The release of persistent organic pollutants from a closed system dicofol production process.

PubMed

Li, Sumei; Tian, Yajing; Ding, Qiong; Liu, Wenbin

2014-01-01

High concentrations of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs) have been found to be produced in chemical processes in which chlorine is a raw material. Samples of workshop air, waste water, waste acid, and the dicofol product were collected from a pesticide factory in China that uses a closed-system dicofol production process, and were analyzed for PCDD/Fs and ΣDDTs. The ΣDDTs concentrations were 1.88-17.53 μg m(-3) in the workshop air samples, 4.85-456 μg kg(-1) in the waste water and waste acid samples, and 4.74 g kg(-1) in the dicofol product. The total estimated daily intakes of ΣDDTs for workers by inhalation in the workplace were in the range of 0.38-3.51 μg kg(-1)bwd(-1) for moderate activities. The annual amounts of ΣDDTs and p,p'-DDT directly released to the environment via the use of dicofol were 9,480 kg and 1,080 kg, respectively. The PCDD/F toxicity equivalent values (I-TEQs) in the waste water and waste acid samples ranged from 1.5 to 122 pg I-TEQ kg(-1) and 86.3 ng I-TEQ kg(-1) in the dicofol sample. The annual amount of PCDD/Fs released to the environment was 0.17 g I-TEQ. From the PCDD/F distribution patterns, it is suggested that the major pathway for PCDD/F formation involves precursor synthesis during the production of dicofol in the closed-system process. Copyright © 2013 Elsevier Ltd. All rights reserved.

Distributed Computation and TENEX-Related Activities

DTIC Science & Technology

1978-01-01

IPCF) which provides the inter-job communication functions required by MSG. MSG will be modified to use the IPCF primitives when running under TOPS...mmummi iiiwnrnrtnr’in i^WMBi. ■a^j.i.aiAj.k ■*"-’"’’"— •’ ’■■ BBN Report No. 3752 Bolt Beranek and Newman Inc. . . - . *. - primitive (e.g...from a process to MSG when a communication primitive is executed, and from MSG to a process when a pending event (e.g., outstanding receive operation

Dimensionality Reduction in Big Data with Nonnegative Matrix Factorization

DTIC Science & Technology

2017-06-20

appli- cations of data mining, signal processing , computer vision, bioinformatics, etc. Fun- damentally, NMF has two main purposes. First, it reduces...shape of the function becomes more spherical because ∂ 2g ∂y2i = 1, ∀i, and g(y) is convex. This part aims to make the post- processing parts more...maxStop = 0 for each thread of computation */; 3 /*Re-scaling variables*/; 4 Q = H√ diag(H)diag(H)T ; q = h√ diag(H) ; 5 /*Solving NQP: minimizingf(x

Prediction in the Processing of Repair Disfluencies: Evidence from the Visual-World Paradigm

ERIC Educational Resources Information Center

Lowder, Matthew W.; Ferreira, Fernanda

2016-01-01

Two visual-world eye-tracking experiments investigated the role of prediction in the processing of repair disfluencies (e.g., "The chef reached for some salt uh I mean some ketchup ..."). Experiment 1 showed that listeners were more likely to fixate a critical distractor item (e.g., "pepper") during the processing of repair…

Is Moving More Memorable than Proving? Effects of Embodiment and Imagined Enactment on Verb Memory

PubMed Central

Sidhu, David M.; Pexman, Penny M.

2016-01-01

Theories of embodied cognition propose that sensorimotor information is simulated during language processing (e.g., Barsalou, 1999). Previous studies have demonstrated that differences in simulation can have implications for word processing; for instance, lexical processing is facilitated for verbs that have relatively more embodied meanings (e.g., Sidhu et al., 2014). Here we examined the effects of these differences on memory for verbs. We observed higher rates of recognition (Experiments 1a-2a) and recall accuracy (Experiments 2b-3b) for verbs with a greater amount of associated bodily information (i.e., an embodiment effect). We also examined how this interacted with the imagined enactment effect: a memory benefit for actions that one imagines performing (e.g., Ditman et al., 2010). We found that these two effects did not interact (Experiment 3b), suggesting that the memory benefits of automatic simulation (i.e., the embodiment effect) and deliberate simulation (i.e., the imagined enactment effect) are distinct. These results provide evidence for the role of simulation in language processing, and its effects on memory. PMID:27445956

Dynamics of asymmetric non-polymeric binary glass formers—A nuclear magnetic resonance and dielectric spectroscopy study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pötzschner, B.; Mohamed, F.; Lichtinger, A.

2015-10-21

We study a dynamically asymmetric binary glass former with the low-T{sub g} component m-tri-cresyl phosphate (m-TCP: T{sub g} = 206 K) and a spirobichroman derivative as a non-polymeric high-T{sub g} component (T{sub g} = 382 K) by means of {sup 1}H nuclear magnetic resonance (NMR), {sup 31}P NMR, and dielectric spectroscopy which allow component-selectively probing the dynamics. The entire concentration range is covered, and two main relaxation processes with two T{sub g} are identified, T{sub g1} and T{sub g2}. The slower one is attributed to the high-T{sub g} component (α{sub 1}-process), and the faster one is related to the m-TCPmore » molecules (α{sub 2}-process). Yet, there are indications that a small fraction of m-TCP is associated also with the α{sub 1}-process. While the α{sub 1}-relaxation only weakly broadens upon adding m-TCP, the α{sub 2}-relaxation becomes extremely stretched leading to quasi-logarithmic correlation functions at low m-TCP concentrations—as probed by {sup 31}P NMR stimulated echo experiments. Frequency-temperature superposition does not apply for the α{sub 2}-process and it reflects an isotropic, liquid-like motion which is observed even below T{sub g1}, i.e., in the matrix of the arrested high-T{sub g} molecules. As proven by 2D {sup 31}P NMR, the corresponding dynamic heterogeneities are of transient nature, i.e., exchange occurs within the distribution G(lnτ{sub α2}). At T{sub g1} a crossover is found for the temperature dependence of (mean) τ{sub α2}(T) from non-Arrhenius above to Arrhenius below T{sub g1} which is attributed to intrinsic confinement effects. This “fragile-to-strong” transition also leads to a re-decrease of T{sub g2}(c{sub m−TCP}) at low concentration c{sub m−TCP}, i.e., a maximum is observed in T{sub g2}(c{sub m−TCP}) while T{sub g1}(c{sub m−TCP}) displays the well-known plasticizer effect. Although only non-polymeric components are involved, we re-discover essentially all features previously reported for polymer-plasticizer systems.« less

I.C.E.F.M. 94. Proceedings of the International Conference on Experimental Fluid Mechanics (2nd) Held in Torino, Italy on July 4-8, 1994,

DTIC Science & Technology

1994-07-08

visualization was first observed during the NASA/Boeing 757 Hybrid Laminar Flow Control flight test program in 1991. In this process, the hypothesis is...lil ( a) /’C r 0 .3 le a in g ed g OIL !!.;, II)" (a 4’r= .3i t xA .1’ -.45 (a) ~ ~ ~ ~ ~ b X1 Cr.3 .lcdi= e I 1111 I H Fi.1 Axa veicl dietocitiy

A Shared Memory Algorithm and Proof for the Generalized Alternative Construct in CSP (Communicating Sequential Processes)

DTIC Science & Technology

1987-06-01

shared variables. This will be discussed later. One procedure merits special attention. CheckAndCommit(m, g ,): INTEGER is called by process P, (I...denotes the local process) to check that "valid" communications can take place between P, using guard g , and Pm (m denotes the remote process). If so, P...local guard gi. By matching we mean gj contains an 1/O operation with P. By compatible we mean g , and gj do not both contain input (output) commands

Report to the High Order Language Working Group (HOLWG)

DTIC Science & Technology

1977-01-14

as running, runnable, suspended or dormant, may be synchronized by semaphore variables, may be schedaled using clock and duration data types and mpy...Recursive and non-recursive routines G6. Parallel processes, synchronization , critical regions G7. User defined parameterized exception handling G8...typed and lacks extensibility, parallel processing, synchronization and real-time features. Overall Evaluation IBM strongly recommended PL/I as a

Isolation of high-salinity-tolerant bacterial strains, Enterobacter sp., Serratia sp., Yersinia sp., for nitrification and aerobic denitrification under cyanogenic conditions.

PubMed

Mpongwana, N; Ntwampe, S K O; Mekuto, L; Akinpelu, E A; Dyantyi, S; Mpentshu, Y

2016-01-01

Cyanides (CN(-)) and soluble salts could potentially inhibit biological processes in wastewater treatment plants (WWTPs), such as nitrification and denitrification. Cyanide in wastewater can alter metabolic functions of microbial populations in WWTPs, thus significantly inhibiting nitrifier and denitrifier metabolic processes, rendering the water treatment processes ineffective. In this study, bacterial isolates that are tolerant to high salinity conditions, which are capable of nitrification and aerobic denitrification under cyanogenic conditions, were isolated from a poultry slaughterhouse effluent. Three of the bacterial isolates were found to be able to oxidise NH(4)-N in the presence of 65.91 mg/L of free cyanide (CN(-)) under saline conditions, i.e. 4.5% (w/v) NaCl. The isolates I, H and G, were identified as Enterobacter sp., Yersinia sp. and Serratia sp., respectively. Results showed that 81% (I), 71% (G) and 75% (H) of 400 mg/L NH(4)-N was biodegraded (nitrification) within 72 h, with the rates of biodegradation being suitably described by first order reactions, with rate constants being: 4.19 h(-1) (I), 4.21 h(-1) (H) and 3.79 h(-1) (G), respectively, with correlation coefficients ranging between 0.82 and 0.89. Chemical oxygen demand (COD) removal rates were 38% (I), 42% (H) and 48% (G), over a period of 168 h with COD reduction being highest at near neutral pH.

SOVRaD - A Digest of Recent Soviet R and D Articles. Volume 2, Number 1, 1976

DTIC Science & Technology

1976-01-01

sensors and for making pyroelectric pow^r generators. [ Chechkin , V . V . , A , I. Leychenko, O. S. Didkovskaya, G. Ye. Savenkova, V . V ...ALlenov, M. I. , A . V . Afomn, M. F. Akhmetzyanov, et al. High-speed apparatus for recording and processing measurements of fluctuations...is included. [Medvedev, G. A . , M. A . Markovich, and V . I. Shlyakhov. Optical light flux demodulation device for optical probes. Author’s

Neural Processing of What and Who Information in Speech

ERIC Educational Resources Information Center

Chandrasekaran, Bharath; Chan, Alice H. D.; Wong, Patrick C. M.

2011-01-01

Human speech is composed of two types of information, related to content (lexical information, i.e., "what" is being said [e.g., words]) and to the speaker (indexical information, i.e., "who" is talking [e.g., voices]). The extent to which lexical versus indexical information is represented separately or integrally in the brain is unresolved. In…

Laser Material Processing for Microengineering Applications

NASA Technical Reports Server (NTRS)

Helvajian, H.

1995-01-01

The processing of materials via laser irradiation is presented in a brief survey. Various techniques currently used in laser processing are outlined and the significance to the development of space qualified microinstrumentation are identified. In general the laser processing technique permits the transferring of patterns (i.e. lithography), machining (i.e. with nanometer precision), material deposition (e.g., metals, dielectrics), the removal of contaminants/debris/passivation layers and the ability to provide process control through spectroscopy.

Boiler Control Systems Oxygen Trim Systems Manual.

DTIC Science & Technology

1983-02-01

F/ G 5/9 N EhhhhhhhmonsoI smhhhEmhhhhhh smhhhhhhhhhhh Ehh0h0010I-E1E FEmhhhhEmmhhhhhhI LL+4 -.Lm(m~mkl~~d - - ." " - , -, - - ’ - °. ,,_ ". . . b...PAGIES Ik NNITrG A9NC ORS7 Ir- e, 0) 1 SECURITY CLASS. (of K4* MPMf) Office, g &, Washington, DC 20360 Unclassified Naval Facilities Engineering Coand...1NPLJT SoNAI . S141NAL. f* FIR4GIb[CTIQNAL SCkEMIATC DICIAN A’ RLfL FOSITIOWINC- SY<STEM1 (FUUMArIC) PRESSURE PROC.ESS PIIN42 ATI 6 C~rEMASTERO F13UE

Implementation Intentions Reduce Implicit Stereotype Activation and Application.

PubMed

Rees, Heather Rose; Rivers, Andrew Michael; Sherman, Jeffrey W

2018-05-01

Research has found that implementation intentions, if-then action plans (e.g., "if I see a Black face, I will think safe"), reduce stereotyping on implicit measures. However, it is unknown by what process(es) implementation intentions reduce implicit stereotyping. The present research examines the effects of implementation intentions on stereotype activation (e.g., extent to which stereotypic information is accessible) and stereotype application (e.g., extent to which accessible stereotypes are applied in judgment). In addition, we assessed the efficiency of implementation intentions by manipulating cognitive resources (e.g., digit-span, restricted response window) while participants made judgments on an implicit stereotyping measure. Across four studies, implementation intentions reduced implicit stereotyping. This decrease in stereotyping was associated with reductions in both stereotype activation and application. In addition, these effects of implementation intentions were highly efficient and associated with reduced stereotyping even for groups for which people may have little practice inhibiting stereotypes (e.g., gender).

Work Strategies: The Development and Testing of a Model.

DTIC Science & Technology

1986-03-01

strategies (e.g., Craik & Lockhart , 1972); hemispheric process - -7 ing differences (e.g., Seamon & Gazzaniga, 1973); problem-solving strategies (e.g...Charness, N. (1931). Aging and skilled problem solving. 3ournal of Experimental Psychology: General, 110, 21-38. Craik , F. I. \\., & Lockhart , R. S...1972). Levels of processing : A framework for memory research. Journal of Verbal Learning and Verbal Behavior, L1, 671-684. 3ansereau, D. F., McDonald

Guidelines for Effective Selective Listening

DTIC Science & Technology

1979-05-01

N., & Lockhart , R. S. Levels -of processing : A framework for qor research. Journa of Verbal Learnina and Verbal Behavior, Doeknimgo D. 0,9...e.g., Craik & Lockhart , 1972), interfering activities (e.g., Postman, 1961), and manner in which retention is measured (e.g., Postman & Rau, 1957...TO ENHANCE THE PROCESSING OF TARGET I NFORMATIONT 8 WHEN OPERATING IN HEAVY BACKGROUND NOISE, IT MAY BE BENEFICIAL TO MAINTAIN SOME VISUAL CONTACT WITH

Method of determining glass durability

DOEpatents

Jantzen, C.M.; Pickett, J.B.; Brown, K.G.; Edwards, T.B.

1998-12-08

A process is described for determining one or more leachate concentrations of one or more components of a glass composition in an aqueous solution of the glass composition by identifying the components of the glass composition, including associated oxides, determining a preliminary glass dissolution estimator, {Delta}G{sub p}, based upon the free energies of hydration for the component reactant species, determining an accelerated glass dissolution function, {Delta}G{sub a}, based upon the free energy associated with weak acid dissociation, {Delta}G{sub a}{sup WA}, and accelerated matrix dissolution at high pH, {Delta}G{sub a}{sup SB} associated with solution strong base formation, and determining a final hydration free energy, {Delta}G{sub f}. This final hydration free energy is then used to determine leachate concentrations for elements of interest using a regression analysis and the formula log{sub 10}(N C{sub i}(g/L))=a{sub i} + b{sub i}{Delta}G{sub f}. The present invention also includes a method to determine whether a particular glass to be produced will be homogeneous or phase separated. The present invention is also directed to methods of monitoring and controlling processes for making glass using these determinations to modify the feedstock materials until a desired glass durability and homogeneity is obtained. 4 figs.

Method of determining glass durability

DOEpatents

Jantzen, Carol Maryanne; Pickett, John Butler; Brown, Kevin George; Edwards, Thomas Barry

1998-01-01

A process for determining one or more leachate concentrations of one or more components of a glass composition in an aqueous solution of the glass composition by identifying the components of the glass composition, including associated oxides, determining a preliminary glass dissolution estimator, .DELTA.G.sub.p, based upon the free energies of hydration for the component reactant species, determining an accelerated glass dissolution function, .DELTA.G.sub.a, based upon the free energy associated with weak acid dissociation, .DELTA.G.sub.a.sup.WA, and accelerated matrix dissolution at high pH, .DELTA.G.sub.a.sup.SB associated with solution strong base formation, and determining a final hydration free energy, .DELTA.G.sub.f. This final hydration free energy is then used to determine leachate concentrations for elements of interest using a regression analysis and the formula log.sub.10 (N C.sub.i (g/L))=a.sub.i +b.sub.i .DELTA.G.sub.f. The present invention also includes a method to determine whether a particular glass to be produced will be homogeneous or phase separated. The present invention is also directed to methods of monitoring and controlling processes for making glass using these determinations to modify the feedstock materials until a desired glass durability and homogeneity is obtained.

The Processing and Mechanical Properties of High Temperature/ High Performance Composites. Mechanism-Based Constitutive Laws and Design. Book 1

DTIC Science & Technology

1994-03-01

H. Pestes Composites S . V . Kamat J. P. Hirth KJS 4/27/94 I I I I I M I BOOK 3 FATIGUE AND CREEP 32. Mode I Fatigue Cracking in a Fiber D . P. Walls...Mater.. 7 (1989) 305-17. Are: + 2(Am + 4m)(c, + d ) - (3;m + 2m)a mAT 9. Brindley. P. K.. Draper. S . L.. Nathal. M. V . & dm = R Eldridge. J. I...Mech. Ph vs. A 22A, 2975 (1991). Solids 24, 141 (1976). 8. S . Majumdar and P. V . Jr. McLaughlin, J. appl. Mech. 14. P. D . Warren, A. G. Mackin and A. G

Building Sustainability into the Air Force Remediation Process

DTIC Science & Technology

2010-06-16

Phytoremediation Biobarrier  Wrap-up  Future Direction 2 I n t e g r i t y - S e r v i c e - E x c e l l e n c e AF Environmental Restoration...Bioreactor  Phytoremediation  Biobarrier I n t e g r i t y - S e r v i c e - E x c e l l e n c e GSR Demo Site: In situ Bioreactor  Battery acid... Phytoremediation 24 ’ 98 1998 Nov 1999 Nov 2000 Nov 2001 Nov 2002 Nov 2003 Nov 2004 Nov 2005 Nov 2006 Nov 2007 Nov 2008 Nov 2009 Nov ’ 10 Follow-Up

High Temperature Advanced Structural Composites. Volume 2. Ceramic Matrix Composites, Fiber Processing and Properties, and Interfaces

DTIC Science & Technology

1993-04-02

1977) 97. 3 W. Wieswieler, E. Fitzer, G . Nagel, and H. Jager, Thin Solid Film, 148 (1987) 93. 4 T. A. Chernyshova , L. I. Kobelova, J. Mater. Scl., 20...AD-A267 023 I[E[gh ’Temperature kdvanced Structural (Composites Rensselaer Polytechnic Institute , \\ G Troy, N. Y. 12180-3590 - Final Report -- Book 2...thermodynamic data (heats of forma- ,(T p, comp.) °+p, comp.) (1) tion, absolute entropies, heat capacities) of reactants where g ’ is the chemical

Formation Processes and Impacts of Reactive and Nonreactive Minerals in Permeable Reactive Barriers

EPA Science Inventory

Mineral precipitates in zero-valent iron PRBs can be classified by formation processes into three groups: 1) those that result from changes in chemical conditions (i.e., changes in pH, e.g., calcite); 2) those that are a consequence of microbial activity (i.e., sulfate reduction,...

FORMATION PROCESSES AND CONSEQUENCES OF REACTIVE AND NON-REACTIVE MINERAL PRECIPITATES IN PERMEABLE REACTIVE BARRIERS

EPA Science Inventory

Mineral precipitates in zero-valent iron PRBs can be classified by formation processes into three groups: 1) those that result from changes in chemical conditions (i.e., change in pH, e.g., calcite); 2) those that are a consequence of microbial activity (i.e., sulfate reduction, ...

Exploratory Development on a New Process to Produce Improved RDX crystals: Supercritical Fluid Anti-Solvent Recrystallization

DTIC Science & Technology

1988-05-02

G. and J. Chiovini. Decaffeination Process . U.S. Patent 4,251.559; 17 February 1981. 43. Friedrich, J.P.. G.R. List, and A.J. Leakin. Petroleum...0 CONTRACT REPORT BRL-CR-606 EXPLORATORY DEVELOPMENT ON A NEW PROCESS TO PRODUCE IMPROVED RDX CRYSTALS: SUPERCRITICAL FLUID ANTI-SOLVENT...CCESSION NO. 11. TITLE (icnude Sun• y Uasuihcanon) I . • EXPLORATORY DEVELOPMENT ON A NEW PROCESS TO PRODUCE IMPROVED RDX CRYSTALS: SUPERCRITICAL

Processing Advantages of Lexical Bundles: Evidence from Self-Paced Reading and Sentence Recall Tasks

ERIC Educational Resources Information Center

Tremblay, Antoine; Derwing, Bruce; Libben, Gary; Westbury, Chris

2011-01-01

This article examines the extent to which lexical bundles (LBs; i.e., frequently recurring strings of words that often span traditional syntactic boundaries) are stored and processed holistically. Three self-paced reading experiments compared sentences containing LBs (e.g., "in the middle of the") and matched control sentence fragments (e.g., "in…

The mechanistic basis of internal conductance: a theoretical analysis of mesophyll cell photosynthesis and CO2 diffusion.

PubMed

Tholen, Danny; Zhu, Xin-Guang

2011-05-01

Photosynthesis is limited by the conductance of carbon dioxide (CO(2)) from intercellular spaces to the sites of carboxylation. Although the concept of internal conductance (g(i)) has been known for over 50 years, shortcomings in the theoretical description of this process may have resulted in a limited understanding of the underlying mechanisms. To tackle this issue, we developed a three-dimensional reaction-diffusion model of photosynthesis in a typical C(3) mesophyll cell that includes all major components of the CO(2) diffusion pathway and associated reactions. Using this novel systems model, we systematically and quantitatively examined the mechanisms underlying g(i). Our results identify the resistances of the cell wall and chloroplast envelope as the most significant limitations to photosynthesis. In addition, the concentration of carbonic anhydrase in the stroma may also be limiting for the photosynthetic rate. Our analysis demonstrated that higher levels of photorespiration increase the apparent resistance to CO(2) diffusion, an effect that has thus far been ignored when determining g(i). Finally, we show that outward bicarbonate leakage through the chloroplast envelope could contribute to the observed decrease in g(i) under elevated CO(2). Our analysis suggests that physiological and anatomical features associated with g(i) have been evolutionarily fine-tuned to benefit CO(2) diffusion and photosynthesis. The model presented here provides a novel theoretical framework to further analyze the mechanisms underlying diffusion processes in the mesophyll.

Proceedings of Colloquium on Stable Solutions of Some Ill-Posed Problems, October 9, 1979.

DTIC Science & Technology

1980-06-30

4. In (24] iterative process (9) was applied for calculation of the magnetization of thin magnetic films . This problem is of interest for computer...equation fl I (x-t) -f(t) = g(x), x > 1. (i) Its multidimensional analogue fmX-tK-if(t)dt = g(x), xEA, AnD (2) can be intepreted as the problem of

Selective interaction of AGS3 with G-proteins and the influence of AGS3 on the activation state of G-proteins.

PubMed

Bernard, M L; Peterson, Y K; Chung, P; Jourdan, J; Lanier, S M

2001-01-12

AGS3 (activator of G-protein signaling 3) was isolated in a yeast-based functional screen for receptor-independent activators of heterotrimeric G-proteins. As an initial approach to define the role of AGS3 in mammalian signal processing, we defined the AGS3 subdomains involved in G-protein interaction, its selectivity for G-proteins, and its influence on the activation state of G-protein. Immunoblot analysis with AGS3 antisera indicated expression in rat brain, the neuronal-like cell lines PC12 and NG108-15, as well as the smooth muscle cell line DDT(1)-MF2. Immunofluorescence studies and confocal imaging indicated that AGS3 was predominantly cytoplasmic and enriched in microdomains of the cell. AGS3 coimmunoprecipitated with Galpha(i3) from cell and tissue lysates, indicating that a subpopulation of AGS3 and Galpha(i) exist as a complex in the cell. The coimmunoprecipitation of AGS3 and Galpha(i) was dependent upon the conformation of Galpha(i3) (GDP GTPgammaS (guanosine 5'-3-O-(thio)triphosphate)). The regions of AGS3 that bound Galpha(i) were localized to four amino acid repeats (G-protein regulatory motif (GPR)) in the carboxyl terminus (Pro(463)-Ser(650)), each of which were capable of binding Galpha(i). AGS3-GPR domains selectively interacted with Galpha(i) in tissue and cell lysates and with purified Galpha(i)/Galpha(t). Subsequent experiments with purified Galpha(i2) and Galpha(i3) indicated that the carboxyl-terminal region containing the four GPR motifs actually bound more than one Galpha(i) subunit at the same time. The AGS3-GPR domains effectively competed with Gbetagamma for binding to Galpha(t(GDP)) and blocked GTPgammaS binding to Galpha(i1). AGS3 and related proteins provide unexpected mechanisms for coordination of G-protein signaling pathways.

Negotiation Performance: Antecedents, Outcomes, and Training Recommendations

DTIC Science & Technology

2011-10-01

Tutorial Cognitive Apprenticeships Instructional Conversations Independent Programmed Instruction Computer-Based Instruction I Rr La...procedural knowledge, as well as the more distal antecedents of individual difference variables (e.g., cognitive ability , personality) and psychological...individual difference variables (e.g., cognitive ability , personality) and psychological processes (e.g., cognitive , motivational, and emotional). This

Shaped Charge Liner Materials: Resources, Processes, Properties, Costs, and Applications

DTIC Science & Technology

1991-02-01

SUBTITLE 5. FUNDING NUMBERS Shaped Charge Liner Materials: Resources, Processes, Properties, Costs, and Applications 2 6. AUTHOC Steven M. Buc 7...summaries of the mineral availability, Cq prmarymetal refinement processeb, material costs in raw form and as finished shaped charge liners , relevant... liner materials. 94-11479 gI 14, SUBJECT TERMS iSt NUMBER OF PAGIS 13chrg wrhad :xplosively formed penetrators material R. PRCE COEV" processing

The Human Operator and System Effectiveness.

DTIC Science & Technology

1984-06-01

required in some decision process (e. g., component selection). 14 le NWC TP 6541 3. Be clearly stated in the final study report, with the rationale...BICYC LES t 5 - : BUSRSTO %* -.-’. ... % .% % . . J . % ... ~ ,4~ V’ .- *’ .-.-. , -LOADER T 1 = 1 + t 2 + LARGEST OF (t 3, t 4, t5) ,’ .t 2 t 3...34’,"t OPEN I UNLOAD " "I t DOORS PASSENGERSHI H" "" I PARK" "B. I AT t 5 t 4 BU SO OPERATE UNLOAD • . _ P LO A D ER BICYC LES -’, ",T 1 t I + L A R G

Speciation and formation of iodinated trihalomethane from microbially derived organic matter during the biological treatment of micro-polluted source water.

PubMed

Wei, Yuanyuan; Liu, Yan; Ma, Luming; Wang, Hongwu; Fan, Jinhong; Liu, Xiang; Dai, Rui-Hua

2013-09-01

Water sources are micro-polluted by the increasing range of anthropogenic activities around them. Disinfection byproduct (DBP) precursors in water have gradually expanded from humic acid (HA) and fulvic acid to other important sources of potential organic matter. This study aimed to provide further insights into the effects of microbially derived organic matter as precursors on iodinated trihalomethane (I-THM) speciation and formation during the biological treatment of micro-polluted source water. The occurrence of I-THMs in drinking water treated by biological processes was investigated. The results showed for the first time that CHCl2I and CHBrClI are emerging DBPs in China. Biological pre-treatment and biological activated carbon can increase levels of microbes, which could serve as DBP precursors. Chlorination experiments with bovine serum albumin (BSA), starch, HA, deoxyribonucleic acid (DNA), and fish oil, confirmed the close correlation between the I-THM species identified during the treatment processes and those predicted from the model compounds. The effects of iodide and bromide on the I-THM speciation and formation were related to the biochemical composition of microbially derived organic precursors. Lipids produced up to 16.98μgL(-1) of CHCl2I at an initial iodide concentration of 2mgL(-1). HA and starch produced less CHCl2I at 3.88 and 3.54μgL(-1), respectively, followed by BSA (1.50μgL(-1)) and DNA (1.35μgL(-1)). Only fish oil produced I-THMs when iodide and bromide were both present in solution; the four other model compounds formed brominated species. Copyright © 2013 Elsevier Ltd. All rights reserved.

Construct Validity in TOEFL iBT Speaking Tasks: Insights from Natural Language Processing

ERIC Educational Resources Information Center

Kyle, Kristopher; Crossley, Scott A.; McNamara, Danielle S.

2016-01-01

This study explores the construct validity of speaking tasks included in the TOEFL iBT (e.g., integrated and independent speaking tasks). Specifically, advanced natural language processing (NLP) tools, MANOVA difference statistics, and discriminant function analyses (DFA) are used to assess the degree to which and in what ways responses to these…

Automatic/Control Processing Concepts and Their Implications for the Training of Skills.

DTIC Science & Technology

1982-04-01

driving a car are examples of automatic processes. Controll p s is comparatively slow, serial, limited by short-term memory, and requires subject effort...development has convinced us that moivation a oftn more Jmportn nti mAn =other iJli velLJoa jjthpgy gI. njj Lautomatic U_2,LLjjk. Motivation Is much more

Integrated Data and Control Level Fault Tolerance Techniques for Signal Processing Computer Design

DTIC Science & Technology

1990-09-01

TOLERANCE TECHNIQUES FOR SIGNAL PROCESSING COMPUTER DESIGN G. Robert Redinbo I. INTRODUCTION High-speed signal processing is an important application of...techniques and mathematical approaches will be expanded later to the situation where hardware errors and roundoff and quantization noise affect all...detect errors equal in number to the degree of g(X), the maximum permitted by the Singleton bound [13]. Real cyclic codes, primarily applicable to

Linking Acquisition Decisionmaking With National Military Strategy

DTIC Science & Technology

1990-10-01

DTIC CONTAINED A SIGNIFICANT NUMBER OF COLOR PAGES WHICH DO NOT REPRODUCE LEGIBLY ON BLACK AND WHITE MICROFICHE, L i REPORT DOCUMENTATION PAGE Form...objectives I within the planning process. A fourth issue was the pace of change in enchancing the joint role in the acquisition g process. The former CJCS...goals, the roadmap, and PPOs. Hence, the DPG provides a VI-22 5 I systematic institutional memory , incorporating decisions as they are made, and thus

[Production of a compost accelerator inoculant].

PubMed

Medina Lara, M Socorro; Quintero Lizaola, Roberto; Espinosa Victoria, David; Alarcón, Alejandro; Etchevers Barra, Jorge D; Trinidad Santos, Antonio; Conde Martínez, F Víctor

2017-10-26

Composting was performed using a mixture of ovine manure and straw. Inoculum was extracted at five different phases of the composting process (18, 23, 28, 33 and 38 days after the start of the composting process) and its effect on reducing biotransformation time was evaluated in the composted ovine manure. The samples were preserved in a deep freezer, then lyophilized to obtain the inoculum, 50g of which was added to each treatment in the second experimental phase. Six treatments were established; C=straw (P)+ovine manure (E), T1=P+ E+inoculum 18 days after the start of the composting process (I18), T2=P+E+I23, T3=P+E+I28, T4=P+E+I33, T5=P+E+I38, with three replications. Treatments were placed in a controlled-environment chamber at 45% relative humidity and 30°C along with flasks containing 50g of material to measure daily production, CO 2 accumulation, temperature, pH, electric conductivity (dS/m), organic matter (%), total nitrogen (%), total carbon (%), C: N ratio, particle size (Tp) and bulk density (g/l). CO 2 production (mg) showed a significant difference (p ≤.05) of treatments T2 and T5 with respect to the others, which demonstrated that the inoculum of these treatments accelerated the dynamics of microorganisms and the composting process. The quality and maturity of the compost are guaranteed as the amount of CO 2 decreases. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Leadership Styles and Self-Efficacy in Determining Transfer Intentions of Safety Training

ERIC Educational Resources Information Center

Vignoli, Michela; Mariani, Marco Giovanni; Guglielmi, Dina; Violante, Francesco Saverio

2018-01-01

Purpose: This study aims to investigate the factors that can influence the transfer process of training in open skills, i.e. non-technical skills (NTS). Specifically, according to the model of the transfer process, the aim of this paper is to analyse the effects of both personal (e.g. self-efficacy) and work environment (e.g. safety leadership…

The role of secondary processes in kinetics of triplet states of a hydrogen molecule in an ECR discharge

NASA Astrophysics Data System (ADS)

Shakhatov, V. A.; Lebedev, Yu A.; Lacoste, A.; Bechu, S.

2017-11-01

An electronic state sensitive semiempirical collision-radiative model of hydrogen plasma of ECR-discharge is used to analyze the applicability of emission of triplet states of molecular hydrogen for plasma diagnostics. It is shown that secondary processes make the greatest contribution to the kinetics of population-depopulation of triplet states {a}3{{Σ }}}g+,{c}3{{{\\Pi }}}u,{d}3{{{\\Pi }}}u,{e}3{{{Σ }}}u+,{g}3{{{Σ }}}g+,{h}3{{{Σ }}}g+, i 3Πg and r 3Πg. The secondary processes give the smallest contribution to the excitation and deactivation of triplet states {f}3{{{Σ }}}u+ {\\unicode{x00438;} {k}3{{{\\Pi }}}u. Thus a simplified coronal model (electron impact excitation followed by radiative decay) can be used to process the intensities of the dipole allowed {f}3{{{Σ }}}u+ \\to {a}3{{{Σ }}}g+,{g}3{{{Σ }}}g+ and {k}3{{{\\Pi }}}u \\to {a}3{{{Σ }}}g+ transitions. The complicated collision-radiative model should be used for other transitions.

Tropical Cyclone Motion: Environmental Interaction Plus a Beta Effect,

DTIC Science & Technology

1982-11-01

il)-Ai3l 808 TROPICA YL ONE NOTION: ENVIRONMENTAL INTERCIION PLUS 1/1 A BETA EFFECT (U) C LORADO STATE UNIV FORT COLLINS DEPT OF ATMOSPHERIC SCIENCE... EFFECT -~~ BY G RE G J. HOLLAND P 1. WILLIAM M. GRAY t’ :’ - .T Atmospheric Science S"TPAPER 󈧎. AUG 2 9 1983 . •4. . .. . . . . . .. ". . . .i L’S I g...causes a westward deviation from the pure steering flow. The nonlinear marner in which these two processes combine together with the effect of as

Aviation Turbine Fuels from Tar Sands Bitumen and Heavy Oils. Part 3. Laboratory Sample Production.

DTIC Science & Technology

1987-12-01

FILD7 ar Sands, Heavy Ois Jet Fue - - - etF IE L D G R O U P S U B -G R O U P , u e -. IT - 3 seC m ) A s h l GROUP SB-RP Fue-i-T-33-A Reduced Crude...connec- tion with processes for heavy oil cracking and related catalysts. * program which allowed processing of bitumen stocks . The overall process flow

Optical Data Processing in Europe,

DTIC Science & Technology

1981-12-31

PROCESSING IN EUROPE4 _____________ 6PERFORMING ORG. REPORT NUMBER 7. AUTIKOR(eJ G . CONTRACT OR GRANT NUMBER(&) /7David/)Casasent 9. PERFORMING ORGANIZATION...Direction Des Recherches, Etudes et Techniques (DRET]). Present at this meeting were J. Graf, M. Petri and G . Marie of LEP as well as M. Constans and M...be useful in sonai , and processing studies. I visited Henri at Elf Aquitaine in Pau, Frarce. wt- w,-1. overall view of the company and a summary of

When are support and opposition not opposites? Depth of processing as a moderator of the valence-framing effect.

PubMed

Bizer, George Y; Žeželj, Iris L; Luguri, Jamie B

2013-03-01

Prior research has demonstrated the valence-framing effect, in which leading people to frame a preference negatively (e.g., 'I oppose Romney') yields stronger attitudes than does leading people to frame that same preference positively (e.g., 'I support Obama'). Three studies tested whether or not depth of processing (as operationalized by manipulations of motivation and ability to cognitively process) moderate the effect. The valence-framing effect was replicated, such that opposers manifested stronger attitudes than did supporters, but only when attitudes were relevant to the participants (Experiments 1 and 3), and when participants were not under cognitive load (Experiment 2). Our results thus identify depth of processing as an important moderator of the valence-framing effect and provide potential insight into the effect's mechanism. © 2012 The British Psychological Society.

Wave Characteristics of Temperature Inversion Process of Nighttime Radiation,

DTIC Science & Technology

1983-12-09

CHARACTERISTICS OF TEMPERATURE INVERSION PROCESS OF NIGHTTIME RADIATION By: Zhou Mingyu and Zhang ¥i English pages: 8 Source: Kexue Tongbao, 1982, pp. 156...lJournal of Meteorology], 39 (1981), 1:70-81. 3. Drazin, P. G., J. Fluid. Mech., 4 (1958), 214-224. 4. Zhou Mingyu et al., QIXIANG XUEBAO, 38 (1980), 3: 250...258. 5. Emnanuel, C. B., B-L. Meteor., 5(1973), N(1/2)8 19-27. 6. Zhou Mingyu et al., J. Acoust. Soc., A. m., 68 (1980), 1: 303-308. 8 I iI

Space/Frequency Conversions in Image Processing and Transmission.

DTIC Science & Technology

1981-11-01

particularly with respect to the signal-to- noise ratio of the processed outputs. Devejlmnnt 9i a 1megtg fO-g s *&t~i egM2&Y conversion image_ aEggMsinLg: One...slowiv, whil e tle spatial impulse r-on i Ix~v; t) is vairied rapidly Iit *I tat tern recognitiont steartcl operaitioti. Under thiese c’irc-umstances, 11...electronic) will he incapable of recording the image with good signal-to- noise ratio. In what follows, we consider two approaches to producing these

Analyzing Process Data from Game/Scenario-Based Tasks: An Edit Distance Approach

ERIC Educational Resources Information Center

Hao, Jiangang; Shu, Zhan; von Davier, Alina

2015-01-01

Students' activities in game/scenario-based tasks (G/SBTs) can be characterized by a sequence of time-stamped actions of different types with different attributes. For a subset of G/SBTs in which only the order of the actions is of great interest, the process data can be well characterized as a string of characters (i.e., action string) if we…

40 CFR 63.9620 - On which units and by what date must I conduct performance tests or other initial compliance...

Code of Federal Regulations, 2013 CFR

2013-07-01

... section. (1) All emission units within a group must be of the same process type (e.g., primary crushers... emission units from different process types together for the purposes of this section. (2) All emission units within a group must also have the same type of air pollution control device (e.g., wet scrubbers...

40 CFR 63.9620 - On which units and by what date must I conduct performance tests or other initial compliance...

Code of Federal Regulations, 2014 CFR

2014-07-01

... section. (1) All emission units within a group must be of the same process type (e.g., primary crushers... emission units from different process types together for the purposes of this section. (2) All emission units within a group must also have the same type of air pollution control device (e.g., wet scrubbers...

40 CFR 63.9620 - On which units and by what date must I conduct performance tests or other initial compliance...

Code of Federal Regulations, 2012 CFR

2012-07-01

... section. (1) All emission units within a group must be of the same process type (e.g., primary crushers... emission units from different process types together for the purposes of this section. (2) All emission units within a group must also have the same type of air pollution control device (e.g., wet scrubbers...

40 CFR 63.9620 - On which units and by what date must I conduct performance tests or other initial compliance...

Code of Federal Regulations, 2010 CFR

2010-07-01

... section. (1) All emission units within a group must be of the same process type (e.g., primary crushers... emission units from different process types together for the purposes of this section. (2) All emission units within a group must also have the same type of air pollution control device (e.g., wet scrubbers...

40 CFR 63.9620 - On which units and by what date must I conduct performance tests or other initial compliance...

Code of Federal Regulations, 2011 CFR

2011-07-01

... section. (1) All emission units within a group must be of the same process type (e.g., primary crushers... emission units from different process types together for the purposes of this section. (2) All emission units within a group must also have the same type of air pollution control device (e.g., wet scrubbers...

High-Performance Liquid Chromatography Studies to Estimate Ergosterol Content at Different Developmental Stages of the Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Agaricomycetes).

PubMed

Goyal, Anna; Kalia, Anu; Sodhi, Harpreet Singh

2016-01-01

Ganoderma lucidum has been widely used as a source of potent nutraceutical products. This study was planned to identify and characterize the role of ergosterol in the developmental process of G. lucidum. Four strains of G. lucidum (GL-I-IV) showed a gradual increase in biomass (from 25.52 to 31.72 g) after 3 weeks of growth in mushroom complete medium broth, with maximum biomass observed for strain GL-III. Upon cultivation of G. lucidum strains on wheat straw supplemented with 5% wheat bran, maximum biological efficiency was recorded for the GL-I strain (31.23%), followed by GL-II (26.73%); the number of fruiting bodies were 927 and 693, each weighing 33.7 and 38.6 g, respectively. The amount of ergosterol in the Ganoderma test strains varied among the strains and at different developmental stages, namely, the vegetative mycelium, spawn run, pinhead, and fruiting body phases. The maximum ergosterol content was produced by the GL-I strain during the vegetative mycelium (4601 p.g/g) and reproductive fruiting body (7009 p.g/g) stages. However, strain GL-IV followed by strain GL-II exhibited maximum ergosterol content in the spawn run stage. The ergosterol content was better for GL-II at the pinhead stage. This report indicates that ergosterol content varies among the test strains. Moreover, it increases with each stage of the cultivation process, that is, from spawn run to pinhead to and fruiting body formation.

WASTE STABILIZATION FUNDAMENTALS FOR BIOREACTOR LANDFILLS

EPA Science Inventory

Waste stabilization is the process where putrescible waste is biodegraded by microorganisms resulting in an end-product being a relatively inert substrate (e.g., like compost). When exposed to moisture, biologically stabilized waste should not produce substantial quantitie...

How meaning similarity influences ambiguous word processing: the current state of the literature

PubMed Central

Tokowicz, Natasha

2016-01-01

The majority of words in the English language do not correspond to a single meaning, but rather correspond to two or more unrelated meanings (i.e., are homonyms) or multiple related senses (i.e., are polysemes). It has been proposed that the different types of “semantically-ambiguous words” (i.e., words with more than one meaning) are processed and represented differently in the human mind. Several review papers and books have been written on the subject of semantic ambiguity (e.g., Adriaens, Small, Cottrell, & Tanenhaus, 1988; Burgess & Simpson, 1988; Degani & Tokowicz, 2010; Gorfein, 1989, 2001; Simpson, 1984). However, several more recent studies (e.g., Klein & Murphy, 2001; Klepousniotou, 2002; Klepousniotou & Baum, 2007; Rodd, Gaskell, & Marslen-Wilson, 2002) have investigated the role of the semantic similarity between the multiple meanings of ambiguous words on processing and representation, whereas this was not the emphasis of previous reviews of the literature. In this review, we focus on the current state of the semantic ambiguity literature that examines how different types of ambiguous words influence processing and representation. We analyze the consistent and inconsistent findings reported in the literature and how factors such as semantic similarity, meaning/sense frequency, task, timing, and modality affect ambiguous word processing. We discuss the findings with respect to recent parallel distributed processing (PDP) models of ambiguity processing (Armstrong & Plaut, 2008, 2011; Rodd, Gaskell, & Marslen-Wilson, 2004). Finally, we discuss how experience/instance-based models (e.g., Hintzman, 1986; Reichle & Perfetti, 2003) can inform a comprehensive understanding of semantic ambiguity resolution. PMID:24889119

Signal Processing Distortion Loss in Spread-Spectrum Communication, Command, Control, and Navigation Systems.

DTIC Science & Technology

1980-10-01

Communications, fourth edition; Bell Telephone Laboratories, Western Electric Co., Technical Publications, Winston- Salem , NC (1971). 2. Sunde, E.D...PAI,-A F - IC 1i 1 I o I j q V (:0-(YjX) 093 [’ FF5 Fs PFA \\ / fjl U C. ŗ(:OL ’i IPH, .INJ(𔃾X) 00 U’G! F VFA ANLI 0.0 CYL!0- I1I-L. I3TF AT -, i

HLA-G and classical HLA class I expression in primary colorectal cancer and associated liver metastases.

PubMed

Swets, Marloes; König, Marion H; Zaalberg, Anniek; Dekker-Ensink, Neeltje G; Gelderblom, Hans; van de Velde, Cornelis J H; van den Elsen, Peter J; Kuppen, Peter J K

2016-09-01

De novo expression of HLA-G has been demonstrated in colorectal cancer. HLA-G, amongst others, inhibits natural killer cell function, contributing to host immune defense evasion. Another mechanism to escape anti-tumor immunity is loss of HLA class I. Therefore, we determined HLA-G and HLA class I expression on primary colorectal tumors and associated liver metastases, in order to get insight in the metastasizing process regarding escaping anti-tumor immunity. HLA-G expression was evaluated using three mAbs; 4H84, MEM-G/1 and MEM-G/2. In total 81 colorectal cancer patients were evaluated. Formalin-fixed paraffin-embedded tissue sections of primary tumors and associated liver metastases, were immunohistochemically stained. A concordance between expression or loss/downregulation in the primary tumor and associated liver metastasis regarding HLA class I expression was observed in 80% of the cases. In contrast with the hypothesis of escaping NK cell-killing, we demonstrated for each HLA-G detecting mAbs used in this study, that the majority of the primary tumors that positively stained for HLA-G did not express HLA-G in the associated liver metastasis. Furthermore, we revealed the existence of non-specific binding and in addition we found that the different epitopes of HLA-G detected by 4H84, MEM-G/1 and MEM-G/2 mAbs were expressed differentially in colorectal tumor tissues. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Distributed Computing for Signal Processing: Modeling of Asynchronous Parallel Computation.

DTIC Science & Technology

1986-03-01

the proposed approaches 16, 16, 40 . 451. The conclusion most often reached is that the best scheme to use in a particular design depends highly upon...76. 40 . Siegel, H. J., McMillen. R. J., and Mueller. P. T.. Jr. A survey of interconnection methods for reconligurable parallel processing systems...addressing meehaanm distributed in the network area rimonication% tit reach gigabit./second speeds je g.. PoCoS83 .’ i.V--i the lirO! lk i nitronment is

European Master's Program in Gerontology (EuMaG): Goals, Curriculum, and Students

ERIC Educational Resources Information Center

Aartsen, Marja

2011-01-01

The European Master's Program in Gerontology (EuMaG) started in September 2003 with support from the European Commission. The EuMaG is a modular, 2-year, part-time international training program about the aging process and its societal implications. The multidisciplinary curriculum comprises four domains of gerontology (i.e., social gerontology,…

Effect of Concentrated Apple Extract on Experimental Colitis Induced by Acetic Acid.

PubMed

Pastrelo, Maurício Mercaldi; Dias Ribeiro, Carla Caroline; Duarte, Joselmo Willamys; Bioago Gollücke, Andréa Pitelli; Artigiani-Neto, Ricardo; Ribeiro, Daniel Araki; Miszputen, Sender Jankiel; Fujiyama Oshima, Celina Tizuko; Ribeiro Paiotti, Ana Paula

2017-01-01

Reactive oxygen and nitrogen species (ROS/RNS) play a crucial role in inflammatory bowel disease (IBD) exacerbating the chronic inflammatory process. Endogenous and diet antioxidants can neutralize these compounds. The apple is widely consumed, with several antioxidant activity compounds. The present study evaluated the effects of concentrated apple extract (CAE) in acetic acid induced colitis. 29 Wistar male rats were randomized into 5 groups. G1-Sham/saline solution, G2-CAE/control, G3-acetic acid/control, G4-curative- CAE treatment and G5-preventive-CAE treatment. Eight days later, the animals were euthanized and the colonic segment resected for macroscopic and histological analysis. Gene expression was evaluated for inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), catalase and copper and zinc superoxide dismutase (CuZnSOD) by quantitative real time PCR, while protein expression was assessed for iNOS, COX-2 and 8-hydroxy-20-deoxyguanosine (8-OHdG) via immunohistochemistry. The groups G3, G4 and G5 had weight loss, while G5 had weight increase at the end of the experiment. The treatment with CAE reduced the macroscopic and microscopic injury, decreased iNOS mRNA expression and increased CuZnSOD mRNA expression in animals with induced acetic acid-colitis. The findings of the present study suggest that CAE treatment exerts an antioxidant role by downregulating iNOS and upregulating CuZnSOD.

The inflammatory & neurodegenerative (I&ND) hypothesis of depression: leads for future research and new drug developments in depression.

PubMed

Maes, Michael; Yirmyia, Raz; Noraberg, Jens; Brene, Stefan; Hibbeln, Joe; Perini, Giulia; Kubera, Marta; Bob, Petr; Lerer, Bernard; Maj, Mario

2009-03-01

Despite extensive research, the current theories on serotonergic dysfunctions and cortisol hypersecretion do not provide sufficient explanations for the nature of depression. Rational treatments aimed at causal factors of depression are not available yet. With the currently available antidepressant drugs, which mainly target serotonin, less than two thirds of depressed patients achieve remission. There is now evidence that inflammatory and neurodegenerative (I&ND) processes play an important role in depression and that enhanced neurodegeneration in depression may-at least partly-be caused by inflammatory processes. Multiple inflammatory-cytokines, oxygen radical damage, tryptophan catabolites-and neurodegenerative biomarkers have been established in patients with depression and these findings are corroborated by animal models of depression. A number of vulnerability factors may predispose towards depression by enhancing inflammatory reactions, e.g. lower peptidase activities (dipeptidyl-peptidase IV, DPP IV), lower omega-3 polyunsaturated levels and an increased gut permeability (leaky gut). The cytokine hypothesis considers that external, e.g. psychosocial stressors, and internal stressors, e.g. organic inflammatory disorders or conditions, such as the postpartum period, may trigger depression via inflammatory processes. Most if not all antidepressants have specific anti-inflammatory effects, while restoration of decreased neurogenesis, which may be induced by inflammatory processes, may be related to the therapeutic efficacy of antidepressant treatments. Future research to disentangle the complex etiology of depression calls for a powerful paradigm shift, i.e. by means of a high throughput-high quality screening, including functional genetics and genotyping microarrays; established and novel animal and ex vivo-in vitro models for depression, such as new transgenic mouse models and endophenotype-based animal models, specific cell lines, in vivo and ex vivo electroporation, and organotypic brain slice culture models. This screening will allow to: 1) discover new I&ND biomarkers, both at the level of gene expression and the phenotype; and elucidate the underlying molecular I&ND pathways causing depression; and 2) identify new therapeutic targets in the I&ND pathways; develop new anti-I&ND drugs for these targets; select existing anti-I&ND drugs or substances that could augment the efficacy of antidepressants; and predict therapeutic response by genetic I&ND profiles.

An extraction process to recover vanadium from low-grade vanadium-bearing titanomagnetite.

PubMed

Chen, Desheng; Zhao, Hongxin; Hu, Guoping; Qi, Tao; Yu, Hongdong; Zhang, Guozhi; Wang, Lina; Wang, Weijing

2015-08-30

An extraction process to recover vanadium from low-grade vanadium-bearing titanomagnetite was developed. In this study, a mixed solvent system of di(2-ethylhexyl) phosphate (D2EHPA) and tri-n-butyl phosphate (TBP) diluted with kerosene was used for the selective extraction of vanadium from a hydrochloric acid leaching solution that contained low vanadium concentration with high concentrations of iron and impurities of Ca, Mg, and Al. In the extraction process, the initial solution pH and the phase ratio had considerable functions in the extraction of vanadium from the hydrochloric acid leaching solution. Under optimal extraction conditions (i.e., 30-40°C for 10min, 1:3 phase ratio (O/A), 20% D2EHPA concentration (v/v), and 0-0.8 initial solution pH), 99.4% vanadium and only 4.2% iron were extracted by the three-stage counter-current extraction process. In the stripping process with H2SO4 as the stripping agent and under optimal stripping conditions (i.e., 20% H2SO4 concentration, 5:1 phase ratio (O/A), 20min stripping time, and 40°C stripping temperature), 99.6% vanadium and only 5.4% iron were stripped by the three-stage counter-current stripping process. The stripping solution contained 40.16g/LV2O5,0.691g/L Fe, 0.007g/L TiO2, 0.006g/L SiO2 and 0.247g/L CaO. A V2O5 product with a purity of 99.12% V2O5 and only 0.026% Fe was obtained after the oxidation, precipitation, and calcination processes. The total vanadium recovered from the hydrochloric acid leaching solution was 85.5%. Copyright © 2015 Elsevier B.V. All rights reserved.

Improved Generation of Induced Cardiomyocytes Using a Polycistronic Construct Expressing Optimal Ratio of Gata4, Mef2c and Tbx5.

PubMed

Wang, Li; Liu, Ziqing; Yin, Chaoying; Zhou, Yang; Liu, Jiandong; Qian, Li

2015-11-13

Direct conversion of cardiac fibroblasts (CFs) into induced cardiomyocytes (iCMs) holds great potential for regenerative medicine by offering alternative strategies for treatment of heart disease. This conversion has been achieved by forced expression of defined factors such as Gata4 (G), Mef2c (M) and Tbx5 (T). Traditionally, iCMs are generated by a cocktail of viruses expressing these individual factors. However, reprogramming efficiency is relatively low and most of the in vitro G,M,T-transduced fibroblasts do not become fully reprogrammed, making it difficult to study the reprogramming mechanisms. We recently have shown that the stoichiometry of G,M,T is crucial for efficient iCM reprogramming. An optimal stoichiometry of G,M,T with relative high level of M and low levels of G and T achieved by using our polycistronic MGT vector (hereafter referred to as MGT) significantly increased reprogramming efficiency and improved iCM quality in vitro. Here we provide a detailed description of the methodology used to generate iCMs with MGT construct from cardiac fibroblasts. Isolation of cardiac fibroblasts, generation of virus for reprogramming and evaluation of the reprogramming process are also included to provide a platform for efficient and reproducible generation of iCMs.

A Model of Sexual Risk Behaviors among Young Gay and Bisexual Men: Longitudinal Associations of Mental Health, Substance Abuse, Sexual Abuse, and the Coming-Out Process

ERIC Educational Resources Information Center

Rosario, Margaret; Schrimshaw, Eric W.; Hunter, Joyce

2006-01-01

Sexual risk behaviors of young gay and bisexualmen must be understood within the context of other health concerns (e.g., anxiety, substance abuse), population specific factors (i.e., the coming-out process and gay-related stress), childhood sexual abuse, and other theoretical factors (e.g., safer-sex intentions). The current report proposes and…

Structural, Electronic, and Electrochemical Properties of LixCo[Fe(CN)6]0.902.9H2O

NASA Astrophysics Data System (ADS)

Takachi, Masamitsu; Matsuda, Tomoyuki; Moritomo, Yutaka

2013-04-01

Prussian blue analogues with jungle-gym-type structure are promising candidates for cathode materials of the lithium-ion secondary battery (LIB). Here, we investigated the structural, electronic, and electrochemical properties of cobalt hexacyanoferrate, LixCo[Fe(CN)6]0.902.9H2O, against Li concentration (x). The capacity (= 139 mAh/g) of the thin-film electrode was close to the ideal value (= 132 mAh/g) for the two-electron reaction. The discharge curve exhibits three plateaus, i.e., plateaus I, II, and III. The material exhibits a first-order phase transition accompanied by significant volume expansion by 7% at the boundary between plateaus II and III. Ex situ X-ray absorption spectroscopy (XAS) indicates that the discharge processes of plateaus I, II, and III are ascribed to the reduction processes of Fe3+, Co3+, and Fe3+, respectively. The rate (r) and cycle (n) dependence of the electrode performance will be discussed in terms of the reduction processes.

