcription factors that regulate the expression of TLRs in innate immune cells such as macrophages and DCs. Our results imply that the distinctive transcription regulatory machinery for TLRs on epithelium may represent a promising new avenue for the development of epithelia-specific therapeutic interventions. PMID:19801549

  19. Targeting hypoxic response for cancer therapy

    PubMed Central

    Paolicchi, Elisa; Gemignani, Federica; Krstic-Demonacos, Marija; Dedhar, Shoukat; Mutti, Luciano; Landi, Stefano

    2016-01-01

    Hypoxic tumor microenvironment (HTM) is considered to promote metabolic changes, oncogene activation and epithelial mesenchymal transition, and resistance to chemo- and radio-therapy, all of which are hallmarks of aggressive tumor behavior. Cancer cells within the HTM acquire phenotypic properties that allow them to overcome the lack of energy and nutrients supply within this niche. These phenotypic properties include activation of genes regulating glycolysis, glucose transport, acidosis regulators, angiogenesis, all of which are orchestrated through the activation of the transcription factor, HIF1A, which is an independent marker of poor prognosis. Moreover, during the adaptation to a HTM cancer cells undergo deep changes in mitochondrial functions such as “Warburg effect” and the “reverse Warburg effect”. This review aims to provide an overview of the characteristics of the HTM, with particular focus on novel therapeutic strategies currently in clinical trials, targeting the adaptive response to hypoxia of cancer cells. PMID:26859576

  20. The neuroprotection of hypoxic preconditioning on rat brain against traumatic brain injury by up-regulated transcription factor Nrf2 and HO-1 expression.

    PubMed

    Shu, Longfei; Wang, Chunlin; Wang, Jinbiao; Zhang, Yongming; Zhang, Xing; Yang, Yanyan; Zhuo, Jianwei; Liu, Jiachuan

    2016-01-12

    Hypoxic preconditioning (HPC) increases the inherent tolerance of brain tissue suffering from severe hypoxia or ischemia insult by stimulating the protective ability of the brain. However, little is known concerning the effect of HPC on traumatic brain injury (TBI). We designed this study to investigate the effect of HPC on TBI and explore its underlying mechanisms. We found that HPC significantly alleviates neurological dysfunction, lessens brain edema, reduces cell apoptosis, increases neuronal survival, up-regulates the expressions of Nrf2 and HO-1, and decreases the inducer of protein carbonyls, 4-hydroxy-2-nonenal, and 8-hydroxy-2-deoxyguanosine in the brain tissue of rats 24h after brain injury. However, no influence was observed in normal rats after only 3d of hypoxic training. Results further indicated that HPC protects the brain against traumatic damage. This protective effect may be achieved by up-regulating Nrf2 and HO-1 expression and alleviating oxidative stress damage. PMID:26590328

  1. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )

    1991-07-01

    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  2. The obesity-associated Fto gene is a transcriptional coactivator.

    PubMed

    Wu, Qiong; Saunders, Rudel A; Szkudlarek-Mikho, Maria; Serna, Ivana de la; Chin, Khew-Voon

    2010-10-22

    The fat mass and obesity associated, FTO, gene has been shown to be associated with obesity in human in several genome-wide association scans. In vitro studies suggest that Fto may function as a single-stranded DNA demethylase. In addition, homologous recombination-targeted knockout of Fto in mice resulted in growth retardation, loss of white adipose tissue, and increase energy metabolism and systemic sympathetic activation. Despite these intense investigations, the exact function of Fto remains unclear. We show here that Fto is a transcriptional coactivator that enhances the transactivation potential of the CCAAT/enhancer binding proteins (C/EBPs) from unmethylated as well as methylation-inhibited gene promoters. Fto also exhibits nuclease activity. We showed further that Fto enhances the binding C/EBP to unmethylated and methylated DNA. The coactivator role of FTO in modulating the transcriptional regulation of adipogenesis by C/EBPs is consistent with the temporal progressive loss of adipose tissue in the Fto-deficient mice, thus suggesting a role for Fto in the epigenetic regulation of the development and maintenance of fat tissue. How FTO reactivates transcription from methyl-repressed gene needs to be further investigated.

  3. Post-transcriptional regulation of the chicken thymidine kinase gene.

    PubMed

    Groudine, M; Casimir, C

    1984-02-10

    In attempting to understand the molecular basis of the control of chicken thymidine kinase (cTK) gene expression, we have examined the steady state cTK RNA content, and the patterns of DNA methylation, chromatin structure and endogenous nuclear runoff transcription of this gene in dividing and non-dividing cells. Our results reveal that the steady state level of cTK poly A+ RNA is correlated with the divisional activity of normal avian cells and tissues. However, no differences in the pattern of Hpa II site methylation or chromatin structure are found among cells containing high or undetectable levels of steady state cTK RNA. In addition, no differences in cTK transcription as assayed by nuclear runoff experiments are detectable in isolated nuclei derived from dividing or non-dividing cells containing high or low levels of steady state cTK RNA. These results suggest that the principal control of chicken thymidine kinase gene expression is post-transcriptional in nature.

  4. Synaptic, transcriptional and chromatin genes disrupted in autism.

    PubMed

    De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D

    2014-11-13

    The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.

  5. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.

    PubMed

    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June

    2016-04-01

    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  6. From top to bottom: the two faces of HIPK2 for regulation of the hypoxic response.

    PubMed

    Calzado, Marco A; De La Vega, Laureano; Munoz, Eduardo; Schmitz, M Lienhard

    2009-06-01

    Oxygen deprivation (hypoxia) triggers a complex network of signaling pathways that result in changed gene expression patterns in order to cope with this challenge. Recent work has identified the serine/threonine kinase HIPK2 as a novel regulatory protein participating in hypoxic gene regulation. HIPK2 can affect apical as well as downstream events during the hypoxic response. Under normoxic conditions, HIPK2-mediated phosphorylation of the ubiquitin E3 ligase Siah2 weakens mutual binding and destabilizes the phosphorylated E3 ligase. Low oxygen levels result in strongly increased HIPK2/Siah2 interactions that lead to efficient polyubiquitylation and proteasomal degradation of the kinase. At the apical level, the Siah2 inhibiting phosphorylations are lost, thus allowing Siah2-dependent proteolysis of dioxygenases which in turn allows for activation of transcription factor HIF. Downstream events of the hypoxic response are affected by the proteasomal elimination of HIPK2 from gene repressing complexes, an event that allows for full induction of gene expression. Thus HIPK2 can regulate a subset of HIF-dependent and -independent genes during the hypoxic response.

  7. Transcriptional and posttranscriptional control of hepatitis B virus gene expression

    PubMed Central

    Uprichard, Susan L.; Wieland, Stefan F.; Althage, Alana; Chisari, Francis V.

    2003-01-01

    Hepatitis B virus (HBV) infects humans and certain nonhuman primates. Viral clearance and acute disease are associated with a strong, polyclonal, multispecific cytotoxic T lymphocyte response. Infiltrating T cells, as well as other activated inflammatory cells, produce cytokines that can regulate hepatocellular gene expression. Using an HBV transgenic mouse model, our laboratory has previously demonstrated that adoptive transfer of HBV-specific cytotoxic T lymphocytes or injection of IL-2 can noncytopathically inhibit HBV gene expression by a posttranscriptional IFN-γ- and/or tumor necrosis factor α-dependent mechanism. Here, we report that HBV gene expression can also be controlled at the posttranscriptional level during persistent lymphocytic choriomeningitis virus infection. In contrast, it is controlled at the transcriptional level during acute murine cytomegalovirus infection or after repetitive polyinosinic-polycytidylic acid injection. Finally, we show that transcriptional inhibition of HBV is associated with changes in liver-specific gene expression. These results elucidate pathways that regulate the viral life cycle and suggest additional approaches for the treatment of chronic HBV infection. PMID:12552098

  8. Transcriptional Truncation of the Long Coding Imprinted Gene Usp29

    PubMed Central

    He, Hongzhi; Ye, An; Kim, Joomyeong

    2016-01-01

    Usp29 (Ubiquitin-specific protease 29) is a paternally expressed gene located upstream of another imprinted gene Peg3. In the current study, the transcription of this long coding gene spanning a 250-kb genomic distance was truncated using a knockin allele. According to the results, paternal transmission of the mutant allele resulted in reduced body and litter sizes whereas the maternal transmission caused no obvious effects. In the paternal mutant, the expression levels of Usp29 were reduced to 14–18% level of the wild-type littermates due to the Poly-A signal included in the knockin cassette. Expression analyses further revealed an unusual female-specific up-regulation of the adjacent imprinted gene Zfp264 in the mutant. Consistent with this, the promoter of Zfp264 was hypomethylated only in the female mutant. Interestingly, this female-specific hypomethylation by the knockin allele was not detected in the offspring of an interspecific crossing, indicating its sensitivity to genetic background. Overall, the results suggest that the transcription of Usp29 may be involved in DNA methylation setting of Zfp264 promoter in a sex-specific manner. PMID:27327533

  9. Zinc triggers a complex transcriptional and post-transcriptional regulation of the metal homeostasis gene FRD3 in Arabidopsis relatives

    PubMed Central

    Charlier, Jean-Benoit; Polese, Catherine; Nouet, Cécile; Carnol, Monique; Bosman, Bernard; Krämer, Ute; Motte, Patrick; Hanikenne, Marc

    2015-01-01

    In Arabidopsis thaliana, FRD3 (FERRIC CHELATE REDUCTASE DEFECTIVE 3) plays a central role in metal homeostasis. FRD3 is among a set of metal homeostasis genes that are constitutively highly expressed in roots and shoots of Arabidopsis halleri, a zinc hyperaccumulating and hypertolerant species. Here, we examined the regulation of FRD3 by zinc in both species to shed light on the evolutionary processes underlying the evolution of hyperaccumulation in A. halleri. We combined gene expression studies with the use of β-glucuronidase and green fluorescent protein reporter constructs to compare the expression profile and transcriptional and post-transcriptional regulation of FRD3 in both species. The AtFRD3 and AhFRD3 genes displayed a conserved expression profile. In A. thaliana, alternative transcription initiation sites from two promoters determined transcript variants that were differentially regulated by zinc supply in roots and shoots to favour the most highly translated variant under zinc-excess conditions. In A. halleri, a single transcript variant with higher transcript stability and enhanced translation has been maintained. The FRD3 gene thus undergoes complex transcriptional and post-transcriptional regulation in Arabidopsis relatives. Our study reveals that a diverse set of mechanisms underlie increased gene dosage in the A. halleri lineage and illustrates how an environmental challenge can alter gene regulation. PMID:25900619

  10. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.

    2016-01-01

    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  11. Transcriptional and post-transcriptional regulation of tyrosine hydroxylase gene by protein kinase C.

    PubMed Central

    Vyas, S; Faucon Biguet, N; Mallet, J

    1990-01-01

    The role played by protein kinase C (PKC) in TH gene regulation was investigated at transcriptional and post-transcriptional levels using PC12 cells. The cells were treated with the phorbol ester TPA, which not only activates PKC but also causes down-regulation. PKC levels were monitored by [3H]PDBU binding assay and by using an anti-PKC antibody that detected intact PKC (79 kd) as well as its catalytic and regulatory domains. The [3H]PDBU binding to the membrane-associated PKC increased within 15-30 min of TPA treatment; thereafter total cellular [3H]PDBU binding decreased to a minimum of 20% of the control at 8 h. The rate of decrease in binding was greater than the decrease in the intensity of the staining of PKC holo enzyme visualized by anti-PKC antibody. TH mRNA levels, measured over the same time period, rose within 15 min of TPA treatment to peak at 4 h and subsequently declined below control level, paralleling the depletion of PKC. If cells depleted of PKC were reincubated in the normal medium, a recovery in PKC level was seen and, in parallel, TH mRNA levels increased to above control level. Furthermore, if down-regulation of PKC was prevented by incubating the cells with the protease inhibitor leupeptin, a decrease beyond control level in TH mRNA was not observed. TPA rapidly induced TH gene transcription; a maximal increase of two-fold was observed at 15 min, but the transcriptional rate then declined although it did not decrease beyond control values after 8 and 24 h of TPA treatment.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig.2 Fig.3 Fig.6 PMID:1976513

  12. Transcriptomic changes in human renal proximal tubular cells revealed under hypoxic conditions by RNA sequencing.

    PubMed

    Yu, Wenmin; Li, Yiping; Wang, Zhi; Liu, Lei; Liu, Jing; Ding, Fengan; Zhang, Xiaoyi; Cheng, Zhengyuan; Chen, Pingsheng; Dou, Jun

    2016-09-01

    Chronic hypoxia often occurs among patients with chronic kidney disease (CKD). Renal proximal tubular cells may be the primary target of a hypoxic insult. However, the underlying transcriptional mechanisms remain undefined. In this study, we revealed the global changes in gene expression in HK‑2 human renal proximal tubular cells under hypoxic and normoxic conditions. We analyzed the transcriptome of HK‑2 cells exposed to hypoxia for 24 h using RNA sequencing. A total of 279 differentially expressed genes was examined, as these genes could potentially explain the differences in HK‑2 cells between hypoxic and normoxic conditions. Moreover, 17 genes were validated by qPCR, and the results were highly concordant with the RNA seqencing results. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to better understand the functions of these differentially expressed genes. The upregulated genes appeared to be significantly enriched in the pathyway of extracellular matrix (ECM)-receptor interaction, and in paticular, the pathway of renal cell carcinoma was upregulated under hypoxic conditions. The downregulated genes were enriched in the signaling pathway related to antigen processing and presentation; however, the pathway of glutathione metabolism was downregulated. Our analysis revealed numerous novel transcripts and alternative splicing events. Simultaneously, we also identified a large number of single nucleotide polymorphisms, which will be a rich resource for future marker development. On the whole, our data indicate that transcriptome analysis provides valuable information for a more in depth understanding of the molecular mechanisms in CKD and renal cell carcinoma. PMID:27432315

  13. Macromolecular Crowding as a Regulator of Gene Transcription

    PubMed Central

    Matsuda, Hiroaki; Putzel, Gregory Garbès; Backman, Vadim; Szleifer, Igal

    2014-01-01

    Studies of macromolecular crowding have shown its important effects on molecular transport and interactions in living cells. Less clear is the effect of crowding when its influence is incorporated into a complex network of interactions. Here, we explore the effects of crowding in the cell nucleus on a model of gene transcription as a network of reactions involving transcription factors, RNA polymerases, and DNA binding sites for these proteins. The novelty of our approach is that we determine the effects of crowding on the rates of these reactions using Brownian dynamics and Monte Carlo simulations, allowing us to integrate molecular-scale information, such as the shapes and sizes of each molecular species, into the rate equations of the model. The steady-state cytoplasmic mRNA concentration shows several regimes with qualitatively different dependences on the volume fraction, ϕ, of crowding agents in the nucleus, including a broad range of parameter values where it depends nonmonotonically on ϕ, with maximum mRNA production occurring at a physiologically relevant value. The extent of this crowding dependence can be modulated by a variety of means, suggesting that the transcriptional output of a gene can be regulated jointly by the local level of macromolecular crowding in the nucleus, together with the local concentrations of polymerases and DNA-binding proteins, as well as other properties of the gene’s physical environment. PMID:24739179

  14. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing

    2015-01-01

    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  15. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.

    2015-01-01

    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  16. One-year monitoring of meta-cleavage dioxygenase gene expression and microbial community dynamics reveals the relevance of subfamily I.2.C extradiol dioxygenases in hypoxic, BTEX-contaminated groundwater.

    PubMed

    Táncsics, András; Farkas, Milán; Szoboszlay, Sándor; Szabó, István; Kukolya, József; Vajna, Balázs; Kovács, Balázs; Benedek, Tibor; Kriszt, Balázs

    2013-07-01

    Aromatic hydrocarbons including benzene, toluene, ethyl-benzene, and xylene (BTEX) are frequent contaminants of groundwater, the major drinking water resource. Bioremediation is the only sustainable process to clean up these environments. Microbial degradation of BTEX compounds occurs rapidly under aerobic conditions but, in subsurface environments, the availability of oxygen is commonly restricted. Even so, the microaerobic degradation of aromatic compounds is still poorly understood. Hence, the dynamics of a bacterial community and the expression of meta-cleavage dioxygenase genes, with particular emphasis on subfamily I.2.C extradiol dioxygenase genes, were assessed over a 13-month period in a hypoxic, aromatic hydrocarbon-contaminated shallow groundwater by using sequence-aided terminal-restriction fragment length polymorphism (T-RFLP) and single-nucleotide primer extension (SNuPE), respectively. The bacterial 16S rRNA fingerprinting revealed the predominance of members of Rhodoferax, Azoarcus, Pseudomonas, and unknown bacteria related to Rhodocyclaceae. It was observed that mRNA transcripts of subfamily I.2.C extradiol dioxygenase genes were detected constantly over the monitoring period, and the detected sequences clustered into six distinct clusters. In order to reveal changes in the expression of these clusters over the monitoring period a SNuPE assay was developed. This quasi fingerprinting of functional gene expression provided the opportunity to link the investigated function to specific microbial populations. The results obtained can improve our understanding of aromatic hydrocarbon degradation under oxygen limitation and may benefit bioremediation research by demonstrating the usefulness of SNuPE for the monitoring of microbial populations involved in degradation process.

  17. Controlling for gene expression changes in transcription factor protein networks.

    PubMed

    Banks, Charles A S; Lee, Zachary T; Boanca, Gina; Lakshminarasimhan, Mahadevan; Groppe, Brad D; Wen, Zhihui; Hattem, Gaye L; Seidel, Chris W; Florens, Laurence; Washburn, Michael P

    2014-06-01

    The development of affinity purification technologies combined with mass spectrometric analysis of purified protein mixtures has been used both to identify new protein-protein interactions and to define the subunit composition of protein complexes. Transcription factor protein interactions, however, have not been systematically analyzed using these approaches. Here, we investigated whether ectopic expression of an affinity tagged transcription factor as bait in affinity purification mass spectrometry experiments perturbs gene expression in cells, resulting in the false positive identification of bait-associated proteins when typical experimental controls are used. Using quantitative proteomics and RNA sequencing, we determined that the increase in the abundance of a set of proteins caused by overexpression of the transcription factor RelA is not sufficient for these proteins to then co-purify non-specifically and be misidentified as bait-associated proteins. Therefore, typical controls should be sufficient, and a number of different baits can be compared with a common set of controls. This is of practical interest when identifying bait interactors from a large number of different baits. As expected, we found several known RelA interactors enriched in our RelA purifications (NFκB1, NFκB2, Rel, RelB, IκBα, IκBβ, and IκBε). We also found several proteins not previously described in association with RelA, including the small mitochondrial chaperone Tim13. Using a variety of biochemical approaches, we further investigated the nature of the association between Tim13 and NFκB family transcription factors. This work therefore provides a conceptual and experimental framework for analyzing transcription factor protein interactions.

  18. Transcriptional networks driving enhancer function in the CFTR gene.

    PubMed

    Kerschner, Jenny L; Harris, Ann

    2012-09-01

    A critical cis-regulatory element for the CFTR (cystic fibrosis transmembrane conductance regulator) gene is located in intron 11, 100 kb distal to the promoter, with which it interacts. This sequence contains an intestine-selective enhancer and associates with enhancer signature proteins, such as p300, in addition to tissue-specific TFs (transcription factors). In the present study we identify critical TFs that are recruited to this element and demonstrate their importance in regulating CFTR expression. In vitro DNase I footprinting and EMSAs (electrophoretic mobility-shift assays) identified four cell-type-selective regions that bound TFs in vitro. ChIP (chromatin immunoprecipitation) identified FOXA1/A2 (forkhead box A1/A2), HNF1 (hepatocyte nuclear factor 1) and CDX2 (caudal-type homeobox 2) as in vivo trans-interacting factors. Mutation of their binding sites in the intron 11 core compromised its enhancer activity when measured by reporter gene assay. Moreover, siRNA (small interfering RNA)-mediated knockdown of CDX2 caused a significant reduction in endogenous CFTR transcription in intestinal cells, suggesting that this factor is critical for the maintenance of high levels of CFTR expression in these cells. The ChIP data also demonstrate that these TFs interact with multiple cis-regulatory elements across the CFTR locus, implicating a more global role in intestinal expression of the gene.

  19. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    PubMed Central

    Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

    2015-01-01

    MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by “top-down” and “guide-gene” approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via “top-down” approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by “guide-gene” approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  20. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo

    2006-01-01

    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  1. Transcript profiling of transcription factor genes during silique development in Arabidopsis.

    PubMed

    de Folter, Stefan; Busscher, Jacqueline; Colombo, Lucia; Losa, Alessia; Angenent, Gerco C

    2004-10-01

    Flower development is a key process for all angiosperms and is essential for sexual reproduction. The last phase in flower development is fertilization of the ovules and formation of the fruits, which are both biologically and economically of importance. Here, we report the expression profiles of over 1100 unique Arabidopsis genes coding for known and putative transcription factors (TFs) during silique development using high-density filter array hybridizations. Hierarchical cluster analyses revealed distinct expression profiles for the different silique developmental stages. This allowed a functional classification of these expression profiles in groups, namely pistil development, embryogenesis, seed maturation, fruit maturation, and fruit development. A further focus was made on the MADS-box family, which contains many members that are functionally well-characterized. The expression profiles of these MADS-box genes during silique development give additional clues on their functions and evolutionary relationship. PMID:15604749

  2. The molecular clock regulates circadian transcription of tissue factor gene.

    PubMed

    Oishi, Katsutaka; Koyanagi, Satoru; Ohkura, Naoki

    2013-02-01

    Tissue factor (TF) is involved in endotoxin-induced inflammation and mortality. We found that the circadian expression of TF mRNA, which peaked at the day to night transition (activity onset), was damped in the liver of Clock mutant mice. Luciferase reporter and chromatin immunoprecipitation analyses using embryonic fibroblasts derived from wild-type or Clock mutant mice showed that CLOCK is involved in transcription of the TF gene. Furthermore, the results of real-time luciferase reporter experiments revealed that the circadian expression of TF mRNA is regulated by clock molecules through a cell-autonomous mechanism via an E-box element located in the promoter region.

  3. Extreme Hypoxic Conditions Induce Selective Molecular Responses and Metabolic Reset in Detached Apple Fruit

    PubMed Central

    Cukrov, Dubravka; Zermiani, Monica; Brizzolara, Stefano; Cestaro, Alessandro; Licausi, Francesco; Luchinat, Claudio; Santucci, Claudio; Tenori, Leonardo; Van Veen, Hans; Zuccolo, Andrea; Ruperti, Benedetto; Tonutti, Pietro

    2016-01-01

    The ripening physiology of detached fruit is altered by low oxygen conditions with profound effects on quality parameters. To study hypoxia-related processes and regulatory mechanisms, apple (Malus domestica, cv Granny Smith) fruit, harvested at commercial ripening, were kept at 1°C under normoxic (control) and hypoxic (0.4 and 0.8 kPa oxygen) conditions for up to 60 days. NMR analyses of cortex tissue identified eight metabolites showing significantly different accumulations between samples, with ethanol and alanine displaying the most pronounced difference between hypoxic and normoxic treatments. A rapid up-regulation of alcohol dehydrogenase and pyruvate-related metabolism (lactate dehydrogenase, pyruvate decarboxylase, alanine aminotransferase) gene expression was detected under both hypoxic conditions with a more pronounced effect induced by the lowest (0.4 kPa) oxygen concentration. Both hypoxic conditions negatively affected ACC synthase and ACC oxidase transcript accumulation. Analysis of RNA-seq data of samples collected after 24 days of hypoxic treatment identified more than 1000 genes differentially expressed when comparing 0.4 vs. 0.8 kPa oxygen concentration samples. Genes involved in cell-wall, minor and major CHO, amino acid and secondary metabolisms, fermentation and glycolysis as well as genes involved in transport, defense responses, and oxidation-reduction appeared to be selectively affected by treatments. The lowest oxygen concentration induced a higher expression of transcription factors belonging to AUX/IAA, WRKY, HB, Zinc-finger families, while MADS box family genes were more expressed when apples were kept under 0.8 kPa oxygen. Out of the eight group VII ERF members present in apple genome, two genes showed a rapid up-regulation under hypoxia, and western blot analysis showed that apple MdRAP2.12 proteins were differentially accumulated in normoxic and hypoxic samples, with the highest level reached under 0.4 kPa oxygen. These data suggest

  4. Extreme Hypoxic Conditions Induce Selective Molecular Responses and Metabolic Reset in Detached Apple Fruit.

    PubMed

    Cukrov, Dubravka; Zermiani, Monica; Brizzolara, Stefano; Cestaro, Alessandro; Licausi, Francesco; Luchinat, Claudio; Santucci, Claudio; Tenori, Leonardo; Van Veen, Hans; Zuccolo, Andrea; Ruperti, Benedetto; Tonutti, Pietro

    2016-01-01

    The ripening physiology of detached fruit is altered by low oxygen conditions with profound effects on quality parameters. To study hypoxia-related processes and regulatory mechanisms, apple (Malus domestica, cv Granny Smith) fruit, harvested at commercial ripening, were kept at 1°C under normoxic (control) and hypoxic (0.4 and 0.8 kPa oxygen) conditions for up to 60 days. NMR analyses of cortex tissue identified eight metabolites showing significantly different accumulations between samples, with ethanol and alanine displaying the most pronounced difference between hypoxic and normoxic treatments. A rapid up-regulation of alcohol dehydrogenase and pyruvate-related metabolism (lactate dehydrogenase, pyruvate decarboxylase, alanine aminotransferase) gene expression was detected under both hypoxic conditions with a more pronounced effect induced by the lowest (0.4 kPa) oxygen concentration. Both hypoxic conditions negatively affected ACC synthase and ACC oxidase transcript accumulation. Analysis of RNA-seq data of samples collected after 24 days of hypoxic treatment identified more than 1000 genes differentially expressed when comparing 0.4 vs. 0.8 kPa oxygen concentration samples. Genes involved in cell-wall, minor and major CHO, amino acid and secondary metabolisms, fermentation and glycolysis as well as genes involved in transport, defense responses, and oxidation-reduction appeared to be selectively affected by treatments. The lowest oxygen concentration induced a higher expression of transcription factors belonging to AUX/IAA, WRKY, HB, Zinc-finger families, while MADS box family genes were more expressed when apples were kept under 0.8 kPa oxygen. Out of the eight group VII ERF members present in apple genome, two genes showed a rapid up-regulation under hypoxia, and western blot analysis showed that apple MdRAP2.12 proteins were differentially accumulated in normoxic and hypoxic samples, with the highest level reached under 0.4 kPa oxygen. These data suggest

  5. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  6. The Trypanosoma brucei protein phosphatase gene: polycistronic transcription with the RNA polymerase II largest subunit gene.

    PubMed Central

    Evers, R; Cornelissen, A W

    1990-01-01

    We have previously described the trypanosomal gene encoding the largest subunit of RNA polymerase II (RNAP II) and found that two almost identical genes are encoded within the Trypanosoma brucei genome. Here we show by Southern analyses that the 5' breakpoint between both loci is located approximately 7.5 kb upstream of the RNAP II genes. Northern analyses revealed that the 5' duplicated segment contains at least four other genes, which are transcribed in both bloodstream and procyclic trypanosomes. The gene located immediately upstream of the RNAP II gene in both loci was characterized by sequence analyses. The deduced amino acid sequences show a high degree of similarity to the catalytic subunit of protein phosphatase class 1 (PP1) genes. S1 mapping provided strong evidence in support of the fact that the PP1 and RNAP II genes belong to a single transcription unit. Images PMID:2169604

  7. Transcriptional mapping of the DNA polymerase gene of vaccinia virus

    SciTech Connect

    Traktman, P.; Sridhar, P.; Condit, R.C.; Roberts, B.E.

    1984-01-01

    Vaccinia virus DNA polymerase, a single-subunit enzyme of 110,000 molecular weight, is induced early after infection. Genetic analysis suggests that the gene encoding the enzyme maps within a 15-kilobase HindIII fragment located 45 kilobases from the left-hand end of the genome. The authors identified the in vitro translation product with these propeties and mapped the transcript by hybrid selection, RNA filter hybridization, and S1 nuclease mapping. Two mRNAs from this region, 3.4 and 3.9 kilobases in size, could be translated in vitro to yield a 110K polypeptide. The two RNAs shared a common 5' terminus and had staggered 3' ends. Sequences mapping entirely within the gene were shown to be biologically active in rescuing mutants with temperature-sensitive or drug-resistant polymerase activity to the wild-type phenotype.

  8. Transcription factor 4 gene rs9960767 polymorphism in bipolar disorder

    PubMed Central

    Ozel, Mavi Deniz; Onder, Mehmet Emin; Sazci, Ali

    2016-01-01

    The transcription factor 4 (TCF4) gene encodes a helix-loop-helix transcription factor protein, which initiates neuronal differentiation and is primarily expressed during nervous system development. The aim of the present study is to investigate the association of the TCF4 rs9960767 polymorphism and bipolar disorder, which is highly heritable. DNA isolation was performed on 95 patients with bipolar disorder and 108 healthy control subjects to examine the TCF4 rs9960767 polymorphism. Genotypic and allelic frequencies were determined using the polymerase chain reaction-restriction fragment length polymorphism method designed in our laboratory. Statistical analysis was performed using χ2 test within the 95% confidence interval. Odds ratios were calculated and Hardy-Weinberg equilibrium (HWE) was verified for all control subjects and patients. The A allele frequency was 95.8% in the patients and 94.4% in the control subjects, and 4.2% in the patients and 5.6% in the control subjects for the C allele. The genotype frequencies of the TCF4 gene rs9960767 variant were as follows: AA, 91.6% and AC, 8.4% in patients with bipolar (CC genotype was not observed in cases); AA, 89.8%; AC, 9.3% and CC, 0.9% in the control subjects. No statistically significant difference was identified between the patients and control subjects (χ2=0.937; P=0.626). In addition, gender specific analysis was performed, although no significant association was found according to the gender distrubition. All patients and control subjects were in HWE (P>0.05). Statistical analysis of the data indicates that the TCF4 gene rs9960767 polymorphism is not an independent risk factor for bipolar disorder in the overall population or in terms of gender; however, an increased population size would improve the statistical power. Furthermore, additional gene variants that are specifically involved in neuronal development may be analyzed for revealing the complex genetic architecture of bipolar disorder. An

  9. Docosahexaenoic Acid (DHA) and Hepatic Gene Transcription1,3

    PubMed Central

    Jump, Donald B.; Botolin, Daniela; Wang, Yun; Xu, Jinghua; Demeure, Olivier; Christian, Barbara

    2008-01-01

    The type and quantity of dietary fat ingested contributes to the onset and progression of chronic diseases, like diabetes and atherosclerosis. The liver plays a central role in whole body lipid metabolism and responds rapidly to changes in dietary fat composition. Polyunsaturated fatty acids (PUFA) play a key role in membrane composition and function, metabolism and the control of gene expression. Certain PUFA, like the n-3 PUFA, enhance hepatic fatty acid oxidation and inhibit fatty acid synthesis and VLDL secretion, in part, by regulating gene expression. Our studies have established that key transcription factors, like PPARα, SREBP-1, ChREBP and MLX, are regulated by n-3 PUFA, which in turn control levels of proteins involved in lipid and carbohydrate metabolism. Of the n-3 PUFA, 22:6,n-3 has recently been established as a key controller of hepatic lipid synthesis. 22:6,n-3 controls the 26S proteasomal degradation of the nuclear form of SREBP-1. SREBP-1 is a major transcription factor that controls the expression of multiple genes involved fatty acid synthesis and desaturation. 22:6,n-3 suppresses nuclear SREBP-1 which, in turn suppresses lipogenesis. This mechanism is achieved, in part, through control of the phosphorylation status of protein kinases. This review will examine both the general features of PUFA-regulated hepatic gene transcription and highlight the unique mechanisms by which 22:6,n-3 impacts gene expression. The outcome of this analysis will reveal that changes in hepatic 22:6,n-3 content has a major impact on hepatic lipid and carbohydrate metabolism. Moreover, the mechanisms involve 22:6,n-3 control of several well-known signaling pathways, such as Akt, Erk1/2, Gsk3β and PKC (novel or atypical). 22:6,n-3 control of these same signaling pathways in non-hepatic tissues may help explain the diverse actions of n-3 PUFA on such complex physiological processes as visual acuity and learning. PMID:18343222

  10. Transcription factor 4 gene rs9960767 polymorphism in bipolar disorder

    PubMed Central

    Ozel, Mavi Deniz; Onder, Mehmet Emin; Sazci, Ali

    2016-01-01

    The transcription factor 4 (TCF4) gene encodes a helix-loop-helix transcription factor protein, which initiates neuronal differentiation and is primarily expressed during nervous system development. The aim of the present study is to investigate the association of the TCF4 rs9960767 polymorphism and bipolar disorder, which is highly heritable. DNA isolation was performed on 95 patients with bipolar disorder and 108 healthy control subjects to examine the TCF4 rs9960767 polymorphism. Genotypic and allelic frequencies were determined using the polymerase chain reaction-restriction fragment length polymorphism method designed in our laboratory. Statistical analysis was performed using χ2 test within the 95% confidence interval. Odds ratios were calculated and Hardy-Weinberg equilibrium (HWE) was verified for all control subjects and patients. The A allele frequency was 95.8% in the patients and 94.4% in the control subjects, and 4.2% in the patients and 5.6% in the control subjects for the C allele. The genotype frequencies of the TCF4 gene rs9960767 variant were as follows: AA, 91.6% and AC, 8.4% in patients with bipolar (CC genotype was not observed in cases); AA, 89.8%; AC, 9.3% and CC, 0.9% in the control subjects. No statistically significant difference was identified between the patients and control subjects (χ2=0.937; P=0.626). In addition, gender specific analysis was performed, although no significant association was found according to the gender distrubition. All patients and control subjects were in HWE (P>0.05). Statistical analysis of the data indicates that the TCF4 gene rs9960767 polymorphism is not an independent risk factor for bipolar disorder in the overall population or in terms of gender; however, an increased population size would improve the statistical power. Furthermore, additional gene variants that are specifically involved in neuronal development may be analyzed for revealing the complex genetic architecture of bipolar disorder. An

  11. Dietary polyunsaturated fatty acid regulation of gene transcription.

    PubMed

    Clarke, S D; Jump, D B

    1994-01-01

    We have known for nearly 30 years that dietary polyenoic (n-6) and (n-3) fatty acids potentially inhibit hepatic fatty acid biosynthesis. The teleological explanation for this unique action of PUFAs resides in their ability to suppress the synthesis of (n-9) fatty acids. By inhibiting fatty acid biosynthesis, dietary PUFAs reduce the availability of substrate for delta 9 desaturase (7, 22, 34, 36) and in turn reduce the availability of (n-9) fatty acids for incorporation into plasma membranes. In this way, essential biological processes dependent on essential fatty acids (e.g. reproduction and trans-dermal water loss) continue to operate normally. Therefore, if essential fatty acid intake did not regulate (n-9) fatty acid synthesis, the survival of the organism would be threatened. During the past 20 years, we have gradually elucidated the cellular and molecular mechanisms by which dietary PUFAs modulate fatty acid biosynthesis and (n-9) fatty acid availability. Central to this mechanism has been our ability to determine that dietary PUFAs regulate the transcription of genes coding for lipogenic enzymes (12, 40). The potential mechanisms by which PUFAs govern gene transcription are numerous, and it is unlikely that any one mechanism can fully elucidate the nuclear actions of PUFA. The difficulty in providing a unifying hypothesis at this time stems from: (a) the many metabolic routes taken by PUFAs upon entering the hepatocyte (Figure 1); and (b) the lack of identity of a specific PUFA-regulated trans-acting factor. However, the studies described above indicate that macronutrients, like PUFA, are not only utilized as fuel and structural components of cells, but also serve as important mediators of gene expression (12, 14, 40). As regulators of gene expression, PUFAs (or metabolites) are thought to affect the activity of transcription factors, which in turn target key cis-linked elements associated with specific genes. Whether this targeting involves DNA

  12. Differential sensitivities of transcription factor target genes underlie cell type-specific gene expression profiles

    PubMed Central

    Johnson, Kirby D.; Kim, Shin-Il; Bresnick, Emery H.

    2006-01-01

    Changes in transcription factor levels and activities dictate developmental fate. Such a change might affect the full ensemble of target genes for a factor or only uniquely sensitive targets. We investigated the relationship among activity of the hematopoietic transcription factor GATA-1, chromatin occupancy, and target gene sensitivity. Graded activation of GATA-1 in GATA-1-null cells revealed high-, intermediate-, and low-sensitivity targets. GATA-1 activity requirements for occupancy and transcription often correlated. A GATA-1 amino-terminal deletion mutant severely deregulated the low-sensitivity gene Tac-2. Thus, cells expressing different levels of a cell type-specific activator can have qualitatively distinct target gene expression patterns, and factor mutations preferentially deregulate low-sensitivity genes. Unlike other target genes, GATA-1-mediated Tac-2 regulation was bimodal, with activation followed by repression, and the coregulator Friend of GATA-1 (FOG-1) selectively mediated repression. A GATA-1 mutant defective in FOG-1 binding occupied a Tac-2 regulatory region at levels higher than wild-type GATA-1, whereas FOG-1 facilitated chromatin occupancy at a distinct target site. These results indicate that FOG-1 is a determinant of GATA factor target gene sensitivity by either facilitating or opposing chromatin occupancy. PMID:17043224

  13. Current insights into the molecular mechanisms of hypoxic pre- and postconditioning using hypobaric hypoxia

    PubMed Central

    Rybnikova, Elena; Samoilov, Mikhail

    2015-01-01

    Exposure of organisms to repetitive mild hypoxia results in development of brain hypoxic/ischemic tolerance and cross-tolerance to injurious factors of a psycho-emotional nature. Such preconditioning by mild hypobaric hypoxia functions as a “warning” signal which prepares an organism, and in particular the brain, to subsequent more harmful conditions. The endogenous defense processes which are mobilized by hypoxic preconditioning and result in development of brain tolerance are based on evolutionarily acquired gene-determined mechanisms of adaptation and neuroprotection. They involve an activation of intracellular cascades including kinases, transcription factors and changes in expression of multiple regulatory proteins in susceptible areas of the brain. On the other hand they lead to multilevel modifications of the hypothalamic-pituitary-adrenal endocrine axis regulating various functions in the organism. All these components are engaged sequentially in the initiation, induction and expression of hypoxia-induced tolerance. A special role belongs to the epigenetic regulation of gene expression, in particular of histone acetylation leading to changes in chromatin structure which ensure access of pro-adaptive transcription factors activated by preconditioning to the promoters of target genes. Mechanisms of another, relatively novel, neuroprotective phenomenon termed hypoxic postconditioning (an application of mild hypoxic episodes after severe insults) are still largely unknown but according to recent data they involve apoptosis-related proteins, hypoxia-inducible factor and neurotrophins. The fundamental data accumulated to date and discussed in this review open new avenues for elaboration of the effective therapeutic applications of hypoxic pre- and postconditioning. PMID:26557049

  14. The transcriptional repressor DREAM is involved in thyroid gene expression

    SciTech Connect

    D'Andrea, Barbara; Di Palma, Tina; Mascia, Anna; Motti, Maria Letizia; Viglietto, Giuseppe; Nitsch, Lucio; Zannini, Mariastella . E-mail: stella@szn.it

    2005-04-15

    Downstream regulatory element antagonistic modulator (DREAM) was originally identified in neuroendocrine cells as a calcium-binding protein that specifically binds to downstream regulatory elements (DRE) on DNA, and represses transcription of its target genes. To explore the possibility that DREAM may regulate the endocrine activity of the thyroid gland, we analyzed its mRNA expression in undifferentiated and differentiated thyroid cells. We demonstrated that DREAM is expressed in the normal thyroid tissue as well as in differentiated thyroid cells in culture while it is absent in FRT poorly differentiated cells. In the present work, we also show that DREAM specifically binds to DRE sites identified in the 5' untranslated region (UTR) of the thyroid-specific transcription factors Pax8 and TTF-2/FoxE1 in a calcium-dependent manner. By gel retardation assays we demonstrated that thapsigargin treatment increases the binding of DREAM to the DRE sequences present in Pax8 and TTF-2/Foxe1 5' UTRs, and this correlates with a significant reduction of the expression of these genes. Interestingly, in poorly differentiated thyroid cells overexpression of exogenous DREAM strongly inhibits Pax8 expression. Moreover, we provide evidence that a mutated form of DREAM unable to bind Ca{sup 2+} interferes with thyroid cell proliferation. Therefore, we propose that in thyroid cells DREAM is a mediator of the calcium-signaling pathway and it is involved in the regulation of thyroid cell function.