Arsenic exposure levels in relation to different working departments in a copper mining and smelting plant

NASA Astrophysics Data System (ADS)

Sun, Qingshan; Song, Yingli; Liu, Shengnan; Wang, Fei; Zhang, Lin; Xi, Shuhua; Sun, Guifan

2015-10-01

The investigation was carried out to evaluate arsenic exposure and the urine metabolite profiles of workers with different working departments, including administration (Group1), copper ore mining (Group2), copper ore grinding (Group3), electrolytic procession (Group4) and copper smelting (Group5) in a Copper mining and processing plant in China. Information about characteristics of each subject was obtained by questionnaire and inorganic arsenic (iAs), monomethylarsonic acid (MMA), dimethylarsinic acid (DMA) in urine were determined. The highest urinary levels of iAs, MMA and DMA all were found in the Group 5. Group 4 workers had a higher iAs% and a lower PMI compared to Group 3. The urinary total As (TAs) levels of 54.7% subjects exceeded 50 μg/g Cr, and the highest percentage (93.3%) was found in Group 5, smelters. The results of the present study indicate that workers in copper production plant indeed exposed to As, especially for smelters and workers of electrolytic process.

Pentadecapeptide BPC 157 reduces bleeding time and thrombocytopenia after amputation in rats treated with heparin, warfarin or aspirin.

PubMed

Stupnisek, Mirjana; Franjic, Sandra; Drmic, Domagoj; Hrelec, Masa; Kolenc, Danijela; Radic, Bozo; Bojic, Davor; Vcev, Aleksandar; Seiwerth, Sven; Sikiric, Predrag

2012-05-01

Recently, in rat abdominal aorta terminoterminal-anastomosis the stable gastric pentadecapeptide BPC 157 prevents obstructive thrombus formation and rapidly destroys already formed obstructive thrombus. Also, BPC 157 wound healing may signify the clot as conductive matrix or "scaffold" to speed up wound healing process, and decrease bleeding. Here, in rats, BPC 157 (10 μg/kg, 10 ng/kg) improved always reduced bleeding time and amount of bleeding after (tail) amputation only, heparin (250 mg/kg, 25mg/kg, 10mg/kg i.v.), warfarin (1.5mg/kg i.g. once daily for 3 consecutive days), aspirin (0.1g/kg i.g. (once daily/3 consecutive days) or 1.0 g/kg i.p. once), and amputation associated with those agents application. BPC 157 counteracting regimens (i.v., i.p., i.g. (immediately after any challenge)) correspondingly follow the route of bleeding-agents application. All heparin-, warfarin-, and aspirin-rats and normal-rats that received BPC 157 exhibited lesser fall in platelets count. BPC 157 attenuated over-increased APTT-, TT-values in 10mg/kg heparin-rats, but did not influence heparin activity (anti-Xa test). Indicatively, unless counteracted in BPC 157 rats, excessive bleeding-acute thrombocytopenia (<20% of initial values in heparin-rats) approaches substantial fall in platelets count known in type II HIT. Also, BPC 157 markedly prolongs the survival time (heparin-rats, 25mg/kg, right foot amputation). Copyright © 2011 Elsevier Ltd. All rights reserved.

Strategies for elimination of cyanogens from cassava for reducing toxicity and improving food safety.

PubMed

Nambisan, Bala

2011-03-01

Toxicity of cassava arises due to the presence of the cyanoglucosides linamarin and lotaustralin which are hydrolysed by endogenous enzyme linamarase to acetonecyanohydrin (ACN) and cyanide (CN) which are toxic. Major research efforts to eliminate/reduce cyanoglucosides have focused on (i) development of acyanogenic cassava varieties by breeding; (ii) controlling its metabolism; and (iii) processing to remove cyanogens. The cyanoglucoside (CNG) content in cassava is genetically controlled and cultivars may be classified as low (<50 μg/g), medium (50-100 μg/g) and high CN (>100 μg CN eq./g) varieties. Molecular techniques for reducing tuber CNG have focused on development of transgenic plants with reduced expression of cyt P 450 in leaves, or increased expression of hydroxynitrilelyase in tuber. For immediate solution, CNG content can be reduced using several processing methods. Traditional methods used for processing include boiling, drying, parboiling and drying, baking, steaming, frying and preparation of flour. These processes result in CN losses ranging from 25% to 98%. The cyanogen level in the final product is influenced both by the tuber CNG and the method of processing. In order to achieve safe levels of 10 μg/g in cassava products, new methods of processing, especially for cassava containing more than 250 μg CN eq./g, remains a challenging problem. Copyright © 2010. Published by Elsevier Ltd.

A process-content approach to adolescent identity formation: examining longitudinal associations between identity styles and goal pursuits.

PubMed

Duriez, Bart; Luyckx, Koen; Soenens, Bart; Berzonsky, Michael

2012-02-01

Research on identity focuses on the processes involved (e.g., identity style) or its content (e.g., goals and values), but limited research has addressed both issues simultaneously. The present study investigates cross-lagged relations between identity styles (i.e., informational, normative, and diffuse-avoidant) and goals (i.e., intrinsic vs. extrinsic and openness to change vs. conservation) in a 3-wave adolescent sample (N = 806). Results support a reciprocal model, with process and content influencing each other. As for process effects, the informational and diffuse-avoidant style predicted decreases in conservation goals, and the normative style predicted increases in conservation and extrinsic goals. As for content effects, conservation goals increased the normative style, and extrinsic goals decreased the informational and increased the diffuse-avoidant style. © 2012 The Authors. Journal of Personality © 2012, Wiley Periodicals, Inc.

Primary and secondary relaxation process in plastically crystalline cyanocyclohexane studied by 2H nuclear magnetic resonance. II. Quantitative analysis.

PubMed

Micko, B; Kruk, D; Rössler, E A

2013-02-21

We analyze the results of our previously reported 2H nuclear magnetic resonance (NMR) experiments in the plastically crystalline (PC) phase of cyanocyclohexane (Part I of this work) to study the fast secondary relaxation (or β-process) in detail. Both, the occurrence of an additional minimum in the spin-lattice relaxation T1 and the pronounced effects arising in the solid-echo spectrum above the glass transition temperature T(g) = 134 K, allow for a direct determination of the restricting geometry of the β-process in terms of the "wobbling-in-a-cone" model. Whereas at temperatures below T(g) the reorientation is confined to rather small solid angles (below 10°), the spatial restriction decreases strongly with temperature above T(g), i.e., the distribution of cone angles shifts continuously towards higher values. The β-process in the PC phase of cyanocyclohexane proceeds via the same mechanism as found in structural glass formers. This is substantiated by demonstrating the very similar behavior (for T < T(g)) of spin-lattice relaxation, stimulated echo decays, and spectral parameters when plotted as a function of (taken from dielectric spectroscopy). We do, however, not observe a clear-cut relation between the relaxation strength of the β-process observed by NMR (calculated within the wobbling-in-a-cone model) and dielectric spectroscopy.

Healing of a mechano-responsive material

NASA Astrophysics Data System (ADS)

Vetter, A.; Sander, O.; Duda, G. N.; Weinkamer, R.

2013-12-01

While contribution of physics to model fracture of materials is significant, the “reversed” process of healing is hardly investigated. Inspired by fracture healing that occurs as a self-repair process in nature, e.g. in bone, we computationally study the conditions under which a material can repair itself. In our model the material around a fracture is assumed mechano-responsive: it processes the information of i) local stiffness and ii) local strain and responds by local stiffening. Depending on how information i) and ii) is processed, healing evolves via fundamentally different paths.

Aspectual asymmetries in the mental representation of events: Role of lexical and grammatical aspect.

PubMed

Yap, Foong Ha; Chu, Patrick Chun Kau; Yiu, Emily Sze Man; Wong, Stella Fay; Kwan, Stella Wing Man; Matthews, Stephen; Tan, Li Hai; Li, Ping; Shirai, Yasuhiro

2009-07-01

Temporal information is important in the construction of situation models, and many languages make use of perfective and imperfective aspect markers to distinguish between completed situations (e.g., He made a cake) and ongoing situations (e.g., He is making a cake). Previous studies in which the effect of grammatical aspect has been examined have shown that perfective sentences are often processed more quickly than imperfective ones (e.g., Chan, Yap, Shirai, & Matthews, 2004; Madden & Zwaan, 2003; Yap et al., 2004; Yap et al., 2006). However, these studies used only accomplishment verbs (i.e., verbs with an inherent endpoint, such as bake a cake). The present study on the processing of Cantonese includes activity verbs (i.e., durative verbs with no inherent endpoint, such as play the piano), and the results indicate a strong interaction between lexical aspect (i.e., verb type) and grammatical aspect. That is, perfective sentences were processed more quickly with accomplishment verbs, consistent with previous findings, but imperfective sentences were processed more quickly with activity verbs. We suggest that these different aspectual asymmetries emerge as a result of the inherent associations between accomplishment verbs and the bounded features of perfective aspect and between activity verbs and the unbounded features of imperfective aspect. The sentence stimuli from this study may be downloaded from mc.psychonomic-journals.org/content/supplemental.

Intrinsic and Extrinsic Properties of Fiber Optic Sensor Materials.

DTIC Science & Technology

1983-09-01

Inc. 320 Needham Street Av ;-,:s Newton Upper Falls, MA 02164 I ;1 -EC 1983 i September 1983 ~~~~D I S T IU V! ’ : il : . AppIove d im p :,h,: el,-aao...C., Sigel, Jr., G. H., Levin, K. H., Ginther, R. J., "Rayleigh Scattering in ZrF4-based glasses," Electron. Letters, 18, p . 1046 (1982). 2. Ohishi, Y...Prepared by a Rotational Casting Process," Electron. Lett., 18, p . 657 (1982). 9. Tran, D. C., Burk, M. J., Sigel, Jr., G. H., "Preparation of Heavy

Analysis of I-Br-Cl in single fluid inclusions by LA-ICP-MS

NASA Astrophysics Data System (ADS)

Giehl, C.; Fusswinkel, T.; Beermann, O.; Garbe-Schönberg, D.; Scholten, L.; Wagner, T.

2017-12-01

Halogens are excellent tracers of hydrothermal fluid sources and in-situ LA-ICP-MS analysis of Cl and Br in single fluid inclusions has provided fundamentally new insight into hydrothermal fluid flow and ore formation. There is mounting evidence that enrichment and depletion of Br relative to Cl may be caused by a number of processes beyond seawater evaporation and halite dissolution which cannot be discriminated on the basis of Br/Cl ratios alone. Expanding the analytical capabilities of fluid inclusion LA-ICP-MS analysis to include iodine would allow to discern between selective and coupled enrichment processes of Cl, Br and I, even in geologically complex samples that are inaccessible to bulk extraction techniques. We present iodine concentration data determined by LA-ICP-MS analysis of synthetic fluid inclusions, using the Sca17 scapolite reference material for external standardization (Seo et al., 2011). Iodine concentrations in Sca17 were determined using the Durango apatite standard. Four starting solutions containing I (0.3, 1.5, 27, 78 µg/g), Br (941, 1403, 2868, 4275 µg/g), Na (30.7, 94.7 mg/g), and Cl (50, 137 mg/g) (analyzed by ICP-OES and ICP-MS at CAU Kiel) were prepared by dissolving reagent grade chemical powders in ultra-pure water. Spherical inclusions (up to 40 µm) were synthesized from the starting solutions in pre-cracked, HF-treated synthetic quartz crystals which were placed in gold capsules and equilibrated at 600°C, 100/200 MPa in cold seal pressure vessels. Fluid inclusion LA-ICP-MS analysis (University of Helsinki) yielded average I concentrations in excellent agreement with the starting solutions (27.3 µg/g ± 14 %RSD for the 27 µg/g solution and 77.6 µg/g ± 8.3 %RSD for the 78 µg/g solution). Average Br and I concentrations deviate less than 10 % from solution concentration values. For the low I concentration solutions, the synthetic inclusions were too small to detect I. Thus, given suitable standard materials and sufficient inclusion sizes, LA-ICP-MS fluid inclusion microanalysis can be used to determine accurate I-Br-Cl concentration data and track the sources of crustal fluids in a wide range of geological settings. Seo, J.H., Guillong, M., Aerts, M., Zajacz, Z., Heinrich, C.A., 2011. Microanalysis of S, Cl, and Br in fluid inclusions by LA-ICP-MS. Chemical Geology 284, 35-44.

Herpes Simplex Virus Membrane Proteins gE/gI and US9 Act Cooperatively To Promote Transport of Capsids and Glycoproteins from Neuron Cell Bodies into Initial Axon Segments

PubMed Central

Howard, Paul W.; Howard, Tiffani L.

2013-01-01

Herpes simplex virus (HSV) and other alphaherpesviruses must move from sites of latency in ganglia to peripheral epithelial cells. How HSV navigates in neuronal axons is not well understood. Two HSV membrane proteins, gE/gI and US9, are key to understanding the processes by which viral glycoproteins, unenveloped capsids, and enveloped virions are transported toward axon tips. Whether gE/gI and US9 function to promote the loading of viral proteins onto microtubule motors in neuron cell bodies or to tether viral proteins onto microtubule motors within axons is not clear. One impediment to understanding how HSV gE/gI and US9 function in axonal transport relates to observations that gE−, gI−, or US9− mutants are not absolutely blocked in axonal transport. Mutants are significantly reduced in numbers of capsids and glycoproteins in distal axons, but there are less extensive effects in proximal axons. We constructed HSV recombinants lacking both gE and US9 that transported no detectable capsids and glycoproteins to distal axons and failed to spread from axon tips to adjacent cells. Live-cell imaging of a gE−/US9− double mutant that expressed fluorescent capsids and gB demonstrated >90% diminished capsids and gB in medial axons and no evidence for decreased rates of transport, stalling, or increased retrograde transport. Instead, capsids, gB, and enveloped virions failed to enter proximal axons. We concluded that gE/gI and US9 function in neuron cell bodies, in a cooperative fashion, to promote the loading of HSV capsids and vesicles containing glycoproteins and enveloped virions onto microtubule motors or their transport into proximal axons. PMID:23077321

Nonlinear Stochastic Markov Processes and Modeling Uncertainty in Populations

DTIC Science & Technology

2011-07-06

219–232. [26] I. Karatzas and S.E. Shreve, Brownian Motion and Stochastic Calculus, Second Edition, Springer, New York, 1991. [27] F. Klebaner...ubiquitous in mathematics and physics (e.g., particle transport, filtering), biology (population models), finance (e.g., Black-Scholes equations) among other

Unified Tri-Services Cognitive Performance Assessment Battery: Review and Methodology

DTIC Science & Technology

1987-03-01

sections in this report. 11 ,i The present report provides extensive documentattbn for Pach test; in the UTC-PAB to aid in the selection and...memory storage (e.g., Wanner and Shiner, 19/6) aid processing. Previous research (e.g., Perez, 1982) has shown that transitions from one operation to...information processing model. Two antidepressant drugs, amoxapine and amitriptyline , were given to depressed outpatients whose rpactlon times on the memory

The Importance of Long Wavelength Processes in Generating Landscapes

NASA Astrophysics Data System (ADS)

Roberts, Gareth G.; White, Nicky

2017-04-01

The processes responsible for generating landscapes observed on Earth and elsewhere are poorly understood. For example, the relative importance of long (>10 km) and short wavelength erosional processes in determining the evolution of topography is debated. Much work has focused on developing an observational and theoretical framework for evolution of longitudinal river profiles (i.e. elevation as a function of streamwise distance), which probably sets the pace of erosion in low-mid latitude continents. A large number of geomorphic studies emphasis the importance of short wavelength processes in sculpting topography (e.g. waterfall migration, interaction of biota and the solid Earth, hill slope evolution). However, it is not clear if these processes scale to generate topography observed at longer (>10 km) wavelengths. At wavelengths of tens to thousands of kilometers topography is generated by modification of the lithosphere (e.g. shortening, extension, flexure) and by sub-plate processes (e.g. dynamic support). Inversion of drainage patterns suggests that uplift rate histories can be reliably recovered at these long wavelengths using simple erosional models (e.g. stream power). Calculated uplift and erosion rate histories are insensitive to short wavelength (<10 km) or rapid (<100 ka) environmental changes (e.g. biota, precipitation, lithology). One way to examine the relative importance of short and long wavelength processes in generating topography is to transform river profiles into distance-frequency space. We calculate the wavelet power spectrum of a suite of river profiles and examine their spectral content. Big rivers in North America (e.g. Colorado, Rio Grande) and Africa (e.g. Niger, Orange) have a red noise spectrum (i.e. power inversely proportional to wavenumber-squared) at wavelengths > 100 km. More than 90% of river profile elevations in our inventory are determined at these wavelengths. At shorter wavelengths spectra more closely resemble pink noise (power inversely proportional to wavenumber). These observations suggest that short wavelength processes do not simply scale to generate the long wavelength changes in elevation. Instead we suggest that long wavelength processes (e.g. regional uplift, knickzone migration) determine the shape and evolution of nearly all topography. These results suggest that the erosional complexity observed in local geomorphic studies and the relative simplicity of erosional models required to fit continental-scale drainage patterns are not mutually exclusive. Rather that the problem of fluvial erosion is being tackled at different and probably unrelated scales.

Final Nevada Training Initiative Environmental Assessment

DTIC Science & Technology

2003-07-01

Impact StAtement, pursuaoltO the National Environmental Policy Ac1 of 1969 (Public Law 91-190) is not "i:§ o .*= : ~-Dale z.g:n FIND I G OF NO SIGNIFICANT...July 2003 Figure 2-12 Alternatives 2A and 2B Facility Locations Munitions storage area DJ~==;===== o ...Process Drivers Analyzed in this EA Resources C on st ru ct io n O pe ra tio ns Yes No Air Quality Ä Ä Ä Biological Resources Ä Ä Cultural

Wireless Source Localization and Signal Collection from an Airborne Symmetric Line Array Sensor Network

DTIC Science & Technology

2014-09-01

band signal samples by taking the ratio of (166) and (165) as     2 2 /2 /2 sin sin coscos g g g g gg cQ cI eE n E n e...processors,” EEE Trans. Acoust. Speech Signal Process., vol. 31, no. 6, pp. 1378–1393, Dec. 1983. [10] J. Li, P. Stoica and Z. Wang, “On robust

Neuro-Endocrine Control of Reproduction in Hermaphroditic Freshwater Snails: Mechanisms and Evolution

PubMed Central

Koene, Joris M.

2010-01-01

Invertebrates are used extensively as model species to investigate neuro-endocrine processes regulating behaviors, and many of these processes may be extrapolated to vertebrates. However, when it comes to reproductive processes, many of these model species differ notably in their mode of reproduction. A point in case are simultaneously hermaphroditic molluscs. In this review I aim to achieve two things. On the one hand, I provide a comprehensive overview of the neuro-endocrine control of male and female reproductive processes in freshwater snails. Even though the focus will necessarily be on Lymnaea stagnalis, since this is the best-studied species in this respect, extensions to other species are made wherever possible. On the other hand, I will place these findings in the actual context of the whole animal, after all these are simultaneous hermaphrodites. By considering the hermaphroditic situation, I uncover a numbers of possible links between the regulation of the two reproductive systems that are present within this animal, and suggest a few possible mechanisms via which this animal can effectively switch between the two sexual roles in the flexible way that it does. Evidently, this opens up a number of new research questions and areas that explicitly integrate knowledge about behavioral decisions (e.g., mating, insemination, egg laying) and sexual selection processes (e.g., mate choice, sperm allocation) with the actual underlying neuronal and endocrine mechanisms required for these processes to act and function effectively. PMID:21088700

40 CFR 152.5 - Pests.

Code of Federal Regulations, 2010 CFR

2010-07-01

... AND CLASSIFICATION PROCEDURES General Provisions § 152.5 Pests. An organism is declared to be a pest... or in processed food or processed animal feed, beverages, drugs (as defined in FFDCA sec. 201(g)(1)) and cosmetics (as defined in FFDCA sec. 201(i)). ...

40 CFR 152.5 - Pests.

Code of Federal Regulations, 2011 CFR

2011-07-01

... AND CLASSIFICATION PROCEDURES General Provisions § 152.5 Pests. An organism is declared to be a pest... or in processed food or processed animal feed, beverages, drugs (as defined in FFDCA sec. 201(g)(1)) and cosmetics (as defined in FFDCA sec. 201(i)). ...

Multifunctional Nitrogen-Doped Loofah Sponge Carbon Blocking Layer for High-Performance Rechargeable Lithium Batteries.

PubMed

Gu, Xingxing; Tong, Chuan-Jia; Rehman, Sarish; Liu, Li-Min; Hou, Yanglong; Zhang, Shanqing

2016-06-29

Low-cost, long-life, and high-performance lithium batteries not only provide an economically viable power source to electric vehicles and smart electricity grids but also address the issues of the energy shortage and environmental sustainability. Herein, low-cost, hierarchically porous, and nitrogen-doped loofah sponge carbon (N-LSC) derived from the loofah sponge has been synthesized via a simple calcining process and then applied as a multifunctional blocking layer for Li-S, Li-Se, and Li-I2 batteries. As a result of the ultrahigh specific area (2551.06 m(2) g(-1)), high porosity (1.75 cm(3) g(-1)), high conductivity (1170 S m(-1)), and heteroatoms doping of N-LSC, the resultant Li-S, Li-Se, and Li-I2 batteries with the N-LSC-900 membrane deliver outstanding electrochemical performance stability in all cases, i.e., high reversible capacities of 623.6 mA h g(-1) at 1675 mA g(-1) after 500 cycles, 350 mA h g(-1) at 1356 mA g(-1) after 1000 cycles, and 150 mA h g(-1) at 10550 mA g(-1) after 5000 cycles, respectively. The successful application to Li-S, Li-Se, and Li-I2 batteries suggests that loofa sponge carbon could play a vital role in modern rechargeable battery industries as a universal, cost-effective, environmentally friendly, and high-performance blocking layer.

The Use of Ion Implantation for Materials Processing.

DTIC Science & Technology

1983-09-28

SPUTTERING ANALYSIS WITH PIXE.......................... 31 J.M. Lambert, P.A. Treado, D . Trbojevic ,2 R.G. Alias, A.R. Knudson, G.W. Reynolds and F.R...Lambert and P. . Treado I D . Trbojevic R. G. Allas and A. R. Knudson 3 G. W. Reynolds and F. R. Vozzo 4 IGeorgetown University Washington, D . C. and...D.C. 20057 and 20375 D . Trbojevic Georgetown University, Washington, D.C. 20057 R.G. Alias and A.R. Knudson Naval Research Laboratory, Washington, D.C

A case for conflict across multiple domains: Memory and language impairments following damage to ventrolateral prefrontal cortex

PubMed Central

Novick, Jared M.; Kan, Irene P.; Trueswell, John C.; Thompson-Schill, Sharon L.

2013-01-01

Patients with focal lesions to the left inferior frontal gyrus (LIFG; BA 44/45) exhibit difficulty with language production and comprehension tasks, although the nature of their impairments has been somewhat difficult to characterize. No reported cases suggest that these patients are Broca's aphasics in the classic agrammatic sense. Recent case studies, however, do reveal a consistent pattern of deficit regarding their general cognitive processes: They are reliably impaired on tasks in which conflicting representations must be resolved by implementing top-down cognitive control (e.g., Stroop; memory tasks involving proactive interference). In the present study, we ask whether the language production and comprehension impairments displayed by a patient with circumscribed LIFG damage can best be understood within a general conflict resolution deficit account. We focus on one patient in particular—patient I.G.—and discuss the implications for language processing abilities as a consequence of a general cognitive control disorder. We compared I.G. and other frontal patients to age-matched control participants across four experiments. Experiment 1 tested participants’ general conflict resolution abilities within a modified working memory paradigm in an attempt to replicate prior case study findings. We then tested language production abilities on tasks of picture naming (Experiment 2) and verbal fluency (Experiment 3), tasks that generated conflict at the semantic and/or conceptual levels. Experiment 4 tested participants’ sentence processing and comprehension abilities using both online (eye movement) and offline measures. In this task, participants carried out spoken instructions containing a syntactic ambiguity, in which early interpretation commitments had to be overridden in order to recover an alternative, intended analysis of sentence meaning. Comparisons of I.G.'s performance with frontal and healthy control participants supported the following claim: I.G. suffers from a general conflict resolution impairment, which affects his ability to produce and comprehend language under specific conditions—namely, when semantic, conceptual, and/or syntactic representations compete and must be resolved. PMID:20183014

Experimental Studies of CADA-Based Utility Assessment Procedures.

DTIC Science & Technology

1981-02-01

Trabajos de Estadistica, in press, 1981. Novick, M. R., Isaacs, G. L., Hamer, R., Chen, J., Chuang, D., Woodworth, G., Molenaar , I., Lewis, C., & Libby...Hill Book Co., Inc., 1959. Slovic, P. From Shakespeare to Simo: Spoculatie - and sm evidence - about man’s ability to process Imfotmatiea. Or&&n

Variability in Arabinoxylan, Xylanase activity and Xylanase inhibitor levels in hard spring wheat

USDA-ARS?s Scientific Manuscript database

Arabinoxylans (AX), xylanase, and xylanase inhibitors have an important role in many cereal food processing applications. The effect of genotype (G), growing location (L), and their interaction (G*L) on AX, apparent xylanase and apparent xylanase inhibition activities of Triticum aestivum xylanase i...

GDP-GTP exchange processes of G{alpha}i1 protein are accelerated/decelerated depending on the type and the concentration of added detergents.

PubMed

Kubota, Makoto; Tanaka, Takeshi; Kohno, Toshiyuki; Wakamatsu, Kaori

2009-12-01

Although detergents have been widely used in G-protein studies to increase solubility and stability of the protein, we noticed that detergents modulate the nucleotide-binding properties of G-proteins. Hence, we analysed the effects of detergents on guanine nucleotide exchange reactions of Galpha(i1). Lubrol PX, a non-ionic detergent, which has been widely used in nucleotide dissociation/binding assays, was found to accelerate both GDP dissociation and GTPgammaS binding from/to Galpha in parallel at above its critical micelle concentration (cmc). Sodium cholate, an anionic detergent, which have been used to extract G-proteins from animal tissues, decelerated and accelerated GDP dissociation below and above its cmc, respectively. Surprisingly, micellar cholate decelerated GTPgammaS binding, and the binding rate constant was decreased by three orders of magnitude in the presence of 2% cholate. These results demonstrate that the guanine nucleotide exchange reactions of Galpha(i1) are drastically modulated by detergents differently depending on the type and the state (monomeric or micellar) of the detergents and that dissociation of GDP from Galpha(i1) does not necessarily lead to immediate binding of GTP to Galpha(i1) in some cases. These effects of detergents on G-proteins must be taken into account in G-protein experiments.

JPRS Report, Science & Technology, USSR: Science & Technology Policy

DTIC Science & Technology

1989-03-22

Y. N. Yarmashev; STANDARTY I KACHESTVO, No 11, Nov 88] 60 Typization of Thermal Effect Assembly Processes on the Basis of Production -Wise...STANDARTY I KACHESTVO, No 11, Nov 88] 60 What Prevents Gospriomka From Assuring a Radical Improvement of Product Performance and Quality? [G. N...Noreyka, L. V. Tsoy, et al; STANDARTY I KACHESTVO, No 11, Nov 88] . 60 State Testing of Products : Lessons, Problems, Prospects [STANDARTY I KACHESTVO

The emission of volatile compounds during the aerobic and the combined anaerobic/aerobic composting of biowaste

NASA Astrophysics Data System (ADS)

Smet, Erik; Van Langenhove, Herman; De Bo, Inge

Two different biowaste composting techniques were compared with regard to their overall emission of volatile compounds during the active composting period. In the aerobic composting process, the biowaste was aerated during a 12-week period, while the combined anaerobic/aerobic composting process consisted of a sequence of a 3-week anaerobic digestion (phase I) and a 2-week aeration period (phase II). While the emission of volatiles during phase I of the combined anaerobic/aerobic composting process was measured in a full-scale composting plant, the aerobic stages of both composting techniques were performed in pilot-scale composting bins. Similar groups of volatile compounds were analysed in the biogas and the aerobic composting waste gases, being alcohols, carbonyl compounds, terpenes, esters, sulphur compounds and ethers. Predominance of alcohols (38% wt/wt of the cumulative emission) was observed in the exhaust air of the aerobic composting process, while predominance of terpenes (87%) and ammonia (93%) was observed in phases I and II of the combined anaerobic/aerobic composting process, respectively. In the aerobic composting process, 2-propanol, ethanol, acetone, limonene and ethyl acetate made up about 82% of the total volatile organic compounds (VOC)-emission. Next to this, the gas analysis during the aerobic composting process revealed a strong difference in emission profile as a function of time between different groups of volatiles. The total emission of VOC, NH 3 and H 2S during the aerobic composting process was 742 g ton -1 biowaste, while the total emission during phases I and II of the combined anaerobic/aerobic composting process was 236 and 44 g ton -1 biowaste, respectively. Taking into consideration the 99% removal efficiency of volatiles upon combustion of the biogas of phase I in the electricity generator, the combined anaerobic/aerobic composting process can be considered as an attractive alternative for aerobic biowaste composting because of its 17 times lower overall emission of the volatiles mentioned.

An analysis of the polymorphisms of the GLUT1 gene in urothelial cell carcinomas of the bladder and its correlation with p53, Ki67 and GLUT1 expressions.

PubMed

Xu, C; Yang, X; Wang, Y; Ding, N; Han, R; Sun, Y; Wang, Y

2017-07-01

Frequencies of two glucose transporter 1 (GLUT1) single-nucleotide polymorphisms (SNPs) (XbaI G>T and HaeIII T>C) were studied with urothelial cell carcinomas of the bladder (UCC) and 204 normal persons. And the expression of the p53, Ki67 and GLUT1 was assayed by immunohistochemistry. The frequency of the TT genotype and T allele of the XbaI G>T SNP was decreased in the patients with UCC. The frequency of the CC genotype and C allele of the HaeIII T>C SNP was decreased in the patients with UCC. The GLUT1 XbaI genotype GG was more frequent in higher tumor stage and higher tumor grade patients. In the XbaI G>T SNP, the GG genotype was significantly related to higher Remmele immunoreactive score (IRS) of Ki67 and higher IRS of GLUT1. In conclusion, the TT genotype in XbaI G>T SNP and CC genotype of HaeIII T>C SNP may have protective effect in the carcinogenesis process of UCC. In the XbaI G>T SNP, the GG genotype of was positively related to tumor proliferation, glucose metabolism, tumor grade and stage. Therefore, the variant might become a possible proliferation-related prognostic factor for UCC.

High Solid Fed-batch Butanol Fermentation with Simultaneous Product Recovery: Part II - Process Integration.

PubMed

Qureshi, Nasib; Klasson, K Thomas; Saha, Badal C; Liu, Siqing

2018-04-25

In these studies liquid hot water (LHW) pretreated and enzymatically hydrolyzed Sweet Sorghum Bagasse (SSB) hydrolyzates were fermented in a fed-batch reactor. As reported in the preceding paper, the culture was not able to ferment the hydrolyzate I in a batch process due to presence of high level of toxic chemicals, in particular acetic acid released from SSB during the hydrolytic process. To be able to ferment the hydrolyzate I obtained from 250 gL -1 SSB hydrolysis, a fed-batch reactor with in-situ butanol recovery was devised. The process was started with the hydrolyzate II and when good cell growth and vigorous fermentation were observed, the hydrolyzate I was slowly fed to the reactor. In this manner the culture was able to ferment all the sugars present in both the hydrolyzates to acetone butanol ethanol (ABE). In a control batch reactor in which ABE was produced from glucose, ABE productivity and yield of 0.42 gL -1 h -1 and 0.36 were obtained, respectively. In the fed-batch reactor fed with SSB hydrolyzates these productivity and yield values were 0.44 gL -1 h -1 and 0.45, respectively. ABE yield in the integrated system was high due to utilization of acetic acid to convert to ABE. In summary we were able to utilize both the hydrolyzates obtained from LHW pretreated and enzymatically hydrolyzed SSB (250 gL -1 ) and convert them to ABE. Complete fermentation was possible due to simultaneous recovery of ABE by vacuum. This article is protected by copyright. All rights reserved. © 2018 American Institute of Chemical Engineers.

Influence of Process Parameters on Laser Weld Characteristics in Aluminum Alloys

DTIC Science & Technology

1988-08-01

sacrifices that my family has so patiently endured through these long years of my education . I. .i % 1IM Chapter 1 INTRODUCTION Multi-kilowatt CO 2 lasers...ep taxil gowt frmp rn eal lqa inad g lm rto of pase n HA (x 00) I -. _k .... 4 122 In the HAZ close to the fusion boundary, there is evidence of

Prospective memory training in older adults and its relevance for successful aging.

PubMed

Hering, Alexandra; Rendell, Peter G; Rose, Nathan S; Schnitzspahn, Katharina M; Kliegel, Matthias

2014-11-01

In research on cognitive plasticity, two training approaches have been established: (1) training of strategies to improve performance in a given task (e.g., encoding strategies to improve episodic memory performance) and (2) training of basic cognitive processes (e.g., working memory, inhibition) that underlie a range of more complex cognitive tasks (e.g., planning) to improve both the training target and the complex transfer tasks. Strategy training aims to compensate or circumvent limitations in underlying processes, while process training attempts to augment or to restore these processes. Although research on both approaches has produced some promising findings, results are still heterogeneous and the impact of most training regimes for everyday life is unknown. We, therefore, discuss recent proposals of training regimes aiming to improve prospective memory (i.e., forming and realizing delayed intentions) as this type of complex cognition is highly relevant for independent living. Furthermore, prospective memory is associated with working memory and executive functions and age-related decline is widely reported. We review initial evidence suggesting that both training regimes (i.e., strategy and/or process training) can successfully be applied to improve prospective memory. Conceptual and methodological implications of the findings for research on age-related prospective memory and for training research in general are discussed.

Prediction in the Processing of Repair Disfluencies: Evidence from the Visual-World Paradigm

PubMed Central

Lowder, Matthew W.; Ferreira, Fernanda

2016-01-01

Two visual-world eye-tracking experiments investigated the role of prediction in the processing of repair disfluencies (e.g., The chef reached for some salt uh I mean some ketchup…). Experiment 1 showed that listeners were more likely to fixate a critical distractor item (e.g., pepper) during the processing of repair disfluencies compared to the processing of coordination structures (e.g., …some salt and also some ketchup…). Experiment 2 replicated the findings of Experiment 1 for disfluency versus coordination constructions and also showed that the pattern of fixations to the critical distractor for disfluency constructions was similar to the fixation patterns for sentences employing contrastive focus (e.g., …not some salt but rather some ketchup…). The results suggest that similar mechanisms underlie the processing of repair disfluencies and contrastive focus, with listeners generating sets of entities that stand in semantic contrast to the reparandum in the case of disfluencies or the negated entity in the case of contrastive focus. PMID:26866657

Evaluating Web accessibility at different processing phases

NASA Astrophysics Data System (ADS)

Fernandes, N.; Lopes, R.; Carriço, L.

2012-09-01

Modern Web sites use several techniques (e.g. DOM manipulation) that allow for the injection of new content into their Web pages (e.g. AJAX), as well as manipulation of the HTML DOM tree. This has the consequence that the Web pages that are presented to users (i.e. after browser processing) are different from the original structure and content that is transmitted through HTTP communication (i.e. after browser processing). This poses a series of challenges for Web accessibility evaluation, especially on automated evaluation software. This article details an experimental study designed to understand the differences posed by accessibility evaluation after Web browser processing. We implemented a Javascript-based evaluator, QualWeb, that can perform WCAG 2.0 based accessibility evaluations in the two phases of browser processing. Our study shows that, in fact, there are considerable differences between the HTML DOM trees in both phases, which have the consequence of having distinct evaluation results. We discuss the impact of these results in the light of the potential problems that these differences can pose to designers and developers that use accessibility evaluators that function before browser processing.

Calcium, BOBs, QEDs, microdomains and a cellular decision: control of mitotic cell division in sand dollar blastomeres.

PubMed

Silver, R B

1996-08-01

The role of Ca2+ in controlling cell processes (e.g. mitosis) presents an enigma in its ubiquity and selectivity. Intracellular free Ca2+ (Ca2+i) is an essential regulator of specific biochemical and physiological aspects of mitosis (e.g. nuclear envelope breakdown (NEB)). Changes in Ca2+i concentrations during mitosis in second cell-cycle sand dollar (Echinaracnius parma) blastomeres were imaged as Ca(2+)-dependent luminescence of the photoprotein aequorin with multi-spectral analytical video microscopy. Photons of this luminescence were seen as bright observable blobs (BOBs). Spatiotemporal patterns of BOBs were followed through one or more cell cycles to detect directly changes in Ca2+i, and were seen to change in a characteristic fashion prior to NEB, the onset of anaphase chromosome movement, and during cytokinesis. These patterns were observed from one cell cycle to the next in a single cell, from cell to cell, and from egg batch to egg batch. In both mitosis and synaptic transmission increases in Ca2+i concentration occurs in discrete, short-lived, highly localized pulses we name quantum emission domains (QEDs) within regions we named microdomains. Signal and statistical optical analyses of spatiotemporal BOB patterns show that many BOBs are linked by constant displacements in space-time (velocity). Linked BOBs are thus nonrandom and are classified as QEDS. Analyses of QED patterns demonstrated that the calcium signals required for NEB are nonrandom, and are evoked by an agent(s) generated proximal to a Ca2+i-QED; models of waves, diffusible agonists and Ca(2+)-activated Ca2+ release do not fit pre-NEB cell data. Spatial and temporal resolution of this multispectral approach significantly exceeds that reported for other methods, and avoids the perturbations associated with many fluorescent Ca2+ reporters that interfere with cells being studied (Ca(2+)-buffering, UV toxicity, etc.). Spatiotemporal patterns of Ca2+i-QED can control so many different processes, i.e. specific frequencies used to control particular processes. Predictive and structured patterns of calcium signals (e.g. a language expressed in Ca2+) may selectively regulate specific Ca(2+)-dependent cellular processes.

Prospective systematic review registration: perspective from the Guidelines International Network (G-I-N).

PubMed

Van der Wees, Philip; Qaseem, Amir; Kaila, Minna; Ollenschlaeger, Guenter; Rosenfeld, Richard

2012-02-09

Clinical practice and public health guidelines are important tools for translating research findings into practice with the aim of assisting health practitioners as well as patients and consumers in health behavior and healthcare decision-making. Numerous programs for guideline development exist around the world, with growing international collaboration to improve their quality. One of the key features in developing trustworthy guidelines is that recommendations should be based on high-quality systematic reviews of the best available evidence. The review process used by guideline developers to identify and grade relevant evidence for developing recommendations should be systematic, transparent and unbiased. In this paper, we provide an overview of current international developments in the field of practice guidelines and methods to develop guidelines, with a specific focus on the role of systematic reviews. The Guidelines International Network (G-I-N) aims to stimulate collaboration between guideline developers and systematic reviewers to optimize the use of available evidence in guideline development and to increase efficiency in the guideline development process. Considering the significant benefit of systematic reviews for the guideline community, the G-I-N Board of Trustees supports the international prospective register of systematic reviews (PROSPERO) initiative. G-I-N also recently launched a Data Extraction Resource (GINDER) to present and share data extracted from individual studies in a standardized template. PROSPERO and GINDER are complementary tools to enhance collaboration between guideline developers and systematic reviewers to allow for alignment of activities and a reduction in duplication of effort.

Verbal Inflectional Morphology in L1 and L2 Spanish: A Frequency Effects Study Examining Storage versus Composition

PubMed Central

Bowden, Harriet Wood; Gelfand, Matthew P.; Sanz, Cristina; Ullman, Michael T.

2009-01-01

This study examines the storage vs. composition of Spanish inflected verbal forms in L1 and L2 speakers of Spanish. L2 participants were selected to have mid-to-advanced proficiency, high classroom experience, and low immersion experience, typical of medium-to-advanced foreign language learners. Participants were shown the infinitival forms of verbs from either Class I (the default class, which takes new verbs) or Classes II and III (non-default classes), and were asked to produce either first-person singular present-tense or imperfect forms, in separate tasks. In the present tense, the L1 speakers showed inflected-form frequency effects (i.e., higher frequency forms were produced faster, which is taken as a reflection of storage) for stem-changing (irregular) verb-forms from both Class I (e.g., pensar-pienso) and Classes II and III (e.g., perder-pierdo), as well as for non-stem-changing (regular) forms in Classes II/III (e.g., vender-vendo), in which the regular transformation does not appear to constitute a default. In contrast, Class I regulars (e.g., pescar-pesco), whose non-stem-changing transformation constitutes a default (e.g., it is applied to new verbs), showed no frequency effects. L2 speakers showed frequency effects for all four conditions (Classes I and II/III, regulars and irregulars). In the imperfect tense, the L1 speakers showed frequency effects for Class II/III (-ía-suffixed) but not Class I (-aba-suffixed) forms, even though both involve non-stem-change (regular) default transformations. The L2 speakers showed frequency effects for both types of forms. The pattern of results was not explained by a wide range of potentially confounding experimental and statistical factors, and does not appear to be compatible with single-mechanism models, which argue that all linguistic forms are learned and processed in associative memory. The findings are consistent with a dual-system view in which both verb class and regularity influence the storage vs. composition of inflected forms. Specifically, the data suggest that in L1, inflected verbal forms are stored (as evidenced by frequency effects) unless they are both from Class I and undergo non-stem-changing default transformations. In contrast the findings suggest that at least these L2 participants may store all inflected verb-forms. Taken together, the results support dual-system models of L1 and L2 processing in which, at least at mid-to-advanced L2 proficiency and lower levels of immersion experience, the processing of rule-governed forms may depend not on L1 combinatorial processes, but instead on memorized representations. PMID:20419083

In-Service Support Plan for Electromagnetic Environment Effects.

DTIC Science & Technology

1978-05-05

assure highly motivated and trained Fleet personnel are placed in positions to initiate formal EME deficiency reports. The human factors and technological...Assistant I )eputy C hief of Naval Material AD P Automiated Data Processing ALRE-I1 Air-LUmnhed G uided Weapons System Perform-rance Re- port APL

Searching for a Link Between Suprathermal Ions and Solar Wind Parameters During Quiet Times.

NASA Astrophysics Data System (ADS)

Nickell, J.; Desai, M. I.; Dayeh, M. A.

2017-12-01

The acceleration processes that suprathermal particles undergo are largely ambiguous. The two prevailing acceleration processes are: 1) Continuous acceleration in the IP space due to i) Bulk velocity fluctuations (e.g., Fahr et al. 2012), ii) magnetic compressions (e.g., Fisk and Gloeckler 2012), iii) magnetic field waves and turbulence (e.g., Zhang and Lee 2013), and iv) reconnection between magnetic islands (e.g., Drake et al. 2014) . 2) Discrete acceleration that occurs in discrete solar events such as CIRs, CME-driven shocks, and flares (e.g., Reames 1999, Desai et al. 2008). Using data from ACE/ULEIS during solar cycles 23 and 24 (1997-present), we examine the solar wind and magnetic field parameters during quiet-times (e.g., Dayeh et al. 2017) in an attempt to gain insights into the acceleration processes of the suprathermal particle population. In particular, we look for compression regions by performing comparative studies between solar wind and magnetic field parameters during quiet-times in the interplanetary space.

The RNA recognition motif of eukaryotic translation initiation factor 3g (eIF3g) is required for resumption of scanning of posttermination ribosomes for reinitiation on GCN4 and together with eIF3i stimulates linear scanning.

PubMed

Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos

2010-10-01

Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.

A Classification Scheme for Glaciological AVA Responses

NASA Astrophysics Data System (ADS)

Booth, A.; Emir, E.

2014-12-01

A classification scheme is proposed for amplitude vs. angle (AVA) responses as an aid to the interpretation of seismic reflectivity in glaciological research campaigns. AVA responses are a powerful tool in characterising the material properties of glacier ice and its substrate. However, before interpreting AVA data, careful true amplitude processing is required to constrain basal reflectivity and compensate amplitude decay mechanisms, including anelastic attenuation and spherical divergence. These fundamental processing steps can be difficult to design in cases of noisy data, e.g. where a target reflection is contaminated by surface wave energy (in the case of shallow glaciers) or by energy reflected from out of the survey plane. AVA methods have equally powerful usage in estimating the fluid fill of potential hydrocarbon reservoirs. However, such applications seldom use true amplitude data and instead consider qualitative AVA responses using a well-defined classification scheme. Such schemes are often defined in terms of the characteristics of best-fit responses to the observed reflectivity, e.g. the intercept (I) and gradient (G) of a linear approximation to the AVA data. The position of the response on a cross-plot of I and G then offers a diagnostic attribute for certain fluid types. We investigate the advantages in glaciology of emulating this practice, and develop a cross-plot based on the 3-term Shuey AVA approximation (using I, G, and a curvature term C). Model AVA curves define a clear lithification trend: AVA responses to stiff (lithified) substrates fall discretely into one quadrant of the cross-plot, with positive I and negative G, whereas those to fluid-rich substrates plot diagonally opposite (in the negative I and positive G quadrant). The remaining quadrants are unoccupied by plausible single-layer responses and may therefore be diagnostic of complex thin-layer reflectivity, and the magnitude and polarity of the C term serves as a further indicator of fluid content. The use of the AVA cross-plot is explored for seismic data from European Arctic glaciers, including Storglaciären and Midtre Lovénbreen, with additional examples from other published sources. The classification scheme should provide a useful reference for the initial assessment of a glaciological AVA response.

The Dark Energy Survey Image Processing Pipeline

NASA Astrophysics Data System (ADS)

Morganson, E.; Gruendl, R. A.; Menanteau, F.; Carrasco Kind, M.; Chen, Y.-C.; Daues, G.; Drlica-Wagner, A.; Friedel, D. N.; Gower, M.; Johnson, M. W. G.; Johnson, M. D.; Kessler, R.; Paz-Chinchón, F.; Petravick, D.; Pond, C.; Yanny, B.; Allam, S.; Armstrong, R.; Barkhouse, W.; Bechtol, K.; Benoit-Lévy, A.; Bernstein, G. M.; Bertin, E.; Buckley-Geer, E.; Covarrubias, R.; Desai, S.; Diehl, H. T.; Goldstein, D. A.; Gruen, D.; Li, T. S.; Lin, H.; Marriner, J.; Mohr, J. J.; Neilsen, E.; Ngeow, C.-C.; Paech, K.; Rykoff, E. S.; Sako, M.; Sevilla-Noarbe, I.; Sheldon, E.; Sobreira, F.; Tucker, D. L.; Wester, W.; DES Collaboration

2018-07-01

The Dark Energy Survey (DES) is a five-year optical imaging campaign with the goal of understanding the origin of cosmic acceleration. DES performs a ∼5000 deg2 survey of the southern sky in five optical bands (g, r, i, z, Y) to a depth of ∼24th magnitude. Contemporaneously, DES performs a deep, time-domain survey in four optical bands (g, r, i, z) over ∼27 deg2. DES exposures are processed nightly with an evolving data reduction pipeline and evaluated for image quality to determine if they need to be retaken. Difference imaging and transient source detection are also performed in the time domain component nightly. On a bi-annual basis, DES exposures are reprocessed with a refined pipeline and coadded to maximize imaging depth. Here we describe the DES image processing pipeline in support of DES science, as a reference for users of archival DES data, and as a guide for future astronomical surveys.

Heterotrimeric G protein alpha subunit controls growth, stress response, extracellular protease activity, and cyclopiazonic acid production in Penicillium camemberti.

PubMed

García-Rico, Ramón O; Gil-Durán, Carlos; Rojas-Aedo, Juan F; Vaca, Inmaculada; Figueroa, Luis; Levicán, Gloria; Chávez, Renato

2017-09-01

The fungus Penicillium camemberti is widely used in the ripening of various bloomy-rind cheeses. Several properties of P. camemberti are important in cheese ripening, including conidiation, growth and enzyme production, among others. However, the production of mycotoxins such as cyclopiazonic acid during the ripening process by P. camemberti has raised concerns among consumers that demand food with minimal contamination. Here we show that overexpressing an α-subunit from the subgroup I of the heterotrimeric G protein (Gαi) influences several of these processes: it negatively affects growth in a media-dependent manner, triggers conidial germination, reduces the rate of sporulation, affects thermal and osmotic stress resistance, and also extracellular protease and cyclopiazonic acid production. Our results contribute to understanding the biological determinants underlying these biological processes in the economically important fungus P. camemberti. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Breaking Lander-Waterman’s Coverage Bound

PubMed Central

Nashta-ali, Damoun; Motahari, Seyed Abolfazl; Hosseinkhalaj, Babak

2016-01-01

Lander-Waterman’s coverage bound establishes the total number of reads required to cover the whole genome of size G bases. In fact, their bound is a direct consequence of the well-known solution to the coupon collector’s problem which proves that for such genome, the total number of bases to be sequenced should be O(G ln G). Although the result leads to a tight bound, it is based on a tacit assumption that the set of reads are first collected through a sequencing process and then are processed through a computation process, i.e., there are two different machines: one for sequencing and one for processing. In this paper, we present a significant improvement compared to Lander-Waterman’s result and prove that by combining the sequencing and computing processes, one can re-sequence the whole genome with as low as O(G) sequenced bases in total. Our approach also dramatically reduces the required computational power for the combined process. Simulation results are performed on real genomes with different sequencing error rates. The results support our theory predicting the log G improvement on coverage bound and corresponding reduction in the total number of bases required to be sequenced. PMID:27806058

Enhanced pharmaceutical removal from water in a three step bio-ozone-bio process.

PubMed

de Wilt, Arnoud; van Gijn, Koen; Verhoek, Tom; Vergnes, Amber; Hoek, Mirit; Rijnaarts, Huub; Langenhoff, Alette

2018-07-01

Individual treatment processes like biological treatment or ozonation have their limitations for the removal of pharmaceuticals from secondary clarified effluents with high organic matter concentrations (i.e. 17 mg TOC/L). These limitations can be overcome by combining these two processes for a cost-effective pharmaceutical removal. A three-step biological-ozone-biological (BO 3 B) treatment process was therefore designed for the enhanced pharmaceutical removal from wastewater effluent. The first biological step removed 38% of ozone scavenging TOC, thus proportionally reducing the absolute ozone input for the subsequent ozonation. Complementariness between biological and ozone treatment, i.e. targeting different pharmaceuticals, resulted in cost-effective pharmaceutical removal by the overall BO 3 B process. At a low ozone dose of 0.2 g O 3 /g TOC and an HRT of 1.46 h in the biological reactors, the removal of 8 out of 9 pharmaceuticals exceeded 85%, except for metoprolol (60%). Testing various ozone doses and HRTs revealed that pharmaceuticals were ineffectively removed at 0.1 g O3/g TOC and an HRT of 0.3 h. At HRTs of 0.47 and 1.46 h easily and moderately biodegradable pharmaceuticals such as caffeine, gemfibrozil, ibuprofen, naproxen and sulfamethoxazole were over 95% removed by biological treatment. The biorecalcitrant carbamazepine was completely ozonated at a dose of 0.4 g O 3 /g TOC. Ozonation products are likely biodegraded in the last biological reactor as a 17% TOC removal was found. No appreciable acute toxicity towards D. magna, P. subcapitata and V. fischeri was found after exposure to the influents and effluents of the individual BO 3 B reactors. The BO 3 B process is estimated to increase the yearly wastewater treatment tariff per population equivalent in the Netherlands by less than 10%. Overall, the BO 3 B process is a cost-effective treatment process for the removal of pharmaceuticals from secondary clarified effluents. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

The experience of agency: an interplay between prediction and postdiction

PubMed Central

Synofzik, Matthis; Vosgerau, Gottfried; Voss, Martin

2013-01-01

The experience of agency, i.e., the registration that I am the initiator of my actions, is a basic and constant underpinning of our interaction with the world. Whereas several accounts have underlined predictive processes as the central mechanism (e.g., the comparator model by C. Frith), others emphasized postdictive inferences (e.g., post-hoc inference account by D. Wegner). Based on increasing evidence that both predictive and postdictive processes contribute to the experience of agency, we here present a unifying but at the same time parsimonious approach that reconciles these accounts: predictive and postdictive processes are both integrated by the brain according to the principles of optimal cue integration. According to this framework, predictive and postdictive processes each serve as authorship cues that are continuously integrated and weighted depending on their availability and reliability in a given situation. Both sensorimotor and cognitive signals can serve as predictive cues (e.g., internal predictions based on an efferency copy of the motor command or cognitive anticipations based on priming). Similarly, other sensorimotor and cognitive cues can each serve as post-hoc cues (e.g., visual feedback of the action or the affective valence of the action outcome). Integration and weighting of these cues might not only differ between contexts and individuals, but also between different subject and disease groups. For example, schizophrenia patients with delusions of influence seem to rely less on (probably imprecise) predictive motor signals of the action and more on post-hoc action cues like e.g., visual feedback and, possibly, the affective valence of the action outcome. Thus, the framework of optimal cue integration offers a promising approach that directly stimulates a wide range of experimentally testable hypotheses on agency processing in different subject groups. PMID:23508565

A Productivity Measurement Model Application at an Aircraft Maintenance Facility.

DTIC Science & Technology

1980-12-01

Thesis Advisor: John W. Creighton Approved for Public Release; Distribution Unlimited -- .. .. . . . .... ’-....... ’ . .... I ) m i ll i li i l i i...Catwine 02. 18. 119CURITY CLASS. (00O Alpe e) Unclassified III& huCATIO14 001IN8RAOING Approved for Public Release; Distribution Unlimited. to. SIJPPL...collection process. 2 D1D4 r1 73 a ’~.f146O1g.VeV 46UAVWTW OF TWime P&wb i5 Approved for Public Release; Distribution Unlimited A Productivity Measurement

Toward a Glossary of Self-related Terms.

PubMed

Morin, Alain

2017-01-01

Some scholars have noted that an impressive number of self-related terms have been gradually introduced in the scientific literature. Several of these terms are either ill-defined or synonymous, creating confusion, and redundancy. In an effort to minimize this problem, I present a novel and systematic way of looking at possible relations between several key self-terms. I also propose a tentative classification scheme of self-terms as follows: (1) basic terms related to the overall process of self-perception (e.g., self-awareness), (2) non self-terms that are importantly associated to some other self-terms (e.g., consciousness and Theory of Mind), (3) processes related to the executive self and involving agency, volition, and self-control (e.g., self-regulation), and (4) self-views, that is, the content and feelings about the self (e.g., self-esteem). Three additional categories not discussed in this paper are self-biases, reactions to the self, and interpersonal style. Arguably unambiguous definitions for some of the most important and frequently used self-terms are suggested. These are presented in tables meant for the reader to search for definitions as well as related terms.

Bifunctional phenyl monophosphonic/sulfonic acid ion exchange resin and process for using the same

DOEpatents

Alexandratos, Spiro; Shelley, Christopher A.; Horwitz, E. Philip; Chiarizia, Renato

2001-01-01

A cross-linked water-insoluble ion exchange resin comprised of polymerized monomers having a phenyl ring is disclosed. A contemplated resin contains (i) polymerized phenyl ring-containing monomers having a phosphonic acid ligand linked to the phenyl ring, (ii) about 2 to about 5 millimoles per gram (mmol/g) of phosphorus as phosphonic acid ligands, and (iii) a sufficient amount of a sulfonic acid ligand such that the ratio of mmol/g of phosphonic acid to mmol/g sulfonic acid is up to 3:1. A process for removing polyvalent metal cations from aqueous solution, and a process for removing iron(III) cations from acidic copper(II) cation-containing solutions that utilize the contemplated resin or other resins are disclosed.

Bifunctional phenyl monophosphonic/sulfonic acid ion exchange resin and process for using the same

DOEpatents

Alexandratos, Spiro; Shelley, Christopher A.; Horwitz, E. Philip; Chiarizia, Renato; Gula, Michael J.; Xue, Sui; Harvey, James T.

2002-01-01

A cross-linked water-insoluble ion exchange resin comprised of polymerized monomers having a phenyl ring is disclosed. A contemplated resin contains (i) polymerized phenyl ring-containing monomers having a phosphonic acid ligand linked to the phenyl ring, (ii) about 2 to about 5 millimoles per gram (mmol/g) of phosphorus as phosphonic acid ligands, and (iii) a sufficient amount of a sulfonic acid ligand such that the ratio of mmol/g of phosphonic acid to mmol/g sulfonic acid is up to 3:1. A process for removing polyvalent metal cations from aqueous solution, and a process for removing iron(III) cations from acidic copper(II) cation-containing solutions that utilize the contemplated resin or other resins are disclosed.

Training Procedures for Enhancing Reserve Component Learning, Retention, and Transfer

DTIC Science & Technology

1989-09-01

181). San Diego, CA: Academic Press. Craik , F. I. M., & Lockhart , R. S. (1972). Levels of processing : A framework for memory research. Journal of Verbal...performance. New York: Academic Press. Battig, W. F. (1979). The flexibility of human memory. In L. S. Cermak A F. I. M. Craik (Eds.), Levels of processing and...better retention and transfer (e.g., Craik & Lockhart , 1972). In contrast, Lee and Magill (1983) argue that random practice during training causes

Processing of Sequential and Holistic Stimuli in Left and Right Visual Fields,

DTIC Science & Technology

1980-10-01

1 7 A-A091 588 AIR =FORCE ACADEMY CO IF/G 5/10 I PROCESSING OF SEQUENTIAL AND HOLISTIC STIMULI IN LEFT AND RIGHT--ETC( U ) OCT 80 E H GALLUSCIO. D A...neocortical commissures sectioned to reduce grand mal seizures have added significantly to 1.. ... . ....... .......- , l - ’ ’ . .... . .. ’ r U I l...REALISTIC AUTISTIC MASLOW RATIONAL INTUITIVE MILNER VERBAL NON-VERBAL NEISSER SEQUENTIAL MULTIPLE ORNSTEIN ANALYTIC HOLISTIC C. S. PEIRCE EXPLICATIVE

Important considerations for feasibility studies in physical activity research involving persons with multiple sclerosis: a scoping systematic review and case study.

PubMed

Learmonth, Yvonne C; Motl, Robert W

2018-01-01

Much research has been undertaken to establish the important benefits of physical activity in persons with multiple sclerosis (MS). There is disagreement regarding the strength of this research, perhaps because the majority of studies on physical activity and its benefits have not undergone initial and systematic feasibility testing. We aim to address the feasibility processes that have been examined within the context of physical activity interventions in MS. A systematic scoping review was conducted based on a literature search of five databases to identify feasibility processes described in preliminary studies of physical activity in MS. We read and extracted methodology from each study based on the following feasibility metrics: process (e.g. recruitment), resource (e.g. monetary costs), management (e.g. personnel time requirements) and scientific outcomes (e.g. clinical/participant reported outcome measures). We illustrate the use of the four feasibility metrics within a randomised controlled trial of a home-based exercise intervention in persons with MS. Twenty-five studies were identified. Resource feasibility (e.g. time and resources) and scientific outcomes feasibility (e.g. clinical outcomes) methodologies were applied and described in many studies; however, these metrics have not been systematically addressed. Metrics related to process feasibility (e.g. recruitment) and management feasibility (e.g. human and data management) are not well described within the literature. Our case study successfully enabled us to address the four feasibility metrics, and we provide new information on management feasibility (i.e. estimate data completeness and estimate data entry) and scientific outcomes feasibility (i.e. determining data collection materials appropriateness). Our review highlights the existing research and provides a case study which assesses important metrics of study feasibility. This review serves as a clarion call for feasibility trials that will substantially strengthen the foundation of research on exercise in MS.

Synthesis of Energetic Materials by Rapid Expansion of a Supercritical Solution into Aqueous Solution (RESS-AS) Process

DTIC Science & Technology

2010-12-02

1366-1373, (2005). 16. Young, T . J ., Mawson , S., Johnston, K. P., Henriksen, I. B., Pace, G. W., and Mishra, A. K., Rapid Expansion from...Synthesis of Energetic Materials by Rapid Expansion of a Supercritical Solution into Aqueous Solution (RESS-AS) Process* J . T . Essel, A. C...Cortopassi, K. K. Kuo, J . H. Adair, and C. G. Leh The Pennsylvania State University University Park, PA 16802 USA T . M. Klapötke Ludwig Maximilian

Effect of Coatings and Processing on Failure Mechanisms of Polycarbonate Material. Phase 1

DTIC Science & Technology

1991-11-01

PHASE I By R.D. Eisler A.K. Chatterjee G. Burghart A.H. Koivu C.D. Newlander S.F. Stone Mission Research Corporation Costa Mesa, CA 92626 and...PHASE I ’ 6. AUTHOR(S) DAAK60-89- C-0011 R.D. EISLER , A.K. CHATTERJEE, G. BURGHART, A.H. KOIVU, C.D. NEWLANDER, S.F. STONE, E. HEALY* : 7...response to Department of Defense solicitation 88.1 dated 8 January 1987 , SBIR Topic ABB-140. The published description of SBIR topic A88-140 is included

A Multiprocessor Implementation of CSP (Communicating Sequential Processes)

DTIC Science & Technology

1988-03-01

P to check that "valid" communications can take place between P using guard g , and P,, and if so, to attempt to commit to P,. If a commit was...AltList,, gi): INTEGER that scans the remote alternative list AltList, looking for a matching and corn- patible guard g , to the local guard g ,. By...matching we mean gj contains an I/O operation with P. By compatible we mean g , and gj do not both contain input (output) commands. CheckGuard returns j

Computational Particle Dynamic Simulations on Multicore Processors (CPDMu) Final Report Phase I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schmalz, Mark S

2011-07-24

Statement of Problem - Department of Energy has many legacy codes for simulation of computational particle dynamics and computational fluid dynamics applications that are designed to run on sequential processors and are not easily parallelized. Emerging high-performance computing architectures employ massively parallel multicore architectures (e.g., graphics processing units) to increase throughput. Parallelization of legacy simulation codes is a high priority, to achieve compatibility, efficiency, accuracy, and extensibility. General Statement of Solution - A legacy simulation application designed for implementation on mainly-sequential processors has been represented as a graph G. Mathematical transformations, applied to G, produce a graph representation {und G}more » for a high-performance architecture. Key computational and data movement kernels of the application were analyzed/optimized for parallel execution using the mapping G {yields} {und G}, which can be performed semi-automatically. This approach is widely applicable to many types of high-performance computing systems, such as graphics processing units or clusters comprised of nodes that contain one or more such units. Phase I Accomplishments - Phase I research decomposed/profiled computational particle dynamics simulation code for rocket fuel combustion into low and high computational cost regions (respectively, mainly sequential and mainly parallel kernels), with analysis of space and time complexity. Using the research team's expertise in algorithm-to-architecture mappings, the high-cost kernels were transformed, parallelized, and implemented on Nvidia Fermi GPUs. Measured speedups (GPU with respect to single-core CPU) were approximately 20-32X for realistic model parameters, without final optimization. Error analysis showed no loss of computational accuracy. Commercial Applications and Other Benefits - The proposed research will constitute a breakthrough in solution of problems related to efficient parallel computation of particle and fluid dynamics simulations. These problems occur throughout DOE, military and commercial sectors: the potential payoff is high. We plan to license or sell the solution to contractors for military and domestic applications such as disaster simulation (aerodynamic and hydrodynamic), Government agencies (hydrological and environmental simulations), and medical applications (e.g., in tomographic image reconstruction). Keywords - High-performance Computing, Graphic Processing Unit, Fluid/Particle Simulation. Summary for Members of Congress - Department of Energy has many simulation codes that must compute faster, to be effective. The Phase I research parallelized particle/fluid simulations for rocket combustion, for high-performance computing systems.« less

Ophthalmological, Cognitive, Electrophysiological and MRI Assessment of Visual Processing in Preterm Children without Major Neuromotor Impairment

ERIC Educational Resources Information Center

O'Reilly, Michelle; Vollmer, Brigitte; Vargha-Khadem, Faraneh; Neville, Brian; Connelly, Alan; Wyatt, John; Timms, Chris; De Haan, Michelle

2010-01-01

Many studies report chronic deficits in visual processing in children born preterm. We investigated whether functional abnormalities in visual processing exist in children born preterm but without major neuromotor impairment (i.e. cerebral palsy). Twelve such children (less than 33 weeks gestation or birthweight less than 1000 g) without major…

40 CFR 63.8535 - Am I subject to this subpart?

Code of Federal Regulations, 2010 CFR

2010-07-01

... manufacturing facility is a plant site that manufactures pressed floor tile, pressed wall tile, other pressed tile, or sanitaryware (e.g., sinks and toilets). Clay ceramics manufacturing facilities typically process clay, shale, and various additives; form the processed materials into tile or sanitaryware shapes...

40 CFR 63.8535 - Am I subject to this subpart?

Code of Federal Regulations, 2014 CFR

2014-07-01

... manufacturing facility is a plant site that manufactures pressed floor tile, pressed wall tile, other pressed tile, or sanitaryware (e.g., sinks and toilets). Clay ceramics manufacturing facilities typically process clay, shale, and various additives; form the processed materials into tile or sanitaryware shapes...

40 CFR 63.8535 - Am I subject to this subpart?

Code of Federal Regulations, 2013 CFR

2013-07-01

... manufacturing facility is a plant site that manufactures pressed floor tile, pressed wall tile, other pressed tile, or sanitaryware (e.g., sinks and toilets). Clay ceramics manufacturing facilities typically process clay, shale, and various additives; form the processed materials into tile or sanitaryware shapes...

40 CFR 63.8535 - Am I subject to this subpart?

Code of Federal Regulations, 2011 CFR

2011-07-01

... manufacturing facility is a plant site that manufactures pressed floor tile, pressed wall tile, other pressed tile, or sanitaryware (e.g., sinks and toilets). Clay ceramics manufacturing facilities typically process clay, shale, and various additives; form the processed materials into tile or sanitaryware shapes...

40 CFR 63.8535 - Am I subject to this subpart?

Code of Federal Regulations, 2012 CFR

2012-07-01

... manufacturing facility is a plant site that manufactures pressed floor tile, pressed wall tile, other pressed tile, or sanitaryware (e.g., sinks and toilets). Clay ceramics manufacturing facilities typically process clay, shale, and various additives; form the processed materials into tile or sanitaryware shapes...

The Application of Magnesium(I) Compounds to Energy Storage Materials - Phase 2

DTIC Science & Technology

2013-06-24

currently exploring the use of 10 as a catalyst for a number of other processes, e.g. the selective hydroboration of ketone , aldehydes and nitriles...hydroboration of ketones ; (vi) a variety of related results, including the preparation of an iron(I) dimer with the shortest Fe-Fe multiple bond

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, I.S.; Gaa, S.T.; Rogers, T.B.

The muscarinic cholinergic agonist, carbachol, and pertussis toxin were used to examine the functional status of the guanine nucleotide-binding protein that inhibits adenylate cyclase (G{sub i}) in cultured neonatal rat heart myocytes. The isoproterenol stimulation of adenylate cyclase activity in myocyte membranes and adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) accumulation in intact cells (4 days in culture) were insensitive to carbachol. However, in cells cultured for 11 days, carbachol inhibited isoproterenol-stimulated cAMP accumulation by 30%. Angiotensin II (ANG II) was also found to inhibit isoproterenol-stimulated cAMP accumulation in day 11 cells in a dose-dependent manner. Pertussis toxin treatment reversed the inhibitory effectsmore » of both ANG II and carbachol, suggesting a role for G{sub i} in the process. Carbachol binding to membranes from day 4 cells was relatively insensitive to guanine nucleotides when compared with binding to membranes from day 11 or adult cells. Furthermore, pertussis toxin-mediated {sup 32}P incorporation into a 39- to 41-kDa substrate in day 11 membranes was increased 3.2-fold over that measured in day 4 membranes. These findings support the view that, although G{sub i} is expressed, it is nonfunctional in 4-day-old cultured neonatal rat heart myocytes and acquisition of functional G{sub i} is dependent on culture conditions. Furthermore, the ANG II receptor can couple to G{sub i} in heart.« less

Long-term priming of neighbours biases the word recognition process: evidence from a lexical decision task.

PubMed

Wagenmakers, Eric-Jan; Raaijmakers, Jeroen G W

2006-12-01

The role of orthographically similar words (i.e., neighbours) in the word recognition process has been studied extensively using short-term priming paradigms (e.g., Colombo, 1986). Here we demonstrate that long-term effects of neighbour priming can also be obtained. Experiment 1 showed that prior study of a neighbour (e.g., TANGO) increased later lexical decision performance for similar words (e.g., MANGO), but decreased performance for similar pseudowords (e.g., LANGO). Experiment 2 replicated this bias effect and showed that the increase in lexical decision performance due to neighbour priming is selectively due to words from a relatively sparse neighbourhood. Explanations of the bias effect in terms of lexical activation and episodic memory retrieval are discussed.

The role of syllabic structure in French visual word recognition.

PubMed

Rouibah, A; Taft, M

2001-03-01

Two experiments are reported in which the processing units involved in the reading of French polysyllabic words are examined. A comparison was made between units following the maximal onset principle (i.e., the spoken syllable) and units following the maximal coda principle (i.e., the basic orthographic syllabic structure [BOSS]). In the first experiment, it took longer to recognize that a syllable was the beginning of a word (e.g., the FOE of FOETUS) than to make the same judgment of a BOSS (e.g., FOET). The fact that a BOSS plus one letter (e.g., FOETU) also took longer to judge than the BOSS indicated that the maximal coda principle applies to the units of processing in French. The second experiment confirmed this, using a lexical decision task with the different units being demarcated on the basis of color. It was concluded that the syllabic structure that is so clearly manifested in the spoken form of French is not involved in visual word recognition.

Investigation of Complex Angle Processing to Reduce Radome Induced Angle Pointing Errors.

DTIC Science & Technology

1979-10-01

PAfNGv 0 -. 0DIF19DIF2vDELsNO9Dlv2 I -ARG/DL+. o 5 IF (I eE~o 1) 1=2 IF( I r-0,N) I N-1 DIF0=tRG-ANG( 1-1) rO! F3 . -ARG-4N.G(! ) C!F2uARG-ANG( I 41...1) C n0 35 !=2,NL APRPR=APP’wAPERP(I I+SPP*CP.:RP(I) BPI Pr’t.Dp* BPP ’ P( TI +SOP.*op’qp( I! CPRPR=CPP*. PRP(I)+OPP*CP--P(!) APRFAP*APRA(I)+BPRCpR

Chemical-Looping Combustion and Gasification of Coals and Oxygen Carrier Development: A Brief Review

DOE PAGES

Wang, Ping; Means, Nicholas; Shekhawat, Dushyant; ...

2015-09-24

Chemical-looping technology is one of the promising CO 2 capture technologies. It generates a CO 2 enriched flue gas, which will greatly benefit CO 2 capture, utilization or sequestration. Both chemical-looping combustion (CLC) and chemical-looping gasification (CLG) have the potential to be used to generate power, chemicals, and liquid fuels. Chemical-looping is an oxygen transporting process using oxygen carriers. Recently, attention has focused on solid fuels such as coal. Coal chemical-looping reactions are more complicated than gaseous fuels due to coal properties (like mineral matter) and the complex reaction pathways involving solid fuels. The mineral matter/ash and sulfur in coalmore » may affect the activity of oxygen carriers. Oxygen carriers are the key issue in chemical-looping processes. Thermogravimetric analysis (TGA) has been widely used for the development of oxygen carriers (e.g., oxide reactivity). Two proposed processes for the CLC of solid fuels are in-situ Gasification Chemical-Looping Combustion (iG-CLC) and Chemical-Looping with Oxygen Uncoupling (CLOU). The objectives of this review are to discuss various chemical-looping processes with coal, summarize TGA applications in oxygen carrier development, and outline the major challenges associated with coal chemical-looping in iG-CLC and CLOU.« less

Discussion on the Modelling and Processing of Signals fom an Acousto-Optic Spectrum Analyzer.

DTIC Science & Technology

1987-06-01

AD-AIBS 639 DISCUSSION ON THE MODELLING AND PROCESSIN OF SIGNALS 1/1 FOR RN ACOUSTO - OPTIC SPECTRUM ANALYZER(U)G DFENCE RESERCH ESTABGLISHMENT OTTANA...8217’~ AV - I National DefenseI Defence nationale DISCUSSION ON THE MODELLING AND PROCESSING OF SIGNALS FROM AN ACOUSTO - OPTIC SPECTRUM ANALYZER by Guy...signals generated by an Acousto - Optic Spectrum Analyzer (AOSA). It also shows how this calculation can be related to pulse modu- lated signals. In its

Sedimentological Characteristics and Classification of Depositional Processes and Deposits in the Glacial Environment,

DTIC Science & Technology

1981-12-01

I characteristics and classification of depositional processes and d,4, r -%sits in the glacial environment C",. 44k (1-I J For conversion of SI metric...Discussion with Dr. John Shaw, Dr. Geoffrey Boulton, Dr. David Croot and Dr. Ross Powell helped considerably in formulating ideas presented in this report...glacial or non- glacial origins of diamictites of Precambrian and COMPARISON OF MELT-OUT other ages (e.g., Schermerhorn 1974, Edwards AND SEDIMENT FLOW

Contextual Modulation of Reading Rate for Direct versus Indirect Speech Quotations

ERIC Educational Resources Information Center

Yao, Bo; Scheepers, Christoph

2011-01-01

In human communication, direct speech (e.g., "Mary said: "I'm hungry"") is perceived to be more vivid than indirect speech (e.g., "Mary said [that] she was hungry"). However, the processing consequences of this distinction are largely unclear. In two experiments, participants were asked to either orally (Experiment 1) or silently (Experiment 2,…

Development of virtual research environment for regional climatic and ecological studies and continuous education support

NASA Astrophysics Data System (ADS)

Gordov, Evgeny; Lykosov, Vasily; Krupchatnikov, Vladimir; Bogomolov, Vasily; Gordova, Yulia; Martynova, Yulia; Okladnikov, Igor; Titov, Alexander; Shulgina, Tamara

2014-05-01

Volumes of environmental data archives are growing immensely due to recent models, high performance computers and sensors development. It makes impossible their comprehensive analysis in conventional manner on workplace using in house computing facilities, data storage and processing software at hands. One of possible answers to this challenge is creation of virtual research environment (VRE), which should provide a researcher with an integrated access to huge data resources, tools and services across disciplines and user communities and enable researchers to process structured and qualitative data in virtual workspaces. VRE should integrate data, network and computing resources providing interdisciplinary climatic research community with opportunity to get profound understanding of ongoing and possible future climatic changes and their consequences. Presented are first steps and plans for development of VRE prototype element aimed at regional climatic and ecological monitoring and modeling as well as at continuous education and training support. Recently developed experimental software and hardware platform aimed at integrated analysis of heterogeneous georeferenced data "Climate" (http://climate.scert.ru/, Gordov et al., 2013; Shulgina et al., 2013; Okladnikov et al., 2013) is used as a VRE element prototype and approach test bench. VRE under development will integrate on the base of geoportal distributed thematic data storage, processing and analysis systems and set of models of complex climatic and environmental processes run on supercomputers. VRE specific tools are aimed at high resolution rendering on-going climatic processes occurring in Northern Eurasia and reliable and found prognoses of their dynamics for selected sets of future mankind activity scenaria. Currently the VRE element is accessible via developed geoportal at the same link (http://climate.scert.ru/) and integrates the WRF and «Planet Simulator» models, basic reanalysis and instrumental measurements data and support profound statistical analysis of storaged and modeled on demand data. In particular, one can run the integrated models, preprocess modeling results data, using dedicated modules for numerical processing perform analysys and visualize obtained results. New functionality recently has been added to the statistical analysis tools set aimed at detailed studies of climatic extremes occurring in Northern Asia. The VRE element is also supporting thematic educational courses for students and post-graduate students of the Tomsk State University. In particular, it allow students to perform on-line thematic laboratory work cycles on the basics of analysis of current and potential future regional climate change using Siberia territory as an example (Gordova et al, 2013). We plan to expand the integrated models set and add comprehensive surface and Arctic Ocean description. Developed VRE element "Climate" provides specialists involved into multidisciplinary research projects with reliable and practical instruments for integrated research of climate and ecosystems changes on global and regional scales. With its help even a user without programming skills can process and visualize multidimensional observational and model data through unified web-interface using a common graphical web-browser. This work is partially supported by SB RAS project VIII.80.2.1, RFBR grant 13-05-12034, grant 14-05-00502, and integrated project SB RAS 131. References 1. Gordov E.P., Lykosov V.N., Krupchatnikov V.N., Okladnikov I.G., Titov A.G., Shulgina T.M. Computationaland information technologies for monitoring and modeling of climate changes and their consequences. Novosibirsk: Nauka, Siberian branch, 2013. - 195 p. (in Russian) 2. T.M. Shulgina, E.P. Gordov, I.G. Okladnikov, A.G., Titov, E.Yu. Genina, N.P. Gorbatenko, I.V. Kuzhevskaya,A.S. Akhmetshina. Software complex for a regional climate change analysis. // Vestnik NGU. Series: Information technologies. 2013. Vol. 11. Issue 1. P. 124-131. (in Russian) 3. I.G. Okladnikov, A.G. Titov, T.M. Shulgina, E.P. Gordov, V.Yu. Bogomolov, Yu.V. Martynova, S.P. Suschenko,A.V. Skvortsov. Software for analysis and visualization of climate change monitoring and forecasting data //Numerical methods and programming, 2013. Vol. 14. P. 123-131.(in Russian) 4. Yu.E. Gordova, E.Yu. Genina, V.P. Gorbatenko, E.P. Gordov, I.V. Kuzhevskaya, Yu.V. Martynova , I.G. Okladnikov, A.G. Titov, T.M. Shulgina, N.K. Barashkova Support of the educational process in modern climatology within the web-gis platform «Climate». Open and Distant Education. 2013, No 1(49)., P. 14-19.(in Russian)

Production of ethanol 3G from Kappaphycus alvarezii: evaluation of different process strategies.

PubMed

Hargreaves, Paulo Iiboshi; Barcelos, Carolina Araújo; da Costa, Antonio Carlos Augusto; Pereira, Nei

2013-04-01

This study evaluated the potential of Kappaphycus alvarezii as feedstock for ethanol production, i.e. ethanol 3G. First, aquatic biomass was subjected to a diluted acid pretreatment. This acid pretreatment generated two streams--a galactose-containing liquid fraction and a cellulose-containing solid fraction, which were investigated to determine their fermentability with the following strategies: a single-stream process (simultaneous saccharification and co-fermentation (SSCF) of both fractions altogether), which achieved 64.3 g L(-1) of ethanol, and a two-stream process (fractions were fermented separately), which resulted in 38 g L(-1) of ethanol from the liquid fraction and 53.0 g L(-1) from the simultaneous saccharification and fermentation (SSF) of the solid fraction. Based on the average fermentable carbohydrate concentration, it was possible to obtain 105 L of ethanol per ton of dry seaweed. These preliminaries results indicate that the use of the macro-algae K. alvarezii has a good potential feedstock for bioethanol production. Copyright © 2013. Published by Elsevier Ltd.

Situated conceptualization and semantic processing: effects of emotional experience and context availability in semantic categorization and naming tasks.

PubMed

Moffat, Michael; Siakaluk, Paul D; Sidhu, David M; Pexman, Penny M

2015-04-01

It has been proposed that much of conceptual knowledge is acquired through situated conceptualization, such that both external (e.g., agents, objects, events) and internal (e.g., emotions, introspections) environments are considered important (Barsalou, 2003). To evaluate this proposal, we characterized two dimensions by which situated conceptualization may be measured and which should have different relevance for abstract and concrete concepts; namely, emotional experience (i.e., the ease with which words evoke emotional experience; Newcombe, Campbell, Siakaluk, & Pexman, 2012) and context availability (i.e., the ease with which words evoke contexts in which their referents may appear; Schwanenflugel & Shoben, 1983). We examined the effects of these two dimensions on abstract and concrete word processing in verbal semantic categorization (VSCT) and naming tasks. In the VSCT, emotional experience facilitated processing of abstract words but inhibited processing of concrete words, whereas context availability facilitated processing of both types of words. In the naming task in which abstract words and concrete words were not blocked by emotional experience, context availability facilitated responding to only the abstract words. In the naming task in which abstract words and concrete words were blocked by emotional experience, emotional experience facilitated responding to only the abstract words, whereas context availability facilitated responding to only the concrete words. These results were observed even with several lexical (e.g., frequency, age of acquisition) and semantic (e.g., concreteness, arousal, valence) variables included in the analyses. As such, the present research suggests that emotional experience and context availability tap into different aspects of situated conceptualization and make unique contributions to the representation and processing of abstract and concrete concepts.

Perceptions of Sexual Orientation From Minimal Cues.

PubMed

Rule, Nicholas O

2017-01-01

People derive considerable amounts of information about each other from minimal nonverbal cues. Apart from characteristics typically regarded as obvious when encountering another person (e.g., age, race, and sex), perceivers can identify many other qualities about a person that are typically rather subtle. One such feature is sexual orientation. Here, I review the literature documenting the accurate perception of sexual orientation from nonverbal cues related to one's adornment, acoustics, actions, and appearance. In addition to chronicling studies that have demonstrated how people express and extract sexual orientation in each of these domains, I discuss some of the basic cognitive and perceptual processes that support these judgments, including how cues to sexual orientation manifest in behavioral (e.g., clothing choices) and structural (e.g., facial morphology) signals. Finally, I attend to boundary conditions in the accurate perception of sexual orientation, such as the states, traits, and group memberships that moderate individuals' ability to reliably decipher others' sexual orientation.

Correlations of CTLA-4 exon-1 49 A/G and promoter region 318C/T polymorphisms with the therapeutic efficacy of 131 I radionuclide in graves' disease in Chinese Han population.

PubMed

Han, Xin-Rui; Wen, Xin; Wang, Shan; Fan, Shao-Hua; Zhuang, Juan; Wang, Yong-Jian; Zhang, Zi-Feng; Li, Meng-Qiu; Hu, Bin; Shan, Qun; Sun, Chun-Hui; Bao, Ya-Xing; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin

2017-08-04

Graves' disease is an autoimmune process in which the thyroid gland is triggered by autoantibodies, resulting in hyperthyroidism. The purpose of the present study is to elucidate whether exon-1 49 A/G and promoter region 318C/T polymorphisms in the CTLA-4 gene. This study consisted of 653 eligible patients with Graves' disease. After receiving 131I radionuclide therapy, these patients were classified into the remission and non-remission groups. A logistic regression-based model was used to analyze independent factors affecting the patient response to 131I radionuclide therapy. The results showed that CTLA-4 49 A/G was closely related to the efficacy of 131 I treatment for Graves' disease (AG + GG vs. AA: OR = 6.543, 95%CI = 2.611 ∼ 16.40, P < 0.001; G vs. A: OR = 3.482, 95%CI = 2.457 ∼ 4.934, P < 0.001). Moreover, the findings revealed that haplotype A-C (P < 0.001, OR = 3.592, 95%CI: 2.451 ∼ 5.262) and G-C (P < 0.001, OR = 0.282, 95%CI: 0.204 ∼ 0.391) were associated with the efficacy of 131 I therapy in treating Graves' disease. Logistic regression analysis indicated that thyroid weight (OR = 0.963, 95%CI = 0.944 ∼ 0.982, P < 0.001) and CTLA-4 exon-1 49 A/G polymorphism (OR = 0.334, 95%CI = 0.233 ∼ 0.478, P < 0.001) independently affect the efficacy of 131 I therapy in Graves' disease. These data indicated that CTLA-4 exon-1 49 A/G polymorphism may be associated with patient response to radionuclide 131 I therapy in Graves' disease. © 2017 Wiley Periodicals, Inc.

[F-18]Fluorodihydrorotenone: Synthesis and evaluation of a mitochondrial electron transport chain (ETC) complex I probe for PET

DOE Office of Scientific and Technical Information (OSTI.GOV)

VanBrocklin, H.F.; Enas, J.D.; Hanrahan, S.M.

1994-05-01

The mitochondrial electron transport chain (ETC) consists of five enzyme complexes (I-V) which participate in the transfer of electrons to oxygen and phosphorylation of ADP (oxidative phosphorylation). ETC dysfunction has been linked to several genetic neurological diseases as well as implicated in Parkinson`s (complex I) and Huntington`s (complex I) disease and normal aging processes. Dihydrorotenone (DHR) is a specific high affinity inhibitor of complex I. In order to develop a PET tracer for complex I, we have labeled DHR with fluorine-18. The tosylate precursor was produced in three steps from commercially available rotenone. Fluorine-18 was introduced by nucleophilic displacement ofmore » the tosylate using tetrabutyl-ammonium fluoride. Subsequent oxidation with MnO{sub 2} and HPLC purification gave the desired [{sup 18}F]fluoro-DHR. Initial biodistribution studies were carried out in {approximately}200 g male Sprague-Dawley rats. The tracer was taken up rapidly in the heart, an organ highly enriched with mitochondria, (5.5-6% injected dose (ID)/g at 30 minutes) and in the brain ({approximately}1.5% ID/g at 1 hour).« less

Transient Fluvial Response to Alpine Deglaciation, Mount Rainier, WA: Geomorphic Process Domains and Proglacial Flux Controls on Channel Evolution.

NASA Astrophysics Data System (ADS)

Beyeler, J. D.; Montgomery, D.; Kennard, P. M.

2016-12-01

Downwasting of all glaciers on the flanks of Mount Rainier, WA, in recent decades has debuttressed Little Ice Age glaciogenic sediments driving proglacial responses to regionally warming climate. Rivers draining the deglaciating edifice are responding to paraglacial sedimentation processes through transient storage of retreat-liberated sediments in aggrading (e.g., >5m) fluvial networks with widening channel corridors (i.e., 50-150%) post-LIA (ca., 1880-1910 locally). We hypothesize that the downstream transmission of proglacial fluxes (i.e., sediment and water) through deglaciating alpine terrain is a two-step geomorphic process. The ice-proximal portion of the proglacial system is dominated by the delivery of high sediment-to-water ratio flows (i.e., hyperconcentrated and debris slurries) and sediment retention by in-channel accumulation (e.g., confined debris fans within channel margins of valley segments) exacerbated by recruitment and accumulation of large wood (e.g., late seral stage conifers), whereas ice-distal fluvial reworking of transient sediment accumulations generates downstream aggradation. Historical Carbon River observations show restricted ice-proximal proglacial aggradation until a mainstem avulsion in 2009 initiated incision into sediment accumulations formed in recent decades, which is translating into aggradation farther down the network. Surficial morphology mapped with GPS, exposed subsurface sedimentology, and preliminary dating of buried trees suggest a transitional geomorphic process zone has persisted along the proglacial Carbon River through recent centuries and prior to the ultimate LIA glaciation. Structure-from-motion DEM differencing through the 2016 water year shows discrete zones of proglacial evolution through channel-spanning bed aggradation forced by interactions between large wood and sediment-rich flows that transition to fluvial process dominance as sediment is transported downstream. Long-term DEM differencing suggests these are persistent geomorphic processes as rivers respond to alpine deglaciation. This process-based study implies downstream river flooding in deglaciating alpine terrain globally is driven by glaciogenic sediment release and downstream channel aggradation irrespective of changes in discharge.

Analysis and optimization of coagulation and flocculation process

NASA Astrophysics Data System (ADS)

Saritha, V.; Srinivas, N.; Srikanth Vuppala, N. V.

2017-03-01

Natural coagulants have been the focus of research of many investigators through the last decade owing to the problems caused by the chemical coagulants. Optimization of process parameters is vital for the effectiveness of coagulation process. In the present study optimization of parameters like pH, dose of coagulant and mixing speed were studied using natural coagulants sago and chitin in comparison with alum. Jar test apparatus was used to perform the coagulation. The results showed that the removal of turbidity was up to 99 % by both alum and chitin at lower doses of coagulant, i.e., 0.1-0.3 g/L, whereas sago has shown a reduction of 70-100 % at doses of 0.1 and 0.2 g/L. The optimum conditions observed for sago were 6 and 7 whereas chitin was stable at all pH ranges, lower coagulant doses, i.e., 0.1-0.3 g/L and mixing speed—rapid mixing at 100 rpm for 10 min and slow mixing 20 rpm for 20 min. Hence, it can be concluded that sago and chitin can be used for treating water even with large seasonal variation in turbidity.

High quality human immunoglobulin G purified from Cohn fractions by liquid chromatography.

PubMed

Tanaka, K; Sawatani, E; Dias, G A; Shigueoka, E M; Campos, T C; Nakao, H C; Arashiro, F

2000-01-01

In order to obtain intravenous immunoglobulin G (iv IgG) of high quality from F-I+II+III or F-II+III pastes prepared by the Cohn method, we developed a chromatography process using ion exchange gels, Q-Sepharose FF and CM-Sepharose FF, and Sephacryl S-300 gel filtration. Viral inactivation was performed by incubating the preparation with pepsin at pH 4.0 at 35 degrees C for 18 h. The characteristics of 28 batches produced by us were: yield 4.3 +/- 0.2 g/l plasma, i.e., a recovery of 39.1 +/- 1.8%; IgG subclasses distribution: IgG1 = 58.4%, IgG2 = 34.8%, IgG3 = 4.5% and IgG4 = 2. 3%; IgG size distribution was 98.4% monomers, 1.2% dimers and 0.4% polymers and protein aggregates; anticomplement activity was less than 0.5 CH50/mg IgG, and prekallikrein activator activity (PKA) was less than 5 IU/ml. These characteristics satisfied the requirements of the European Pharmacopoea edition, and the regulations of the Brazilian Health Ministry (M.S. Portaria No. 2, 30/10/1998).

State Space Methods in Multidimensional Digital Signal Processing

DTIC Science & Technology

1991-01-01

2-D finite difference equation with quarter-plane support is given by [1]. Li L-2 Ll L2 g (nln2) =E E Zb(jl,j2)f(n,-j, n 2 -j 2 ) - E a(jl,j2) g (n, - j...B2 [ g (n , n2)] = [C1 C2 1 Sq’(n nl2) ]+ D [f (ni, n 2 )] (2.2) Roesser’s state space model is based upon assigning state variables to the output of...QH(n - 1,n2) + [ B1 [f(nl,n2)]Qv(ni, n2) I A3 A411 Qv(nl, n2 -1 1 B2 [ g (n 1 ,n 2 )] = [C1 C 2] Q(n - n) + D[f(nin 2 )] (2.5) I Qv(ni,n2- 1) 1 In this

Current Practices in Global/International Advanced Pharmacy Practice Experiences: Home/Host Country or Site/Institution Considerations

PubMed Central

Dakkuri, Adnan; Abrons, Jeanine P.; Williams, Dennis; Ombengi, David N.; Zheng, HaiAn; Al-Dahir, Sara; Tofade, Toyin; Gim, Suzanna; O’Connell, Mary Beth; Ratka, Anna; Dornblaser, Emily

2016-01-01

International outreach by schools and colleges of pharmacy is increasing. In this paper, we provide current practice guidelines to establish and maintain successful global/international advanced pharmacy practice experiences (G/I APPEs) with specific recommendations for home/host country and host site/institution. The paper is based on a literature review (2000-2014) in databases and Internet searches with specific keywords or terms. Educational documents such as syllabi and memoranda of understanding (MoUs) from pharmacy programs were also examined. In addition, a preliminary draft was developed and the findings and recommendations were reviewed in a 90-minute roundtable discussion at the 2014 American Association of Colleges of Pharmacy Annual Meeting. Recommendations for the host country include travel considerations (eg, passport, visa, air travel), safety, housing, transportation, travel alerts and warnings, health issues, and financial considerations. For the home country, considerations for establishment of G/I APPE site (eg, vetting process, MoU, site expectations) are described. The paper is a resource for development of new G/I APPEs and provides guidance for continuous quality improvement of partnerships focusing on G/I pharmacy education. PMID:27170809

Current Practices in Global/International Advanced Pharmacy Practice Experiences: Home/Host Country or Site/Institution Considerations.

PubMed

Alsharif, Naser Z; Dakkuri, Adnan; Abrons, Jeanine P; Williams, Dennis; Ombengi, David N; Zheng, HaiAn; Al-Dahir, Sara; Tofade, Toyin; Gim, Suzanna; O'Connell, Mary Beth; Ratka, Anna; Dornblaser, Emily

2016-04-25

International outreach by schools and colleges of pharmacy is increasing. In this paper, we provide current practice guidelines to establish and maintain successful global/international advanced pharmacy practice experiences (G/I APPEs) with specific recommendations for home/host country and host site/institution. The paper is based on a literature review (2000-2014) in databases and Internet searches with specific keywords or terms. Educational documents such as syllabi and memoranda of understanding (MoUs) from pharmacy programs were also examined. In addition, a preliminary draft was developed and the findings and recommendations were reviewed in a 90-minute roundtable discussion at the 2014 American Association of Colleges of Pharmacy Annual Meeting. Recommendations for the host country include travel considerations (eg, passport, visa, air travel), safety, housing, transportation, travel alerts and warnings, health issues, and financial considerations. For the home country, considerations for establishment of G/I APPE site (eg, vetting process, MoU, site expectations) are described. The paper is a resource for development of new G/I APPEs and provides guidance for continuous quality improvement of partnerships focusing on G/I pharmacy education.

Microcomputer Geotechnical Quality Assurance of Compacted Earth Fill Data Package: User’s Guide

DTIC Science & Technology

1991-08-01

US 530.0 6 AREA I : "CL 4.,0 100 98 26 36 14:100.8 19.5: 6 10.3 16.2: 100.2 17.6: 1.9 !00.5: I AC .G :iP00 04113 SY 4*70 10 DS 531.5 6 AUREA I :CL 4.00...the general X-Y plot program. The user is referred to the above section or Appendix B for details of this process. One additional feature that is

The Levels of Processing Conceptualization of Human Memory: Some Empirical and Theoretical Issues,

DTIC Science & Technology

1984-12-01

levels -of- processing (LOP) framework was introduced by Craik and Lockhart in 1972...G. H. A multicomponent theory of the memory trace. In F. I. M. Craik and R. S. Lockhart , Levels of 6 processing : A framework for memory research... Lockhart , R. S. Levels of processing : A framework of memory research. Journal of Verbal Learning and Verbal Behavior, 1972, 11, 671-684. 25. Craik , F.

Intelligent Signal Processing for Active Control

DTIC Science & Technology

1992-06-17

FUNDING NUMSI Intelligent Signal Processing for Active Control C-NO001489-J-1633 G. AUTHOR(S) P.A. Ramamoorthy 7. P2RFORMING ORGANIZATION NAME(S) AND...unclassified .unclassified unclassified L . I mu-. W UNIVERSITY OF CINCINNATI COLLEGE OF ENGINEERING Intelligent Signal Processing For Rctiue Control...NAURI RESEARCH Conkact No: NO1489-J-1633 P.L: P.A.imoodh Intelligent Signal Processing For Active Control 1 Executive Summary The thrust of this

Impact of iPads on Break-Time in Primary Schools--A Danish Context

ERIC Educational Resources Information Center

Schilhab, Theresa

2017-01-01

Today, technology in the form of tablet computers (e.g. iPads) is crucial as a tool for learning and education. Tablets support educational activities such as archiving, word processing, and generation of academic products. They also connect with the Internet, providing access to news, encyclopaedic entries, and e-books. In addition, tablets have…

On the dynamics of fission of hot nuclei

NASA Astrophysics Data System (ADS)

Fröbrich, P.

2007-05-01

In this contribution I take the opportunity to address some points which are in my opinion not in a satisfactory state in the dynamical description of fission of hot nuclei. The focus is on relatively light systems where Bohr's hypothesis on the independence of the fusion and subsequent fission processes is valid, but my remarks are also of relevance to attempts to describe the complete fusion-fission process in a unified way, when quasi-fission channels compete in heavier systems and quantal effects may be of increasing importance in particular when considering low temperatures. There is no doubt that the most adequate dynamical description of the fusion-fission process is obtained by solving multi-dimensional Langevin equations to which a Monte Carlo treatment for the evaporation of light (n, p, α, γ) particles is coupled. However, there is less agreement about the input quantities which enter the description. In the review article [P. Fröbrich, I.I. Gontchar, Phys. Rep. 292, 131 (1998)], we deal mainly with an overdamped Langevin dynamics along the fission coordinate which goes over to an appropriately modified statistical model when a stationary regime with respect to the fission mode is reached. The main ingredient is a phenomenological (deformation-dependent, temperature-independent) friction force, which is invented in such a way that it allows a description of a multitude of experimental data in a universal way (i.e. with the same set of parameters). The main success was a systematic simultaneous description of fission or survival probabilities and prescission neutron multiplicities [P. Fröbrich, I.I. Gontchar, N.D. Mavlitov, Nucl. Phys. A 556, 261 (1993)]. This is not possible in any statistical model. The model describes successfully many other data for systems that develop over a completely equilibrated compound nucleus; see Ref. [P. Fröbrich, I.I. Gontchar, Phys. Rep. 292, 131 (1998)] and references therein. It deals with: fission (survival) probabilities prescission neutron multiplicities and spectra prescission charged particle multiplicities and spectra prescission γ-multiplicities and spectra evaporation residue cross sections fission time distributions temperatures at scission fission fragment angular distributions The results above are obtained with the Ito-discretization of the Langevin equation and might lead to some modifications when using the Klimontovich [Yu.L. Klimontovich, Usp. Fiz. Nauk. 37, 737 (1994)] discretization, which is claimed to be more physical [A.E. Gettinger, I.I. Gontchar, J. Phys. G: Nucl. Part. Phys. 26, 347 (2000)]. A satisfactory description of the measured correlation between the kinetic energy distribution and prescission neutron multiplicities could only be obtained when the mass asymmetry degree of freedom is included in the Langevin theory [P.N. Nadtochy, G.D. Adeev, A.V. Karpov, Phys. Rev. C 65, 064615 (2002)], thus generalizing the two-dimensional not overdamped Langevin models of Refs. [G.R. Tillack, R. Reif, A. Schülcke, P. Fröbrich, H.J. Krappe, H.G. Reusch, Phys. Lett. B 296, 296 (1992)] and [T. Wada, Y. Abe, N. Carjan, Phys. Rev. Lett. 70, 3528 (1993)]. A recent article analysing the mass distribution of fission fragments is [E.G. Ryabov, A.V. Karpov, G.D. Adeev, Nucl. Phys. A 765, 39 (2006)]. The first important point I want to stress is that the driving force of a hot system is not simply the negative gradient of the conservative potential but should contain a thermodynamical correction which is not taken into account in a number of publications.

Stem cell therapies in preclinical models of stroke. Is the aged brain microenvironment refractory to cell therapy?

PubMed

Sandu, Raluca Elena; Balseanu, Adrian Tudor; Bogdan, Catalin; Slevin, Mark; Petcu, Eugen; Popa-Wagner, Aurel

2017-08-01

Stroke is a devastating disease demanding vigorous search for new therapies. Initial enthusiasm to stimulate restorative processes in the ischemic brain by means of cell-based therapies has meanwhile converted into a more balanced view recognizing impediments that may be related to unfavorable age-associated environments. Recent results using a variety of drug, cell therapy or combination thereof suggest that, (i) treatment with Granulocyte-Colony Stimulating Factor (G-CSF) in aged rats has primarily a beneficial effect on functional outcome most likely via supportive cellular processes such as neurogenesis; (ii) the combination therapy, G-CSF with mesenchymal cells (G-CSF+BM-MSC or G-CSF+BM-MNC) did not further improve behavioral indices, neurogenesis or infarct volume as compared to G-CSF alone in aged animals; (iii) better results with regard to integration of transplanted cells in the aged rat environment have been obtained using iPS of human origin; (iv) mesenchymal cells may be used as drug carriers for the aged post-stroke brains. While the middle aged brain does not seem to impair drug and cell therapies, in a real clinical practice involving older post-stroke patients, successful regenerative therapies would have to be carried out for a much longer time. Copyright © 2017. Published by Elsevier Inc.

Comparison of Linear and Nonlinear Processing with Acoustic Vector Sensors

DTIC Science & Technology

2008-09-01

can write the general form of the time invariant vector sensor planewave response as mik rm mv V e = i , (2.21) where mik rxm xmv V e = i , mik rym...ymv V e = i , and mik rzm zmv V e = i . Using the vector geometry defined, the response of each component is defined by cosxm mV V θ= , sin...velocity values relative to the other by the acoustic impedance, ρc, according to Equation (2.19) , e.g. , mik r mpm pm pm Pv V e V cρ = =i

Reconstruction and Applications of Collective Storylines from Web Photo Collections

DTIC Science & Technology

2013-09-01

a random surfer model as follows. α = min ( πG(s ∗)q(s∗, st−1) πG(st−1)q(st−1, s∗) , 1 ) where q(i, j ) = λw̃ij + (1− λ)πG( j ). (3.3) 25 In Eq.3.3, the...probability α in Eq.(3.3) where w̃ij is the element (i, j ) of G̃. We repeat this process until the desired numbers of training samples are selected. For...exponential of a linear summation of the functions f lj of the covariates xj with a parameter vector θl = (θl1, · · · , θlJ): log λl(ti|θl) = J ∑ j =1 θljf l j

Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

DOEpatents

Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

2007-03-13

The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

Foods and beverages and colorectal cancer risk: a systematic review and meta-analysis of cohort studies, an update of the evidence of the WCRF-AICR Continuous Update Project.

PubMed

Vieira, A R; Abar, L; Chan, D S M; Vingeliene, S; Polemiti, E; Stevens, C; Greenwood, D; Norat, T

2017-08-01

As part of the World Cancer Research Fund International Continuous Update Project, we updated the systematic review and meta-analysis of prospective studies to quantify the dose-response between foods and beverages intake and colorectal cancer risk. PubMed and several databases up to 31 May 2015. Prospective studies reporting adjusted relative risk estimates for the association of specific food groups and beverages and risk of colorectal, colon and rectal cancer. Dose-response meta-analyses using random effect models to estimate summary relative risks (RRs). About 400 individual study estimates from 111 unique cohort studies were included. Overall, the risk increase of colorectal cancer is 12% for each 100 g/day increase of red and processed meat intake (95% CI = 4-21%, I2=70%, pheterogeneity (ph)<0.01) and 7% for 10 g/day increase of ethanol intake in alcoholic drinks (95% CI = 5-9%, I2=25%, ph = 0.21). Colorectal cancer risk decrease in 17% for each 90g/day increase of whole grains (95% CI = 11-21%, I2 = 0%, ph = 0.30, 6 studies) and 13% for each 400 g/day increase of dairy products intake (95% CI = 10-17%, I2 = 18%, ph = 0.27, 10 studies). Inverse associations were also observed for vegetables intake (RR per 100 g/day =0.98 (95% CI = 0.96-0.99, I2=0%, ph = 0.48, 11 studies) and for fish intake (RR for 100 g/day = 0.89 (95% CI = 0.80-0.99, I2=0%, ph = 0.52, 11 studies), that were weak for vegetables and driven by one study for fish. Intakes of fruits, coffee, tea, cheese, poultry and legumes were not associated with colorectal cancer risk. Our results reinforce the evidence that high intake of red and processed meat and alcohol increase the risk of colorectal cancer. Milk and whole grains may have a protective role against colorectal cancer. The evidence for vegetables and fish was less convincing. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

International Conference on Random Mappings, Partitions and Permutations Held in Los Angeles, California on 3-6 January 1992

DTIC Science & Technology

1992-08-01

cryptography to the simula- tion of epidemic processes and tests of the intrinsic randomness of quantum mechanics. Discussed in this paper are... theorem concerning the height of a random labelled rooted tree [4]; letting f( s ) = ½ + 82, G(t) = 1 - e-t if t > 0, G(t) = 0 otherwise, and A (0], p...o thi cOoection of infromaltion.% no|uaing• viggitIOns for riviucirg this curoon. to WasnaImllor "@as s n o w, i-i1it,"ersondO Daisr hqhvhwao. SWite

Titanite-scale insights into multi-stage magma mixing in Early Cretaceous of NW Jiaodong terrane, North China Craton

NASA Astrophysics Data System (ADS)

Jiang, Peng; Yang, Kui-Feng; Fan, Hong-Rui; Liu, Xuan; Cai, Ya-Chun; Yang, Yue-Heng

2016-08-01

The Early Cretaceous Guojialing-type granodiorites in northwestern Jiaodong terrane carry significant records for strong mantle-crust interaction during the destruction of North China Craton (NCC); however, the definite petrogenetic mechanism and detailed magmatic process remain an enigma. Titanite in igneous rocks can serve as an effective petrogenetic indicator. Here, we present integrated geochronological and geochemical studies on titanites from Guojialing-type granodiorites and their dioritic enclaves to constrain their petrogenesis. Titanites from granodiorites (G-type) and plagioclase-rich dioritic enclaves (E-type-I) present an identical U-Pb age ( 130 Ma) and an indistinguishable wide range of Zr and total REEs contents, and Th/U ratios. However, these two types of titanites exhibit distinct micro-scale textures and geochemical compositions. G-type titanites are characterized by oscillatory zonings with two Light BSE zones (LBZ) and two or three dark BSE zones, whereas E-type-I titanites are marked by core-mantle-rim zonings. Drastic increase of LREEs, Zr, Hf, and Fe and decrease of Nb, Ta, Al, and F contents are observed in LBZ of G-type titanites, whereas remarkable reduction of LREEs, Zr, and Hf and elevation of F contents are observed from the cores to the mantles of E-type-I titanites. Based on Zr-in-titanite thermometry, G-type titanites are interpreted to have experienced twice notable temperature increase, while E-type-I titanites are inferred to have undergone a rapid cooling process. Furthermore, we suggest that the drastic chemical changes in G-type and E-type-I titanites are ascribed to early-stage magma mixing between a colder felsic magma and a Fe-, REE-rich hotter dioritic magma. Compared to G-type and E-type-I titanites, titanites from plagioclase-poor dioritic enclaves (E-type-II) are characterized by their occurrence in interstitial space and present a relatively younger U-Pb age ( 128 Ma) and much narrower and lower range of Zr, total REEs contents, and Th/U ratios, but reveal high F contents (0.35-0.76 wt.%) and extreme high Nb/Ta ratios (up to 65.6). Such titanites are perceived to record late-stage mingling, during which F-rich and REE-poor hybrid granodioritic magma squeezed into the incompletely consolidated dioritic enclaves with accompanying fluid-rock interaction. Combining our results with previous isotopic studies, a new genetic model for Guojialing-type granodiorites is envisaged, which involves multi-stage magma mixing between Archean lower crust-derived felsic magma and mafic lower crust-derived dioritic magma, triggered by mantle-derived mafic magma underplating during the course of asthenospheric upwelling in Early Cretaceous. Such process further implicates the reactivation of Jiaodong lower crust during the destruction of NCC.

Theoretical Studies Relating to the Interaction of Radiation with Matter: Atomic Collision Processes Occurring in the Presence of Radiation Fields.

DTIC Science & Technology

1980-10-01

34normal" or the interaction of a nonuniform relative velocity distribution into the representation, oing to condition (21. average over 0, but the results...the Oi-dei of 10"i see ) inn this of tile integrals :rppra-inij~g in Eq’(. (i3. I) and,(in ase, a lair !’ anneunlt of vnigCy Joel, collisijon totecniin

Toward a Glossary of Self-related Terms

PubMed Central

Morin, Alain

2017-01-01

Some scholars have noted that an impressive number of self-related terms have been gradually introduced in the scientific literature. Several of these terms are either ill-defined or synonymous, creating confusion, and redundancy. In an effort to minimize this problem, I present a novel and systematic way of looking at possible relations between several key self-terms. I also propose a tentative classification scheme of self-terms as follows: (1) basic terms related to the overall process of self-perception (e.g., self-awareness), (2) non self-terms that are importantly associated to some other self-terms (e.g., consciousness and Theory of Mind), (3) processes related to the executive self and involving agency, volition, and self-control (e.g., self-regulation), and (4) self-views, that is, the content and feelings about the self (e.g., self-esteem). Three additional categories not discussed in this paper are self-biases, reactions to the self, and interpersonal style. Arguably unambiguous definitions for some of the most important and frequently used self-terms are suggested. These are presented in tables meant for the reader to search for definitions as well as related terms. PMID:28293209

Critical Behaviors in Contagion Dynamics.

PubMed

Böttcher, L; Nagler, J; Herrmann, H J

2017-02-24

We study the critical behavior of a general contagion model where nodes are either active (e.g., with opinion A, or functioning) or inactive (e.g., with opinion B, or damaged). The transitions between these two states are determined by (i) spontaneous transitions independent of the neighborhood, (ii) transitions induced by neighboring nodes, and (iii) spontaneous reverse transitions. The resulting dynamics is extremely rich including limit cycles and random phase switching. We derive a unifying mean-field theory. Specifically, we analytically show that the critical behavior of systems whose dynamics is governed by processes (i)-(iii) can only exhibit three distinct regimes: (a) uncorrelated spontaneous transition dynamics, (b) contact process dynamics, and (c) cusp catastrophes. This ends a long-standing debate on the universality classes of complex contagion dynamics in mean field and substantially deepens its mathematical understanding.

40 CFR 63.645 - Test methods and procedures for miscellaneous process vents.

Code of Federal Regulations, 2012 CFR

2012-07-01

... analysis based on accepted chemical engineering principles, measurable process parameters, or physical or... minute, at a temperature of 20 °C. (g) Engineering assessment may be used to determine the TOC emission...) Engineering assessment includes, but is not limited to, the following: (i) Previous test results provided the...

40 CFR 63.645 - Test methods and procedures for miscellaneous process vents.

Code of Federal Regulations, 2013 CFR

2013-07-01

... analysis based on accepted chemical engineering principles, measurable process parameters, or physical or... minute, at a temperature of 20 °C. (g) Engineering assessment may be used to determine the TOC emission...) Engineering assessment includes, but is not limited to, the following: (i) Previous test results provided the...