  15. Sense and antisense transcription are associated with distinct chromatin architectures across genes.

    PubMed

    Murray, Struan C; Haenni, Simon; Howe, Françoise S; Fischl, Harry; Chocian, Karolina; Nair, Anitha; Mellor, Jane

    2015-09-18

    Genes from yeast to mammals are frequently subject to non-coding transcription of their antisense strand; however the genome-wide role for antisense transcription remains elusive. As transcription influences chromatin structure, we took a genome-wide approach to assess which chromatin features are associated with nascent antisense transcription, and contrast these with features associated with nascent sense transcription. We describe a distinct chromatin architecture at the promoter and gene body specifically associated with antisense transcription, marked by reduced H2B ubiquitination, H3K36 and H3K79 trimethylation and increased levels of H3 acetylation, chromatin remodelling enzymes, histone chaperones and histone turnover. The difference in sense transcription between genes with high or low levels of antisense transcription is slight; thus the antisense transcription-associated chromatin state is not simply analogous to a repressed state. Using mutants in which the level of antisense transcription is reduced at GAL1, or altered genome-wide, we show that non-coding transcription is associated with high H3 acetylation and H3 levels across the gene, while reducing H3K36me3. Set1 is required for these antisense transcription-associated chromatin changes in the gene body. We propose that nascent antisense and sense transcription have fundamentally distinct relationships with chromatin, and that both should be considered canonical features of eukaryotic genes.

  16. Genomewide identification of genes under directional selection: gene transcription Q(ST) scan in diverging Atlantic salmon subpopulations.

    PubMed

    Roberge, C; Guderley, H; Bernatchez, L

    2007-10-01

    Evolutionary genomics has benefited from methods that allow identifying evolutionarily important genomic regions on a genomewide scale, including genome scans and QTL mapping. Recently, genomewide scanning by means of microarrays has permitted assessing gene transcription differences among species or populations. However, the identification of differentially transcribed genes does not in itself suffice to measure the role of selection in driving evolutionary changes in gene transcription. Here, we propose and apply a "transcriptome scan" approach to investigating the role of selection in shaping differential profiles of gene transcription among populations. We compared the genomewide transcription levels between two Atlantic salmon subpopulations that have been diverging for only six generations. Following assessment of normality and unimodality on a gene-per-gene basis, the additive genetic basis of gene transcription was estimated using the animal model. Gene transcription h(2) estimates were significant for 1044 (16%) of all detected cDNA clones. In an approach analogous to that of genome scans, we used the distribution of the Q(ST) values estimated from intra- and intersubpopulation additive genetic components of the transcription profiles to identify 16 outlier genes (average Q(ST) estimate = 0.11) whose transcription levels are likely to have evolved under the influence of directional selection within six generations only. Overall, this study contributes both empirically and methodologically to the quantitative genetic exploration of gene transcription data. PMID:17720934

  17. VITELLOGENIN GENE TRANSCRIPTION: A RELATIVE QUANTITATIVE EXPOSURE INDICATOR OF ENVIRONMENTAL ESTROGENS

    EPA Science Inventory

    We report the development of a quantifiable exposure indicator for measuring the presence of environmental estrogens in aquatic systems. Synthetic oligonucleotides, designed specifically for the vitellogenin gene (Vg) transcription product, were used in a Reverse Transcription Po...

  18. Unsaturated fatty acids-dependent linkage between respiration and fermentation revealed by deletion of hypoxic regulatory KlMGA2 gene in the facultative anaerobe-respiratory yeast Kluyveromyces lactis.

    PubMed

    Ottaviano, Daniela; Montanari, Arianna; De Angelis, Lorenzo; Santomartino, Rosa; Visca, Andrea; Brambilla, Luca; Rinaldi, Teresa; Bello, Cristiano; Reverberi, Massimo; Bianchi, Michele M

    2015-08-01

    In the yeast Kluyveromyces lactis, the inactivation of structural or regulatory glycolytic and fermentative genes generates obligate respiratory mutants which can be characterized by sensitivity to the mitochondrial drug antimycin A on glucose medium (Rag(-) phenotype). Rag(-) mutations can occasionally be generated by the inactivation of genes not evidently related to glycolysis or fermentation. One such gene is the hypoxic regulatory gene KlMGA2. In this work, we report a study of the many defects, in addition to the Rag(-) phenotype, generated by KlMGA2 deletion. We analyzed the fermentative and respiratory metabolism, mitochondrial functioning and morphology in the Klmga2Δ strain. We also examined alterations in the regulation of the expression of lipid biosynthetic genes, in particular fatty acids, ergosterol and cardiolipin, under hypoxic and cold stress and the phenotypic suppression by unsaturated fatty acids of the deleted strain. Results indicate that, despite the fact that the deleted mutant strain had a typical glycolytic/fermentative phenotype and KlMGA2 is a hypoxic regulatory gene, the deletion of this gene generated defects linked to mitochondrial functions suggesting new roles of this protein in the general regulation and cellular fitness of K. lactis. Supplementation of unsaturated fatty acids suppressed or modified these defects suggesting that KlMga2 modulates membrane functioning or membrane-associated functions, both cytoplasmic and mitochondrial.

  19. Gene transcription analysis of carrot allergens by relative quantification with single and duplex reverse transcription real-time PCR.

    PubMed

    Zagon, Jutta; Jansen, Bärbel; Knoppik, Meike; Ehlers, Anke; Kroh, Lothar W; Holzhauser, Thomas; Vieths, Stefan; Broll, Hermann

    2010-01-01

    Single and duplex real-time polymerase chain reaction (PCR) systems have been developed to quantify specific mRNA transcription of genes coding for the major Daucus carota allergen isoforms Dau c 1.01 and Dau c 1.02. Methods were tested with samples from the local market. Whereas the gene transcription levels for Dau c 1.01 were consistently high in all investigated samples, significant differences for the Dau c 1.02 transcription could be demonstrated in randomly collected market samples. The gene transcription level for the minor Dau c 1.02 variant is about one log below Dau c 1.01. Both formats, single or duplex real-time methods, exhibit ideal cycle threshold (CT) ranges and good reproducibility. In particular, the easily performed duplex real-time PCR system is potentially suited for the selection of hypoallergenic varieties and studying the impact of post-harvesting or environmental conditions.

  20. ROMA: an in vitro approach to defining target genes for transcription regulators

    PubMed Central

    MacLellan, Shawn R.; Eiamphungporn, Warawan; Helmann, John D.

    2009-01-01

    We describe an in vitro transcription-based method called ROMA (run-off transcription-microarray analysis) for the genome-wide analysis of transcription regulated by sigma factors and other transcriptional regulators. ROMA uses purified RNA polymerase with and without a regulatory protein to monitor products of transcription from a genomic DNA template. Transcribed RNA is converted to cDNA and hybridized to gene arrays allowing for the identification of genes that are specifically activated by the regulator. We discuss the use of ROMA to define sigma factor regulons in Bacillus subtilis and its broad application to defining regulons for other transcriptional regulators in various species. PMID:18948201

  1. Topics in Transcriptional Control of Lipid Metabolism: from Transcription Factors to Gene-Promoter Polymorphisms

    PubMed Central

    Bergen, Werner G.; Burnett, Derris D.

    2013-01-01

    The central dogma of biology (DNA>>RNA>>Protein) has remained as an extremely useful scaffold to guide the study of molecular regulation of cellular metabolism. Molecular regulation of cellular metabolism has been pursued from an individual enzyme to a global assessment of protein function at the genomic (DNA), transcriptomic (RNA) and translation (Protein) levels. Details of a key role by inhibitory small RNAs and post-translational processing of cellular proteins on a whole cell/global basis are now just emerging. Below we emphasize the role of transcription factors (TF) in regulation of adipogenesis and lipogenesis. Additionally we have also focused on emerging additional TF that may also have hitherto unrecognized roles in adipogenesis and lipogenesis as compared to our present understanding. It is generally recognized that SNPs in structural genes can affect the final structure/function of a given protein. The implications of SNPs located in the non-transcribed promoter region on transcription have not been examined as extensively at this time. Here we have also summarized some emerging results on promoter SNPs for lipid metabolism and related cellular processes. PMID:25031651

  2. Transcription of interferon-stimulated genes is induced by adenovirus particles but is suppressed by E1A gene products.

    PubMed Central

    Reich, N; Pine, R; Levy, D; Darnell, J E

    1988-01-01

    Interferon treatment of cell cultures results in the rapid transcriptional induction of a specific set of genes. In this paper we explore the effect of cellular infection by several adenoviruses, both wild type and mutant, on the expression of these genes. Infection with adenovirus induces the transcription of the interferon-stimulated genes in the absence of any protein synthesis. In fact, the inhibition of protein synthesis during a wild-type infection produces enhanced stimulation of transcription of these genes. Experiments with viral mutants indicate the ability to specifically suppress this transcription maps to the E1A gene. In addition, the E1A gene products are capable of suppressing the specific transcriptional induction of interferon-stimulated promoters during cotransfection experiments and therefore presumably during viral infection. The dual effect of adenovirus on the expression of interferon-stimulated genes may represent an example of action and evolutionary reaction between virus and host. Images PMID:2446013

  3. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  4. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  5. Pairwise comparisons of ten porcine tissues identify differential transcriptional regulation at the gene, isoform, promoter and transcription start site level

    SciTech Connect

    Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn

    2013-08-23

    Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i

  6. Modulation of Aanat gene transcription in the rat pineal gland.

    PubMed

    Ho, Anthony K; Chik, Constance L

    2010-01-01

    The main function of the rat pineal gland is to transform the circadian rhythm generated in the suprachiasmatic nucleus into a rhythmic signal of circulating melatonin characterized by a large nocturnal increase that closely reflects the duration of night period. This is achieved through the tight coupling between environmental lighting and the expression of arylalkylamine-N-acetyltransferase, the rhythm-controlling enzyme in melatonin synthesis. The initiation of Aanat transcription at night is controlled largely by the norepinephrine-stimulated phosphorylation of cAMP response element-binding protein by protein kinase A. However, to accurately reflect the duration of darkness, additional signaling mechanisms also participate to fine-tune the temporal profile of adrenergic-induced Aanat transcription. Here, we reviewed some of these signaling mechanisms, with emphasis on the more recent findings. These signaling mechanisms can be divided into two groups: those involving modification of constitutively expressed proteins and those requiring synthesis of new proteins. This review highlights the pineal gland as an excellent model system for studying neurotransmitter-regulated rhythmic gene expression.

  7. Dynamic Encounters of Genes and Transcripts with the Nuclear Pore.

    PubMed

    Ben-Yishay, Rakefet; Ashkenazy, Asaf J; Shav-Tal, Yaron

    2016-07-01

    Transcribed mRNA molecules must reach the cytoplasm to undergo translation. Technological developments in imaging have placed mRNAs under the spotlight, allowing the quantitative study of the spatial and temporal dynamics of the nucleocytoplasmic mRNA export process. Here, we discuss studies that have used such experimental approaches to demonstrate that gene tethering at the nuclear pore complex (NPC) regulates mRNA expression, and to characterize mRNA dynamics during transport in real time. The paths taken by mRNAs as they move from their sites of transcription and travel through the nucleoplasm, in between chromatin domains, and finally through the NPC, can now be observed in detail. PMID:27185238

  8. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    EPA Science Inventory

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  9. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    PubMed Central

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  10. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.

    PubMed

    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent

    2016-01-15

    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context. PMID:26456102

  11. The novel hypoxic cytotoxin, TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and hypoxia inducible factor-1{alpha} targeted gene expression

    SciTech Connect

    Miyake, Kotaro; Nishioka, Masanori; Imura, Satoru; Batmunkh, Erdenebulgan; Uto, Yoshihiro; Nagasawa, Hideko; Hori, Hitoshi; Shimada, Mitsuo

    2012-08-01

    Tumor hypoxia has been considered to be a potential therapeutic target, because hypoxia is a common feature of solid tumors and is associated with their malignant phenotype. In the present study, we investigated the antitumor effect of a novel hypoxic cytotoxin, 3-[2-hydroxyethyl(methyl)amino]-2-quinoxalinecarbonitrile 1,4-dioxide (TX-2098) in inhibiting the expression of hypoxia inducible factor-1{alpha} (HIF-1{alpha}), and consequently vascular endothelial cell growth factor (VEGF) expression in pancreatic cancer. The antitumor effects of TX-2098 under hypoxia were tested against various human pancreatic cancer cell lines using WST-8 assay. VEGF protein induced pancreatic cancer was determined on cell-free supernatant by ELISA. Moreover, nude mice bearing subcutaneously (s.c.) or orthotopically implanted human SUIT-2 were treated with TX-2098. Tumor volume, survival and expression of HIF-1 and associated molecules were evaluated in treatment versus control groups. In vitro, TX-2098 inhibited the proliferation of various pancreatic cancer cell lines. In s.c model, tumors from nude mice injected with pancreatic cancer cells and treated with TX-2098 showed significant reductions in volume (P < 0.01 versus control). Quantitative real-time reverse transcription-PCR analysis revealed that TX-2098 significantly inhibited mRNA expression of the HIF-1 associated molecules, VEGF, glucose transporter 1 and Aldolase A (P < 0.01 versus control). These treatments also prolong the survival in orthotopic models. These results suggest that the effect of TX-2098 in pancreatic cancer might be correlated with the expression of VEGF and HIF-1 targeted molecules. -- Highlights: Black-Right-Pointing-Pointer We designed and synthesized novel hypoxic cytoxin, TX-2098. Black-Right-Pointing-Pointer TX-2098 inhibited the proliferation of human pancreatic cancer cells than TPZ. Black-Right-Pointing-Pointer TX-2098 reduced VEGF protein level than TPZ. Black-Right-Pointing-Pointer TX-2098

  12. Comprehensive analysis of the transcription of starch synthesis genes and the transcription factor RSR1 in wheat (Triticum aestivum) endosperm.

    PubMed

    Kang, Guo-Zhang; Xu, Wei; Liu, Guo-Qin; Peng, Xiao-Qi; Guo, Tian-Cai

    2013-02-01

    The cDNA sequences of 26 starch synthesis genes were identified in common wheat (Triticum aestivum L.), and their transcript levels were measured using quantitative real-time RT-PCR to assess the function of individual genes and the regulatory mechanism in wheat endosperm. The expression patterns of 26 genes in wheat endosperm were classified into three groups. The genes in group 1 were richly expressed in the early stage of grain development and may be involved in the construction of fundamental cell machinery, synthesis of glucan primers, and initiation of starch granules. The genes in group 2 were highly expressed during the middle and late stages of grain development, and their expression profiles were similar to the accumulation rate of endosperm starch; these genes are presumed to play a crucial role in starch production. The genes in group 3 were scantily expressed throughout the grain development period and might be associated with transitory starch synthesis. Transcripts of the negative transcription factor TaRSR1 were high at the early and late stages of grain development but low during the middle stage. The expression pattern of TaRSR1 was almost opposite to those of the group 2 starch synthesis genes, indicating that TaRSR1 might negatively regulate the expression of many endosperm starch synthesis genes during grain development.

  13. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  14. Identification, phylogeny, and transcript of chitinase family genes in sugarcane.

    PubMed

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function.

  15. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  16. Evaluation of quantitative polymerase chain reaction-based approaches for determining gene copy and gene transcript numbers in environmental samples.

    PubMed

    Smith, Cindy J; Nedwell, David B; Dong, Liang F; Osborn, A Mark

    2006-05-01

    Quantitative polymerase chain reaction (Q-PCR) amplification is widely applied for determining gene and transcript numbers within environmental samples. This research evaluated Q-PCR reproducibility via TaqMan assays quantifying 16S rRNA gene and transcript numbers in sediments, within and between replicate Q-PCR assays. Intra-assay variation in 16S rRNA gene numbers in replicate DNA samples was low (coefficients of variation; CV from 3.2 to 5.2%). However, variability increased using replicated standard curves within separate Q-PCR assays (CV from 11.2% to 26%), indicating absolute comparison of gene numbers between Q-PCR assays was less reliable. 16S rRNA transcript quantification was evaluated using standard curves of diluted RNA or cDNA (before, or following, reverse transcription). These standard curves were statistically different with cDNA-derived curves giving higher r(2) values and Q-PCR efficiencies. Template concentrations used in Q-PCR also affected 16S rRNA gene and transcript numbers. For DNA, 10(-3) dilutions yielded higher gene numbers than 10(-1) and 10(-2) dilutions. Conversely, RNA template dilution reduced numbers of transcripts detected. Finally, different nucleic acid isolation methods also resulted in gene and transcript number variability. This research demonstrates Q-PCR determination of absolute numbers of genes and transcripts using environmental nucleic acids should be treated cautiously.

  17. Model of gene transcription including the return of a RNA polymerase to the beginning of a transcriptional cycle

    NASA Astrophysics Data System (ADS)

    Zhdanov, Vladimir P.

    2009-11-01

    The gene transcription occurs via the RNA polymerase (RNAP) recruitment on the DNA promoter sequence, formation of a locally open DNA chain, promoter escape, steps of the RNA synthesis, and RNA and RNAP release after reading the final DNA base. Just after the end of the RNA synthesis, RNAP surrounds the closed DNA chain and may diffuse along DNA, desorb, or reach the promoter and start the RNA-synthesis cycle again. We present a generic kinetic model taking the latter steps into account and show analytically and by Monte Carlo simulations that it predicts transcriptional bursts even in the absence of explicit regulation of the transcription by master proteins.

  18. Induction of AhR-Mediated Gene Transcription by Coffee

    PubMed Central

    Ishikawa, Toshio; Takahashi, Satoshi; Morita, Koji; Okinaga, Hiroko; Teramoto, Tamio

    2014-01-01

    Background Aryl hydrocarbon receptor (AhR) is classically known to be activated by xenobiotics such as dioxins and polycyclic aromatic hydrocarbons (PAHs). Although it has been reported that PAHs are contained in roasted coffee beans, in general coffee beverages are not considered to be AhR activators. We tested whether exposure to coffee would activate AhR in cultured cells. Methods HepG2 cells stably expressing an AhR-responsive reporter gene were treated with coffee samples. Also, expression of CYP1A1, an endogenous AhR-responsive gene, was quantitated by RT-PCR and Western blotting in HepG2, Caco-2, and MCF-7 cells, after treatment with coffee. In order to obtain sensitive and reproducible results, all the experiments were performed with the cells placed in either phosphate-buffered saline (PBS) or pure serum, instead of routinely-used culture medium, whose intrinsic AhR-stimulating activity turned out to be so strong as to interfere with the analyses. Results All the coffee samples tested robustly stimulated AhR-mediated transcription in the reporter gene assays. Of note, to what extent coffee and other AhR agonists activated AhR was different, depending on whether the experiments were done in PBS or serum. CYP1A1 mRNA was induced by coffee, in HepG2, Caco-2, and MCF-7 cells placed in either PBS or serum. CYP1A1 protein expression, which was not detected in these cells incubated in PBS, was also increased by coffee in cells placed in serum. Conclusions By using culture medium-free experimental settings, we have shown that coffee is a strong AhR activator. Our observation may help elucidate as-yet-unrecognized effects of coffee on human health. PMID:25007155

  19. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  20. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent.

  1. Effect of soil clay content on RNA isolation and on detection and quantification of bacterial gene transcripts in soil by quantitative reverse transcription-PCR.

    PubMed

    Novinscak, A; Filion, M

    2011-09-01

    In this study, we evaluated the effect of soil clay content on RNA isolation and on quantitative reverse transcription-PCR (qRT-PCR) quantification of microbial gene transcripts. The amount of clay significantly altered RNA isolation yields and qRT-PCR analyses. Recommendations are made for quantifying microbial gene transcripts in soil samples varying in clay content.

  2. Transcriptome analysis of human tissues and cell lines reveals one dominant transcript per gene

    PubMed Central

    2013-01-01

    Background RNA sequencing has opened new avenues for the study of transcriptome composition. Significant evidence has accumulated showing that the human transcriptome contains in excess of a hundred thousand different transcripts. However, it is still not clear to what extent this diversity prevails when considering the relative abundances of different transcripts from the same gene. Results Here we show that, in a given condition, most protein coding genes have one major transcript expressed at significantly higher level than others, that in human tissues the major transcripts contribute almost 85 percent to the total mRNA from protein coding loci, and that often the same major transcript is expressed in many tissues. We detect a high degree of overlap between the set of major transcripts and a recently published set of alternatively spliced transcripts that are predicted to be translated utilizing proteomic data. Thus, we hypothesize that although some minor transcripts may play a functional role, the major ones are likely to be the main contributors to the proteome. However, we still detect a non-negligible fraction of protein coding genes for which the major transcript does not code a protein. Conclusions Overall, our findings suggest that the transcriptome from protein coding loci is dominated by one transcript per gene and that not all the transcripts that contribute to transcriptome diversity are equally likely to contribute to protein diversity. This observation can help to prioritize candidate targets in proteomics research and to predict the functional impact of the detected changes in variation studies. PMID:23815980

  3. Trans-Reactivation: A New Epigenetic Phenomenon Underlying Transcriptional Reactivation of Silenced Genes.

    PubMed

    Onorati, Maria Cristina; Arancio, Walter; Cavalieri, Vincenzo; Ingrassia, Antonia M R; Pavesi, Giulio; Corona, Davide F V

    2015-08-01

    In order to study the role played by cellular RNA pools produced by homologous genomic loci in defining the transcriptional state of a silenced gene, we tested the effect of non-functional alleles of the white gene in the presence of a functional copy of white, silenced by heterochromatin. We found that non-functional alleles of white, unable to produce a coding transcript, could reactivate in trans the expression of a wild type copy of the same gene silenced by heterochromatin. This new epigenetic phenomenon of transcriptional trans-reactivation is heritable, relies on the presence of homologous RNA's and is affected by mutations in genes involved in post-transcriptional gene silencing. Our data suggest a general new unexpected level of gene expression control mediated by homologous RNA molecules in the context of heterochromatic genes. PMID:26292210

  4. Correlation of Methane Production and Functional Gene Transcriptional Activity in a Peat Soil ▿

    PubMed Central

    Freitag, Thomas E.; Prosser, James I.

    2009-01-01

    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37°C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25°C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems. PMID:19749064

  5. Correlation of methane production and functional gene transcriptional activity in a peat soil.

    PubMed

    Freitag, Thomas E; Prosser, James I

    2009-11-01

    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37 degrees C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25 degrees C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems.

  6. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-01-01

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  7. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.

    PubMed

    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E

    2015-11-11

    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding.

  8. Regulation of gene expression by hypoxia.

    PubMed

    Kenneth, Niall Steven; Rocha, Sonia

    2008-08-15

    Hypoxia induces profound changes in the cellular gene expression profile. The discovery of a major transcription factor family activated by hypoxia, HIF (hypoxia-inducible factor), and the factors that contribute to HIF regulation have greatly enhanced our knowledge of the molecular aspects of the hypoxic response. However, in addition to HIF, other transcription factors and cellular pathways are activated by exposure to reduced oxygen. In the present review, we summarize the current knowledge of how additional hypoxia-responsive transcription factors integrate with HIF and how other cellular pathways such as chromatin remodelling, translation regulation and microRNA induction, contribute to the co-ordinated cellular response observed following hypoxic stress.

  9. Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis.

    PubMed

    Ko, Jae-Heung; Kim, Won-Chan; Han, Kyung-Hwan

    2009-11-01

    MYB46 functions as a transcriptional switch that turns on the genes necessary for secondary wall biosynthesis. Elucidating the transcriptional regulatory network immediately downstream of MYB46 is crucial to our understanding of the molecular and biochemical processes involved in the biosynthesis and deposition of secondary walls in plants. To gain insights into MYB46-mediated transcriptional regulation, we first established an inducible secondary wall thickening system in Arabidopsis by expressing MYB46 under the control of dexamethasone-inducible promoter. Then, we used an ATH1 GeneChip microarray and Illumina digital gene expression system to obtain a series of transcriptome profiles with regard to the induction of secondary wall development. These analyses allowed us to identify a group of transcription factors whose expression coincided with or preceded the induction of secondary wall biosynthetic genes. A transient transcriptional activation assay was used to confirm the hierarchical relationships among the transcription factors in the network. The in vivo assay showed that MYB46 transcriptionally activates downstream target transcription factors, three of which (AtC3H14, MYB52 and MYB63) were shown to be able to activate secondary wall biosynthesis genes. AtC3H14 activated the transcription of all of the secondary wall biosynthesis genes tested, suggesting that AtC3H14 may be another master regulator of secondary wall biosynthesis. The transcription factors identified here may include direct activators of secondary wall biosynthesis genes. The present study discovered novel hierarchical relationships among the transcription factors involved in the transcriptional regulation of secondary wall biosynthesis, and generated several testable hypotheses.

  10. MEF2 transcription factors: developmental regulators and emerging cancer genes

    PubMed Central

    Pon, Julia R.; Marra, Marco A.

    2016-01-01

    The MEF2 transcription factors have roles in muscle, cardiac, skeletal, vascular, neural, blood and immune system cell development through their effects on cell differentiation, proliferation, apoptosis, migration, shape and metabolism. Altered MEF2 activity plays a role in human diseases and has recently been implicated in the development of several cancer types. In particular, MEF2B, the most divergent and least studied protein of the MEF2 family, has a role unique from its paralogs in non-Hodgkin lymphomas. The use of genome-scale technologies has enabled comprehensive MEF2 target gene sets to be identified, contributing to our understanding of MEF2 proteins as nodes in complex regulatory networks. This review surveys the molecular interactions of MEF2 proteins and their effects on cellular and organismal phenotypes. We include a discussion of the emerging roles of MEF2 proteins as oncogenes and tumor suppressors of cancer. Throughout this article we highlight similarities and differences between the MEF2 family proteins, including a focus on functions of MEF2B. PMID:26506234

  11. [Association of schizophrenia with variations in genes encoding transcription factors].

    PubMed

    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V

    2015-01-01

    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  12. Metabolic and hypoxic adaptation to anti-angiogenic therapy: a target for induced essentiality

    PubMed Central

    McIntyre, Alan; Harris, Adrian L

    2015-01-01

    Anti-angiogenic therapy has increased the progression-free survival of many cancer patients but has had little effect on overall survival, even in colon cancer (average 6–8 weeks) due to resistance. The current licensed targeted therapies all inhibit VEGF signalling (Table1). Many mechanisms of resistance to anti-VEGF therapy have been identified that enable cancers to bypass the angiogenic blockade. In addition, over the last decade, there has been increasing evidence for the role that the hypoxic and metabolic responses play in tumour adaptation to anti-angiogenic therapy. The hypoxic tumour response, through the transcription factor hypoxia-inducible factors (HIFs), induces major gene expression, metabolic and phenotypic changes, including increased invasion and metastasis. Pre-clinical studies combining anti-angiogenics with inhibitors of tumour hypoxic and metabolic adaptation have shown great promise, and combination clinical trials have been instigated. Understanding individual patient response and the response timing, given the opposing effects of vascular normalisation versus reduced perfusion seen with anti-angiogenics, provides a further hurdle in the paradigm of personalised therapeutic intervention. Additional approaches for targeting the hypoxic tumour microenvironment are being investigated in pre-clinical and clinical studies that have potential for producing synthetic lethality in combination with anti-angiogenic therapy as a future therapeutic strategy. PMID:25700172

  13. Hypoxic preconditioning decreases nuclear factor κB activity via Disrupted in Schizophrenia-1.

    PubMed

    Liu, Jia-Ren; Liu, Qian; Khoury, Joseph; Li, Yue-Jin; Han, Xiao-Hui; Li, Jing; Ibla, Juan C

    2016-01-01

    Nuclear factor κB is a key mediator of inflammation during conditions of hypoxia. Here, we used models of hypoxic pre-conditioning as mechanism to decrease nuclear factor κB activity induced by hypoxia. Our initial studies suggested that Disrupted in Schizophrenia-1 may be induced by hypoxic pre-conditioning and possibly involved in the regulation of nuclear factor κB. In this study we used Disrupted in Schizophrenia-1 exogenous over-expression and knock-down to determine its effect on ataxia telangiectasia mutated--nuclear factor κB activation cascade. Our results demonstrated that hypoxic pre-conditioning significantly increased the expression of Disrupted in Schizophrenia-1 at mRNA and protein levels both in vitro and in vivo. Over-expression of Disrupted in Schizophrenia-1 significantly attenuated the hypoxia-mediated ataxia telangiectasia mutated phosphorylation and prevented its cytoplasm translocation where it functions to activate nuclear factor κB. We further determined that Disrupted in Schizophrenia-1 activated the protein phosphatase 2A, preventing the phosphorylation of ataxia telangiectasia mutated serine-1981, the main regulatory site of ataxia telangiectasia mutated activity. Cellular levels of Disrupted in Schizophrenia-1 protein significantly decreased nuclear factor κB activation profiles and pro-inflammatory gene expression. Taken together, these results demonstrate that hypoxic pre-conditioning decreases the activation of nuclear factor κB through the transcriptional induction of Disrupted in Schizophrenia-1.

  14. Global Profiling of Metabolic Adaptation to Hypoxic Stress in Human Glioblastoma Cells

    PubMed Central

    Kucharzewska, Paulina; Christianson, Helena C.; Belting, Mattias

    2015-01-01

    Oncogenetic events and unique phenomena of the tumor microenvironment together induce adaptive metabolic responses that may offer new diagnostic tools and therapeutic targets of cancer. Hypoxia, or low oxygen tension, represents a well-established and universal feature of the tumor microenvironment and has been linked to increased tumor aggressiveness as well as resistance to conventional oncological treatments. Previous studies have provided important insights into hypoxia induced changes of the transcriptome and proteome; however, how this translates into changes at the metabolite level remains to be defined. Here, we have investigated dynamic, time-dependent effects of hypoxia on the cancer cell metabolome across all families of macromolecules, i.e., carbohydrate, protein, lipid and nucleic acid, in human glioblastoma cells. Using GC/MS and LC/MS/MS, 345 and 126 metabolites were identified and quantified in cells and corresponding media, respectively, at short (6 h), intermediate (24 h), and prolonged (48 h) incubation at normoxic or hypoxic (1% O2) conditions. In conjunction, we performed gene array studies with hypoxic and normoxic cells following short and prolonged incubation. We found that levels of several key metabolites varied with the duration of hypoxic stress. In some cases, metabolic changes corresponded with hypoxic regulation of key pathways at the transcriptional level. Our results provide new insights into the metabolic response of glioblastoma cells to hypoxia, which should stimulate further work aimed at targeting cancer cell adaptive mechanisms to microenvironmental stress. PMID:25633823

  15. Identification of brassinosteroid-related genes by means of transcript co-response analyses

    PubMed Central

    Lisso, Janina; Steinhauser, Dirk; Altmann, Thomas; Kopka, Joachim; Müssig, Carsten

    2005-01-01

    The comprehensive systems-biology database (CSB.DB) was used to reveal brassinosteroid (BR)-related genes from expression profiles based on co-response analyses. Genes exhibiting simultaneous changes in transcript levels are candidates of common transcriptional regulation. Combining numerous different experiments in data matrices allows ruling out outliers and conditional changes of transcript levels. CSB.DB was queried for transcriptional co-responses with the BR-signalling components BRI1 and BAK1: 301 out of 9694 genes represented in the nasc0271 database showed co-responses with both genes. As expected, these genes comprised pathway-involved genes (e.g. 72 BR-induced genes), because the BRI1 and BAK1 proteins are required for BR-responses. But transcript co-response takes the analysis a step further compared with direct approaches because BR-related non BR-responsive genes were identified. Insights into networks and the functional context of genes are provided, because factors determining expression patterns are reflected in correlations. Our findings demonstrate that transcript co-response analysis presents a valuable resource to uncover common regulatory patterns of genes. Different data matrices in CSB.DB allow examination of specific biological questions. All matrices are publicly available through CSB.DB. This work presents one possible roadmap to use the CSB.DB resources. PMID:15891113

  16. Gene model 129 (Gm129) encodes a novel transcriptional repressor that modulates circadian gene expression.

    PubMed

    Annayev, Yunus; Adar, Sheera; Chiou, Yi-Ying; Lieb, Jason D; Sancar, Aziz; Ye, Rui

    2014-02-21

    The mammalian circadian clock is a molecular oscillator composed of a feedback loop that involves transcriptional activators CLOCK and BMAL1, and repressors Cryptochrome (CRY) and Period (PER). Here we show that a direct CLOCK·BMAL1 target gene, Gm129, is a novel regulator of the feedback loop. ChIP analysis revealed that the CLOCK·BMAL1·CRY1 complex strongly occupies the promoter region of Gm129. Both mRNA and protein levels of GM129 exhibit high amplitude circadian oscillations in mouse liver, and Gm129 gene encodes a nuclear-localized protein that directly interacts with BMAL1 and represses CLOCK·BMAL1 activity. In vitro and in vivo protein-DNA interaction results demonstrate that, like CRY1, GM129 functions as a repressor by binding to the CLOCK·BMAL1 complex on DNA. Although Gm129(-/-) or Cry1(-/-) Gm129(-/-) mice retain a robust circadian rhythm, the peaks of Nr1d1 and Dbp mRNAs in liver exhibit a significant phase delay compared with control. Our results suggest that, in addition to CRYs and PERs, the GM129 protein contributes to the transcriptional feedback loop by modulating CLOCK·BMAL1 activity as a transcriptional repressor.

  17. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  18. Tissue-specific epigenetics in gene neighborhoods: myogenic transcription factor genes

    PubMed Central

    Chandra, Sruti; Terragni, Jolyon; Zhang, Guoqiang; Pradhan, Sriharsa; Haushka, Stephen; Johnston, Douglas; Baribault, Carl; Lacey, Michelle; Ehrlich, Melanie

    2015-01-01

    Myogenic regulatory factor (MRF) genes, MYOD1, MYOG, MYF6 and MYF5, are critical for the skeletal muscle lineage. Here, we used various epigenome profiles from human myoblasts (Mb), myotubes (Mt), muscle and diverse non-muscle samples to elucidate the involvement of multigene neighborhoods in the regulation of MRF genes. We found more far-distal enhancer chromatin associated with MRF genes in Mb and Mt than previously reported from studies in mice. For the MYF5/MYF6 gene-pair, regions of Mb-associated enhancer chromatin were located throughout the adjacent 236-kb PTPRQ gene even though Mb expressed negligible amounts of PTPRQ mRNA. Some enhancer chromatin regions inside PTPRQ in Mb were also seen in PTPRQ mRNA-expressing non-myogenic cells. This suggests dual-purpose PTPRQ enhancers that upregulate expression of PTPRQ in non-myogenic cells and MYF5/MYF6 in myogenic cells. In contrast, the myogenic enhancer chromatin regions distal to MYOD1 were intergenic and up to 19 kb long. Two of them contain small, known MYOD1 enhancers, and one displayed an unusually high level of 5-hydroxymethylcytosine in a quantitative DNA hydroxymethylation assay. Unexpectedly, three regions of MYOD1-distal enhancer chromatin in Mb and Mt overlapped enhancer chromatin in umbilical vein endothelial cells, which might upregulate a distant gene (PIK3C2A). Lastly, genes surrounding MYOG were preferentially transcribed in Mt, like MYOG itself, and exhibited nearby myogenic enhancer chromatin. These neighboring chromatin regions may be enhancers acting in concert to regulate myogenic expression of multiple adjacent genes. Our findings reveal the very different and complex organization of gene neighborhoods containing closely related transcription factor genes. PMID:26041816

  19. A distance difference matrix approach to identifying transcription factors that regulate differential gene expression

    PubMed Central

    De Bleser, Pieter; Hooghe, Bart; Vlieghe, Dominique; van Roy, Frans

    2007-01-01

    We introduce a method that considers target genes of a transcription factor, and searches for transcription factor binding sites (TFBSs) of secondary factors responsible for differential responses among these targets. Based on the distance difference matrix concept, the method simultaneously integrates statistical overrepresentation and co-occurrence of TFBSs. Our approach is validated on datasets of differentially regulated human genes and is shown to be highly effective in detecting TFBSs responsible for the observed differential gene expression. PMID:17504544

  20. Regulation of nitrogenase gene expression by transcript stability in the cyanobacterium Anabaena variabilis.

    PubMed

    Pratte, Brenda S; Thiel, Teresa

    2014-10-01

    The nitrogenase gene cluster in cyanobacteria has been thought to comprise multiple operons; however, in Anabaena variabilis, the promoter for the first gene in the cluster, nifB1, appeared to be the primary promoter for the entire nif cluster. The structural genes nifHDK1 were the most abundant transcripts; however, their abundance was not controlled by an independent nifH1 promoter, but rather, by RNA processing, which produced a very stable nifH1 transcript and a moderately stable nifD1 transcript. There was also no separate promoter for nifEN1. In addition to the nifB1 promoter, there were weak promoters inside the nifU1 gene and inside the nifE1 gene, and both promoters were heterocyst specific. In an xisA mutant, which effectively separated promoters upstream of an 11-kb excision element in nifD1 from the downstream genes, the internal nifE1 promoter was functional. Transcription of the nif1 genes downstream of the 11-kb element, including the most distant genes, hesAB1 and fdxH1, was reduced in the xisA mutant, indicating that the nifB1 promoter contributed to their expression. However, with the exception of nifK1 and nifE1, which had no expression, the downstream genes showed low to moderate levels of transcription in the xisA mutant. The hesA1 gene also had a promoter, but the fdxH gene had a processing site just upstream of the gene. The processing of transcripts at sites upstream of nifH1 and fdxH1 correlated with increased stability of these transcripts, resulting in greater amounts than transcripts that were not close to processing sites. PMID:25092030

  1. NanoScript: A Nanoparticle-Based Artificial Transcription Factor for Effective Gene Regulation

    PubMed Central

    2015-01-01

    Transcription factor (TF) proteins are master regulators of transcriptional activity and gene expression. TF-based gene regulation is a promising approach for many biological applications; however, several limitations hinder the full potential of TFs. Herein, we developed an artificial, nanoparticle-based transcription factor, termed NanoScript, which is designed to mimic the structure and function of TFs. NanoScript was constructed by tethering functional peptides and small molecules called synthetic transcription factors, which mimic the individual TF domains, onto gold nanoparticles. We demonstrate that NanoScript localizes within the nucleus and initiates transcription of a reporter plasmid by over 15-fold. Moreover, NanoScript can effectively transcribe targeted genes on endogenous DNA in a nonviral manner. Because NanoScript is a functional replica of TF proteins and a tunable gene-regulating platform, it has great potential for various stem cell applications. PMID:25133310

  2. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.