40 CFR 63.645 - Test methods and procedures for miscellaneous process vents.

Code of Federal Regulations, 2011 CFR

2011-07-01

... analysis based on accepted chemical engineering principles, measurable process parameters, or physical or... minute, at a temperature of 20 °C. (g) Engineering assessment may be used to determine the TOC emission...) Engineering assessment includes, but is not limited to, the following: (i) Previous test results provided the...

Knowledge Intensive Programming: A New Educational Computing Environment.

ERIC Educational Resources Information Center

Seidman, Robert H.

1990-01-01

Comparison of the process of problem solving using a conventional procedural computer programing language (e.g., BASIC, Logo, Pascal), with the process when using a logic programing language (i.e., Prolog), focuses on the potential of the two types of programing languages to facilitate the transfer of problem-solving skills, cognitive development,…

Visual and Auditory Input in Second-Language Speech Processing

ERIC Educational Resources Information Center

Hardison, Debra M.

2010-01-01

The majority of studies in second-language (L2) speech processing have involved unimodal (i.e., auditory) input; however, in many instances, speech communication involves both visual and auditory sources of information. Some researchers have argued that multimodal speech is the primary mode of speech perception (e.g., Rosenblum 2005). Research on…

The Dark Energy Survey Image Processing Pipeline

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morganson, E.; et al.

The Dark Energy Survey (DES) is a five-year optical imaging campaign with the goal of understanding the origin of cosmic acceleration. DES performs a 5000 square degree survey of the southern sky in five optical bands (g,r,i,z,Y) to a depth of ~24th magnitude. Contemporaneously, DES performs a deep, time-domain survey in four optical bands (g,r,i,z) over 27 square degrees. DES exposures are processed nightly with an evolving data reduction pipeline and evaluated for image quality to determine if they need to be retaken. Difference imaging and transient source detection are also performed in the time domain component nightly. On amore » bi-annual basis, DES exposures are reprocessed with a refined pipeline and coadded to maximize imaging depth. Here we describe the DES image processing pipeline in support of DES science, as a reference for users of archival DES data, and as a guide for future astronomical surveys.« less

Did I read or did I name? Diminished awareness of processes yielding identical 'outputs'.

PubMed

Molapour, Tanaz; Berger, Christopher C; Morsella, Ezequiel

2011-12-01

It has been proposed that incompatible intentions (e.g., to inhale and not inhale while holding one's breath while underwater) are an essential ingredient of conscious conflict. Laboratory tasks such as the Stroop color naming task can instantiate conscious conflict innocuously. However, little research has explored what occurs subjectively at the other end of conflict, when intentions are harmonious. The hypothesis of synchrony blindness proposes that, during harmonious processing, not only may one not experience any conflict, but one may also be unaware that more than one process yielded the same intention/action plan. Accordingly, in the Stroop task, participants reported less of an urge to err (by reading) when words were presented in the congruent condition (e.g., RED presented in red) than when the very same words were presented in standard font color, suggesting that awareness of word-reading was diminished experimentally. The implications of this finding for theories about consciousness are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

The Reddy maker

NASA Astrophysics Data System (ADS)

Nof, Doron; Paldor, Nathan; Gorder, Stephen Van

2002-09-01

A new mechanism for the formation of high-amplitude anticyclonic eddies (lenses) from outflows emptying into the ocean at mid-depth is proposed. The essence of the new mechanism is that, in order for an inviscid outflow to exist as a continuous (uninterrupted) current, the condition g' S/ f> α( g' H) 1/2 [where g' is the "reduced gravity", S the bottom slope, f the Coriolis parameter, α a coefficient of order unity whose value depends on the outflow's potential vorticity (it is 2 for a zero potential vorticity outflow and unity for a uniform potential vorticity) and H the maximum thickness] must hold. When the above condition is not met, i.e., when g' S/ f< α( g' H) 1/2, the outflow can only exist as a chain of propagating lenses. Nonlinear analytical considerations leading to the above conclusion are (successfully) compared to numerical simulations which we have conducted (using a reduced gravity layer-and-a-half model). The experiments show that an outflow situated on a bottom whose (uniform) slope gradually varies in the downstream direction is continuous (i.e., is not broken into eddies) where the slope is supercritical [ g' S/ f> α( g' H) 1/2] and discontinuous (i.e., constitutes a chain of eddies) where the slope is subcritical [ g' S/ f< α( g' H) 1/2]. Hence, the eddies are generated by the gradual reduction in the bottom slope rather than by an instability process. Namely, the eddies are not formed by the breakdown of a known steady solution because such a steady solution does not exist. We note that after reaching its "balanced depth", an outflow usually continues to (slowly) descend toward the bottom of the ocean due to frictional effects associated with an energy loss. [Note that the "balanced depth" is the depth at which the outflow has completed its initial adjustment in the sense that it has adjusted to a state where it no longer flows primarily offshore but rather propagates primarily along the isobaths. This depth needs to be distinguished from the (sometimes significantly greater) equilibrium depth corresponding to the point where the outflow's density equals the environmental density.] Most of the time, the outflow descent is accompanied by a reduction in the bottom slope S, and an entrainment which causes both a reduction in g' and an increase in H. All of these alterations bring the outflow closer and closer to the critical condition and it is, therefore, argued that all outflows ultimately reach the critical point (unless diffusion and mixing destroy them prior to that stage). It is suggested that Reddies (i.e., isolated lenses containing Red Sea water) are formed by the above processes. Namely, we propose that the "Reddy maker" is a combination of three processes, the natural reduction in the bottom slope which the outflow senses as it approaches the bottom of the ocean, the entrainment-induced increase in the outflow's thickness, and the entrainment-induced decrease in the outflow's density. An animation of the eddy generation process can be viewed at http://doronnof.net/features.html#video (click on "Reddy maker video").

A Methodology for Project Selection Using Economic Analysis and the Analytic Hierarchy Process

DTIC Science & Technology

1992-09-01

5 L 0.278 G 0.065 Figure 7. Lower Levels for Cost Criterion 58 0 I I i I I 0 BEN’ S #1 0 iL 0. 353 WEIGHT 100% USE DEFF&SAFE MOVE NEW 0 L .333 3 L...and George Foster. Cost Accounting : a Managerial Emphasis (Seventh Edition). Englewood Cliffs NJ: Prentice Hall, 1991. 22. Kankey, Roland D...have cost in terms of manpower and/or dollars if it had been accomplished under contract or if it had been done in-house. Man Years S 4. Often it is not

Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

PubMed

Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

2017-05-23

A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

What's the Point of a Raster ? Advantages of 3D Point Cloud Processing over Raster Based Methods for Accurate Geomorphic Analysis of High Resolution Topography.

NASA Astrophysics Data System (ADS)

Lague, D.

2014-12-01

High Resolution Topographic (HRT) datasets are predominantly stored and analyzed as 2D raster grids of elevations (i.e., Digital Elevation Models). Raster grid processing is common in GIS software and benefits from a large library of fast algorithms dedicated to geometrical analysis, drainage network computation and topographic change measurement. Yet, all instruments or methods currently generating HRT datasets (e.g., ALS, TLS, SFM, stereo satellite imagery) output natively 3D unstructured point clouds that are (i) non-regularly sampled, (ii) incomplete (e.g., submerged parts of river channels are rarely measured), and (iii) include 3D elements (e.g., vegetation, vertical features such as river banks or cliffs) that cannot be accurately described in a DEM. Interpolating the raw point cloud onto a 2D grid generally results in a loss of position accuracy, spatial resolution and in more or less controlled interpolation. Here I demonstrate how studying earth surface topography and processes directly on native 3D point cloud datasets offers several advantages over raster based methods: point cloud methods preserve the accuracy of the original data, can better handle the evaluation of uncertainty associated to topographic change measurements and are more suitable to study vegetation characteristics and steep features of the landscape. In this presentation, I will illustrate and compare Point Cloud based and Raster based workflows with various examples involving ALS, TLS and SFM for the analysis of bank erosion processes in bedrock and alluvial rivers, rockfall statistics (including rockfall volume estimate directly from point clouds) and the interaction of vegetation/hydraulics and sedimentation in salt marshes. These workflows use 2 recently published algorithms for point cloud classification (CANUPO) and point cloud comparison (M3C2) now implemented in the open source software CloudCompare.

On gate stack scalability of double-gate negative-capacitance FET with ferroelectric HfO2 for energy efficient sub-0.2 V operation

NASA Astrophysics Data System (ADS)

Jang, Kyungmin; Saraya, Takuya; Kobayashi, Masaharu; Hiramoto, Toshiro

2018-02-01

We have investigated the gate stack scalability and energy efficiency of double-gate negative-capacitance FET (DGNCFET) with a CMOS-compatible ferroelectric HfO2 (FE:HfO2). Analytic model-based simulation is conducted to investigate the impacts of ferroelectric characteristic of FE:HfO2 and gate stack thickness on the I on/I off ratio of DGNCFET. DGNCFET has wider design window for the gate stack where higher I on/I off ratio can be achieved than DG classical MOSFET. Under a process-induced constraint with sub-10 nm gate length (L g), FE:HfO2-based DGNCFET still has a design point for high I on/I off ratio. With an optimized gate stack thickness for sub-10 nm L g, FE:HfO2-based DGNCFET has 2.5× higher energy efficiency than DG classical MOSFET even at ultralow operation voltage of sub-0.2 V.

Current Mercury Exposure from Artisanal and Small-Scale Gold Mining in Bombana, Southeast Sulawesi, Indonesia-Future Significant Health Risks.

PubMed

Sakakibara, Masayuki; Sera, Koichiro

2017-02-08

The rapid expansion of the artisanal and small-scale gold mining (ASGM) industry in developing countries has marginalized the local communities in poverty, and resulted in occupational exposure to mercury via the gold extraction process. We investigated the mercury exposure of the mining workers lived inside and outside the mining area. Based on the occupations of the contributors, the hair samples were divided into three subgroups: directly exposed, indirectly exposed, and a control. A total of 81 hair samples were analyzed by particle-induced X-ray emission spectrometry. The median mercury concentration was highest in the hair from the directly exposed group (12.82 μg/g hair) (control group median: 4.8 μg/g hair, p < 0.05), and the concentrations in hair from 45 respondents exceeded the Human Biomonitoring I (HBM I) threshold limit. Mercury concentrations were also elevated in the hair from the indirectly exposed group (median 7.64 μg/g hair, p < 0.05), and concentrations in hair from 24 respondents exceeded the HBM I threshold limits. Exposure to mercury during ASGM presents health risks and is harmful for the miners; mercury is also at hazardous levels for people who live in the mining area but who are not engaged in mercury-based gold extraction.

Is VIRTU4L Larger than VIR7UAL? Automatic Processing of Number Quantity and Lexical Representations in Leet Words

ERIC Educational Resources Information Center

García-Orza, Javier; Comesaña, Montserrat; Piñeiro, Ana; Soares, Ana Paula; Perea, Manuel

2016-01-01

Recent research has shown that leet words (i.e., words in which some of the letters are replaced by visually similar digits; e.g., VIRTU4L) can be processed as their base words without much cost. However, it remains unclear whether the digits inserted in leet words are simply processed as letters or whether they are simultaneously processed as…

Examining the Interplay of Processes Across Multiple Time-Scales: Illustration With the Intraindividual Study of Affect, Health, and Interpersonal Behavior (iSAHIB).

PubMed

Ram, Nilam; Conroy, David E; Pincus, Aaron L; Lorek, Amy; Rebar, Amanda; Roche, Michael J; Coccia, Michael; Morack, Jennifer; Feldman, Josh; Gerstorf, Denis

Human development is characterized by the complex interplay of processes that manifest at multiple levels of analysis and time-scales. We introduce the Intraindividual Study of Affect, Health and Interpersonal Behavior (iSAHIB) as a model for how multiple time-scale study designs facilitate more precise articulation of developmental theory. Combining age heterogeneity, longitudinal panel, daily diary, and experience sampling protocols, the study made use of smartphone and web-based technologies to obtain intensive longitudinal data from 150 persons age 18-89 years as they completed three 21-day measurement bursts ( t = 426 bursts, t = 8,557 days) wherein they provided reports on their social interactions ( t = 64,112) as they went about their daily lives. We illustrate how multiple time-scales of data can be used to articulate bioecological models of development and the interplay among more 'distal' processes that manifest at 'slower' time-scales (e.g., age-related differences and burst-to-burst changes in mental health) and more 'proximal' processes that manifest at 'faster' time-scales (e.g., changes in context that progress in accordance with the weekly calendar and family influence processes).

A minority stress--emotion regulation model of sexual compulsivity among highly sexually active gay and bisexual men.

PubMed

Pachankis, John E; Rendina, H Jonathon; Restar, Arjee; Ventuneac, Ana; Grov, Christian; Parsons, Jeffrey T

2015-08-01

Sexual compulsivity represents a significant public health concern among gay and bisexual men, given its co-occurrence with other mental health problems and HIV infection. The purpose of this study was to examine a model of sexual compulsivity based on minority stress theory and emotion regulation models of mental health among gay and bisexual men. Gay and bisexual men in New York City reporting at least nine past-90-day sexual partners (n = 374) completed measures of distal minority stressors (i.e., boyhood gender nonconformity and peer rejection, adulthood perceived discrimination), hypothesized proximal minority stress mediators (i.e., rejection sensitivity, internalized homonegativity), hypothesized universal mediators (i.e., emotion dysregulation, depression, and anxiety), and sexual compulsivity. The hypothesized model fit the data well (RMSEA = 0.05, CFI = 0.98, TLI = 0.95, SRMR = 0.03). Distal minority stress processes (e.g., adulthood discrimination) were generally found to confer risk for both proximal minority stressors (e.g., internalized homonegativity) and emotion dysregulation. Proximal minority stressors and emotion dysregulation, in turn, generally predicted sexual compulsivity both directly and indirectly through anxiety and depression. The final model suggests that gay-specific (e.g., internalized homonegativity) and universal (e.g., emotion dysregulation) processes represent potential treatment targets to attenuate the impact of minority stress on gay and bisexual men's sexual health. Tests of interventions that address these targets to treat sexual compulsivity among gay and bisexual men represent a promising future research endeavor. (c) 2015 APA, all rights reserved).

A Minority Stress – Emotion Regulation Model of Sexual Compulsivity among Highly Sexually Active Gay and Bisexual Men

PubMed Central

Pachankis, John E.; Rendina, H. Jonathon; Restar, Arjee; Ventuneac, Ana; Grov, Christian; Parsons, Jeffrey T.

2014-01-01

Objective Sexual compulsivity represents a significant public health concern among gay and bisexual men given its co-occurrence with other mental health problems and HIV infection. The purpose of this study was to examine a model of sexual compulsivity based on minority stress theory and emotion regulation models of mental health among gay and bisexual men. Method Gay and bisexual men in New York City reporting at least nine past-90-day sexual partners (n = 374) completed measures of distal minority stressors (i.e., boyhood gender nonconformity and peer rejection, adulthood perceived discrimination), hypothesized proximal minority stress mediators (i.e., rejection sensitivity, internalized homonegativity), hypothesized universal mediators (i.e., emotion dysregulation, depression and anxiety), and sexual compulsivity. Results The hypothesized model fit the data well (RMSEA = 0.05, CFI = 0.98, TLI = 0.95, SRMR = 0.03). Distal minority stress processes (e.g., peer rejection) were generally found to confer risk for both proximal minority stressors (e.g., internalized homonegativity) and emotion dysregulation. Proximal minority stressors and emotion dysregulation, in turn, generally predicted sexual compulsivity both directly and indirectly through anxiety and depression. Conclusions The final model suggests that gay-specific (e.g., internalized homonegativity) and universal (e.g., emotion dysregulation) processes represent potential treatment targets to attenuate the impact of minority stress on gay and bisexual men's sexual health. Tests of interventions that address these targets to treat sexual compulsivity among gay and bisexual men represent a promising future research endeavor. PMID:25528179

The Helium Golden Ratios: triplet-singlet and G for He-like X-ray Emission

NASA Astrophysics Data System (ADS)

Stancil, Phillip C.; Miller, Ansley; Terry, Jason; Cumbee, Renata; Mullen, Patrick Dean; Schultz, David R.

2017-06-01

The existence of a mere two electrons manifests a multitude of interesting and diverse phenomena in the atomic structure of He-like ions including separate spin manifolds (singlets and triplets), unusual ordering of angular momentum states, and intercombination (i) and forbidden (f) radiative transitions. This rich behavior extends also to the dynamics involving He-like ions and various perturbers. While electrons have a propensity for exciting resonant (r) dipole-allowed transitions, heavy particles are far less selective. In this presentation, I'll illustrate how these properties play out in ion-neutral charge exchange (CX) processes which result in He-like product ions. The focus will be on the spin-multiplicity of the atomic ions and the quasi-molecular states involved in the interactions, how these affect the CX cross sections, and their impact on the resulting X-ray spectrum. In particular, the G-ratio, the ratio of Kα line intensities (f+i)/r, is very sensitive to the spin-dependent cross sections which in turn is dependent on the neutral target, whether open-shell like H (Nolte et al. 2012, 2017; Wu et al. 2012) or closed-shell like He or H2 (Cumbee et al. 2017; Mullen et al. 2016, 2017). Preliminary evidence also suggests that multielectron capture processes may influence the G-ratio when multielectron targets are involved.Cumbee R. S. et al. 2017, ApJ, submittedMullen, P. D. et al. 2016, ApJS, 224, 31Mullen, P. D. et al. 2017, ApJ, submittedNolte, J. et al. 2012, JPB, 45, 245202; 2017, to be submittedWu, Y. et al. 2012, JPB, 84, 022711This work was partially supported by NASA grants NNX09AC46G and NNG09WF24I.

Clam Shell Dredging in Lakes Pontchartrain and Maurepas, Louisiana. Volume 1. Final Environmental Impact Statement and Appendixes.

DTIC Science & Technology

1987-11-01

SHELL DREDGING IN. LAKES PONTCHARTRAIN AND’ MAUREPAS, LOUISIANAD lc . - . . - ~ K’. .. E.LEC .-- *- pas .- K - E ---.Ms---- g * ~ ,~VAUREPAS ~ ~ K...cause significant impacts due to the gradual decline and ultimate cessation of the shell dredging industry (see Sections 3.6 and 3.7). g . Long-term...process and the lakes i.1 the area expanded rapidly to their general present configurit ion. .IS - O .,* g Lake Pontchartrain is the focal point of the

A Model Process for Institutional Goals-Setting. A Module of the Needs Assessment Project.

ERIC Educational Resources Information Center

King, Maxwell C.; And Others

A goals-setting model for the community/junior college that would interface with the community needs assessment model was developed, using as the survey instrument the Institutional Goals Inventory (I.G.I.) developed by the Educational Testing Service. The nine steps in the model are: Establish Committee on College Goals and Identify Goals Project…

Multimodal Interactions in Sensory-Motor Processing

DTIC Science & Technology

1992-06-30

Luce & Green,1972; Wandell and Luce, 1978; Blake, Martens, Garrett & Westendorf , 1980; Fidell, 1970; Fournier & Eriksen, 1990; Rose, Blake and Holper...1988; i Westendorf and Blake, 1988) or at the level of response selection or execution (eg.,Diederich & Colonius, 1987; Eriksen and Schultz, 1977...Mathematical Statistics. Holden-Day, Inc. Oakland, CA. I Blake, R., Martens, W., Garrett, G., & Westendorf , D. (1980). Estimating probability summation for

Programmable Image Processing Element.

DTIC Science & Technology

1980-11-01

appicaIOn IS g-ivenl Ill A parallel ss OIL irmnat . Ilece. thle block diagramm of- [iguire 3 is modifwid to chanlge the 1iput data frmM pl)JIll oiit to...is slownl In I iguie -42. -1h1 breaid- board oi~s of, nine iniput latche\\,. niruc pifdle-ini seri:il-oiit shl’t reitcs I fast 5 1-’ 1 2--ilt

Techno-economic evaluation of 2nd generation bioethanol production from sugar cane bagasse and leaves integrated with the sugar-based ethanol process

PubMed Central

2012-01-01

Background Bioethanol produced from the lignocellulosic fractions of sugar cane (bagasse and leaves), i.e. second generation (2G) bioethanol, has a promising market potential as an automotive fuel; however, the process is still under investigation on pilot/demonstration scale. From a process perspective, improvements in plant design can lower the production cost, providing better profitability and competitiveness if the conversion of the whole sugar cane is considered. Simulations have been performed with AspenPlus to investigate how process integration can affect the minimum ethanol selling price of this 2G process (MESP-2G), as well as improve the plant energy efficiency. This is achieved by integrating the well-established sucrose-to-bioethanol process with the enzymatic process for lignocellulosic materials. Bagasse and leaves were steam pretreated using H3PO4 as catalyst and separately hydrolysed and fermented. Results The addition of a steam dryer, doubling of the enzyme dosage in enzymatic hydrolysis, including leaves as raw material in the 2G process, heat integration and the use of more energy-efficient equipment led to a 37 % reduction in MESP-2G compared to the Base case. Modelling showed that the MESP for 2G ethanol was 0.97 US$/L, while in the future it could be reduced to 0.78 US$/L. In this case the overall production cost of 1G + 2G ethanol would be about 0.40 US$/L with an output of 102 L/ton dry sugar cane including 50 % leaves. Sensitivity analysis of the future scenario showed that a 50 % decrease in the cost of enzymes, electricity or leaves would lower the MESP-2G by about 20%, 10% and 4.5%, respectively. Conclusions According to the simulations, the production of 2G bioethanol from sugar cane bagasse and leaves in Brazil is already competitive (without subsidies) with 1G starch-based bioethanol production in Europe. Moreover 2G bioethanol could be produced at a lower cost if subsidies were used to compensate for the opportunity cost from the sale of excess electricity and if the cost of enzymes continues to fall. PMID:22502801

Identification of AR(I)MA processes for modelling temporal correlations of GPS observations

NASA Astrophysics Data System (ADS)

Luo, X.; Mayer, M.; Heck, B.

2009-04-01

In many geodetic applications observations of the Global Positioning System (GPS) are routinely processed by means of the least-squares method. However, this algorithm delivers reliable estimates of unknown parameters und realistic accuracy measures only if both the functional and stochastic models are appropriately defined within GPS data processing. One deficiency of the stochastic model used in many GPS software products consists in neglecting temporal correlations of GPS observations. In practice the knowledge of the temporal stochastic behaviour of GPS observations can be improved by analysing time series of residuals resulting from the least-squares evaluation. This paper presents an approach based on the theory of autoregressive (integrated) moving average (AR(I)MA) processes to model temporal correlations of GPS observations using time series of observation residuals. A practicable integration of AR(I)MA models in GPS data processing requires the determination of the order parameters of AR(I)MA processes at first. In case of GPS, the identification of AR(I)MA processes could be affected by various factors impacting GPS positioning results, e.g. baseline length, multipath effects, observation weighting, or weather variations. The influences of these factors on AR(I)MA identification are empirically analysed based on a large amount of representative residual time series resulting from differential GPS post-processing using 1-Hz observation data collected within the permanent SAPOS® (Satellite Positioning Service of the German State Survey) network. Both short and long time series are modelled by means of AR(I)MA processes. The final order parameters are determined based on the whole residual database; the corresponding empirical distribution functions illustrate that multipath and weather variations seem to affect the identification of AR(I)MA processes much more significantly than baseline length and observation weighting. Additionally, the modelling results of temporal correlations using high-order AR(I)MA processes are compared with those by means of first order autoregressive (AR(1)) processes and empirically estimated autocorrelation functions.

schwimmbad: A uniform interface to parallel processing pools in Python

NASA Astrophysics Data System (ADS)

Price-Whelan, Adrian M.; Foreman-Mackey, Daniel

2017-09-01

Many scientific and computing problems require doing some calculation on all elements of some data set. If the calculations can be executed in parallel (i.e. without any communication between calculations), these problems are said to be perfectly parallel. On computers with multiple processing cores, these tasks can be distributed and executed in parallel to greatly improve performance. A common paradigm for handling these distributed computing problems is to use a processing "pool": the "tasks" (the data) are passed in bulk to the pool, and the pool handles distributing the tasks to a number of worker processes when available. schwimmbad provides a uniform interface to parallel processing pools and enables switching easily between local development (e.g., serial processing or with multiprocessing) and deployment on a cluster or supercomputer (via, e.g., MPI or JobLib).

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

PubMed

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

The Origin of Scales and Scaling Laws in Star Formation

NASA Astrophysics Data System (ADS)

Guszejnov, David; Hopkins, Philip; Grudich, Michael

2018-01-01

Star formation is one of the key processes of cosmic evolution as it influences phenomena from the formation of galaxies to the formation of planets, and the development of life. Unfortunately, there is no comprehensive theory of star formation, despite intense effort on both the theoretical and observational sides, due to the large amount of complicated, non-linear physics involved (e.g. MHD, gravity, radiation). A possible approach is to formulate simple, easily testable models that allow us to draw a clear connection between phenomena and physical processes.In the first part of the talk I will focus on the origin of the IMF peak, the characteristic scale of stars. There is debate in the literature about whether the initial conditions of isothermal turbulence could set the IMF peak. Using detailed numerical simulations, I will demonstrate that not to be the case, the initial conditions are "forgotten" through the fragmentation cascade. Additional physics (e.g. feedback) is required to set the IMF peak.In the second part I will use simulated galaxies from the Feedback in Realistic Environments (FIRE) project to show that most star formation theories are unable to reproduce the near universal IMF peak of the Milky Way.Finally, I will present analytic arguments (supported by simulations) that a large number of observables (e.g. IMF slope) are the consequences of scale-free structure formation and are (to first order) unsuitable for differentiating between star formation theories.

Resonant Enhanced Modulators

DTIC Science & Technology

2004-05-01

Lepore, M. H. Kwakernaak, H. Mohseni, G. A. Pajer, G. Griffel , D. Bechtle, A. F. Ulmer, Z. A. Shellenbarger, H. An, I. Adesida, S. Rommel, J-W...Advanced nanofabrication and advanced process development Giora Griffel – Ring resonator concept Daniel W. Bechtle – RF electrode design University of...conducted in glass microspheres by Giora Griffel (then at Polytechnic University) and other workers. Extremely high quality factors (Q’s) could be

The TANAMI Program

DTIC Science & Technology

2010-06-01

Sternwartstrasse 7, 96049 Bamberg, Germany 3 CRESST/ NASA Goddard Space Flight Center, Greenbelt, ~’iID 20771, USA 4 USRA, 10211 Wincopin Circle, Suite...program and present early results on the 75 sources currently being monitored. 1. Introduction Very Long Baseline Interferometry (VLBI) observations...wavelength studies (e.g., Abdo et al. 2010a, Chang et al. 2010) be - sides probing emission processes along AGN jets (e.g., Muller et al. 2010, Hungwe

Spatial and temporal variations in core- and polar- isoprenoid tetraether lipids along a salinity gradient from the lower Pearl River to its estuary

NASA Astrophysics Data System (ADS)

Jia, C.; Gao, S.; Wang, J. X.; Zhang, C. L.

2014-12-01

Isoprenoid glycerol dialkyl glycerol tetraethers (iGDGTs) are major archaeal lipids that widely occur in nature and have been used to study paleo-climate and paleo-environments. Estuaries are a dynamic ecosystem that links or divides terrestrial and marine processes. However, factors controlling changes in iGDGTs in estuaries are poorly known. In this study we performed monthly sampling of sediments between July 2012 and May 2013 at four sites from the lower Pearl River to the estuary. Total lipids were extracted to obtain core- and polar-GDGTs, which were identified and quantified using liquid chromatography-mass spectrometry (LC-MS). The average concentrations of archaeal lipids were highest at the seawater station (C-iGDGTs: 1804.0 ng/g; P-iGDGTs: 986.9 ng/g) and lowest at the brackish water station (C-iGDGTs: 364.1 ng/g; P-iGDGTs: 324.4 ng/g) with C-iGDGTs being more abundant than P-iGDGTs in most samples. The composition of iGDGTs varied widely from station to station, but was generally dominated by GDGT-0 or crenarchaeol in both C- and P-iGDGTs. At the freshwater station in the lower Pearl River, the relative abundance of C- and P-iGDGTs varied from month to month, whereas such temporal changes were much less at stations in the brackish and marine environments. These results suggest that Archaea living in freshwater might be more sensitive to environmental variation. A significant positive correlation (R2>0.80, p<0.01) was found between the ratio of Cren./(Cren.+GDGT-0) or ring index and salinity in both C- and P-iGDGT fractions, indicating that salinity is the most important factor affecting the composition of iGDGTs in the estuary environment.

Time-Structured and Net Intraindividual Variability: Tools for Examining the Development of Dynamic Characteristics and Processes

PubMed Central

Ram, Nilam; Gerstorf, Denis

2009-01-01

The study of intraindividual variability is the study of fluctuations, oscillations, adaptations, and “noise” in behavioral outcomes that manifest on micro-time scales. This paper provides a descriptive frame for the combined study of intraindividual variability and aging/development. At the conceptual level, we highlight that the study of intraindividual variability provides access to dynamic characteristics – construct-level descriptions of individuals' capacities for change (e.g., lability), and dynamic processes – the systematic changes individuals' exhibit in response to endogenous and exogenous influences (e.g., regulation). At the methodological level, we review how quantifications of net intraindividual variability (e.g., iSD) and models of time-structured intraindividual variability (e.g., time-series) are being used to measure and describe dynamic characteristics and processes. At the research design level, we point to the benefits of measurement burst study designs, wherein data are obtained across multiple time scales, for the study of development. PMID:20025395

The neural correlates of cognitive reappraisal during emotional autobiographical memory recall.

PubMed

Holland, Alisha C; Kensinger, Elizabeth A

2013-01-01

We used fMRI to investigate the neural processes engaged as individuals down- and up-regulated the emotions associated with negative autobiographical memories (AMs) using cognitive reappraisal strategies. Our analyses examined neural activity during three separate phases, as participants (a) viewed a reappraisal instruction (i.e., Decrease, Increase, Maintain), (b) searched for an AM referenced by a self-generated cue, and (c) elaborated upon the details of the AM being held in mind. Decreasing emotional intensity primarily engaged activity in regions previously implicated in cognitive control (e.g., dorsal and ventral lateral pFC), emotion generation and processing (e.g., amygdala, insula), and visual imagery (e.g., precuneus) as participants searched for and retrieved events. In contrast, increasing emotional intensity engaged similar regions during the instruction phase (i.e., before a memory cue was presented) and again as individuals later elaborated upon the details of the events they had recalled. These findings confirm that reappraisal can modulate neural activity during the recall of personally relevant events, although the time course of this modulation appears to depend on whether individuals are attempting to down- or up-regulate their emotions.

Temporal Information Processing as a Basis for Auditory Comprehension: Clinical Evidence from Aphasic Patients

ERIC Educational Resources Information Center

Oron, Anna; Szymaszek, Aneta; Szelag, Elzbieta

2015-01-01

Background: Temporal information processing (TIP) underlies many aspects of cognitive functions like language, motor control, learning, memory, attention, etc. Millisecond timing may be assessed by sequencing abilities, e.g. the perception of event order. It may be measured with auditory temporal-order-threshold (TOT), i.e. a minimum time gap…

The Neuropsychology of Imagery Processing

DTIC Science & Technology

1991-01-25

B. (1985). Agnosia . In K. M. Heilman and E. Valenstein (Eds.), Clinical Neuropsychology. New York: Oxford University Press. Biederman, I. (1987...Campion, J. (1987). Apperceptive agnosia : the specification and description of constructs. In Humphreys, G. W., and Riddoch, M. J. (1987a) (Eds...R. (1986). Disorders of complex visual processing: agnosias , achromatopsia, Balint’s syndrome and related difficulties of orientation and

Patterns of Time Processing Ability in Children with and without Developmental Disabilities

ERIC Educational Resources Information Center

Janeslatt, Gunnel; Granlund, Mats; Kottorp, Anders; Almqvist, Lena

2010-01-01

Background: Children with developmental disabilities, e.g. intellectual disability or autism, are reported to have problems in time perception, time orientation or time management, i.e. in time-processing ability (TPA). The aim was to investigate whether the problems described are diagnosis specific or reflect differences in age or in level of…

Fast Nitrogen Atoms from Dissociative Excitation of N2 by Electron Impact

NASA Technical Reports Server (NTRS)

Ajello, Joseph M.; Ciocca, Marco

1996-01-01

The Doppler profiles of one of the fine structure lines of the N I (1200 A) g (sup 4)S(sup 0)-(sup 4)P multiplet and of the N II (1085 A) g (sup 3)p(sup O)-(sup 3)D multiplet have been measured. Excitation of the multiplets is produced by electron impact dissociative excitation of N2. The experimental line profiles are evaluated by fast Fourier transform (FFT) techniques and analysis of the profiles yields the kinetic energy distribution of fragments. The full width at half maximum (FWHM) of N I (1200 A) increases from 27+/-6 mA at 30 eV to 37+/-4 mA at 100 eV as the emission cross section of the dissociative ionization excitation process becomes more important relative to the dissociative excitation process. The FWHM of the N II (1085 A) line is 36+/-4 mA at 100 eV. For each multiplet the kinetic energy distribution function of each of the two fragment N atoms (ions) is much broader than thermal with a mean energy above 1.0 eV. The dissociation process with the largest cross section is predissociation and predominantly produces N atoms with kinetic energy distributions having mean energies above 0.5 eV. Dissociative processes can lead to a substantial escape flux of N I atoms from the satellites, Titan and Triton of the outer planets.

Adsorption of C.I. Reactive Red 228 and Congo Red dye from aqueous solution by amino-functionalized Fe3O4 particles: kinetics, equilibrium, and thermodynamics.

PubMed

Yan, Ting-guo; Wang, Li-Juan

2014-01-01

A magnetic adsorbent was synthesized by γ-aminopropyltriethoxysilane (APTES) modification of Fe(3)O(4) particles using a two-step process. Scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), X-ray photoelectron spectroscopy (XPS), and vibration sample magnetometry were used to characterize the obtained magnetic adsorbent. EDS and XPS showed that APTES polymer was successfully introduced onto the as-prepared Fe(3)O(4)/APTES particle surfaces. The saturation magnetization of the magnetic adsorbent was around 65 emu g(-1), which indicated that the dye can be removed fast and efficiently from aqueous solution with an external magnetic field. The maximum adsorption capacities of Fe(3)O(4)/APTES for C.I. Reactive Red 228 (RR 228) and Congo Red (CR) were 51.4 and 118.8 mg g(-1), respectively. The adsorption of C.I. Reactive Red 228 (RR 228) and Congo Red (CR) on Fe(3)O(4)/APTES particles corresponded well to the Langmuir model and the Freundlich model, respectively. The adsorption processes for RR 228 and CR followed the pseudo-second-order model. The Boyd's film-diffusion model showed that film diffusion also played a major role in the studied adsorption processes for both dyes. Thermodynamic study indicated that both of the adsorption processes of the two dyes are spontaneous exothermic.

Nonlinear Dynamics, Chaotic and Complex Systems

NASA Astrophysics Data System (ADS)

Infeld, E.; Zelazny, R.; Galkowski, A.

2011-04-01

Part I. Dynamic Systems Bifurcation Theory and Chaos: 1. Chaos in random dynamical systems V. M. Gunldach; 2. Controlling chaos using embedded unstable periodic orbits: the problem of optimal periodic orbits B. R. Hunt and E. Ott; 3. Chaotic tracer dynamics in open hydrodynamical flows G. Karolyi, A. Pentek, T. Tel and Z. Toroczkai; 4. Homoclinic chaos L. P. Shilnikov; Part II. Spatially Extended Systems: 5. Hydrodynamics of relativistic probability flows I. Bialynicki-Birula; 6. Waves in ionic reaction-diffusion-migration systems P. Hasal, V. Nevoral, I. Schreiber, H. Sevcikova, D. Snita, and M. Marek; 7. Anomalous scaling in turbulence: a field theoretical approach V. Lvov and I. Procaccia; 8. Abelian sandpile cellular automata M. Markosova; 9. Transport in an incompletely chaotic magnetic field F. Spineanu; Part III. Dynamical Chaos Quantum Physics and Foundations Of Statistical Mechanics: 10. Non-equilibrium statistical mechanics and ergodic theory L. A. Bunimovich; 11. Pseudochaos in statistical physics B. Chirikov; 12. Foundations of non-equilibrium statistical mechanics J. P. Dougherty; 13. Thermomechanical particle simulations W. G. Hoover, H. A. Posch, C. H. Dellago, O. Kum, C. G. Hoover, A. J. De Groot and B. L. Holian; 14. Quantum dynamics on a Markov background and irreversibility B. Pavlov; 15. Time chaos and the laws of nature I. Prigogine and D. J. Driebe; 16. Evolutionary Q and cognitive systems: dynamic entropies and predictability of evolutionary processes W. Ebeling; 17. Spatiotemporal chaos information processing in neural networks H. Szu; 18. Phase transitions and learning in neural networks C. Van den Broeck; 19. Synthesis of chaos A. Vanecek and S. Celikovsky; 20. Computational complexity of continuous problems H. Wozniakowski; Part IV. Complex Systems As An Interface Between Natural Sciences and Environmental Social and Economic Sciences: 21. Stochastic differential geometry in finance studies V. G. Makhankov; Part V. Conference Banquet Speech: Where will the future go? M. J. Feigenbaum.

Neural Markers in Pediatric Bipolar Disorder and Familial Risk for Bipolar Disorder.

PubMed

Wiggins, Jillian Lee; Brotman, Melissa A; Adleman, Nancy E; Kim, Pilyoung; Wambach, Caroline G; Reynolds, Richard C; Chen, Gang; Towbin, Kenneth; Pine, Daniel S; Leibenluft, Ellen

2017-01-01

Bipolar disorder (BD) is highly heritable. Neuroimaging studies comparing unaffected youth at high familial risk for BD (i.e., those with a first-degree relative with the disorder; termed "high-risk" [HR]) to "low-risk" (LR) youth (i.e., those without a first-degree relative with BD) and to patients with BD may help identify potential brain-based markers associated with risk (i.e., regions where HR+BD≠LR), resilience (HR≠BD+LR), or illness (BD≠HR+LR). During functional magnetic resonance imaging (fMRI), 99 youths (i.e., adolescents and young adults) aged 9.8 to 24.8 years (36 BD, 22 HR, 41 LR) performed a task probing face emotion labeling, previously shown to be impaired behaviorally in youth with BD and HR youth. We found three patterns of results. Candidate risk endophenotypes (i.e., where BD and HR shared deficits) included dysfunction in higher-order face processing regions (e.g., middle temporal gyrus, dorsolateral prefrontal cortex). Candidate resilience markers and disorder sequelae (where HR and BD, respectively, show unique alterations relative to the other two groups) included different patterns of neural responses across other regions mediating face processing (e.g., fusiform), executive function (e.g., inferior frontal gyrus), and social cognition (e.g., default network, superior temporal sulcus, temporo-parietal junction). If replicated in longitudinal studies and with additional populations, neural patterns suggesting risk endophenotypes could be used to identify individuals at risk for BD who may benefit from prevention measures. Moreover, information about risk and resilience markers could be used to develop novel treatments that recruit neural markers of resilience and attenuate neural patterns associated with risk. Clinical trial registration information-Studies of Brain Function and Course of Illness in Pediatric Bipolar Disorder and Child and Adolescent Bipolar Disorder Brain Imaging and Treatment Study; http://clinicaltrials.gov/; NCT00025935 and NCT00006177. Published by Elsevier Inc.

Insights into HLA-G Genetics Provided by Worldwide Haplotype Diversity

PubMed Central

Castelli, Erick C.; Ramalho, Jaqueline; Porto, Iane O. P.; Lima, Thálitta H. A.; Felício, Leandro P.; Sabbagh, Audrey; Donadi, Eduardo A.; Mendes-Junior, Celso T.

2014-01-01

Human leukocyte antigen G (HLA-G) belongs to the family of non-classical HLA class I genes, located within the major histocompatibility complex (MHC). HLA-G has been the target of most recent research regarding the function of class I non-classical genes. The main features that distinguish HLA-G from classical class I genes are (a) limited protein variability, (b) alternative splicing generating several membrane bound and soluble isoforms, (c) short cytoplasmic tail, (d) modulation of immune response (immune tolerance), and (e) restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments [promoter, coding, and 3′ untranslated region (UTR)]. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding, and 3′UTRs are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures. PMID:25339953

Generalization bounds of ERM-based learning processes for continuous-time Markov chains.

PubMed

Zhang, Chao; Tao, Dacheng

2012-12-01

Many existing results on statistical learning theory are based on the assumption that samples are independently and identically distributed (i.i.d.). However, the assumption of i.i.d. samples is not suitable for practical application to problems in which samples are time dependent. In this paper, we are mainly concerned with the empirical risk minimization (ERM) based learning process for time-dependent samples drawn from a continuous-time Markov chain. This learning process covers many kinds of practical applications, e.g., the prediction for a time series and the estimation of channel state information. Thus, it is significant to study its theoretical properties including the generalization bound, the asymptotic convergence, and the rate of convergence. It is noteworthy that, since samples are time dependent in this learning process, the concerns of this paper cannot (at least straightforwardly) be addressed by existing methods developed under the sample i.i.d. assumption. We first develop a deviation inequality for a sequence of time-dependent samples drawn from a continuous-time Markov chain and present a symmetrization inequality for such a sequence. By using the resultant deviation inequality and symmetrization inequality, we then obtain the generalization bounds of the ERM-based learning process for time-dependent samples drawn from a continuous-time Markov chain. Finally, based on the resultant generalization bounds, we analyze the asymptotic convergence and the rate of convergence of the learning process.

40 CFR 270.305 - What tank information must I keep at my facility?

Code of Federal Regulations, 2011 CFR

2011-07-01

..., bypass systems, and pressure controls (e.g., vents). (d) A diagram of piping, instrumentation, and process flow for each tank system. (e) A description of materials and equipment used to provide external...

40 CFR 270.305 - What tank information must I keep at my facility?

Code of Federal Regulations, 2012 CFR

2012-07-01

..., bypass systems, and pressure controls (e.g., vents). (d) A diagram of piping, instrumentation, and process flow for each tank system. (e) A description of materials and equipment used to provide external...

40 CFR 270.305 - What tank information must I keep at my facility?

Code of Federal Regulations, 2013 CFR

2013-07-01

..., bypass systems, and pressure controls (e.g., vents). (d) A diagram of piping, instrumentation, and process flow for each tank system. (e) A description of materials and equipment used to provide external...

40 CFR 270.305 - What tank information must I keep at my facility?

Code of Federal Regulations, 2014 CFR

2014-07-01

..., bypass systems, and pressure controls (e.g., vents). (d) A diagram of piping, instrumentation, and process flow for each tank system. (e) A description of materials and equipment used to provide external...

Analysis and assessment on heavy metal sources in the coastal soils developed from alluvial deposits using multivariate statistical methods.

PubMed

Li, Jinling; He, Ming; Han, Wei; Gu, Yifan

2009-05-30

An investigation on heavy metal sources, i.e., Cu, Zn, Ni, Pb, Cr, and Cd in the coastal soils of Shanghai, China, was conducted using multivariate statistical methods (principal component analysis, clustering analysis, and correlation analysis). All the results of the multivariate analysis showed that: (i) Cu, Ni, Pb, and Cd had anthropogenic sources (e.g., overuse of chemical fertilizers and pesticides, industrial and municipal discharges, animal wastes, sewage irrigation, etc.); (ii) Zn and Cr were associated with parent materials and therefore had natural sources (e.g., the weathering process of parent materials and subsequent pedo-genesis due to the alluvial deposits). The effect of heavy metals in the soils was greatly affected by soil formation, atmospheric deposition, and human activities. These findings provided essential information on the possible sources of heavy metals, which would contribute to the monitoring and assessment process of agricultural soils in worldwide regions.

SkyMapper Filter Set: Design and Fabrication of Large-Scale Optical Filters

NASA Astrophysics Data System (ADS)

Bessell, Michael; Bloxham, Gabe; Schmidt, Brian; Keller, Stefan; Tisserand, Patrick; Francis, Paul

2011-07-01

The SkyMapper Southern Sky Survey will be conducted from Siding Spring Observatory with u, v, g, r, i, and z filters that comprise glued glass combination filters with dimensions of 309 × 309 × 15 mm. In this article we discuss the rationale for our bandpasses and physical characteristics of the filter set. The u, v, g, and z filters are entirely glass filters, which provide highly uniform bandpasses across the complete filter aperture. The i filter uses glass with a short-wave pass coating, and the r filter is a complete dielectric filter. We describe the process by which the filters were constructed, including the processes used to obtain uniform dielectric coatings and optimized narrowband antireflection coatings, as well as the technique of gluing the large glass pieces together after coating using UV transparent epoxy cement. The measured passbands, including extinction and CCD QE, are presented.

Toxicity reduction of photo processing wastewaters

USGS Publications Warehouse

Wang, W.

1992-01-01

The photo processing industry can be characterized by treatment processes and subsequent silver recovery. The effluents generated all contain various amounts of silver. The objectives of this study were to determine toxicity of photo processing effluents and to explore their toxicity mitigation. Six samples, from small shops to a major photo processing center, were studied. Two samples (I and VI) were found to be extremely toxic, causing 100 and 99% inhibition of duckweed frond reproduction, respectively, and were used for subsequent toxicity reduction experiments. Lime and sodium sulfide were effective for the toxicity reduction of Sample VI; both reduced its toxicity to negligible. Sample I was far more toxic and was first diluted to 2.2% and then treated with 0.5 g lime/100 mL, reducing toxicity from 100% to 12% inhibition.

Special Issue ;Sediment cascades in cold climate geosystems;

NASA Astrophysics Data System (ADS)

Morche, David; Krautblatter, Michael; Beylich, Achim A.

2017-06-01

This Editorial introduces the Special Issue on sediment cascades in cold climate geosystems that evolved from the eighth I.A.G./A.I.G. SEDIBUD (Sediment Budgets in Cold Environments; http://www.geomorph.org/sedibud-working-group/) workshop. The workshop was held from 1st to 4th September 2014 at the Environmental Research Station ;Schneefernerhaus; (http://www.schneefernerhaus.de/en/home.html) located at Mt. Zugspitze, the highest peak of Germany, (2962 m asl). Paper and poster presentations focused on observations, measurements and modeling of geomorphological processes in sediment cascades in cold climate geosystems. This resulting Special Issue brings together ten selected contributions from arctic and alpine environments.

Automation of the Marine Corps Planning Process

DTIC Science & Technology

2014-06-01

I & IV P ro b le m Fr am in g C h ap te r II  JT C W  C P O F  IO Sv 1 C O A D e ve lo p m e n t C O A W ar -G am e C O A C o m p...S  JA D IC S  P SS -S O F  St ri ke Li n k  C ID N E  IO Sv 2  IO Sv 3  M ar in e Li n k Command & Control C h ap te r II I

Symbolic and non symbolic numerical representation in adults with and without developmental dyscalculia

PubMed Central

2012-01-01

Background The question whether Developmental Dyscalculia (DD; a deficit in the ability to process numerical information) is the result of deficiencies in the non symbolic numerical representation system (e.g., a group of dots) or in the symbolic numerical representation system (e.g., Arabic numerals) has been debated in scientific literature. It is accepted that the non symbolic system is divided into two different ranges, the subitizing range (i.e., quantities from 1-4) which is processed automatically and quickly, and the counting range (i.e., quantities larger than 4) which is an attention demanding procedure and is therefore processed serially and slowly. However, so far no study has tested the automaticity of symbolic and non symbolic representation in DD participants separately for the subitizing and the counting ranges. Methods DD and control participants undergo a novel version of the Stroop task, i.e., the Enumeration Stroop. They were presented with a random series of between one and nine written digits, and were asked to name either the relevant written digit (in the symbolic task) or the relevant quantity of digits (in the non symbolic task) while ignoring the irrelevant aspect. Result DD participants, unlike the control group, didn't show any congruency effect in the subitizing range of the non symbolic task. Conclusion These findings suggest that DD may be impaired in the ability to process symbolic numerical information or in the ability to automatically associate the two systems (i.e., the symbolic vs. the non symbolic). Additionally DD have deficiencies in the non symbolic counting range. PMID:23190433

Symbolic and non symbolic numerical representation in adults with and without developmental dyscalculia.

PubMed

Furman, Tamar; Rubinsten, Orly

2012-11-28

The question whether Developmental Dyscalculia (DD; a deficit in the ability to process numerical information) is the result of deficiencies in the non symbolic numerical representation system (e.g., a group of dots) or in the symbolic numerical representation system (e.g., Arabic numerals) has been debated in scientific literature. It is accepted that the non symbolic system is divided into two different ranges, the subitizing range (i.e., quantities from 1-4) which is processed automatically and quickly, and the counting range (i.e., quantities larger than 4) which is an attention demanding procedure and is therefore processed serially and slowly. However, so far no study has tested the automaticity of symbolic and non symbolic representation in DD participants separately for the subitizing and the counting ranges. DD and control participants undergo a novel version of the Stroop task, i.e., the Enumeration Stroop. They were presented with a random series of between one and nine written digits, and were asked to name either the relevant written digit (in the symbolic task) or the relevant quantity of digits (in the non symbolic task) while ignoring the irrelevant aspect. DD participants, unlike the control group, didn't show any congruency effect in the subitizing range of the non symbolic task. These findings suggest that DD may be impaired in the ability to process symbolic numerical information or in the ability to automatically associate the two systems (i.e., the symbolic vs. the non symbolic). Additionally DD have deficiencies in the non symbolic counting range.

Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase.

PubMed

Takahashi, Shuntaro; Brazier, John A; Sugimoto, Naoki

2017-09-05

Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases.

Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase

PubMed Central

Takahashi, Shuntaro; Brazier, John A.; Sugimoto, Naoki

2017-01-01

Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases. PMID:28827350

Examining direct and indirect pathways to health behaviour: the influence of cognitive and affective probability beliefs.

PubMed

Janssen, Eva; van Osch, Liesbeth; de Vries, Hein; Lechner, Lilian

2013-01-01

This study aimed to extricate the influence of rational (e.g., 'I think …') and intuitive (e.g., 'I feel …') probability beliefs in the behavioural decision-making process regarding skin cancer prevention practices. Structural equation modelling was used in two longitudinal surveys (sun protection during winter sports [N = 491]; sun protection during summer [N = 277]) to examine direct and indirect behavioural effects of affective and cognitive likelihood (i.e. unmediated or mediated by intention), controlled for attitude, social influence and self-efficacy. Affective likelihood was directly related to sun protection in both studies, whereas no direct effects were found for cognitive likelihood. After accounting for past sun protective behaviour, affective likelihood was only directly related to sun protection in Study 1. No support was found for the indirect effects of affective and cognitive likelihood through intention. The findings underscore the importance of feelings of (cancer) risk in the decision-making process and should be acknowledged by health behaviour theories and risk communication practices. Suggestions for future research are discussed.

Thioflavin T as an efficient fluorescence sensor for selective recognition of RNA G-quadruplexes

NASA Astrophysics Data System (ADS)

Xu, Shujuan; Li, Qian; Xiang, Junfeng; Yang, Qianfan; Sun, Hongxia; Guan, Aijiao; Wang, Lixia; Liu, Yan; Yu, Lijia; Shi, Yunhua; Chen, Hongbo; Tang, Yalin

2016-04-01

RNA G-quadruplexes (G4s) play important roles in translational regulation, mRNA processing events and gene expression. Therefore, a fluorescent probe that is capable of efficiently recognizing RNA G-quadruplex structures among other RNA forms is highly desirable. In this study, a water-soluble fluorogenic dye (i.e., Thioflavin T (ThT)) was employed to recognize RNA G-quadruplex structures using UV-Vis absorption spectra, fluorescence spectra and emission lifetime experiments. By stacking on the G-tetrad, the ThT probe exhibited highly specific recognition of RNA G-quadruplex structures with striking fluorescence enhancement compared with other RNA forms. The specific binding demonstrates that ThT is an efficient fluorescence sensor that can distinguish G4 and non-G4 RNA structures.

Abstracts of the International Symposium on Gas Kinetics (9th) Held in Talence (France) on 20-25 July 1986.

DTIC Science & Technology

1986-07-25

1 - chloropropane is much higher than unity. We were interested In the alternative radical chain process which is strongly inhibited by the products...AD-A174 474 flj? s 1 /JUL UNCLASSIFIED I/- ~-~J4-S..g1F/C 7/4 PL NW100 2- o use 1315 1112-2. -U- 1 *18 I11I 1 - I11I15 11-61 UNIVERSITY OF BORDEAUX...10.20 A2 Study of the H + H2 (V = 1 ) reaction and its isotopic analogs. V.B. Rozenshtein, Y.M. Gershenzon, A.V. Ivanov, S.D. Ilin, S.I. Kucheryavii

Fusion between perinuclear virions and the outer nuclear membrane requires the fusogenic activity of herpes simplex virus gB.

PubMed

Wright, Catherine C; Wisner, Todd W; Hannah, Brian P; Eisenberg, Roselyn J; Cohen, Gary H; Johnson, David C

2009-11-01

Herpesviruses cross nuclear membranes (NMs) in two steps, as follows: (i) capsids assemble and bud through the inner NM into the perinuclear space, producing enveloped virus particles, and (ii) the envelopes of these virus particles fuse with the outer NM. Two herpes simplex virus (HSV) glycoproteins, gB and gH (the latter, likely complexed as a heterodimer with gL), are necessary for the second step of this process. Mutants lacking both gB and gH accumulate in the perinuclear space or in herniations (membrane vesicles derived from the inner NM). Both gB and gH/gL are also known to act directly in fusing the virion envelope with host cell membranes during HSV entry into cells, i.e., both glycoproteins appear to function directly in different aspects of the membrane fusion process. We hypothesized that HSV gB and gH/gL also act directly in the membrane fusion that occurs during virus egress from the nucleus. Previous studies of the role of gB and gH/gL in nuclear egress involved HSV gB and gH null mutants that could potentially also possess gross defects in the virion envelope. Here, we produced recombinant HSV-expressing mutant forms of gB with single amino acid substitutions in the hydrophobic "fusion loops." These fusion loops are thought to play a direct role in membrane fusion by insertion into cellular membranes. HSV recombinants expressing gB with any one of four fusion loop mutations (W174R, W174Y, Y179K, and A261D) were unable to enter cells. Moreover, two of the mutants, W174Y and Y179K, displayed reduced abilities to mediate HSV cell-to-cell spread, and W174R and A261D exhibited no spread. All mutant viruses exhibited defects in nuclear egress, enveloped virions accumulated in herniations and in the perinuclear space, and fewer enveloped virions were detected on cell surfaces. These results support the hypothesis that gB functions directly to mediate the fusion between perinuclear virus particles and the outer NM.

Simulators for Mariner Training and Licensing. Phase I. The Role of Simulators in the Mariner Training and Licensing Process. Volume I

DTIC Science & Technology

1980-07-01

between giving a rudder :ommand and the perception of the ship beginning to respond) ( van Manen and Hooft, 1.󈨊). The basic research literature...the Navy is one such example (e.g., Birmingham, Kahn, and Taylor, 1954; Kelley, 1962. 3. D. van Manen and 3. P. HIoft, 1970) suggest that time lags of

The Department of Defense Small Business Technology Transfer (STTR) FY 2000

DTIC Science & Technology

2000-01-04

applications (e.g. drug design, pharmacogenomics, and modeling of cells and organs). DARPA - 6 PHASE I: Develop a high performance database...Army, and particularly the Dismounted Soldier, has need for high -energy, lightweight power sources. Polymer electrolyte membrane fuel cells (PEM FCs... efficiently processed fabricated, and tailored to resist high velocity impact and penetration should be developed. PHASE II: Prototype designs from Phase I

An Information Processing Analysis of the Function of Conceptual Understanding in the Learning of Arithmetic Procedures

DTIC Science & Technology

1988-08-01

J. R. (1986). Knowledge compilation: The general learning mechanism. In R. S . Michalski, J. G. Carbonell, & T. M. Mitchell (Eds.), Machine learning...REPORTApproval for public release, 2b. DECLASSIFICATION I DOWNGRADING SCHEDULE d i s tri bution un limi ted 4. PERFORMING ORGANIZATION REPORT NUMBER( S ) S ...MONITORING ORGANIZATION REPORT NUMBER( S ) UPITT/LRDC/ONR/KUL-88-03 6a. NAME OF PERFORMING ORGANIZATION I6b. OFFICE SYMBOL 7a. NAME OF MONITORING

DARPA - Advanced Composite Materials Annual Presentation Held in Gainesville, Florida on 19-20 November 1992

DTIC Science & Technology

1992-11-20

34 and M.D. Sacks 13) "Fabrication of SiC -Based Composites by Reactive Infiltration of Metals (RIM)" K. Wang," G.W. Scheiffele, P.J. Sanchez-Soto, and...Ig I I keactive Infiltration of Metals (RIM) Ii * Densification with little or no shrinkage e SIC -based composites with little or no residual metal...M.D. Sacks I) Indicates Presenter Intermetallic: Matrix Composites 14) *Processing of Compositionally Tailored Silica-Free MoSi 2/ SiC Composites ’ S

Neural responses to maternal criticism in healthy youth

PubMed Central

Siegle, Greg J.; Dahl, Ronald E.; Hooley, Jill M.; Silk, Jennifer S.

2015-01-01

Parental criticism can have positive and negative effects on children’s and adolescents’ behavior; yet, it is unclear how youth react to, understand and process parental criticism. We proposed that youth would engage three sets of neural processes in response to parental criticism including the following: (i) activating emotional reactions, (ii) regulating those reactions and (iii) social cognitive processing (e.g. understanding the parent’s mental state). To examine neural processes associated with both emotional and social processing of parental criticism in personally relevant and ecologically valid social contexts, typically developing youth were scanned while they listened to their mother providing critical, praising and neutral statements. In response to maternal criticism, youth showed increased brain activity in affective networks (e.g. subcortical–limbic regions including lentiform nucleus and posterior insula), but decreased activity in cognitive control networks (e.g. dorsolateral prefrontal cortex and caudal anterior cingulate cortex) and social cognitive networks (e.g. temporoparietal junction and posterior cingulate cortex/precuneus). These results suggest that youth may respond to maternal criticism with increased emotional reactivity but decreased cognitive control and social cognitive processing. A better understanding of children’s responses to parental criticism may provide insights into the ways that parental feedback can be modified to be more helpful to behavior and development in youth. PMID:25338632

Pneumatic Regolith Transfer Systems for In-Situ Resource Utilization

NASA Technical Reports Server (NTRS)

Mueller, Robert P.; Townsend, Ivan I., III; Mantovani, James G.

2010-01-01

One aspect of In-Situ Resource Utilization (lSRU) in a lunar environment is to extract oxygen and other elements from the minerals that make up the lunar regolith. Typical ISRU oxygen production processes include but are not limited to hydrogen reduction, carbothermal and molten oxide electrolysis. All of these processes require the transfer of regolith from a supply hopper into a reactor for chemical reaction processing, and the subsequent extraction of the reacted regolith from the reactor. This paper will discuss recent activities in the NASA ISRU project involved with developing pneumatic conveying methods to achieve lunar regolith simulant transfer under I-g and 1/6-g gravitational environments. Examples will be given of hardware that has been developed and tested by NASA on reduced gravity flights. Lessons learned and details of pneumatic regolith transfer systems will be examined as well as the relative performance in a 1/6th G environment

When visual perception causes feeling: enhanced cross-modal processing in grapheme-color synesthesia.

PubMed

Weiss, Peter H; Zilles, Karl; Fink, Gereon R

2005-12-01

In synesthesia, stimulation of one sensory modality (e.g., hearing) triggers a percept in another, non-stimulated sensory modality (e.g., vision). Likewise, perception of a form (e.g., a letter) may induce a color percept (i.e., grapheme-color synesthesia). To date, the neural mechanisms underlying synesthesia remain to be elucidated. We disclosed by fMRI, while controlling for surface color processing, enhanced activity in the left intraparietal cortex during the experience of grapheme-color synesthesia (n = 9). In contrast, the perception of surface color per se activated the color centers in the fusiform gyrus bilaterally. The data support theoretical accounts that grapheme-color synesthesia may originate from enhanced cross-modal binding of form and color. A mismatch of surface color and grapheme induced synesthetically felt color additionally activated the left dorsolateral prefrontal cortex (DLPFC). This suggests that cognitive control processes become active to resolve the perceptual conflict resulting from synesthesia.

Enhanced coproduction of hydrogen and methane from cornstalks by a three-stage anaerobic fermentation process integrated with alkaline hydrolysis.

PubMed

Cheng, Xi-Yu; Liu, Chun-Zhao

2012-01-01

A three-stage anaerobic fermentation process including H(2) fermentation I, H(2) fermentation II, methane fermentation was developed for the coproduction of hydrogen and methane from cornstalks. Hydrogen production from cornstalks using direct microbial conversion by Clostridium thermocellum 7072 was markedly enhanced in the two-stage thermophilic hydrogen fermentation process integrated with alkaline treatment. The highest total hydrogen yield from cornstalks in the two-stage fermentation process reached 74.4 mL/g-cornstalk. The hydrogen fermentation effluents and alkaline hydrolyzate were further used for methane fermentation by anaerobic granular sludge, and the total methane yield reached 205.8 mL/g-cornstalk. The total energy recovery in the three-stage anaerobic fermentation process integrated with alkaline hydrolysis reached 70.0%. Copyright © 2011 Elsevier Ltd. All rights reserved.

A diffusion-based approach to stochastic individual growth and energy budget, with consequences to life-history optimization and population dynamics.

PubMed

Filin, I

2009-06-01

Using diffusion processes, I model stochastic individual growth, given exogenous hazards and starvation risk. By maximizing survival to final size, optimal life histories (e.g. switching size for habitat/dietary shift) are determined by two ratios: mean growth rate over growth variance (diffusion coefficient) and mortality rate over mean growth rate; all are size dependent. For example, switching size decreases with either ratio, if both are positive. I provide examples and compare with previous work on risk-sensitive foraging and the energy-predation trade-off. I then decompose individual size into reversibly and irreversibly growing components, e.g. reserves and structure. I provide a general expression for optimal structural growth, when reserves grow stochastically. I conclude that increased growth variance of reserves delays structural growth (raises threshold size for its commencement) but may eventually lead to larger structures. The effect depends on whether the structural trait is related to foraging or defence. Implications for population dynamics are discussed.

AUTOMATED MONITORING OF WASTEWATER TREATMENT EFFICIENCY - PHASE I

EPA Science Inventory

78 FR 5194 - Agency Information Collection Activities: Petition To Remove the Conditions on Residence, Form I...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-24

... information technology, e.g., permitting electronic submission of responses. Overview of This Information... 1.17 hours for the biometric processing. (6) An estimate of the total public burden (in hours...

Ebselen inhibits the activity of acetylcholinesterase globular isoform G4 in vitro and attenuates scopolamine-induced amnesia in mice.

PubMed

Martini, Franciele; Pesarico, Ana P; Brüning, César A; Zeni, Gilson; Nogueira, Cristina W

2018-02-05

There is a well-known relationship between the cholinergic system and learning, memory, and other common cognitive processes. The process for researching and developing new drugs has lead researchers to repurpose older ones. This study investigated the effects of ebselen on the activity of acethylcholinesterase (AChE) isoforms in vitro and in an amnesia model induced by scopolamine in Swiss mice. In vitro, ebselen at concentrations equal or higher than 10 μM inhibited the activity of cortical and hippocampal G4/AChE, but not G1/AChE isoform. Treatment of mice with ebselen (50 mg/kg, i.p.) was effective against impairment of spatial recognition memory in both Y-maze and novel object recognition tests induced by scopolamine (1 mg/kg, i.p.). Ebselen (50 mg/kg) inhibited hippocampal AChE activity in mice. The present study demonstrates that ebselen inhibited the G4/AChE isoform in vitro and elicited an anti-amnesic effect in a mouse model induced by scopolamine. These findings reveal ebselen as a potential compound in terms of opening up valid therapeutic avenues for the treatment of memory impairment diseases. © 2018 Wiley Periodicals, Inc.

Applying Semantics in Dataset Summarization for Solar Data Ingest Pipelines

NASA Astrophysics Data System (ADS)

Michaelis, J.; McGuinness, D. L.; Zednik, S.; West, P.; Fox, P. A.

2012-12-01

One goal in studying phenomena of the solar corona (e.g., flares, coronal mass ejections) is to create and refine predictive models of space weather - which have broad implications for terrestrial activity (e.g., communication grid reliability). The High Altitude Observatory (HAO) [1] presently maintains an infrastructure for generating time-series visualizations of the solar corona. Through raw data gathered at the Mauna Loa Solar Observatory (MLSO) in Hawaii, HAO performs follow-up processing and quality control steps to derive visualization sets consumable by scientists. Individual visualizations will acquire several properties during their derivation, including: (i) the source instrument at MLSO used to obtain the raw data, (ii) the time the data was gathered, (iii) processing steps applied by HAO to generate the visualization, and (iv) quality metrics applied over both the raw and processed data. In parallel to MLSO's standard data gathering, time stamped observation logs are maintained by MLSO staff, which covers content of potential relevance to data gathered (such as local weather and instrument conditions). In this setting, while a significant amount of solar data is gathered, only small sections will typically be of interest to consuming parties. Additionally, direct presentation of solar data collections could overwhelm consumers (particularly those with limited background in the data structuring). This work explores how multidimensional analysis based navigation can be used to generate summary views of data collections, based on two operations: (i) grouping visualization entries based on similarity metrics (e.g., data gathered between 23:15-23:30 6-21-2012), or (ii) filtering entries (e.g., data with a quality score of UGLY, on a scale of GOOD, BAD, or UGLY). Here, semantic encodings of solar visualization collections (based on the Resource Description Framework (RDF) Datacube vocabulary [2]) are being utilized, based on the flexibility of the RDF model for supporting the following use cases: (i) Temporal alignment of time-stamped MLSO observations with raw data gathered at MLSO. (ii) Linking of multiple visualization entries to common (and structurally complex) workflow structures - designed to capture the visualization generation process. To provide real-world use cases for the described approach, a semantic summarization system is being developed for data gathered from HAO's Coronal Multi-channel Polarimeter (CoMP) and Chromospheric Helium-I Imaging Photometer (CHIP) pipelines. Web Links: [1] http://mlso.hao.ucar.edu/ [2] http://www.w3.org/TR/vocab-data-cube/

Effect of closed-loop order processing on the time to initial antimicrobial therapy.

PubMed

Panosh, Nicole; Rew, Richardd; Sharpe, Michelle

2012-08-15

The results of a study comparing the average time to initiation of i.v. antimicrobial therapy with closed-versus open-loop order entry and processing are reported. A retrospective cohort study was performed to compare order-to-administration times for initial doses of i.v. antimicrobials before and after a closed-loop order-processing system including computerized prescriber order entry (CPOE) was implemented at a large medical center. A total of 741 i.v. antimicrobial administrations to adult patients during designated five-month preimplementation and postimplementation study periods were assessed. Drug-use reports generated by the pharmacy database were used to identify order-entry times, and medication administration records were reviewed to determine times of i.v. antimicrobial administration. The mean ± S.D. order-to-administration times before and after the implementation of the CPOE system and closed-loop order processing were 3.18 ± 2.60 and 2.00 ± 1.89 hours, respectively, a reduction of 1.18 hours (p < 0.0001). Closed-loop order processing was associated with significant reductions in the average time to initiation of i.v. therapy in all patient care areas evaluated (cardiology, general medicine, and oncology). The study results suggest that CPOE-based closed-loop order processing can play an important role in achieving compliance with current practice guidelines calling for increased efforts to ensure the prompt initiation of i.v. antimicrobials for severe infections (e.g., sepsis, meningitis). Implementation of a closed-loop order-processing system resulted in a significant decrease in order-to-administration times for i.v. antimicrobial therapy.

Dissipation kinetics and effect of processing on imidacloprid and its metabolites in cardamom (Elettaria cardamomum Maton).

PubMed

Pratheeshkumar, N; Chandran, M; Beevi, S Naseema; Mathew, Thomas Biju; George, Thomas; Paul, Ambily; Xavier, George; Ravi, K Prathibha; Kumar, S Visal; Rajith, R

2016-01-01

Dissipation behaviour of the chloronicotinyl insecticide, imidacloprid (Tatamida 17.8 % SL), in fresh and cured cardamom capsules was studied following application at doses 20 and 40 g a.i. ha(-1) in a cardamom plantation of Indian Cardamom Hills (ICH), Idukki, Kerala, India. A single-laboratory ultra performance liquid chromatography mass spectrometry (UPLC-MS/MS) method was developed and validated for the estimation of imidacloprid and its six metabolites (5-hydroxy, olefin, guanidine, urea, 6-chloronicotinic acid and nitrosimine) in fresh and cured cardamom. At the lower dose, the initial deposits of total imidacloprid residues were 1.91 and 7.23 μg g(-1), respectively, in fresh and cured cardamom. At the higher dose, the initial residues were 3.94 and 14.72 μg g(-1), respectively, in fresh and cured capsules. The residues dissipated below the quantitation level of 0.01 μg g(-1) after 21 and 28 days at lower dose and after 28 days for both at higher dose. The half-lives of imidacloprid in fresh and cured cardamom were 4.02 and 3.63 days, respectively, at lower dose and 3.61 days for both at higher dose. The waiting periods of imidacloprid on fresh and cured cardamom at lower and higher doses were 21.40, 27.10, 23.85 and 30.70 days, respectively. The mean processing factor of imidacloprid was 3.96 at 20 g a.i. ha(-1). Amongst metabolites of imidacloprid, urea had maximum residues in fresh and cured cardamom followed by 5-hydroxy and guanidine. Other metabolites such as 6-chloronicotinic acid, olefin and nitrosimine were not detected either in fresh or cured cardamom.

On-demand generation of background-free single photons from a solid-state source

NASA Astrophysics Data System (ADS)

Schweickert, Lucas; Jöns, Klaus D.; Zeuner, Katharina D.; Covre da Silva, Saimon Filipe; Huang, Huiying; Lettner, Thomas; Reindl, Marcus; Zichi, Julien; Trotta, Rinaldo; Rastelli, Armando; Zwiller, Val

2018-02-01

True on-demand high-repetition-rate single-photon sources are highly sought after for quantum information processing applications. However, any coherently driven two-level quantum system suffers from a finite re-excitation probability under pulsed excitation, causing undesirable multi-photon emission. Here, we present a solid-state source of on-demand single photons yielding a raw second-order coherence of g(2 )(0 )=(7.5 ±1.6 )×10-5 without any background subtraction or data processing. To this date, this is the lowest value of g(2 )(0 ) reported for any single-photon source even compared to the previously reported best background subtracted values. We achieve this result on GaAs/AlGaAs quantum dots embedded in a low-Q planar cavity by employing (i) a two-photon excitation process and (ii) a filtering and detection setup featuring two superconducting single-photon detectors with ultralow dark-count rates of (0.0056 ±0.0007 ) s-1 and (0.017 ±0.001 ) s-1, respectively. Re-excitation processes are dramatically suppressed by (i), while (ii) removes false coincidences resulting in a negligibly low noise floor.

Microbial production of polyhydroxybutyrate with tailor-made properties: an integrated modelling approach and experimental validation.

PubMed

Penloglou, Giannis; Chatzidoukas, Christos; Kiparissides, Costas

2012-01-01

The microbial production of polyhydroxybutyrate (PHB) is a complex process in which the final quantity and quality of the PHB depend on a large number of process operating variables. Consequently, the design and optimal dynamic operation of a microbial process for the efficient production of PHB with tailor-made molecular properties is an extremely interesting problem. The present study investigates how key process operating variables (i.e., nutritional and aeration conditions) affect the biomass production rate and the PHB accumulation in the cells and its associated molecular weight distribution. A combined metabolic/polymerization/macroscopic modelling approach, relating the process performance and product quality with the process variables, was developed and validated using an extensive series of experiments and measurements. The model predicts the dynamic evolution of the biomass growth, the polymer accumulation, the consumption of carbon and nitrogen sources and the average molecular weights of the PHB in a bioreactor, under batch and fed-batch operating conditions. The proposed integrated model was used for the model-based optimization of the production of PHB with tailor-made molecular properties in Azohydromonas lata bacteria. The process optimization led to a high intracellular PHB accumulation (up to 95% g of PHB per g of DCW) and the production of different grades (i.e., different molecular weight distributions) of PHB. Copyright © 2011 Elsevier Inc. All rights reserved.

Sources of dioxins in the United Kingdom: the steel industry and other sources.

PubMed

Anderson, David R; Fisher, Raymond

2002-01-01

Several countries have compiled national inventories of dioxin (polychlorinated dibenzo-p-dioxin [PCDD] and polychlorinated dibenzofuran [PCDF]) releases that detail annual mass emission estimates for regulated sources. High temperature processes, such as commercial waste incineration and iron ore sintering used in the production of iron and steel, have been identified as point sources of dioxins. Other important releases of dioxins are from various diffuse sources such as bonfire burning and domestic heating. The PCDD/F inventory for emissions to air in the UK has decreased significantly from 1995 to 1998 because of reduced emissions from waste incinerators which now generally operate at waste gas stack emissions of 1 ng I-TEQ/Nm3 or below. The iron ore sintering process is the only noteworthy source of PCDD/Fs at integrated iron and steelworks operated by Corus (formerly British Steel plc) in the UK. The mean waste gas stack PCDD/F concentration for this process is 1,2 ng I-TEQ/Nm3 based on 94 measurements and it has been estimated that this results in an annual mass release of approximately 38 g I-TEQ per annum. Diffuse sources now form a major contribution to the UK inventory as PCDD/Fs from regulated sources have decreased, for example, the annual celebration of Bonfire Night on 5th November in the UK causes an estimated release of 30 g I-TEQ, similar to that emitted by five sinter plants in the UK.

Expression and characterization of duck enteritis virus gI gene

PubMed Central

2011-01-01

Background At present, alphaherpesviruses gI gene and its encoding protein have been extensively studied. It is likely that gI protein and its homolog play similar roles in virions direct cell-to-cell spread of alphaherpesviruses. But, little is known about the characteristics of DEV gI gene. In this study, we expressed and presented the basic properties of the DEV gI protein. Results The special 1221-bp fragment containing complete open reading frame(ORF) of duck enteritis virus(DEV) gI gene was extracted from plasmid pMD18-T-gI, and then cloned into prokaryotic expression vector pET-32a(+), resulting in pET-32a(+)-gI. After being confirmed by PCR, restriction endonuclease digestion and sequencing, pET-32a(+)-gI was transformed into E.coli BL21(DE3) competent cells for overexpression. DEV gI gene was successfully expressed by the addition of isopropyl-β-D-thiogalactopyranoside(IPTG). SDS-PAGE showed that the recombinant protein His6-tagged gI molecular weight was about 61 kDa. Subsequently, the expressed product was applied to generate specific antibody against gI protein. The specificity of the rabbit immuneserum was confirmed by its ability to react with the recombinant protein His6-tagged gI. In addition, real time-PCR was used to determine the the levels of the mRNA transcripts of gI gene, the results showed that the DEV gI gene was transcribed most abundantly during the late phase of infection. Furthermore, indirect immunofluorescence(IIF) was established to study the gI protein expression and localization in DEV-infected duck embryo fibroblasts (DEFs), the results confirmed that the protein was expressed and located in the cytoplasm of the infected cells, intensively. Conclusions The recombinant prokaryotic expression vector of DEV gI gene was constructed successfully. The gI protein was successfully expressed by E.coli BL21(DE3) and maintained its antigenicity very well. The basic information of the transcription and intracellular localization of gI gene were presented, that would be helpful to assess the possible role of DEV gI gene. The research will provide useful clues for further functional analysis of DEV gI gene. PMID:21595918

Occurrence of Aflatoxins in Selected Processed Foods from Pakistan

PubMed Central

Mushtaq, Muhammad; Sultana, Bushra; Anwar, Farooq; Khan, Muhammad Zargham; Ashrafuzzaman, Muhammad

2012-01-01

A total of 125 (ready to eat) processed food samples (70 intended for infant and 55 for adult intake) belonging to 20 different food categories were analyzed for aflatoxins contamination using Reverse Phase High Performance Liquid Chromatography (RP-HPLC) with fluorescent detection. A solvent mixture of acetonitrile-water was used for the extraction followed by immunoaffinity clean-up to enhance sensitivity of the method. The limit of detection (LOD) (0.01–0.02 ng·g−1) and limit of quantification (LOQ) (0.02 ng·g−1) was established for aflatoxins based on signal to noise ratio of 3:1 and 10:1, respectively. Of the processed food samples tested, 38% were contaminated with four types of aflatoxins, i.e., AFB1 (0.02–1.24 μg·kg−1), AFB2 (0.02–0.37 μg·kg−1), AFG1 (0.25–2.7 μg·kg−1) and AFG2 (0.21–1.3 μg·kg−1). In addition, the results showed that 21% of the processed foods intended for infants contained AFB1 levels higher than the European Union permissible limits (0.1 μg·kg−1), while all of those intended for adult consumption had aflatoxin contamination levels within the permitted limits. PMID:22942705

The integration of emotional and symbolic components in multimodal communication

PubMed Central

Mehu, Marc

2015-01-01

Human multimodal communication can be said to serve two main purposes: information transfer and social influence. In this paper, I argue that different components of multimodal signals play different roles in the processes of information transfer and social influence. Although the symbolic components of communication (e.g., verbal and denotative signals) are well suited to transfer conceptual information, emotional components (e.g., non-verbal signals that are difficult to manipulate voluntarily) likely take a function that is closer to social influence. I suggest that emotion should be considered a property of communicative signals, rather than an entity that is transferred as content by non-verbal signals. In this view, the effect of emotional processes on communication serve to change the quality of social signals to make them more efficient at producing responses in perceivers, whereas symbolic components increase the signals’ efficiency at interacting with the cognitive processes dedicated to the assessment of relevance. The interaction between symbolic and emotional components will be discussed in relation to the need for perceivers to evaluate the reliability of multimodal signals. PMID:26217280

Spectral-element simulations of wave propagation in complex exploration-industry models: Imaging and adjoint tomography

NASA Astrophysics Data System (ADS)

Luo, Y.; Nissen-Meyer, T.; Morency, C.; Tromp, J.

2008-12-01

Seismic imaging in the exploration industry is often based upon ray-theoretical migration techniques (e.g., Kirchhoff) or other ideas which neglect some fraction of the seismic wavefield (e.g., wavefield continuation for acoustic-wave first arrivals) in the inversion process. In a companion paper we discuss the possibility of solving the full physical forward problem (i.e., including visco- and poroelastic, anisotropic media) using the spectral-element method. With such a tool at hand, we can readily apply the adjoint method to tomographic inversions, i.e., iteratively improving an initial 3D background model to fit the data. In the context of this inversion process, we draw connections between kernels in adjoint tomography and basic imaging principles in migration. We show that the images obtained by migration are nothing but particular kinds of adjoint kernels (mainly density kernels). Migration is basically a first step in the iterative inversion process of adjoint tomography. We apply the approach to basic 2D problems involving layered structures, overthrusting faults, topography, salt domes, and poroelastic regions.

Scheduling Capacitated One-Way Vehicles on Paths with Deadlines

NASA Astrophysics Data System (ADS)

Uchida, Jun; Karuno, Yoshiyuki; Nagamochi, Hiroshi

In this paper, we deal with a scheduling problem of minimizing the number of employed vehicles on paths. Let G=(V,E) be a path with a set V={vi|i=1,2,...,n} of vertices and a set E={{vi,vi+1}|i=1,2,...,n-1} of edges. Vehicles with capacity b are initially situated at v1. There is a job i at each vertex vi∈V, which has its own handling time hi and deadline di. With each edge {vi,vi+1}∈E, a travel time wi,i+1 is associated. Each job is processed by exactly one vehicle, and the number of jobs processed by a vehicle does not exceed the capacity b. A routing of a vehicle is called one-way if the vehicle visits every edge {vi,vi+1} exactly once (i.e., it simply moves from v1 to vn on G). Any vehicle is assumed to follow the one-way routing constraint. The problem asks to find a schedule that minimizes the number of one-way vehicles, meeting the deadline and capacity constraints. A greedy heuristic is proposed, which repeats a dynamic programming procedure for a single one-way vehicle problem of maximizing the number of non-tardy jobs. We show that the greedy heuristic runs in O(n3) time, and the approximation ratio is at most ln b+1.

Municipal waste liquor treatment via bioelectrochemical and fermentation (H2 + CH4) processes: Assessment of various technological sequences.

PubMed

Rózsenberszki, Tamás; Koók, László; Bakonyi, Péter; Nemestóthy, Nándor; Logroño, Washington; Pérez, Mario; Urquizo, Gladys; Recalde, Celso; Kurdi, Róbert; Sarkady, Attila

2017-03-01

In this paper, the anaerobic treatment of a high organic-strength wastewater-type feedstock, referred as the liquid fraction of pressed municipal solid waste (LPW) was studied for energy recovery and organic matter removal. The processes investigated were (i) dark fermentation to produce biohydrogen, (ii) anaerobic digestion for biogas formation and (iii) microbial fuel cells for electrical energy generation. To find a feasible alternative for LPW treatment (meeting the two-fold aims given above), various one- as well as multi-stage processes were tested. The applications were evaluated based on their (i) COD removal efficiencies and (ii) specific energy gain. As a result, considering the former aspect, the single-stage processes could be ranked as: microbial fuel cell (92.4%)> anaerobic digestion (50.2%)> hydrogen fermentation (8.8%). From the latter standpoint, an order of hydrogen fermentation (2277 J g -1  COD removed  d -1 )> anaerobic digestion (205 J g -1  COD removed  d -1 )> microbial fuel cell (0.43 J g -1  COD removed  d -1 ) was attained. The assessment showed that combined, multi-step treatment was necessary to simultaneously achieve efficient organic matter removal and energy recovery from LPW. Therefore, a three-stage system (hydrogen fermentation-biomethanation-bioelectrochemical cell in sequence) was suggested. The different approaches were characterized via the estimation of COD balance, as well. Copyright © 2016 Elsevier Ltd. All rights reserved.

PCBs and DDE in commercial fish feeds

USGS Publications Warehouse

Mac, Michael J.; Nicholson, L.W.; McCauley, C.A.

1979-01-01

Three commercial fish feeds were analyzed for PCBs and p,p' DDE and were reported in dry weight concentrations. In various sizes of Oregon Moist Pellets, concentrations of PCBs ranged from less than 0.10 to 0.30 I?g/g and those of p,p' DDE from less than 0.01 to 0.47 I?g/g. In Silver Cup, concentrations of PCBs were 0.06 to 0.07 I?g/g, and p,p' DDE, 0.01 to 0.06 I?g/g. Nauplii of brine shrimp (Artemia salina) contained 0.14 I?g/g PCB and 0.03 I?g/g p,p' DDE.

Coupling of wrinkled laminar flames with gravity

NASA Technical Reports Server (NTRS)

Bedat, Benoit; Kostiuk, Larry W.; Cheng, Robert K.

1995-01-01

The overall objective of our research is to understand flame-gravity coupling processes in laminar and low turbulent Reynolds number, Re(sub l), premixed flames (i.e. wrinkled- laminar flames). The approach we have developed is to compare the flowfields and mean flame properties under different gravitational orientations. Key to our study is the investigation of microgravity (mu g) flames. These mu g experiments provide vital information to reconcile the differences between flames in normal gravity (+g, flame pointing upward) and reverse gravity (-g, flame pointing downwards). Traditionally, gravity effects are assumed to be insignificant or circumvented in the laboratory, therefore, not much is available in the literature on the behavior of -g flames.

77 FR 65708 - Agency Information Collection Activities: Petition To Remove the Conditions on Residence, Form...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-30

... technological collection techniques or other forms of information technology, e.g., permitting electronic... form I-751 and an estimated time burden per response of 1.17 hours for the biometric processing. (6) An...

The Processing and Mechanical Properties of High Temperature/ High Performance Composites. Processing/Property Correlations. Book 4

DTIC Science & Technology

1994-03-01

Metals Park , Ohio(1088). 42. E.W. Colin s, The Physical Metallurgy of Ti Alloys, pp.111-21-. ASM, Metals Park , Ohio (198 43. C.R. Brooos, Heat...Treatment. Structure and Properties of Nonferrous Alloys, pp.361-376. ASM, Metals Park , Ohio (1982). 44. W.C. Ha-rigan, Jr., Met. Trans. A 5, 565 (1974). 45...CJ 0 c0 CMJ 0 1~~ 00 0; 0D/D ’sseils; eJI~suG LO) C~i 0 Cl E -i E 0z Ln C; 0 DO/D ’SsOJIS teU! WON LO E C 0. 22.0 x In 0o 0)- 00D LO qw)r 0; ; 0 0i 6 0

THE MAGNETIC SENSITIVITY OF THE Mg ii k LINE TO THE JOINT ACTION OF HANLE, ZEEMAN, AND MAGNETO-OPTICAL EFFECTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, E. Alsina; Bueno, J. Trujillo; Belluzzi, L., E-mail: ealsina@iac.es, E-mail: jtb@iac.es, E-mail: belluzzi@irsol.ch

2016-11-10

We highlight the main results of a radiative transfer investigation on the magnetic sensitivity of the solar Mg ii k resonance line at 2795.5 Å, accounting for the joint action of the Hanle and Zeeman effects as well as partial frequency redistribution phenomena. We confirm that at the line center, the linear polarization signals produced by scattering processes are measurable, and that they are sensitive, via the Hanle effect, to magnetic fields with strengths between 5 and 50 G, approximately. We also show that the Zeeman effect produces conspicuous circular polarization signals, especially for longitudinal fields stronger than 50 G,more » which can be used to estimate the magnetization of the solar chromosphere via the familiar magnetograph formula. The most novel result is that magneto-optical effects produce, in the wings of the line, a decrease of the Q / I scattering polarization pattern and the appearance of U / I signals (i.e., a rotation of the plane of linear polarization). This sensitivity of the Q / I and U / I wing signals to both weak (∼5 G) and stronger magnetic fields expands the scientific interest of the Mg ii k line for probing the chromosphere in quiet and active regions of the Sun.« less

Overlapping neurobehavioral circuits in ADHD, obesity, and binge eating: Evidence from Neuroimaging Research

PubMed Central

Seymour, Karen E.; Reinblatt, Shauna P.; Benson, Leora; Carnell, Susan

2015-01-01

Attention-deficit/hyperactivity disorder (ADHD) and conditions involving excessive eating (e.g. obesity, binge / loss of control eating) are increasingly prevalent within pediatric populations, and correlational and some longitudinal studies have suggested inter-relationships between these disorders. In addition, a number of common neural correlates are emerging across conditions, e.g. functional abnormalities within circuits subserving reward processing and executive functioning. To explore this potential cross-condition overlap in neurobehavioral underpinnings, we selectively review relevant functional neuroimaging literature, specifically focusing on studies probing i) reward processing, ii) response inhibition, and iii) emotional processing and regulation, and outline three specific shared neurobehavioral circuits. Based on our review, we also identify gaps within the literature that would benefit from further research. PMID:26098969

Inhibition of E2F1 activity and cell cycle progression by arsenic via retinoblastoma protein.

PubMed

Sheldon, Lynn A

2017-01-01

The regulation of cell cycle progression by steroid hormones and growth factors is important for maintaining normal cellular processes including development and cell proliferation. Deregulated progression through the G1/S and G2/M cell cycle transitions can lead to uncontrolled cell proliferation and cancer. The transcription factor E2F1, a key cell cycle regulator, targets genes encoding proteins that regulate cell cycle progression through the G1/S transition as well as proteins important in DNA repair and apoptosis. E2F1 expression and activity is inhibited by inorganic arsenic (iAs) that has a dual role as a cancer therapeutic and as a toxin that leads to diseases including cancer. An understanding of what underlies this dichotomy will contribute to understanding how to use iAs as a more effective therapeutic and also how to treat cancers that iAs promotes. Here, we show that quiescent breast adenocarcinoma MCF-7 cells treated with 17-β estradiol (E2) progress through the cell cycle, but few cells treated with E2 + iAs progress from G1 into S-phase due to a block in cell cycle progression. Our data support a model in which iAs inhibits the dissociation of E2F1 from the tumor suppressor, retinoblastoma protein (pRB) due to changes in pRB phosphorylation which leads to decreased E2F1 transcriptional activity. These findings present an explanation for how iAs can disrupt cell cycle progression through E2F1-pRB and has implications for how iAs acts as a cancer therapeutic as well as how it may promote tumorigenesis through decreased DNA repair.

Active Control of Complex Systems via Dynamic (Recurrent) Neural Networks

DTIC Science & Technology

1992-05-30

course, to on-going changes brought about by learning processes. As research in neurodynamics proceeded, the concept of reverberatory information flows...Microstructure of Cognition . Vol. 1: Foundations, M.I.T. Press, Cambridge, Massachusetts, pp. 354-361, 1986. 100 I Schwarz, G., "Estimating the dimension of a...Continually Running Fully Recurrent Neural Networks, ICS Report 8805, Institute of Cognitive Science, University of California at San Diego, 1988. 10 II

Effects of gravity on meiosis, fertilization and early embryogenesis in Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Sasagawa, Y.; Saito, Y.; Shimizu, M.; Ishioka, N.; Yamashita, M.; Takahashi, H.; Higashitani, A.

The embryonic development of the nematode Caenorhabditis elegans was examined under different gravitational conditions. The first cleavage plane in the 1-cell embryo was slid to some extent by re-orientation of liquid culture vessel, but the pattern and timing of cleavages were not affected. Under 100G of hypergravity condition with swing-centrifuge, the number of eggs laid from an adult hermaphrodite decreased and their hatching rate was drastically reduced. On the other hand, the embryonic development after fertilization normally occurred and grew to adulthood at more than 100G of hypergravity. When the adult hermaphrodites cultured under 100G of hypergravity transferred to a ground condition (1G), the newly fertilized embryos normally developed and their hatching rate was fully recovered. These results indicated that the reproductive process except spermatogenesis, oogenesis and embryogenesis after fertilization is impaired under 100G of hypergravity condition, and the effect is transient. Namely, the fertilization process including meiotic divisions I and II is sensitive to hypergravity in the nematode C. elegans.

Computer-Based Methods for Thermodynamic Analysis of Materials Processing.

DTIC Science & Technology

1983-11-30

metallic alloys (12,13), silicides (14),and oxynitride * . systems (15). - . 2. Thermochemical System Employed to Characterize Binary Ill-V Phase Diagrams The...reference to Figure I shows that the stable form of RbF is the sodium chloride S form. Table I shows that OGH -oS -RFRFLS-RFRFLM-12866-.381T J/g.at. (5...KF, BF=(I/3)8aF LF-(I/4)LaF3V PF-(113)PbF 2 S- Sodium Chloride Structures Stable form of NF, KE, RE and (;F L-Liquid, M-Stable form of ZF, KeStable form

Age Is Relative-Impact of Donor Age on Induced Pluripotent Stem Cell-Derived Cell Functionality.

PubMed

Strässler, Elisabeth Tamara; Aalto-Setälä, Katriina; Kiamehr, Mostafa; Landmesser, Ulf; Kränkel, Nicolle

2018-01-01

Induced pluripotent stem cells (iPSCs) avoid many of the restrictions that hamper the application of human embryonic stem cells: limited availability of source material due to legal restrictions in some countries, immunogenic rejection and ethical concerns. Also, the donor's clinical phenotype is often known when working with iPSCs. Therefore, iPSCs seem ideal to tackle the two biggest tasks of regenerative medicine: degenerative diseases with genetic cause (e.g., Duchenne's muscular dystrophy) and organ replacement in age-related diseases (e.g., end-stage heart or renal failure), especially in combination with recently developed gene-editing tools. In the setting of autologous transplantation in elderly patients, donor age becomes a potentially relevant factor that needs to be assessed. Here, we review and critically discuss available data pertinent to the questions: How does donor age influence the reprogramming process and iPSC functionality? Would it even be possible to reprogram senescent somatic cells? How does donor age affect iPSC differentiation into specialised cells and their functionality? We also identify research needs, which might help resolve current unknowns. Until recently, most hallmarks of ageing were attributed to an accumulation of DNA damage over time, and it was thus expected that DNA damage from a somatic cell would accumulate in iPSCs and the cells derived from them. In line with this, a decreased lifespan of cloned organisms compared with the donor was also observed in early cloning experiments. Therefore, it was questioned for a time whether iPSC derived from an old individual's somatic cells would suffer from early senescence and, thus, may not be a viable option either for disease modelling nor future clinical applications. Instead, typical signs of cellular ageing are reverted in the process of iPSC reprogramming, and iPSCs from older donors do not show diminished differentiation potential nor do iPSC-derived cells from older donors suffer early senescence or show functional impairments when compared with those from younger donors. Thus, the data would suggest that donor age does not limit iPSC application for modelling genetic diseases nor regenerative therapies. However, open questions remain, e.g., regarding the potential tumourigenicity of iPSC-derived cells and the impact of epigenetic pattern retention.

Imbalanced Learning for RR Lyrae Stars Based on SDSS and GALEX Databases

NASA Astrophysics Data System (ADS)

Zhang, Jingyi; Zhang, Yanxia; Zhao, Yongheng

2018-03-01

We apply machine learning and Convex-Hull algorithms to separate RR Lyrae stars from other stars like main-sequence stars, white dwarf stars, carbon stars, CVs, and carbon-lines stars, based on the Sloan Digital Sky Survey and Galaxy Evolution Explorer (GALEX). In low-dimensional spaces, the Convex-Hull algorithm is applied to select RR Lyrae stars. Given different input patterns of (u ‑ g, g ‑ r), (g ‑ r, r ‑ i), (r ‑ i, i ‑ z), (u ‑ g, g ‑ r, r ‑ i), (g ‑ r, r ‑ i, i ‑ z), (u ‑ g, g ‑ r, i ‑ z), and (u ‑ g, r ‑ i, i ‑ z), different convex hulls can be built for RR Lyrae stars. Comparing the performance of different input patterns, u ‑ g, g ‑ r, i ‑ z is the best input pattern. For this input pattern, the efficiency (the fraction of true RR Lyrae stars in the predicted RR Lyrae sample) is 4.2% with a completeness (the fraction of recovered RR Lyrae stars in the whole RR Lyrae sample) of 100%, increases to 9.9% with 97% completeness and to 16.1% with 53% completeness by removing some outliers. In high-dimensional spaces, machine learning algorithms are used with input patterns (u ‑ g, g ‑ r, r ‑ i, i ‑ z), (u ‑ g, g ‑ r, r ‑ i, i ‑ z, r), (NUV ‑ u, u ‑ g, g ‑ r, r ‑ i, i ‑ z), and (NUV ‑ u, u ‑ g, g ‑ r, r ‑ i, i ‑ z, r). RR Lyrae stars, which belong to the class of interest in our paper, are rare compared to other stars. For the highly imbalanced data, cost-sensitive Support Vector Machine, cost-sensitive Random Forest, and Fast Boxes is used. The results show that information from GALEX is helpful for identifying RR Lyrae stars, and Fast Boxes is the best performer on the skewed data in our case.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roederer, Ian U.; Karakas, Amanda I.; Pignatari, Marco

We present a detailed analysis of the composition and nucleosynthetic origins of the heavy elements in the metal-poor ([Fe/H] = −1.62 ± 0.09) star HD 94028. Previous studies revealed that this star is mildly enhanced in elements produced by the slow neutron-capture process (s process; e.g., [Pb/Fe] = +0.79 ± 0.32) and rapid neutron-capture process (r process; e.g., [Eu/Fe] = +0.22 ± 0.12), including unusually large molybdenum ([Mo/Fe] = +0.97 ± 0.16) and ruthenium ([Ru/Fe] = +0.69 ± 0.17) enhancements. However, this star is not enhanced in carbon ([C/Fe] = −0.06 ± 0.19). We analyze an archival near-ultraviolet spectrum of HD 94028, collected using the Space Telescope Imaging Spectrograph on board the Hubble Space Telescope, and other archival optical spectra collected frommore » ground-based telescopes. We report abundances or upper limits derived from 64 species of 56 elements. We compare these observations with s-process yields from low-metallicity AGB evolution and nucleosynthesis models. No combination of s- and r-process patterns can adequately reproduce the observed abundances, including the super-solar [As/Ge] ratio (+0.99 ± 0.23) and the enhanced [Mo/Fe] and [Ru/Fe] ratios. We can fit these features when including an additional contribution from the intermediate neutron-capture process (i process), which perhaps operated through the ingestion of H in He-burning convective regions in massive stars, super-AGB stars, or low-mass AGB stars. Currently, only the i process appears capable of consistently producing the super-solar [As/Ge] ratios and ratios among neighboring heavy elements found in HD 94028. Other metal-poor stars also show enhanced [As/Ge] ratios, hinting that operation of the i process may have been common in the early Galaxy.« less

Confinement of Iodine Molecules into Triple-Helical Chains within Robust Metal-Organic Frameworks.

PubMed

Zhang, Xinran; da Silva, Ivan; Godfrey, Harry G W; Callear, Samantha K; Sapchenko, Sergey A; Cheng, Yongqiang; Vitórica-Yrezábal, Inigo; Frogley, Mark D; Cinque, Gianfelice; Tang, Chiu C; Giacobbe, Carlotta; Dejoie, Catherine; Rudić, Svemir; Ramirez-Cuesta, Anibal J; Denecke, Melissa A; Yang, Sihai; Schröder, Martin

2017-11-15

During nuclear waste disposal process, radioactive iodine as a fission product can be released. The widespread implementation of sustainable nuclear energy thus requires the development of efficient iodine stores that have simultaneously high capacity, stability and more importantly, storage density (and hence minimized system volume). Here, we report high I 2 adsorption in a series of robust porous metal-organic materials, MFM-300(M) (M = Al, Sc, Fe, In). MFM-300(Sc) exhibits fully reversible I 2 uptake of 1.54 g g -1 , and its structure remains completely unperturbed upon inclusion/removal of I 2 . Direct observation and quantification of the adsorption, binding domains and dynamics of guest I 2 molecules within these hosts have been achieved using XPS, TGA-MS, high resolution synchrotron X-ray diffraction, pair distribution function analysis, Raman, terahertz and neutron spectroscopy, coupled with density functional theory modeling. These complementary techniques reveal a comprehensive understanding of the host-I 2 and I 2 -I 2 binding interactions at a molecular level. The initial binding site of I 2 in MFM-300(Sc), I 2 I , is located near the bridging hydroxyl group of the [ScO 4 (OH) 2 ] moiety [I 2 I ···H-O = 2.263(9) Å] with an occupancy of 0.268. I 2 II is located interstitially between two phenyl rings of neighboring ligand molecules [I 2 II ···phenyl ring = 3.378(9) and 4.228(5) Å]. I 2 II is 4.565(2) Å from the hydroxyl group with an occupancy of 0.208. Significantly, at high I 2 loading an unprecedented self-aggregation of I 2 molecules into triple-helical chains within the confined nanovoids has been observed at crystallographic resolution, leading to a highly efficient packing of I 2 molecules with an exceptional I 2 storage density of 3.08 g cm -3 in MFM-300(Sc).

40 CFR Appendix R to Subpart G of... - Substitutes Subject to Use Restrictions Listed in the December 20, 2011 Final Rule, Effective...

Code of Federal Regulations, 2014 CFR

2014-07-01

.... “Differ” means that either the diameter differs by at least 1/16 inch or the thread direction is reversed... (e.g., process tubes). The color mark must extend at least 2.5 centimeters (1 inch) from the... diameter differs by at least 1/16 inch or the thread direction is reversed (i.e., right-handed vs. left...

40 CFR Appendix R to Subpart G of... - Substitutes Subject to Use Restrictions Listed in the December 20, 2011 Final Rule, Effective...

Code of Federal Regulations, 2013 CFR

2013-07-01

.... “Differ” means that either the diameter differs by at least 1/16 inch or the thread direction is reversed... (e.g., process tubes). The color mark must extend at least 2.5 centimeters (1 inch) from the... diameter differs by at least 1/16 inch or the thread direction is reversed (i.e., right-handed vs. left...

Real-Time Radio Wave Propagation for Mobile Ad-Hoc Network Emulation and Simulation Using General Purpose Graphics Processing Units (GPGPUs)

DTIC Science & Technology

2014-05-01

COST-Walfisch- Ikegami model (14) estimates the received power predominantly on the basis of frequency and distance to the transmitter. Ray-optical (15...34 # $ $ # % & ’ ( ) * + , , - . / - 0 1 2 3 4 5 6 7 7 6 8 9 : ; < = > ? @ A B C ? D E F A B G H ? E E I J K L M N O P Q R S T U V W X S Y Z O Y [ Q [ \\ W O P...a b _ c _ d _ e f ` d g h ` i j k l l m n o p k q r s t u v w w x y z

Effects of biodrying process on municipal solid waste properties.

PubMed

Tambone, F; Scaglia, B; Scotti, S; Adani, F

2011-08-01

In this paper, the effect of biodrying process on municipal solid waste (MSW) properties was studied. The results obtained indicated that after 14d, biodrying reduced the water content of waste, allowing the production of biodried waste with a net heating value (NHV) of 16,779±2,074kJ kg(-1) wet weight, i.e. 41% higher than that of untreated waste. The low moisture content of the biodried material reduced, also, the potential impacts of the waste, i.e. potential self-ignition and potential odors production. Low waste impacts suggest to landfill the biodried material obtaining energy via biogas production by waste re-moistening, i.e. bioreactor. Nevertheless, results of this work indicate that biodrying process because of the partial degradation of the organic fraction contained in the waste (losses of 290g kg(-1) VS), reduced of about 28% the total producible biogas. Copyright © 2011 Elsevier Ltd. All rights reserved.

Pretreatment optimization of Sorghum pioneer biomass for bioethanol production and its scale-up.

PubMed

Koradiya, Manoj; Duggirala, Srinivas; Tipre, Devayani; Dave, Shailesh

2016-01-01

Based on one parameter at a time, saccharification of delignified sorghum biomass by 4% and 70% v/v sulfuric acid resulted in maximum 30.8 and 33.8 g% sugar production from biomass respectively. The Box Behnken Design was applied for further optimization of acid hydrolysis. As a result of the designed experiment 36.3g% sugar production was achieved when 3% v/v H2SO4 treatment given for 60 min at 180°C. The process was scaled-up to treat 2 kg of biomass. During the screening of yeast cultures, isolate C, MK-I and N were found to be potent ethanol producers from sorghum hydrolyzate. Culture MK-I was the best so used for scale up of ethanol production up to 25 L capacity, which gave a yield of 0.49 g ethanol/g sugar from hydrolyzate obtained from 2 kg of sorghum biomass. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biobutanol production in a Clostridium acetobutylicum biofilm reactor integrated with simultaneous product recovery by adsorption

PubMed Central

2014-01-01

Background Clostridium acetobutylicum can propagate on fibrous matrices and form biofilms that have improved butanol tolerance and a high fermentation rate and can be repeatedly used. Previously, a novel macroporous resin, KA-I, was synthesized in our laboratory and was demonstrated to be a good adsorbent with high selectivity and capacity for butanol recovery from a model solution. Based on these results, we aimed to develop a process integrating a biofilm reactor with simultaneous product recovery using the KA-I resin to maximize the production efficiency of biobutanol. Results KA-I showed great affinity for butanol and butyrate and could selectively enhance acetoin production at the expense of acetone during the fermentation. The biofilm reactor exhibited high productivity with considerably low broth turbidity during repeated batch fermentations. By maintaining the butanol level above 6.5 g/L in the biofilm reactor, butyrate adsorption by the KA-I resin was effectively reduced. Co-adsorption of acetone by the resin improved the fermentation performance. By redox modulation with methyl viologen (MV), the butanol-acetone ratio and the total product yield increased. An equivalent solvent titer of 96.5 to 130.7 g/L was achieved with a productivity of 1.0 to 1.5 g · L-1 · h-1. The solvent concentration and productivity increased by 4 to 6-fold and 3 to 5-fold, respectively, compared to traditional batch fermentation using planktonic culture. Conclusions Compared to the conventional process, the integrated process dramatically improved the productivity and reduced the energy consumption as well as water usage in biobutanol production. While genetic engineering focuses on strain improvement to enhance butanol production, process development can fully exploit the productivity of a strain and maximize the production efficiency. PMID:24401161

Electrostatic application of antimicrobial sprays to sanitize food handling and processing surfaces for enhanced food safety

NASA Astrophysics Data System (ADS)

Lyons, Shawn M.; Harrison, Mark A.; Law, S. Edward

2011-06-01

Human illnesses and deaths caused by foodborne pathogens (e.g., Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7, etc.) are of increasing concern globally in maintaining safe food supplies. At various stages of the food production, processing and supply chain antimicrobial agents are required to sanitize contact surfaces. Additionally, during outbreaks of contagious pathogenic microorganisms (e.g., H1N1 influenza), public health requires timely decontamination of extensive surfaces within public schools, mass transit systems, etc. Prior publications verify effectiveness of air-assisted, induction-charged (AAIC) electrostatic spraying of various chemical and biological agents to protect on-farm production of food crops...typically doubling droplet deposition efficiency with concomitant increases in biological control efficacy. Within a biosafety facility this present work evaluated the AAIC electrostatic-spraying process for application of antimicrobial liquids onto various pathogen-inoculated food processing and handling surfaces as a food safety intervention strategy. Fluoroanalysis of AAIC electrostatic sprays (-7.2 mC/kg charge-to-mass ratio) showed significantly greater (p<0.05) mass of tracer active ingredient (A.I.) deposited onto target surfaces at various orientations as compared both to a similar uncharged spray nozzle (0 mC/kg) and to a conventional hydraulic-atomizing nozzle. Per unit mass of A.I. dispensed toward targets, for example, A.I. mass deposited by AAIC electrostatic sprays onto difficult to coat backsides was 6.1-times greater than for similar uncharged sprays and 29.0-times greater than for conventional hydraulic-nozzle sprays. Even at the 56% reduction in peracetic acid sanitizer A.I. dispensed by AAIC electrostatic spray applications, they achieved equal or greater CFU population reductions of Salmonella on most target orientations and materials as compared to uncharged sprays and conventional full-rate hydraulic-nozzle sprays.

n-capture elements in the Sculptor dwarf spheroidal galaxy

NASA Astrophysics Data System (ADS)

Skúladóttir, Ása

2018-06-01

Sculptor is a well studied dwarf galaxy in the Local Group, which is dominated by an old stellar population (>10 Gyr) and is therefore an ideal system to study early chemical evolution. With high-resolution VLT/FLAMES spectra, R~20,000, we are able to get accurate abundances of several n-capture elements in ~100 stars, from both the lighter n-capture elements (Y) as well as the heavier ones, both tracers of the s-process (e.g. Ba) and the r-process (e.g. Eu). I will discuss the similarities and differences in the n-capture elements in Sculptor and the Milky Way, as well as other dwarf galaxies.

Advances in microscale separations towards nanoproteomics applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi, Lian; Piehowski, Paul D.; Shi, Tujin

Microscale separations (e.g., liquid chromatography or capillary electrophoresis) coupled with mass spectrometry (MS) has become the primary tool for advanced proteomics, an indispensable technology for gaining understanding of complex biological processes. While significant advances have been achieved in MS-based proteomics, the current platforms still face a significant challenge in overall sensitivity towards nanoproteomics (i.e., with less than 1 g total amount of proteins available) applications such as cellular heterogeneity in tissue pathologies. Herein, we review recent advances in microscale separation techniques and integrated sample processing systems that improve the overall sensitivity and coverage of the proteomics workflow, and their contributionsmore » towards nanoproteomics applications.« less

Supercritical CO₂assisted extraction and LC-MS identification of picroside I and picroside II from Picrorhiza kurroa.

PubMed

Patil, Ajit A; Sachin, Bhusari S; Shinde, Devanand B; Wakte, Pravin S

2013-02-01

Picroside I and picroside II have been studied intensively because of their pharmacological actions and clinical applications. Numerous methods have been reported for extracting picroside I and picroside II from Picrorrhiza. kurroa rhizomes. This is the first report of picroside I and picroside II extraction using the supercritical carbon dioxide assisted extraction technique. To develop supercritical carbon dioxide assisted extraction and LC-MS identification of picroside I and picroside II from the Picrorrhiza kurroa Royle rhizomes. Surface response methodology based on 3³ fractional factorial design was used to extract picroside I and picroside II from P. kurroa rhizomes. The effects of various process factors, namely temperature (40-80°C), pressure (25-35 MPa) and co-solvent (methanol) concentration (0-10% v/v) on extraction yield of the two compounds were evaluated. The picroside I and picroside II contents were determined using validated LC-MS methodology. The maximum yield of picroside I (32.502 ± 1.131 mg/g) and picroside II (9.717 ± 0.382 mg/g) was obtained at the 10% v/v co-solvent concentration, 40°C temperature and 30 MPa pressure. The conventional Soxhlet assisted methanol extract of P. kurroa powder resulted in 36.743 ± 1.75 and 11.251 ± 0.54 mg/g yield of picroside I and picroside II, respectively. Variation of concentration and extraction time showed a significant effect on the picroside I and picroside II yield. Supercritical carbon dioxide assisted extraction using methanol as a co-solvent is an efficient and environmentally sustainable method for extracting picroside I and picroside II from P. kurroa rhizomes. Copyright © 2012 John Wiley & Sons, Ltd.

Sequential ethanol fermentation and anaerobic digestion increases bioenergy yields from duckweed.

PubMed

Calicioglu, O; Brennan, R A

2018-06-01

The potential for improving bioenergy yields from duckweed, a fast-growing, simple, floating aquatic plant, was evaluated by subjecting the dried biomass directly to anaerobic digestion, or sequentially to ethanol fermentation and then anaerobic digestion, after evaporating ethanol from the fermentation broth. Bioethanol yields of 0.41 ± 0.03 g/g and 0.50 ± 0.01 g/g (glucose) were achieved for duckweed harvested from the Penn State Living-Filter (Lemna obscura) and Eco-Machine™ (Lemna minor/japonica and Wolffia columbiana), respectively. The highest biomethane yield, 390 ± 0.1 ml CH 4 /g volatile solids added, was achieved in a reactor containing fermented duckweed from the Living-Filter at a substrate-to-inoculum (S/I) ratio (i.e., duckweed to microorganism ratio) of 1.0. This value was 51.2% higher than the biomethane yield of a replicate reactor with raw (non-fermented) duckweed. The combined bioethanol-biomethane process yielded 70.4% more bioenergy from duckweed, than if anaerobic digestion had been run alone. Copyright © 2018 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xinran; da Silva, Ivan; Godfrey, Harry G. W.