    PubMed

    Yu, Chunxiao; Genco, Caroline Attardo

    2012-04-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  3. Fur-Mediated Activation of Gene Transcription in the Human Pathogen Neisseria gonorrhoeae

    PubMed Central

    Yu, Chunxiao

    2012-01-01

    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  4. Endosymbiotic gene transfer and transcriptional regulation of transferred genes in Paulinella chromatophora.

    PubMed

    Nowack, Eva C M; Vogel, Heiko; Groth, Marco; Grossman, Arthur R; Melkonian, Michael; Glöckner, Gernot

    2011-01-01

    Paulinella chromatophora is a cercozoan amoeba that contains "chromatophores," which are photosynthetic inclusions of cyanobacterial origin. The recent discovery that chromatophores evolved independently of plastids, underwent major genome reduction, and transferred at least two genes to the host nucleus has highlighted P. chromatophora as a model to infer early steps in the evolution of photosynthetic organelles. However, owing to the paucity of nuclear genome sequence data, the extent of endosymbiotic gene transfer (EGT) and host symbiont regulation are currently unknown. A combination of 454 and Illumina next generation sequencing enabled us to generate a comprehensive reference transcriptome data set for P. chromatophora on which we mapped short Illumina cDNA reads generated from cultures from the dark and light phases of a diel cycle. Combined with extensive phylogenetic analyses of the deduced protein sequences, these data revealed that 1) about 0.3-0.8% of the nuclear genes were obtained by EGT compared with 11-14% in the Plantae, 2) transferred genes show a distinct bias in that many encode small proteins involved in photosynthesis and photoacclimation, 3) host cells established control over expression of transferred genes, and 4) not only EGT, but to a minor extent also horizontal gene transfer from organisms that presumably served as food sources, helped to shape the nuclear genome of P. chromatophora. The identification of a significant number of transferred genes involved in photosynthesis and photoacclimation of thylakoid membranes as well as the observed transcriptional regulation of these genes strongly implies import of the encoded gene products into chromatophores, a feature previously thought to be restricted to canonical organelles. Thus, a possible mechanism by which P. chromatophora exerts control over the performance of its newly acquired photosynthetic organelle may involve controlling the expression of nuclear-encoded chromatophore

  5. Retinoic acid receptors and GATA transcription factors activate the transcription of the human lecithin:retinol acyltransferase gene

    PubMed Central

    Cai, Kun; Gudas, Lorraine J.

    2008-01-01

    Lecithin retinol acyltransferase (LRAT) catalyzes the esterification of retinol (vitamin A). Retinyl esters and LRAT protein levels are reduced in many types of cancer cells. We present data that both the LRAT and retinoic acid receptor β2 (RARβ2) mRNA levels in the human prostate cancer cell line PC-3 are lower than those in cultured normal human prostate epithelial cells (PrEC). The activity of the human LRAT promoter (2.0 kb) driving a luciferase reporter gene in PC-3 cells is less than 40% of that in PrEC cells. Retinoic acid (RA) treatment increased this LRAT promoter-luciferase activity in PrEC cells, but not in PC-3 cells. Deletion of various regions of the human LRAT promoter demonstrated that a 172-bp proximal promoter region is essential for LRAT transcription and confers RA responsiveness in PrEC cells. This 172-bp region, contained within the 186 bp pLRAT/luciferase construct, has five putative GATA binding sites. Co-transfection of RARβ2 or RARγ and the transcription factor GATA-4 increased LRAT (pLRAT186) promoter activity in both PrEC and PC-3 cells. In addition, we found that both retinoic acid and retinol induced transcripts for the STRA6 gene, which encodes a membrane receptor involved in retinol (vitamin A) uptake, in PrEC cells but not in PC-3 cells. In summary, our data show that the transcriptional regulation of the human LRAT gene is aberrant in human prostate cancer cells and that GATA transcription factors are involved in the transcriptional activation of LRAT in PrEC cells. PMID:18652909

  6. Negative elongation factor NELF controls transcription of immediate early genes in a stimulus-specific manner

    SciTech Connect

    Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner

    2009-01-15

    The transcription rate of immediate early genes (IEGs) is controlled directly by transcription elongation factors at the transcription elongation step. Negative elongation factor (NELF) and 5,6-dichloro-1-{beta}-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) stall RNA polymerase II (pol II) soon after transcription initiation. Upon induction of IEG transcription, DSIF is converted into an accelerator for pol II elongation. To address whether and how NELF as well as DSIF controls overall IEG transcription, its expression was reduced using stable RNA interference in GH4C1 cells. NELF knock-down reduced thyrotropin-releasing hormone (TRH)-induced transcription of the IEGs c-fos, MKP-1, and junB. In contrast, epidermal growth factor (EGF)-induced transcription of these IEGs was unaltered or even slightly increased by NELF knock-down. Thus, stable knock-down of NELF affects IEG transcription stimulation-specifically. Conversely, DSIF knock-down reduced both TRH- and EGF-induced transcription of the three IEGs. Interestingly, TRH-induced activation of the MAP kinase pathway, a pathway essential for transcription of the three IEGs, was down-regulated by NELF knock-down. Thus, stable knock-down of NELF, by modulating intracellular signaling pathways, caused stimulation-specific loss of IEG transcription. These observations indicate that NELF controls overall IEG transcription via multiple mechanisms both directly and indirectly.

  7. Transcription variants of SLA-7, a swine non classical MHC class I gene.

    PubMed

    Hu, Rui; Lemonnier, Gaëtan; Bourneuf, Emmanuelle; Vincent-Naulleau, Silvia; Rogel-Gaillard, Claire

    2011-06-03

    In pig, very little information is available on the non classical class I (Ib) genes of the Major Histocompatibility Complex (MHC) i.e. SLA-6, -7 and -8. Our aim was to focus on the transcription pattern of the SLA-7 gene. RT-PCR experiments were carried out with SLA-7 specific primers targeting either the full coding sequence (CDS) from exon 1 to the 3 prime untranslated region (3UTR) or a partial CDS from exon 4 to the 3UTR. We show that the SLA-7 gene expresses a full length transcript not yet identified that refines annotation of the gene with eight exons instead of seven as initially described from the existing RefSeq RNA. These two RNAs encode molecules that differ in cytoplasmic tail length. In this study, another SLA-7 transcript variant was characterized, which encodes a protein with a shorter alpha 3 domain, as a consequence of a splicing site within exon 4. Surprisingly, a cryptic non canonical GA-AG splicing site is used to generate this transcript variant. An additional SLA-7 variant was also identified in the 3UTR with a splicing site occurring 31 nucleotides downstream to the stop codon. In conclusion, the pig SLA-7 MHC class Ib gene presents a complex transcription pattern with two transcripts encoding various molecules and transcripts that do not alter the CDS and may be subject to post-transcriptional regulation.

  8. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  9. Translation of Two Nested Genes in Bacteriophage P4 Controls Immunity-Specific Transcription Termination

    PubMed Central

    Forti, Francesca; Polo, Simona; Lane, Kirk B.; Six, Erich W.; Sironi, Gianpiero; Dehò, Gianni; Ghisotti, Daniela

    1999-01-01

    In phage P4, transcription of the left operon may occur from both the constitutive PLE promoter and the regulated PLL promoter, about 400 nucleotides upstream of PLE. A strong Rho-dependent termination site, timm, is located downstream of both promoters. When P4 immunity is expressed, transcription starting at PLE is efficiently terminated at timm, whereas transcription from PLL is immunity insensitive and reads through timm. We report the identification of two nested genes, kil and eta, located in the P4 left operon. The P4 kil gene, which encodes a 65-amino-acid polypeptide, is the first translated gene downstream of the PLE promoter, and its expression is controlled by P4 immunity. Overexpression of kil causes cell killing. This gene is the terminal part of a longer open reading frame, eta, which begins upstream of PLE. The eta gene is expressed when transcription starts from the PLL promoter. Three likely start codons predict a size between 197 and 199 amino acids for the Eta gene product. Both kil and eta overlap the timm site. By cloning kil upstream of a tRNA reporter gene, we demonstrated that translation of the kil region prevents premature transcription termination at timm. This suggests that P4 immunity might negatively control kil translation, thus enabling transcription termination at timm. Transcription starting from PLL proceeds through timm. Mutations that create nonsense codons in eta caused premature termination of transcription starting from PLL. Suppression of the nonsense mutation restored transcription readthrough at timm. Thus, termination of transcription from PLL is prevented by translation of eta. PMID:10464191

  10. Intracompartmental and Intercompartmental Transcriptional Networks Coordinate the Expression of Genes for Organellar Functions1[W

    PubMed Central

    Leister, Dario; Wang, Xi; Haberer, Georg; Mayer, Klaus F.X.; Kleine, Tatjana

    2011-01-01

    Genes for mitochondrial and chloroplast proteins are distributed between the nuclear and organellar genomes. Organelle biogenesis and metabolism, therefore, require appropriate coordination of gene expression in the different compartments to ensure efficient synthesis of essential multiprotein complexes of mixed genetic origin. Whereas organelle-to-nucleus signaling influences nuclear gene expression at the transcriptional level, organellar gene expression (OGE) is thought to be primarily regulated posttranscriptionally. Here, we show that intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions. Nearly 1,300 ATH1 microarray-based transcriptional profiles of nuclear and organellar genes for mitochondrial and chloroplast proteins in the model plant Arabidopsis (Arabidopsis thaliana) were analyzed. The activity of genes involved in organellar energy production (OEP) or OGE in each of the organelles and in the nucleus is highly coordinated. Intracompartmental networks that link the OEP and OGE gene sets serve to synchronize the expression of nucleus- and organelle-encoded proteins. At a higher regulatory level, coexpression of organellar and nuclear OEP/OGE genes typically modulates chloroplast functions but affects mitochondria only when chloroplast functions are perturbed. Under conditions that induce energy shortage, the intercompartmental coregulation of photosynthesis genes can even override intracompartmental networks. We conclude that dynamic intracompartmental and intercompartmental transcriptional networks for OEP and OGE genes adjust the activity of organelles in response to the cellular energy state and environmental stresses, and we identify candidate cis-elements involved in the transcriptional coregulation of nuclear genes. Regarding the transcriptional regulation of chloroplast genes, novel tentative target genes of σ factors are identified. PMID:21775496

  11. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.

    1992-01-01

    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  12. RNAi-directed post transcriptional gene silencing of an Arabidopsis Myb transgene in tobacco

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The AtMyb90 gene encodes the 'production of anthocyanin pigment 2' (PAP2) transcription factor of Arabidopsis thaliana and is able to induce a visible hyper-pigmented phenotype when expressed in tobacco. Based upon this phenotype, we have used the AtMyb90 gene as a reporter gene to examine RNAi-dire...

  13. Identification of a Novel Reference Gene for Apple Transcriptional Profiling under Postharvest Conditions

    PubMed Central

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference—ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)—along with two novel candidates—HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest. PMID:25774904

  14. Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

    PubMed

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

  15. Prostaglandin synthesis genes are differentially transcripted in normal and pyometra endometria of bitches.

    PubMed

    Silva, E; Leitão, S; Ferreira-Dias, G; Lopes da Costa, L; Mateus, L

    2009-07-01

    Pro-inflammatory stimuli, such as endotoxins released by Gram-negative bacteria, are potent stimulators of prostaglandin (PG) synthesis. The aim of this study was to evaluate the gene transcription pattern of PG synthesis enzymes in normal (anestrous, n = 6 and diestrous, n = 8) and pyometra (n = 7) endometria of bitches. Uteri were collected during routine ovariohysterectomy, processed for histopathological evaluation and uterine contents cultured. Gene transcription of COX-1, COX-2, mPGES-1 and PGF-synthase (PGFS) were evaluated by relative real-time PCR and normalized with the ribosomal protein L27 (RPL27) housekeeping gene. Normal uteri had no histological abnormalities and were negative for bacteriology. All pyometra uteri were hyperplasic and Escherichia coli was the only isolated bacterium. Except for COX-1, gene transcription was significantly higher in pyometra than in normal endometria. No significant differences in gene transcription were observed between normal diestrous and anestrous endometria. COX-2 gene transcription was 19 and 69 times higher in pyometra than in diestrous and anestrous endometria (p < 0.001), while PGFS gene transcription had a 3- and 600-fold increase in pyometra endometria compared to normal diestrous and anestrous endometria (p < 0.001). Gene transcription of mPGES-1 was 9 times higher in pyometra than in normal uteri (p < 0.01). Based on these results, we suggest that pyometra-associated E. coli endotoxin release stimulates the up-regulation of COX-2 PGFS and mPGES-1 gene transcription in the endometrium. PMID:19754568

  16. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.

    1995-01-01

    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  17. Identifying Stress Transcription Factors Using Gene Expression and TF-Gene Association Data.

    PubMed

    Wu, Wei-Sheng; Chen, Bor-Sen

    2009-11-24

    Unicellular organisms such as yeasts have evolved to survive environmental stresses by rapidly reorganizing the genomic expression program to meet the challenges of harsh environments. The complex adaptation mechanisms to stress remain to be elucidated. In this study, we developed Stress Transcription Factor Identification Algorithm (STFIA), which integrates gene expression and TF-gene association data to identify the stress transcription factors (TFs) of six kinds of stresses. We identified some general stress TFs that are in response to various stresses, and some specific stress TFs that are in response to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs may be sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the adaptation mechanisms to different stresses may have a bow-tie structure. Second, there may exist extensive regulatory cross-talk among different stress responses. In conclusion, this study proposes a network of the regulators of stress responses and their mechanism of action.

  18. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  19. Post-transcriptional regulation of ribosomal protein genes during serum starvation in Entamoeba histolytica.

    PubMed

    Ahamad, Jamaluddin; Ojha, Sandeep; Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha

    2015-06-01

    Ribosome synthesis involves all three RNA polymerases which are co-ordinately regulated to produce equimolar amounts of rRNAs and ribosomal proteins (RPs). Unlike model organisms where transcription of rRNA and RP genes slows down during stress, in E. histolytica rDNA transcription continues but pre-rRNA processing slows down and unprocessed pre-rRNA accumulates during serum starvation. To investigate the regulation of RP genes under stress we measured transcription of six selected RP genes from the small- and large-ribosomal subunits (RPS6, RPS3, RPS19, RPL5, RPL26, RPL30) representing the early-, mid-, and late-stages of ribosomal assembly. Transcripts of these genes persisted in growth-stressed cells. Expression of luciferase reporter under the control of two RP genes (RPS19 and RPL30) was studied during serum starvation and upon serum replenishment. Although luciferase transcript levels remained unchanged during starvation, luciferase activity steadily declined to 7.8% and 15% of control cells, respectively. After serum replenishment the activity increased to normal levels, suggesting post-transcriptional regulation of these genes. Mutations in the sequence -2 to -9 upstream of AUG in the RPL30 gene resulted in the phenotype expected of post-transcriptional regulation. Transcription of luciferase reporter was unaffected in this mutant, and luciferase activity did not decline during serum starvation, showing that this sequence is required to repress translation of RPL30 mRNA, and mutations in this region relieve repression. Our data show that during serum starvation E. histolytica blocks ribosome biogenesis post-transcriptionally by inhibiting pre-rRNA processing on the one hand, and the translation of RP mRNAs on the other.

  20. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    PubMed

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery.

  1. VITELLOGENIN GENE TRANSCRIPTION AS AN INDICATOR OF EXPOSURE TO 17-ALPHA-ETHYNYLESTRADIOL IN FATHEAD MINNOWS

    EPA Science Inventory

    Environmentally persistent chemicals that functionally mimic estrogen are ubiquitous in surface waters and have been shown to effect reproductive health of species living in these habitats. Toxicant induced transcription of specific genes is a sensitive indicator of exposure and ...

  2. Acetylation of RNA Polymerase II Regulates Growth-Factor-Induced Gene Transcription in Mammalian Cells

    PubMed Central

    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A.; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S.; Capra, John A.; Schnölzer, Martina; Cole, Philip A.; Geyer, Matthias; Bruneau, Benoit G.; Adelman, Karen; Ott, Melanie

    2014-01-01

    SUMMARY Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes. PMID:24207025

  3. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    PubMed

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. PMID:27181059

  4. Increased Transcript Complexity in Genes Associated with Chronic Obstructive Pulmonary Disease.

    PubMed

    Lackey, Lela; McArthur, Evonne; Laederach, Alain

    2015-01-01

    Genome-wide association studies aim to correlate genotype with phenotype. Many common diseases including Type II diabetes, Alzheimer's, Parkinson's and Chronic Obstructive Pulmonary Disease (COPD) are complex genetic traits with hundreds of different loci that are associated with varied disease risk. Identifying common features in the genes associated with each disease remains a challenge. Furthermore, the role of post-transcriptional regulation, and in particular alternative splicing, is still poorly understood in most multigenic diseases. We therefore compiled comprehensive lists of genes associated with Type II diabetes, Alzheimer's, Parkinson's and COPD in an attempt to identify common features of their corresponding mRNA transcripts within each gene set. The SERPINA1 gene is a well-recognized genetic risk factor of COPD and it produces 11 transcript variants, which is exceptional for a human gene. This led us to hypothesize that other genes associated with COPD, and complex disorders in general, are highly transcriptionally diverse. We found that COPD-associated genes have a statistically significant enrichment in transcript complexity stemming from a disproportionately high level of alternative splicing, however, Type II Diabetes, Alzheimer's and Parkinson's disease genes were not significantly enriched. We also identified a subset of transcriptionally complex COPD-associated genes (~40%) that are differentially expressed between mild, moderate and severe COPD. Although the genes associated with other lung diseases are not extensively documented, we found preliminary data that idiopathic pulmonary disease genes, but not cystic fibrosis modulators, are also more transcriptionally complex. Interestingly, complex COPD transcripts are more often the product of alternative acceptor site usage. To verify the biological importance of these alternative transcripts, we used RNA-sequencing analyses to determine that COPD-associated genes are frequently expressed in

  5. The Transcription Factor Ultraspiracle Influences Honey Bee Social Behavior and Behavior-Related Gene Expression

    PubMed Central

    Chen, Chieh-Chun; Blatti, Charles A.; Hong, Feng; Liang, Zhengzheng S.; Negre, Nicolas; White, Kevin P.; Rodriguez-Zas, Sandra L.; Mizzen, Craig A.; Sinha, Saurabh; Zhong, Sheng; Robinson, Gene E.

    2012-01-01

    Behavior is among the most dynamic animal phenotypes, modulated by a variety of internal and external stimuli. Behavioral differences are associated with large-scale changes in gene expression, but little is known about how these changes are regulated. Here we show how a transcription factor (TF), ultraspiracle (usp; the insect homolog of the Retinoid X Receptor), working in complex transcriptional networks, can regulate behavioral plasticity and associated changes in gene expression. We first show that RNAi knockdown of USP in honey bee abdominal fat bodies delayed the transition from working in the hive (primarily “nursing” brood) to foraging outside. We then demonstrate through transcriptomics experiments that USP induced many maturation-related transcriptional changes in the fat bodies by mediating transcriptional responses to juvenile hormone. These maturation-related transcriptional responses to USP occurred without changes in USP's genomic binding sites, as revealed by ChIP–chip. Instead, behaviorally related gene expression is likely determined by combinatorial interactions between USP and other TFs whose cis-regulatory motifs were enriched at USP's binding sites. Many modules of JH– and maturation-related genes were co-regulated in both the fat body and brain, predicting that usp and cofactors influence shared transcriptional networks in both of these maturation-related tissues. Our findings demonstrate how “single gene effects” on behavioral plasticity can involve complex transcriptional networks, in both brain and peripheral tissues. PMID:22479195

  6. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    PubMed Central

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  7. Diurnal Transcriptional Regulation of Endosymbiotically Derived Genes in the Chlorarachniophyte Bigelowiella natans.

    PubMed

    Suzuki, Shigekatsu; Ishida, Ken-Ichiro; Hirakawa, Yoshihisa

    2016-01-01

    Chlorarachniophyte algae possess complex plastids acquired by the secondary endosymbiosis of a green alga, and the plastids harbor a relict nucleus of the endosymbiont, the so-called nucleomorph. Due to massive gene transfer from the endosymbiont to the host, many proteins involved in plastid and nucleomorph are encoded by the nuclear genome. Genome sequences have provided a blueprint for the fate of endosymbiotically derived genes; however, transcriptional regulation of these genes remains poorly understood. To gain insight into the evolution of endosymbiotic genes, we performed genome-wide transcript profiling along the cell cycle of the chlorarachniophyte Bigelowiella natans, synchronized by light and dark cycles. Our comparative analyses demonstrated that transcript levels of 7,751 nuclear genes (35.7% of 21,706 genes) significantly oscillated along the diurnal/cell cycles, and those included 780 and 147 genes for putative plastid and nucleomorph-targeted proteins, respectively. Clustering analysis of those genes revealed the existence of transcriptional networks related to specific biological processes such as photosynthesis, carbon metabolism, translation, and DNA replication. Interestingly, transcripts of many plastid-targeted proteins in B. natans were induced before dawn, unlike other photosynthetic organisms. In contrast to nuclear genes, 99% nucleomorph genes were found to be constitutively expressed during the cycles. We also found that the nucleomorph DNA replication would be controlled by a nucleus-encoded viral-like DNA polymerase. The results of this study suggest that nucleomorph genes have lost transcriptional regulation along the diurnal cycles, and nuclear genes exert control over the complex plastid including the nucleomorph. PMID:27503292

  8. Network analysis of microRNAs, transcription factors, target genes and host genes in nasopharyngeal carcinoma

    PubMed Central

    WANG, HAO; XU, ZHIWEN; MA, MENGYAO; WANG, NING; WANG, KUNHAO

    2016-01-01

    Numerous studies on the morbidity of nasopharyngeal carcinoma (NPC) have identified several genes, microRNAs (miRNAs or miRs) and transcription factors (TFs) that influence the pathogenesis of NPC. However, summarizing all the regulatory networks involved in NPC is challenging. In the present study, the genes, miRNAs and TFs involved in NPC were considered as the nodes of the so-called regulatory network, and the associations between them were investigated. To clearly represent these associations, three regulatory networks were built seperately, namely, the differentially expressed network, the associated network and the global network. The differentially expressed network is the most important one of these three networks, since its nodes are differentially expressed genes whose mutations may lead to the development of NPC. Therefore, by modifying the aberrant expression of those genes that are differentially expressed in this network, their dysregulation may be corrected and the tumorigenesis of NPC may thus be prevented. Analysis of the aforementioned three networks highlighted the importance of certain pathways, such as self-adaptation pathways, in the development of NPC. For example, cyclin D1 (CCND1) was observed to regulate Homo sapiens-miR-20a, which in turn targeted CCND1. The present study conducted a systematic analysis of the pathogenesis of NPC through the three aforementioned regulatory networks, and provided a theoretical model for biologists. Future studies are required to evaluate the influence of the highlighted pathways in NPC. PMID:27313701

  9. A Synthetic Transcriptional Activator of Genes Associated with the Retina in Human Dermal Fibroblasts.

    PubMed

    Syed, Junetha; Chandran, Anandhakumar; Pandian, Ganesh N; Taniguchi, Junichi; Sato, Shinsuke; Hashiya, Kaori; Kashiwazaki, Gengo; Bando, Toshikazu; Sugiyama, Hiroshi

    2015-07-01

    Small molecules capable of modulating epigenetic signatures can activate the transcription of tissue-restricted genes in a totally unrelated cell type and have potential use in epigenetic therapy. To provide an example for an initial approach, we report here on one synthetic small-molecule compound-termed "SAHA-PIP X"-from our library of conjugates. This compound triggered histone acetylation accompanied by the transcription of retinal-tissue-related genes in human dermal fibroblasts (HDFs).

  10. Honey dilution impact on in vitro wound healing: Normoxic and hypoxic condition.

    PubMed

    Chaudhary, Amrita; Bag, Swarnendu; Barui, Ananya; Banerjee, Provas; Chatterjee, Jyotirmoy

    2015-01-01

    Honey is known as a popular healing agent against tropical infections and wounds. However, the effects of honey dilutions on keratinocyte (HaCaT) wound healing under hypoxic condition is still not explored. In this study, we examined whether honey dilution have wound healing potential under hypoxic stress. The antioxidant potential and healing efficacy of honey dilution on in vitro wound of human epidermal keratinocyte (HaCaT cells) under hypoxia (3% O2 ), and normoxia is explored by nitro blue tetrazolium assay. The cell survival % quantified by MTT assay to select four honey dilutions like 10, 1, 0.1, and 0.01 v/v% and the changes in cellular function was observed microscopically. Further, the cell proliferation, migration, cell-cell adhesion, and relevant gene expression were studied by flow cytometry, migration/scratch assay, immunocytochemistry, and reverse transcription-polymerase chain reaction, respectively. The expression pattern of cardinal molecular features viz. E-cadherin, cytoskeletal protein F-actin, p63, and hypoxia marker Hif 1α were examined. Honey dilution in 0.1% v/v combat wound healing limitations in vitro under normoxia and hypoxia (3%). Its wound healing potential was quantified by immunocytochemistry and real-time PCR for the associated molecular features that were responsible for cell proliferation and migration. Our data showed that honey dilution can be effective in hypoxic wound healing. Additionally, it reduced superoxide generation and supplied favorable bioambience for cell proliferation, migration, and differentiation during hypoxic wound healing. These findings may reveal the importance of honey as an alternative and cost effective therapeutic natural product for wound healing in hypoxic condition.

  11. Transcription termination between polo and snap, two closely spaced tandem genes of D. melanogaster.

    PubMed

    Henriques, Telmo; Ji, Zhe; Tan-Wong, Sue Mei; Carmo, Alexandre M; Tian, Bin; Proudfoot, Nicholas J; Moreira, Alexandra

    2012-01-01

    Transcription termination of RNA polymerase II between closely spaced genes is an important, though poorly understood, mechanism. This is true, in particular, in the Drosophila genome, where approximately 52% of tandem genes are separated by less than 1 kb. We show that a set of Drosophila tandem genes has a negative correlation of gene expression and display several molecular marks indicative of promoter pausing. We find that an intergenic spacing of 168 bp is sufficient for efficient transcription termination between the polo-snap tandem gene pair, by a mechanism that is independent of Pcf11 and Xrn2. In contrast, analysis of a tandem gene pair containing a longer intergenic region reveals that termination occurs farther downstream of the poly(A) signal and is, in this case, dependent on Pcf11 and Xrn2. For polo-snap, displacement of poised polymerase from the snap promoter by depletion of the initiation factor TFIIB results in an increase of polo transcriptional read-through. This suggests that poised polymerase is necessary for transcription termination. Interestingly, we observe that polo forms a TFIIB dependent gene loop between its promoter and terminator regions. Furthermore, in a plasmid containing the polo-snap locus, deletion of the polo promoter causes an increase in snap expression, as does deletion of polo poly(A) signals. Taken together, our results indicate that polo forms a gene loop and polo transcription termination occurs by an Xrn2 and Pcf11 independent mechanism that requires TFIIB.

  12. Clustered Transcription Factor Genes Regulate Nicotine Biosynthesis in Tobacco[W][OA

    PubMed Central

    Shoji, Tsubasa; Kajikawa, Masataka; Hashimoto, Takashi

    2010-01-01

    Tobacco (Nicotiana tabacum) synthesizes nicotine and related pyridine alkaloids in the root, and their synthesis increases upon herbivory on the leaf via a jasmonate-mediated signaling cascade. Regulatory NIC loci that positively regulate nicotine biosynthesis have been genetically identified, and their mutant alleles have been used to breed low-nicotine tobacco varieties. Here, we report that the NIC2 locus, originally called locus B, comprises clustered transcription factor genes of an ethylene response factor (ERF) subfamily; in the nic2 mutant, at least seven ERF genes are deleted altogether. Overexpression, suppression, and dominant repression experiments using transgenic tobacco roots showed both functional redundancy and divergence among the NIC2-locus ERF genes. These transcription factors recognized a GCC-box element in the promoter of a nicotine pathway gene and specifically activated all known structural genes in the pathway. The NIC2-locus ERF genes are expressed in the root and upregulated by jasmonate with kinetics that are distinct among the members. Thus, gene duplication events generated a cluster of highly homologous transcription factor genes with transcriptional and functional diversity. The NIC2-locus ERFs are close homologs of ORCA3, a jasmonate-responsive transcriptional activator of indole alkaloid biosynthesis in Catharanthus roseus, indicating that the NIC2/ORCA3 ERF subfamily was recruited independently to regulate jasmonate-inducible secondary metabolism in distinct plant lineages. PMID:20959558

  13. Transcription factor NF-Y is a functional regulator of the transcription of core clock gene Bmal1.

    PubMed

    Xiao, Jun; Zhou, Yongchun; Lai, Hao; Lei, Shi; Chi, Lisa H; Mo, Xianwei

    2013-11-01

    The circadian clock enables organisms to adjust to daily environmental changes and synchronize multiple molecular, biochemical, physiological, and behavioral processes accordingly. In mammalian clock work, Bmal1 is the most important core clock gene, which works with another core clock gene Clock to drive the expression of other clock genes and clock-controlled genes. However, the regulation of Bmal1 has not been fully understood. This work was aimed at identifying the positive regulator(s) of Bmal1 transcription. A series of 5' deletion reporter constructs was generated, and binding site mutations of mouse Bmal1 promoter fragments were cloned into pGL3-basic and pGL3(R2.1)-basic plasmids and transfected into NIH 3T3 cells. Luciferase activity was either measured 48 h after transfection or recorded for 4 days after serum shock. DNA affinity precipitation assay was used to detect the transcription factors binding to Bmal1 promoter. Small interfering RNA against nuclear factor Y, subunit A (NF-YA) and dominant negative NF-YA were employed to study the role of NF-Y in Bmal1 transcription regulation. Deletion and mutation analyses identified two clusters of CCAAT/GC-boxes at the proximal region of Bmal1 promoter as the activating cis-elements. Bmal1 promoter activity was up-regulated by NF-Y and/or Sp1 and repressed by dominant negative NF-YA or siRNA against NF-YA. The activation of Bmal1 promoter activity by NF-Y and Sp1 was inhibited by Rev-Erbα. DNA affinity precipitation assay showed that NF-Y and Sp1 bound to the two CCAAT/GC clusters of Bmal1 promoter. These results indicate that NF-Y is a functional activator of Bmal1 transcription and it cooperates with Sp1 and Rev-Erbα to generate the daily cycle of Bmal1 expression.

  14. Phage vectors that allow monitoring of transcription of secondary metabolism genes in Streptomyces.

    PubMed

    Bruton, C J; Guthrie, E P; Chater, K F

    1991-07-01

    We describe a bacteriophage phi C31-based system that permits the transcriptional fusion of the convenient reporter gene xylE to chromosomally located promoters in Streptomyces hosts. Applicability of the system to genes for secondary metabolism is demonstrated in an experiment showing that transcription of genes for actinorhodin production in Streptomyces coelicolor A3(2) depends on a transfer RNA gene (bldA) for the rare UUA codon. Two other phi C31::xylE vectors are described that allow detection of promoter activity away from their natural location, either at single copy in a prophage or during lytic infections in plaques.

  15. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli.

    PubMed

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  16. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    SciTech Connect

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  17. Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

    PubMed Central

    Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

    2016-01-01

    The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

  18. Genome-wide identification and characterization of reference genes with different transcript abundances for Streptomyces coelicolor

    PubMed Central

    Li, Shanshan; Wang, Weishan; Li, Xiao; Fan, Keqiang; Yang, Keqian

    2015-01-01

    The lack of reliable reference genes (RGs) in the genus Streptomyces hampers effort to obtain the precise data of transcript levels. To address this issue, we aimed to identify reliable RGs in the model organism Streptomyces coelicolor. A pool of potential RGs containing 1,471 genes was first identified by determining the intersection of genes with stable transcript levels from four time-series transcriptome microarray datasets of S. coelicolor M145 cultivated in different conditions. Then, following a strict rational selection scheme including homology analysis, disturbance analysis, function analysis and transcript abundance analysis, 13 candidates were selected from the 1,471 genes. Based on real-time quantitative reverse transcription PCR assays, SCO0710, SCO6185, SCO1544, SCO3183 and SCO4758 were identified as the top five genes with the most stable transcript levels among the 13 candidates. Further analyses showed these five genes also maintained stable transcript levels in different S. coelicolor strains, as well as in Streptomyces avermitilis MA-4680 and Streptomyces clavuligerus NRRL 3585, suggesting they could fulfill the requirements of accurate data normalization in streptomycetes. Moreover, the systematic strategy employed in this work could be used for reference in other microorganism to select reliable RGs. PMID:26527303

  19. Validation of Reference Genes for Transcriptional Analyses in Pleurotus ostreatus by Using Reverse Transcription-Quantitative PCR.

    PubMed

    Castanera, Raúl; López-Varas, Leticia; Pisabarro, Antonio G; Ramírez, Lucía

    2015-06-15

    Recently, the lignin-degrading basidiomycete Pleurotus ostreatus has become a widely used model organism for fungal genomic and transcriptomic analyses. The increasing interest in this species has led to an increasing number of studies analyzing the transcriptional regulation of multigene families that encode extracellular enzymes. Reverse transcription (RT) followed by real-time PCR is the most suitable technique for analyzing the expression of gene sets under multiple culture conditions. In this work, we tested the suitability of 13 candidate genes for their use as reference genes in P. ostreatus time course cultures for enzyme production. We applied three different statistical algorithms and obtained a combination of stable reference genes for optimal normalization of RT-quantitative PCR assays. This reference index can be used for future transcriptomic analyses and validation of transcriptome sequencing or microarray data. Moreover, we analyzed the expression patterns of a laccase and a manganese peroxidase (lacc10 and mnp3, respectively) in lignocellulose and glucose-based media using submerged, semisolid, and solid-state fermentation. By testing different normalization strategies, we demonstrate that the use of nonvalidated reference genes as internal controls leads to biased results and misinterpretations of the biological responses underlying expression changes. PMID:25862220

  20. Transcription factor C/EBPβ promotes the transcription of the porcine GPR120 gene.

    PubMed

    Chen, Kun; Zhou, Ji-Dan; Zhang, Feng; Zhang, Fang; Zhang, Rui-Rui; Zhan, Meng-Si; Tang, Xiao-Yin; Deng, Bing; Lei, Ming-Gang; Xiong, Yuan-Zhu

    2016-02-01

    G protein-coupled receptor 120 (GPR120), an adipogenic receptor critical for the differentiation and maturation of adipocytes, plays an important role in controlling obesity in both humans and rodents and, thus, is an attractive target of obesity treatment studies. However, the mechanisms that regulate the expression of porcine GPR120 remain unclear. In this study, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) techniques were used to analyze and identify the binding of C/EBPβ (transcription factor CCAAT/enhancer binding protein beta) to the GPR120 promoter. C/EBPβ overexpression and RNA interference studies showed that C/EBPβ regulated GPR120 promoter activity and endogenous GPR120 expression. The binding site of C/EBPβ in the GPR120 promoter region from -101 to -87 was identified by promoter deletion analysis and site-directed mutagenesis. Overexpression of C/EBPβ increased endogenous GPR120 expression in pig kidney cells (PK). Furthermore, when endogenous C/EBPβ was knocked down, GPR120 mRNA and protein levels were decreased. The stimulatory effect of C/EBPβ on GPR120 transcription and its ability to bind the transcription factor-binding site were confirmed by luciferase, ChIP, and EMSA. Moreover, the mRNA and protein expression levels of C/EBPβ were induced by high fat diet feeding. Taken together, it can be concluded that C/EBPβ plays a vital role in regulating GPR120 transcription and suggests HFD-feeding induces GPR120 transcription by influencing C/EBPβ expression.

  1. Transcriptional profiling of CcpE-regulated genes in Staphylococcus aureus.

    PubMed

    Li, Han; Ding, Yue; Lan, Lefu

    2015-09-01

    The transcriptional regulator CcpE is an important citrate-sensing regulator that modulates metabolic state, virulence factor expression, and bacterial virulence of Staphylococcus aureus (Ding et al., 2014 [1]). In this article, we report detailed methods for genome-wide transcriptional profiling of CcpE-regulated genes generated for the research article "Metabolic sensor governing bacterial virulence in Staphylococcus aureus" (Ding et al., 2014 [1]). All transcriptional profiling data was deposited to Gene Expression Omnibus (GEO) database under accession number GSE57260. PMID:26484245

  2. Pleiohomeotic Interacts with the Core Transcription Elongation Factor Spt5 to Regulate Gene Expression in Drosophila

    PubMed Central

    Jennings, Barbara H.

    2013-01-01

    The early elongation checkpoint regulated by Positive Transcription Elongation Factor b (P-TEFb) is a critical control point for the expression of many genes. Spt5 interacts directly with RNA polymerase II and has an essential role in establishing this checkpoint, and also for further transcript elongation. Here we demonstrate that Drosophila Spt5 interacts both physically and genetically with the Polycomb Group (PcG) protein Pleiohomeotic (Pho), and the majority of Pho binding sites overlap with Spt5 binding sites across the genome in S2 cells. Our results indicate that Pho can interact with Spt5 to regulate transcription elongation in a gene specific manner. PMID:23894613

  3. The Role of Transcription Factors at Antisense-Expressing Gene Pairs in Yeast

    PubMed Central

    Mostovoy, Yulia; Thiemicke, Alexander; Hsu, Tiffany Y.; Brem, Rachel B.