During nuclear waste disposal process, radioactive iodine as a fission product can be released. The widespread implementation of sustainable nuclear energy thus requires the development of efficient iodine stores that have simultaneously high capacity, stability and more importantly, storage density (and hence minimized system volume). Here, we report high I 2 adsorption in a series of robust porous metal–organic materials, MFM-300(M) (M = Al, Sc, Fe, In). MFM-300(Sc) exhibits fully reversible I 2 uptake of 1.54 g g –1, and its structure remains completely unperturbed upon inclusion/removal of I 2. Direct observation and quantification of the adsorption, binding domains andmore » dynamics of guest I 2 molecules within these hosts have been achieved using XPS, TGA-MS, high resolution synchrotron X-ray diffraction, pair distribution function analysis, Raman, terahertz and neutron spectroscopy, coupled with density functional theory modeling. These complementary techniques reveal a comprehensive understanding of the host–I 2 and I 2–I 2 binding interactions at a molecular level. The initial binding site of I 2 in MFM-300(Sc), I 2 I, is located near the bridging hydroxyl group of the [ScO 4(OH) 2] moiety [I 2 I···H–O = 2.263(9) Å] with an occupancy of 0.268. I 2 II is located interstitially between two phenyl rings of neighboring ligand molecules [I 2 II···phenyl ring = 3.378(9) and 4.228(5) Å]. I 2 II is 4.565(2) Å from the hydroxyl group with an occupancy of 0.208. Significantly, at high I 2 loading an unprecedented self-aggregation of I 2 molecules into triple-helical chains within the confined nanovoids has been observed at crystallographic resolution, leading to a highly efficient packing of I 2 molecules with an exceptional I 2 storage density of 3.08 g cm –3 in MFM-300(Sc).« less

Confinement of Iodine Molecules into Triple-Helical Chains within Robust Metal–Organic Frameworks

DOE PAGES

Zhang, Xinran; da Silva, Ivan; Godfrey, Harry G. W.; ...

2017-10-11

During nuclear waste disposal process, radioactive iodine as a fission product can be released. The widespread implementation of sustainable nuclear energy thus requires the development of efficient iodine stores that have simultaneously high capacity, stability and more importantly, storage density (and hence minimized system volume). Here, we report high I 2 adsorption in a series of robust porous metal–organic materials, MFM-300(M) (M = Al, Sc, Fe, In). MFM-300(Sc) exhibits fully reversible I 2 uptake of 1.54 g g –1, and its structure remains completely unperturbed upon inclusion/removal of I 2. Direct observation and quantification of the adsorption, binding domains andmore » dynamics of guest I 2 molecules within these hosts have been achieved using XPS, TGA-MS, high resolution synchrotron X-ray diffraction, pair distribution function analysis, Raman, terahertz and neutron spectroscopy, coupled with density functional theory modeling. These complementary techniques reveal a comprehensive understanding of the host–I 2 and I 2–I 2 binding interactions at a molecular level. The initial binding site of I 2 in MFM-300(Sc), I 2 I, is located near the bridging hydroxyl group of the [ScO 4(OH) 2] moiety [I 2 I···H–O = 2.263(9) Å] with an occupancy of 0.268. I 2 II is located interstitially between two phenyl rings of neighboring ligand molecules [I 2 II···phenyl ring = 3.378(9) and 4.228(5) Å]. I 2 II is 4.565(2) Å from the hydroxyl group with an occupancy of 0.208. Significantly, at high I 2 loading an unprecedented self-aggregation of I 2 molecules into triple-helical chains within the confined nanovoids has been observed at crystallographic resolution, leading to a highly efficient packing of I 2 molecules with an exceptional I 2 storage density of 3.08 g cm –3 in MFM-300(Sc).« less

A novel inactivated gE/gI deleted pseudorabies virus (PRV) vaccine completely protects pigs from an emerged variant PRV challenge.

PubMed

Gu, Zhenqing; Dong, Jing; Wang, Jichun; Hou, Chengcai; Sun, Haifeng; Yang, Wenping; Bai, Juan; Jiang, Ping

2015-01-02

A highly virulent and antigenic variant of pseudorabies virus (PRV) broke out in China at the end of 2011 and caused great economic loss in the pig industry. In this study, an infectious bacterial artificial chromosome (BAC) clone containing the full-length genome of the emerged variant PRV ZJ01 strain was generated. The BAC-derived viruses, vZJ01-GFPΔgE/gI (gE/gI deleted strain, and exhibiting green autofluorescence), vZJ01ΔgE/gI (gE/gI deleted strain), and vZJ01gE/gI-R (gE/gI revertant strain), showed similar in vitro growth to their parent strain. In pigs, inactivated vZJ01ΔgE/gI vaccine generated significantly high levels of neutralizing antibodies against ZJ01 compared with Bartha-K61 live vaccine (p<0.05). After fatal ZJ01 challenge, all five animals in the inactivated vZJ01ΔgE/gI vaccine group survived without exhibiting any clinical sings, but two of five animals exhibited central nervous signs in the Bartha-K61 group. Meanwhile, all the non-vaccinated control animals died at 7 days post-challenge. This indicates that the inactivated vZJ01ΔgE/gI vaccine is a promising vaccine candidate for controlling the variant strains of PRV now circulating in China. Copyright © 2014 Elsevier B.V. All rights reserved.

An Examination of "Self-Monitoring" and the "Influence of Others" as Determinants of Attitude to the Higher Education Application Service Process in the UK

ERIC Educational Resources Information Center

Clarke, Geraldine

2005-01-01

The paper presents empirical research that investigated significant dependent relationships between "type" of influencer, e.g., parent, sibling, friend and total number of influencers, and levels of satisfaction within the context of an extended service buying process, i.e., application to an institution of higher education. The type of…

34 CFR 644.7 - What definitions apply?

Code of Federal Regulations, 2014 CFR

2014-07-01

... knowledge about— (i) Personal and family budget planning; (ii) Understanding credit building principles to..., personal costs); (v) Financial assistance (e.g., searches, application processes, and differences between... individual means an individual whose family's taxable income did not exceed 150 percent of the poverty level...

34 CFR 644.7 - What definitions apply?

Code of Federal Regulations, 2012 CFR

2012-07-01

... knowledge about— (i) Personal and family budget planning; (ii) Understanding credit building principles to..., personal costs); (v) Financial assistance (e.g., searches, application processes, and differences between... individual means an individual whose family's taxable income did not exceed 150 percent of the poverty level...

34 CFR 644.7 - What definitions apply?

Code of Federal Regulations, 2013 CFR

2013-07-01

... knowledge about— (i) Personal and family budget planning; (ii) Understanding credit building principles to..., personal costs); (v) Financial assistance (e.g., searches, application processes, and differences between... individual means an individual whose family's taxable income did not exceed 150 percent of the poverty level...

Phonon self-energy corrections to non-zero wavevector phonon modes in single-layer graphene

NASA Astrophysics Data System (ADS)

Araujo, Paulo; Mafra, Daniela; Sato, Kentaro; Saito, Richiiro; Kong, Jing; Dresselhaus, Mildred

2012-02-01

Phonon self-energy corrections have mostly been studied theoretically and experimentally for phonon modes with zone-center (q = 0) wave-vectors. Here, gate-modulated Raman scattering is used to study phonons of a single layer of graphene (1LG) in the frequency range from 2350 to 2750 cm-1, which shows the G* and the G'-band features originating from a double-resonant Raman process with q 0. The observed phonon renormalization effects are different from what is observed for the zone-center q = 0 case. To explain our experimental findings, we explored the phonon self-energy for the phonons with non-zero wave-vectors (q 0) in 1LG in which the frequencies and decay widths are expected to behave oppositely to the behavior observed in the corresponding zone-center q = 0 processes. Within this framework, we resolve the identification of the phonon modes contributing to the G* Raman feature at 2450 cm-1 to include the iTO+LA combination modes with q 0 and the 2iTO overtone modes with q = 0, showing both to be associated with wave-vectors near the high symmetry point K in the Brillouin zone.

The Neural Correlates of Cognitive Reappraisal during Emotional Autobiographical Memory Recall

PubMed Central

Holland, Alisha C.; Kensinger, Elizabeth A.

2013-01-01

We used fMRI to investigate the neural processes engaged as individuals down- and up-regulated the emotions associated with negative autobiographical memories (AMs) using cognitive reappraisal strategies. Our analyses examined neural activity during 3 separate phases, as participants: (a) viewed a reappraisal instruction (i.e., Decrease, Increase, Maintain), (b) searched for an AM referenced by a self-generated cue, and (c) elaborated upon the details of the AM being held in mind. Decreasing emotional intensity primarily engaged activity in regions previously implicated in cognitive control (e.g., dorsal and ventral lateral prefrontal cortex), emotion generation and processing (e.g., amygdala, insula), and visual imagery (e.g., precuneus) as participants searched for and retrieved events. In contrast, increasing emotional intensity engaged similar regions during the instruction phase (i.e., before a memory cue was presented) and again as individuals later elaborated upon the details of the events they had recalled. These findings confirm that reappraisal can modulate neural activity during the recall of personally-relevant events, though the time course of this modulation appears to depend on whether individuals are attempting to down- or up-regulate their emotions. PMID:22905826

I-PFO: the new technology for simple and flexible implementation of high productive on-the-fly remote processes

NASA Astrophysics Data System (ADS)

Müllegger, Andreas; Ryba, Tracey

2017-02-01

Standardized production systems which can be implemented, programmed, maintained and sourced in a simple and efficient way are key for a successful global production of automobiles or related parts at component suppliers. This is also valid for systems, which are built by laser based processes. One of the key applications is remote laser welding (RLW) of "Body in White" (BIW) parts (such as hang-on parts, B-Pillars, side frames, etc.), but also builtin components (such as car seats, batteries, etc.). The majority of RLW applications are based on the implementation of a 3-D scanner optic (e.g. the PFO 3D from TRUMPF) which positions the laser beam on the various component surfaces to be welded. Over the past 10 years it has been proven that the most efficient way to build up the RLW process is to have a system where an industrial robot and a scanner optic are combined in one production cell. They usually cooperate within an "On-The-Fly" (OTF) process as this ensures minimum cycle times. Until now there are several technologies on the market which can coordinate both the robot and scanner in the OTF mode. But none of them meet all requirements of global standardized production solutions. With the introduction of the I-PFO (Intelligent Programmable Focusing Optics) technology the situation has changed. It is now possible to program or adopt complex remote processes in a fast and easy way by the "Teach-in" function via the robot teach pendant. Additionally a 3D offline designer software is an option for this system. It automatically creates the ideal remote process based on the part, fixture, production cell and required process parameters. The I-PFO technology doesn't need additional hardware due to the fact that it runs on the controller within the PFO 3D. Furthermore it works together with different types of industrial robots (e.g. ABB, Fanuc and KUKA) which allow highest flexibility for the production planning phase. Finally a single TRUMPF laser source can supply up to six I-PFOs. This guarantees maximum beam-on time at the production line. Within this report the concept of the I-PFO technology (with mentioned functions) is described and is compared to the other existing ways for Remote Laser processing.

Near infrared spectroscopy combined with multivariate analysis for monitoring the ethanol precipitation process of fraction I + II + III supernatant in human albumin separation

NASA Astrophysics Data System (ADS)

Li, Can; Wang, Fei; Zang, Lixuan; Zang, Hengchang; Alcalà, Manel; Nie, Lei; Wang, Mingyu; Li, Lian

2017-03-01

Nowadays, as a powerful process analytical tool, near infrared spectroscopy (NIRS) has been widely applied in process monitoring. In present work, NIRS combined with multivariate analysis was used to monitor the ethanol precipitation process of fraction I + II + III (FI + II + III) supernatant in human albumin (HA) separation to achieve qualitative and quantitative monitoring at the same time and assure the product's quality. First, a qualitative model was established by using principal component analysis (PCA) with 6 of 8 normal batches samples, and evaluated by the remaining 2 normal batches and 3 abnormal batches. The results showed that the first principal component (PC1) score chart could be successfully used for fault detection and diagnosis. Then, two quantitative models were built with 6 of 8 normal batches to determine the content of the total protein (TP) and HA separately by using partial least squares regression (PLS-R) strategy, and the models were validated by 2 remaining normal batches. The determination coefficient of validation (Rp2), root mean square error of cross validation (RMSECV), root mean square error of prediction (RMSEP) and ratio of performance deviation (RPD) were 0.975, 0.501 g/L, 0.465 g/L and 5.57 for TP, and 0.969, 0.530 g/L, 0.341 g/L and 5.47 for HA, respectively. The results showed that the established models could give a rapid and accurate measurement of the content of TP and HA. The results of this study indicated that NIRS is an effective tool and could be successfully used for qualitative and quantitative monitoring the ethanol precipitation process of FI + II + III supernatant simultaneously. This research has significant reference value for assuring the quality and improving the recovery ratio of HA in industrialization scale by using NIRS.

Near infrared spectroscopy combined with multivariate analysis for monitoring the ethanol precipitation process of fraction I+II+III supernatant in human albumin separation.

PubMed

Li, Can; Wang, Fei; Zang, Lixuan; Zang, Hengchang; Alcalà, Manel; Nie, Lei; Wang, Mingyu; Li, Lian

2017-03-15

Nowadays, as a powerful process analytical tool, near infrared spectroscopy (NIRS) has been widely applied in process monitoring. In present work, NIRS combined with multivariate analysis was used to monitor the ethanol precipitation process of fraction I+II+III (FI+II+III) supernatant in human albumin (HA) separation to achieve qualitative and quantitative monitoring at the same time and assure the product's quality. First, a qualitative model was established by using principal component analysis (PCA) with 6 of 8 normal batches samples, and evaluated by the remaining 2 normal batches and 3 abnormal batches. The results showed that the first principal component (PC1) score chart could be successfully used for fault detection and diagnosis. Then, two quantitative models were built with 6 of 8 normal batches to determine the content of the total protein (TP) and HA separately by using partial least squares regression (PLS-R) strategy, and the models were validated by 2 remaining normal batches. The determination coefficient of validation (R p 2 ), root mean square error of cross validation (RMSECV), root mean square error of prediction (RMSEP) and ratio of performance deviation (RPD) were 0.975, 0.501g/L, 0.465g/L and 5.57 for TP, and 0.969, 0.530g/L, 0.341g/L and 5.47 for HA, respectively. The results showed that the established models could give a rapid and accurate measurement of the content of TP and HA. The results of this study indicated that NIRS is an effective tool and could be successfully used for qualitative and quantitative monitoring the ethanol precipitation process of FI+II+III supernatant simultaneously. This research has significant reference value for assuring the quality and improving the recovery ratio of HA in industrialization scale by using NIRS. Copyright © 2016 Elsevier B.V. All rights reserved.

A New Data Collection System for Ionospheric Modelling and Related Topics

DTIC Science & Technology

1993-04-15

Fluctuations of sgn, I strengt g d t1sr are cftcn os.;erved :,t utF frequencies in r ,:’i:- a t-e cayn r at r af’rer sunset. Marke d seasom c dependenc es in...Unfortunately there are few choices for real-time operating systems for PCs. The common alternate operating environments such as DeskView, MS Windows or...of the analog I/O and DMA support functions supplied by MetraByte. The processing module is where all the action is. After receiving a full data buffer

Triage and Injury Severity Scoring Systems Conference Held at Washington, D.C. on 26-28 September 1983.

DTIC Science & Technology

1984-02-01

AD = 37 925 TRIAGE AND INJURY SEVERITY SCORING SYSTEMS CONFERENCE i (U) WASHINGTON HOSPITAL CENTER DC H R CHAMPION ET AL. FEB 84 DAMDI7-83-G-9529...PROCESSING SHEET PREVIOUS EDITION MAY 3E USED UNTIL CDTIC 70A STOCK IS EXHAUSTED. AD TRIAGE ALM INJURY SEVERITY SCORING SYSTEMS CONFERENCE FINAL REPORT... WORK UNIT NUMBERS The Washington Hospital Center 62734A.3MI62734A875.AG.151 Washington, D.C. 20010 I I. CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT

RNA G-quadruplexes: emerging mechanisms in disease

PubMed Central

Cammas, Anne

2017-01-01

Abstract RNA G-quadruplexes (G4s) are formed by G-rich RNA sequences in protein-coding (mRNA) and non-coding (ncRNA) transcripts that fold into a four-stranded conformation. Experimental studies and bioinformatic predictions support the view that these structures are involved in different cellular functions associated to both DNA processes (telomere elongation, recombination and transcription) and RNA post-transcriptional mechanisms (including pre-mRNA processing, mRNA turnover, targeting and translation). An increasing number of different diseases have been associated with the inappropriate regulation of RNA G4s exemplifying the potential importance of these structures on human health. Here, we review the different molecular mechanisms underlying the link between RNA G4s and human diseases by proposing several overlapping models of deregulation emerging from recent research, including (i) sequestration of RNA-binding proteins, (ii) aberrant expression or localization of RNA G4-binding proteins, (iii) repeat associated non-AUG (RAN) translation, (iv) mRNA translational blockade and (v) disabling of protein–RNA G4 complexes. This review also provides a comprehensive survey of the functional RNA G4 and their mechanisms of action. Finally, we highlight future directions for research aimed at improving our understanding on RNA G4-mediated regulatory mechanisms linked to diseases. PMID:28013268

A live, attenuated pseudorabies virus strain JS-2012 deleted for gE/gI protects against both classical and emerging strains.

PubMed

Tong, Wu; Li, Guoxin; Liang, Chao; Liu, Fei; Tian, Qing; Cao, Yanyun; Li, Lin; Zheng, Xuchen; Zheng, Hao; Tong, Guangzhi

2016-06-01

Emerging pseudorabies virus (PRV) variant have led to pseudorabies outbreaks in Chinese pig farms. The commercially available PRV vaccine provides poor protection against the PRV variant. In this study, a gE/gI deleted PRV strain JS-2012-△gE/gI was generated from a PRV variant strain using homologous DNA recombination. Compared to the parental strain JS-2012, JS-2012-△gE/gI grew slowly and showed small plaque morphology on Vero cells. The safety and immunological efficacy of JS-2012-△gE/gI was evaluated as a vaccine candidate. JS-2012-△gE/gI was avirulent to suckling piglets, but was able to provide full protection for young piglets against challenge with both the classical virulent PRV and the emerging PRV variant. After sows were vaccinated with the gE/gI-deleted strain, their suckling offspring were resistant to an otherwise lethal challenge with the classical and the variant PRVs. Piglets inoculated with JS-2012-△gE/gI did not develop PRV-specific gE-ELISA antibodies. Thus, JS-2012-△gE/gI appears to be a promising marker vaccine candidate to control PRV variant circulating in pig farms in China. Copyright © 2016 Elsevier B.V. All rights reserved.

Rapid Processing of a Global Feature in the ON Visual Pathways of Behaving Monkeys.

PubMed

Huang, Jun; Yang, Yan; Zhou, Ke; Zhao, Xudong; Zhou, Quan; Zhu, Hong; Yang, Yingshan; Zhang, Chunming; Zhou, Yifeng; Zhou, Wu

2017-01-01

Visual objects are recognized by their features. Whereas, some features are based on simple components (i.e., local features, such as orientation of line segments), some features are based on the whole object (i.e., global features, such as an object having a hole in it). Over the past five decades, behavioral, physiological, anatomical, and computational studies have established a general model of vision, which starts from extracting local features in the lower visual pathways followed by a feature integration process that extracts global features in the higher visual pathways. This local-to-global model is successful in providing a unified account for a vast sets of perception experiments, but it fails to account for a set of experiments showing human visual systems' superior sensitivity to global features. Understanding the neural mechanisms underlying the "global-first" process will offer critical insights into new models of vision. The goal of the present study was to establish a non-human primate model of rapid processing of global features for elucidating the neural mechanisms underlying differential processing of global and local features. Monkeys were trained to make a saccade to a target in the black background, which was different from the distractors (white circle) in color (e.g., red circle target), local features (e.g., white square target), a global feature (e.g., white ring with a hole target) or their combinations (e.g., red square target). Contrary to the predictions of the prevailing local-to-global model, we found that (1) detecting a distinction or a change in the global feature was faster than detecting a distinction or a change in color or local features; (2) detecting a distinction in color was facilitated by a distinction in the global feature, but not in the local features; and (3) detecting the hole was interfered by the local features of the hole (e.g., white ring with a squared hole). These results suggest that monkey ON visual systems have a subsystem that is more sensitive to distinctions in the global feature than local features. They also provide the behavioral constraints for identifying the underlying neural substrates.

Development of the Second Generation Berry Impact Recording Device (BIRD II)

PubMed Central

Xu, Rui; Li, Changying

2015-01-01

To quantitatively measure the impacts during blueberry harvesting and post-harvest handling, this study designed the second generation Berry Impact Recording Device (BIRD II) sensor with a size of 21 mm in diameter and a weight of 3.9 g, which reduced the size by 17% and the weight by 50% compared to the previous prototype. The sensor was able to measure accelerations up to 346 g at a maximum frequency of 2 KHz. Universal Serial Bus (USB) was used to directly connect the sensor with the computer, removing the interface box used previously. LabVIEW-based PC software was designed to configure the sensor, download and process the data. The sensor was calibrated using a centrifuge. The accuracy of the sensor was between −1.76 g to 2.17 g, and the precision was between 0.21 g to 0.81 g. Dynamic drop tests showed that BIRD II had smaller variance in measurements than BIRD I. In terms of size and weight, BIRD II is more similar to an average blueberry fruit than BIRD I, which leads to more accurate measurements of the impacts for blueberries. PMID:25664430

Innovative Processing of Composites for Ultra-High Temperature Applications. Book 2

DTIC Science & Technology

1993-11-01

with dispersed aluminum and nickel particles [6). Successful toughening has also been observed in titanium aluminide [7] and molybdenum disilicide [g,9...2) Nb-based aluminides with the major focus on NbAl3. I Research Summary To achieve the goal of this program, the present investigation has been...toughening to produce hybrid composites. I Niobium aluminid Matrix Composites Reactive hot compaction (RHC) has been successfully utilized to produce

Handbook of Sonar Transducer Passive Materials

DTIC Science & Technology

1981-10-30

Water A sorption 570 -19 days 4.3 1.6 (mg/cm ) Water Permeability 38°C 44 (01 10gI 2 0Cm/cm 2 /cm-hr -torr) ൪ . .7- a. Compounding Recipe The gum...materials in sonar transducers I are discussed. Factors in the compounding and processing of elastorneric materials which affect end-product performance~ are...A. Scope of the Handbook ................ B. Problems r.,f General Consideration ............ C. Compounding of Elastomers

40 CFR Appendix R to Subpart G of... - Substitutes Subject to Use Restrictions Listed in the December 20, 2011 Final Rule, Effective...

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means that either the diameter differs by at least 1/16 inch or the thread direction is reversed (i.e...., process tubes). The color mark must extend at least 2.5 centimeters (1 inch) from the compressor and must... diameter differs by at least 1/16 inch or the thread direction is reversed (i.e., right-handed vs. left...

Do Hypervolumes Have Holes?

PubMed

Blonder, Benjamin

2016-04-01

Hypervolumes are used widely to conceptualize niches and trait distributions for both species and communities. Some hypervolumes are expected to be convex, with boundaries defined by only upper and lower limits (e.g., fundamental niches), while others are expected to be maximal, with boundaries defined by the limits of available space (e.g., potential niches). However, observed hypervolumes (e.g., realized niches) could also have holes, defined as unoccupied hyperspace representing deviations from these expectations that may indicate unconsidered ecological or evolutionary processes. Detecting holes in more than two dimensions has to date not been possible. I develop a mathematical approach, implemented in the hypervolume R package, to infer holes in large and high-dimensional data sets. As a demonstration analysis, I assess evidence for vacant niches in a Galapagos finch community on Isabela Island. These mathematical concepts and software tools for detecting holes provide approaches for addressing contemporary research questions across ecology and evolutionary biology.

Glass composite waste forms for iodine confined in bismuth-embedded SBA-15

NASA Astrophysics Data System (ADS)

Yang, Jae Hwan; Park, Hwan Seo; Ahn, Do-Hee; Yim, Man-Sung

2016-11-01

The aim of this study was to stabilize bismuth-embedded SBA-15 that captured iodine gas by fabrication of monolithic waste forms. The iodine containing waste was mixed with Bi2O3 (a stabilizing additive) and low-temperature sintering glass followed by pelletizing and the sintering process to produce glass composite materials. Iodine volatility during the sintering process was significantly affected by the ratio of Bi2O3 and the glass composition. It was confirmed that BiI3, the main iodine phase within bismuth-embedded SBA-15, was effectively transformed to the mixed phases of Bi5O7I and BiOI. The initial leaching rates of iodine from the glass composite waste forms ranged 10-3-10-2 g/m2 day, showing the stability of the iodine phases encapsulated by the glassy networks. It was also observed that common groundwater anions (e.g., chloride, carbonate, sulfite, and fluoride) elevated the iodine leaching rate by anion exchange reactions. The present results suggest that the glass composite waste form of bismuth-embedded SBA-15 could be a candidate material for stable storage of 129I.

Effect of the addition of IGF-I and vitamin E to stored boar semen.

PubMed

Mendez, M F B; Zangeronimo, M G; Rocha, L G P; Faria, B G; Pereira, B A; Fernandes, C D; Chaves, B R; Murgas, L D S; Sousa, R V

2013-05-01

The objective of this study was to evaluate the addition of IGF-I to pig insemination doses stored at 15°C, in conjunction with the addition of different amounts of vitamin E (α-tocopherol). Semen samples (n = 12) from four boars were treated by the addition of different concentrations of vitamin E, ranging up to 400 μg/ml. Immediately after processing and after the doses had been stored at 15°C for 24 or 72 h, samples were warmed at 37°C and 30 ng/ml of IGF-I was added. The assessments were made after 10 and 120 min of IGF-I addition. There was a minor effect of the vitamin E added before cooling and IGF-I added after storage on sperm quality. The addition of 400 μg/ml of vitamin E to diluted semen reduced (P < 0.01) the malondialdehyde (MDA) production in boar semen stored at 15°C for 72 h, regardless of the addition of IGF-I as additive during a 120 min incubation period at 37°C. In these conditions, IGF-I also reduced (P < 0.05) the MDA production in semen samples without addition of vitamin E. IGF-I in the presence of vitamin E reduced (P = 0.03) the glucose intake in freshly diluted boar semen samples before cooling. It was concluded that the addition of 400 μg/ml of vitamin E reduces the MDA production in boar semen stored at 15°C for 72 h, regardless of the presence of IGF-I additive. The addition of IGF-I in doses stored for 72 h with vitamin E ensures higher sperm motility after 120 min of incubation at 37°C.

Understanding the Delay in Onset of Pagets Disease of Bone

DTIC Science & Technology

2015-09-01

gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene

Final report on the maintenance asset management project : phase I.

DOT National Transportation Integrated Search

2012-07-01

This project resulted in the development of a proof of concept for a features inventory process to be used by field staff. The resulting concept is adaptable for different asset classes (e.g. culverts, guardrail) and able to leverage existing DOT res...

Study of visible luminescence spectra from Nd3+ doped TPO glass upon 808 nm excitation

NASA Astrophysics Data System (ADS)

Azam, Mohd; Rai, Vineet Kumar

2018-05-01

The Nd3+ doped TPO glasses have been prepared by melting and quenching method using the high temperature electric furnace. The upconversion (UC) spectra of Nd3+ doped TPO glasses at different concentration of rare ions have been recorded in the 400-700 nm wavelength range upon 808 nm laser excitation source. In the UC emission process, there are four bands centered at ˜495 nm, 546 nm, 602 nm and 653 nm respectively in the visible range were observed. But the green and red bands centered at˜546 nm and ˜653 nm corresponding to the 4G7/2 → 4I9/2 and 4G7/2 → 4I13/2 transitions respectively have been observed as the strong bands. The UC emission mechanism was observed as two photon process. The material can be used as a good NIR to visible upconverter and non-colour tunable display.

The contribution of extracurricular activities to adolescent friendships: new insights through social network analysis.

PubMed

Schaefer, David R; Simpkins, Sandra D; Vest, Andrea E; Price, Chara D

2011-07-01

Extracurricular activities are settings that are theorized to help adolescents maintain existing friendships and develop new friendships. The overarching goal of the current investigation was to examine whether coparticipating in school-based extracurricular activities supported adolescents' school-based friendships. We used social network methods and data from the National Longitudinal Study of Adolescent Health to examine whether dyadic friendship ties were more likely to exist among activity coparticipants while controlling for alternative friendship processes, namely dyadic homophily (e.g., demographic and behavioral similarities) and network-level processes (e.g., triadic closure). Results provide strong evidence that activities were associated with current friendships and promoted the formation of new friendships. These associations varied based on school level (i.e., middle vs. high school) and activity type (i.e., sports, academic, arts). Results of this study provide new insight into the complex relations between activities and friendship that can inform theories of their developmental outcomes. PsycINFO Database Record (c) 2011 APA, all rights reserved

The Contribution of Extracurricular Activities to Adolescent Friendships: New Insights through Social Network Analysis

PubMed Central

Schaefer, David R.; Simpkins, Sandra D.; Vest, Andrea E.; Price, Chara D.

2011-01-01

Extracurricular activities are settings that are theorized to help adolescents maintain existing friendships and develop new friendships. The overarching goal of the current investigation was to examine whether co-participating in school-based extracurricular activities supported adolescents’ school-based friendships. We utilized social network methods and data from the National Longitudinal Study of Adolescent Health to examine whether dyadic friendship ties were more likely to exist among activity co-participants while controlling for alternative friendship processes, namely dyadic homophily (e.g., demographic and behavioral similarities) and network-level processes (e.g., triadic closure). Results provide strong evidence that activities were associated with current friendships and promoted the formation of new friendships. These associations varied based on school level (i.e., middle versus high school) and activity type (i.e., sports, academic, arts). Results of this study provide new insight into the complex relations between activities and friendship that can inform theories of their developmental outcomes. PMID:21639618

The AquaDEB project (phase I): Analysing the physiological flexibility of aquatic species and connecting physiological diversity to ecological and evolutionary processes by using Dynamic Energy Budgets

NASA Astrophysics Data System (ADS)

Alunno-Bruscia, Marianne; van der Veer, Henk W.; Kooijman, Sebastiaan A. L. M.

2009-08-01

The European Research Project AquaDEB (2007-2011, http://www.ifremer.fr/aquadeb/) is joining skills and expertise of some French and Dutch research institutes and universities to analyse the physiological flexibility of aquatic organisms and to link it to ecological and evolutionary processes within a common theoretical framework for quantitative bioenergetics [Kooijman, S.A.L.M., 2000. Dynamic energy and mass budgets in biological systems. Cambridge University Press, Cambridge]. The main scientific objectives in AquaDEB are i) to study and compare the sensitivity of aquatic species (mainly molluscs and fish) to environmental variability of natural or human origin, and ii) to evaluate the related consequences at different biological levels (individual, population, ecosystem) and temporal scales (life cycle, population dynamics, evolution). At mid-term life, the AquaDEB collaboration has already yielded interesting results by quantifying bio-energetic processes of various aquatic species (e.g. molluscs, fish, crustaceans, algae) with a single mathematical framework. It has also allowed to federate scientists with different backgrounds, e.g. mathematics, microbiology, ecology, chemistry, and working in different fields, e.g. aquaculture, fisheries, ecology, agronomy, ecotoxicology, climate change. For the two coming years, the focus of the AquaDEB collaboration will be in priority: (i) to compare energetic and physiological strategies among species through the DEB parameter values and to identify the factors responsible for any differences in bioenergetics and physiology; and to compare dynamic (DEB) versus static (SEB) energy models to study the physiological performance of aquatic species; (ii) to consider different scenarios of environmental disruption (excess of nutrients, diffuse or massive pollution, exploitation by man, climate change) to forecast effects on growth, reproduction and survival of key species; (iii) to scale up the models for a few species from the individual level up to the level of evolutionary processes.

Variational PDE Models in Image Processing

DTIC Science & Technology

2002-07-31

161–168, 2001. [22] T. F. Chan and L. A. Vese. Active contour and segmentation models using ge- ometric PDE’s for medical imaging. Malladi , R . (Ed...continuous “movie” NMOPQ (with some small time step R ), D E >LK @ ’s are the estimated optical flows (i.e. velocity fields) at each moment. During...Bertalmio, G. Sapiro, V. Caselles, and C. Ballester. Image inpainting. Computer Graphics, SIGGRAPH 2000, July, 2000. [6] G. Birkhoff and C. R . De Boor

A Knowledge Dictionary System for Scheduling Support

DTIC Science & Technology

1988-10-01

quantity of the resource is allocated; (g) two (or more) activities that conflict temporall , can only proceed if one or more of the activities are re...does not allow any parameter substitution but merely processes the contents of the file as a series of I:eystrokes. To create a macro, simply type...bytes in the system. When the hardware actually uses such a struc- ture (e.g., the Motorola 68000 series CPU) the OS will almost always present it that

Friendly Extensible Transfer Tool Beta Version

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, William P.; Gutierrez, Kenneth M.; McRee, Susan R.

2016-04-15

Often data transfer software is designed to meet specific requirements or apply to specific environments. Frequently, this requires source code integration for added functionality. An extensible data transfer framework is needed to more easily incorporate new capabilities, in modular fashion. Using FrETT framework, functionality may be incorporated (in many cases without need of source code) to handle new platform capabilities: I/O methods (e.g., platform specific data access), network transport methods, data processing (e.g., data compression.).

Controls and variability of solute and sedimentary fluxes in Antarctic and sub-Antarctic Environments

NASA Astrophysics Data System (ADS)

Zwolinski, Zbigniew

2015-04-01

The currently prepared SEDIBUD Book on "Source-to-Sink Fluxes in Undisturbed Cold Environments" (edited by Achim A. Beylich, John C. Dixon and Zbigniew Zwolinski and published by Cambridge University Press) is summarizing and synthesizing the achievements of the International Association of Geomorphologists` (I.A.G./A.I.G.) Working Group SEDIBUD (Sediment Budgets in Cold Environments), which has been active since 2005 (http://www.geomorph.org/wg/wgsb.html). The book comprises five parts. One of them is part about sub-Antarctic and Antarctic Environments. This part "Sub-Antarctic and Antarctic Environments" describes two different environments, namely oceanic and continental ones. Each part contains results of research on environmental drivers and rates of contemporary solute and sedimentary fluxes in selected sites. Apart from describing the environmental conditions of the whole continent of Antarctica and sub-Antarctic islands (Zb.Zwolinski, M.Kejna, A.N.Lastochkin, A.Zhirov, S.Boltramovich) this part of the book characterizes terrestrial polar oases free from multi-year ice and snow covers (Zb.Zwolinski). The detailed results of geoecological and sedimentological research come from different parts of Antarctica. Antarctic continental shelf (E.Isla) is an example of sub-Antarctic oceanic environment. South Shetlands, especially King George Island (Zb.Zwolinski, M.Kejna, G.Rachlewicz, I.Sobota, J.Szpikowski), is an example of sub-Antarctic terrestrial environment. Antarctic Peninsula (G.Vieira, M.Francelino, J.C.Fernandes) and surroundings of McMurdo Dry Valleys (W.B.Lyons, K.A.Welch, J.Levy, A.Fountain, D.McKnight) are examples of Antarctic continental environments. The key goals of the Antarctic and sub-Antarctic book chapters are following: (i) identify the main environmental drivers and rates of contemporary solute and sedimentary fluxes, and (ii) model possible effects of projected climate change on solute and sedimentary fluxes in cold climate environments. Solute and sediment transport in the streams of analyzed environments are constrained by the relatively short water runoff season that typically lasts from a few weeks to maximum of four months during the austral summer, for Antarctic and sub-Antarctic regions respectively. Because of high intensity of mechanical and chemical weathering processes solute and sediment transport are rather high within Antarctic environments. Weathering rates on slopes and magnitude of fluvial transport in relatively short streams control the intensity of denudational processes. Both mechanical and chemical denudation varies highly through sub-Antarctic and Antarctic environments. To generate accurate predictions of fluvial and denudational processes we must fully understand the actual geoecological processes, which in some places are under rapid change, e.g., the Antarctic Peninsula and sub-Antarctic islands.

Ulex europaeus agglutinin-I binds to developing gastrin cells.

PubMed

Ge, Z H; Blom, J; Larsson, L I

1998-03-01

We have previously reported that antropyloric gastrin (G) and somatostatin (D) cells derive from precursor (G/D) cells that coexpress both hormones. We have now analyzed this endocrine cell pedigree for binding of Ulex europaeus agglutinin-I (UEA-I), which previously has been reported to represent a useful marker for cell differentiation. Subpopulations of G/D, D, and G cells were all found to express UEA-I binding. Labelling with bromodeoxyuridine showed that UEA-I positive G cells possessed a higher labelling index than UEA-I negative G cells. These data suggest that the UEA-I positive G cells represent maturing cells still involved in DNA synthesis and cell division. Electron microscopically, specific UEA-I binding sites were localized to the secretory granules and the apical cell membrane of G cells. We conclude that UEA-I represents a differentiation marker for G cells. Moreover, the presence of UEA-I binding sites in these cells may be relevant for Helicobacter pylori-mediated disturbances of gastric acid secretion and gastrin hypersecretion.

Formation of Globular Clusters with Internal Abundance Spreads in r-Process Elements: Strong Evidence for Prolonged Star Formation

NASA Astrophysics Data System (ADS)

Bekki, Kenji; Tsujimoto, Takuji

2017-07-01

Several globular clusters (GCs) in the Galaxy are observed to show internal abundance spreads in r-process elements (e.g., Eu). We propose a new scenario that explains the origin of these GCs (e.g., M5 and M15). In this scenario, stars with no/little abundance variations first form from a massive molecular cloud (MC). After all of the remaining gas of the MC is expelled by numerous supernovae, gas ejected from asymptotic giant branch stars can be accumulated in the central region of the GC to form a high-density intracluster medium (ICM). Merging of neutron stars then occurs to eject r-process elements, which can be efficiently trapped in and subsequently mixed with the ICM. New stars formed from the ICM can have r-process abundances that are quite different from those of earlier generations of stars within the GC. This scenario can explain both (I) why r-process elements can be trapped within GCs and (II) why GCs with internal abundance spreads in r-process elements do not show [Fe/H] spreads. Our model shows (I) that a large fraction of Eu-rich stars can be seen in Na-enhanced stellar populations of GCs, as observed in M15, and (II) why most of the Galactic GCs do not exhibit such internal abundance spreads. Our model demonstrates that the observed internal spreads of r-process elements in GCs provide strong evidence for prolonged star formation (˜108 yr).

Process Characterization of Electrical Discharge Machining of Highly Doped Silicon

DTIC Science & Technology

2012-06-01

EEE .! E# EEE @! E#EEEI! E#EEEJ! E# EE "! E# EE ".! E# EE "@! E# EE "I! E# EE "J! $L! $U! 07$(L<--B(L$B(F-O(D1$(ZL]\\(E[( GMU! GML! 64... EE ! LFE# EE ! L@F# EE ! L@E# EE ! L<F# EE ! L<E# EE ! L.F# EE ! &*6)! M! NDO! D! %A! DP! N5P! /G! G! LY > (Z B ; [( G&’=41416(D1ɟ$(H&%&C-$-%( IEFG(N.76=416(LY...roughing experiment. Surface roughness measurements ranged from just over 24

Signaling by Antibodies: Recent Progress

PubMed Central

Bournazos, Stylianos; Wang, Taia T.; Dahan, Rony; Maamary, Jad; Ravetch, Jeffrey V.

2017-01-01

IgG antibodies mediate a diversity of immune functions by coupling of antigen specificity through the Fab domain to signal transduction via Fc-Fc receptor interactions. Indeed, balanced IgG signaling through Type I and Type II Fc receptors is required for the control of pro-inflammatory, anti-inflammatory, and immunomodulatory processes. In this review, we discuss the mechanisms that govern IgG-Fc receptor interactions, highlighting the diversity of Fc receptor-mediated effector functions that regulate immunity and inflammation, as well as determine susceptibility to infection and autoimmunity, and responsiveness to antibody-based therapeutics, and vaccine responses. PMID:28446061

Investigation of Defect and Electronic Interactions Associated With GaAs Device Processing.

DTIC Science & Technology

1987-08-01

34 / sorption due to EL2. All of the photoconductivity measure- h I = g .1 X 10l cm- 3 K- 3/2 N, is the concentration of va- ments were performed at...arsenic vacancy complex 1J. Lagowski, D. G . Lin, T.-P. Chen, M. Skowronski, and H . C. Gatos, model,’"’ it should be mentioned that although an analogy...p. 509. J. Lagowaki. and H . C. Gatos, Appi. Phys. Left. 48.1162 (1986) OR. W. Halatyanid G . R. Cronin.t msisofSemiconductos, edited by M. sMh. Caldas

Individual versus group female-specific cognitive behavior therapy for alcohol use disorder.

PubMed

Epstein, Elizabeth E; McCrady, Barbara S; Hallgren, Kevin A; Gaba, Ayorkor; Cook, Sharon; Jensen, Noelle; Hildebrandt, Thomas; Holzhauer, Cathryn Glanton; Litt, Mark D

2018-05-01

To test group-based Female-Specific Cognitive Behavioral Therapy (G-FS-CBT) for women with Alcohol Use Disorder (AUD) against an individual Female-Specific Cognitive Behavioral Therapy (I-FS-CBT). This aims of this paper are to describe G-FS-CBT development, content, feasibility, acceptability, group process, engagement in treatment, and within- and post-treatment outcomes. Women with AUD (n=155) were randomly assigned to 12 manual-guided sessions of G-FS-CBT or I-FS-CBT; 138 women attended at least one treatment session. Women in G-FS-CBT attended fewer sessions (M=7.6) than women in I-FS-CBT (M=9.7; p<.001). Women in both conditions reported high satisfaction with the treatments. Independent coders rated high fidelity of delivery of both G-FS-CBT and I-FS-CBT. Therapeutic alliance with the therapist was high in both conditions, with I-FS-CBT being slightly but significantly higher than G-FS-CBT. In the first six weeks of treatment, women in both treatment conditions significantly reduced their percent drinking days (PDD) and percent heavy days drinking (PHD) by equivalent amounts, maintained through the rest of treatment and the 12month follow up with no treatment condition effects. Women reported significant improvement in all but one of the secondary outcomes during treatment; gains made during treatment in depression, anxiety, autonomy, and interpersonal problems were maintained during the follow-up period, while gains made during treatment in use of coping skills, self-efficacy for abstinence, self-care, and sociotropy deteriorated over follow up but remained improved compared to baseline. Findings support the feasibility, acceptability, and efficacy of a group format for female-specific CBT for AUD, a new 12-session, single gender, community friendly, group therapy with programming specifically for women. Similar, positive outcomes for individual and group treatment formats were found for drinking, mood, coping skills, self-confidence, interpersonal functioning, and self-care. Copyright © 2018. Published by Elsevier Inc.

Fate of Listeria monocytogenes in tissues of experimentally infected cattle and in hard salami.

PubMed Central

Johnson, J L; Doyle, M P; Cassens, R G; Schoeni, J L

1988-01-01

Muscle, organ, and lymphoid tissues of four Holstein cows experimentally inoculated (intravenously) with Listeria monocytogenes were examined 2, 6, or 54 days postinoculation for the presence of the organism by direct plating and cold enrichment procedures. L. monocytogenes was isolated from 66% of the tissues sampled; 38% of the isolations were attributed to the use of cold enrichment. Isolation of the organism from muscle tissue was possible only with animals inoculated 2 days before slaughter. The fate of L. monocytogenes during the manufacture and storage of fermented hard salami made from this meat also was determined. Three sausage treatments were evaluated: (i) uninoculated control sausage, (ii) "naturally" contaminated sausage (NC) made from meat of an experimentally inoculated cow, and (iii) sausage made from beef inoculated with a laboratory culture of L. monocytogenes (I). Initial Listeria levels in NC and I sausage were 10(3) CFU/g in trial 1 and 10(4) CFU/g in trial 2. Numbers of L. monocytogenes decreased by approximately 1 log10 CFU/g during fermentation and decreased further during drying and refrigerated storage. Small numbers (less than or equal to 20 CFU/g) of L. monocytogenes were present in I and NC sausage at the end of 12 weeks of refrigerated storage; recovery of these organisms generally depended on the use of an enrichment procedure. The results indicate that L. monocytogenes does not multiply during the fermentation and drying processes typical of hard salami manufacture but that survival may occur if the organism is initially present at greater than or equal to 10(3) CFU/g. PMID:3128165

Switch I-dependent allosteric signaling in a G-protein chaperone-B12 enzyme complex.

PubMed

Campanello, Gregory C; Lofgren, Michael; Yokom, Adam L; Southworth, Daniel R; Banerjee, Ruma

2017-10-27

G-proteins regulate various processes ranging from DNA replication and protein synthesis to cytoskeletal dynamics and cofactor assimilation and serve as models for uncovering strategies deployed for allosteric signal transduction. MeaB is a multifunctional G-protein chaperone, which gates loading of the active 5'-deoxyadenosylcobalamin cofactor onto methylmalonyl-CoA mutase (MCM) and precludes loading of inactive cofactor forms. MeaB also safeguards MCM, which uses radical chemistry, against inactivation and rescues MCM inactivated during catalytic turnover by using the GTP-binding energy to offload inactive cofactor. The conserved switch I and II signaling motifs used by G-proteins are predicted to mediate allosteric regulation in response to nucleotide binding and hydrolysis in MeaB. Herein, we targeted conserved residues in the MeaB switch I motif to interrogate the function of this loop. Unexpectedly, the switch I mutations had only modest effects on GTP binding and on GTPase activity and did not perturb stability of the MCM-MeaB complex. However, these mutations disrupted multiple MeaB chaperone functions, including cofactor editing, loading, and offloading. Hence, although residues in the switch I motif are not essential for catalysis, they are important for allosteric regulation. Furthermore, single-particle EM analysis revealed, for the first time, the overall architecture of the MCM-MeaB complex, which exhibits a 2:1 stoichiometry. These EM studies also demonstrate that the complex exhibits considerable conformational flexibility. In conclusion, the switch I element does not significantly stabilize the MCM-MeaB complex or influence the affinity of MeaB for GTP but is required for transducing signals between MeaB and MCM. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Distinct Functional Connectivities Predict Clinical Response with Emotion Regulation Therapy

PubMed Central

Fresco, David M.; Roy, Amy K.; Adelsberg, Samantha; Seeley, Saren; García-Lesy, Emmanuel; Liston, Conor; Mennin, Douglas S.

2017-01-01

Despite the success of available medical and psychosocial treatments, a sizable subgroup of individuals with commonly co-occurring disorders, generalized anxiety disorder (GAD) and major depressive disorder (MDD), fail to make sufficient treatment gains thereby prolonging their deficits in life functioning and satisfaction. Clinically, these patients often display temperamental features reflecting heightened sensitivity to underlying motivational systems related to threat/safety and reward/loss (e.g., somatic anxiety) as well as inordinate negative self-referential processing (e.g., worry, rumination). This profile may reflect disruption in two important neural networks associated with emotional/motivational salience (e.g., salience network) and self-referentiality (e.g., default network, DN). Emotion Regulation Therapy (ERT) was developed to target this hypothesized profile and its neurobehavioral markers. In the present study, 22 GAD patients (with and without MDD) completed resting state MRI scans before receiving 16 sessions of ERT. To test study these hypotheses, we examined the associations between baseline patterns of intrinsic functional connectivity (iFC) of the insula and of hubs within the DN (anterior and dorsal medial prefrontal cortex [MPFC] and posterior cingulate cortex [PCC]) and treatment-related changes in worry, somatic anxiety symptoms and decentering. Results suggest that greater treatment linked reductions in worry were associated with iFC clusters in both the insular and parietal cortices. Greater treatment linked gains in decentering, a metacognitive process that involves the capacity to observe items that arise in the mind with healthy psychological distance that is targeted by ERT, was associated with iFC clusters in the anterior and posterior DN. The current study adds to the growing body of research implicating disruptions in the default and salience networks as promising targets of treatment for GAD with and without co-occurring MDD. PMID:28316567

Report on IVS-WG4

NASA Astrophysics Data System (ADS)

Gipson, John

2011-07-01

I describe the proposed data structure for storing, archiving and processing VLBI data. In this scheme, most VLBI data is stored in NetCDF files. NetCDF has the advantage that there are interfaces to most common computer languages including Fortran, Fortran-90, C, C++, Perl, etc, and the most common operating systems including linux, Windows and Mac. The data files for a particular session are organized by special ASCII "wrapper" files which contain pointers to the data files. This allows great flexibility in the processing and analysis of VLBI data, and also allows for extending the types of data used, e.g., source maps. I discuss the use of the new format in calc/solve and other VLBI analysis packages. I also discuss plans for transitioning to the new structure.

Alcoholic fermentation with flocculant Saccharomyces cerevisiae in fed-batch process.

PubMed

Guidini, Carla Zanella; Marquez, Líbia Diniz Santos; de Almeida Silva, Helisângela; de Resende, Miriam Maria; Cardoso, Vicelma Luiz; Ribeiro, Eloízio Júlio

2014-02-01

Studies have been conducted on selecting yeast strains for use in fermentation for ethanol production to improve the performance of industrial plants and decrease production costs. In this paper, we study alcoholic fermentation in a fed-batch process using a Saccharomyces cerevisiae yeast strain with flocculant characteristics. Central composite design (CCD) was used to determine the optimal combination of the variables involved, with the sucrose concentration of 170 g/L, a cellular concentration in the inoculum of 40% (v/v), and a filling time of 6 h, which resulted in a 92.20% yield relative to the theoretical maximum yield, a productivity of 6.01 g/L h and a residual sucrose concentration of 44.33 g/L. With some changes in the process such as recirculation of medium during the fermentation process and increase in cellular concentration in the inoculum after use of the CCD was possible to reduce the residual sucrose concentration to 2.8 g/L in 9 h of fermentation and increase yield and productivity for 92.75% and 9.26 g/L h, respectively. A model was developed to describe the inhibition of alcoholic fermentation kinetics by the substrate and the product. The maximum specific growth rate was 0.103 h(-1), with K(I) and K(s) values of 109.86 and 30.24 g/L, respectively. The experimental results from the fed-batch reactor show a good fit with the proposed model, resulting in a maximum growth rate of 0.080 h(-1).

Implementing successful strategic plans: a simple formula.

PubMed

Blondeau, Whitney; Blondeau, Benoit

2015-01-01

Strategic planning is a process. One way to think of strategic planning is to envision its development and design as a framework that will help your hospital navigate through internal and external changing environments over time. Although the process of strategic planning can feel daunting, following a simple formula involving five steps using the mnemonic B.E.G.I.N. (Begin, Evaluate, Goals & Objectives, Integration, and Next steps) will help the planning process feel more manageable, and lead you to greater success.

ALKALINE CARBONATE LEACHING PROCESS FOR URANIUM EXTRACTION

DOEpatents

Thunaes, A.; Brown, E.A.; Rabbitts, A.T.

1957-11-12

A process for the leaching of uranium from high carbonate ores is presented. According to the process, the ore is leached at a temperature of about 200 deg C and a pressure of about 200 p.s.i.g. with a solution containing alkali carbonate, alkali permanganate, and bicarbonate ion, the bicarbonate ion functionlng to prevent premature formation of alkali hydroxide and consequent precipitation of a diuranate. After the leaching is complete, the uranium present is recovered by precipitation with NaOH.

Neural correlates of context-dependent feature conjunction learning in visual search tasks.

PubMed

Reavis, Eric A; Frank, Sebastian M; Greenlee, Mark W; Tse, Peter U

2016-06-01

Many perceptual learning experiments show that repeated exposure to a basic visual feature such as a specific orientation or spatial frequency can modify perception of that feature, and that those perceptual changes are associated with changes in neural tuning early in visual processing. Such perceptual learning effects thus exert a bottom-up influence on subsequent stimulus processing, independent of task-demands or endogenous influences (e.g., volitional attention). However, it is unclear whether such bottom-up changes in perception can occur as more complex stimuli such as conjunctions of visual features are learned. It is not known whether changes in the efficiency with which people learn to process feature conjunctions in a task (e.g., visual search) reflect true bottom-up perceptual learning versus top-down, task-related learning (e.g., learning better control of endogenous attention). Here we show that feature conjunction learning in visual search leads to bottom-up changes in stimulus processing. First, using fMRI, we demonstrate that conjunction learning in visual search has a distinct neural signature: an increase in target-evoked activity relative to distractor-evoked activity (i.e., a relative increase in target salience). Second, we demonstrate that after learning, this neural signature is still evident even when participants passively view learned stimuli while performing an unrelated, attention-demanding task. This suggests that conjunction learning results in altered bottom-up perceptual processing of the learned conjunction stimuli (i.e., a perceptual change independent of the task). We further show that the acquired change in target-evoked activity is contextually dependent on the presence of distractors, suggesting that search array Gestalts are learned. Hum Brain Mapp 37:2319-2330, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Digital Library Storage using iRODS Data Grids

NASA Astrophysics Data System (ADS)

Hedges, Mark; Blanke, Tobias; Hasan, Adil

Digital repository software provides a powerful and flexible infrastructure for managing and delivering complex digital resources and metadata. However, issues can arise in managing the very large, distributed data files that may constitute these resources. This paper describes an implementation approach that combines the Fedora digital repository software with a storage layer implemented as a data grid, using the iRODS middleware developed by DICE (Data Intensive Cyber Environments) as the successor to SRB. This approach allows us to use Fedoras flexible architecture to manage the structure of resources and to provide application- layer services to users. The grid-based storage layer provides efficient support for managing and processing the underlying distributed data objects, which may be very large (e.g. audio-visual material). The Rule Engine built into iRODS is used to integrate complex workflows at the data level that need not be visible to users, e.g. digital preservation functionality.

Get excited: reappraising pre-performance anxiety as excitement.

PubMed

Brooks, Alison Wood

2014-06-01

Individuals often feel anxious in anticipation of tasks such as speaking in public or meeting with a boss. I find that an overwhelming majority of people believe trying to calm down is the best way to cope with pre-performance anxiety. However, across several studies involving karaoke singing, public speaking, and math performance, I investigate an alternative strategy: reappraising anxiety as excitement. Compared with those who attempt to calm down, individuals who reappraise their anxious arousal as excitement feel more excited and perform better. Individuals can reappraise anxiety as excitement using minimal strategies such as self-talk (e.g., saying "I am excited" out loud) or simple messages (e.g., "get excited"), which lead them to feel more excited, adopt an opportunity mind-set (as opposed to a threat mind-set), and improve their subsequent performance. These findings suggest the importance of arousal congruency during the emotional reappraisal process. PsycINFO Database Record (c) 2014 APA, all rights reserved.

The impact of granulocyte colony stimulating factor at content of donor lymphocytes collected for cellular immunotherapy.

PubMed

Arat, Mutlu; Arslan, Onder; Gürman, Günhan; Dalva, Klara; Ozcan, Muhit; Uğur, Aynur; Ilhan, Osman

2004-02-01

Donor lymphocyte infusions (DLI) have become widely used for prevention or treatment of relapse after allogeneic hematopoietic stem cell transplantation. Increasing use of reduced intensity conditioning regimens (RICR) and subsequent application of DLI forced the hemapheresis centers to collect donor lymphocytes in certain quantity and quality. The place of growth factors especially granulocyte colony stimulating factor (rhG-CSF, filgrastim) in allogeneic hemapoietic stem cell (HSC) collection is established, but there is no consensus about the role of rhG-CSF. We aimed to clarify the dose effect of rhG-CSF on lymphocyte subpopulations (CD3+, CD3+4+, CD3+8+, CD19+, CD3-16+56+) cells and CD34+ HSC. Major indications for DLI (mean volume: 180+/-52 ml) were for relapse or transplants using RICR mainly in patients with acute leukemia (n=20) or chronic myeloid leukemia (n=15). In four years we performed 40 lymphocyte apheresis (LA) on 30 healthy (med. age 28, M/F 21/9) donors using continuous flow cell separators by processing 2-2.5 times of their total blood volume (TBV). The apheresis data is divided into three groups according to rhG-CSF dose used for priming. Donors in Group I (n=18), Group II (n=9) and Group III (n=13) received no rhG-CSF (steady state), rhG-CSF 5 microg/kg/dsc x 5 days and rhG-CSF 10 microg/kg/dsc x 5 days, respectively. There was no difference within groups concerning TBV processed and recipient body weight. A total of 11,565 ml (+/-3700) of blood was processed in 216 min (+/-36.5) at an inlet of 56.8 ml/min (+/-10.6) using 999 ml (+/-307) ACD. The CD34+ HSC increased with increasing rhG-CSF dose as expected. Median CD3+ lymphocyte yield per recipient body weight in Group I, II and III were 0.9 x 10e8/kg (range: 0.1-2.1), 2.9 x 10e8/kg (range: 1.6-4.3) and 2.1 x 10e8/kg (range: 0.6-6.9), respectively. The primed donors T lymphocyte yield was 2-3-fold more in comparison to Group I. This gain was most significant between Group I and III in terms of mean CD3+ (1.09 x 10e8/kg vs 2.41 x 10e8/kg, p=0.02), CD3+4+ (0.64 x 10e8/kg vs 1.44 x 10e8/kg, p=0.02) and CD3+8+ (0.42 x 10e8/kg vs 0.89 x 10e8/kg, p=0.03) cells, respectively. Though the yield of lymphocyte subsets in G-CSF primed donors exceeds the non-primed donors, the target range of 1 x 10e7-1 x 10e8/kg CD3+ lymphocytes could be achieved in the majority of the apheresis procedures without rhG-CSF priming. The yield of T and B lymphocyte subsets are increased by G-CSF stimulation but not on a logarithmic scale, which did not correlate into a clinical relevance.

VizieR Online Data Catalog: Palomar Transient Factory photometric observations (Arcavi+, 2014)

NASA Astrophysics Data System (ADS)

Arcavi, I.; Gal-Yam, A.; Sullivan, M.; Pan, Y.-C.; Cenko, S. B.; Horesh, A.; Ofek, E. O.; De Cia, A.; Yan, L.; Yang, C.-W.; Howell, D. A.; Tal, D.; Kulkarni, S. R.; Tendulkar, S. P.; Tang, S.; Xu, D.; Sternberg, A.; Cohen, J. G.; Bloom, J. S.; Nugent, P. E.; Kasliwal, M. M.; Perley, D. A.; Quimby, R. M.; Miller, A. A.; Theissen, C. A.; Laher, R. R.

2017-04-01

All the events from our archival search were discovered by the Palomar 48 inch Oschin Schmidt Telescope (P48) as part of the PTF survey using the Mould R-band filter. We obtained photometric observations in the R and g bands using P48, and in g, r, and i bands with the Palomar 60 inch telescope (P60; Cenko et al. 2006PASP..118.1396C). Initial processing of the P48 images was conducted by the Infrared Processing and Analysis Center (IPAC; Laher et al. 2014PASP..126..674L). Photometry was extracted using a custom PSF fitting routine (e.g., Sullivan et al. 2006AJ....131..960S), which measures the transient flux after image subtraction (using template images taken before the outburst or long after it faded). (1 data file).

The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

PubMed

Bondar, Alexey; Lazar, Josef

2017-06-09

The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

78 FR 39346 - Self-Regulatory Organizations; NASDAQ OMX PHLX LLC; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-01

... collected, unless a Quote Exhaust has occurred, in which case the Quote Exhaust process in Rule 1082(a)(ii.... * * * * * Rule 1082 Firm Quotations (a)(i)-(ii)(B)(3)(g)(v) No change. (vi) If, after trading at the Phlx and/or... occurred, in which case the Quote Exhaust process in Rule 1082(a)(ii)(B)(3) will ensue,\\6\\ triggering a new...

Man as an Information Processor: A Bibliography (1972-1976).

DTIC Science & Technology

1977-09-01

Alloway (Eds.), Communication and affect: Language and thought. New York, MY: Academic Press, 1973, 200. Craik , F. I., & Lockhart , R. S. Levels of...Mazuryk, G. F., & Lockhart , R. S. Negative recency and levels of processing in free recall. Canadian Journal of Psychology, 1974, 28(1), 114-123...capability -- to accomplish work in the area of information and decision processes at both the exploratory development and advanced development levels

Protection and synergism by recombinant fowl pox vaccines expressing multiple genes from Marek's disease virus.

PubMed

Lee, Lucy E; Witter, R L; Reddy, S M; Wu, P; Yanagida, N; Yoshida, S

2003-01-01

Recombinant fowl poxviruses (rFPVs) were constructed to express genes from serotype 1 Marek's disease virus (MDV) coding for glycoproteins B, E, I, H, and UL32 (gB1, gE, gI, gH, and UL32). An additional rFPV was constructed to contain four MDV genes (gB1, gE, gI, and UL32). These rFPVs were evaluated for their ability to protect maternal antibody-positive chickens against challenge with highly virulent MDV isolates. The protection induced by a single rFPV/gB1 (42%) confirmed our previous finding. The protection induced by rFPV/gI (43%), rFPV/gB1UL32 (46%), rFPV/gB1gEgI (72%), and rFPV/gB1gEgIUL32 (70%) contributed to additional knowledge on MDV genes involved in protective immunity. In contrast, the rFPV containing gE, gH, or UL32 did not induce significant protection compared with turkey herpesvirus (HVT). Levels of protection by rFPV/gB1 and rFPV/gl were comparable with that of HVT. Only gB1 and gI conferred synergism in rFPV containing these two genes. Protection by both rFPV/gB1gEgI (72%) and rFPV/gB1gEgIUL32(70%) against Marek's disease was significantly enhanced compared with a single gB1 or gI gene (40%). This protective synergism between gB1 and gI in rFPVs may be the basis for better protection when bivalent vaccines between serotypes 2 and 3 were used. When rFPV/gB1gIgEUL32 + HVT were used as vaccine against Md5 challenge, the protection was significantly enhanced (94%). This synergism between rFPV/gB1gIgEUL32 and HVT indicates additional genes yet to be discovered in HVT may be responsible for the enhancement.

Methodology of Calculation the Terminal Settling Velocity Distribution of Spherical Particles for High Values of the Reynold's Number

NASA Astrophysics Data System (ADS)

Surowiak, Agnieszka; Brożek, Marian

2014-03-01

The particle settling velocity is the feature of separation in such processes as flowing classification and jigging. It characterizes material forwarded to the separation process and belongs to the so-called complex features because it is the function of particle density and size. i.e. the function of two simple features. The affiliation to a given subset is determined by the values of two properties and the distribution of such feature in a sample is the function of distributions of particle density and size. The knowledge about distribution of particle settling velocity in jigging process is as much important factor as knowledge about particle size distribution in screening or particle density distribution in dense media beneficiation. The paper will present a method of determining the distribution of settling velocity in the sample of spherical particles for the turbulent particle motion in which the settling velocity is expressed by the Newton formula. Because it depends on density and size of particle which are random variable of certain distributions, the settling velocity is a random variable. Applying theorems of probability, concerning distributions function of random variables, the authors present general formula of probability density function of settling velocity for the turbulent motion and particularly calculate probability density function for Weibull's forms of frequency functions of particle size and density. Distribution of settling velocity will calculate numerically and perform in graphical form. The paper presents the simulation of calculation of settling velocity distribution on the basis of real distributions of density and projective diameter of particles assuming that particles are spherical. Prędkość opadania ziarna jest cechą rozdziału w takich procesach przeróbki surowców jak klasyfikacja czy wzbogacanie w osadzarce. Cecha ta opisuje materiał kierowany do procesu rozdziału i należy do tzw. cech złożonych, ze względu na to, że jest funkcją dwóch cech prostych, którymi są: wielkość ziarna i gęstość ziarna. Przynależność do określonego podzbioru ziaren jest określona przez wartość dwóch cech, a rozkład tych cech w próbce jest funkcją rozkładów gęstości i wielkości ziarna. Znajomość rozkładu prędkości opadania ziaren w osadzarce jest istotnym parametrem jak znajomość rozkładu wielkości ziarna w procesie przesiewania czy znajomość rozkładu gęstości w procesie wzbogacania w cieczach ciężkich. W artykule przedstawiono metodykę wyliczania rozkładu prędkości opadania ziaren sferycznych w warunkach ruchu turbulentnego wyrażonego przy pomocy równania Newtona. Zarówno gęstość jak i wielkość ziarna są zmiennymi losowymi o określonych rozkładach. W związku z tym prędkość opadania ziarna jako funkcja cech prostych tj. gęstości i wielkości ziarna będzie również zmienną losową o rozkładzie, który jest funkcją rozkładów argumentów prostych. Wykorzystując twierdzenia rachunku prawdopodobieństwa odnoszące się do rozkładów funkcji zmiennych losowych przedstawiono ogólny wzór na funkcję gęstości rozkładu prędkości opadania w warunkach ruchu turbulentnego. Empiryczne rozkłady wielkości i gęstości ziaren aproksymowano rozkładem Weibulla. Rozkład prędkości opadania wyliczono numerycznie i przedstawiono w postaci graficznej. W artykule przedstawiono symulację wyliczania rozkładu prędkości opadania w oparciu o rzeczywiste rozkłady gęstości i średnicy projekcyjnej ziaren zakładając, że ziarna mają kształt sferyczny.

Bioactivity of 2′-deoxyinosine-incorporated aptamer AS1411

PubMed Central

Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

2016-01-01

Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2′-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2′-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2′-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2′-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2′-deoxyinosine moieties in interactive binding processes. PMID:27194215

Bioactivity of 2'-deoxyinosine-incorporated aptamer AS1411.

PubMed

Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

2016-05-19

Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2'-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2'-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2'-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2'-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2'-deoxyinosine moieties in interactive binding processes.

Adsorption of Ag (I) from aqueous solution by waste yeast: kinetic, equilibrium and mechanism studies.

PubMed

Zhao, Yufeng; Wang, Dongfang; Xie, Hezhen; Won, Sung Wook; Cui, Longzhe; Wu, Guiping

2015-01-01

One type of biosorbents, brewer fermentation industry waste yeast, was developed to adsorb the Ag (I) in aqueous solution. The result of FTIR analysis of waste yeast indicated that the ion exchange, chelating and reduction were the main binding mechanisms between the silver ions and the binding sites on the surface of the biomass. Furthermore, TEM, XRD and XPS results suggested that Ag(0) nanoparticles were deposited on the surface of yeast. The kinetic experiments revealed that sorption equilibrium could reach within 60 min, and the removal efficiency of Ag (I) could be still over 93 % when the initial concentration of Ag (I) was below 100 mg/L. Thermodynamic parameters of the adsorption process (ΔG, ΔH and ΔS) identified that the adsorption was a spontaneous and exothermic process. The waste yeast, playing a significant role in the adsorption of the silver ions, is useful to fast adsorb Ag (I) from low concentration.

5 CFR 9701.521 - Grievance procedures.

Code of Federal Regulations, 2010 CFR

2010-01-01

... paragraphs (d), (f), and (g) of this section, the procedures must be the exclusive administrative procedures... simple, provide for expeditious processing, and include procedures that— (i) Assure an exclusive representative the right, in its own behalf or on behalf of any employee in the unit represented by the exclusive...

Storying Literacies, Reimagining Classrooms: Teaching, Research, and Writing as Blurred Translating

ERIC Educational Resources Information Center

McManimon, Shannon K.

2014-01-01

I theorize teaching and researching as practices of "blurred translating" that center antioppressive education (Kumashiro, 2002) and storytelling (e.g., Frank, 2010; Zipes, 1995, 2004). Based in listening, research and teaching as blurred translating are relational, contextual, and ongoing processes oriented toward transformation and…

Evaluating the Air Quality, Climate & Economic Impacts of Biogas Management Technologies

EPA Science Inventory

Anaerobic digestion is a natural biological process in which microorganisms break down organic materials in the absence of oxygen. When anaerobic microbes metabolize organic waste – i.e., the carbon-based remains of plants, animals and their waste products, e.g. animal manu...

49 CFR 240.309 - Railroad oversight responsibilities.

Code of Federal Regulations, 2014 CFR

2014-10-01

... following punishments was imposed by the hearing officer: (i) The person was withheld from service; (ii) The... punishment was imposed only that punishment deemed the most severe shall be shown. (g) For reporting purposes...) The number of instances in which the railroad's internal appeals process reduced the punishment...

49 CFR 240.309 - Railroad oversight responsibilities.

Code of Federal Regulations, 2012 CFR

2012-10-01

... following punishments was imposed by the hearing officer: (i) The person was withheld from service; (ii) The... punishment was imposed only that punishment deemed the most severe shall be shown. (g) For reporting purposes...) The number of instances in which the railroad's internal appeals process reduced the punishment...

49 CFR 240.309 - Railroad oversight responsibilities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... following punishments was imposed by the hearing officer: (i) The person was withheld from service; (ii) The... punishment was imposed only that punishment deemed the most severe shall be shown. (g) For reporting purposes...) The number of instances in which the railroad's internal appeals process reduced the punishment...

49 CFR 240.309 - Railroad oversight responsibilities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... following punishments was imposed by the hearing officer: (i) The person was withheld from service; (ii) The... punishment was imposed only that punishment deemed the most severe shall be shown. (g) For reporting purposes...) The number of instances in which the railroad's internal appeals process reduced the punishment...

Effective solidification/stabilisation of mercury-contaminated wastes using zeolites and chemically bonded phosphate ceramics.

PubMed

Zhang, Shaoqing; Zhang, Xinyan; Xiong, Ya; Wang, Guoping; Zheng, Na

2015-02-01

In this study, two kinds of zeolites materials (natural zeolite and thiol-functionalised zeolite) were added to the chemically bonded phosphate ceramic processes to treat mercury-contaminated wastes. Strong promotion effects of zeolites (natural zeolite and thiol-functionalised zeolite) on the stability of mercury in the wastes were obtained and these technologies showed promising advantages toward the traditional Portland cement process, i.e. using Portland cement as a solidification agent and natural or thiol-functionalised zeolite as a stabilisation agent. Not only is a high stabilisation efficiency (lowered the Toxicity Characteristic Leaching Procedure Hg by above 10%) obtained, but also a lower dosage of solidification (for thiol-functionalised zeolite as stabilisation agent, 0.5 g g(-1) and 0.7 g g(-1) for chemically bonded phosphate ceramic and Portland cement, respectively) and stabilisation agents (for natural zeolite as stabilisation agent, 0.35 g g(-1) and 0.4 g g(-1) for chemically bonded phosphate ceramic and Portland cement, respectively) were used compared with the Portland cement process. Treated by thiol-functionalised zeolite and chemically bonded phosphate ceramic under optimum parameters, the waste containing 1500 mg Hg kg(-1) passed the Toxicity Characteristic Leaching Procedure test. Moreover, stabilisation/solidification technology using natural zeolite and chemically bonded phosphate ceramic also passed the Toxicity Characteristic Leaching Procedure test (the mercury waste containing 625 mg Hg kg(-1)). Moreover, the presence of chloride and phosphate did not have a negative effect on the chemically bonded phosphate ceramic/thiol-functionalised zeolite treatment process; thus, showing potential for future application in treatment of 'difficult-to-manage' mercury-contaminated wastes or landfill disposal with high phosphate and chloride content. © The Author(s) 2015.

Gyrokinetic and kinetic particle-in-cell simulations of guide-field reconnection. I. Macroscopic effects of the electron flows

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muñoz, P. A., E-mail: munozp@mps.mpg.de; Kilian, P.; Büchner, J.

In this work, we compare gyrokinetic (GK) with fully kinetic Particle-in-Cell (PIC) simulations of magnetic reconnection in the limit of strong guide field. In particular, we analyze the limits of applicability of the GK plasma model compared to a fully kinetic description of force free current sheets for finite guide fields (b{sub g}). Here, we report the first part of an extended comparison, focusing on the macroscopic effects of the electron flows. For a low beta plasma (β{sub i} = 0.01), it is shown that both plasma models develop magnetic reconnection with similar features in the secondary magnetic islands if a sufficientlymore » high guide field (b{sub g} ≳ 30) is imposed in the kinetic PIC simulations. Outside of these regions, in the separatrices close to the X points, the convergence between both plasma descriptions is less restrictive (b{sub g} ≳ 5). Kinetic PIC simulations using guide fields b{sub g} ≲ 30 reveal secondary magnetic islands with a core magnetic field and less energetic flows inside of them in comparison to the GK or kinetic PIC runs with stronger guide fields. We find that these processes are mostly due to an initial shear flow absent in the GK initialization and negligible in the kinetic PIC high guide field regime, in addition to fast outflows on the order of the ion thermal speed that violate the GK ordering. Since secondary magnetic islands appear after the reconnection peak time, a kinetic PIC/GK comparison is more accurate in the linear phase of magnetic reconnection. For a high beta plasma (β{sub i} = 1.0) where reconnection rates and fluctuations levels are reduced, similar processes happen in the secondary magnetic islands in the fully kinetic description, but requiring much lower guide fields (b{sub g} ≲ 3)« less

Acute toxicities of copper, cadmium and Cu: Cd mixture to larvae of the shrimp Penaeus Penicillatus

NASA Astrophysics Data System (ADS)

Munshi, A. B.; Su, Yong-Quan; Li, Shao-Jing

1996-06-01

This study showed lethal concentrations (LC) of copper for Peneaus penicillatus at various stages of its life cycle were 1000 μg/L for nauplii, 1000 μg/L for Zoea I, 2000 vg/L for Zoea II, 2500 μg/L for Zoea III, 3000 μg/L for Mysis I, II and III and that for almost 100% mortality for postlarvae was 3000 μg/L. For cadmium LC were 100 μg/L for nauplii, 500 μg/L for Zoea I, 1000 μg/L for Zoea II, 2000 μg/L for Zoea III, 2500 μg/L for Mysis I and 3500 μg/L for Mysis II, III and postlarvae. For mixture of both metals, LC were 400 μg/L for nauplii, 1000 μg/L for Zoea I, 2000 μg/L for Zoea II and 3000 μg/L for Mysis I, II, III and post larvae.

Foundry and Solidification Processing Laboratory | College of Engineering &

Science.gov Websites

Applied Science A B C D E F G H I J K L M N O P Q R S T U V W X Y Z D2L PAWS Email My UW Visit Apply Give to UWM Jobs D2L PAWS Email My UW-System University of Wisconsin-Milwaukee College Olympiad Girls Who Code Club FIRST Tech Challenge NSF I-Corps Site of Southeastern Wisconsin UW-Milwaukee

A Comparison of Optical versus Hardware Fourier Transforms.

DTIC Science & Technology

1983-10-31

AD- R136 223 A COMPRISON’OF OPTICAL ERSUS HARDWARE FOURIER i/i.TRANSFORMS(U) VIRGINIA POLYTECHNIC INST AND STATE UNIV BLACKSBURG DEPT OF PHYSICS S P...transform and its inverse filtered Fourier transform obtained with the Digital Image Processing (DIP) hardware system located at the School of Aerospace...transparencies, and provided to us by Dr. Ralph G. Allen, Director of the Laser Effects Branch (Division of Radiation Sciences). The DIP system consisted of: an

National Economic Development Procedures Manual - Agricultural Flood Damage,

DTIC Science & Technology

1987-10-01

based on the conceptual framework of the Economic and Environmental Principles and Guidelines for Water and Related Land Resources Implementation...the planning process and the NED evaluacion ’- ". procedures for agriculture, as described in the P&G, are thei presented. Also identified are some...ood Ioss compu t at ion approach de ’(’ op4 t hie f I ond damage for hypothetical frequency flood events and weights the result to I V- II1. + . IV-11

Workshop on Future Directions for Optical Information Processing.

DTIC Science & Technology

1981-03-01

h . The i reference point source simultaneously illuminates the i member of a family of n phase-encoding Aiffusers (e.g. shower glass , ground glass ...diffuser (ground glass ) section illuminated with a plane wave [35.37). The n(n-1) - 4(3) - 12 crosstalk terms have been distributed into the noise...for 2x2 input Fig. 6. Outnut of processor analogous to that array, l.Sx magnifier, ground glass diffuser of Fig. 5, but using spherical wavefront and

Conceptual Model of Iodine Behavior in the Subsurface at the Hanford Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Truex, Michael J.; Lee, Brady D.; Johnson, Christian D.

Isotopes of iodine were generated during plutonium production within the nine production reactors at the U.S. Department of Energy Hanford Site. The short half-life 131I that was released from the fuel into the atmosphere during the dissolution process (when the fuel was dissolved) in the Hanford Site 200 Area is no longer present at concentrations of concern in the environment. The long half-life 129I generated at the Hanford Site during reactor operations was (1) stored in single-shell and double-shell tanks, (2) discharged to liquid disposal sites (e.g., cribs and trenches), (3) released to the atmosphere during fuel reprocessing operations, ormore » (4) captured by off-gas absorbent devices (silver reactors) at chemical separations plants (PUREX, B-Plant, T-Plant, and REDOX). Releases of 129I to the subsurface have resulted in several large, though dilute, plumes in the groundwater. There is also 129I remaining in the vadose zone beneath disposal or leak locations. The fate and transport of 129I in the environment and potential remediation technologies are currently being studied as part of environmental remediation activities at the Hanford Site. A conceptual model describing the nature and extent of subsurface contamination, factors that control plume behavior, and factors relevant to potential remediation processes is needed to support environmental remedy decisions. Because 129I is an uncommon contaminant, relevant remediation experience and scientific literature are limited. In addition, its behavior in subsurface is different from that of other more common and important contaminants (e.g., U, Cr and Tc) in terms of sorption (adsorption and precipitation), and aqueous phase species transformation via redox reactions. Thus, the conceptual model also needs to both describe known contaminant and biogeochemical process information and identify aspects about which additional information is needed to effectively support remedy decisions.« less

Interactive Biophysics with Microswimmers: Education, Cloud Experimentation, Programmed Swarms, and Biotic Games

NASA Astrophysics Data System (ADS)

Riedel-Kruse, Ingmar

Modern biotechnology gets increasingly powerful to manipulate and measure microscopic biophysical processes. Nevertheless, no platform exists to truly interact with these processes, certainly not with the convenience that we are accustomed to from our electronic smart devices. In my talk I will provide the rational for such Interactive Biotechnology and conceptualize its core component, the BPU (biotic processing unit), which is then connected to an according user interface. The biophysical phenomena currently featured on these platforms utilize the phototactic response of motile microorganisms, e.g., Euglena gracilis, resulting in spatio-temporal dynamics from the single cell to the self-organized multi-cellular scale. I will demonstrate multiple platforms, such as scalable biology cloud experimentation labs, tangible museum exhibits, biotic video games, low-cost interactive DIY kits using smartphones, and programming languages for swarm robotics. I will discuss applications for education as well as for professional and citizen science. Hence, we turn traditionally observational microscopy into an interactive experience. I was told that presenting in the educational section does not count against the ''one author - one talk policy'' - so I submit two abstracts. In case of conflict - please contact me: ingmar@stanford.edu.

Total and inorganic arsenic in marketed food and associated health risks for the Catalan (Spain) population.

PubMed

Fontcuberta, Mireia; Calderon, Josep; Villalbí, Joan R; Centrich, Francesc; Portaña, Samuel; Espelt, Albert; Duran, Julia; Nebot, Manel

2011-09-28

Inorganic arsenic (iAs) is considered to be a human carcinogen. In this paper, total (As) and iAs contents of 215 food products and drinks (i.e., seafood, fruits and vegetables, meat products, oils and fats, rice and rice products, seasonings, and alcoholic drinks) marketed in Catalonia (Spain) were quantified by inductively coupled plasma-mass spectrometry. The analytical method described was used for different food products, obtaining feasible results without the need to couple LC-ICP-MS for iAs. Daily As and iAs intakes for the average adult Catalan consumer were estimated at 354 and 6.1 μg/day/person, respectively, using consumption data from the Catalan Nutrition Survey (ENCAT). The highest As content was found in seafood, contributing 96% of dietary As intake, whereas rice presented the highest iAs values, corresponding to 67% of dietary iAs intake. As cooking process may affect iAs content, boiled rice was evaluated, showing an iAs reduction (up to 86%) when using higher water volumes (30:1 water/rice ratio) than those used in previous studies. This iAs exposure was slightly below the exposure risk range stated by the European Food Safety Authority (0.3-8 μg/kg of body weight/day), although the possibility of a risk to the population with high rice consumption cannot be excluded.

Self-Disturbances as a Possible Premorbid Indicator of Schizophrenia Risk: A Neurodevelopmental Perspective

PubMed Central

Brent, Benjamin K.; Seidman, Larry J.; Thermenos, Heidi W.; Holt, Daphne J.; Keshavan, Matcheri S.

2013-01-01

Self-disturbances (SDs) are increasingly identified in schizophrenia and are theorized to confer vulnerability to psychosis. Neuroimaging research has shed some light on the neural correlates of SDs in schizophrenia. But, the onset and trajectory of the neural alterations underlying SDs in schizophrenia remain incompletely understood. We hypothesize that the aberrant structure and function of brain areas (e.g., prefrontal, lateral temporal, and parietal cortical structures) comprising the “neural circuitry of self” may represent an early, premorbid (i.e., pre-prodromal) indicator of schizophrenia risk. Consistent with neurodevelopmental models, we argue that “early” (i.e., perinatal) dysmaturational processes (e.g., abnormal cortical neural cell migration and mini-columnar formation) affecting key prefrontal (e.g., medial prefrontal cortex), lateral temporal cortical (e.g., superior temporal sulcus), parietal (e.g., inferior parietal lobule) structures involved in self-processing may lead to subtle disruptions of “self” during childhood in persons at risk for schizophrenia. During adolescence, progressive neurodevelopmental alterations (e.g., aberrant synaptic pruning) affecting the neural circuitry of self may contribute to worsening of SDs. This could result in the emergence of prodromal symptoms and, eventually, full-blown psychosis. To highlight why adolescence may be a period of heightened risk for SDs, we first summarize the literature regarding the neural correlates of self in typically developing children. Next, we present evidence from neuroimaging studies in genetic high-risk youth suggesting that fronto-temporal-parietal structures mediating self-reflection may be abnormal in the premorbid period. Our goal is that the ideas presented here might provide future directions for research into the neurobiology of SDs during the pre-psychosis development of youth at risk for schizophrenia. PMID:23932148

Feasibility Studies of Optical Processing of Image Bandwidth Compression Schemes.

DTIC Science & Technology

1984-07-15

c A T I O N s O w N G R A O ’N G SCMEULE distribution unlimited. aP $NEORMN ORGANIZATION REPORT NUMERI(S) S. MONITORING ORGANIZATION REPORT NUMBER(S...AFOSR.Tit. 8 5- 0 17 • OF PERFORMING ORGANIZATION b, OFFICE SYMB’OL 7 NAME OF MONITORING ORGANIZATION The University of Arizona AFOSR/N 4k, ADDRESS...20332-6448 ga. NAME OF PUNDING/SPONSORING Ob. OFFICE SYMBOL 9. PROCUREMENT INSTRUMENT IDENTIFICATION NUMBER ORGANIZATION if appiUcabfle AFOSR NE AFOSR-81

Effects of Whole-Body VX Vapor Exposure on Lethality in Rats

DTIC Science & Technology

2007-01-01

J. "New Method for Hemoglobin Determination by Using Sodium Lauryl Sulfate (SLS)." Clin. Biochem. 15(1) 83-88 (1982). Prins, J, "Product and Process...regenerated VX-G and deuterated internal standard VX-G were eluted with I mL ethyl acetate that was collected and dried over anhydrous sodium sulfate ...anhydrous sodium sulfate . The ethyl acetate was removed from the collection tube and filtered through a 0.2 lim nylon Acrodisc syringe filter (Pall Gelman

A Management Process Workshop for Head Nurses with More than Two Years Experience in a Management Role

DTIC Science & Technology

1989-06-01

Business Review, 47.(1), 98-108. Raines, C. (1988). Personal value systema: How they affect teamwork. AORN, 48, 324-330. Schermerhorn , J. R ., Hunt, J. G...Osborn, R . N.I (1985). Managing organizational behavior (2nd ed.). New York: John Wiley & Sons. Tropman, J. E. (1980). Effective meetings improve...Scherierhorn, J. R ., Hunt, J. G., & Osborn, R.N. (1982). anaging organizational behavior (2nd ed.). New York: John Wiley & Sons. Vroom, V. H. (1964). Work

Apolipoproteins A-I, A-II and E are independently distributed among intracellular and newly secreted HDL of human hepatoma cells

PubMed Central

Gillard, Baiba K.; Lin, Hu-Yu Alice; Massey, John B.; Pownall, Henry J.

2009-01-01

Whereas hepatocytes secrete the major human plasma high density lipoproteins (HDL)-protein, apo A-I, as lipid-free and lipidated species, the biogenic itineraries of apo A-II and apo E are unknown. Human plasma and HepG2 cell-derived apo A-II and apo E occur as monomers, homodimers and heterodimers. Dimerization of apo A-II, which is more lipophilic than apo A-I, is catalyzed by lipid surfaces. Thus, we hypothesized that lipidation of intracellular and secreted apo A-II exceeds that of apo A-I, and once lipidated, apo A-II dimerizes. Fractionation of HepG2 cell lysate and media by size exclusion chromatography showed that intracellular apo A-II and apo E are fully lipidated and occur on nascent HDL and VLDL respectively, while only 45% of intracellular apo A-I is lipidated. Secreted apo A-II and apo E occur on small HDL and on LDL and large HDL respectively. HDL particles containing both apo A-II and apo A-I form only after secretion from both HepG2 and Huh7 hepatoma cells. Apo A-II dimerizes intracellularly while intracellular apo E is monomeric but after secretion associates with HDL and subsequently dimerizes. Thus, HDL apolipoproteins A-I, A-II and E have distinct intracellular and post-secretory pathways of hepatic lipidation and dimerization in the process of HDL formation. These early forms of HDL are expected to follow different apolipoprotein-specific pathways through plasma remodeling and reverse cholesterol transport. PMID:19635584

PET imaging of β-glucuronidase activity by an activity-based 124I-trapping probe for the personalized glucuronide prodrug targeted therapy.

PubMed

Su, Yu-Cheng; Cheng, Ta-Chun; Leu, Yu-Ling; Roffler, Steve R; Wang, Jaw-Yuan; Chuang, Chih-Hung; Kao, Chien-Han; Chen, Kai-Chuan; Wang, Hsin-Ell; Cheng, Tian-Lu

2014-12-01

Beta-glucuronidase (βG) is a potential biomarker for cancer diagnosis and prodrug therapy. The ability to image βG activity in patients would assist in personalized glucuronide prodrug cancer therapy. However, whole-body imaging of βG activity for medical usage is not yet available. Here, we developed a radioactive βG activity-based trapping probe for positron emission tomography (PET). We generated a (124)I-tyramine-conjugated difluoromethylphenol beta-glucuronide probe (TrapG) to form (124)I-TrapG that could be selectively activated by βG for subsequent attachment of (124)I-tyramine to nucleophilic moieties near βG-expressing sites. We estimated the specificity of a fluorescent FITC-TrapG, the cytotoxicity of tyramine-TrapG, and the serum half-life of (124)I-TrapG. βG targeting of (124)I-TrapG in vivo was examined by micro-PET. The biodistribution of (131)I-TrapG was investigated in different organs. Finally, we imaged the endogenous βG activity and assessed its correlation with therapeutic efficacy of 9-aminocamptothecin glucuronide (9ACG) prodrug in native tumors. FITC-TrapG showed specific trapping at βG-expressing CT26 (CT26/mβG) cells but not in CT26 cells. The native TrapG probe possessed low cytotoxicity. (124)I-TrapG preferentially accumulated in CT26/mβG but not CT26 cells. Meanwhile, micro-PET and whole-body autoradiography results demonstrated that (124)I-TrapG signals in CT26/mβG tumors were 141.4-fold greater than in CT26 tumors. Importantly, Colo205 xenografts in nude mice that express elevated endogenous βG can be monitored by using infrared glucuronide trapping probes (NIR-TrapG) and suppressed by 9ACG prodrug treatment. (124)I-TrapG exhibited low cytotoxicity allowing long-term monitoring of βG activity in vivo to aid in the optimization of prodrug targeted therapy. ©2014 American Association for Cancer Research.

Primary and secondary relaxation process in plastically crystalline cyanocyclohexane studied by 2H nuclear magnetic resonance. I.

PubMed

Micko, B; Lusceac, S A; Zimmermann, H; Rössler, E A

2013-02-21

We study the main (α-) and secondary (β-) relaxation in the plastically crystalline (PC) phase of cyanocyclohexane by various 2H nuclear magnetic resonance (NMR) methods (line-shape, spin-lattice relaxation, stimulated echo, and two-dimensional spectra) above and below the glass transition temperature T(g) = 134 K. Our results regarding the α-process demonstrate that molecular motion is not governed by the symmetry of the lattice. Rather it is similar to the one reported for structural glass formers and can be modeled by a reorientation proceeding via a distribution of small and large angular jumps. A solid-echo line-shape analysis regarding the β-process below T(g) yields again very similar results when compared to those of the structural glass formers ethanol and toluene. Hence we cannot confirm an intramolecular origin for the β-process in cyanocyclohexane. The fast β-process in the PC phase allows for the first time a detailed 2H NMR study of the process also at T > T(g): an additional minimum in the spin-lattice relaxation time reflecting the β-process is found. Furthermore the solid-echo spectra show a distinct deviation from the rigid limit Pake pattern, which allows a direct determination of the temperature dependent spatial restriction of the process. In Part II of this work, a quantitative analysis is carried out, where we demonstrate that within the model of a "wobbling in a cone" the mean cone angle increases above T(g) and the corresponding relaxation strength is compared to dielectric results.

Simultaneous methanogenesis and denitrification of pretreated effluents from a fish canning industry.

PubMed

Mosquera-Corral, A; Sánchez, M; Campos, J L; Méndez, R; Lema, J M

2001-02-01

A lab-scale hybrid upflow sludge bed-filter (USBF) reactor was employed to carry out methanogenesis and denitrification of the effluent from an anaerobic industrial reactor (EAIR) in a fish canning industry. The reactor was initially inoculated with methanogenic sludge and there were two different operational steps. During the first step (Step I: days 1-61), the methanogenic process was carried out at organic loading rates (OLR) of 1.0-1.25 g COD l-1 d-1 reaching COD removal percentages of 80%. During the second step (Step II: days 62-109) nitrate was added as KNO3 to the industrial effluent and the OLR was varied between 1.0 and 1.25 g COD l-1 d-1. Two different nitrogen loads of 0.10 and 0.22 g NO3(-)-N l-1 d-1 were applied and these led to nitrogen removal percentages of around 100% in both cases and COD removal percentages of around 80%. Carbon to nitrogen ratio (C:N) in the influent was maintained at 2.0 and eventually it was increased to 3.0, by means of glucose addition, to control the denitrification process. From these results it is possible to establish that wastewater produced in a fish canning industry can be used as a carbon source for denitrification and that denitrifying microorganisms were present in the initially methanogenic sludge. Biomass productions of 0.23 and 0.61 g VSS:g TOC fed for Steps I and II, respectively, were calculated from carbon global balances, showing an increase in biomass growth due to denitrification.

Composite body movements modulate numerical cognition: evidence from the motion-numerical compatibility effect

PubMed Central

Cheng, Xiaorong; Ge, Hui; Andoni, Deljfina; Ding, Xianfeng; Fan, Zhao

2015-01-01

A recent hierarchical model of numerical processing, initiated by Fischer and Brugger (2011) and Fischer (2012), suggested that situated factors, such as different body postures and body movements, can influence the magnitude representation and bias numerical processing. Indeed, Loetscher et al. (2008) found that participants’ behavior in a random number generation task was biased by head rotations. More small numbers were reported after leftward than rightward head turns, i.e., a motion-numerical compatibility effect. Here, by carrying out two experiments, we explored whether similar motion-numerical compatibility effects exist for movements of other important body components, e.g., arms, and for composite body movements as well, which are basis for complex human activities in many ecologically meaningful situations. In Experiment 1, a motion-numerical compatibility effect was observed for lateral rotations of two body components, i.e., the head and arms. Relatively large numbers were reported after making rightward compared to leftward movements for both lateral head and arm turns. The motion-numerical compatibility effect was observed again in Experiment 2 when participants were asked to perform composite body movements of congruent movement directions, e.g., simultaneous head left turns and arm left turns. However, it disappeared when the movement directions were incongruent, e.g., simultaneous head left turns and arm right turns. Taken together, our results extended Loetscher et al.’s (2008) finding by demonstrating that their effect is effector-general and exists for arm movements. Moreover, our study reveals for the first time that the impact of spatial information on numerical processing induced by each of the two sensorimotor-based situated factors, e.g., a lateral head turn and a lateral arm turn, can cancel each other out. PMID:26594188

Hemispheric asymmetries in processing L1 and L2 idioms: effects of salience and context.

PubMed

Cieślicka, Anna B; Heredia, Roberto R

2011-03-01

This study investigates the contribution of the left and right hemispheres to the comprehension of bilingual figurative language and the joint effects of salience and context on the differential cerebral involvement in idiom processing. The divided visual field and the lexical decision priming paradigms were employed to examine the activation of salient and nonsalient ambiguous idiom interpretations (i.e., literal vs. non-literal) in the two hemispheres. Literally plausible ambiguous idioms, L1 (Polish) and L2 (English), were embedded in unconstraining ambiguous (e.g., I knew he kept an ace up his sleeve) or constraining unambiguous context clearly favoring their conventional idiomatic interpretation (e.g., The debating president kept an ace up his sleeve). Idioms were presented centrally, followed by laterally presented targets related to the figurative (e.g., GAIN) or literal (e.g., SHIRT) meaning of the idiom and displayed at Interstimulus Intervals (ISIs) of 0 ms (Experiment 1), 300 ms (Experiment 2), and 800 ms (Experiment 3). Results indicate that context and salience effects are significantly modulated by the language (native vs. nonnative) of the stimulus materials being presented to each hemisphere. Literal facilitation was found for L2 idioms in all three ISI conditions, which supports the notion of the special status that literal meanings of L2 idioms enjoy in the course of their processing by nonnative language users. No significant differences were found between the right and left hemispheres in regards to their sensitivity to contextual constraints. Results are discussed in terms of the Graded Salience Hypothesis and the Fine/Coarse Coding Theory. Copyright © 2010 Elsevier Inc. All rights reserved.

Categorical Speech Perception in Adults with Autism Spectrum Conditions

ERIC Educational Resources Information Center

Stewart, Mary E.; Petrou, Alexandra M.; Ota, Mitsuhiko

2018-01-01

This study tested whether individuals with autism spectrum conditions (n = 23) show enhanced discrimination of acoustic differences that signal a linguistic contrast (i.e., /g/ versus /k/ as in "goat" and "coat") and whether they process such differences in a less categorical fashion as compared with 23 IQ-matched typically…

NUTRIENT ADDITION TO RESTORE SALMON RUNS: CONSIDERATIONS FOR DEVELOPING ENVIRONMENTAL PROTECTION POLICIES AND REGULATIONS

EPA Science Inventory

One scheme to help restore salmon to the Pacific Northwest is the addition of nutrients (i.e., raw or processed salmon carcasses, and commercially produced organic or inorganic fertilizers) to headwaters (e.g., watersheds, lakes, or streams) that are now nutrient deficient becau...

SecureCore Security Architecture: Authority Mode and Emergency Management

DTIC Science & Technology

2007-10-16

can shield first responders from social vultures (e.g., “ambulance chasers”) or malicious parties who could intentionally interfere with emergency...hierarchical design Communications Management: network communication Process Management...and Emergency Management 1 I. Introduction During many crises, first- responder access to sensitive, restricted emergency information is

Estuarine consumers utilize marine, estuarine and terrestrial organic matter and provide connectivity among these food webs

EPA Science Inventory

The flux of organic matter (OM) across ecosystem boundaries can influence estuarine food web dynamics and productivity. However, this process is seldom investigated taking into account all the adjacent ecosystems (e.g. ocean, river, land) and different hydrological settings (i.e....

76 FR 69653 - Abamectin (avermectin); Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-09

... are available in Pesticide Analytical Manual II (PAM II) for citrus and processed fractions (Method I... (ID) number EPA-HQ-OPP-2010-0619. All documents in the docket are listed in the docket index available... available, e.g., Confidential Business Information (CBI) or other information whose disclosure is restricted...

Evolving Agents as a Metaphor for the Developing Child

ERIC Educational Resources Information Center

Schlesinger, Matthew

2004-01-01

The emerging field of Evolutionary Computation (EC), inspired by neo-Darwinian principles (e.g. natural selection, mutation, etc.), offers developmental psychologists a wide array of mathematical tools for simulating ontogenetic processes. In this brief review, I begin by highlighting three of the approaches that EC researchers employ (Artificial…

Infant Attention and Early Childhood Executive Function

ERIC Educational Resources Information Center

Cuevas, Kimberly; Bell, Martha Ann

2014-01-01

Individual differences in infant attention are theorized to reflect the speed of information processing and are related to later cognitive abilities (i.e., memory, language, and intelligence). This study provides the first systematic longitudinal analysis of infant attention and early childhood executive function (EF; e.g., working memory,…

Evaluating the Air Quality, Climate and Economic Impacts of Biogas Management Technologies

EPA Science Inventory

Anaerobic digestion is a natural biological process in which microorganisms break down organic materials in the absence of oxygen. When anaerobic microbes metabolize organic waste – i.e., the carbon-based remains of plants, animals and their waste products, e.g. animal manure, se...

40 CFR Table 12 to Subpart G of... - Monitoring Requirements for Treatment Processes

Code of Federal Regulations, 2013 CFR

2013-07-01

... Appropriate methods as specified in § 63.143 and as approved by permitting authority. 2. Steam stripper (i... recorder. (ii) Wastewater feed mass flow rate; and Continuously Liquid flow meter installed at stripper... operating temperature Continuously (A) Liquid temperature monitoring device installed at stripper influent...

40 CFR Table 12 to Subpart G of... - Monitoring Requirements for Treatment Processes

Code of Federal Regulations, 2010 CFR

2010-07-01

... Appropriate methods as specified in § 63.143 and as approved by permitting authority. 2. Steam stripper (i... recorder. (ii) Wastewater feed mass flow rate; and Continuously Liquid flow meter installed at stripper... operating temperature Continuously (A) Liquid temperature monitoring device installed at stripper influent...

40 CFR Table 12 to Subpart G of... - Monitoring Requirements for Treatment Processes

Code of Federal Regulations, 2011 CFR

2011-07-01

... Appropriate methods as specified in § 63.143 and as approved by permitting authority. 2. Steam stripper (i... recorder. (ii) Wastewater feed mass flow rate; and Continuously Liquid flow meter installed at stripper... operating temperature Continuously (A) Liquid temperature monitoring device installed at stripper influent...

40 CFR Table 12 to Subpart G of... - Monitoring Requirements for Treatment Processes

Code of Federal Regulations, 2014 CFR

2014-07-01

... Appropriate methods as specified in § 63.143 and as approved by permitting authority. 2. Steam stripper (i... recorder. (ii) Wastewater feed mass flow rate; and Continuously Liquid flow meter installed at stripper... operating temperature Continuously (A) Liquid temperature monitoring device installed at stripper influent...

40 CFR Table 12 to Subpart G of... - Monitoring Requirements for Treatment Processes

Code of Federal Regulations, 2012 CFR

2012-07-01

... Appropriate methods as specified in § 63.143 and as approved by permitting authority. 2. Steam stripper (i... recorder. (ii) Wastewater feed mass flow rate; and Continuously Liquid flow meter installed at stripper... operating temperature Continuously (A) Liquid temperature monitoring device installed at stripper influent...

Post-CMOS Micromachining of Surface and Bulk Structures

DTIC Science & Technology

2002-05-06

Structures iii Acknowledgements I would like to thank my advisors, Professor Gary K. Fedder and Professor Dave W. Greve, for their continuing support...Donnelly, Plasma Chem. Plasma Process, vol. 1, pp. 37, 1981. [54] J. L. Mauer, J. S. Logan, L. B. Zielinski , and G. S. Schwartz, J. Vac. Sci. Technol

Coexistence of anti-β2-glycoprotein I domain I and anti-phosphatidylserine/prothrombin antibodies suggests strong thrombotic risk.

PubMed

Lee, Jee-Soo; Gu, JaYoon; Park, Hee Sue; Yoo, Hyun Ju; Kim, Hyun Kyung

2017-05-01

Highly specific assays for measuring antiphospholipid antibodies (aPLs) are required for accurate assessment of thrombotic risk. aPLs against β2-glycoprotein I domain I (anti-β2GPIdI) and against prothrombin complexed with phosphatidylserine (anti-PS/PT) have been recently identified as being associated with a hypercoagulable state. This study evaluated the synergism between anti-β2GPIdI and anti-PS/PT for predicting thrombotic events. A total of 180 patients with clinical suspicion of hypercoagulability were evaluated. The plasma levels of lupus anticoagulant (LA) and antibodies against anticardiolipin (anti-CL) (IgG and IgM), β2GPI (IgG and IgM), PS/PT (IgG and IgM), and β2GPI dI (IgG) were measured. IgG anti-β2GPIdI and LA were highly associated with thrombosis. Mean values and positivity rates of IgG anti-β2GPI dI and IgG anti-PS/PT were significantly higher in the triple-positive group (LA+, IgG anti-CL+, IgG anti-β2GPI+) than in the other groups. Interestingly, the thrombotic risk [odds ratio (OR) 24.400, 95% confidence interval (CI) 1.976-63.273, p<0.001] of the newly defined triple positive group (LA+, IgG anti-CL+, IgG anti-β2GPIdI+; OR 11.182, 95% CI 1.976-63.273, p=0.006) was more than twice that of the triple-positive group (LA+, IgG anti-CL+, IgG anti-β2GPI+). Double positivity for IgG anti-PS/PT and IgG anti-β2GPI also indicated significant thrombotic risk (OR 7.467, 95% CI 2.350-23.729, p=0.001). Furthermore, the thrombotic risk associated with double positivity for IgG anti-PS/PT and IgG anti-β2GPIdI was markedly elevated (OR 33.654, 95% CI 6.322-179.141, p<0.001). Our data suggest that simultaneous measurement of IgG anti-β2GPIdI and IgG anti-PS/PT may improve clinical decision-making for aPL-positive patients.

Photodissociation Cross Sections and Spectroscopy of Atmospheric Positive Ions

DTIC Science & Technology

1979-03-13

MP 79-1 * ATNR~ e _____________________ CONTRAg T’. NUMNER(s) G. P. Smith, L. C. Lee, P. CCobJ. R. I . DA 9--C- /EPeter o J.: T.1 MoseASy PEFRMN...Photodissociation of positive ions can be an important power-loss process in e -beam and gas discharge lasers, and a genctal model should prove useful...monJel ca.l)olatioa i detibed is, Apm4i 0, 4 PHOTON ENERGY (eV) 1.5 2.0 2.5 3.0 3.5 24k NONO+ E 20E °This work Vanderhoff 0 . -Model calculation 16- z 0_ m

Numerical modelling of fluid-rock interactions: Lessons learnt from carbonate rocks diagenesis studies

NASA Astrophysics Data System (ADS)

Nader, Fadi; Bachaud, Pierre; Michel, Anthony

2015-04-01

Quantitative assessment of fluid-rock interactions and their impact on carbonate host-rocks has recently become a very attractive research topic within academic and industrial realms. Today, a common operational workflow that aims at predicting the relevant diagenetic processes on the host rocks (i.e. fluid-rock interactions) consists of three main stages: i) constructing a conceptual diagenesis model including inferred preferential fluids pathways; ii) quantifying the resulted diagenetic phases (e.g. depositing cements, dissolved and recrystallized minerals); and iii) numerical modelling of diagenetic processes. Most of the concepts of diagenetic processes operate at the larger, basin-scale, however, the description of the diagenetic phases (products of such processes) and their association with the overall petrophysical evolution of sedimentary rocks remain at reservoir (and even outcrop/ well core) scale. Conceptual models of diagenetic processes are thereafter constructed based on studying surface-exposed rocks and well cores (e.g. petrography, geochemistry, fluid inclusions). We are able to quantify the diagenetic products with various evolving techniques and on varying scales (e.g. point-counting, 2D and 3D image analysis, XRD, micro-CT and pore network models). Geochemical modelling makes use of thermodynamic and kinetic rules as well as data-bases to simulate chemical reactions and fluid-rock interactions. This can be through a 0D model, whereby a certain process is tested (e.g. the likelihood of a certain chemical reaction to operate under specific conditions). Results relate to the fluids and mineral phases involved in the chemical reactions. They could be used as arguments to support or refute proposed outcomes of fluid-rock interactions. Coupling geochemical modelling with transport (reactive transport model; 1D, 2D and 3D) is another possibility, attractive as it provides forward simulations of diagenetic processes and resulting phases. This contribution is based on several studies that were undertaken on carbonate rocks diagenesis in some of the major reservoir rocks in the Middle East and outcrop analogues in Europe. Here, the main processes at hand are related to fracture-related dolomitization and carbonate dissolution. We would like to present the workflows we have followed and the questioning that resulted for a series of case studies. The way forward, seems evident as the integration of workflows and numerical modelling tools at different scales, bringing better constrains on the boundary data and less uncertainty.

Probability of fixation under weak selection: a branching process unifying approach.

PubMed

Lambert, Amaury

2006-06-01

We link two-allele population models by Haldane and Fisher with Kimura's diffusion approximations of the Wright-Fisher model, by considering continuous-state branching (CB) processes which are either independent (model I) or conditioned to have constant sum (model II). Recent works by the author allow us to further include logistic density-dependence (model III), which is ubiquitous in ecology. In all models, each allele (mutant or resident) is then characterized by a triple demographic trait: intrinsic growth rate r, reproduction variance sigma and competition sensitivity c. Generally, the fixation probability u of the mutant depends on its initial proportion p, the total initial population size z, and the six demographic traits. Under weak selection, we can linearize u in all models thanks to the same master formula u = p + p(1 - p)[g(r)s(r) + g(sigma)s(sigma) + g(c)s(c)] + o(s(r),s(sigma),s(c), where s(r) = r' - r, s(sigma) = sigma-sigma' and s(c) = c - c' are selection coefficients, and g(r), g(sigma), g(c) are invasibility coefficients (' refers to the mutant traits), which are positive and do not depend on p. In particular, increased reproduction variance is always deleterious. We prove that in all three models g(sigma) = 1/sigma and g(r) = z/sigma for small initial population sizes z. In model II, g(r) = z/sigma for all z, and we display invasion isoclines of the 'mean vs variance' type. A slight departure from the isocline is shown to be more beneficial to alleles with low sigma than with high r. In model III, g(c) increases with z like ln(z)/c, and g(r)(z) converges to a finite limit L > K/sigma, where K = r/c is the carrying capacity. For r > 0 the growth invasibility is above z/sigma when z < K, and below z/sigma when z > K, showing that classical models I and II underestimate the fixation probabilities in growing populations, and overestimate them in declining populations.

Airborne-Fiber Optics Manufacturing Technology, Aircraft Installation Processes.

DTIC Science & Technology

1980-08-19

but the impact is minor. With simpler equipment and techniques there may be a J’ 1 -, long- term savings potential. Overall costs and benefits of...4/72 1 * lh427 ,. . . ... .. - - . .. . 4.0 ASSEMBLY OF FIBER OPTIC CABLES AND HARNESSES 4.1 CABLE IDENTIFICATION (Marking) 4.1.1 Physically identify...FIBER OPTICS MANUFACTURING TECHNOLOGY Aircraft Installation Processes G Kosmos ~ ~ 19 August 1980 I 2 Final Report: May 1978 - June 1980 . 1 Prepared for

SLOAN DIGITAL SKY SURVEY OBSERVATIONS OF KUIPER BELT OBJECTS: COLORS AND VARIABILITY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ofek, Eran O.

2012-04-10

Colors of trans-Neptunian objects (TNOs) are used to study the evolutionary processes of bodies in the outskirts of the solar system and to test theories regarding their origin. Here I describe a search for serendipitous Sloan Digital Sky Survey (SDSS) observations of known TNOs and Centaurs. I present a catalog of SDSS photometry, colors, and astrometry of 388 measurements of 42 outer solar system objects. I find weak evidence, at the Almost-Equal-To 2{sigma} level (per trial), for a correlation between the g - r color and inclination of scattered disk objects and hot classical Kuiper Belt objects. I find amore » correlation between the g - r color and the angular momentum in the z direction of all the objects in this sample. These findings should be verified using larger samples of TNOs. Light curves as a function of phase angle are constructed for 13 objects. The steepness of the slopes of these light curves suggests that the coherent backscatter mechanism plays a major role in the reflectivity of outer solar system small objects at small phase angles. I find weak evidence for an anticorrelation, significant at the 2{sigma} confidence level (per trial), between the g-band phase-angle slope parameter and the semimajor axis, as well as the aphelion distance, of these objects (i.e., they show a more prominent 'opposition effect' at smaller distances from the Sun). However, this plausible correlation should be verified using a larger sample. I discuss the origin of this possible correlation and argue that if this correlation is real it probably indicates that 'Sedna'-like objects have a different origin than other classes of TNOs. Finally, I identify several objects with large variability amplitudes.« less

NATICH Bibliography Of Selected Reports And Federal ...

EPA Pesticide Factsheets

... la* hi i • M -HW - i • 1 • fl • a M rt P rt B Hill 13 | M saas 5 II * ' I a |!: a I! rs i : i S '! i: :• 13 1 •c n« !i H ! 3 ' « . | * IS II •d H 1 & g H i g g 3 H ,1 i i o « »? ii i ...

Multi-Stakeholder Collaboration in the Redesign of Family-Centered Rounds Process

PubMed Central

Xie, Anping; Carayon, Pascale; Cartmill, Randi; Li, Yaqiong; Cox, Elizabeth D.; Plotkin, Julie A.; Kelly, Michelle M.

2014-01-01

A human factors approach to healthcare system redesign emphasizes the involvement of multiple healthcare stakeholders (e.g., patients and families, healthcare providers) in the redesign process. This study explores the experience of multiple stakeholders with collaboration in a healthcare system redesign project. Interviews were conducted with ten stakeholder representatives who participated in the redesign of the family-centered rounds process in a pediatric hospital. Qualitative interview data were analyzed using a phenomenological approach. A model of collaborative healthcare system redesign was developed, which defined four phases (i.e., setup of the redesign team, preparation for meetings, collaboration in meetings, follow-up after meetings) and two outcomes (i.e., team outcomes, redesign outcomes) of the collaborative process. Challenges to multi-stakeholder collaboration in healthcare system redesign, such as need to represent all relevant stakeholders, scheduling of meetings and managing different perspectives, were identified. PMID:25124394

Multi-stakeholder collaboration in the redesign of family-centered rounds process.