    2016-01-01

    Genes encoded close to one another on the chromosome are often coexpressed, by a mechanism and regulatory logic that remain poorly understood. We surveyed the yeast genome for tandem gene pairs oriented tail-to-head at which expression antisense to the upstream gene was conserved across species. The intergenic region at most such tandem pairs is a bidirectional promoter, shared by the downstream gene mRNA and the upstream antisense transcript. Genomic analyses of these intergenic loci revealed distinctive patterns of transcription factor regulation. Mutation of a given transcription factor verified its role as a regulator in trans of tandem gene pair loci, including the proximally initiating upstream antisense transcript and downstream mRNA and the distally initiating upstream mRNA. To investigate cis-regulatory activity at such a locus, we focused on the stress-induced NAD(P)H dehydratase YKL151C and its downstream neighbor, the metabolic enzyme GPM1. Previous work has implicated the region between these genes in regulation of GPM1 expression; our mutation experiments established its function in rich medium as a repressor in cis of the distally initiating YKL151C sense RNA, and an activator of the proximally initiating YKL151C antisense RNA. Wild-type expression of all three transcripts required the transcription factor Gcr2. Thus, at this locus, the intergenic region serves as a focal point of regulatory input, driving antisense expression and mediating the coordinated regulation of YKL151C and GPM1. Together, our findings implicate transcription factors in the joint control of neighboring genes specialized to opposing conditions and the antisense transcripts expressed between them. PMID:27190003

  4. Towards a Quantitative Understanding of Single-Gene Transcription

    NASA Astrophysics Data System (ADS)

    O'Maoiléidigh, Dáibhid

    2008-03-01

    The transcription of the genetic information in DNA into RNA is the first step in protein synthesis. This process is highly regulated and is carried out by RNA polymerase (RNAP), a complex molecular motor. Here we discuss some of the consequences of a Brownian ratchet model of transcription, which incorporates internal structural degrees of freedom of RNAP and kinetic barriers to backtracking of RNAP resulting from steric clashes with co-transcriptionally folded RNA. This approach was previously used (a) to successfully predict sequence dependent positions of pauses during the elongation process [1,2]; (b) to study the behavior of a number of mutants of RNAP, with different elongation behaviors, believed to involve different internal motions of the enzyme [3]; and (c) to gain insight into the interpretation of single-molecule transcription elongation experiments [2]. The same model can be used to characterize the stability of the elongation complex at specific termination sequences, places along DNA where, with high probability, RNAP releases the RNA transcript and disengages from the template. Recent experimental results on termination reinforce a picture of the elongation complex as a flexible structure, not a rigid body [4]. In more general terms, some of the modeling to be presented raises fundamental issues related to ``model comparison'' and ``model selection,'' the problem of identifying and characterizing quantitative models on the basis of limited sets of experimental data [5]. [1] Tadigotla V. R., 'O Maoil'eidigh D., Sengupta A. M., Epshtein V., Ebright R. H., Nudler E., Ruckenstein A. E., Thermodynamic and Kinetic Modeling of Transcriptional Pausing. Proc Natl Acad Sci U S A,03:4439-4444 (2006). [2] D. 'O Maoil'eidigh, Ph.D. Thesis, Rutgers University, 2006 [3] Bar-Nahum, G., Epshtein, V., Ruckenstein, A. E., Rafikov, R., Mustaev, A. and Nudler E., A Ratchet Mechanism of Transcription Elongation and its Control. Cell, 120:183-193 (2005). [4] Epshtein, V

  5. Operator Sequence Alters Gene Expression Independently of Transcription Factor Occupancy in Bacteria

    PubMed Central

    Garcia, Hernan G.; Sanchez, Alvaro; Boedicker, James Q.; Osborne, Melisa; Gelles, Jeff; Kondev, Jane; Phillips, Rob

    2012-01-01

    SUMMARY A canonical quantitative view of transcriptional regulation holds that the only role of operator sequence is to set the probability of transcription factor binding, with operator occupancy determining the level of gene expression. In this work, we test this idea by characterizing repression in vivo and the binding of RNA polymerase in vitro in experiments where operators of various sequences were placed either upstream or downstream from the promoter in Escherichia coli. Surprisingly, we find that operators with a weaker binding affinity can yield higher repression levels than stronger operators. Repressor bound to upstream operators modulates promoter escape, and the magnitude of this modulation is not correlated with the repressor-operator binding affinity. This suggests that operator sequences may modulate transcription by altering the nature of the interaction of the bound transcription factor with the transcriptional machinery, implying a new layer of sequence dependence that must be confronted in the quantitative understanding of gene expression. PMID:22840405

  6. Three Genes Are Required for trans-Activation of Ty Transcription in Yeast

    PubMed Central

    Winston, Fred; Dollard, Catherine; Malone, Elizabeth A.; Clare, Jeffrey; Kapakos, James G.; Farabaugh, Philip; Minehart, Patricia L.

    1987-01-01

    Mutations in the SPT3 gene were isolated as one class of suppressors of Ty and solo δ insertion mutations in Saccharomyces cerevisiae. Previous work has shown that null mutations in SPT3 abolish the normal Ty δ-δ transcript; instead, a transcript that initiates 800 bases farther downstream is made, suggesting that SPT3 is required for transcription initiation in δ sequences. We have selected for new spt mutations and have screened for those with the unique suppression pattern of spt3 mutations with respect to two insertion mutations. Our selection and screen has identified two additional genes, SPT7 and SPT8, that are also required for transcription initiation in δ sequences. We show that mutations in SPT7 or SPT8 result in the same alteration of Ty transcription as do mutations in SPT3. In addition, mutations in all three genes cause a sporulation defect. By assay of a Ty-lacZ fusion we have shown that spt3, spt7 and spt8 mutations reduce transcription from a δ sequence by 10–25-fold. Finally, we show that SPT3 mRNA levels are unaffected in either spt7 or spt8 mutants, suggesting that these two genes do not regulate transcription of SPT3. PMID:3034719

  7. Promoter-like sequences regulating transcriptional activity in neurexin and neuroligin genes.

    PubMed

    Runkel, Fabian; Rohlmann, Astrid; Reissner, Carsten; Brand, Stefan-Martin; Missler, Markus

    2013-10-01

    Synapse function requires the cell-adhesion molecules neurexins (Nrxn) and neuroligins (Nlgn). Although these molecules are essential for neurotransmission and prefer distinct isoform combinations for interaction, little is known about their transcriptional regulation. Here, we started to explore this important aspect because expression of Nrxn1-3 and Nlgn1-3 genes is altered in mice lacking the transcriptional regulator methyl-CpG-binding protein2 (MeCP2). Since MeCP2 can bind to methylated CpG-dinucleotides and Nrxn/Nlgn contain CpG-islands, we tested genomic sequences for transcriptional activity in reporter gene assays. We found that their influence on transcription are differentially activating or inhibiting. As we observed an activity difference between heterologous and neuronal cell lines for distinct Nrxn1 and Nlgn2 sequences, we dissected their putative promoter regions. In both genes, we identify regions in exon1 that can induce transcription, in addition to the alternative transcriptional start points in exon2. While the 5'-regions of Nrxn1 and Nlgn2 contain two CpG-rich elements that show distinct methylation frequency and binding to MeCP2, other regions may act independently of this transcriptional regulator. These data provide first insights into regulatory sequences of Nrxn and Nlgn genes that may represent an important aspect of their function at synapses in health and disease.

  8. Transcription Profile of Aging and Cognition-Related Genes in the Medial Prefrontal Cortex

    PubMed Central

    Ianov, Lara; Rani, Asha; Beas, Blanca S.; Kumar, Ashok; Foster, Thomas C.

    2016-01-01

    Cognitive function depends on transcription; however, there is little information linking altered gene expression to impaired prefrontal cortex function during aging. Young and aged F344 rats were characterized on attentional set shift and spatial memory tasks. Transcriptional differences associated with age and cognition were examined using RNA sequencing to construct transcriptomic profiles for the medial prefrontal cortex (mPFC), white matter, and region CA1 of the hippocampus. The results indicate regional differences in vulnerability to aging. Age-related gene expression in the mPFC was similar to, though less robust than, changes in the dorsolateral PFC of aging humans suggesting that aging processes may be similar. Importantly, the pattern of transcription associated with aging did not predict cognitive decline. Rather, increased mPFC expression of genes involved in regulation of transcription, including transcription factors that regulate the strength of excitatory and inhibitory inputs, and neural activity-related immediate-early genes was observed in aged animals that exhibit delayed set shift behavior. The specificity of impairment on a mPFC-dependent task, associated with a particular mPFC transcriptional profile indicates that impaired executive function involves altered transcriptional regulation and neural activity/plasticity processes that are distinct from that described for impaired hippocampal function. PMID:27242522

  9. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  10. Extracellular Matrix-Regulated Gene Expression RequiresCooperation of SWI/SNF and Transcription Factors

    SciTech Connect

    Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.

    2006-05-25

    Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.

  11. FoxO1 Deacetylation Regulates Thyroid Hormone-induced Transcription of Key Hepatic Gluconeogenic Genes*

    PubMed Central

    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael

    2013-01-01

    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD+-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ−/−) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status. PMID:23995837

  12. Temporal and Spatial Coexistence of Archaeal and Bacterial amoA Genes and Gene Transcripts in Lake Lucerne

    PubMed Central

    Vissers, Elisabeth W.; Anselmetti, Flavio S.; Bodelier, Paul L. E.; Muyzer, Gerard; Schleper, Christa; Tourna, Maria; Laanbroek, Hendrikus J.

    2013-01-01

    Despite their crucial role in the nitrogen cycle, freshwater ecosystems are relatively rarely studied for active ammonia oxidizers (AO). This study of Lake Lucerne determined the abundance of both amoA genes and gene transcripts of ammonia-oxidizing archaea (AOA) and bacteria (AOB) over a period of 16 months, shedding more light on the role of both AO in a deep, alpine lake environment. At the surface, at 42 m water depth, and in the water layer immediately above the sediment, AOA generally outnumbered AOB. However, in the surface water during summer stratification, when both AO were low in abundance, AOB were more numerous than AOA. Temporal distribution patterns of AOA and AOB were comparable. Higher abundances of amoA gene transcripts were observed at the onset and end of summer stratification. In summer, archaeal amoA genes and transcripts correlated negatively with temperature and conductivity. Concentrations of ammonium and oxygen did not vary enough to explain the amoA gene and transcript dynamics. The observed herbivorous zooplankton may have caused a hidden flux of mineralized ammonium and a change in abundance of genes and transcripts. At the surface, AO might have been repressed during summer stratification due to nutrient limitation caused by active phytoplankton. PMID:23533328

  13. Structures of Mycobacterium tuberculosis DosR and DosR-DNA Complex Involved in Gene Activation during Adaptation to Hypoxic Latency

    SciTech Connect

    Wisedchaisri, Goragot; Wu, Meiting; Rice, Adrian E; Roberts, David M; Sherman, David R; Hol, Wim G.J.

    2010-07-20

    On encountering low oxygen conditions, DosR activates the transcription of 47 genes, promoting long-term survival of Mycobacterium tuberculosis in a non-replicating state. Here, we report the crystal structures of the DosR C-terminal domain and its complex with a consensus DNA sequence of the hypoxia-induced gene promoter. The DosR C-terminal domain contains four {alpha}-helices and forms tetramers consisting of two dimers with non-intersecting dyads. In the DNA-bound structure, each DosR C-terminal domain in a dimer places its DNA-binding helix deep into the major groove, causing two bends in the DNA. DosR makes numerous protein-DNA base contacts using only three amino acid residues per subunit: Lys179, Lys182, and Asn183. The DosR tetramer is unique among response regulators with known structures.

  14. Joint immobilization induced hypoxic and inflammatory conditions in rat knee joints.

    PubMed

    Yabe, Yutaka; Hagiwara, Yoshihiro; Suda, Hideaki; Ando, Akira; Onoda, Yoshito; Tsuchiya, Masahiro; Hatori, Kouki; Itoi, Eiji

    2013-01-01

    The purpose of this study was to examine the hypoxic and inflammatory conditions after immobilization in the joint capsule of rat knees. The unilateral knee joints of adult male rats were immobilized with an internal fixator (Im group) for 1 day, 3 days, and 1, 2, 4, 8, and 16 weeks. Sham-operated animals had holes drilled in the femur and tibia and screws inserted without a plate (control group). The number of cells and blood vessels in the capsule were histologically examined. The hypoxic condition in the capsule was histologically examined with a Hypoxyprobe™-1. The gene expressions related to the hypoxic (hypoxia inducible factor-1α, vascular endothelial growth factor, and fibroblast growth factor 2) and inflammatory conditions [interleukin-6 (IL-6), IL-1α, IL-1β, tumor necrosis factor-α, and tumor necrosis factor-β] were evaluated by quantitative reverse transcription polymerase chain reaction. The number of cells was unchanged at 1 day in the two groups; however, the number significantly increased at 3 days in the Im group. The number of blood vessels in the Im group gradually decreased. Strong immunostaining of Hypoxyprobe™-1 around the blood vessels was observed in the Im group. The gene expressions of hypoxia inducible factor-1α and fibroblast growth factor 2 were significantly higher in the Im group compared with those in the control group. The gene expressions of IL-6, IL-1α, IL-1β, and tumor necrosis factor-β were significantly higher in the Im group compared with those in the control group. These data indicated that joint immobilization induced hypoxic and inflammatory conditions in the joint capsule, which might be an initiating factor for joint contracture.

  15. Genome-wide modulation of gene transcription in ovarian carcinoma cells by a new mithramycin analogue.

    PubMed

    Vizcaíno, Carolina; Núñez, Luz-Elena; Morís, Francisco; Portugal, José

    2014-01-01

    Ovarian cancer has a poor prognosis due to intrinsic or acquired resistance to some cytotoxic drugs, raising the interest in new DNA-binding agents such as mithramycin analogues as potential chemotherapeutic agents in gynecological cancer. Using a genome-wide approach, we have analyzed gene expression in A2780 human ovarian carcinoma cells treated with the novel mithramycin analogue DIG-MSK (demycarosyl-3D-β-D-digitoxosyl-mithramycin SK) that binds to C+G-rich DNA sequences. Nanomolar concentrations of DIG-MSK abrogated the expression of genes involved in a variety of cell processes including transcription regulation and tumor development, which resulted in cell death. Some of those genes have been associated with cell proliferation and poor prognosis in ovarian cancer. Sp1 transcription factor regulated most of the genes that were down-regulated by the drug, as well as the up-regulation of other genes mainly involved in response to cell stress. The effect of DIG-MSK in the control of gene expression by other transcription factors was also explored. Some of them, such as CREB, E2F and EGR1, also recognize C/G-rich regions in gene promoters, which encompass potential DIG-MSK binding sites. DIG-MSK affected several biological processes and molecular functions related to transcription and its cellular regulation in A2780 cells, including transcription factor activity. This new compound might be a promising drug for the treatment of ovarian cancer.

  16. Regulation of the human LAT gene by the Elf-1 transcription factor

    PubMed Central

    Finco, Timothy S; Justice-Healy, Geri E; Patel, Shivani J; Hamilton, Victoria E

    2006-01-01

    Background The LAT gene encodes an intracellular adaptor protein that links cell-surface receptor engagement to numerous downstream signalling events, and thereby plays an integral role in the function of cell types that express the gene, including T cells, mast cells, natural killer cells, and platelets. To date, the mechanisms responsible for the transcriptional regulation of this gene have not been investigated. Results In this study we have mapped the transcriptional start sites for the human LAT gene and localized the 5' and 3' boundaries of the proximal promoter. We find that the promoter contains both positive and negative regulatory regions, and that two binding sites for the Ets family of transcription factors have a strong, positive effect on gene expression. Each site binds the Ets family member Elf-1, and overexpression of Elf-1 augments LAT promoter activity. The promoter also contains a Runx binding site adjacent to one of the Ets sites. This site, which is shown to bind Runx-1, has an inhibitory effect on gene expression. Finally, data is also presented indicating that the identified promoter may regulate cell-type specific expression. Conclusion Collectively, these results provide the first insights into the transcriptional regulation of the LAT gene, including the discovery that the Ets transcription factor Elf-1 may play a central role in its expression. PMID:16464244

  17. Exploring the transcription factor activity in high-throughput gene expression data using RLQ analysis

    PubMed Central

    2013-01-01

    Background Interpretation of gene expression microarray data in the light of external information on both columns and rows (experimental variables and gene annotations) facilitates the extraction of pertinent information hidden in these complex data. Biologists classically interpret genes of interest after retrieving functional information from a subset of genes of interest. Transcription factors play an important role in orchestrating the regulation of gene expression. Their activity can be deduced by examining the presence of putative transcription factors binding sites in the gene promoter regions. Results In this paper we present the multivariate statistical method RLQ which aims to analyze microarray data where additional information is available on both genes and samples. As an illustrative example, we applied RLQ methodology to analyze transcription factor activity associated with the time-course effect of steroids on the growth of primary human lung fibroblasts. RLQ could successfully predict transcription factor activity, and could integrate various other sources of external information in the main frame of the analysis. The approach was validated by means of alternative statistical methods and biological validation. Conclusions RLQ provides an efficient way of extracting and visualizing structures present in a gene expression dataset by directly modeling the link between experimental variables and gene annotations. PMID:23742070

  18. Transcriptional Analysis of a Unique Set of Genes Involved in Schistosoma mansoni Female Reproductive Biology

    PubMed Central

    Cogswell, Alexis A.; Kommer, Valerie P.; Williams, David L.

    2012-01-01

    Schistosomiasis affects more than 200 million people globally. The pathology of schistosome infections is due to chronic tissue inflammation and damage from immune generated granulomas surrounding parasite eggs trapped in host tissues. Schistosoma species are unique among trematode parasites because they are dioecious; females require paring with male parasites in order to attain reproductive maturity and produce viable eggs. Ex vivo cultured females lose the ability to produce viable eggs due to an involution of the vitellarium and loss of mature oocytes. In order to better understand schistosome reproductive biology we used data generated by serial analysis of gene expression (SAGE) to identify uncharacterized genes which have different transcript abundance in mature females, those that have been paired with males, and immature females obtained from unisexual infections. To characterize these genes we used bioinformatics, transcript localization, and transcriptional analysis during the regression of in vitro cultured females. Genes transcribed exclusively in mature females localize primarily in the vitellocytes and/or the ovary. Genes transcribed exclusively in females from single sex infections localize to vitellocytes and subtegumental cells. As female reproductive tissues regress, eggshell precursor proteins and genes involved in eggshell synthesis largely have decreased transcript abundance. However, some genes with elevated transcript abundance in mature adults have increased gene expression following regression indicating that the genes in this study function both in eggshell biology as well as vitellogenesis and maintenance of female reproductive tissues. In addition, we found that genes enriched in females from single sex infections have increased expression during regression in ex vivo females. By using these transcriptional analyses we can direct research to examine the areas of female biology that are both relevant to understanding the overall process

  19. What's that gene (or protein)? Online resources for exploring functions of genes, transcripts, and proteins

    PubMed Central

    Hutchins, James R. A.

    2014-01-01

    The genomic era has enabled research projects that use approaches including genome-scale screens, microarray analysis, next-generation sequencing, and mass spectrometry–based proteomics to discover genes and proteins involved in biological processes. Such methods generate data sets of gene, transcript, or protein hits that researchers wish to explore to understand their properties and functions and thus their possible roles in biological systems of interest. Recent years have seen a profusion of Internet-based resources to aid this process. This review takes the viewpoint of the curious biologist wishing to explore the properties of protein-coding genes and their products, identified using genome-based technologies. Ten key questions are asked about each hit, addressing functions, phenotypes, expression, evolutionary conservation, disease association, protein structure, interactors, posttranslational modifications, and inhibitors. Answers are provided by presenting the latest publicly available resources, together with methods for hit-specific and data set–wide information retrieval, suited to any genome-based analytical technique and experimental species. The utility of these resources is demonstrated for 20 factors regulating cell proliferation. Results obtained using some of these are discussed in more depth using the p53 tumor suppressor as an example. This flexible and universally applicable approach for characterizing experimental hits helps researchers to maximize the potential of their projects for biological discovery. PMID:24723265

  20. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    PubMed

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  1. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts.

    PubMed

    Pandian, Ganesh N; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D; Sugiyama, Hiroshi

    2014-01-24

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation.

  2. Bypassing the Requirements for Epigenetic Modifications in Gene Transcription by Increasing Enhancer Strength▿

    PubMed Central

    Koutroubas, George; Merika, Menie; Thanos, Dimitris

    2008-01-01

    Our current concept postulates that histone acetylation is required for the recruitment of bromodomain-containing transcription complexes, such as the chromatin-remodeling machine SWI/SNF and the basal transcription factor TFIID. We generated simple NF-κB-dependent enhancers of increasing transcriptional strengths and found that the histone acetylation requirements for activation of transcription depended on the strengths of these enhancers. All enhancers function by recruiting SWI/SNF and TFIID to induce nucleosome sliding, a prerequisite for transcriptional activation. However, histone acetylation, although it occurs, is dispensable for TFIID and SWI/SNF recruitment by the strong enhancers, indicating that strong activators can overcome the chromatin barrier by directly recruiting the necessary transcriptional complexes. Weak enhancers depend on histone acetylation for recruitment, and this requirement is independent of a histone acetylation code. Thus, the need for nucleosome modifications is imposed on genes and translated according to the quality and strengths of the activators. PMID:18025106

  3. Encoding four gene expression programs in the activation dynamics of a single transcription factor.

    PubMed

    Hansen, Anders S; O'Shea, Erin K

    2016-04-01

    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  4. Possible role of lysophosphatidic acid in rat model of hypoxic pulmonary vascular remodeling

    PubMed Central

    2014-01-01

    Abstract Pulmonary hypertension is characterized by cellular and structural changes in the vascular wall of pulmonary arteries. We hypothesized that lysophosphatidic acid (LPA), a bioactive lipid, is implicated in this vascular remodeling in a rat model of hypoxic pulmonary hypertension. Exposure of Wistar rats to 10% O2 for 3 weeks induced an increase in the mean serum levels of LPA, to 40.9 (log-detransformed standard deviations: 23.4–71.7) μM versus 21.6 (11.0–42.3) μM in a matched control animal group (P = 0.037). We also observed perivascular LPA immunohistochemical staining in lungs of hypoxic rats colocalized with the secreted lysophospholipase D autotaxin (ATX). Moreover, ATX colocalized with mast cell tryptase, suggesting implication of these cells in perivascular LPA production. Hypoxic rat lungs expressed more ATX transcripts (2.4-fold) and more transcripts of proteins implicated in cell migration: β2 integrin (1.74-fold), intracellular adhesion molecule 1 (ICAM-1; 1.84-fold), and αM integrin (2.70-fold). Serum from the hypoxic group of animals had significantly higher chemoattractant properties toward rat primary lung fibroblasts, and this increase in cell migration could be prevented by the LPA receptor 1 and 3 antagonists. LPA also increased adhesive properties of human pulmonary artery endothelial cells as well as those of human peripheral blood mononuclear cells, via the activation of LPA receptor 1 or 3 followed by the stimulation of gene expression of ICAM-1, β-1, E-selectin, and vascular cell adhesion molecule integrins. In conclusion, chronic hypoxia increases circulating and tissue levels of LPA, which might induce fibroblast migration and recruitment of mononuclear cells in pulmonary vasculature, both of which contribute to pulmonary vascular remodeling. PMID:25621161

  5. Scaling of Gene Expression with Transcription-Factor Fugacity

    PubMed Central

    Weinert, Franz M.; Brewster, Robert C.; Rydenfelt, Mattias; Phillips, Rob; Kegel, Willem K.

    2015-01-01

    The proteins associated with gene regulation are often shared between multiple pathways simultaneously. By way of contrast, models in regulatory biology often assume these pathways act independently. We demonstrate a framework for calculating the change in gene expression for the interacting case by decoupling repressor occupancy across the cell from the gene of interest by way of a chemical potential. The details of the interacting regulatory architecture are encompassed in an effective concentration, and thus, a single scaling function describes a collection of gene expression data from diverse regulatory situations and collapses it onto a single master curve. PMID:25554908

  6. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.

    1986-08-01

    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  7. Genomic organization and promoter analysis of a transcriptional repressor gene from Fenneropenaeus chinensis.

    PubMed

    Lai, Xiaofang; Shen, Shanrui; Gao, Huan; Yan, Binlun

    2015-02-01

    In this study, we cloned and sequenced genomic sequences from a Fenneropenaeus chinensis transcriptional repressor gene, FcTR. The FcTR gene is 2,671 bp in length and has four exons and three introns. The 873 bp promoter contains several transcription factor binding sites, including a TATA box and a cyclic AMP-responsive element. Promoter deletion analysis using a luciferase reporter gene identified regulatory elements. Challenge with white spot syndrome virus increased expression from the promoter-deletion constructs. These results suggest that FcTR might play an important role in the shrimp immune response.

  8. Genetic effects of an air discharge plasma on Staphylococcus aureus at the gene transcription level

    NASA Astrophysics Data System (ADS)

    Xu, Zimu; Wei, Jun; Shen, Jie; Liu, Yuan; Ma, Ronghua; Zhang, Zelong; Qian, Shulou; Ma, Jie; Lan, Yan; Zhang, Hao; Zhao, Ying; Xia, Weidong; Sun, Qiang; Cheng, Cheng; Chu, Paul K.

    2015-05-01

    The dynamics of gene expression regulation (at transcription level) in Staphylococcus aureus after different doses of atmospheric-pressure room-temperature air plasma treatments are investigated by monitoring the quantitative real-time polymerase chain reaction. The plasma treatment influences the transcription of genes which are associated with several important bio-molecular processes related to the environmental stress resistance of the bacteria, including oxidative stress response, biofilm formation, antibiotics resistance, and DNA damage protection/repair. The reactive species generated by the plasma discharge in the gas phase and/or induced in the liquid phase may account for these gene expression changes.

  9. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.

    2003-01-01

    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  10. Ethylene and pollination decrease transcript abundance of an ethylene receptor gene in Dendrobium petals.

    PubMed

    Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G

    2015-03-15

    We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects.

  11. DNA methylation, riboswitches, and transcription factor activity: fundamental mechanisms of gene-nutrient interactions involving vitamins.

    PubMed

    Huang, Janet; Vieira, Amandio

    2006-12-01

    Nutrient-gene interactions occur with a variety of nutrients including some minerals, vitamins, polyunsaturated fatty acids and other lipids. Fundamental molecular mechanisms that underlie many of the effects of nutrients on gene expression are presented herein. Two of the mechanisms described influence gene transcription: DNA methylation and transcription factor activation. Another mechanism, riboswitching, can regulate gene expression at different levels, for example, at the mRNA translation level. The first two mechanisms are widely distributed across animal phyla. Riboswitches are documented primarily in more primitive organisms, but may prove to be of wider relevance. Riboswitches are known for several vitamins; those involving thiamine are presented here. The role of folates and retinoids in DNA methylation and transcriptional factor (nuclear retinoid receptor) activities, respectively, is presented in the context of cell proliferation and differentiation, and related physiological or pathological effects during embryogenesis and cancer.

  12. Role of Sam68 in post-transcriptional gene regulation.

    PubMed

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-11-28

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation.

  13. Role of Sam68 in Post-Transcriptional Gene Regulation

    PubMed Central

    Sánchez-Jiménez, Flora; Sánchez-Margalet, Víctor

    2013-01-01

    The STAR family of proteins links signaling pathways to various aspects of post-transcriptional regulation and processing of RNAs. Sam68 belongs to this class of heteronuclear ribonucleoprotein particle K (hnRNP K) homology (KH) single domain-containing family of RNA-binding proteins that also contains some domains predicted to bind critical components in signal transduction pathways. In response to phosphorylation and other post-transcriptional modifications, Sam68 has been shown to have the ability to link signal transduction pathways to downstream effects regulating RNA metabolism, including transcription, alternative splicing or RNA transport. In addition to its function as a docking protein in some signaling pathways, this prototypic STAR protein has been identified to have a nuclear localization and to take part in the formation of both nuclear and cytosolic multi-molecular complexes such as Sam68 nuclear bodies and stress granules. Coupling with other proteins and RNA targets, Sam68 may play a role in the regulation of differential expression and mRNA processing and translation according to internal and external signals, thus mediating important physiological functions, such as cell death, proliferation or cell differentiation. PMID:24287914

  14. In situ transcription and splicing in the Balbiani ring 3 gene

    PubMed Central

    Wetterberg, Ingela; Zhao, Jian; Masich, Sergej; Wieslander, Lars; Skoglund, Ulf

    2001-01-01

    The Balbiani ring 3 (BR3) gene contains 38 introns, and more than half of them are co-transcriptionally excised. We have determined the in situ structure of the active BR3 gene by electron tomography. Each of the 20–25 nascent transcripts on the gene is present together with splicing factors and the RNA polymerase II in a nascent transcript and splicing complex, here called the NTS complex. The results indicate that extensive changes in overall shape, substructure and molecular mass take place repeatedly within an NTS complex as it moves along the gene. The volume and calculated mass of the NTS complexes show that, maximally, one complete spliceosome is assembled on the multi-intron transcript at any given time point. The structural data show that the spliceosome is not a structurally well-defined unit in situ and that the C-terminal domain of the elongating RNA polymerase II cannot carry spliceosomal components for all introns in the BR3 transcript. Our data indicate that spliceosomal factors are continuously added to and released from the NTS complexes during transcription elongation. PMID:11350946

  15. Transcriptional profiling of hexaploid wheat (Triticum aestivum L.) roots identifies novel, dehydration-responsive genes.

    PubMed

    Mohammadi, Mohsen; Kav, Nat N V; Deyholos, Michael K

    2007-05-01

    We used a long-oligonucleotide microarray to identify transcripts that increased or decreased in abundance in roots of dehydration-tolerant hexaploid bread wheat, in response to withholding of water. We observed that the major classes of dehydration-responsive genes (e.g. osmoprotectants, compatible solutes, proteases, glycosyltransferases/hydrolases, signal transducers components, ion transporters) were generally similar to those observed previously in other species and osmotic stresses. More specifically, we highlighted increases in transcript expression for specific genes including those putatively related to the synthesis of asparagine, trehalose, oligopeptide transporters, metal-binding proteins, the gamma-aminobutyric acid (GABA) shunt and transcription factors. Conversely, we noted a decrease in transcript abundance for diverse classes of glutathione and sulphur-related enzymes, specific amino acids, as well as MATE-efflux carrier proteins. From these data, we identified a novel, dehydration-induced putative AP2/ERF transcription factor, which we predict to function as a transcriptional repressor. We also identified a dehydration-induced 'little protein' (LitP; predicted mass: 8 kDa) that is highly conserved across spermatophytes. Using qRT-PCR, we compared the expression patterns of selected genes between two related wheat genotypes that differed in their susceptibility to dehydration, and confirmed that these novel genes were highly inducible by water limitation in both genotypes, although the magnitude of induction differed.

  16. ZXDC, a novel zinc finger protein that binds CIITA and activates MHC gene transcription

    PubMed Central

    Al-Kandari, Wafa; Jambunathan, Srikarthika; Navalgund, Vandana; Koneni, Rupa; Freer, Margot; Parimi, Neeta; Mudhasani, Rajini; Fontes, Joseph D.

    2006-01-01

    The class II trans-activator (CIITA) is recognized as the master regulator of major histocompatibility complex (MHC) class II gene transcription and contributes to the transcription of MHC class I genes. To better understand the function of CIITA, we performed yeast two-hybrid with the C-terminal 807 amino acids of CIITA, and cloned a novel human cDNA named zinc finger, X-linked, duplicated family member C (ZXDC). The 858 amino acid ZXDC protein contains 10 zinc fingers and a transcriptional activation domain, and was found to interact with the region of CIITA containing leucine-rich repeats. Over-expression of ZXDC in human cell lines resulted in super-activation of MHC class I and class II promoters by CIITA. Conversely, silencing of ZXDC expression reduced the ability of CIITA to activate transcription of MHC class II genes. Given the specific interaction between the ZXDC and CIITA proteins, as well as the effect of ZXDC on MHC gene transcription, it appears that ZXDC is an important regulator of both MHC class I and class II transcription. PMID:16600381

  17. Transcription of interferon stimulated genes in response to Porcine rubulavirus infection in vitro

    PubMed Central

    Flores-Ocelotl, María del Rosario; Rosas-Murrieta, Nora Hilda; Vallejo-Ruiz, Verónica; Reyes-Leyva, Julio; Herrera-Camacho, Irma; Santos-López, Gerardo

    2011-01-01

    Porcine rubulavirus (PoRV) is an emerging virus causing meningo-encephalitis and reproductive failures in pigs. Little is known about the pathogenesis and immune evasion of this virus; therefore research on the mechanisms underlying tissue damage during infection is essential. To explore these mechanisms, the effect of PoRV on the transcription of interferon (IFN) pathway members was analyzed in vitro by semi-quantitative RT-PCR. Ten TCID50 of PoRV stimulated transcription of IFNα, IFNβ, STAT1, STAT2, p48 and OAS genes in neuroblastoma cells, whereas infection with 100 TCID50 did not stimulate transcription levels more than non-infected cells. When the cells were primed with IFNα, infection with 1 TCDI50 of PoRV sufficed to stimulate the transcription of the same genes, but 10 and 100 TCID50 did not modify the transcription level of those genes as compared with non-infected and primed controls. MxA gene transcription was observed only when the cells were primed with IFNα and stimulated with 10 TCID50, whereas 100 TCID50 of PoRV did not modify the MxA transcription level as compared to non-infected and primed cells. Our results show that PoRV replication at low titers stimulates the expression of IFN-responsive genes in neuroblastoma cells, and suggest that replication of PoRV at higher titers inhibits the transcription of several members of the IFN pathway. These findings may contribute to the understanding of the pathogenesis of PoRV. PMID:24031738

  18. Regulation of transcription of cell division genes in the Escherichia coli dcw cluster.

    PubMed

    Vicente, M; Gomez, M J; Ayala, J A

    1998-04-01

    The Escherichia coli dcw cluster contains cell division genes, such as the phylogenetically ubiquitous ftsZ, and genes involved in peptidoglycan synthesis. Transcription in the cluster proceeds in the same direction as the progress of the replication fork along the chromosome. Regulation is exerted at the transcriptional and post-transcriptional levels. The absence of transcriptional termination signals may, in principle, allow extension of the transcripts initiated at the up-stream promoter (mraZ1p) even to the furthest down-stream gene (envA). Complementation tests suggest that they extend into ftsW in the central part of the cluster. In addition, the cluster contains other promoters individually regulated by cis- and trans-acting signals. Dissociation of the expression of the ftsZ gene, located after ftsQ and A near the 3' end of the cluster, from its natural regulatory signals leads to an alteration in the physiology of cell division. The complexities observed in the regulation of gene expression in the cluster may then have an important biological role. Among them, LexA-binding SOS boxes have been found at the 5' end of the cluster, preceding promoters which direct the expression of ftsI (coding for PBP3, the penicillin-binding protein involved in septum formation). A gearbox promoter, ftsQ1p, forms part of the signals regulating the transcription of ftsQ, A and Z. It is an inversely growth-dependent mechanism driven by RNA polymerase containing sigma s, the factor involved in the expression of stationary phase-specific genes. Although the dcw cluster is conserved to a different extent in a variety of bacteria, the regulation of gene expression, the presence or absence of individual genes, and even the essentiality of some of them, show variations in the phylogenetic scale which may reflect adaptation to specific life cycles.

  19. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  20. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits

    PubMed Central

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-01-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. ‘Superficial scald’ of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress. PMID:26428066

  1. Ethylene negatively regulates transcript abundance of ROP-GAP rheostat-encoding genes and affects apoplastic reactive oxygen species homeostasis in epicarps of cold stored apple fruits.

    PubMed

    Zermiani, Monica; Zonin, Elisabetta; Nonis, Alberto; Begheldo, Maura; Ceccato, Luca; Vezzaro, Alice; Baldan, Barbara; Trentin, Annarita; Masi, Antonio; Pegoraro, Marco; Fadanelli, Livio; Teale, William; Palme, Klaus; Quintieri, Luigi; Ruperti, Benedetto

    2015-12-01

    Apple (Malus×domestica Borkh) fruits are stored for long periods of time at low temperatures (1 °C) leading to the occurrence of physiological disorders. 'Superficial scald' of Granny Smith apples, an economically important ethylene-dependent disorder, was used as a model to study relationships among ethylene action, the regulation of the ROP-GAP rheostat, and maintenance of H2O2 homeostasis in fruits during prolonged cold exposure. The ROP-GAP rheostat is a key module for adaptation to low oxygen in Arabidopsis through Respiratory Burst NADPH Oxidase Homologs (RBOH)-mediated and ROP GTPase-dependent regulation of reactive oxygen species (ROS) homeostasis. Here, it was shown that the transcriptional expression of several components of the apple ROP-GAP machinery, including genes encoding RBOHs, ROPs, and their ancillary proteins ROP-GEFs and ROP-GAPs, is coordinately and negatively regulated by ethylene in conjunction with the progressive impairment of apoplastic H2O2 homeostatic levels. RNA sequencing analyses showed that several components of the known ROP- and ROS-associated transcriptional networks are regulated along with the ROP-GAP rheostat in response to ethylene perception. These findings may extend the role of the ROP-GAP rheostat beyond hypoxic responses and suggest that it may be a functional regulatory node involved in the integration of ethylene and ROS signalling pathways in abiotic stress.

  2. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast.

    PubMed

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. (1)H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes.

  3. [Transcriptional analysis of the Grp gene, a genomic homolog of the retrotransposon gypsy gag gene, in Drosophila melanogaster].

    PubMed

    Nefedova, L N; Kuz'min, I V; Burmistrova, D A; Rezazadekh, S; Kim, A I

    2011-08-01

    In the present work, we studied the Grp gene (CG4680, Gag related protein) expression at the transcriptional level. It was found that at the embryonic and larval stages of D. melanogaster development the Grp expression proceeds at a low level, but it significantly increases at the adult stage. Adult individuals display a tissue-specific expression: an eleveated level of transcription is observed in the gut tissues, but not in the chitin carcass, head, and gonads. Since the gut may potentially be a primary barrier for the penetration of a viral infection, we conducted a comparative analysis of Grp gene transcription in D. melanogaster strains differing in the presence of active copies of the gypsy errantivirus and in the status of the flamenco gene controlling sensitivity to errantiviral infections. No noticeable differences in the level of Grp gene transcription were revealed. Thus, the Grp gene is not a pseudogene, but it is a functional gene of the D. melanogaster genome whose role remains to be elucidated.

  4. [Transcriptional analysis of the Grp gene, a genomic homolog of the retrotransposon gypsy gag gene, in Drosophila melanogaster].

    PubMed

    Nefedova, L N; Kuz'min, I V; Burmistrova, D A; Rezazadekh, S; Kim, A I

    2011-08-01

    In the present work, we studied the Grp gene (CG4680, Gag related protein) expression at the transcriptional level. It was found that at the embryonic and larval stages of D. melanogaster development the Grp expression proceeds at a low level, but it significantly increases at the adult stage. Adult individuals display a tissue-specific expression: an eleveated level of transcription is observed in the gut tissues, but not in the chitin carcass, head, and gonads. Since the gut may potentially be a primary barrier for the penetration of a viral infection, we conducted a comparative analysis of Grp gene transcription in D. melanogaster strains differing in the presence of active copies of the gypsy errantivirus and in the status of the flamenco gene controlling sensitivity to errantiviral infections. No noticeable differences in the level of Grp gene transcription were revealed. Thus, the Grp gene is not a pseudogene, but it is a functional gene of the D. melanogaster genome whose role remains to be elucidated. PMID:21954611

  5. Medusa structure of the gene regulatory network: dominance of transcription factors in cancer subtype classification.

    PubMed

    Guo, Yuchun; Feng, Ying; Trivedi, Niraj S; Huang, Sui

    2011-05-01

    Gene expression profiles consisting of ten thousands of transcripts are used for clustering of tissue, such as tumors, into subtypes, often without considering the underlying reason that the distinct patterns of expression arise because of constraints in the realization of gene expression profiles imposed by the gene regulatory network. The topology of this network has been suggested to consist of a regulatory core of genes represented most prominently by transcription factors (TFs) and microRNAs, that influence the expression of other genes, and of a periphery of 'enslaved' effector genes that are regulated but not regulating. This 'medusa' architecture implies that the core genes are much stronger determinants of the realized gene expression profiles. To test this hypothesis, we examined the clustering of gene expression profiles into known tumor types to quantitatively demonstrate that TFs, and even more pronounced, microRNAs, are much stronger discriminators of tumor type specific gene expression patterns than a same number of randomly selected or metabolic genes. These findings lend support to the hypothesis of a medusa architecture and of the canalizing nature of regulation by microRNAs. They also reveal the degree of freedom for the expression of peripheral genes that are less stringently associated with a tissue type specific global gene expression profile.

  6. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    PubMed Central

    Ha, Misook; Hong, Soondo

    2016-01-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac. PMID:27075878

  7. VIP gene transcription is regulated by far upstream enhancer and repressor elements.

    PubMed

    Liu, D; Krajniak, K; Chun, D; Sena, M; Casillas, R; Lelièvre, V; Nguyen, T; Bravo, D; Colburn, S; Waschek, J A

    2001-06-01

    SK-N-SH human neuroblastoma subclones differ widely in basal and second messenger induction of the gene encoding the neuropeptide vasoactive intestinal peptide (VIP). These differences were recapitulated by a chimeric gene which consisted of 5.2 kb of the human VIP gene 5' flanking sequence fused to a reporter. Subsequent gene deletion experiments revealed several regulatory regions on the gene, including a 645-bp sequence located approximately 4.0 upstream from the transcription start site. Here we examined this upstream region in detail. Inhibitory sequences were found to be present on each end of the 645-bp fragment. When removed, basal transcription increased more than 50-fold. Subsequent deletion/mutation analysis showed that the 213-bp fragment contained at least two enhancer elements. One of these was localized to an AT-rich 42-bp sequence shown by others to bind Oct proteins in neuroblastoma cells, while the other corresponded to a composite AP-1/ets element. In addition to these enhancers, a 28-bp sequence on the 213-bp fragment with no apparent homology to known silencers inhibited transcription. The studies provide molecular details of a complex regulatory region on the VIP gene that is likely to be used to finely tune the level of gene transcription in vivo.

  8. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    NASA Astrophysics Data System (ADS)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  9. Transcription of the procyclic acidic repetitive protein genes of Trypanosoma brucei.

    PubMed Central

    Clayton, C E; Fueri, J P; Itzhaki, J E; Bellofatto, V; Sherman, D R; Wisdom, G S; Vijayasarathy, S; Mowatt, M R

    1990-01-01

    The procyclic acidic repetitive protein (parp) genes of Trypanosoma brucei encode a small family of abundant surface proteins whose expression is restricted to the procyclic form of the parasite. They are found at two unlinked loci, parpA and parpB; transcription of both loci is developmentally regulated. The region of homology upstream of the A and B parp genes is only 640 base pairs long and may contain sequences responsible for transcriptional initiation and regulation. Transcription upstream of this putative promoter region is not developmentally regulated and is much less active than that of the parp genes; the polymerase responsible is inhibited by alpha-amanitin, whereas that transcribing the parp genes is not. Transcription of the parp genes is strongly stimulated by low levels of UV irradiation. The putative parp promoter, when placed upstream of the chloramphenicol acetyltransferase gene, is sufficient to cause production of chloramphenicol acetyltransferase in a T. brucei DNA transformation assay. Taken together, these results suggest that a promoter for an alpha-amanitin-resistant RNA polymerase lies less than 600 nucleotides upstream of the parp genes. Images PMID:2342468

  10. Global transcription network incorporating distal regulator binding reveals selective cooperation of cancer drivers and risk genes

    PubMed Central

    Kim, Kwoneel; Yang, Woojin; Lee, Kang Seon; Bang, Hyoeun; Jang, Kiwon; Kim, Sang Cheol; Yang, Jin Ok; Park, Seongjin; Park, Kiejung; Choi, Jung Kyoon

    2015-01-01

    Global network modeling of distal regulatory interactions is essential in understanding the overall architecture of gene expression programs. Here, we developed a Bayesian probabilistic model and computational method for global causal network construction with breast cancer as a model. Whereas physical regulator binding was well supported by gene expression causality in general, distal elements in intragenic regions or loci distant from the target gene exhibited particularly strong functional effects. Modeling the action of long-range enhancers was critical in recovering true biological interactions with increased coverage and specificity overall and unraveling regulatory complexity underlying tumor subclasses and drug responses in particular. Transcriptional cancer drivers and risk genes were discovered based on the network analysis of somatic and genetic cancer-related DNA variants. Notably, we observed that the risk genes were functionally downstream of the cancer drivers and were selectively susceptible to network perturbation by tumorigenic changes in their upstream drivers. Furthermore, cancer risk alleles tended to increase the susceptibility of the transcription of their associated genes. These findings suggest that transcriptional cancer drivers selectively induce a combinatorial misregulation of downstream risk genes, and that genetic risk factors, mostly residing in distal regulatory regions, increase transcriptional susceptibility to upstream cancer-driving somatic changes. PMID:26001967

  11. Transcriptional control of MHC class II gene expression during differentiation from B cells to plasma cells.

    PubMed

    Dellabona, P; Latron, F; Maffei, A; Scarpellino, L; Accolla, R S

    1989-04-15

    In this study we investigated the molecular mechanisms responsible for the extinction of the constitutive MHC class II gene expression of human B cells on somatic cell hybridization with murine plasmocytoma cells. We found that this event is due to trans-acting suppressor functions of mouse origin pre-existing in the plasmocytoma cells and acting at transcriptional level. Transcription of the entire family of human class II genes is suppressed, including genes as DO beta for which a distinct regulation of expression in B cells had been previously demonstrated. Suppression appears specific for class II genes because in the hybrids expression of MHC class I genes of mouse is unaffected and of human only partially reduced. Interestingly, also murine invariant chain gene is expressed in both parental plasmocytoma and hybrid cells although at reduced amounts as compared to a murine class II positive B cell line. The class II negative phenotype of hybrid cells and parental plasmocytoma cells is highly stable and unaffected by treatment with protein synthesis inhibitors, suggesting that the transcriptional suppressor function is not mediated by rapid, labile turning-over proteins. Possible mechanisms responsible for transcriptional regulation of MHC class II gene expression during terminal differentiation of B cells to plasma cells are discussed. PMID:2495328

  12. Transcriptional Analysis of the Conjugal Transfer Genes of Rickettsia bellii RML 369-C

    PubMed Central

    Heu, Chan C.; Kurtti, Timothy J.; Nelson, Curtis M.; Munderloh, Ulrike G.

    2015-01-01

    Rickettsia bellii is an obligate intracellular bacterium that is one of the few rickettsiae that encode a complete set of conjugative transfer (tra) genes involved in bacterial conjugation and has been shown to exhibit pili-like structures. The reductive genomes of rickettsiae beg the question whether the tra genes are nonfunctional or functioning to enhance the genetic plasticity and biology of rickettsiae. We characterized the transcriptional dynamics of R. bellii tra genes in comparison to genes transcribed stably and above the background level to understand when and at what levels the tra genes are active or whether the tra genes are degenerative. We determined that the best reference genes, out of 10 tested, were methionyl tRNA ligase (metG) or a combination of metG and ribonucleoside diphosphate reductase 2 subunit beta (nrdF), using statistical algorithms from two different programs: Normfinder and BestKeeper. To validate the use of metG with other rickettsial genes exhibiting variable transcriptional patterns we examined its use with sca2 and rickA, genes involved in actin based motility. Both were shown to be up-regulated at different times of replication in Vero cells, showing variable and stable transcription levels of rickA and sca2, respectively. traATi was up-regulated at 72 hours post inoculation in the tick cell line ISE6, but showed no apparent changes in the monkey cell line Vero and mouse cell line L929. The transcription of tra genes was positively correlated with one another and up-regulated from 12 to 72 hours post inoculation (HPI) when compared to RBE_0422 (an inactivated transposase-derivative found within the tra cluster). Thus, the up-regulation of the tra genes indicated that the integrity and activity of each gene were intact and may facilitate the search for the optimal conditions necessary to demonstrate conjugation in rickettsiae. PMID:26352829

  13. Transcription of Quorum-Sensing System Genes in Clinical and Environmental Isolates of Pseudomonas aeruginosa

    PubMed Central

    Cabrol, Ségolène; Olliver, Anne; Pier, Gerald B.; Andremont, Antoine; Ruimy, Raymond

    2003-01-01

    Quorum sensing (QS)-based transcriptional responses in Pseudomonas aeruginosa have been defined on the basis of increases in transcript levels of QS-controlled genes such as lasB and aprA following the hierarchical transcriptional increases of central controllers such as the lasR gene. These increases occur at high bacterial concentrations such as early-stationary-phase growth in vitro. However, the extent to which the increases occur in a variety of clinical and environmental isolates has not been determined nor is there extensive information on allelic variation in lasR genes. An analysis of the sequences of the lasR gene among 66 clinical and environmental isolates showed that 81% have a sequence either identical to that of strain PAO1 or with a silent mutation, 15% have nucleotide changes resulting in amino acid changes, and 5% have an insertion sequence in the lasR gene. Using real-time PCR to quantify transcript levels of lasR, lasB, and aprA in the early log and early stationary phases among 35 isolates from bacteremia and pneumonia cases and the environment, we found most (33 of 35) strains had increases in lasR transcripts in early stationary phase but with a very wide range of final transcript levels per cell. There was a strong correlation (r2 = 0.84) between early-log- and early-stationary-phase transcript levels in all strains, but this finding remained true only for the 50% of strains above the median level of lasR found in early log phase. There were significant (P < 0.05) but weak-to-modest correlations of lasR transcript levels with aprA (r2 = 0.2) and lasB (r2 = 0.5) transcript levels, but again this correlation occurred only in the 50% of P. aeruginosa strains with the highest levels of lasR transcripts in early stationary phase. There were no differences in distribution of lasR alleles among the bacteremia, pneumonia, or environmental isolates. Overall, only about 50% of P. aeruginosa strains from clinical and environmental sources show a las

  14. Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.

    PubMed Central

    Deretic, V; Gill, J F; Chakrabarty, A M

    1987-01-01

    Transcriptional regulation of alginate biosynthesis by Pseudomonas aeruginosa was studied. A DNA region complementing the alg-5 mutation within the alginate gene cluster was found by RNA-DNA dot blot and Northern hybridization to be transcriptionally activated in mucoid P. aeruginosa. This region was subcloned as a 3.2-kilobase BglII-ClaI DNA fragment on the broad-host-range controlled transcription vector pMMB24, and gene products were analyzed by expression from the tac promoter. A 48-kilodalton polypeptide was detected in extracts of P. aeruginosa and 35S-labeled Escherichia coli maxicells. By using the same expression system, GDPmannose dehydrogenase activity was detected in both P. aeruginosa and E. coli. Thus, gene algD coding for this enzyme was found to be present in the transcriptionally active DNA area. Insertion of the xylE gene within the BglII-ClaI fragment disrupted the induction of the 48-kilodalton polypeptide, GDPmannose dehydrogenase activity, and alg-5 complementing ability. With the algD-xylE transcription fusion, activation of algD gene expression was shown to occur in mucoid P. aeruginosa of different origins. In addition, regulation of the algD promoter activity was demonstrated to be mediated by a diffusible factor. Images PMID:3025179

  15. Gα13 regulates MEF2-dependent gene transcription in endothelial cells: role in angiogenesis

    PubMed Central

    Liu, Guoquan; Han, Jingyan; Profirovic, Jasmina; Strekalova, Elena; Voyno-Yasenetskaya, Tatyana A.

    2010-01-01

    The α subunit of heterotrimeric G13 protein is required for the embryonic angiogenesis (Offermanns et al., Science 275:533–536, 1997). However, the molecular mechanism of Gα13-dependent angiogenesis is not understood. Here, we show that myocyte-specific enhancer factor-2 (MEF2) mediates Gα13-dependent angiogenesis. Our data showed that constitutively activated Gα13Q226L stimulated MEF2-dependent gene transcription. In addition, downregulation of endogenous Gα13 inhibited thrombin-stimulated MEF2-dependent gene transcription in endothelial cells. Both Ca2+/calmodulin-dependent kinase IV (CaMKIV) and histone deacetylase 5 (HDAC5) were involved in Gα13-mediated MEF2-dependent gene transcription. Gα13Q226L also increased Ca2+/calmodulin-independent CaMKIV activity, while dominant negative mutant of CaMKIV inhibited MEF2-dependent gene transcription induced by Gα13Q226L. Furthermore, Gα13Q226L was able to derepress HDAC5-mediated repression of gene transcription and induce the translocation of HDAC5 from nucleus to cytoplasm. Finally, downregulation of endogenous Gα13 and MEF2 proteins in endothelial cells reduced cell proliferation and capillary tube formation. Decrease of endothelial cell proliferation that was caused by the Gα13 downregulation was partially restored by the constitutively active MEF2-VP16. Our studies suggest that MEF2 proteins are an important component in Gα13-mediated angiogenesis. PMID:19093215

  16. The mean first passage time and stochastic resonance in gene transcriptional system with time delay

    NASA Astrophysics Data System (ADS)

    Feng, Y. L.; Zhu, J.; Zhang, M.; Gao, L. L.; Liu, Y. F.; Dong, J. M.

    2016-04-01

    In this paper, the gene transcriptional dynamics driven by correlated noises are investigated, where the time delay for the synthesis of transcriptional factor is introduced. The effects of the noise correlation strength and time delay on the stationary probability distribution (SPD), the mean first passage time and the stochastic resonance (SR) are analyzed in detail based on the delay Fokker-Planck equation. It is found that both the time delay and noise correlation strength play important roles in the bistable transcriptional system. The effect of the correlation strength reduces but the time delay enhances the mean first passage time (MFPT). Finally, the SR for this gene transcriptional system is found to be enhanced by the time delay.

  17. Isolation of Arabidopsis nuclei and measurement of gene transcription rates using nuclear run-on assays.

    PubMed

    Folta, Kevin M; Kaufman, Lon S

    2006-01-01

    Isolation of transcriptionally active nuclei from plant tissues is a fundamental first step in many plant molecular biology protocols. Enriched nuclear fractions may be used in "run-on" assays to measure the rate of transcription for any given gene, adding additional resolution to assays of steady-state transcript accumulation such as RNA-gel blots, RT-PCR or microarrays. The protocols presented here streamline, adapt and optimize existing methods for use in Arabidopsis thaliana. Plant materials are ground in hexylene glycol-based buffers and highly enriched nuclear fractions are obtained using Percoll density gradients. Standard and small-scale protocols are presented, along with a tested method for nuclear run-on assays. The entire process may be completed within 3 days. This capability complements the immense body of steady-state transcript measurements and indirectly identifies instances where message turnover may have a critical and/or primary role in regulating gene expression levels.

  18. Genome Wide Binding Site Analysis Reveals Transcriptional Coactivation of Cytokinin-Responsive Genes by DELLA Proteins

    PubMed Central

    Marín-de la Rosa, Nora; Pfeiffer, Anne; Hill, Kristine; Locascio, Antonella; Bhalerao, Rishikesh P.; Miskolczi, Pal; Grønlund, Anne L.; Wanchoo-Kohli, Aakriti; Thomas, Stephen G.; Bennett, Malcolm J.; Lohmann, Jan U.; Blázquez, Miguel A.; Alabadí, David

    2015-01-01

    The ability of plants to provide a plastic response to environmental cues relies on the connectivity between signaling pathways. DELLA proteins act as hubs that relay environmental information to the multiple transcriptional circuits that control growth and development through physical interaction with transcription factors from different families. We have analyzed the presence of one DELLA protein at the Arabidopsis genome by chromatin immunoprecipitation coupled to large-scale sequencing and we find that it binds at the promoters of multiple genes. Enrichment analysis shows a strong preference for cis elements recognized by specific transcription factor families. In particular, we demonstrate that DELLA proteins are recruited by type-B ARABIDOPSIS RESPONSE REGULATORS (ARR) to the promoters of cytokinin-regulated genes, where they act as transcriptional co-activators. The biological relevance of this mechanism is underpinned by the necessity of simultaneous presence of DELLAs and ARRs to restrict root meristem growth and to promote photomorphogenesis. PMID:26134422

  19. Dependence of Enhancer-Mediated Transcription of the Immunoglobulin μ Gene on Nuclear Matrix Attachment Regions

    NASA Astrophysics Data System (ADS)

    Forrester, William C.; van Genderen, Courtney; Jenuwein, Thomas; Grosschedl, Rudolf

    1994-08-01

    Transcription of the immunoglobulin μ heavy chain locus is regulated by an intronic enhancer that is flanked on both sides by nuclear matrix attachment regions (MARs). These MARs have now been shown to be essential for transcription of a rearranged μ gene in transgenic B lymphocytes, but they were not required in stably transfected tissue culture cells. Normal rates of transcriptional initiation at a variable region promoter and the formation of an extended deoxyribonuclease I (DNase I)-sensitive chromatin domain were dependent on MARs, although DNase I hypersensitivity at the enhancer was detected in the absence of MARs. Thus, transcriptional activation of the μ gene during normal lymphoid development requires a synergistic collaboration between the enhancer and flanking MARs.

  20. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  1. Transcription control of ribulose bisphosphate carboxylase/oxygenase activase and adjacent genes in Anabaena species.

    PubMed Central

    Li, L A; Tabita, F R

    1994-01-01

    The gene encoding ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) activase (rca) was uniformly localized downstream from the genes encoding the large and small subunits of RubisCO (rbcL and rbcS) in three strains of Anabaena species. However, two open reading frames (ORF1 and ORF2), situated between rbcS and rca in Anabaena sp. strain CA, were not found in the intergenic region of Anabaena variabilis and Anabaena sp. strain PCC 7120. During autotrophic growth of Anabaena cells, rca and rbc transcripts accumulated in the light and diminished in the dark; light-dependent expression of these genes was not affected by the nitrogen source and the concentration of exogenous CO2 supplied to the cells. When grown on fructose, rca- and rbc-specific transcripts accumulated in A. variabilis regardless of whether the cells were illuminated. Transcript levels, however, were much lower in dark-grown heterotrophic cultures than in photoheterotrophic cultures. In photoheterotrophic cultures, the expression of the rca and rbc genes was similar to that in cultures grown with CO2 as the sole source of carbon. Although the rbcL-rbcS and rca genes are linked and are in the same transcriptional orientation in Anabaena strains, hybridization of rbc and rca to distinct transcripts suggested that these genes are not cotranscribed, consistent with the results of primer extension and secondary structure analysis of the nucleotide sequence. Transcription from ORF1 and ORF2 was not detected under the conditions examined, and the function of these putative genes remains unknown. Images PMID:7961423

  2. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    PubMed

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  3. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    PubMed Central

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  4. Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

    PubMed

    Kim, Kihoon; Kim, AeRi

    2010-09-01

    Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR.

  5. Links between Transcription, Environmental Adaptation and Gene Variability in Escherichia coli: Correlations between Gene Expression and Gene Variability Reflect Growth Efficiencies.

    PubMed

    Feugeas, Jean-Paul; Tourret, Jerome; Launay, Adrien; Bouvet, Odile; Hoede, Claire; Denamur, Erick; Tenaillon, Olivier

    2016-10-01

    Gene expression is known to be the principle factor explaining how fast genes evolve. Highly transcribed genes evolve slowly because any negative impact caused by a particular mutation is magnified by protein abundance. However, gene expression is a phenotype that depends both on the environment and on the strains or species. We studied this phenotypic plasticity by analyzing the transcriptome profiles of four Escherichia coli strains grown in three different culture media, and explored how expression variability was linked to gene allelic diversity. Genes whose expression changed according to the media and not to the strains were less polymorphic than other genes. Genes for which transcription depended predominantly on the strain were more polymorphic than other genes and were involved in sensing and responding to environmental changes, with an overrepresentation of two-component system genes. Surprisingly, we found that the correlation between transcription and gene diversity was highly variable among growth conditions and could be used to quantify growth efficiency of a strain in a medium. Genetic variability was found to increase with gene expression in poor growth conditions. As such conditions are also characterized by down-regulation of all DNA repair systems, including transcription-coupled repair, we suggest that gene expression under stressful conditions may be mutagenic and thus leads to a variability in mutation rate among genes in the genome which contributes to the pattern of protein evolution.

  6. Gene transcription and electromagnetic fields. Final progress report

    SciTech Connect

    Henderson, A.S.

    1992-12-31

    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  7. Inhibition of Hypoxia Inducible Factor Alpha and Astrocyte-Elevated Gene-1 Mediates Cryptotanshinone Exerted Antitumor Activity in Hypoxic PC-3 Cells

    PubMed Central

    Lee, Hyo-Jeong; Jung, Deok-Beom; Sohn, Eun Jung; Kim, Hanna Hyun; Park, Moon Nyeo; Lew, Jae-Hwan; Lee, Seok Geun; Kim, Bonglee; Kim, Sung-Hoon

    2012-01-01

    Although cryptotanshinone (CT) was known to exert antitumor activity in several cancers, its molecular mechanism under hypoxia still remains unclear. Here, the roles of AEG-1 and HIF-1α in CT-induced antitumor activity were investigated in hypoxic PC-3 cells. CT exerted cytotoxicity against prostate cancer cells and suppressed HIF-1α accumulation and AEG-1 expression in hypoxic PC-3 cells. Also, AEG-1 was overexpressed in prostate cancer cells. Interestingly, HIF-1α siRNA transfection enhanced the cleavages of caspase-9,3, and PAPR and decreased expression of Bcl-2 and AEG1 induced by CT in hypoxic PC-3 cells. Of note, DMOG enhanced the stability of AEG-1 and HIF-1α during hypoxia. Additionally, CT significantly reduced cellular level of VEGF in PC-3 cells and disturbed tube formation of HUVECs. Consistently, ChIP assay revealed that CT inhibited the binding of HIF-1α to VEGF promoter. Furthermore, CT at 10 mg/kg suppressed the growth of PC-3 cells in BALB/c athymic nude mice by 46.4% compared to untreated control. Consistently, immunohistochemistry revealed decreased expression of Ki-67, CD34, VEGF, carbonic anhydrase IX, and AEG-1 indices in CT-treated group compared to untreated control. Overall, our findings suggest that CT exerts antitumor activity via inhibition of HIF-1α, AEG1, and VEGF as a potent chemotherapeutic agent. PMID:23243443

  8. A possible mechanism for the inhibition of ribosomal RNA gene transcription during mitosis.

    PubMed

    Weisenberger, D; Scheer, U

    1995-05-01

    When cells enter mitosis, RNA synthesis ceases. Yet the RNA polymerase I (pol I) transcription machinery involved in the production of pre-rRNA remains bound to the nucleolus organizing region (NOR), the chromosome site harboring the tandemly repeated rRNA genes. Here we examine whether rDNA transcription units are transiently blocked or "frozen" during mitosis. By using fluorescent in situ hybridization we were unable to detect nascent pre-rRNA chains on the NORs of mouse 3T3 and rat kangaroo PtK2 cells. Appropriate controls showed that our approach was sensitive enough to visualize, at the light microscopic level, individual transcriptionally active rRNA genes both in situ after experimental unfolding of nucleoli and in chromatin spreads ("Miller spreads"). Analysis of the cell cycle-dependent redistribution of transcript-associated components also revealed that most transcripts are released from the rDNA at mitosis. Upon disintegration of the nucleolus during mitosis, U3 small nucleolar RNA (snoRNA) and the nucleolar proteins fibrillarin and nucleolin became dispersed throughout the cytoplasm and were excluded from the NORs. Together, our data rule out the presence of "frozen Christmas-trees" at the mitotic NORs but are compatible with the view that inactive pol I remains on the rDNA. We propose that expression of the rRNA genes is regulated during mitosis at the level of transcription elongation, similarly to what is known for a number of genes transcribed by pol II. Such a mechanism may explain the decondensed state of the NOR chromatin and the immediate transcriptional reactivation of the rRNA genes following mitosis.

  9. Action of SNAIL1 in Cardiac Myofibroblasts Is Important for Cardiac Fibrosis following Hypoxic Injury

    PubMed Central

    Biswas, Hirak; Longmore, Gregory D.

    2016-01-01

    Hypoxic injury to the heart results in cardiac fibrosis that leads to cardiac dysfunction and heart failure. SNAIL1 is a zinc finger transcription factor implicated in fibrosis following organ injury and cancer. To determine if the action of SNAIL1 contributed to cardiac fibrosis following hypoxic injury, we used an endogenous SNAIL1 bioluminescence reporter mice, and SNAIL1 knockout mouse models. Here we report that SNAIL1 expression is upregulated in the infarcted heart, especially in the myofibroblasts. Utilizing primary cardiac fibroblasts in ex vivo cultures we find that pro-fibrotic factors and collagen I increase SNAIL1 protein level. SNAIL1 is required in cardiac fibroblasts for the adoption of myofibroblast fate, collagen I expression and expression of fibrosis-related genes. Taken together this data suggests that SNAIL1 expression is induced in the cardiac fibroblasts after hypoxic injury and contributes to myofibroblast phenotype and a fibrotic scar formation. Resultant collagen deposition in the scar can maintain elevated SNAIL1 expression in the myofibroblasts and help propagate fibrosis. PMID:27706205

  10. Fusion FISH Imaging: Single-Molecule Detection of Gene Fusion Transcripts In Situ

    PubMed Central

    Markey, Fatu Badiane; Ruezinsky, William; Tyagi, Sanjay; Batish, Mona

    2014-01-01

    Double-stranded DNA breaks occur on a regular basis in the human genome as a consequence of genotoxic stress and errors during replication. Usually these breaks are rapidly and faithfully repaired, but occasionally different chromosomes, or different regions of the same chromosome, are fused to each other. Some of these aberrant chromosomal translocations yield functional recombinant genes, which have been implicated as the cause of a number of lymphomas, leukemias, sarcomas, and solid tumors. Reliable methods are needed for the in situ detection of the transcripts encoded by these recombinant genes. We have developed just such a method, utilizing single-molecule fluorescence in situ hybridization (sm-FISH), in which approximately 50 short fluorescent probes bind to adjacent sites on the same mRNA molecule, rendering each target mRNA molecule visible as a diffraction-limited spot in a fluorescence microscope. Utilizing this method, gene fusion transcripts are detected with two differently colored probe sets, each specific for one of the two recombinant segments of a target mRNA; enabling the fusion transcripts to be seen in the microscope as distinct spots that fluoresce in both colors. We demonstrate this method by detecting the BCR-ABL fusion transcripts that occur in chronic myeloid leukemia cells, and by detecting the EWSR1-FLI1 fusion transcripts that occur in Ewing's sarcoma cells. This technology should pave the way for accurate in situ typing of many cancers that are associated with, or caused by, fusion transcripts. PMID:24675777

  11. Patient mutation in AIRE disrupts P-TEFb binding and target gene transcription.

    PubMed

    Žumer, Kristina; Plemenitaš, Ana; Saksela, Kalle; Peterlin, B Matija

    2011-10-01

    Autoimmune regulator (AIRE) is a transcription factor that induces the expression of a large subset of otherwise strictly tissue restricted antigens in medullary thymic epithelial cells, thereby enabling their presentation to developing T cells for negative selection. Mutations in AIRE lead to autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), a rare monogenetic disease. Although it has been reported that AIRE interacts with proteins involved in nuclear transport, DNA-damage response, chromatin remodeling, transcription and pre-mRNA-splicing, the precise mechanism of AIRE-induced tissue restricted antigen expression has remained elusive. In this study, we investigated an APECED patient mutation that causes the loss of the extreme C-terminus of AIRE and found that this mutant protein is transcriptionaly inactive. When tethered heterologously to DNA, this domain could stimulate transcription and splicing by itself. Moreover, the loss of this C-terminus disrupted interactions with the positive transcription elongation factor b (P-TEFb). Via P-TEFb, AIRE increased levels of RNA polymerase II on and enhanced pre-mRNA splicing of heterologous and endogenous target genes. Indeed, the inhibition of CDK9, the kinase subunit of P-TEFb, inhibited AIRE-induced pre-mRNA splicing of these genes. Thus, AIRE requires P-TEFb to activate transcription elongation and co-transcriptional processing of target genes.

  12. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae.

    PubMed

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja; Jäntti, Jussi; Mojzita, Dominik

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  13. Synthetic Transcription Amplifier System for Orthogonal Control of Gene Expression in Saccharomyces cerevisiae

    PubMed Central

    Rantasalo, Anssi; Czeizler, Elena; Virtanen, Riitta; Rousu, Juho; Lähdesmäki, Harri; Penttilä, Merja

    2016-01-01

    This work describes the development and characterization of a modular synthetic expression system that provides a broad range of adjustable and predictable expression levels in S. cerevisiae. The system works as a fixed-gain transcription amplifier, where the input signal is transferred via a synthetic transcription factor (sTF) onto a synthetic promoter, containing a defined core promoter, generating a transcription output signal. The system activation is based on the bacterial LexA-DNA-binding domain, a set of modified, modular LexA-binding sites and a selection of transcription activation domains. We show both experimentally and computationally that the tuning of the system is achieved through the selection of three separate modules, each of which enables an adjustable output signal: 1) the transcription-activation domain of the sTF, 2) the binding-site modules in the output promoter, and 3) the core promoter modules which define the transcription initiation site in the output promoter. The system has a novel bidirectional architecture that enables generation of compact, yet versatile expression modules for multiple genes with highly diversified expression levels ranging from negligible to very strong using one synthetic transcription factor. In contrast to most existing modular gene expression regulation systems, the present system is independent from externally added compounds. Furthermore, the established system was minimally affected by the several tested growth conditions. These features suggest that it can be highly useful in large scale biotechnology applications. PMID:26901642

  14. Negative Feedback and Transcriptional Overshooting in a Regulatory Network for Horizontal Gene Transfer

    PubMed Central

    Fernandez-Lopez, Raul; del Campo, Irene; Revilla, Carlos; Cuevas, Ana; de la Cruz, Fernando

    2014-01-01

    Horizontal gene transfer (HGT) is a major force driving bacterial evolution. Because of their ability to cross inter-species barriers, bacterial plasmids are essential agents for HGT. This ability, however, poses specific requisites on plasmid physiology, in particular the need to overcome a multilevel selection process with opposing demands. We analyzed the transcriptional network of plasmid R388, one of the most promiscuous plasmids in Proteobacteria. Transcriptional analysis by fluorescence expression profiling and quantitative PCR revealed a regulatory network controlled by six transcriptional repressors. The regulatory network relied on strong promoters, which were tightly repressed in negative feedback loops. Computational simulations and theoretical analysis indicated that this architecture would show a transcriptional burst after plasmid conjugation, linking the magnitude of the feedback gain with the intensity of the transcriptional burst. Experimental analysis showed that transcriptional overshooting occurred when the plasmid invaded a new population of susceptible cells. We propose that transcriptional overshooting allows genome rebooting after horizontal gene transfer, and might have an adaptive role in overcoming the opposing demands of multilevel selection. PMID:24586200

  15. Decoupling of evolutionary changes in transcription factor binding and gene expression in mammals.

    PubMed

    Wong, Emily S; Thybert, David; Schmitt, Bianca M; Stefflova, Klara; Odom, Duncan T; Flicek, Paul

    2015-02-01

    To understand the evolutionary dynamics between transcription factor (TF) binding and gene expression in mammals, we compared transcriptional output and the binding intensities for three tissue-specific TFs in livers from four closely related mouse species. For each transcription factor, TF-dependent genes and the TF binding sites most likely to influence mRNA expression were identified by comparing mRNA expression levels between wild-type and TF knockout mice. Independent evolution was observed genome-wide between the rate of change in TF binding and the rate of change in mRNA expression across taxa, with the exception of a small number of TF-dependent genes. We also found that binding intensities are preferentially conserved near genes whose expression is dependent on the TF, and the conservation is shared among binding peaks in close proximity to each other near the TSS. Expression of TF-dependent genes typically showed an increased sensitivity to changes in binding levels as measured by mRNA abundance. Taken together, these results highlight a significant tolerance to evolutionary changes in TF binding intensity in mammalian transcriptional networks and suggest that some TF-dependent genes may be largely regulated by a single TF across evolution.

  16. Integrating Gene Transcription-Based Biomarkers to Understand Desert Tortoise and Ecosystem Health.

    PubMed

    Bowen, Lizabeth; Miles, A Keith; Drake, K Kristina; Waters, Shannon C; Esque, Todd C; Nussear, Kenneth E

    2015-09-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal's habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcription C T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

  17. Disturbance of Social Hierarchy by an Invasive Species: A Gene Transcription Study

    PubMed Central

    Dodson, Julian J.; Guderley, Helga; Bernatchez, Louis

    2008-01-01

    Background Ecological and evolutionary changes in native populations facing invasion by exotic species are increasingly reported. Recently, it has been shown that competition with exotic rainbow trout (Oncorhynchus mykiss) disrupts dominance hierarchies within groups of native Atlantic salmon (Salmo salar). The genetic and molecular actors underlying phenotypic plasticity are poorly understood. Methodology Here, we aimed at identifying the genetic and molecular actors contributing to this plastic loss of dominance hierarchies as well as at identifying genes implicated in behaviours related to social dominance. By using microarrays, we compared the genome-wide gene transcription profiles in brains of dominant versus subordinate juvenile Atlantic salmon in presence or absence of a competitive rainbow trout. Principal Findings Adding the trout competitor resulted in dominant and subordinate salmon being more similar, both behaviourally and at the level of brain gene transcription patterns. Genes for which transcription levels differed between dominant and subordinate salmon in the absence of exotic trout were mainly over-expressed in dominant salmon and included genes implicated in protein turnover, neuronal structural change and oxygen transport. Conclusions/Significance Our study provides one of the few examples demonstrating a close interplay between behavioural plasticity and gene transcription, therefore contributing to the understanding of the molecular mechanisms underlying these processes in an ecologically relevant context. PMID:18545706

  18. Integrating gene transcription-based biomarkers to understand desert tortoise and ecosystem health

    USGS Publications Warehouse

    Bowen, Lizabeth; Miles, A. Keith; Drake, Karla K.; Waters, Shannon C.; Esque, Todd C.; Nussear, Kenneth E.

    2015-01-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal’s habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcriptionC T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.

  19. Integrating Gene Transcription-Based Biomarkers to Understand Desert Tortoise and Ecosystem Health.

    PubMed

    Bowen, Lizabeth; Miles, A Keith; Drake, K Kristina; Waters, Shannon C; Esque, Todd C; Nussear, Kenneth E

    2015-09-01

    Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal's habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcription C T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise. PMID:25561383

  20. Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression.

    PubMed

    Kabadi, Ami M; Gersbach, Charles A

    2014-09-01

    Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications.

  1. Transcriptional rewiring over evolutionary timescales changes quantitative and qualitative properties of gene expression

    PubMed Central

    Dalal, Chiraj K; Zuleta, Ignacio A; Mitchell, Kaitlin F; Andes, David R; El-Samad, Hana; Johnson, Alexander D

    2016-01-01

    Evolutionary changes in transcription networks are an important source of diversity across species, yet the quantitative consequences of network evolution have rarely been studied. Here we consider the transcriptional ‘rewiring’ of the three GAL genes that encode the enzymes needed for cells to convert galactose to glucose. In Saccharomyces cerevisiae, the transcriptional regulator Gal4 binds and activates these genes. In the human pathogen Candida albicans (which last shared a common ancestor with S. cerevisiae some 300 million years ago), we show that different regulators, Rtg1 and Rtg3, activate the three GAL genes. Using single-cell dynamics and RNA-sequencing, we demonstrate that although the overall logic of regulation is the same in both species—the GAL genes are induced by galactose—there are major differences in both the quantitative response of these genes to galactose and in the position of these genes in the overall transcription network structure of the two species. DOI: http://dx.doi.org/10.7554/eLife.18981.001 PMID:27614020

  2. Vesicular stomatitis virus matrix protein inhibits host cell-directed transcription of target genes in vivo.

    PubMed Central

    Black, B L; Lyles, D S

    1992-01-01

    Infection by vesicular stomatitis virus (VSV) results in a rapid inhibition of host cell transcription and translation. To determine whether the viral matrix (M) protein was involved in this inhibition of host cell gene expression, an M protein expression vector was cotransfected with a target gene vector, encoding the target gene, encoding chloramphenicol acetyltransferase (CAT). Expression of M protein caused a decrease in CAT activity in a gene dosage-dependent manner, and inhibition was apparent by 12 h posttransfection. The inhibitory effect of M protein was quite potent. The level of M protein required for a 10-fold inhibition of CAT activity was less than 1% of the level of M protein produced during the sixth hour of VSV infection. Northern (RNA) analysis of cotransfected cells showed that expression of M protein caused a reduction in the steady-state level of the vector-encoded mRNAs. Expression of both CAT and M mRNAs was reduced in cells cotransfected with a plasmid encoding M protein, indicating that expression of small amounts of M protein from plasmid DNA inhibits further expression of both M and CAT mRNAs. Nuclear runoff transcription analysis demonstrated that expression of M protein inhibited transcription of the target genes. This is the first report of a viral gene product which is capable of inhibiting transcription in vivo in the absence of any other viral component. Images PMID:1318397

  3. High initiation rates at the ribosomal gene promoter do not depend upon spacer transcription

    SciTech Connect

    Labhart, P.; Reeder, R.H. )

    1989-05-01

    We report experiments that test the model that in Xenopus laevis, RNA polymerase I is handed over in a conservative fashion from the T3 terminator to the adjacent gene promoter. We have introduced transcription-terminating lesions into the ribosomal DNA repeat by irradiating cultured cells with ultraviolet light. We used isolated nuclei to measure the effect of such lesions on transcription. UV damage sufficient to prevent all elongating RNA polymerase from reaching T3 from upstream had no adverse effect on the density of RNA polymerase at the very 5' end of the gene. We conclude that high rates of transcription initiation at the gene promoter do not depend upon polymerase passing from one repeat to the next or on polymerase initiating at the spacer promoters.

  4. Murine chromosomal location of five bHLH-Zip transcription factor genes

    SciTech Connect

    Steingrimsson, E.; Gilbert, D.J.; Copeland, N.G.; Jenkins, N.A.

    1995-07-20

    The genes for the bHLH-Zip transcription factors Tfap4, Mxi1, Tcfeb, Usf1, and Usf2 have been mapped in mouse by interspecific backcross analysis. Mxi1, Usf1, and Usf2 have been mapped previously by in situ hybridization, but their positions on the meiotic linkage map had not been determined. The other two genes have not previously been mapped in mouse. These transcription factors belong to a growing family of transcriptional regulators, some of which are known to form a complex network of interacting proteins that control cell proliferation and apoptosis. As expected, based on mapping studies of other bHLH-Zip genes, these loci were well distributed among mouse chromosomes. In addition, some of the probes used in this study detected multiple, independently segregating loci, suggesting the possible existence of additional family members or species-specific pseudogenes. 34 refs., 1 fig., 1 tab.

  5. [Inhibition of replication and transcription of WSN influenza A virus by IFIT family genes].

    PubMed

    Hou, Lidan; Li, Jing; Qu, Hongren; Yang, Limin; Chen, Yajun; Du, Qianqian; Liu, Wenjun

    2015-01-01

    IFIT family genes are a kind of interferon stimulated genes (ISGs), and play important roles in antiviral sector and immunity regulation. To study the regulatory effect of IFIT family genes during influenza A virus (IAV) infection, we used RNA-sequencing analysis (RNA-Seq) technique and found that when 293T cells were infected by A/WSN/33 (WSN), the concentration of IFIT family genes were increased. Further study reveals that overexpression of IFIT2 or IFIT3 could inhibit IAV replication and transcription, and cause the dose-dependent inhibition of polymerase activity of vRNP. In addition, IFIT2 and IFIT3 encoding protein could colocalize with NS1 in 293T cells infected by WSN, indicating that they might interact with each other. The results suggest that IFIT family genes can inhibit the replication and transcription of IAV, which contributes to our understanding of the regulatory effect of host factors during influenza virus infection.

  6. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  7. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  8. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  9. Transcription of histone gene cluster by differential core-promoter factors

    PubMed Central

    Isogai, Yoh; Keles, Sündüz; Prestel, Matthias; Hochheimer, Andreas; Tjian, Robert

    2007-01-01

    The 100 copies of tandemly arrayed Drosophila linker (H1) and core (H2A/B and H3/H4) histone gene cluster are coordinately regulated during the cell cycle. However, the molecular mechanisms that must allow differential transcription of linker versus core histones prevalent during development remain elusive. Here, we used fluorescence imaging, biochemistry, and genetics to show that TBP (TATA-box-binding protein)-related factor 2 (TRF2) selectively regulates the TATA-less Histone H1 gene promoter, while TBP/TFIID targets core histone transcription. Importantly, TRF2-depleted polytene chromosomes display severe chromosomal structural defects. This selective usage of TRF2 and TBP provides a novel mechanism to differentially direct transcription within the histone cluster. Moreover, genome-wide chromatin immunoprecipitation (ChIP)-on-chip analyses coupled with RNA interference (RNAi)-mediated functional studies revealed that TRF2 targets several classes of TATA-less promoters of >1000 genes including those driving transcription of essential chromatin organization and protein synthesis genes. Our studies establish that TRF2 promoter recognition complexes play a significantly more central role in governing metazoan transcription than previously appreciated. PMID:17978101

  10. Retinoid-mediated transcriptional regulaton of keratin genes in human epidermal and squamous cell carcinoma cells

    SciTech Connect

    Stellmach, V.; Leask, A.; Fuchs, E. )

    1991-06-01

    Vitamin A and other retinoids profoundly inhibit morphological and biochemical heatures of epidermal differentiation in vivo and in vitro. To elucidate the molecular mechanisms underlying the differential expression of epidermal keratins and their regulation by retinoids, the authors retinoid-mediated changes in total protein expression, protein synthesis, mRNA expression, and transcription in cultured human keratinocytes and in squamous cell carcinoma (SCC-13) cells of epidermal origin. The studies revealed that the epidermal keratins, K5, K6, K14, and K16, their mRNAs, and their transcripts were diminished relative to actin as a consequence of retinoic acid (RA) treatment. The effects were most pronounced in SCC-13 and were detected as early as 6 hr post-RA treatment, with enhancement over an additional 24-48 hr. Repression was also observed when 5{prime} upstream sequences of K14 or K5 genes were used to drive expression of a chloramphenicol acetyltransferase reporter gene in SCC-13 keratinocytes. Both cell types were found to express mRNAs for the RA receptors {alpha} and {gamma}, which may be involved in the RA-mediated transcriptional changes in these cells. The rapid transcriptional changes in epidermal keratin genes were in striking contrast to the previously reported slow transcriptional changes in simple epithelial keratin genes.

  11. Identification of novel transcripts from the porcine MYL1 gene and initial characterization of its promoters.

    PubMed

    Ling, Fei; Fang, Wei; Chen, Yaosheng; Li, Jiaqi; Liu, Xiaohui; Wang, Liangliang; Zhang, Hao; Chen, Songling; Mei, Yingjie; Du, Hongli; Wang, Chong

    2010-10-01

    The fast skeletal alkali myosin light polypeptide 1 (MYL1) gene is one of three mammalian alkali MLC genes and encodes two isoforms, 1f and 3f, which play a vital role in embryonic, fetal, and adult skeletal muscle development. We isolated the MYL1 gene from a pig BAC library with the goal of characterizing its promoter and identifying its transcripts. Genes and isoforms were identified by reverse transcriptase-PCR, northern blot and RACE (Rapid Amplification of cDNA Ends). Potential MYL1 gene promoters were characterized using a luciferase reporter assay and electrophoretic mobility shift assays (EMSA). MLC1f, MLC3f, and three additional isoforms of porcine MYL1, MLC5f-A, -B, and -C were identified. Up to now, the three novel isoforms had not been reported in human or mouse. Northern blot analysis indicated that MLC1f, MLC3f, and MLC5fs were expressed only in longissimus dorsi muscles. Two transcription initiation and termination sites were identified by RACE. Promoter analysis and EMSA demonstrated the presence of a MEF3 (skeletal muscle-specific transcriptional enhancer) binding site (+384 to +481), which might be essential for porcine MYL1 transcription. Our results suggested that five transcript variants were generated using alternative promoters, two transcription start sites, and polyA sites, as well as variable splicing of the pig MYL1 exon 5. The identification of alternative promoters and splice variants, the expression of the splice variants in different muscle tissues, and the definition of regulatory elements provide important molecular genetic knowledge concerning the MYL1 gene.

  12. RNA Editing of Androgen Receptor Gene Transcripts in Prostate Cancer Cells*S⃞

    PubMed Central

    Martinez, Harryl D.; Jasavala, Rohini J.; Hinkson, Izumi; Fitzgerald, Latricia D.; Trimmer, James S.; Kung, Hsing-Jien; Wright, Michael E.

    2008-01-01

    Reactivation of the androgen receptor (AR) signaling pathway represents a critical step in the growth and survival of androgen-independent (AI) prostate cancer (CaP). In this study we show the DU145 and PC3 AI human CaP cell lines respond to androgens and require AR expression for optimal proliferation in vitro. Interestingly, AR gene transcripts in DU145 and PC3 cells harbored a large number of single base pair nucleotide transitions that resulted in missense mutations in selected AR codons. The most notable lesion detected in AR gene transcripts included the oncogenic codon 877T→A gain-of-function mutation. Surprisingly, AR gene transcript nucleotide transitions were not genome-encoded substitutions, but instead the mutations co-localized to putative A-to-I, U-to-C, C-to-U, and G-to-A RNA editing sites, suggesting the lesions were mediated through RNA editing mechanisms. Higher levels of mRNA encoding the A-to-I RNA editing enzymes ADAR1 and ADARB1 were observed in DU145 and PC3 cells relative to the androgen-responsive LNCaP and 22Rv1 human CaP cell lines, which correlated with higher levels of AR gene transcript A-to-I editing detected in DU145 and PC3 cells. Our results suggest that AR gene transcripts are targeted by different RNA editing enzymes in DU145 and PC3 cells. Thus RNA editing of AR gene transcripts may contribute to the etiology of hormone-refractory phenotypes in advanced stage AI CaP. PMID:18708348

  13. Reciprocal regulation of transcription factors and PLC isozyme gene expression in adult cardiomyocytes.

    PubMed

    Singal, Tushi; Dhalla, Naranjan S; Tappia, Paramjit S

    2010-06-01

    By employing a pharmacological approach, we have shown that phospholipase C (PLC) activity is involved in the regulation of gene expression of transcription factors such as c-Fos and c-Jun in cardiomyocytes in response to norepinephrine (NE). However, there is no information available regarding the identity of specific PLC isozymes involved in the regulation of c-Fos and c-Jun or on the involvement of these transcription factors in PLC isozyme gene expression in adult cardiomyocytes. In this study, transfection of cardiomyocytes with PLC isozyme specific siRNA was found to prevent the NE-mediated increases in the corresponding PLC isozyme gene expression, protein content and activity. Unlike PLC gamma(1) gene, silencing of PLC beta(1), beta(3) and delta(1) genes with si RNA prevented the increases in c-Fos and c-Jun gene expression in response to NE. On the other hand, transfection with c-Jun si RNA suppressed the NE-induced increase in c-Jun as well as PLC beta(1), beta(3) and delta(1) gene expression, but had no effect on PLC gamma(1) gene expression. Although transfection of cardiomyocytes with c-Fos si RNA prevented NE-induced expression of c-Fos, PLC beta(1) and PLC beta(3) genes, it did not affect the increases in PLC delta(1) and PLC gamma(1) gene expression. Silencing of either c-Fos or c-Jun also depressed the NE-mediated increases in PLC beta(1), beta(3) and gamma(1) protein content and activity in an isozyme specific manner. Furthermore, silencing of all PLC isozymes as well as of c-Fos and c-Jun resulted in prevention of the NE-mediated increase in atrial natriuretic factor gene expression. These findings, by employing gene silencing techniques, demonstrate that there occurs a reciprocal regulation of transcription factors and specific PLC isozyme gene expression in cardiomyocytes.

  14. Transcriptional analysis of the 5'-noncoding region of the human involucrin gene.

    PubMed

    Lopez-Bayghen, E; Vega, A; Cadena, A; Granados, S E; Jave, L F; Gariglio, P; Alvarez-Salas, L M

    1996-01-01

    Human involucrin whose gene transcription is directed by a 2456-nucleotide (nt) 5'-noncoding region is a structural component of the epithelial cornified layer. Transient transfection assays demonstrated that this region is transcriptionally active in multiplying keratinocytes and is enhanced by 2 mM CaCl2 treatment. Calcium-independent transcriptional activity and the interaction with the AP-1 transcriptional factor was located on the proximal part (nt -159 to -1) of the 5'-noncoding region. However, CaCl2 responsiveness was mapped to a distal 1185-nt fragment (nt -2456 to -1272). Moreover, this fragment potentiated the Herpes simplex thymidine kinase promoter in normal keratinocytes and is responsive to calcium treatment in a cell type-specific manner. Interestingly, the absence of a 491-nt fragment located between the two enhancer domains (nt -651 to -160) resulted in transcriptional activation in multiplying keratinocytes. This fragment interacts with AP-1 and the YY1 transcriptional silencer. It is concluded that human involucrin 5'-noncoding region contains at least three regulatory domains, a distal CaCl2-responsive enhancer, a putative transcriptional silencer (that interacts with AP-1 and YY1), and a proximal enhancer/promoter (that interacts with AP-1). Thus, this study demonstrates the presence of particular transcriptional factors can potentially regulate the human involucrin expression.

  15. Contributions of transcription and mRNA decay to gene expression dynamics of fission yeast in response to oxidative stress

    PubMed Central

    Marguerat, Samuel; Lawler, Katherine; Brazma, Alvis; Bähler, Jürg

    2014-01-01

    The cooperation of transcriptional and post-transcriptional levels of control to shape gene regulation is only partially understood. Here we show that a combination of two simple and non-invasive genomic techniques, coupled with kinetic mathematical modeling, affords insight into the intricate dynamics of RNA regulation in response to oxidative stress in the fission yeast Schizosaccharomyces pombe. This study reveals a dominant role of transcriptional regulation in response to stress, but also points to the first minutes after stress induction as a critical time when the coordinated control of mRNA turnover can support the control of transcription for rapid gene regulation. In addition, we uncover specialized gene expression strategies associated with distinct functional gene groups, such as simultaneous transcriptional repression and mRNA destabilization for genes encoding ribosomal proteins, delayed mRNA destabilization with varying contribution of transcription for ribosome biogenesis genes, dominant roles of mRNA stabilization for genes functioning in protein degradation, and adjustment of both transcription and mRNA turnover during the adaptation to stress. We also show that genes regulated independently of the bZIP transcription factor Atf1p are predominantly controlled by mRNA turnover, and identify putative cis-regulatory sequences that are associated with different gene expression strategies during the stress response. This study highlights the intricate and multi-faceted interplay between transcription and RNA turnover during the dynamic regulatory response to stress. PMID:25007214

  16. Quantitative Real-Time PCR Analysis of Gene Transcripts of Mosquito Follicles.

    PubMed

    Telang, Aparna

    2016-01-01

    Real-time (quantitative) PCR, or QPCR, has become an indispensible tool for characterizing gene expression. Depending on the experimental design, researchers can use either the relative or absolute (standard curve) method to quantify transcript abundance. Characterizing the expression of genes in mosquito ovaries will require use of the standard curve method of quantification. Here, I describe reagents and equipment necessary to run standard curve QPCR. I also provide details on the construction of the standard linear curve and calculations required to determine transcript abundance. PMID:27557577

  17. Identification of a new DMD gene deletion by ectopic transcript analysis.

    PubMed Central

    Rininsland, F; Hahn, A; Niemann-Seyde, S; Slomski, R; Hanefeld, F; Reiss, J

    1992-01-01

    The detailed genetic analysis of the Duchenne/Becker muscular dystrophy gene is hindered by the large number of exons involved and their separation by huge introns. These problems can be overcome by the analysis of mRNA rather than genomic DNA and ectopic transcripts derived from peripheral blood lymphocytes provide a convenient source of material. Using reverse transcription and nested PCR, we show here a comprehensive strategy for the rapid and complete analysis of the coding sequences from complex genes and illustrate its potential by the identification of a hitherto undescribed single exon deletion. Images PMID:1383546

  18. Mechanical control of cyclic AMP signalling and gene transcription through integrins

    NASA Technical Reports Server (NTRS)

    Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.

    2000-01-01

    This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.

  19. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    PubMed

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  20. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C

    2012-01-01

    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  1. Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene.

    PubMed

    Banday, Abdul Rouf; Azim, Shafquat; Tabish, Mohammad

    2011-11-01

    Prkar1a gene encodes regulatory type 1 alpha subunit (RIα) of cAMP-dependent protein kinase (PKA) in mouse. The role of this gene has been implicated in Carney complex and many cancer types that suggest its involvement in physiological processes like cell cycle regulation, growth and/or proliferation. We have identified and sequenced partial cDNA clones encoding four alternatively spliced transcripts of mouse Prkar1a gene. These transcripts have alternate 5' UTR structure which results from splicing of three exons (designated as E1a, E1b, and E1c) to canonical exon 2. The designated transcripts T1, T2, T3, and T4 contain 5' UTR exons as E1c, E1a + E1b, E1a, and E1b, respectively. The transcript T1 corresponded to earlier reported transcript in GenBank. In silico study of genomic DNA sequence revealed three distinct promoter regions namely, P1, P2, and P3 upstream of the exons E1a, E1b, and E1c, respectively. P1 is non-CpG-related promoter but P2 and P3 are CpG-related promoters; however, all three are TATA less. RT-PCR analysis demonstrated the expression of all four transcripts in late postnatal stages; however, these were differentially regulated in early postnatal stages of 0.5 day, 3 day, and 15 day mice in different tissue types. Variations in expression of Prkar1a gene transcripts suggest their regulation from multiple promoters that respond to a variety of signals arising in or out of the cell in tissue and developmental stage-specific manner. PMID:21638026

  2. ORTI: An Open-Access Repository of Transcriptional Interactions for Interrogating Mammalian Gene Expression Data

    PubMed Central

    Ma, Xiuquan; Burykin, Timur; James, David E.; Kuncic, Zdenka

    2016-01-01

    Transcription factors (TFs) play a fundamental role in coordinating biological processes in response to stimuli. Consequently, we often seek to determine the key TFs and their regulated target genes (TGs) amidst gene expression data. This requires a knowledge-base of TF-TG interactions, which would enable us to determine the topology of the transcriptional network and predict novel regulatory interactions. To address this, we generated an Open-access Repository of Transcriptional Interactions, ORTI, by integrating available TF-TG interaction databases. These databases rely on different types of experimental evidence, including low-throughput assays, high-throughput screens, and bioinformatics predictions. We have subsequently categorised TF-TG interactions in ORTI according to the quality of this evidence. To demonstrate its capabilities, we applied ORTI to gene expression data and identified modulated TFs using an enrichment analysis. Combining this with pairwise TF-TG interactions enabled us to visualise temporal regulation of a transcriptional network. Additionally, ORTI enables the prediction of novel TF-TG interactions, based on how well candidate genes co-express with known TGs of the target TF. By filtering out known TF-TG interactions that are unlikely to occur within the experimental context, this analysis predicts context-specific TF-TG interactions. We show that this can be applied to experimental designs of varying complexities. In conclusion, ORTI is a rich and publicly available database of experimentally validated mammalian transcriptional interactions which is accompanied with tools that can identify and predict transcriptional interactions, serving as a useful resource for unravelling the topology of transcriptional networks. PMID:27723773

  3. Functional divergence and convergence between the transcript network and gene network in lung adenocarcinoma

    PubMed Central

    Hsu, Min-Kung; Pan, Chia-Lin; Chen, Feng-Chi

    2016-01-01

    Introduction Alternative RNA splicing is a critical regulatory mechanism during tumorigenesis. However, previous oncological studies mainly focused on the splicing of individual genes. Whether and how transcript isoforms are coordinated to affect cellular functions remain underexplored. Also of great interest is how the splicing regulome cooperates with the transcription regulome to facilitate tumorigenesis. The answers to these questions are of fundamental importance to cancer biology. Results Here, we report a comparative study between the transcript-based network (TN) and the gene-based network (GN) derived from the transcriptomes of paired tumor–normal tissues from 77 lung adenocarcinoma patients. We demonstrate that the two networks differ significantly from each other in terms of patient clustering and the number and functions of network modules. Interestingly, the majority (89.5%) of multi-transcript genes have their transcript isoforms distributed in at least two TN modules, suggesting regulatory and functional divergences between transcript isoforms. Furthermore, TN and GN modules share onlŷ50%–60% of their biological functions. TN thus appears to constitute a regulatory layer separate from GN. Nevertheless, our results indicate that functional convergence and divergence both occur between TN and GN, implying complex interactions between the two regulatory layers. Finally, we report that the expression profiles of module members in both TN and GN shift dramatically yet concordantly during tumorigenesis. The mechanisms underlying this coordinated shifting remain unclear yet are worth further explorations. Conclusion We show that in lung adenocarcinoma, transcript isoforms per se are coordinately regulated to conduct biological functions not conveyed by the network of genes. However, the two networks may interact closely with each other by sharing the same or related biological functions. Unraveling the effects and mechanisms of such interactions will

  4. Position dependent expression of a homeobox gene transcript in relation to amphibian limb regeneration.

    PubMed Central

    Savard, P; Gates, P B; Brockes, J P

    1988-01-01

    Adult urodele amphibians such as the newt Notophthalmus viridescens are capable of regenerating their limbs and tail by formation of a blastema, a growth zone of mesenchymal progenitor cells. In an attempt to identify genes implicated in specification of the regenerate, we screened a newt forelimb blastema cDNA library with homeobox probes, and isolated and sequenced clones that identify a 1.8 kb polyadenylated transcript containing a homeobox. The transcript is derived from a single gene called NvHbox 1, the newt homologue of XIHbox 1 (Xenopus), HHO.c8 (human) and Hox-6.1 (mouse). The cDNA for the 1.8 kb transcript has two exons as determined by isolation and partial sequencing of a genomic clone. The expression of the transcript shows several interesting features in relation to limb regeneration: (i) Hybridization of Northern blots of poly(A)+ RNA from limb and tail and their respective blastemas shows that the transcript in limb tissues has exons 1 and 2, whereas a 1.8 kb transcript in tail tissues has only exon 2. (ii) The transcript is expressed in limbs of adult newt but not of adult Xenopus, raising the possibility that this contributes to an explanation of the loss of regenerative ability with maturation in adult anurans. (iii) The transcript is expressed at a higher level in a proximal (mid-humerus) blastema than in a distal one (mid-radius). When distal blastemas were proximalized by treatment with retinoic acid, no change in the level of the transcript was detected by Northern analysis at a single time point after amputation.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2907476

  5. Identification of Transcriptional Factors and Key Genes in Primary Osteoporosis by DNA Microarray

    PubMed Central

    Xie, Wengui; Ji, Lixin; Zhao, Teng; Gao, Pengfei

    2015-01-01

    Background A number of genes have been identified to be related with primary osteoporosis while less is known about the comprehensive interactions between regulating genes and proteins. We aimed to identify the differentially expressed genes (DEGs) and regulatory effects of transcription factors (TFs) involved in primary osteoporosis. Material/Methods The gene expression profile GSE35958 was obtained from Gene Expression Omnibus database, including 5 primary osteoporosis and 4 normal bone tissues. The differentially expressed genes between primary osteoporosis and normal bone tissues were identified by the same package in R language. The TFs of these DEGs were predicted with the Essaghir A method. DAVID (The Database for Annotation, Visualization and Integrated Discovery) was applied to perform the GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis of DEGs. After analyzing regulatory effects, a regulatory network was built between TFs and the related DEGs. Results A total of 579 DEGs was screened, including 310 up-regulated genes and 269 down-regulated genes in primary osteoporosis samples. In GO terms, more up-regulated genes were enriched in transcription regulator activity, and secondly in transcription factor activity. A total 10 significant pathways were enriched in KEGG analysis, including colorectal cancer, Wnt signaling pathway, Focal adhesion, and MAPK signaling pathway. Moreover, total 7 TFs were enriched, of which CTNNB1, SP1, and TP53 regulated most up-regulated DEGs. Conclusions The discovery of the enriched TFs might contribute to the understanding of the mechanism of primary osteoporosis. Further research on genes and TFs related to the WNT signaling pathway and MAPK pathway is urgent for clinical diagnosis and directing treatment of primary osteoporosis. PMID:25957414

  6. Network analysis of inflammatory genes and their transcriptional regulators in coronary artery disease.

    PubMed

    Nair, Jiny; Ghatge, Madankumar; Kakkar, Vijay V; Shanker, Jayashree

    2014-01-01

    Network analysis is a novel method to understand the complex pathogenesis of inflammation-driven atherosclerosis. Using this approach, we attempted to identify key inflammatory genes and their core transcriptional regulators in coronary artery disease (CAD). Initially, we obtained 124 candidate genes associated with inflammation and CAD using Polysearch and CADgene database for which protein-protein interaction network was generated using STRING 9.0 (Search Tool for the Retrieval of Interacting Genes) and visualized using Cytoscape v 2.8.3. Based on betweenness centrality (BC) and node degree as key topological parameters, we identified interleukin-6 (IL-6), vascular endothelial growth factor A (VEGFA), interleukin-1 beta (IL-1B), tumor necrosis factor (TNF) and prostaglandin-endoperoxide synthase 2 (PTGS2) as hub nodes. The backbone network constructed with these five hub genes showed 111 nodes connected via 348 edges, with IL-6 having the largest degree and highest BC. Nuclear factor kappa B1 (NFKB1), signal transducer and activator of transcription 3 (STAT3) and JUN were identified as the three core transcription factors from the regulatory network derived using MatInspector. For the purpose of validation of the hub genes, 97 test networks were constructed, which revealed the accuracy of the backbone network to be 0.7763 while the frequency of the hub nodes remained largely unaltered. Pathway enrichment analysis with ClueGO, KEGG and REACTOME showed significant enrichment of six validated CAD pathways - smooth muscle cell proliferation, acute-phase response, calcidiol 1-monooxygenase activity, toll-like receptor signaling, NOD-like receptor signaling and adipocytokine signaling pathways. Experimental verification of the above findings in 64 cases and 64 controls showed increased expression of the five candidate genes and the three transcription factors in the cases relative to the controls (p<0.05). Thus, analysis of complex networks aid in the prioritization of

  7. Transcriptional regulation of the cpr gene cluster in ortho-chlorophenol-respiring Desulfitobacterium dehalogenans.

    PubMed

    Smidt, H; van Leest, M; van der Oost, J; de Vos, W M

    2000-10-01

    To characterize the expression and possible regulation of reductive dehalogenation in halorespiring bacteria, a 11.5-kb genomic fragment containing the o-chlorophenol reductive dehalogenase-encoding cprBA genes of the gram-positive bacterium Desulfitobacterium dehalogenans was subjected to detailed molecular characterization. Sequence analysis revealed the presence of eight designated genes with the order cprTKZEBACD and with the same polarity except for cprT. The deduced cprC and cprK gene products belong to the NirI/NosR and CRP-FNR families of transcription regulatory proteins, respectively. CprD and CprE are predicted to be molecular chaperones of the GroEL type, whereas cprT may encode a homologue of the trigger factor folding catalysts. Northern blot analysis, reverse transcriptase PCR, and primer extension analysis were used to elucidate the transcriptional organization and regulation of the cpr gene cluster. Results indicated halorespiration-specific transcriptional induction of the monocistronic cprT gene and the biscistronic cprBA and cprZE genes. Occasional read-through at cprC gives rise to a tetracistronic cprBACD transcript. Transcription of cprBA was induced 15-fold upon addition of the o-chlorophenolic substrate 3-chloro-4-hydroxyphenylacetic acid within 30 min with concomitant induction of dehalogenation activity. Putative regulatory protein binding motifs that to some extent resemble the FNR box were identified in the cprT-cprK and cprK-cprZ intergenic regions and the promoter at cprB, suggesting a role for FNR-like CprK in the control of expression of the cprTKZEBACD genes. PMID:11004165

  8. E2F Transcription Factors Control the Roller Coaster Ride of Cell Cycle Gene Expression.

    PubMed

    Thurlings, Ingrid; de Bruin, Alain

    2016-01-01

    Initially, the E2F transcription factor was discovered as a factor able to bind the adenovirus E2 promoter and activate viral genes. Afterwards it was shown that E2F also binds to promoters of nonviral genes such as C-MYC and DHFR, which were already known at that time to be important for cell growth and DNA metabolism, respectively. These findings provided the first clues that the E2F transcription factor might be an important regulator of the cell cycle. Since this initial discovery in 1987, several additional E2F family members have been identified, and more than 100 targets genes have been shown to be directly regulated by E2Fs, the majority of these are important for controlling the cell cycle. The progression of a cell through the cell cycle is accompanied with the increased expression of a specific set of genes during one phase of the cell cycle and the decrease of the same set of genes during a later phase of the cell cycle. This roller coaster ride, or oscillation, of gene expression is essential for the proper progression through the cell cycle to allow accurate DNA replication and cell division. The E2F transcription factors have been shown to be critical for the temporal expression of the oscillating cell cycle genes. This review will focus on how the oscillation of E2Fs and their targets is regulated by transcriptional, post-transcriptional and post-translational mechanism in mammals, yeast, flies, and worms. Furthermore, we will discuss the functional impact of E2Fs on the cell cycle progression and outline the consequences when E2F expression is disturbed. PMID:26254918

  9. Identification of ATF2 as a transcriptional regulator of renin gene.

    PubMed

    Desch, Michael; Hackmayer, Gerit; Todorov, Vladimir T

    2012-01-01

    The cAMP response element (enhCRE) in the distal enhancer regulatory region of renin gene is believed to play a major role in the control of renin transcription. enhCRE binds the CRE-binding protein (CREB), which is the main transcription factor target of cAMP signaling. Using the mouse renin-producing cell line As4.1 we found that activating transcription factor-2 (ATF2) also binds to enhCRE. N-terminal phosphorylation of ATF2, which controls its transactivation, is associated with downregulation of renin gene expression by the cytokine tumor necrosis factor-α (TNFα). The ubiquitin proteasome inhibitor MG132 also phosphorylates ATF2 and inhibits renin expression. Knockdown of ATF2 attenuated the suppression of renin gene expression by MG132, thus demonstrating that ATF2 mediates the inhibitory effect of MG132. In addition, MG132 increased the DNA-binding of ATF2 as well as the ratio of bound ATF2 to CREB. Using ATF2- and CREB-Gal4 fusion protein constructs coupled with luciferase reporter system we showed that ATF2 has a weaker transactivating capacity than CREB. These data suggest that ATF2 represses renin expression by drifting the transcriptional control of renin gene away from CREB. Accordingly, TNFα completely abrogated the cAMP-dependent stimulation of renin gene expression.

  10. Maternal inheritance of transcripts from three Drosophila src-related genes.

    PubMed Central

    Wadsworth, S C; Madhavan, K; Bilodeau-Wentworth, D

    1985-01-01

    The Drosophila genome contains three major sequences related to the v-src gene. Previously published molecular studies have confirmed the structural homology between v-src and two of the Drosophila sequences. We have sequenced a portion of the third v-src-related Drosophila gene and found that it also shares structural homology with vertebrate and Drosophila src-family genes. RNA sequences from each of the src genes are present in pre-blastoderm embryos indicating that they are of maternal origin. As embryogenesis proceeds, the levels of each of the src RNA sequences decline. The pre-blastoderm src gene transcripts contain poly(A) and are present on polyribosomes suggesting that they are functional mRNAs. Since the Drosophila src transcripts were maternally inherited, we also investigated their distribution in adult females. The majority of the src transcripts in adult females were contained in ovaries. Only low levels of the transcripts were detected in males. These results strongly suggest that an abundant supply of src protein is required during early embryogenesis, perhaps at the time of cellularization of the blastoderm nuclei. Images PMID:3923437

  11. The alpaca agouti gene: genomic locus, transcripts and causative mutations of eumelanic and pheomelanic coat color.

    PubMed

    Chandramohan, Bathrachalam; Renieri, Carlo; La Manna, Vincenzo; La Terza, Antonietta

    2013-06-01

    The agouti gene encodes the agouti signaling protein (ASIP) which regulates pheomelanin and eumelanin synthesis in mammals. To investigate the role of agouti in coat color variation of alpaca, we characterized the agouti gene and identified three mutations potentially involved with the determinism of eumelanic and pheomelanic phenotypes. The exon-4 hosts the mutations g.3836C>T, g.3896G>A and g.3866_3923del57. Further analysis of these mutations revealed two genotypes for black animals. The reverse transcription analysis of mRNA purified from skin biopsies of alpaca revealed the presence of three transcripts with different 5' untranslated regions (UTRs) and color specific expression. The white specific transcript, possibly originating from a duplication event (intra-chromosomal recombination) of the agouti gene is characterise by a 5'UTR containing 142bp of the NCOA6 gene sequence. Furthermore, the relative level expression analysis of mRNA demonstrates that the agouti gene has up-regulated expression in white skin, suggesting a pleiotropic effect of agouti in the white phenotype. Our findings refine the structure of the agouti locus and transcripts and provide additional information in order to understand the role of agouti in the pigmentation of alpaca.

  12. Colorimetric detection of gene transcript by target-induced three-way junction formation.

    PubMed

    Wang, Xuchu; Liu, Weiwei; Yin, Binbin; Yu, Pan; Duan, Xiuzhi; Liao, Zhaoping; Liu, Chunhua; Sang, Yiwen; Zhang, Gong; Chen, Yuhua; Tao, Zhihua

    2016-09-01

    Gene transcript often varies by alternative splicing, which plays different biological role that results in diversity of gene expression. Therefore, a simple and accurate identification of targeted transcript variant is of prime importance to achieve a precise molecular diagnosis. In this work, we presented a three-way junction based system where two split G-quadruplex forming sequences were coupled into two probes. Only upon the introduction of target gene transcript that offering a specific recognizable splicing site did the two probes assembled into three way junction conformation in a devised process, thus providing a functional G-quadruplex conformation that greatly enhanced hemin peroxidation. A notable resolution for gene splicing site detection was achieved. The detection limitation by colorimetric assay was 0.063μM, and this system has been proved to discriminate even in a single base false level around splicing site (about 3 times of single mismatched analyte to gain an equal signal by perfect analyte ). Furthermore, recoveries of 78.1%, 88.1%, 104.6% were obtained with 0.75μM, 0.25μM, 0.083μM of target, respectively, showing a capacity to further exploit a simple equipped device for gene transcript detection. PMID:27343570

  13. Laccase Gene Family in Cerrena sp. HYB07: Sequences, Heterologous Expression and Transcriptional Analysis.

    PubMed

    Yang, Jie; Xu, Xinqi; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2016-01-01

    Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1-8) from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases. PMID:27527131

  14. 20-Hydroxyecdysone stimulates the accumulation of translatable yolk polypeptide gene transcript in adult male Drosophila melanogaster.

    PubMed

    Shirk, P D; Minoo, P; Postlethwait, J H

    1983-01-01

    Yolk polypeptide (YP) synthesis is hormonally stimulated during maturation of adult female Drosophila melanogaster. Synthesis of the three YPs is sex specific and occurs in fat body cells and follicle cells of adult females. However, males have been shown to produce YPs when treated with the steroid hormone 20-hydroxyecdysone (20-HE). By using a cell-free translation system as an assay for YP mRNA, we found that 20-HE also causes the accumulation of translatable YP message in males. In addition, hybridization of cloned copies of genes for both YP1 and YP3 to total RNA from males showed that 20-HE caused the appearance of YP gene transcripts in males. Eight hours after treatment of males with 20-HE, YP gene transcript levels had increased at least 25-fold to approximately 2.7 x 10(6) copies of YP1 gene transcript per adult male fly. In normal adult females, there were 42 x 10(6) copies per fly by 24 hr. There was neither detectable YP synthesis nor translatable YP gene transcript in either normal 1- to 3-day-old males or 24-hr-old males treated with a juvenile hormone analogue. This evidence shows that 20-HE acts to regulate the levels of translatable YP mRNA in male Drosophila.

  15. Abundances of crenarchaeal amoA genes and transcripts in the Pacific Ocean.

    PubMed

    Church, Matthew J; Wai, Brenner; Karl, David M; DeLong, Edward F

    2010-03-01

    Planktonic Crenarchaea are thought to play a key role in chemolithotrophic ammonia oxidation, a critical step of the marine nitrogen (N) cycle. In this study, we examined the spatial distributions of ammonia-oxidizing Crenarchaea across a large (approximately 5200 km) region of the central Pacific Ocean. Examination of crenarchaeal 16S rRNA, ammonia monooxygenase subunit A (amoA) genes, and amoA transcript abundances provided insight into their spatial distributions and activities. Crenarchaeal gene abundances increased three to four orders of magnitude with depth between the upper ocean waters and dimly lit waters of the mesopelagic zone. The resulting median value of the crenarchaeal amoA: 16S rRNA gene ratio was 1.3, suggesting the majority of Crenarchaea in the epi- and mesopelagic regions of the Pacific Ocean have the metabolic machinery for ammonia oxidation. Crenarchaeal amoA transcript abundances typically increased one to two orders of magnitude in the transitional zone separating the epipelagic waters from the mesopelagic (100-200 m), before decreasing into the interior of the mesopelagic zone. The resulting gene copy normalized transcript abundances revealed elevated amoA expression in the upper ocean waters (0-100 m) where crenarchaeal abundances were low, with transcripts decreasing into the mesopelagic zone as crenarchaeal gene abundances increased. These results suggest ammonia-oxidizing Crenarchaea are active contributors to the N cycle throughout the epi- and mesopelagic waters of the Pacific Ocean.

  16. A viral satellite DNA vector-induced transcriptional gene silencing via DNA methylation of gene promoter in Nicotiana benthamiana.

    PubMed

    Ju, Zheng; Wang, Lei; Cao, Dongyan; Zuo, Jinhua; Zhu, Hongliang; Fu, Daqi; Luo, Yunbo; Zhu, Benzhong

    2016-09-01

    Virus-induced gene silencing (VIGS) has been widely used for plant functional genomics study at the post-transcriptional level using various DNA or RNA viral vectors. However, while virus-induced transcriptional gene silencing (VITGS) via DNA methylation of gene promoter was achieved using several plant RNA viral vectors, it has not yet been done using a satellite DNA viral vector. In this study, a viral satellite DNA associated with tomato yellow leaf curl China virus (TYLCCNV), which has been modified as a VIGS vector in previous research, was developed as a VITGS vector. Firstly, the viral satellite DNA VIGS vector was further optimized to a more convenient p1.7A+2mβ vector with high silencing efficiency of the phytoene desaturase (PDS) gene in Nicotiana benthamiana plants. Secondly, the constructed VITGS vector (TYLCCNV:35S), which carried a portion of the cauliflower mosaic virus 35S promoter, could successfully induce heritable transcriptional gene silencing (TGS) of the green fluorescent protein (GFP) gene in the 35S-GFP transgenic N. benthamiana line 16c plants. Moreover, bisulfite sequencing results revealed higher methylated cytosine residues at CG, CHG and CHH sites of the 35S promoter sequence in TYLCCNV:35S-inoculated plants than in TYLCCNV-inoculated line 16c plants (control). Overall, these results demonstrated that the viral satellite DNA vector could be used as an effective VITGS vector to study DNA methylation in plant genomes. PMID:27422476

  17. Amino Acid Supplementation Affects Imprinted Gene Transcription Patterns in Parthenogenetic Porcine Blastocysts

    PubMed Central

    Park, Chi-Hun; Jeong, Young-Hee; Jeong, Yeun-Ik; Kwon, Jeong-Woo; Shin, Taeyoung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Kim, Nam-Hyung; Seo, Sang-Kyo; Lee, Chang-Kyu; Hwang, Woo-Suk

    2014-01-01

    To determine whether exogenous amino acids affect gene transcription patterns in parthenogenetic porcine embryos, we investigated the effects of amino acid mixtures in culture medium. Parthenogenetic embryos were cultured in PZM3 medium under four experimental conditions: 1) control (no amino acids except L-glutamine and taurine); 2) nonessential amino acids (NEAA); 3) essential amino acids (EAA); and 4) NEAA and EAA. The rate of development of embryos to the four-cell stage was not affected by treatment. However, fewer (P<0.05) embryos cultured with EAA (12.8%) reached the blastocyst stage as compared with the control group (25.6%) and NEAA group (30.3%). Based on these findings, we identified genes with altered expression in parthenogenetic embryos exposed to medium with or without EAAs. The results indicated that EAA influenced gene expression patterns, particularly those of imprinted genes (e.g., H19, IGF2R, PEG1, XIST). However, NEAAs did not affect impaired imprinted gene expressions induced by EAA. The results also showed that mechanistic target of rapamycin (MTOR) mRNA expression was significantly increased by EAA alone as compared with control cultures, and that the combined treatment with NEAA and EAA did not differ significantly from those of control cultures. Our results revealed that gene transcription levels in porcine embryos changed differentially depending on the presence of EAA or NEAA. However, the changes in the H19 mRNA observed in the parthenogenetic blastocysts expression level was not related to the DNA methylation status in the IGF2/H19 domain. The addition of exogenous amino acid mixtures affected not only early embryonic development, but also gene transcription levels, particularly those of imprinted genes. However, this study did not reveal how amino acids affect expression of imprinted genes under the culture conditions used. Further studies are thus required to fully evaluate how amino acids affect transcriptional regulation in porcine

  18. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factors in flower development

    PubMed Central

    2014-01-01

    Background Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the mechanisms by which these factors dynamically regulate the expression of their target genes at different developmental stages are still poorly understood. Results We characterized the relationship of chromatin accessibility, gene expression, and DNA binding of two MADS-domain proteins at different stages of Arabidopsis flower development. Dynamic changes in APETALA1 and SEPALLATA3 DNA binding correlated with changes in gene expression, and many of the target genes could be associated with the developmental stage in which they are transcriptionally controlled. We also observe dynamic changes in chromatin accessibility during flower development. Remarkably, DNA binding of APETALA1 and SEPALLATA3 is largely independent of the accessibility status of their binding regions and it can precede increases in DNA accessibility. These results suggest that APETALA1 and SEPALLATA3 may modulate chromatin accessibility, thereby facilitating access of other transcriptional regulators to their target genes. Conclusions Our findings indicate that different homeotic factors regulate partly overlapping, yet also distinctive sets of target genes in a partly stage-specific fashion. By combining the information from DNA-binding and gene expression data, we are able to propose models of stage-specific regulatory interactions, thereby addressing dynamics of regulatory networks throughout flower development. Furthermore, MADS-domain TFs may regulate gene expression by alternative strategies, one of which is modulation of chromatin accessibility. PMID:24581456

  19. Defining the epigenetic actions of growth hormone: acute chromatin changes accompany GH-activated gene transcription.

    PubMed

    Chia, Dennis J; Rotwein, Peter

    2010-10-01

    Many of the long-term physiological effects of GH require hormone-mediated changes in gene expression. The transcription factor signal transducer and activator of transcription 5b (Stat5b) plays a critical role in the actions of GH on growth and metabolism by regulating a large number of GH-dependent genes by incompletely understood mechanisms. Here we have assessed the impact of GH-initiated and Stat5b-mediated signaling on the chromatin landscape of hormone-regulated genes in the liver of pituitary-deficient young adult male rats. In the absence of GH there was minimal ongoing transcription at the Socs2, Cish, Igfals, and Spi 2.1 promoters, minimal occupancy of Stat5b at proximal promoter sites, and relatively closed chromatin, as evidenced by low levels of core histone acetylation. In contrast, transcriptionally silent Igf1 promoter 1 appeared poised to be activated, based on binding of coactivators p300 and Med1/Trap220, high levels of histone acetylation, and the presence of RNA polymerase II. GH treatment led to a 8- to 20-fold rise in transcriptional activity of all five genes within 30-60 min and was accompanied by binding of Stat5b to the proximal Socs2, Cish, Igfals, and Spi 2.1 promoters and to seven distal Igf1 Stat5b elements, by enhanced histone acetylation at all five promoters, by recruitment of RNA polymerase II to the Socs2, Cish, Igfals, and Spi 2.1 promoters, and by loss of the transcriptional repressor Bcl6 from Socs2, Cish, and Igfals Stat5b sites, but not from two Igf1 Stat5b domains. We conclude that GH actions induce rapid and dramatic changes in hepatic chromatin at target promoters and propose that the chromatin signature of Igf1 differs from other GH-and Stat5b-dependent genes. PMID:20702579

  20. An inverted TATA box directs downstream transcription of the bone sialoprotein gene.

    PubMed Central

    Li, J J; Kim, R H; Sodek, J

    1995-01-01

    The orientation of the TATA box is thought to direct downstream transcription of eukaryotic genes by RNA polymerase II. However, the putative TATA box in the promoter of the bone sialoprotein (BSP) gene, which codes for a tissue-specific and developmentally regulated bone matrix protein, is inverted (5'-TTTATA-3') relative to the consensus TATA box sequence (5'-TATAAA-3') and is overlapped by a vitamin D3-response element. Here we show that the inverted TATA sequence in the rat BSP gene binds to recombinant TATA-box-binding protein (TBP) with an affinity similar to that observed with the consensus TATA box, and site-directed point mutations in the inverted TATA sequence (mutating TTTATA into TCTCTA) abrogate both TBP binding and BSP promoter activity. However, when the inverted TATA sequence is changed to a canonical TATAAA, the TBP- and vitamin D3 receptor-binding properties together with the BSP promoter activity are retained. In addition, we found that the TBP is required to reconstitute in vitro transcription driven by the BSP promoter. These studies, which have revealed a naturally occurring inverted TATA box that can bind TBP and direct downstream transcription, demonstrate that the orientation of the TATA box does not determine the direction of transcription in higher eukaryotic genes. Consequently, the inverted TATA box that is conserved in the human, rat and mouse BSP gene promoters will provide an excellent in vivo model to investigate the polarity of the transcription factor IID-DNA complex and its relation to downstream transcription. Images Figure 1 Figure 2 Figure 3 Figure 5 Figure 6 Figure 7 PMID:7646464

  1. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  2. A subgroup of MYB transcription factor genes undergoes highly conserved alternative splicing in Arabidopsis and rice.

    PubMed

    Li, Jigang; Li, Xiaojuan; Guo, Lei; Lu, Feng; Feng, Xiaojie; He, Kun; Wei, Liping; Chen, Zhangliang; Qu, Li-Jia; Gu, Hongya

    2006-01-01

    MYB transcription factor genes play important roles in many developmental processes and in various defence responses of plants. Two Arabidopsis R2R3-type MYB genes, AtMYB59 and AtMYB48, were found to undergo similar alternative splicing. Both genes have four distinctively spliced transcripts that encode either MYB-related proteins or R2R3-MYB proteins. An extensive BLAST search of the GenBank database resulted in finding and cloning two rice homologues, both of which were also found to share a similar alternative splicing pattern. In a semi-quantitative study, the expression of one splice variant of AtMYB59 was found to be differentially regulated in treatments with different phytohormones and stresses. GFP fusion protein analysis revealed that both of the two predicted nuclear localization signals (NLSs) in the R3 domain are required for localizing to the nucleus. Promoter-GUS analysis in transgenic plants showed that 5'-UTR is sufficient for the translation initiation of type 3 transcripts (encoding R2R3-MYB proteins), but not for type 2 transcripts (encoding MYB-related proteins). Moreover, a new type of non-canonical intron, with the same nucleotide repeats at the 5' and 3' splice sites, was identified. Thirty-eight Arabidopsis and rice genes were found to have this type of non-canonical intron, most of which undergo alternative splicing. These data suggest that this subgroup of transcription factor genes may be involved in multiple biological processes and may be transcriptionally regulated by alternative splicing. PMID:16531467

  3. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  4. Association of transcription factor gene LMX1B with autism.

    PubMed

    Thanseem, Ismail; Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Iwata, Keiko; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

    2011-01-01

    Multiple lines of evidence suggest a serotoninergic dysfunction in autism. The role of LMX1B in the development and maintenance of serotoninergic neurons is well known. In order to examine the role, if any, of LMX1B with autism pathophysiology, a trio-based SNP association study using 252 family samples from the AGRE was performed. Using pair-wise tagging method, 24 SNPs were selected from the HapMap data, based on their location and minor allele frequency. Two SNPs (rs10732392 and rs12336217) showed moderate association with autism with p values 0.018 and 0.022 respectively in transmission disequilibrium test. The haplotype AGCGTG also showed significant association (p = 0.008). Further, LMX1B mRNA expressions were studied in the postmortem brain tissues of autism subjects and healthy controls samples. LMX1B transcripts was found to be significantly lower in the anterior cingulate gyrus region of autism patients compared with controls (p = 0.049). Our study suggests a possible role of LMX1B in the pathophysiology of autism. Based on previous reports, it is likely to be mediated through a seretoninergic mechanism. This is the first report on the association of LMX1B with autism, though it should be viewed with some caution considering the modest associations we report.

  5. Association of Transcription Factor Gene LMX1B with Autism

    PubMed Central

    Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Iwata, Keiko; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

    2011-01-01

    Multiple lines of evidence suggest a serotoninergic dysfunction in autism. The role of LMX1B in the development and maintenance of serotoninergic neurons is well known. In order to examine the role, if any, of LMX1B with autism pathophysiology, a trio-based SNP association study using 252 family samples from the AGRE was performed. Using pair-wise tagging method, 24 SNPs were selected from the HapMap data, based on their location and minor allele frequency. Two SNPs (rs10732392 and rs12336217) showed moderate association with autism with p values 0.018 and 0.022 respectively in transmission disequilibrium test. The haplotype AGCGTG also showed significant association (p = 0.008). Further, LMX1B mRNA expressions were studied in the postmortem brain tissues of autism subjects and healthy controls samples. LMX1B transcripts was found to be significantly lower in the anterior cingulate gyrus region of autism patients compared with controls (p = 0.049). Our study suggests a possible role of LMX1B in the pathophysiology of autism. Based on previous reports, it is likely to be mediated through a seretoninergic mechanism. This is the first report on the association of LMX1B with autism, though it should be viewed with some caution considering the modest associations we report. PMID:21901133

  6. The mouse gene for vascular endothelial growth factor. Genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory sequences.

    PubMed

    Shima, D T; Kuroki, M; Deutsch, U; Ng, Y S; Adamis, A P; D'Amore, P A

    1996-02-16

    We describe the genomic organization and functional characterization of the mouse gene encoding vascular endothelial growth factor (VEGF), a polypeptide implicated in embryonic vascular development and postnatal angiogenesis. The coding region for mouse VEGF is interrupted by seven introns and encompasses approximately 14 kilobases. Organization of exons suggests that, similar to the human VEGF gene, alternative splicing generates the 120-, 164-, and 188-amino acid isoforms, but does not predict a fourth VEGF isoform corresponding to human VEGF206. Approximately 1. 2 kilobases of 5'-flanking region have been sequenced, and primer extension analysis identified a single major transcription initiation site, notably lacking TATA or CCAT consensus sequences. The 5'-flanking region is sufficient to promote a 7-fold induction of basal transcription. The genomic region encoding the 3'-untranslated region was determined by Northern and nuclease mapping analysis. Investigation of mRNA sequences responsible for the rapid turnover of VEGF mRNA (mRNA half-life, <1 h) (Shima, D. T. , Deutsch, U., and D'Amore, P. A. (1995) FEBS Lett. 370, 203-208) revealed that the 3'-untranslated region was sufficient to trigger the rapid turnover of a normally long-lived reporter mRNA in vitro. These data and reagents will allow the molecular and genetic analysis of mechanisms that control the developmental and pathological expression of VEGF.

  7. Evaluation of new reference genes in papaya for accurate transcript normalization under different experimental conditions.

    PubMed

    Zhu, Xiaoyang; Li, Xueping; Chen, Weixin; Chen, Jianye; Lu, Wangjin; Chen, Lei; Fu, Danwen

    2012-01-01

    Real-time reverse transcription PCR (RT-qPCR) is a preferred method for rapid and accurate quantification of gene expression studies. Appropriate application of RT-qPCR requires accurate normalization though the use of reference genes. As no single reference gene is universally suitable for all experiments, thus reference gene(s) validation under different experimental conditions is crucial for RT-qPCR analysis. To date, only a few studies on reference genes have been done in other plants but none in papaya. In the present work, we selected 21 candidate reference genes, and evaluated their expression stability in 246 papaya fruit samples using three algorithms, geNorm, NormFinder and RefFinder. The samples consisted of 13 sets collected under different experimental conditions, including various tissues, different storage temperatures, different cultivars, developmental stages, postharvest ripening, modified atmosphere packaging, 1-methylcyclopropene (1-MCP) treatment, hot water treatment, biotic stress and hormone treatment. Our results demonstrated that expression stability varied greatly between reference genes and that different suitable reference gene(s) or combination of reference genes for normalization should be validated according to the experimental conditions. In general, the internal reference genes EIF (Eukaryotic initiation factor 4A), TBP1 (TATA binding protein 1) and TBP2 (TATA binding protein 2) genes had a good performance under most experimental conditions, whereas the most widely present used reference genes, ACTIN (Actin 2), 18S rRNA (18S ribosomal RNA) and GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) were not suitable in many experimental conditions. In addition, two commonly used programs, geNorm and Normfinder, were proved sufficient for the validation. This work provides the first systematic analysis for the selection of superior reference genes for accurate transcript normalization in papaya under different experimental conditions.

  8. NFAT5 regulates transcription of the mouse telomerase reverse transcriptase gene

    SciTech Connect

    Fujiki, Tsukasa; Udono, Miyako; Kotake, Yojiro; Yamashita, Makiko; Shirahata, Sanetaka; Katakura, Yoshinori

    2010-12-10

    We aimed to clarify the transcription-regulation mechanisms of the mouse telomerase reverse transcriptase gene (mTERT). First, we searched for the promoter region required for transcriptional activation of mTERT and identified an enhancer cis-element (named mTERT-EE) located between - 200 and - 179 bp of the mouse TERT gene (mTERT). EMSA results suggested that nuclear factor of activated T cells (NFAT) member proteins bind to mTERT-EE. We then identified NFAT5 as the factor binding to mTERT-EE and found that it activates the transcription of the mTERT core promoter. The results that siRNA directed against NFAT5 significantly reduced mTERT expression and mTERT core promoter activity and that the expressions of NFAT5 and mTERT were well correlated in various mouse tissues except liver suggest that NFAT5 dominantly and directly regulates mTERT expression. To clarify their functionality further, we investigated the effect of hypertonic stress, a known stimulus affecting the expression and transcriptional activity of NFAT5, on mTERT expression. The result indicated that hypertonic stress activates mTERT transcription via the activation and recruitment of NFAT5 to the mTERT promoter. These results provide useful information about the transcription-regulation mechanisms of mTERT.

  9. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    PubMed

    Liu, Fang; Xu, Yunjian; Han, Guomin; Zhou, Lingyan; Ali, Asif; Zhu, Suwen; Li, Xiaoyu

    2016-01-01

    The productivity of maize (Zea mays L.) depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59) were divided into seven groups (I-VII). By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP) analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

  10. The emerging role of RNA in the regulation of gene transcription in human cells

    PubMed Central

    Morris, Kevin V.

    2011-01-01

    Recent evidence suggests that particular species of non-coding RNAs can modulate gene transcription in human cells. While such observations were in the past relegated to imprinted genes, it is now becoming apparent that several different genes in differentiated cells may be under some form of RNA based regulatory control. Studies carried out to date have begun to discern the mechanism of action whereby non-coding RNAs modulate gene transcription by the targeted recruitment of epigenetic silencing complexes to homology containing loci in the genome. The results of these studies will be considered in detail as well as the implications that a vast array of non-coding RNA based regulatory networks may be operative in human cells. PMID:21333746

  11. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway. PMID:24389954

  12. Role of EctR as transcriptional regulator of ectoine biosynthesis genes in Methylophaga thalassica.

    PubMed

    Mustakhimov, I I; Reshetnikov, A S; Fedorov, D N; Khmelenina, V N; Trotsenko, Y A

    2012-08-01

    In the halophilic aerobic methylotrophic bacterium Methylophaga thalassica, the genes encoding the enzymes for biosynthesis of the osmoprotectant ectoine were shown to be located in operon ectABC-ask. Transcription of the ect-operon was started from the two promoters homologous to the σ(70)-dependent promoter of Escherichia coli and regulated by protein EctR, whose encoding gene, ectR, is transcribed from three promoters. Genes homologous to ectR of methylotrophs were found in clusters of ectoine biosynthesis genes in some non-methylotrophic halophilic bacteria. EctR proteins of methylotrophic and heterotrophic halophiles belong to the MarR-family of transcriptional regulators but form a separate branch on the phylogenetic tree of the MarR proteins.

  13. Identification of Multiple Forms of RNA Transcripts Associated with Human-Specific Retrotransposed Gene Copies

    PubMed Central

    Mori, Saori; Hayashi, Masaaki; Inagaki, Shun; Oshima, Takuji; Tateishi, Ken; Fujii, Hiroshi; Suzuki, Shunsuke

    2016-01-01

    The human genome contains thousands of retrocopies, mostly as processed pseudogenes, which were recently shown to be prevalently transcribed. In particular, those specifically acquired in the human lineage are able to modulate gene expression in a manner that contributed to the evolution of human-specific traits. Therefore, knowledge of the human-specific retrocopies that are transcribed or their full-length transcript structure contributes to better understand human genome evolution. In this study, we identified 16 human-specific retrocopies that harbor 5′ CpG islands by in silico analysis and showed that 12 were transcribed in normal tissues and cancer cell lines with a variety of expression patterns, including cancer-specific expression. Determination of the structure of the transcripts associated with the retrocopies revealed that none were transcribed from their 5′ CpG islands, but rather, from inside the 3′ UTR and the nearby 5′ flanking region of the retrocopies as well as the promoter of neighboring genes. The multiple forms of the transcripts, such as chimeric and individual transcripts in both the sense and antisense orientation, might have introduced novel post-transcriptional regulation into the genome during human evolution. These results shed light on the potential role of human-specific retrocopies in the evolution of gene regulation and genomic disorders. PMID:27389689

  14. Widespread transcriptional gene inactivation initiated by a repair intermediate of 8-oxoguanine

    PubMed Central

    Allgayer, Julia; Kitsera, Nataliya; Bartelt, Solveig; Epe, Bernd; Khobta, Andriy

    2016-01-01

    DNA damage can significantly modulate expression of the affected genes either by direct structural interference with transcription components or as a collateral outcome of cellular repair attempts. Thus, DNA glycosylases of the base excision repair (BER) pathway have been implicated in negative transcriptional response to several spontaneously generated DNA base modifications, including a common oxidative DNA base modification 8-oxoguanine (8-oxoG). Here, we report that single 8-oxoG situated in the non-transcribed DNA strand of a reporter gene has a pronounced negative effect on transcription, driven by promoters of various strength and with different structural properties, including viral, human, and artificial promoters. We further show that the magnitude of the negative effect on the gene expression correlates with excision of the modified base by OGG1 in all promoter constructs tested. Moreover, by using expression vectors with nuclease resistant backbone modifications, we demonstrate that OGG1 does not catalyse DNA strand cleavage in vivo. Rather, cleavage of the phosphate bond 5′ to 8-oxodG (catalysed by APE1) is essential and universally required for the onset of transcriptional silencing, regardless of the promoter structure. Hence, induction of transcriptional silencing emerges as a ubiquitous mode of biological response to 8-oxoG in DNA. PMID:27220469

  15. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences

    PubMed Central

    Soneson, Charlotte; Love, Michael I.; Robinson, Mark D.

    2016-01-01

    High-throughput sequencing of cDNA (RNA-seq) is used extensively to characterize the transcriptome of cells. Many transcriptomic studies aim at comparing either abundance levels or the transcriptome composition between given conditions, and as a first step, the sequencing reads must be used as the basis for abundance quantification of transcriptomic features of interest, such as genes or transcripts. Various quantification approaches have been proposed, ranging from simple counting of reads that overlap given genomic regions to more complex estimation of underlying transcript abundances. In this paper, we show that gene-level abundance estimates and statistical inference offer advantages over transcript-level analyses, in terms of performance and interpretability. We also illustrate that the presence of differential isoform usage can lead to inflated false discovery rates in differential gene expression analyses on simple count matrices but that this can be addressed by incorporating offsets derived from transcript-level abundance estimates. We also show that the problem is relatively minor in several real data sets. Finally, we provide an R package ( tximport) to help users integrate transcript-level abundance estimates from common quantification pipelines into count-based statistical inference engines. PMID:26925227

  16. Regulating expression of cell and tissue-specific genes by modifying transcription

    SciTech Connect

    Beachy, Roger N; Dai, Shunhong

    2010-06-14

    Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Rice bZIP transcription factors RF2a, RF2b and RLP1 play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV), through their interactions with the Box II essential cis element located in the promoter (Dai et al., 2006., Dai et al., 2004., Yin et al., 1997). RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. It is equally as important to recognize that these proteins control plant development by regulating differentiation and/or function of the vascular tissues. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins will not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants. We have proposed characterize the function domains of RF2a, RF2b and RLP1 and explore the biological function of the transcription repressor RLP1.

  17. Overexpression of mitochondrial uncoupling protein 1 (UCP1) induces a hypoxic response in Nicotiana tabacum leaves

    PubMed Central

    Barreto, Pedro; Okura, Vagner; Pena, Izabella A.; Maia, Renato; Maia, Ivan G.; Arruda, Paulo

    2016-01-01

    Mitochondrial uncoupling protein 1 (UCP1) decreases reactive oxygen species production under stress conditions by uncoupling the electrochemical gradient from ATP synthesis. This study combined transcriptome profiling with experimentally induced hypoxia to mechanistically dissect the impact of Arabidopsis thaliana UCP1 (AtUCP1) overexpression in tobacco. Transcriptomic analysis of AtUCP1-overexpressing (P07) and wild-type (WT) plants was carried out using RNA sequencing. Metabolite and carbohydrate profiling of hypoxia-treated plants was performed using 1H-nuclear magnetic resonance spectroscopy and high-performance anion-exchange chromatography with pulsed amperometric detection. The transcriptome of P07 plants revealed a broad induction of stress-responsive genes that were not strictly related to the mitochondrial antioxidant machinery, suggesting that overexpression of AtUCP1 imposes a strong stress response within the cell. In addition, transcripts that mapped into carbon fixation and energy expenditure pathways were broadly altered. It was found that metabolite markers of hypoxic adaptation, such as alanine and tricarboxylic acid intermediates, accumulated in P07 plants under control conditions at similar rates to WT plants under hypoxia. These findings indicate that constitutive overexpression of AtUCP1 induces a hypoxic response. The metabolites that accumulated in P07 plants are believed to be important in signalling for an improvement in carbon assimilation and induction of a hypoxic response. Under these conditions, mitochondrial ATP production is less necessary and fermentative glycolysis becomes critical to meet cell energy demands. In this scenario, the more flexible energy metabolism along with an intrinsically activated hypoxic response make these plants better adapted to face several biotic and abiotic stresses. PMID:26494730

  18. Transcription Analysis of a Lantibiotic Gene Cluster from Bifidobacterium longum DJO10A▿

    PubMed Central

    Lee, Ju-Hoon; Li, Xiulan; O'Sullivan, Daniel J.

    2011-01-01

    Bifidobacterium longum DJO10A was previously demonstrated to produce a lantibiotic, but only during growth on agar media. To evaluate the feasibility of production of this lantibiotic in broth media, a transcription analysis of the lanA gene was undertaken. Comparative microarray analysis of broth and agar cultures of B. longum DJO10A revealed that the lantibiotic production, modification, transport/peptidase, and immunity genes were significantly upregulated in agar cultures, while the two-component regulatory genes were expressed equally under both conditions. This suggested that the signal transduction regulatory system should function in broth cultures. Real-time PCR and Northern hybridization confirmed that lanA gene expression was significantly repressed in broth cultures. A crude lantibiotic preparation from an agar-grown culture was obtained, and its antimicrobial spectrum analysis revealed a broad inhibition range. Addition of this extract to broth cultures of B. longum DJO10A induced lanA gene expression in a dose-dependent fashion. Subinoculation using >10% of an induced broth culture maintained lanA expression. The expression of lanA was log-phase specific, being significantly downregulated in stationary phase. Transcription start analysis of lanA revealed a 284-bp 5′ untranslated region, which was proposed to be involved in repression of transcription, while an inverted repeat structure located at bp −75 relative to the transcription start was strategically located to likely function as a binding site for the two-component response regulator. Understanding the transcription regulation of this lanA gene is the first step toward enabling production of this novel and potentially interesting lantibiotic in broth cultures. PMID:21742926

  19. Inhibition of gene transcription by purine rich triplex forming oligodeoxyribonucleotides.

    PubMed Central

    Roy, C

    1993-01-01

    Several oligodeoxynucleotides (ODNs) were designed in order to interact with the purine rich element of the IRE (Interferon Responsive Element) of the 6-16 gene by triplex formation. An ODN of 21 bases, the sequence being identical to that of the purine strand of the IRE (48% G), but in reverse orientation, was able to interact with the IRE (KD: 20 nM). The binding was Mg2+ dependent. The two purine strands of the triplex were oriented antiparallel as confirmed by DNAase I and copper-phenanthroline footprinting experiments. An ODN in which A were replaced by T, also interacted with the same target, but with a lower affinity. Exonuclease III action indicated that the two IRE repeats of the 6-16 promoter interacted with each other through Hoogsteen base pairing, the third strand being parallel to the paired Watson-Crick strand. This led to a potential H-DNA structure which could be destabilized by adding ODNs able to form a triplex structure. 6-16 IRE driven-reporter gene constructs lost their interferon stimulability when co-transfected with triplex forming ODNs. The range of effective ODN concentrations was compatible with the affinity determined when measuring their direct interactions with the DNA. Images PMID:7687346

  20. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria × ananassa) defense responses.

    PubMed

    Amil-Ruiz, Francisco; Garrido-Gala, José; Blanco-Portales, Rosario; Folta, Kevin M; Muñoz-Blanco, Juan; Caballero, José L

    2013-01-01

    Strawberry (Fragaria spp) is an emerging model for the development of basic genomics and recombinant DNA studies among rosaceous crops. Functional genomic and molecular studies involve relative quantification of gene expression under experimental conditions of interest. Accuracy and reliability are dependent upon the choice of an optimal reference control transcript. There is no information available on validated endogenous reference genes for use in studies testing strawberry-pathogen interactions. Thirteen potential pre-selected strawberry reference genes were tested against different tissues, strawberry cultivars, biotic stresses, ripening and senescent conditions, and SA/JA treatments. Evaluation of reference candidate's suitability was analyzed by five different methodologies, and information was merged to identify best reference transcripts. A combination of all five methods was used for selective classification of reference genes. The resulting superior reference genes, FaRIB413, FaACTIN, FaEF1α and FaGAPDH2 are strongly recommended as control genes for relative quantification of gene expression in strawberry. This report constitutes the first systematic study to identify and validate optimal reference genes for accurate normalization of gene expression in strawberry plant defense response studies.

  1. GENES REGULATED BY CALORIC RESTRICTION HAVE UNIQUE ROLES WITHIN TRANSCRIPTIONAL NETWORKS

    PubMed Central

    Swindell, William R.

    2009-01-01

    Caloric restriction (CR) has received much interest as an intervention that delays age-related disease and increases lifespan. Whole-genome microarrays have been used to identify specific genes underlying these effects, and in mice, this has led to the identification of genes with expression responses to CR that are shared across multiple tissue types. Such CR-regulated genes represent strong candidates for future investigation, but have been understood only as a list, without regard to their broader role within transcriptional networks. In this study, co-expression and network properties of CR-regulated genes were investigated using data generated by more than 600 Affymetrix microarrays. This analysis identified groups of co-expressed genes and regulatory factors associated with the mammalian CR response, and uncovered surprising network properties of CR-regulated genes. Genes downregulated by CR were highly connected and located in dense network regions. In contrast, CR-upregulated genes were weakly connected and positioned in sparse network regions. Some network properties were mirrored by CR-regulated genes from invertebrate models, suggesting an evolutionary basis for the observed patterns. These findings contribute to a systems-level picture of how CR influences transcription within mammalian cells, and point towards a comprehensive understanding of CR in terms of its influence on biological networks. PMID:18634819

  2. Control of transcription of gal repressor and isorepressor genes in Escherichia coli.

    PubMed Central

    Weickert, M J; Adhya, S

    1993-01-01

    Two regulatory proteins, Gal repressor and isorepressor, control the expression of the gal and mgl operons in Escherichia coli. The transcription start sites for galR and galS, the genes for the repressor and isorepressor, were determined by primer extension of in vivo transcripts. Study of the promoter-lacZ gene fusions introduced into the chromosome indicated that galS expression was elevated in cells in which the normal galS gene was interrupted, but not in cells in which the galR gene was deleted. When both genes were disrupted, galS expression was further elevated. Expression from the galS promoter was stimulated by the addition of D-fucose, repressed by glucose, and dependent on cyclic AMP receptor protein (CRP). Expression of a similar gene fusion of the galR promoter to lacZ was unregulated. Both galR and galS genes contain two potential operator sites (OE and OI) and a CRP-binding site. The arrangement of OE, OI, and the CRP-binding site in the galS gene is analogous to the arrangement in the gal and mgl promoters, but the arrangement in galR is atypical. The increased concentration of the isorepressor when inducer is present may facilitate early shutoff of the isorepressor-regulated genes of the gal regulon when inducer (substrate) concentration falls. Images PMID:8416900

  3. Transcriptional Responses of Glutathione Transferase Genes in Ruditapes philippinarum Exposed to Microcystin-LR

    PubMed Central

    Reis, Bruno; Carneiro, Mariana; Machado, João; Azevedo, Joana; Vasconcelos, Vitor; Martins, José Carlos

    2015-01-01

    Glutathione Transferases (GSTs) are phase II detoxification enzymes known to be involved in the molecular response against microcystins (MCs) induced toxicity. However, the individual role of the several GST isoforms in the MC detoxification process is still unknown. In this study, the time-dependent changes on gene expression of several GST isoforms (pi, mu, sigma 1, sigma 2) in parallel with enzymatic activity of total GST were investigated in gills and hepatopancreas of the bivalve Ruditapes philippinarum exposed to pure MC-LR (10 and 100 µg/L). No significant changes in GST enzyme activities were found on both organs. In contrast, MC-LR affected the transcriptional activities of these detoxification enzymes both in gills and hepatopancreas. GST transcriptional changes in gills promoted by MC-LR were characterized by an early (12 h) induction of mu and sigma 1 transcripts. On the other hand, the GST transcriptional changes in hepatopancreas were characterized by a later induction (48 h) of mu transcript, but also by an early inhibition (6 h) of the four transcripts. The different transcription patterns obtained for the tested GST isoforms in this study highlight the potential divergent physiological roles played by these isoenzymes during the detoxification of MC-LR. PMID:25884330

  4. A Brassica exon array for whole-transcript gene expression profiling.

    PubMed

    Love, Christopher G; Graham, Neil S; O Lochlainn, Seosamh; Bowen, Helen C; May, Sean T; White, Philip J; Broadley, Martin R; Hammond, John P; King, Graham J

    2010-01-01

    Affymetrix GeneChip® arrays are used widely to study transcriptional changes in response to developmental and environmental stimuli. GeneChip® arrays comprise multiple 25-mer oligonucleotide probes per gene and retain certain advantages over direct sequencing. For plants, there are several public GeneChip® arrays whose probes are localised primarily in 3' exons. Plant whole-transcript (WT) GeneChip® arrays are not yet publicly available, although WT resolution is needed to study complex crop genomes such as Brassica, which are typified by segmental duplications containing paralogous genes and/or allopolyploidy. Available sequence data were sampled from the Brassica A and C genomes, and 142,997 gene models identified. The assembled gene models were then used to establish a comprehensive public WT exon array for transcriptomics studies. The Affymetrix GeneChip® Brassica Exon 1.0 ST Array is a 5 µM feature size array, containing 2.4 million 25-base oligonucleotide probes representing 135,201 gene models, with 15 probes per gene distributed among exons. Discrimination of the gene models was based on an E-value cut-off of 1E(-5), with ≤98% sequence identity. The 135 k Brassica Exon Array was validated by quantifying transcriptome differences between leaf and root tissue from a reference Brassica rapa line (R-o-18), and categorisation by Gene Ontologies (GO) based on gene orthology with Arabidopsis thaliana. Technical validation involved comparison of the exon array with a 60-mer array platform using the same starting RNA samples. The 135 k Brassica Exon Array is a robust platform. All data relating to the array design and probe identities are available in the public domain and are curated within the BrassEnsembl genome viewer at http://www.brassica.info/BrassEnsembl/index.html.

  5. Real-time reverse-transcription polymerase chain reaction: technical considerations for gene expression analysis.

    PubMed

    Doak, Shareen H; Zaïr, Zoulikha M

    2012-01-01

    The reverse transcription - polymerase chain reaction (RT-PCR) is a sensitive technique for the quantification of steady-state mRNA levels, particularly in samples with limited quantities of extracted RNA, or for analysis of low level transcripts. The procedure amplifies defined mRNA transcripts by taking advantage of retroviral enzymes with reverse transcriptase (RT) activity, coupled to PCR. The resultant PCR product concentration is directly proportional to the initial starting quantity of mRNA, therefore allowing quantification of gene expression by incorporation of a fluorescence detector for the appropriate amplicons. In this chapter, we describe a number of the most popular techniques for performing RT-PCR and detail the subsequent analysis methodologies required to interpret the resultant data in either a relative manner or through absolute quantification of gene expression levels.

  6. Negative control of CSL gene transcription by stress/DNA damage response and p53.

    PubMed

    Menietti, Elena; Xu, Xiaoying; Ostano, Paola; Joseph, Jean-Marc; Lefort, Karine; Dotto, G Paolo

    2016-07-01

    CSL is a key transcriptional repressor and mediator of Notch signaling. Despite wide interest in CSL, mechanisms responsible for its own regulation are little studied. CSL down-modulation in human dermal fibroblasts (HDFs) leads to conversion into cancer associated fibroblasts (CAF), promoting keratinocyte tumors. We show here that CSL transcript levels differ among HDF strains from different individuals, with negative correlation with genes involved in DNA damage/repair. CSL expression is negatively regulated by stress/DNA damage caused by UVA, Reactive Oxygen Species (ROS), smoke extract, and doxorubicin treatment. P53, a key effector of the DNA damage response, negatively controls CSL gene transcription, through suppression of CSL promoter activity and, indirectly, by increased p21 expression. CSL was previously shown to bind p53 suppressing its activity. The present findings indicate that p53, in turn, decreases CSL expression, which can serve to enhance p53 activity in acute DNA damage response of cells.

  7. Transcription of metabolic enzyme genes during the excystation of Giardia lamblia.

    PubMed

    Niño, Carlos A; Wasserman, Moises

    2003-12-01

    The present study evaluates the expression of genes of Giardia lamblia, one of the most simple and most early diverging eukaryotes, that encode the metabolic enzymes pyruvate: ferredoxin oxidoreductase (PFOR), acetyl-CoA synthetase (ACS), alcohol dehydrogenase E (ADHE) and glutamate dehydrogenase (GDH) and the cyst wall protein (CWP1) gene in trophozoites, cysts and during the excystation process. Primers were designed to amplify mRNA fragments through quantitative reverse-transcriptase-polymerase-chain-reaction. In trophozoites, all transcripts of the enzymes studied were present. In cysts, three of the transcripts were detected: CWP1, GDH and ACS; but the relative levels of the mRNA of GDH and ACS were very different between trophozoites and cysts. During excystation, PFOR and ADHE transcripts appeared after the first induction phase, and the mRNAs of ACS and GDH increased throughout the process. PMID:14665385

  8. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central

    2016-01-01

    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  9. Functional analysis of the transcriptional promoter for the CYP1A1 gene.

    PubMed Central

    Jones, K W; Whitlock, J P

    1990-01-01

    In mouse hepatoma cells, the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increases the transcription rate of the CYP1A1 gene, which encodes a cytochrome P-450 enzyme. In this study, we analyzed the DNA region immediately upstream of the CYP1A1 gene. A domain that extends upstream to nucleotide--166 was found to function as a transcriptional promoter. The promoter was silent when uncoupled from the dioxin-responsive enhancer located farther upstream. DNase footprinting experiments indicated that nuclear proteins interact with distinct domains of the promoter in a TCDD-independent fashion. Mutational analyses indicated that the CYP1A1 promoter contains at least three functional domains, including a TATAAA sequence, a CCAAT box transcription factor/nuclear factor I-like recognition motif, and a guanine-rich G box. Images PMID:2398886

  10. ZmMADS47 Regulates Zein Gene Transcription through Interaction with Opaque2.

    PubMed

    Qiao, Zhenyi; Qi, Weiwei; Wang, Qian; Feng, Ya'nan; Yang, Qing; Zhang, Nan; Wang, Shanshan; Tang, Yuanping; Song, Rentao

    2016-04-01

    Zeins, the predominent storage proteins in maize endosperm, are encoded by multiple genes and gene families. However, only a few transcriptional factors for zein gene regulation have been functionally characterized. In this study, a MADS-box protein, namely ZmMADS47, was identified as an Opaque2 (O2) interacting protein via yeast two-hybrid screening. The N-terminal portion of ZmMADS47 contains a nuclear localization signal (NLS), and its C-terminal portion contains a transcriptional activation domain (AD). Interestingly, the transcriptional activation activity is blocked in its full length form, suggesting conformational regulation of the AD. Molecular and RNA-seq analyses of ZmMADS47 RNAi lines revealed down regulation of α-zein and 50-kD γ-zein genes. ZmMADS47 binds the CATGT motif in promoters of these zein genes, but ZmMADS47 alone is not able to transactivate the promoters. However, when both O2 and ZmMADS47 are present, the transactivation of these promoters was greatly enhanced. This enhancement was dependent on the AD function of ZmMADS47 and the interaction between ZmMADS47 and O2, but it was independent from the AD function of O2. Therefore, it appears interaction with O2 activates ZmMADS47 on zein gene promoters. PMID:27077660

  11. Rapid parallel evolutionary changes of gene transcription profiles in farmed Atlantic salmon.

    PubMed

    Roberge, Christian; Einum, Sigurd; Guderley, Helga; Bernatchez, Louis

    2006-01-01

    Farmed salmon strains have been selected to improve growth rates as well as other traits of commercial interest but the 2 million farmed salmon escaping annually may enhance the risk of extinction of wild populations through genetic and ecological interactions. Here, we compare the transcription profiles of 3557 genes in the progeny of farmed and wild Atlantic salmon from Norway and Canada grown in controlled conditions, and demonstrate that five to seven generations of artificial selection led to heritable changes in gene transcription profiles, the average magnitude of the differences being 25% and 18% for at least 1.4% and 1.7% of the expressed genes in juvenile salmon from Norway and Canada, respectively. Moreover, genes showing significant transcription profile differences in both farmed strains (16%) all exhibited parallel changes. These findings, along with the identification of several genes whose expression profiles were modified through artificial selection, provide new insights into the molecular basis of parallel evolution, and suggest how gene flow from farmed escapees may affect the genetic integrity of wild populations. PMID:16367826

  12. Recruitment of Transcription Complexes to the β-Globin Gene Locus in Vivo and in Vitro*

    PubMed Central

    Vieira, Karen F.; Levings, Padraic P.; Hill, Meredith A.; Crusselle, Valerie J.; Kang, Sung-Hae Lee; Engel, James Douglas; Bungert, Jörg

    2013-01-01

    Erythroid-specific, high level expression of the β-globin genes is regulated by the locus control region (LCR), composed of multiple DNase I-hypersensitive sites and located far upstream of the genes. Recent studies have shown that LCR core elements recruit RNA polymerase II (pol II). In the present study we demonstrate the following: 1) pol II and other basal transcription factors are recruited to LCR core hypersensitive elements; 2) pol II dissociates from and re-associates with the globin gene locus during replication; 3) pol II interacts with the LCR but not with the β-globin gene prior to erythroid differentiation in embryonic stem cells; and 4) the erythroid transcription factor NF-E2 facilitates the transfer of pol II from immobilized LCR constructs to a β-globin gene in vitro. The data are consistent with the hypothesis that the LCR serves as the primary attachment site for the recruitment of macromolecular complexes involved in chromatin structure alterations and transcription of the globin genes. PMID:15385559

  13. Rapid parallel evolutionary changes of gene transcription profiles in farmed Atlantic salmon.

    PubMed

    Roberge, Christian; Einum, Sigurd; Guderley, Helga; Bernatchez, Louis

    2006-01-01

    Farmed salmon strains have been selected to improve growth rates as well as other traits of commercial interest but the 2 million farmed salmon escaping annually may enhance the risk of extinction of wild populations through genetic and ecological interactions. Here, we compare the transcription profiles of 3557 genes in the progeny of farmed and wild Atlantic salmon from Norway and Canada grown in controlled conditions, and demonstrate that five to seven generations of artificial selection led to heritable changes in gene transcription profiles, the average magnitude of the differences being 25% and 18% for at least 1.4% and 1.7% of the expressed genes in juvenile salmon from Norway and Canada, respectively. Moreover, genes showing significant transcription profile differences in both farmed strains (16%) all exhibited parallel changes. These findings, along with the identification of several genes whose expression profiles were modified through artificial selection, provide new insights into the molecular basis of parallel evolution, and suggest how gene flow from farmed escapees may affect the genetic integrity of wild populations.

  14. Transcription factors and microRNA-co-regulated genes in gastric cancer invasion in ex vivo.

    PubMed

    Shi, Yue; Wang, Jihan; Xin, Zhuoyuan; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2015-01-01

    Aberrant miRNA expression abnormally modulates gene expression in cells and can contribute to tumorigenesis in humans. This study identified functionally relevant differentially expressed genes using the transcription factors and miRNA-co-regulated network analysis for gastric cancer. The TF-miRNA co-regulatory network was constructed based on data obtained from cDNA microarray and miRNA expression profiling of gastric cancer tissues. The network along with their co-regulated genes was analyzed using Database for Annotation, Visualization and Integrated Discovery (DAVID) and Transcriptional Regulatory Element Database (TRED). We found eighteen (17 up-regulated and 1 down-regulated) differentially expressed genes that were co-regulated by transcription factors and miRNAs. KEGG pathway analysis revealed that these genes were part of the extracellular matrix-receptor interaction and focal adhesion signaling pathways. In addition, qRT- PCR and Western blot data showed an increase in COL1A1 and decrease in NCAM1 mRNA and protein levels in gastric cancer tissues. Thus, these data provided the first evidence to illustrate that altered gene network was associated with gastric cancer invasion. Further study with a large sample size and more functional experiments is needed to confirm these data and contribute to diagnostic and treatment strategies for gastric cancer.

  15. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

    SciTech Connect

    Tsai, Fongying; Coruzzi, G. )

    1991-10-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

  16. Dynamic control of gene regulatory logic by seemingly redundant transcription factors

    PubMed Central

    AkhavanAghdam, Zohreh; Sinha, Joydeb; Tabbaa, Omar P; Hao, Nan

    2016-01-01

    Many transcription factors co-express with their homologs to regulate identical target genes, however the advantages of such redundancies remain elusive. Using single-cell imaging and microfluidics, we study the yeast general stress response transcription factor Msn2 and its seemingly redundant homolog Msn4. We find that gene regulation by these two factors is analogous to logic gate systems. Target genes with fast activation kinetics can be fully induced by either factor, behaving as an 'OR' gate. In contrast, target genes with slow activation kinetics behave as an 'AND' gate, requiring distinct contributions from both factors, upon transient stimulation. Furthermore, such genes become an 'OR' gate when the input duration is prolonged, suggesting that the logic gate scheme is not static but rather dependent on the input dynamics. Therefore, Msn2 and Msn4 enable a time-based mode of combinatorial gene regulation that might be applicable to homologous transcription factors in other organisms. DOI: http://dx.doi.org/10.7554/eLife.18458.001 PMID:27690227

  17. Transcription Factors and microRNA-Co-Regulated Genes in Gastric Cancer Invasion in Ex Vivo

    PubMed Central

    Shi, Yue; Wang, Jihan; Xin, Zhuoyuan; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2015-01-01

    Aberrant miRNA expression abnormally modulates gene expression in cells and can contribute to tumorigenesis in humans. This study identified functionally relevant differentially expressed genes using the transcription factors and miRNA-co-regulated network analysis for gastric cancer. The TF-miRNA co-regulatory network was constructed based on data obtained from cDNA microarray and miRNA expression profiling of gastric cancer tissues. The network along with their co-regulated genes was analyzed using Database for Annotation, Visualization and Integrated Discovery (DAVID) and Transcriptional Regulatory Element Database (TRED). We found eighteen (17 up-regulated and 1 down-regulated) differentially expressed genes that were co-regulated by transcription factors and miRNAs. KEGG pathway analysis revealed that these genes were part of the extracellular matrix-receptor interaction and focal adhesion signaling pathways. In addition, qRT- PCR and Western blot data showed an increase in COL1A1 and decrease in NCAM1 mRNA and protein levels in gastric cancer tissues. Thus, these data provided the first evidence to illustrate that altered gene network was associated with gastric cancer invasion. Further study with a large sample size and more functional experiments is needed to confirm these data and contribute to diagnostic and treatment strategies for gastric cancer. PMID:25860484

  18. Nanoscale spatial organization of the HoxD gene cluster in distinct transcriptional states.

    PubMed

    Fabre, Pierre J; Benke, Alexander; Joye, Elisabeth; Nguyen Huynh, Thi Hanh; Manley, Suliana; Duboule, Denis

    2015-11-10

    Chromatin condensation plays an important role in the regulation of gene expression. Recently, it was shown that the transcriptional activation of Hoxd genes during vertebrate digit development involves modifications in 3D interactions within and around the HoxD gene cluster. This reorganization follows a global transition from one set of regulatory contacts to another, between two topologically associating domains (TADs) located on either side of the HoxD locus. Here, we use 3D DNA FISH to assess the spatial organization of chromatin at and around the HoxD gene cluster and report that although the two TADs are tightly associated, they appear as spatially distinct units. We measured the relative position of genes within the cluster and found that they segregate over long distances, suggesting that a physical elongation of the HoxD cluster can occur. We analyzed this possibility by super-resolution imaging (STORM) and found that tissues with distinct transcriptional activity exhibit differing degrees of elongation. We also observed that the morphological change of the HoxD cluster in developing digits is associated with its position at the boundary between the two TADs. Such variations in the fine-scale architecture of the gene cluster suggest causal links among its spatial configuration, transcriptional activation, and the flanking chromatin context. PMID:26504220

  19. ZmMADS47 Regulates Zein Gene Transcription through Interaction with Opaque2

    PubMed Central

    Qiao, Zhenyi; Qi, Weiwei; Wang, Qian; Feng, Ya’nan; Yang, Qing; Zhang, Nan; Wang, Shanshan; Tang, Yuanping; Song, Rentao

    2016-01-01

    Zeins, the predominent storage proteins in maize endosperm, are encoded by multiple genes and gene families. However, only a few transcriptional factors for zein gene regulation have been functionally characterized. In this study, a MADS-box protein, namely ZmMADS47, was identified as an Opaque2 (O2) interacting protein via yeast two-hybrid screening. The N-terminal portion of ZmMADS47 contains a nuclear localization signal (NLS), and its C-terminal portion contains a transcriptional activation domain (AD). Interestingly, the transcriptional activation activity is blocked in its full length form, suggesting conformational regulation of the AD. Molecular and RNA-seq analyses of ZmMADS47 RNAi lines revealed down regulation of α-zein and 50-kD γ-zein genes. ZmMADS47 binds the CATGT motif in promoters of these zein genes, but ZmMADS47 alone is not able to transactivate the promoters. However, when both O2 and ZmMADS47 are present, the transactivation of these promoters was greatly enhanced. This enhancement was dependent on the AD function of ZmMADS47 and the interaction between ZmMADS47 and O2, but it was independent from the AD function of O2. Therefore, it appears interaction with O2 activates ZmMADS47 on zein gene promoters. PMID:27077660

  20. The ubiquitous octamer-binding protein(s) is sufficient for transcription of immunoglobulin genes.

    PubMed

    Johnson, D G; Carayannopoulos, L; Capra, J D; Tucker, P W; Hanke, J H

    1990-03-01

    All immunoglobulin genes contain a conserved octanucleotide promoter element, ATGCAAAT, which has been shown to be required for their normal B-cell-specific transcription. Proteins that bind this octamer have been purified, and cDNAs encoding octamer-binding proteins have been cloned. Some of these proteins (referred to as OTF-2) are lymphoid specific, whereas at least one other, and possibly more (referred to as OTF-1), is found ubiquitously in all cell types. The exact role of these different proteins in directing the tissue-specific expression of immunoglobulin genes is unclear. We have identified two human pre-B-cell lines that contain extremely low levels of OTF-2 yet still express high levels of steady-state immunoglobulin heavy-chain mRNA in vivo and efficiently transcribe an immunoglobulin gene in vitro. Addition of a highly enriched preparation of OTF-1 made from one of these pre-B cells or from HeLa cells specifically stimulated in vitro transcription of an immunoglobulin gene. Furthermore, OFT-1 appeared to have approximately the same transactivation ability as OTF-2 when normalized for binding activity. These results suggest that OTF-1, without OTF-2, is sufficient for transcription of immunoglobulin genes and that OTF-2 alone is not responsible for the B-cell-specific regulation of immunoglobulin gene expression.

  1. Transcription profiling provides insights into gene pathways involved in horn and scurs development in cattle

    PubMed Central

    2010-01-01

    Background Two types of horns are evident in cattle - fixed horns attached to the skull and a variation called scurs, which refers to small loosely attached horns. Cattle lacking horns are referred to as polled. Although both the Poll and Scurs loci have been mapped to BTA1 and 19 respectively, the underlying genetic basis of these phenotypes is unknown, and so far, no candidate genes regulating these developmental processes have been described. This study is the first reported attempt at transcript profiling to identify genes and pathways contributing to horn and scurs development in Brahman cattle, relative to polled counterparts. Results Expression patterns in polled, horned and scurs tissues were obtained using the Agilent 44 k bovine array. The most notable feature when comparing transcriptional profiles of developing horn tissues against polled was the down regulation of genes coding for elements of the cadherin junction as well as those involved in epidermal development. We hypothesize this as a key event involved in keratinocyte migration and subsequent horn development. In the polled-scurs comparison, the most prevalent differentially expressed transcripts code for genes involved in extracellular matrix remodelling, which were up regulated in scurs tissues relative to polled. Conclusion For this first time we describe networks of genes involved in horn and scurs development. Interestingly, we did not observe differential expression in any of the genes present on the fine mapped region of BTA1 known to contain the Poll locus. PMID:20537189

  2. Control of transcription elongation by GreA determines rate of gene expression in Streptococcus pneumoniae

    PubMed Central

    Yuzenkova, Yulia; Gamba, Pamela; Herber, Martijn; Attaiech, Laetitia; Shafeeq, Sulman; Kuipers, Oscar P.; Klumpp, Stefan; Zenkin, Nikolay; Veening, Jan-Willem

    2014-01-01

    Transcription by RNA polymerase may be interrupted by pauses caused by backtracking or misincorporation that can be resolved by the conserved bacterial Gre-factors. However, the consequences of such pausing in the living cell remain obscure. Here, we developed molecular biology and transcriptome sequencing tools in the human pathogen Streptococcus pneumoniae and provide evidence that transcription elongation is rate-limiting on highly expressed genes. Our results suggest that transcription elongation may be a highly regulated step of gene expression in S. pneumoniae. Regulation is accomplished via long-living elongation pauses and their resolution by elongation factor GreA. Interestingly, mathematical modeling indicates that long-living pauses cause queuing of RNA polymerases, which results in ‘transcription traffic jams’ on the gene and thus blocks its expression. Together, our results suggest that long-living pauses and RNA polymerase queues caused by them are a major problem on highly expressed genes and are detrimental for cell viability. The major and possibly sole function of GreA in S. pneumoniae is to prevent formation of backtracked elongation complexes. PMID:25190458

  3. The Integrator complex controls the termination of transcription at diverse classes of gene targets

    PubMed Central

    Skaar, Jeffrey R; Ferris, Andrea L; Wu, Xiaolin; Saraf, Anita; Khanna, Kum Kum; Florens, Laurence; Washburn, Michael P; Hughes, Stephen H; Pagano, Michele

    2015-01-01

    Complexes containing INTS3 and either NABP1 or NABP2 were initially characterized in DNA damage responses, but their biochemical function remained unknown. Using affinity purifications and HIV Integration targeting-sequencing (HIT-Seq), we find that these complexes are part of the Integrator complex, which binds RNA Polymerase II and regulates specific target genes. Integrator cleaves snRNAs as part of their processing to their mature form in a mechanism that is intimately coupled with transcription termination. However, HIT-Seq reveals that Integrator also binds to the 3′ end of replication-dependent histones and promoter proximal regions of genes with polyadenylated transcripts. Depletion of Integrator subunits results in transcription termination failure, disruption of histone mRNA processing, and polyadenylation of snRNAs and histone mRNAs. Furthermore, promoter proximal binding of Integrator negatively regulates expression of genes whose transcripts are normally polyadenylated. Integrator recruitment to all three gene classes is DSIF-dependent, suggesting that Integrator functions as a termination complex at DSIF-dependent RNA Polymerase II pause sites. PMID:25675981

  4. SATB1 Packages Densely Looped, Transcriptionally Active Chromatin for Coordinated Expression of Cytokine Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    SATB1 (special AT-rich sequence binding protein 1) organizes cell type–specific nuclear architecture by anchoring specialized DNA sequences and recruiting chromatin remodeling factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4 and...

  5. STAT4-mediated transcriptional repression of the IL5 gene in human memory Th2 cells.

    PubMed

    Gonzales-van Horn, Sarah R; Estrada, Leonardo D; van Oers, Nicolai S C; Farrar, J David

    2016-06-01

    Type I interferon (IFN-α/β) plays a critical role in suppressing viral replication by driving the transcription of hundreds of interferon-sensitive genes (ISGs). While many ISGs are transcriptionally activated by the ISGF3 complex, the significance of other signaling intermediates in IFN-α/β-mediated gene regulation remains elusive, particularly in rare cases of gene silencing. In human Th2 cells, IFN-α/β signaling suppressed IL5 and IL13 mRNA expression during recall responses to T-cell receptor (TCR) activation. This suppression occurred through a rapid reduction in the rate of nascent transcription, independent of de novo expression of ISGs. Further, IFN-α/β-mediated STAT4 activation was required for repressing the human IL5 gene, and disrupting STAT4 dimerization reversed this effect. This is the first demonstration of STAT4 acting as a transcriptional repressor in response to IFN-α/β signaling and highlights the unique activity of this cytokine to acutely block the expression of an inflammatory cytokine in human T cells. PMID:26990433

  6. Role of RUNX family members in transcriptional repression and gene silencing.

    PubMed

    Durst, Kristie L; Hiebert, Scott W

    2004-05-24

    RUNX family members are DNA-binding transcription factors that regulate the expression of genes involved in cellular differentiation and cell cycle progression. The RUNX family includes three mammalian RUNX proteins (RUNX1, -2, -3) and two homologues in Drosophila. Experiments in Drosophila and mouse indicate that the RUNX proteins are required for gene silencing of engrailed and CD4, respectively. RUNX-mediated repression involves recruitment of corepressors such as mSin3A and Groucho as well as histone deacetylases. Furthermore, RUNX1 and RUNX3 associate with SUV39H1, a histone methyltransferase involved in gene silencing. RUNX1 is frequently targeted in human leukemia by chromosomal translocations that fuse the DNA-binding domain of RUNX1 to other transcription factors and corepressor molecules. The resulting leukemogenic fusion proteins are transcriptional repressors that form stable complexes with corepressors, histone deacetylases and histone methyltransferases. Thus, transcriptional repression and gene silencing through RUNX1 contribute to the mechanisms of leukemogenesis of the fusion proteins. Therapies directed at the associated cofactors may be beneficial for treatment of these leukemias. PMID:15156176

  7. Repression of btuB gene transcription in Escherichia coli by the GadX protein

    PubMed Central

    2011-01-01

    Background BtuB (B  twelve uptake) is an outer membrane protein of Escherichia coli, it serves as a receptor for cobalamines uptake or bactericidal toxin entry. A decrease in the production of the BtuB protein would cause E. coli to become resistant to colicins. The production of BtuB has been shown to be regulated at the post-transcriptional level. The secondary structure switch of 5' untranslated region of butB and the intracellular concentration of adenosylcobalamin (Ado-Cbl) would affect the translation efficiency and RNA stability of btuB. The transcriptional regulation of btuB expression is still unclear. Results To determine whether the btuB gene is also transcriptionally controlled by trans-acting factors, a genomic library was screened for clones that enable E. coli to grow in the presence of colicin E7, and a plasmid carrying gadX and gadY genes was isolated. The lacZ reporter gene assay revealed that these two genes decreased the btuB promoter activity by approximately 50%, and the production of the BtuB protein was reduced by approximately 90% in the presence of a plasmid carrying both gadX and gadY genes in E. coli as determined by Western blotting. Results of electrophoretic mobility assay and DNase I footprinting indicated that the GadX protein binds to the 5' untranslated region of the btuB gene. Since gadX and gadY genes are more highly expressed under acidic conditions, the transcriptional level of btuB in cells cultured in pH 7.4 or pH 5.5 medium was examined by quantitative real-time PCR to investigate the effect of GadX. The results showed the transcription of gadX with 1.4-fold increase but the level of btuB was reduced to 57%. Conclusions Through biological and biochemical analysis, we have demonstrated the GadX can directly interact with btuB promoter and affect the expression of btuB. In conclusion, this study provides the first evidence that the expression of btuB gene is transcriptionally repressed by the acid responsive genes gadX and

  8. Transcription analysis, physical mapping, and molecular characterization of a nonclassical human leukocyte antigen class I gene.

    PubMed Central

    Chorney, M J; Sawada, I; Gillespie, G A; Srivastava, R; Pan, J; Weissman, S M

    1990-01-01

    The human major histocompatibility complex contains approximately 20 class I genes, pseudogenes, and gene fragments. These include the genes for the three major transplantation antigens, HLA-A, HLA-B, and HLA-C, as well as a number of other genes or pseudogenes of unknown biological significance. Most of the latter have C + G-rich sequences in their 5' ends that are unmethylated in the B-lymphoblastoid cell line 3.1.0. We investigated one of these genes, HLA-H, in more detail. The gene is, overall, strongly homologous in sequence to HLA-A but differs in several potentially significant ways, including changes in conserved promoter sequences, a single-base deletion producing a translation termination codon in exon 4, and a region of sequence divergence downstream of the transcribed portion of the gene. Nevertheless, mouse L cells transfected with the gene accumulated small amounts of apparently full-length polyadenylated RNA. A portion of this RNA begins at the transcription site predicted by analogy to certain class I cDNA clones, while another portion appears to begin shortly upstream. L cells transfected with a hybrid gene containing the first three exons of HLA-H and the last five exons of HLA-B27 accumulated full-length HLA transcripts at the same level as cells transfected with an HLA-B27 gene; both levels are at least 15- to 20-fold higher than that directed by HLA-H alone. In addition, we isolated a cDNA clone for HLA-H that contains a portion of intron 3 attached to a normally spliced sequence comprising exons 4 through 8. These results suggest that low levels of translatable mRNA for the truncated class I heavy chain encoded by HLA-H are produced under physiologic circumstances and that sequences 3' of intron 3 decrease the levels of stable transcripts. Images PMID:2294403

  9. The role and regulation of hypoxia-inducible factor-1alpha expression in brain development and neonatal hypoxic-ischemic brain injury.

    PubMed

    Fan, Xiyong; Heijnen, Cobi J; van der Kooij, Michael A; Groenendaal, Floris; van Bel, Frank

    2009-12-11

    During neonatal hypoxic-ischemic brain injury, activation of transcription of a series of genes is induced to stimulate erythropoiesis, anti-apoptosis, apoptosis, necrosis and angiogenesis. A key factor mediating these gene transcriptions is hypoxia-inducible factor-1alpha (HIF-1alpha). During hypoxia, HIF-1alpha protein is stabilized and heterodimerizes with HIF-1beta to form HIF-1, subsequently regulating the expression of target genes. HIF-1alpha participates in early brain development and proliferation of neuronal precursor cells. Under pathological conditions, HIF-1alpha is known to play an important role in neonatal hypoxic-ischemic brain injury: on the one hand, HIF-1alpha has neuroprotective effects whereas it can also have neurotoxic effects. HIF-1alpha regulates the transcription of erythropoietin (EPO), which induces several pathways associated with neuroprotection. HIF-1alpha also promotes the expression of vascular endothelial cell growth factor (VEGF), which is related to neovascularization in hypoxic-ischemic brain areas. In addition, HIF-1alpha has an anti-apoptotic effect by increasing the expression of anti-apoptotic factors such as EPO during mild hypoxia. The neurotoxic effects of HIF-1alpha are represented by its participation in the apoptotic process by increasing the stability of the tumor suppressor protein p53 during severe hypoxia. Moreover, HIF-1alpha plays a role in cell necrosis, by interacting with calcium and calpain. HIF-1alpha can also exacerbate brain edema via increasing the permeability of the blood-brain barrier (BBB). Given these properties, HIF-1alpha has both neuroprotective and neurotoxic effects after hypoxia-ischemia. These events are cell type specific and related to the severity of hypoxia. Unravelling of the complex functions of HIF-1alpha may be important when designing neuroprotective therapies for hypoxic-ischemic brain injury.

  10. Structure of the human laminin {gamma}2 chain gene (LAMC2): Alternative splicing with different tissue distribution of two transcripts

    SciTech Connect

    Airenne, T.; Haakana, H.; Kallunki, T.

    1996-02-15

    This article discusses the exon-intron structure and tissue distribution of the laminin {gamma}2 chain (LAMC2) gene, which is mutated in some cases of junctional epidermolysis bullosa. The article also discusses the transcription and splicing of this gene, which result in alternative uses of the last two exons of the gene. The different tissue distributions of the transcripts indicate different functions for the gene in vivo. 36 refs., 8 figs., 3 tabs.

  11. Deciphering the Molecular Mechanisms Underpinning the Transcriptional Control of Gene Expression by Master Transcriptional Regulators in Arabidopsis Seed.

    PubMed

    Baud, Sébastien; Kelemen, Zsolt; Thévenin, Johanne; Boulard, Céline; Blanchet, Sandrine; To, Alexandra; Payre, Manon; Berger, Nathalie; Effroy-Cuzzi, Delphine; Franco-Zorrilla, Jose Manuel; Godoy, Marta; Solano, Roberto; Thevenon, Emmanuel; Parcy, François; Lepiniec, Loïc; Dubreucq, Bertrand

    2016-06-01

    In Arabidopsis (Arabidopsis thaliana), transcriptional control of seed maturation involves three related regulators with a B3 domain, namely LEAFY COTYLEDON2 (LEC2), ABSCISIC ACID INSENSITIVE3 (ABI3), and FUSCA3 (ABI3/FUS3/LEC2 [AFLs]). Although genetic analyses have demonstrated partially overlapping functions of these regulators, the underlying molecular mechanisms remained elusive. The results presented here confirmed that the three proteins bind RY DNA elements (with a 5'-CATG-3' core sequence) but with different specificities for flanking nucleotides. In planta as in the moss Physcomitrella patens protoplasts, the presence of RY-like (RYL) elements is necessary but not sufficient for the regulation of the OLEOSIN1 (OLE1) promoter by the B3 AFLs. G box-like domains, located in the vicinity of the RYL elements, also are required for proper activation of the promoter, suggesting that several proteins are involved. Consistent with this idea, LEC2 and ABI3 showed synergistic effects on the activation of the OLE1 promoter. What is more, LEC1 (a homolog of the NF-YB subunit of the CCAAT-binding complex) further enhanced the activation of this target promoter in the presence of LEC2 and ABI3. Finally, recombinant LEC1 and LEC2 proteins produced in Arabidopsis protoplasts could form a ternary complex with NF-YC2 in vitro, providing a molecular explanation for their functional interactions. Taken together, these results allow us to propose a molecular model for the transcriptional regulation of seed genes by the L-AFL proteins, based on the formation of regulatory multiprotein complexes between NF-YBs, which carry a specific aspartate-55 residue, and B3 transcription factors. PMID:27208266

  12. Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.

    PubMed

    Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo

    2009-11-01

    XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.

  13. Zinc-sensitive genes as potential new target genes of the metal transcription factor-1 (MTF-1).

    PubMed

    Kindermann, Birgit; Döring, Frank; Budczies, Jan; Daniel, Hannelore

    2005-04-01

    Zinc is an essential trace element that serves as a structural constituent of a large number of transcription factors, which explains its pivotal role in the control of gene expression. Previous studies investigating the effect of zinc deficiency and zinc supplementation on gene expression in the human adenocarcinoma cell line HT-29 led to the identification of a considerable number of genes responding to alterations in cellular zinc status with changes in steady state mRNA levels. For 9 of 20 genes from these previous screenings that were studied in more detail, mRNA steady state levels responded to both high and low media zinc concentrations. As they are primarily zinc-dependent, we assessed whether these genes are controlled by the zinc-finger metal transcription factor MTF-1. To test this hypothesis we generated a doxycyline-inducible Tet-On HT-29 cell line overexpressing MTF-1. Using this conditional expression system, we present evidence that Kruppel-like factor 4 (klf4), hepatitis A virus cellular receptor 1 (hhav), and complement factor B (cfbp) are 3 potential new target genes of MTF-1. To support this, we used in silico analysis to screen for metal-responsive elements (MREs) within promotors of zinc-sensitive genes. We conclude that zinc responsiveness of klf4, hhav, and cfbp in HT-29 cells is mediated at least in part by MTF-1.

  14. Roles of Cell Division and Gene Transcription in the Methylation of CpG Islands

    PubMed Central

    Bender, Christina M.; Gonzalgo, Mark L.; Gonzales, Felicidad A.; Nguyen, Carvell T.; Robertson, Keith D.; Jones, Peter A.

    1999-01-01

    De novo methylation of CpG islands within the promoters of eukaryotic genes is often associated with their transcriptional repression, yet the methylation of CpG islands located downstream of promoters does not block transcription. We investigated the kinetics of mRNA induction, demethylation, and remethylation of the p16 promoter and second-exon CpG islands in T24 cells after 5-aza-2′-deoxycytidine (5-Aza-CdR) treatment to explore the relationship between CpG island methylation and gene transcription. The rates of remethylation of both CpG islands were associated with time but not with the rate of cell division, and remethylation of the p16 exon 2 CpG island occurred at a higher rate than that of the p16 promoter. We also examined the relationship between the remethylation of coding sequence CpG islands and gene transcription. The kinetics of remethylation of the p16 exon 2, PAX-6 exon 5, c-ABL exon 11, and MYF-3 exon 3 loci were examined following 5-Aza-CdR treatment because these genes contain exonic CpG islands which are hypermethylated in T24 cells. Remethylation occurred most rapidly in the p16, PAX-6, and c-ABL genes, shown to be transcribed prior to drug treatment. These regions also exhibited higher levels of remethylation in single-cell clones and subclones derived from 5-Aza-CdR-treated T24 cells. Our data suggest that de novo methylation is not restricted to the S phase of the cell cycle and that transcription through CpG islands does not inhibit their remethylation. PMID:10490608

  15. Functional redundancy of promoter elements ensures efficient transcription of the human 7SK gene in vivo.

    PubMed

    Boyd, D C; Turner, P C; Watkins, N J; Gerster, T; Murphy, S

    1995-11-10

    Deletion and mutation studies of the human 7SK gene transfected into HeLa cells have identified three functional regions of the promoter corresponding to the TATA box at -25, the proximal sequence element (PSE) between -49 and -65 and the distal sequence element (DSE) between -243 and -210. These elements show sequence homology to equivalent regions in other snRNA genes and are functionally analogous. Unlike the DSEs of many snRNA genes however, the 7SK DSE does not contain a consensus binding site for the transcription factor Oct-1 but rather, contains two non-consensus Oct-1 binding sites that can function independently of one another to enhance transcription. Unusually, the 7SK PSE can retain function even after extensive mutation and removal of the conserved TGACC of the PSE has little effect in the context of the whole promoter. However, the same mutation abolishes transcription in the absence of the DSE suggesting that protein/protein interactions between DSE and PSE binding factors can compensate for a mutant PSE. Mutation of the 7SK TATA box allows snRNA type transcription by RNA polymerase II to occur and this is enhanced by the DSE, indicating that both the DSE and the PSE can also function with pol II. In addition, mutation of the TATA box does not abolish pol III dependent transcription, suggesting that other sequence elements may also play a role in the determination of polymerase specificity. Although the human 7SK gene is transcribed efficiently in Xenopus oocytes, analysis of the 7SK wild-type gene and mutants in Xenopus oocytes gives significantly different results from the analysis in HeLa cells indicating that the recognition of functional elements is not the same in the two systems.

  16. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    SciTech Connect

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  17. Genomewide analysis of TCP transcription factor gene family in Malus domestica.

    PubMed

    Xu, Ruirui; Sun, Peng; Jia, Fengjuan; Lu, Longtao; Li, Yuanyuan; Zhang, Shizhong; Huang, Jinguang

    2014-12-01

    Teosinte branched 1/cycloidea/proliferating cell factor 1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are involved in various biological processes, including development and plant metabolism pathways. In this study, a total of 52 TCP genes were identified in apple (Malus domestica) genome. Bioinformatic methods were employed to predicate and analyse their relevant gene classification, gene structure, chromosome location, sequence alignment and conserved domains of MdTCP proteins. Expression analysis from microarray data showed that the expression levels of 28 and 51 MdTCP genes changed during the ripening and rootstock-scion interaction processes, respectively. The expression patterns of 12 selected MdTCP genes were analysed in different tissues and in response to abiotic stresses. All of the selected genes were detected in at least one of the tissues tested, and most of them were modulated by adverse treatments indicating that the MdTCPs were involved in various developmental and physiological processes. To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family. These results provide valuable information for studies on functions of the TCP transcription factor genes in apple.

  18. Gene Networks in the Wild: Identifying Transcriptional Modules that Mediate Coral Resistance to Experimental Heat Stress.

    PubMed

    Rose, Noah H; Seneca, Francois O; Palumbi, Stephen R

    2015-12-28

    Organisms respond to environmental variation partly through changes in gene expression, which underlie both homeostatic and acclimatory responses to environmental stress. In some cases, so many genes change in expression in response to different influences that understanding expression patterns for all these individual genes becomes difficult. To reduce this problem, we use a systems genetics approach to show that variation in the expression of thousands of genes of reef-building corals can be explained as variation in the expression of a small number of coexpressed "modules." Modules were often enriched for specific cellular functions and varied predictably among individuals, experimental treatments, and physiological state. We describe two transcriptional modules for which expression levels immediately after heat stress predict bleaching a day later. One of these early "bleaching modules" is enriched for sequence-specific DNA-binding proteins, particularly E26 transformation-specific (ETS)-family transcription factors. The other module is enriched for extracellular matrix proteins. These classes of bleaching response genes are clear in the modular gene expression analysis we conduct but are much more difficult to discern in single gene analyses. Furthermore, the ETS-family module shows repeated differences in expression among coral colonies grown in the same common garden environment, suggesting a heritable genetic or epigenetic basis for these expression polymorphisms. This finding suggests that these corals harbor high levels of gene-network variation, which could facilitate rapid evolution in the face of environmental change.

  19. Gene Networks in the Wild: Identifying Transcriptional Modules that Mediate Coral Resistance to Experimental Heat Stress

    PubMed Central

    Rose, Noah H.; Seneca, Francois O.; Palumbi, Stephen R.

    2016-01-01

    Organisms respond to environmental variation partly through changes in gene expression, which underlie both homeostatic and acclimatory responses to environmental stress. In some cases, so many genes change in expression in response to different influences that understanding expression patterns for all these individual genes becomes difficult. To reduce this problem, we use a systems genetics approach to show that variation in the expression of thousands of genes of reef-building corals can be explained as variation in the expression of a small number of coexpressed “modules.” Modules were often enriched for specific cellular functions and varied predictably among individuals, experimental treatments, and physiological state. We describe two transcriptional modules for which expression levels immediately after heat stress predict bleaching a day later. One of these early “bleaching modules” is enriched for sequence-specific DNA-binding proteins, particularly E26 transformation-specific (ETS)-family transcription factors. The other module is enriched for extracellular matrix proteins. These classes of bleaching response genes are clear in the modular gene expression analysis we conduct but are much more difficult to discern in single gene analyses. Furthermore, the ETS-family module shows repeated differences in expression among coral colonies grown in the same common garden environment, suggesting a heritable genetic or epigenetic basis for these expression polymorphisms. This finding suggests that these corals harbor high levels of gene-network variation, which could facilitate rapid evolution in the face of environmental change. PMID:26710855

  20. RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

    SciTech Connect

    Smialowska, Agata; Djupedal, Ingela; Wang, Jingwen; Kylsten, Per; Swoboda, Peter; Ekwall, Karl

    2014-02-07

    Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its role in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.

  1. Gene Networks in the Wild: Identifying Transcriptional Modules that Mediate Coral Resistance to Experimental Heat Stress.

    PubMed

    Rose, Noah H; Seneca, Francois O; Palumbi, Stephen R

    2016-01-01

    Organisms respond to environmental variation partly through changes in gene expression, which underlie both homeostatic and acclimatory responses to environmental stress. In some cases, so many genes change in expression in response to different influences that understanding expression patterns for all these individual genes becomes difficult. To reduce this problem, we use a systems genetics approach to show that variation in the expression of thousands of genes of reef-building corals can be explained as variation in the expression of a small number of coexpressed "modules." Modules were often enriched for specific cellular functions and varied predictably among individuals, experimental treatments, and physiological state. We describe two transcriptional modules for which expression levels immediately after heat stress predict bleaching a day later. One of these early "bleaching modules" is enriched for sequence-specific DNA-binding proteins, particularly E26 transformation-specific (ETS)-family transcription factors. The other module is enriched for extracellular matrix proteins. These classes of bleaching response genes are clear in the modular gene expression analysis we conduct but are much more difficult to discern in single gene analyses. Furthermore, the ETS-family module shows repeated differences in expression among coral colonies grown in the same common garden environment, suggesting a heritable genetic or epigenetic basis for these expression polymorphisms. This finding suggests that these corals harbor high levels of gene-network variation, which could facilitate rapid evolution in the face of environmental change. PMID:26710855

  2. Hyperactivated NF-κB and AP-1 Transcription Factors Promote Highly Accessible Chromatin and Constitutive Transcription across the Interleukin-6 Gene Promoter in Metastatic Breast Cancer Cells▿

    PubMed Central

    Ndlovu, ′Matladi N.; Van Lint, Carine; Van Wesemael, Karlien; Callebert, Pieter; Chalbos, Dany; Haegeman, Guy; Vanden Berghe, Wim

    2009-01-01

    Interleukin-6 (IL-6), involved in cancer-related inflammation, acts as an autocrine and paracrine growth factor, which promotes angiogenesis, metastasis, and subversion of immunity, and changes the response to hormones and to chemotherapeutics. We explored transcription mechanisms involved in differential IL-6 gene expression in breast cancer cells with different metastatic properties. In weakly metastatic MCF7 cells, histone H3 K9 methylation, HP1 binding, and weak recruitment of AP-1 Fra-1/c-Jun, NF-κB p65 transcription factors, and coactivators is indicative of low chromatin accessibility and gene transcription at the IL-6 gene promoter. In highly metastatic MDA-MB231 cells, strong DNase, MNase, and restriction enzyme accessibility, as well potent constitutive transcription of the IL-6 gene promoter, coincide with increased H3 S10 K14 phosphoacetylation and promoter enrichment of AP-1 Fra-1/c-Jun and NF-κB p65 transcription factors and MSK1, CBP/p300, Brg1, and Ezh2 cofactors. Complementation, silencing, and kinase inhibitor experiments further demonstrate involvement of AP-1 Fra-1/c-Jun and NF-κB p65/RelB members, but not of the alpha estrogen receptor in promoting chromatin accessibility and transcription across the IL-6 gene promoter in metastatic breast cancer cells. Finally, the natural withanolide Withaferin A was found to repress IL-6 gene transcription in metastatic breast cancer cells upon dual inhibition of NF-κB and AP-1 Fra-1 transcription factors and silencing of IL-6 promoter chromatin accessibility. PMID:19687301

  3. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    ERIC Educational Resources Information Center

    Zhang, Jian

    2009-01-01

    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  4. Transcriptional insulation of the human keratin 18 gene in transgenic mice.

    PubMed Central

    Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G

    1993-01-01

    Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and

  5. Conserved transcriptional responses to cyanobacterial stressors are mediated by alternate regulation of paralogous genes in Daphnia.

    PubMed

    Asselman, Jana; Pfrender, Michael E; Lopez, Jacqueline A; De Coninck, Dieter I M; Janssen, Colin R; Shaw, Joseph R; De Schamphelaere, Karel A C

    2015-04-01

    Despite a significant increase in genomic data, our knowledge of gene functions and their transcriptional responses to environmental stimuli remains limited. Here, we use the model keystone species Daphnia pulex to study environmental responses of genes in the context of their gene family history to better understand the relationship between genome structure and gene function in response to environmental stimuli. Daphnia were exposed to five different treatments, each consisting of a diet supplemented with one of five cyanobacterial species, and a control treatment consisting of a diet of only green algae. Differential gene expression profiles of Daphnia exposed to each of these five cyanobacterial species showed that genes with known functions are more likely to be shared by different expression profiles, whereas genes specific to the lineage of Daphnia are more likely to be unique to a given expression profile. Furthermore, while only a small number of nonlineage-specific genes were conserved across treatment type, there was a high degree of overlap in expression profiles at the functional level. The conservation of functional responses across the different cyanobacterial treatments can be attributed to the treatment-specific expression of different paralogous genes within the same gene family. Comparison with available gene expression data in the literature suggests differences in nutritional composition in diets with cyanobacterial species compared to diets of green algae as a primary driver for cyanobacterial effects on Daphnia. We conclude that conserved functional responses in Daphnia across different cyanobacterial treatments are mediated through alternate regulation of paralogous gene families.

  6. PCBs are associated with altered gene transcript profiles in arctic Beluga Whales (Delphinapterus leucas).

    PubMed

    Noël, Marie; Loseto, Lisa L; Helbing, Caren C; Veldhoen, Nik; Dangerfield, Neil J; Ross, Peter S

    2014-01-01

    High trophic level arctic beluga whales (Delphinapterus leucas) are exposed to persistent organic pollutants (POP) originating primarily from southern latitudes. We collected samples from 43 male beluga harvested by Inuvialuit hunters (2008-2010) in the Beaufort Sea to evaluate the effects of POPs on the levels of 13 health-related gene transcripts using quantitative real-time polymerase chain reaction. Consistent with their role in detoxification, the aryl hydrocarbon receptor (Ahr) (r(2) = 0.18, p = 0.045 for 2008 and 2009) and cytochrome P450 1A1 (Cyp1a1) (r(2) = 0.20, p < 0.001 for 2008 and 2009; r(2) = 0.43, p = 0.049 for 2010) transcripts were positively correlated with polychlorinated biphenyls (PCBs), the dominant POP in beluga. Principal Components Analysis distinguished between these two toxicology genes and 11 other genes primarily involved in growth, metabolism, and development. Factor 1 explained 56% of gene profiles, with these latter 11 gene transcripts displaying greater abundance in years coinciding with periods of low sea ice extent (2008 and 2010). δ(13)C results suggested a shift in feeding ecology and/or change in condition of these ice edge-associated beluga whales during these two years. While this provides insight into the legacy of PCBs in a remote environment, the possible impacts of a changing ice climate on the health of beluga underscores the need for long-term studies.

  7. DNA methylation is associated with transcription of Snail and Slug genes

    PubMed Central

    Chen, Ying; Wang, Kai; Qian, Chao-Nan; Leach, Richard

    2012-01-01

    Snail and Slug play critical roles in the epithelial to mesenchymal transition (EMT), the mesenchymal to epithelial transition (MET) and in the maintenance of mesenchymal morphology. In this research, we investigated the correlation of DNA methylation with the transcriptional level of these two genes during the EMT/MET process. First, we used several cell lines associated with EMT/MET processes of induced pluripotent stem cell generation and differentiation, trophoblast invasion, as well as cancer progression to examine the association between DNA methylation and transcription levels of these two genes. We found an inverse correlation between DNA methylation of first intron regions and transcription levels of Snail and Slug genes in these EMT/METs. To further verify the results, we treated two trophoblast cell line BeWo and HTR8/SVneo and one induced pluripotent stem cell line with 5-aza-2′-deoxycytidine (5-aza-dC), an inhibitor of DNA methyltransferase, which caused increased expression of these two genes. Lastly, we cloned the promoters of both Snail and Slug into pGL3-Basic vector, after in vitro DNA methylation and transfection into IMR90 and HTR8/SVneo cells; we observed the significant reduction of their promoter activity due to DNA methylation. In summary, based on these results, DNA methylation is one of the molecular mechanisms regulating Snail and Slug genes during EMT/MET process. PMID:23261445

  8. The transcriptional repressor EUO regulates both subsets of Chlamydia late genes.

    PubMed

    Rosario, Christopher J; Hanson, Brett R; Tan, Ming

    2014-11-01

    The pathogenic bacterium Chlamydia replicates in a eukaryotic host cell via a developmental cycle marked by temporal waves of gene expression. We have previously shown that late genes transcribed by the major chlamydial RNA polymerase, σ(66) RNA polymerase, are regulated by a transcriptional repressor EUO. We now report that EUO also represses promoters for a second subset of late genes that are transcribed by an alternative polymerase called σ(28) RNA polymerase. EUO bound in the vicinity of six σ(28) -dependent promoters and inhibited transcription of each promoter. We used a mutational analysis to demonstrate that the EUO binding site functions as an operator t