PubMed

Xie, Anping; Carayon, Pascale; Cartmill, Randi; Li, Yaqiong; Cox, Elizabeth D; Plotkin, Julie A; Kelly, Michelle M

2015-01-01

A human factors approach to healthcare system redesign emphasizes the involvement of multiple healthcare stakeholders (e.g., patients and families, healthcare providers) in the redesign process. This study explores the experience of multiple stakeholders with collaboration in a healthcare system redesign project. Interviews were conducted with ten stakeholder representatives who participated in the redesign of the family-centered rounds process in a pediatric hospital. Qualitative interview data were analyzed using a phenomenological approach. A model of collaborative healthcare system redesign was developed, which defined four phases (i.e., setup of the redesign team, preparation for meetings, collaboration in meetings, follow-up after meetings) and two outcomes (i.e., team outcomes, redesign outcomes) of the collaborative process. Challenges to multi-stakeholder collaboration in healthcare system redesign, such as need to represent all relevant stakeholders, scheduling of meetings and managing different perspectives, were identified. Copyright © 2014 Elsevier Ltd and The Ergonomics Society. All rights reserved.

Workshop on the Chemical Processing of Structural Ceramics for Use in Severe Environments Held in Dayton, Ohio on 16-18 July 1984

DTIC Science & Technology

1984-07-18

NaNO 3 : .X10-2M 7,0 OXALIC ACID 600C &,O CITRIC ACID ZL100 0 C’)I w Z 10 G~ 0 0 3 6 9 12, Figure 26 140 2.0x 10-n5 1000- HEMATITE :95 mg ORGANIC...ACID: 2XI1- 2 *NaNO3 : IxI0-2 25 *C,17 h ,10 cm 3 OVNWO -I.5x10- 5 c ioc OXALIC ACID CO 4c 0 3 %2w r mu 0 r OT = X -rr - 2 x / PHXZ S1% 10 3 69 Ll...intermediate phases form in a hydrothermal process, you take advantage of those rhases. In fact they some- times act as a reservoir for your cations

Can Stable Isotope combined with Trace Element Analysis distinguish between pure and g.g.A. (protected geographical indication, P.G.I.) certified Pumpkin Seed Oils?

NASA Astrophysics Data System (ADS)

Meier-Augenstein, Wolfram; Kemp, Helen; Midwood, Andy

2013-04-01

Styrian Pumpkin Seed Oil is a premium single seed vegetable oil that is uniquely linked to the geographic region of Styria where it is grown and produced. In 1996, the strong regional ties of this typical Styrian speciality were recognised by the EU-Commission who declared "Styrian Pumpkin Seed Oil P.G.I." as a Protected Geographical Indication (article 5 VO(EWG) Nr. 2081/92). In 1998, more than 2,000 domestic pumpkin seed producers and 30 oil mills formed an association of Styrian pumpkin seed oil producers, which is now called the "Gemeinschaft Steirisches Kürbiskernöl g.g.A.". This producers' association was formed in order to protect the regionality and the high quality of Styrian Pumpkin Seed Oil P.G.I. Procedures implemented by this producers' association document every step in the process from pumpkin seeds to seed crushing in oil mills and finally bottling of Styrian Pumpkin Seed Oil P.G.I., keeping a contiguous record of all production steps including annual harvest amounts. This permits full traceability of every bottle of Styrian Pumpkin Seed Oil P.G.I from harvest to the finished, bottled products found on the shelf of delis and even supermarkets. Despite these efforts of the producers' association, there have been repeated claims of g.g.A. (P.G.I.) certified bottles of Styrian Pumpkin Seed Oil (PSO) having been analysed independently and shown to contain either mixtures of Styrian and non-Styrian PSO or no Styrian PSO at all. Since keeping records of annual harvest amounts of pumpkin seeds would make it very difficult for an "over-production" by mixing or substitution of alien PSO's to go unnoticed, we formed the hypothesis that the red-flagged bottles could have been counterfeits containing alien PSO with bottles sporting fake g.g.A. seals and fake serial numbers. An alternative hypothesis was that the chosen method of detection of allegedly misrepresented g.g.A. Styrian PSO resulted in a high number of false negatives thus incorrectly rejecting genuine Styrian PSO as alien PSO and mixtures of Styrian PSO with alien PSO. To investigate the potential of multivariate stable isotope analysis as a means to correctly distinguish between genuine Syrian PSOs and other PSOs, we purchased 13 + 1 PSOs (13 different brands) from high-street and on-line shops. Samples were given alpha-numerical sample IDs and were analysed in a single-blinded fashion. Based on 2H, 13C and 18O abundance values alone sensitivity and specificity were 0.75 (1 false negative; 3 true positives) and 0.86 (1 false positive; 6 true negatives), respectively. However, when combining stable isotope data with trace element data, sensitivity and specificity both improved with no false negatives or false positives being detected. Chemometric statistical analysis clearly separated the 3 g.g.A. certified Styrian PSOs from all but one other PSO, which was also a genuine Styrian PSO in as much as it was pressed from genuine Styrian pumpkin seeds though not by a Styrian oil mill and thus not qualifying for the g.g.A. mark.

Chemically amplified i-line positive resist for next-generation flat panel display

NASA Astrophysics Data System (ADS)

Lee, Hsing-Chieh; Lu, Ying-Hao; Huang, Shin-Yih; Lan, Wei-Jen; Hanabata, Makoto

2017-03-01

Traditional diazonaphthoquinone (DNQ) positive photoresists are widely used for TFT-LCD array process. Current LTPS technology has more than 600ppi resolution is required for small or middle-sized TFT liquid crystal display panels. One of the ways to enhance resolution is to apply i-line single exposure system instead of traditional g/h/ibroadband exposure system. We have been developing i-line chemically amplified photoresist ECA 200 series for the next generation flat panel display (FPD). ECA 200 consists of three components: a phenol resin, a photo acid generator and dissolution enhancer. We applied two different types of dissolution enhancers with two different kinds of protected groups to our resist materials. As a result, we achieved higher sensitivity, higher resolution, less footing of the resist profile and reduced standing wave effect compared with traditional DNQ photoresists. In addition, we have found further property of photoresist that does not need post exposure bake (PEB) process. This resist has a great advantage at most of current panel plants without PEB process.

Seeing Life through Positive-Tinted Glasses: Color–Meaning Associations

PubMed Central

Gil, Sandrine; Le Bigot, Ludovic

2014-01-01

There is a growing body of literature to show that color can convey information, owing to its emotionally meaningful associations. Most research so far has focused on negative hue–meaning associations (e.g., red) with the exception of the positive aspects associated with green. We therefore set out to investigate the positive associations of two colors (i.e., green and pink), using an emotional facial expression recognition task in which colors provided the emotional contextual information for the face processing. In two experiments, green and pink backgrounds enhanced happy face recognition and impaired sad face recognition, compared with a control color (gray). Our findings therefore suggest that because green and pink both convey positive information, they facilitate the processing of emotionally congruent facial expressions (i.e., faces expressing happiness) and interfere with that of incongruent facial expressions (i.e., faces expressing sadness). Data also revealed a positive association for white. Results are discussed within the theoretical framework of emotional cue processing and color meaning. PMID:25098167

Seeing life through positive-tinted glasses: color-meaning associations.

PubMed

Gil, Sandrine; Le Bigot, Ludovic

2014-01-01

There is a growing body of literature to show that color can convey information, owing to its emotionally meaningful associations. Most research so far has focused on negative hue-meaning associations (e.g., red) with the exception of the positive aspects associated with green. We therefore set out to investigate the positive associations of two colors (i.e., green and pink), using an emotional facial expression recognition task in which colors provided the emotional contextual information for the face processing. In two experiments, green and pink backgrounds enhanced happy face recognition and impaired sad face recognition, compared with a control color (gray). Our findings therefore suggest that because green and pink both convey positive information, they facilitate the processing of emotionally congruent facial expressions (i.e., faces expressing happiness) and interfere with that of incongruent facial expressions (i.e., faces expressing sadness). Data also revealed a positive association for white. Results are discussed within the theoretical framework of emotional cue processing and color meaning.

Grid enablement of OpenGeospatial Web Services: the G-OWS Working Group

NASA Astrophysics Data System (ADS)

Mazzetti, Paolo

2010-05-01

In last decades two main paradigms for resource sharing emerged and reached maturity: the Web and the Grid. They both demonstrate suitable for building Distributed Computing Infrastructures (DCIs) supporting the coordinated sharing of resources (i.e. data, information, services, etc) on the Internet. Grid and Web DCIs have much in common as a result of their underlying Internet technology (protocols, models and specifications). However, being based on different requirements and architectural approaches, they show some differences as well. The Web's "major goal was to be a shared information space through which people and machines could communicate" [Berners-Lee 1996]. The success of the Web, and its consequent pervasiveness, made it appealing for building specialized systems like the Spatial Data Infrastructures (SDIs). In this systems the introduction of Web-based geo-information technologies enables specialized services for geospatial data sharing and processing. The Grid was born to achieve "flexible, secure, coordinated resource sharing among dynamic collections of individuals, institutions, and resources" [Foster 2001]. It specifically focuses on large-scale resource sharing, innovative applications, and, in some cases, high-performance orientation. In the Earth and Space Sciences (ESS) the most part of handled information is geo-referred (geo-information) since spatial and temporal meta-information is of primary importance in many application domains: Earth Sciences, Disasters Management, Environmental Sciences, etc. On the other hand, in several application areas there is the need of running complex models which require the large processing and storage capabilities that the Grids are able to provide. Therefore the integration of geo-information and Grid technologies might be a valuable approach in order to enable advanced ESS applications. Currently both geo-information and Grid technologies have reached a high level of maturity, allowing to build such an integration on existing solutions. More specifically, the Open Geospatial Consortium (OGC) Web Services (OWS) specifications play a fundamental role in geospatial information sharing (e.g. in INSPIRE Implementing Rules, GEOSS architecture, GMES Services, etc.). On the Grid side, the gLite middleware, developed in the European EGEE (Enabling Grids for E-sciencE) Projects, is widely spread in Europe and beyond, proving its high scalability and it is one of the middleware chosen for the future European Grid Infrastructure (EGI) initiative. Therefore the convergence between OWS and gLite technologies would be desirable for a seamless access to the Grid capabilities through OWS-compliant systems. Anyway, to achieve this harmonization there are some obstacles to overcome. Firstly, a semantics mismatch must be addressed: gLite handle low-level (e.g. close to the machine) concepts like "file", "data", "instruments", "job", etc., while geo-information services handle higher-level (closer to the human) concepts like "coverage", "observation", "measurement", "model", etc. Secondly, an architectural mismatch must be addressed: OWS implements a Web Service-Oriented-Architecture which is stateless, synchronous and with no embedded security (which is demanded to other specs), while gLite implements the Grid paradigm in an architecture which is stateful, asynchronous (even not fully event-based) and with strong embedded security (based on the VO paradigm). In recent years many initiatives and projects have worked out possible approaches for implementing Grid-enabled OWSs. Just to mention some: (i) in 2007 the OGC has signed a Memorandum of Understanding with the Open Grid Forum, "a community of users, developers, and vendors leading the global standardization effort for grid computing."; (ii) the OGC identified "WPS Profiles - Conflation; and Grid processing" as one of the tasks in the Geo Processing Workflow theme of the OWS Phase 6 (OWS-6); (iii) several national, European and international projects investigated different aspects of this integration, developing demonstrators and Proof-of-Concepts; In this context, "gLite enablement of OpenGeospatial Web Services" (G-OWS) is an initiative started in 2008 by the European CYCLOPS, GENESI-DR, and DORII Projects Consortia in order to collect/coordinate experiences on the enablement of OWS on top of the gLite middleware [GOWS]. Currently G-OWS counts ten member organizations from Europe and beyond, and four European Projects involved. It broadened its scope to the development of Spatial Data and Information Infrastructures (SDI and SII) based on the Grid/Cloud capacity in order to enable Earth Science applications and tools. Its operational objectives are the following: i) to contribute to the OGC-OGF initiative; ii) to release a reference implementation as standard gLite APIs (under the gLite software license); iii) to release a reference model (including procedures and guidelines) for OWS Grid-ification, as far as gLite is concerned; iv) to foster and promote the formation of consortiums for participation to projects/initiatives aimed at building Grid-enabled SDIs To achieve this objectives G-OWS bases its activities on two main guiding principles: a) the adoption of a service-oriented architecture based on the information modelling approach, and b) standardization as a means of achieving interoperability (i.e. adoption of standards from ISO TC211, OGC OWS, OGF). In the first year of activity G-OWS has designed a general architectural framework stemming from the FP6 CYCLOPS studies and enriched by the outcomes of other projects and initiatives involved (i.e. FP7 GENESI-DR, FP7 DORII, AIST GeoGrid, etc.). Some proof-of-concepts have been developed to demonstrate the flexibility and scalability of such architectural framework. The G-OWS WG developed implementations of gLite-enabled Web Coverage Service (WCS) and Web Processing Service (WPS), and an implementation of a Shibboleth authentication for gLite-enabled OWS in order to evaluate the possible integration of Web and Grid security models. The presentation will aim to communicate the G-OWS organization, activities, future plans and means to involve the ESSI community. References [Berners-Lee 1996] T. Berners-Lee, "WWW: Past, present, and future". IEEE Computer, 29(10), Oct. 1996, pp. 69-77. [Foster 2001] I. Foster, C. Kesselman and S. Tuecke, "The Anatomy of the Grid. The International Journal ofHigh Performance Computing Applications", 15(3):200-222, Fall 2001 [GOWS] G-OWS WG, https://www.g-ows.org/, accessed: 15 January 2010

Qualitative and Quantitative Distinctions in Personality Disorder

PubMed Central

Wright, Aidan G. C.

2011-01-01

The “categorical-dimensional debate” has catalyzed a wealth of empirical advances in the study of personality pathology. However, this debate is merely one articulation of a broader conceptual question regarding whether to define and describe psychopathology as a quantitatively extreme expression of normal functioning or as qualitatively distinct in its process. In this paper I argue that dynamic models of personality (e.g., object-relations, cognitive-affective processing system) offer the conceptual scaffolding to reconcile these seemingly incompatible approaches to characterizing the relationship between normal and pathological personality. I propose that advances in personality assessment that sample behavior and experiences intensively provide the empirical techniques, whereas interpersonal theory offers an integrative theoretical framework, for accomplishing this goal. PMID:22804676

Electrochemiluminescence based competitive immunoassay for Sudan I by using gold-functionalized graphitic carbon nitride and Au/Cu alloy nanoflowers.

PubMed

Chen, Wanlu; Yao, Xun; Zhou, Xinchun; Zhao, Kang; Deng, Anping; Li, Jianguo

2018-05-01

A flower-like Au/Cu alloy nanocomposite (Au/Cu NFs) was synthesized and used in an electrochemiluminescence (ECL) based method for sensitive determination of the dye Sudan I. The Au-g-C 3 N 4 nanosheets as an ECL emitter were prepared by electrostatic adsorption between gold nanoparticles and g-C 3 N 4 . They form a film on a glassy carbon electrode (GCE) and then can be connected with Sudan I antigen via gold-nitrogen bond and amidation reactions. The Au/Cu NFs combined with Sudan I antibody also via the Au-N bond and was introduced into the modified GCE by specific recognition between the antibody and the antigen. The overlap between emission spectra of the Au-g-C 3 N 4 nanosheets and absorption spectra of Au/Cu NFs enabled the appearance of ECL resonance energy transfer process. That is, when the Sudan I analyte not present, the ECL was weakened due to absorption by the gray Au/Cu NFs on applying voltages from -1.7 V to 0 V. Conversely, the Au/Cu NFs on the GCE are reduced due to the competition for the antibody between the analyte and the antigen. A strong green ECL emission was obtained. The ECL response is linear in the 0.5 pg mL -1 to 100 ng mL -1 Sudan I concentration range, and the detection limit is 0.17 pg mL -1 . Graphical abstract An Au/Cu alloy flower-like nanocomposite (Au/Cu NFs) is firstly synthesized as an acceptor to constitute an electrochemiluminescence-resonance energy transfer (ECL-RET) system for sensitive measurement of Sudan I, while Au nanoparticles (Au NPs) functionalized graphitic carbon nitride (g-C 3 N 4 ) acted as a donor.

THE INTERMEDIATE NEUTRON-CAPTURE PROCESS AND CARBON-ENHANCED METAL-POOR STARS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampel, Melanie; Stancliffe, Richard J.; Lugaro, Maria

Carbon-enhanced metal-poor (CEMP) stars in the Galactic Halo display enrichments in heavy elements associated with either the s (slow) or the r (rapid) neutron-capture process (e.g., barium and europium, respectively), and in some cases they display evidence of both. The abundance patterns of these CEMP- s / r stars, which show both Ba and Eu enrichment, are particularly puzzling, since the s and the r processes require neutron densities that are more than ten orders of magnitude apart and, hence, are thought to occur in very different stellar sites with very different physical conditions. We investigate whether the abundance patternsmore » of CEMP- s / r stars can arise from the nucleosynthesis of the intermediate neutron-capture process (the i process), which is characterized by neutron densities between those of the s and the r processes. Using nuclear network calculations, we study neutron capture nucleosynthesis at different constant neutron densities n ranging from 10{sup 7}–10{sup 15} cm{sup -3}. With respect to the classical s process resulting from neutron densities on the lowest side of this range, neutron densities on the highest side result in abundance patterns, which show an increased production of heavy s -process and r -process elements, but similar abundances of the light s -process elements. Such high values of n may occur in the thermal pulses of asymptotic giant branch stars due to proton ingestion episodes. Comparison to the surface abundances of 20 CEMP- s / r stars shows that our modeled i -process abundances successfully reproduce observed abundance patterns, which could not be previously explained by s -process nucleosynthesis. Because the i -process models fit the abundances of CEMP- s / r stars so well, we propose that this class should be renamed as CEMP- i .« less

Relatedness-based Multi-Entity Summarization

PubMed Central

Gunaratna, Kalpa; Yazdavar, Amir Hossein; Thirunarayan, Krishnaprasad; Sheth, Amit; Cheng, Gong

2017-01-01

Representing world knowledge in a machine processable format is important as entities and their descriptions have fueled tremendous growth in knowledge-rich information processing platforms, services, and systems. Prominent applications of knowledge graphs include search engines (e.g., Google Search and Microsoft Bing), email clients (e.g., Gmail), and intelligent personal assistants (e.g., Google Now, Amazon Echo, and Apple’s Siri). In this paper, we present an approach that can summarize facts about a collection of entities by analyzing their relatedness in preference to summarizing each entity in isolation. Specifically, we generate informative entity summaries by selecting: (i) inter-entity facts that are similar and (ii) intra-entity facts that are important and diverse. We employ a constrained knapsack problem solving approach to efficiently compute entity summaries. We perform both qualitative and quantitative experiments and demonstrate that our approach yields promising results compared to two other stand-alone state-of-the-art entity summarization approaches. PMID:29051696

Controlled graft copolymerization of lactic acid onto starch in a supercritical carbon dioxide medium.

PubMed

Salimi, Kouroush; Yilmaz, Mehmet; Rzayev, Zakir M O; Piskin, Erhan

2014-12-19

This work presents a new approach for the synthesis of a starch-g-poly L-lactic acid (St-g-PLA) copolymer via the graft copolymerization of LA onto starch using stannous 2-ethyl hexanoate (Sn(Oct)2) as a catalyst in a supercritical carbon dioxide (scCO2) medium. The effects of several process parameters, including the pressure, temperature, scCO2 flow rate and reaction time, on the polymerization yield and grafting degree were studied. Amorphous graft St-g-PLA copolymers with increased thermal stability and processability were produced with a high efficiency. The maximum grafting degree (i.e., 52% PLA) was achieved with the following reaction conditions: 6h, 100°C, 200 bar and a 1:3 (w/w) ratio of St/LA. It was concluded that these low cost biobased graft biopolymers are potential candidates for several environment-friendly applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

Nitrogen-Rich Porous Polymers for Carbon Dioxide and Iodine Sequestration for Environmental Remediation.

PubMed

Abdelmoaty, Yomna H; Tessema, Tsemre-Dingel; Choudhury, Fatema Akthar; El-Kadri, Oussama M; El-Kaderi, Hani M

2018-05-09

The use of fossil fuels for energy production is accompanied by carbon dioxide release into the environment causing catastrophic climate changes. Meanwhile, replacing fossil fuels with carbon-free nuclear energy has the potential to release radioactive iodine during nuclear waste processing and in case of a nuclear accident. Therefore, developing efficient adsorbents for carbon dioxide and iodine capture is of great importance. Two nitrogen-rich porous polymers (NRPPs) derived from 4-bis-(2,4-diamino-1,3,5-triazine)-benzene building block were prepared and tested for use in CO 2 and I 2 capture. Copolymerization of 1,4-bis-(2,4-diamino-1,3,5-triazine)-benzene with terephthalaldehyde and 1,3,5-tris(4-formylphenyl)benzene in dimethyl sulfoxide at 180 °C afforded highly porous NRPP-1 (SA BET = 1579 m 2 g -1 ) and NRPP-2 (SA BET = 1028 m 2 g -1 ), respectively. The combination of high nitrogen content, π-electron conjugated structure, and microporosity makes NRPPs very effective in CO 2 uptake and I 2 capture. NRPPs exhibit high CO 2 uptakes (NRPP-1, 6.1 mmol g -1 and NRPP-2, 7.06 mmol g -1 ) at 273 K and 1.0 bar. The 7.06 mmol g -1 CO 2 uptake by NRPP-2 is the second highest value reported to date for porous organic polymers. According to vapor iodine uptake studies, the polymers display high capacity and rapid reversible uptake release for I 2 (NRPP-1, 192 wt % and NRPP-2, 222 wt %). Our studies show that the green nature (metal-free) of NRPPs and their effective capture of CO 2 and I 2 make this class of porous materials promising for environmental remediation.

Person autonomy and voluntariness as important factors in motivation, decision making, and astronaut safety: First results from the Mars500 LODGEAD study

NASA Astrophysics Data System (ADS)

Baarsen, Bernadette van

2013-06-01

The present study aims to explore the influence of person autonomy and voluntariness on the level and orientation of motivation and decision making of crew members who live and work in extreme isolated conditions such as during long-term space flights. Motivation has been related to positive behavioural (e.g., goal-orientation), cognitive (e.g., attention), and psychological (e.g., well-being) outcomes and is likely to be relevant for safe and favourable extraterrestrial life- and working-conditions. The study has been carried out within the scope of the Mars500 study which includes a Mars mission simulation of 105 (pilot study) and 520 (main study) days and involves a multi-national crew of 6 men who lived and worked in hermetically sealed modules in the IBMP facilities in Moscow. Data have been collected by the use of questionnaires that evaluate the Mars experiment in terms of, e.g. information received (e.g., "My experiences here are in line with what I was told during the selection and instruction procedure"), perceived social pressure (e.g., "I don't feel free to make my own decisions"), and personal challenge (e.g., "I think that joining the first Mars mission would be a major challenge for me"). It is hypothesised that stronger (1) perceived information consistency, (2) personal expectation consistency, (3) perceived voluntariness, and (4) experienced freedom of choice will be indicative of higher motivation levels. The results will be interpreted in the light of communication, decision making processes, and mission safety. Also, moral expectations and ethical considerations regarding future participation in long duration Human missions such as Mars will be discussed. We will make use of descriptive, longitudinal pattern analyses and correlations.

Adaptive Control and Parameter Identification of a Doubly-Fed Induction Generator for Wind Power

DTIC Science & Technology

2011-09-01

Computer Controlled Systems, Theory and Design, Third Edition, Prentice Hall, New Jersey, 1997. [27] R. G. Brown and P. Y.C. Hwang , Introduction to...V n y iT iT , (0.0) with Ts as the sampling interval. From [26], the recursive estimate can be interpreted as a Kalman Filter for the process...by substituting t with n. The recursive equations for the RLS can then be derived from the Kalman filter equations used in [27]: 29 $ $ $ 1 1

Organic membrane photonic integrated circuits (OMPICs).

PubMed

Amemiya, Tomohiro; Kanazawa, Toru; Hiratani, Takuo; Inoue, Daisuke; Gu, Zhichen; Yamasaki, Satoshi; Urakami, Tatsuhiro; Arai, Shigehisa

2017-08-07

We propose the concept of organic membrane photonic integrated circuits (OMPICs), which incorporate various functions needed for optical signal processing into a flexible organic membrane. We describe the structure of several devices used within the proposed OMPICs (e.g., transmission lines, I/O couplers, phase shifters, photodetectors, modulators), and theoretically investigate their characteristics. We then present a method of fabricating the photonic devices monolithically in an organic membrane and demonstrate the operation of transmission lines and I/O couplers, the most basic elements of OMPICs.

The Effect of Alloy Composition and Processing on the Structure and Properties of I/M Al-Li-X Alloys

DTIC Science & Technology

1990-07-01

ORGANIZATION Department ot Materials Scienci (N aplicable) University of Virginia U. S. Army Research Office 6c. ADDRESS (City, State, and ZIP Code) 7b...27709 Attention: Dr. Andrew Crowson, Program Officer Materials Science Division Submitted by: E. A. Starke Earnest Oglesby Professor of Materials ...Science and Dean G. J. Shiflet Professor of Materials Science Report No. UVA/525140/MS91/101 July 1990 DTIC ELECTFE SAUG3 1190 I DEPARTMENT OF MATERIALS

Two-Dimensional Signal Processing and Storage and Theory and Applications of Electromagnetic Measurements. Supplement.

DTIC Science & Technology

1984-06-01

TechnologySchool of Electrical Engineering Atlanta, Georgia 30332 I1. CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT DATE U.S. Army Research Office June 1984...Post Office Box 12211 I3. NUMBER OF PAGES Research Triangle Park, NC 27709 14. MONITORING AGENCY NAME G ADDRESS(if dilferent from Controlling Office...could be attached to it to produce a permanent record of images. A video control unit, designed and built in the Optics Lab, was employed to direct and

Human Processes in Intelligence Analysis: Phase I Overview

DTIC Science & Technology

1979-12-01

Inodrtpusehsreac, several operating definitions were thv model, and is based on field obser- adopted. A basic defnition was that vations made from tha...Similarly, the IMINT bo•xes of different analysts, analyst who understands the problems Comnputer data bases, such as those of of the reconnaissance pilot has...TaiulanNevl Franea 3 USA Aviation Test K, Pt Rucler. ATTN: STlG-P( I Prin Scientific Off. Ar-1 HIm mngr Rich Olv. Miniatry 1 USA Apy hr Av4iao SAWe

Comparative study on ambient ionization methods for direct analysis of navel orange tissues by mass spectrometry.

PubMed

Zhang, Hua; Bibi, Aisha; Lu, Haiyan; Han, Jing; Chen, Huanwen

2017-08-01

It is of sustainable interest to improve the sensitivity and selectivity of the ionization process, especially for direct analysis of complex samples without matrix separation. Herein, four ambient ionization methods including desorption atmospheric pressure chemical ionization (DAPCI), heat-assisted desorption atmospheric pressure chemical ionization (heat-assisted DAPCI), microwave plasma torch (MPT) and internal extractive electrospray ionization (iEESI) were employed for comparative analysis of the navel orange tissue samples by mass spectrometry. The volatile organic compounds (e.g. ethanol, vanillin, leaf alcohol and jasmine lactone) were successfully detected by non-heat-assisted DAPCI-MS, while semi-volatile organic compounds (e.g. 1-nonanol and ethyl nonanoate) together with low abundance of non-volatile organic compounds (e.g. sinensetin and nobiletin) were obtained by heat-assisted DAPCI-MS. Typical nonvolatile organic compounds [e.g. 5-(hydroxymethyl)furfural and glucosan] were sensitively detected with MPT-MS. Compounds of high polarity (e.g. amino acids, alkaloids and sugars) were easily profiled with iEESI-MS. Our data showed that more analytes could be detected when more energy was delivered for the desorption ionization purpose; however, heat-sensitive analytes would not be detected once the energy input exceeded the dissociation barriers of the analytes. For the later cases, soft ionization methods such as iEESI were recommended to sensitively profile the bioanalytes of high polarity. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Neuron-derived IgG protects dopaminergic neurons from insult by 6-OHDA and activates microglia through the FcγR I and TLR4 pathways.

PubMed

Zhang, Jie; Niu, Na; Wang, Mingyu; McNutt, Michael A; Zhang, Donghong; Zhang, Baogang; Lu, Shijun; Liu, Yuqing; Liu, Zhihui

2013-08-01

Oxidative and immune attacks from the environment or microglia have been implicated in the loss of dopaminergic neurons of Parkinson's disease. The role of IgG which is an important immunologic molecule in the process of Parkinson's disease has been unclear. Evidence suggests that IgG can be produced by neurons in addition to its traditionally recognized source B lymphocytes, but its function in neurons is poorly understood. In this study, extensive expression of neuron-derived IgG was demonstrated in dopaminergic neurons of human and rat mesencephalon. With an in vitro Parkinson's disease model, we found that neuron-derived IgG can improve the survival and reduce apoptosis of dopaminergic neurons induced by 6-hydroxydopamine toxicity, and also depress the release of NO from microglia triggered by 6-hydroxydopamine. Expression of TNF-α and IL-10 in microglia was elevated to protective levels by neuron-derived IgG at a physiologic level via the FcγR I and TLR4 pathways and microglial activation could be attenuated by IgG blocking. All these data suggested that neuron-derived IgG may exert a self-protective function by activating microglia properly, and IgG may be involved in maintaining immunity homeostasis in the central nervous system and serve as an active factor under pathological conditions such as Parkinson's disease. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

From HeLa cell division to infectious diarrhoea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stephen, J.; Osborne, M.P.; Spencer, A.J.

1990-09-01

Hela S3 cells were grown in suspension both randomly and, synchronously using hydroxyurea which blocks cells at the G1/S interface. Cryosections were prepared, freeze-dried and analyzed by X-ray microanalysis. As cells moved into S and through M phases (Na) and (Cl) increased; both returned to normal levels upon re-entering G1 phase. The Na/K ratio was 1:1 in G1 phase. Infection of HeLa S3 cells in G1 phase with vaccinia virus resulted in no change in intracellular (Na). Infection of neonatal mice with murine rotavirus was localized to villus tip enterocytes and gave rise to diarrhoea which was maximal at 72hmore » post-infection (p.i.). Diarrhoea was preceded by ischemia of villi (18-42h p.i.) and villus shortening (maximal at 42h p.i.), and was also coincident with a dramatic regrowth of villi. At 48h p.i. a proliferative zone of electron lucent cells was observed in villus base regions. Cryosections of infected gut, taken before, during, and after infection, together with corresponding age-matched controls, were freeze-dried and analysed by X-ray microanalysis. At 48h p.i. electron lucent villus base cells were shown to be more hydrated, and, to contain higher levels of both Na and Cl and lower levels of P, S, K and Mg than corresponding control cells. These studies increase confidence in the use of X-ray microanalysis in studying biological systems, provide some insight into the process of cell division, and constitute the basis of a new concept of diarrhoeal secretion.27 references.« less

Stress and fish reproduction: The roles of allostasis and hormesis

USGS Publications Warehouse

Schreck, C.B.

2010-01-01

This paper is a review of the effects of stress on reproduction in fishes. I hope to further the development of the concepts of allostasis and hormesis as relevant to understanding reproduction in general and in fish in particular. The main contentions I derive in this review are the following: Stressors affect fish reproduction in a variety of ways depending on the nature and severity of the stressor. The effects are transduced through a hormonal cascade initiated by perception of the stressor and involving the hypothalamus-pituitary-interrenal axis, the catecholamines, and also cytokines. Mounting a stress response and resisting a stressor is an energetically costly process, including costs associated with allostasis, attempting to reset homeostatic norms. Responses in emergency situations (e.g., being chased by a predator or a net) can be different from those where fish can cope (e.g., being in a more crowded environment) with a stressor, but both situations involve energy re-budgeting. Emergency responses happen in concert with the onset of energy limitations (e.g., the fish may not eat), while coping with allostatic overload can happen in a more energy-rich environment (e.g., the fish can continue to eat). Low levels of stress may have a positive effect on reproductive processes while greater stress has negative effects on fish reproduction. The concept of hormesis is a useful way to think about the effect of stressors on fish reproduction since responses can be nonmonotonal, often biphasic.

Characterization of the Degree of Food Processing in Relation With Its Health Potential and Effects.

PubMed

Fardet, Anthony

2018-01-01

Up today technological processes are intended to produce safe and palatable food products. Yet, it is also expected that processing produces healthy and sustainable foods. However, due to the dramatic increase of chronic diseases prevalence worldwide, i.e., obesity, type 2 diabetes, cardiovascular diseases, and some cancers, ultraprocessing has been pointed out as producing unhealthy foods, rich in energy and poor in protective micronutrients and fiber, i.e., "empty" calories. Indeed the 1980s saw massive arrivals of ultraprocessed foods in supermarkets, i.e., fractionated-recombined foods with added ingredients and/or additives. Epidemiological studies clearly emphasized that populations adhering the most to ultraprocessed foods, e.g., processed meat, refined grains, ultraprocessed plant-based foods, and/or sweetened beverages, exhibited the higher prevalence of chronic diseases. This prompted researchers to classify foods according to their degree of processing as with the international NOVA classification (i.e., un/minimally processed, processed, and ultraprocessed foods). More and more studies showed that such a classification makes sense for health. Overall one distinguishes three categories of processes: mechanical, thermal, and fermentative treatments, this latter being the more favorable to food health potential. This chapter has therefore several ambitions: (1) to review association between degree of food processing and chronic disease risk prevalence; (2) to explore the impact of technological processes on food health potential considering both matrix and compositional effects; (3) to discuss the need for classifying food according to their degree of processing in future epidemiological studies; and (4) to analyze consequences of adhering to a more holistic paradigm in both food processing and nutrition. © 2018 Elsevier Inc. All rights reserved.

Michaelis kinetic analysis of extracellular cellulase and amylase excreted by Lactobacillus plantarum during cassava fermentation

NASA Astrophysics Data System (ADS)

Frediansyah, Andri; Kurniadi, Muhamad

2017-01-01

Our previous study reveal that single culture of Lactobacillus plantarum has ability to ferment cassava tuber in relation to produce modified cassava flour (mocaf). It was used to accelerate a fermentation process. L. plantarum grow well and produce some extracellular enzymes i.e. cellulase to change the structure and breakdown the cell wall of cassava tuber. Then, the starchy materials will be hydrolyzed by i.e. amylase into simple sugar and convert to organic acid. All of these process will give new characteristic of cassava i.e. lower fiber content, good flavor, taste, aroma and texture and the amount of cyanide acid is lower. Therefore this present study was to analyze Michaelis kinetics of extracellular carboxymethyl cellulase and amylase production by L. plantarum during cassava fermentation. The maximum carboxymethyl cellulase and amylase activity of 8.60 U/ml and 14.07 U/ml, respectively, were obtained from filtrate which has been incubated at 37°C for 18 h under stationary conditions. The Vmax and Km of CMCase were 0.8506 × 10-3 U/ml and 0.9594 × 10-3 g/mL, respectively. For amylase were 9.291 × 10-3 U/ml and 0.9163 × 10-3 g/ml, respectively.

G-Hash: Towards Fast Kernel-based Similarity Search in Large Graph Databases.

PubMed

Wang, Xiaohong; Smalter, Aaron; Huan, Jun; Lushington, Gerald H

2009-01-01

Structured data including sets, sequences, trees and graphs, pose significant challenges to fundamental aspects of data management such as efficient storage, indexing, and similarity search. With the fast accumulation of graph databases, similarity search in graph databases has emerged as an important research topic. Graph similarity search has applications in a wide range of domains including cheminformatics, bioinformatics, sensor network management, social network management, and XML documents, among others.Most of the current graph indexing methods focus on subgraph query processing, i.e. determining the set of database graphs that contains the query graph and hence do not directly support similarity search. In data mining and machine learning, various graph kernel functions have been designed to capture the intrinsic similarity of graphs. Though successful in constructing accurate predictive and classification models for supervised learning, graph kernel functions have (i) high computational complexity and (ii) non-trivial difficulty to be indexed in a graph database.Our objective is to bridge graph kernel function and similarity search in graph databases by proposing (i) a novel kernel-based similarity measurement and (ii) an efficient indexing structure for graph data management. Our method of similarity measurement builds upon local features extracted from each node and their neighboring nodes in graphs. A hash table is utilized to support efficient storage and fast search of the extracted local features. Using the hash table, a graph kernel function is defined to capture the intrinsic similarity of graphs and for fast similarity query processing. We have implemented our method, which we have named G-hash, and have demonstrated its utility on large chemical graph databases. Our results show that the G-hash method achieves state-of-the-art performance for k-nearest neighbor (k-NN) classification. Most importantly, the new similarity measurement and the index structure is scalable to large database with smaller indexing size, faster indexing construction time, and faster query processing time as compared to state-of-the-art indexing methods such as C-tree, gIndex, and GraphGrep.

Social priming of dyslexia and reduction of the Stroop effect: what component of the Stroop effect is actually reduced?

PubMed

Augustinova, Maria; Ferrand, Ludovic

2014-03-01

Recently, Goldfarb, Aisenberg, and Henik (2011) showed that in a manual format of the Stroop task, dyslexia priming eliminates the normal magnitude of the interference-based Stroop-like findings otherwise exhibited by individuals participating in such research. Goldfarb et al. (2011) consequently concluded that the effect of word reading in a Stroop task (i.e., one automatic behavior) can be effectively controlled through an automatic instruction "do not read" (i.e., another automatic behavior). The present study further investigated these ideas by examining when and how dyslexia priming controls different processes involved in a Stroop task. To this end, the original finding was first replicated (Experiment 1) and subsequently extended to the vocal (instead of manual) response modality to examine whether previously reported eliminations of the Stroop effect persist with this response format (i.e., format producing larger Stroop effects). Since past work (e.g., Augustinova & Ferrand, 2012a; Brown, Joneleit et al., 2002; Ferrand & Augustinova, 2013) had suggested that various interventions were likely to reduce (rather than eliminate) the interference-based Stroop-like findings with vocal responses, a further aim of these experiments was to identify the component of these findings that dyslexia priming actually reduces. To this end, the effects of this intervention were examined in a more fine-grained variant of the Stroop task that distinguished between interference resulting from task-irrelevant processes involved in computing the lexical and semantic representations of the word (i.e., a written distractor to ignore) and task-relevant processes involved in the selection of a response (i.e., a color target to name) that are both involved in this task. In line with our past work (e.g., Augustinova & Ferrand, 2012a; Ferrand & Augustinova, 2013), the results of two experiments (Experiments 2 and 3) showed that in the vocal format, dyslexia priming reduces but does not eliminate the normal magnitude of the interference-based Stroop-like findings and that this reduction is solely due to the control of processes involved in the selection of a response (i.e., a color target to name) - processes that are known to be controllable in this format (Ferrand & Augustinova, 2013). Given that in this format, dyslexia priming had no effect on task-irrelevant processes involved in computing the lexical and semantic representations of a written distractor to be ignored - processes that are known to be automatic - further implications for the control of automatic processes via dyslexia priming are considered and an interpretation in terms of a unitary control mechanism for both the manual and vocal formats is proposed. Copyright © 2013 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marshall, R.S.

A simple in-line americium assay instrument (AAI) was installed at an americium recovery process area at LASL for use in process development and for providing process control information. The AAI counts 59.5-keV /sup 241/Am gamma rays, using a NaI(T1) detector and Eberline SAM II electronics. It has a useful range of 3 x 10/sup -5/ to 10 g Am/l and does not suffer from plutonium interference. Comparative analyses of samples assayed in the AAI and samples assayed by the LASL Analytical Laboratory show a combined relative standard deviation of 14%.

Mercury health effects among the workers extracting gold from carpets and dusted clays through amalgamation and roasting processes.

PubMed

Gul, Nayab; Khan, Sardar; Khan, Abbas; Ahmad, Sheikh Saeed

2015-11-01

Mercury (Hg) is a highly toxic metal which can cause serious health effects. The aim of this research was to determine the concentrations of total Hg (T-Hg), methyl Hg (Me-Hg), and inorganic Hg (I-Hg) in the biological samples (plasma, red blood cells (RBCs), urine, hair, and nails) of the exposed goldsmith workers. This is the first study that determines the detailed Hg concentrations in the biological samples (plasma, RBCs, urine, hair, and nails) of the exposed goldsmith workers and correlates them with the diseases noted among the workers in a single paper. Biological samples were collected from goldsmith workers (n = 40) and analyzed for T-Hg, Me-Hg, and I-Hg using atomic absorption spectrometer equipped with mercury hydride system. The mean T-Hg concentration in RBCs (33 μg L(-1)), plasma (11.8 μg L(-1)), urine (167 μg L(-1)), hair (4.21 μg g(-1)), and nails (5.91 μg g(-1)) were higher than the control RBCs (1.64 μg L(-1)), plasma (0.55 μg L(-1)), urine (2.72 μg L(-1)), hair (0.35 μg g(-1)), and nails (0.51 μg g(-1)). All workers participated in this study were suffering from physical and mental diseases. The concentration of Hg was found higher among the workers suffering from mental diseases as compared to those suffering from physical diseases. Among the physical diseases, the most serious diseases were sexual dysfunction, skin diseases, and fatigue because the workers suffering from these diseases had higher concentration of Hg than the workers with other diseases. The occurrence of physical diseases (88%) was greater than the mental diseases (53%) among the workers. The correlations of physical and mental diseases with experience (years of work) and exposure time were significant (p < 0.05), while nonsignificant (p > 0.05) correlation was observed between demographic parameters and Hg concentrations in the biological samples of the workers. The burning process of amalgamated gold is a significant source of Hg exposure to goldsmith workers; therefore, awareness and precautionary measures are needed to provide protection to them.

Junctionless tri-gate InGaAs MOSFETs

NASA Astrophysics Data System (ADS)

Zota, Cezar B.; Borg, Mattias; Wernersson, Lars-Erik; Lind, Erik

2017-12-01

We demonstrate and characterize junctionless tri-gate InGaAs MOSFETs, fabricated using a simplified process with gate lengths down to L g = 25 nm at a nanowire dimension of 7 × 16 nm2. These devices use a single 7-nm-thick In0.80Ga0.20As (N D = 1 × 1019 cm-3) layer as both channel and contacts. The devices show SSsat = 76 mV/dec, peak g m = 1.6 mS/µm and I ON = 160 µA/µm (at I OFF = 100 nA/µm and V DD = 0.5 V), the latter which is the highest reported value for a junctionless FET. We also show that device performance is mainly limited by high parasitic access resistance due to the narrow and thin contact layer.

Compile-Time Partitioning and Scheduling of Parallel Programs. Extended Summary,

DTIC Science & Technology

1986-01-01

OO-MI70 9PROGRAMS EXTENED, SUMNNRY(U) STANFORD, UNIV CA COMPUTERSYSTEMS LAO V SARKAR ET AL. L986 MDA9S3-SS-C-S432 UNCLASSIFIEDj F/ G 9/2 H El- 1 9 5...9 C M E h h h" E P RIIN N E O UI G O Fh E L i E Eu Iwle ui J l~I-O IWI INW 2-5 1= 13.111 2-2 l o U l1 . A 12- "m ’- - "- m°" m ’o ’ l ’. , " l...J. A. et al. "Parallel Processing: A Smart Compiler and a Dumb Machine". SIGPLAN Notices 19, 6 (June 1984). 8. Gajski , D. D., Padua, D. K. & Kuck, D

Development of operationally stable inverted organic light-emitting diode prepared without using alkali metals (Presentation Recording)

NASA Astrophysics Data System (ADS)

Fukagawa, Hirohiko; Morii, Katsuyuki; Hasegawa, Munehiro; Gouda, Shun; Tsuzuki, Toshimitsu; Shimizu, Takahisa; Yamamoto, Toshihiro

2015-10-01

The OLED is one of the key devices for realizing future flexible displays and lightings. One of the biggest challenges left for the OLED fabricated on a flexible substrate is the improvement of its resistance to oxygen and moisture. A high barrier layer [a water vapor transmission rate (WVTR) of about 10-6 g/m2/day] is proposed to be necessary for the encapsulation of conventional OLEDs. Some flexible high barrier layers have recently been demonstrated; however, such high barrier layers require a complex process, which makes flexible OLEDs expensive. If an OLED is prepared without using air-sensitive materials such as alkali metals, no stringent encapsulation is necessary for such an OLED. In this presentation, we will discuss our continuing efforts to develop an inverted OLED (iOLED) prepared without using alkali metals. iOLEDs with a bottom cathode are considered to be effective for realizing air-stable OLEDs since the electron injection layer (EIL) can be prepared by fabrication processes that might damage the organic layers, resulting in the enhanced range of materials suitable for EILs. We have demonstrated that a highly efficient and relatively air-stable iOLED can be realized by employing poly(ethyleneimine) as an EIL. Dark spot formation was not observed after 250 days in the poly(ethyleneimine)-based iOLED encapsulated by a barrier film with a WVTR of 10-4 g/m2/day. In addition, we have demonstrated the fabrication of a highly operational stable iOLED utilizing a newly developed EIL. The iOLED exhibits an expected half-lifetime of over 10,000 h from an initial luminance of 1,000 cd/m2.

Lysophosphatidylinositol-induced activation of the cation channel TRPV2 triggers glucagon-like peptide-1 secretion in enteroendocrine L cells.

PubMed

Harada, Kazuki; Kitaguchi, Tetsuya; Kamiya, Taichi; Aung, Kyaw Htet; Nakamura, Kazuaki; Ohta, Kunihiro; Tsuboi, Takashi

2017-06-30

The lysophosphatidylinositol (LPI) has crucial roles in multiple physiological processes, including insulin exocytosis from pancreatic islets. However, the role of LPI in secretion of glucagon-like peptide-1 (GLP-1), a hormone that enhances glucose-induced insulin secretion, is unclear. Here, we used the murine enteroendocrine L cell line GLUTag and primary murine small intestinal cells to elucidate the mechanism of LPI-induced GLP-1 secretion. Exogenous LPI addition increased intracellular Ca 2+ concentrations ([Ca 2+ ] i ) in GLUTag cells and induced GLP-1 secretion from both GLUTag and acutely prepared primary intestinal cells. The [Ca 2+ ] i increase was suppressed by an antagonist for G protein-coupled receptor 55 (GPR55) and by silencing of GPR55 expression, indicating involvement of G q and G 12/13 signaling pathways in the LPI-induced increased [Ca 2+ ] i levels and GLP-1 secretion. However, GPR55 agonists did not mimic many of the effects of LPI. We also found that phospholipase C inhibitor and Rho-associated kinase inhibitor suppressed the [Ca 2+ ] i increase and that LPI increased the number of focal adhesions, indicating actin reorganization. Of note, blockage or silencing of transient receptor potential cation channel subfamily V member 2 (TRPV2) channels suppressed both the LPI-induced [Ca 2+ ] i increase and GLP-1 secretion. Furthermore, LPI accelerated TRPV2 translocation to the plasma membrane, which was significantly suppressed by a GPR55 antagonist. These findings suggest that TRPV2 activation via actin reorganization induced by G q and G 12/13 signaling is involved in LPI-stimulated GLP-1 secretion in enteroendocrine L cells. Because GPR55 agonists largely failed to mimic the effects of LPI, its actions on L cells are at least partially independent of GPR55 activation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The influence of monovalent cations on trimeric G protein G(i)1α activity in HEK293 cells stably expressing DOR-G(i)1α (Cys(351)-Ile(351)) fusion protein.

PubMed

Vošahlíková, M; Svoboda, P

2011-01-01

The effect of monovalent cations on trimeric G protein G(i)1α was measured at equimolar concentration of chloride anion in pertussis-toxin (PTX)-treated HEK293 cells stably expressing PTX-insensitive DOR- G(i)1α (Cys(351)-Ile(351)) fusion protein by high-affinity [(35)S]GTPgammaS binding assay. The high basal level of binding was detected in absence of DOR agonist and monovalent ions and this high level was inhibited with the order of: Na(+) > K(+) > Li(+). The first significant inhibition was detected at 1 mM NaCl. The inhibition by monovalent ions was reversed by increasing concentrations of DOR agonist DADLE. The maximum DADLE response was also highest for sodium and decreased in the order of: Na(+) > K(+) ~ Li(+). Our data indicate i) an inherently high activity of trimeric G protein G(i)1α when expressed within DOR- G(i)1α fusion protein and determined in the absence of monovalent cations, ii) preferential sensitivity of DOR- G(i)1alpha to sodium as far as maximum of agonist response is involved.

78 FR 69302 - National Oil and Hazardous Substances Pollution Contingency Plan; National Priorities List...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-19

..., II-T, III-C, I-C, II-U, I-B, I-E, I-G, I-H, I-I, I-J, I-L, I-M, I-P, II-G, II-I, II-P, III-D, I-K, I..., I-H, I-I, I-J, I-L, I-M, I-P, II-G, II-I, II-P, III-D, I-K, I-N, I-O, I-S, II-E, II-L, II-M, II-R, I... 102(h) of CERCLA, to document that all environmental impacts associated with the DON's activities on...

H I-SELECTED GALAXIES IN THE SLOAN DIGITAL SKY SURVEY. II. THE COLORS OF GAS-RICH GALAXIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

West, Andrew A.; Garcia-Appadoo, Diego A.; Dalcanton, Julianne J.

2009-09-15

We utilize color information for an H I-selected sample of 195 galaxies to explore the star formation histories and physical conditions that produce the observed colors. We show that the H I selection creates a significant offset toward bluer colors that can be explained by enhanced recent bursts of star formation. There is also no obvious color bimodality, because the H I selection restricts the sample to bluer, actively star-forming systems, diminishing the importance of the red sequence. Rising star formation rates are still required to explain the colors of galaxies bluer than g - r< 0.3. We also demonstratemore » that the colors of the bluest galaxies in our sample are dominated by emission lines and that stellar population synthesis models alone (without emission lines) are not adequate for reproducing many of the galaxy colors. These emission lines produce large changes in the r - i colors but leave the g - r color largely unchanged. In addition, we find an increase in the dispersion of galaxy colors at low masses that may be the result of a change in the star formation process in low-mass galaxies.« less

Binding thermodynamics of phosphorylated inhibitors to triosephosphate isomerase and the contribution of electrostatic interactions.

PubMed

Serratos, Iris N; Pérez-Hernández, Gerardo; Garza-Ramos, Georgina; Hernández-Arana, Andrés; González-Mondragón, Edith; Zubillaga, Rafael A

2011-01-07

Electrostatic interactions have a central role in some biological processes, such as recognition of charged ligands by proteins. We characterized the binding energetics of yeast triosephosphate isomerase (TIM) with phosphorylated inhibitors 2-phosphoglycollate (2PG) and phosphoglycolohydroxamate (PGH). We determined the thermodynamic parameters of the binding process (K(b), ΔG(b), ΔH(b), ΔS(b) and ΔC(p)) with different concentrations of NaCl, using fluorimetric and calorimetric titrations in the conventional mode of ITC and a novel method, multithermal titration calorimetry (MTC), which enabled us to measure ΔC(p) in a single experiment. We ruled out specific interactions of Na(+) and Cl(-) with the native enzyme and did not detect significant linked protonation effects upon the binding of inhibitors. Increasing ionic strength (I) caused K(b), ΔG(b) and ΔH(b) to become less favorable, while ΔS(b) became less unfavorable. From the variation of K(b) with I, we determined the electrostatic contribution of TIM-2PG and TIM-PGH to ΔG(b) at I=0.06 M and 25 °C to be 36% and 26%, respectively. The greater affinity of PGH for TIM is due to a more favorable ΔH(b) compared to 2PG (by 19-24 kJ mol(-1) at 25 °C). This difference is compatible with PGH establishing up to five more hydrogen bonds with TIM. Both binding ΔC(p)s were negative, and less negative with increasing ionic strength. ΔC(p)s at I=0.06 M were much more negative than predicted by surface area models. Water molecules trapped in the interface when ligands bind to protein could explain the highly negative ΔCps. Thermodynamic binding functions for TIM-2PG changed more with ionic strength than those for TIM-PGH. This greater dependence is consistent with linked, but compensated, protonation equilibriums yielding the dianionic species of 2PG that binds to TIM, process that is not required for PGH. Copyright © 2010 Elsevier Ltd. All rights reserved.

Mean Energy Density of Photogenerated Magnetic Fields Throughout the EoR

NASA Astrophysics Data System (ADS)

Durrive, Jean-Baptiste; Tashiro, Hiroyuki; Langer, Mathieu; Sugiyama, Naoshi

2018-05-01

There seems to be magnetic fields at all scales and epochs in our Universe, but their origin at large scales remains an important open question of cosmology. In this work we focus on the generation of magnetic fields in the intergalactic medium due to the photoionizations by the first galaxies, all along the Epoch of Reionization. Based on previous studies which considered only isolated sources, we develop an analytical model to estimate the mean magnetic energy density accumulated in the Universe by this process. In our model, without considering any amplification process, the Universe is globally magnetized by this mechanism to the order of, at least, several 10-18 G during the Epoch of Reionization (i.e. a few 10-20 G comoving).

Excitation of O 2(a 1Δ g, b 1Σ g+) and I( 2P 1/2) by energy transfer from I 2(A, A' 3Π 1,2u) in solid rare gases

NASA Astrophysics Data System (ADS)

Böhling, R.; Becker, A. C.; Minaev, B. F.; Seranski, K.; Schurath, U.

1990-04-01

O 2a 1Δ g, b 1Σ g+ → X 3Σ g- and I 2P 1/2→ 2P 3/4 fluorescence occurs in I 2/O 2-doped rare gas matrices when I 2 is excited with visible laser light. O 2(a 1Δ g) and I( 2P 1/2) are populated independently by near-resonant energy transfer from the metastable triplet states of I 2. The doublet splitting of the O 2a→X band, which peaks at 7879 and 7863 cm -1 in argon, is interpreted as sensitized emission from O 2 trapped in distinct nearest neighbour positions of the donor 3I 2. Annealing reverses the intensity of the doublet, showing that the sites can be interconverted. It is suggested that the a→X emission rate is enhanced by the sensitizer, causing a lifetime reduction of the a 1Δ g state from 79 s in pure argon to 21 and 3±1 s next to I 2. The long-lived O 2(a 1Δ g) state is the precursor of I 2-sensitized emission from O 2(b 1Σ g+). The lifetime of O 2(b 1Σ g+) is reduced from 24.5 ms in pure argon to 17±1 ms in the presence of I 2.

The ironic effect of guessing: increased false memory for mediated lists in younger and older adults

PubMed Central

Coane, Jennifer H.; Huff, Mark J.; Hutchison, Keith A.

2016-01-01

Younger and older adults studied lists of words directly (e.g., creek, water) or indirectly (e.g., beaver, faucet) related to a nonpresented critical lure (CL; e.g., river). Indirect (i.e., mediated) lists presented items that were only related to CLs through nonpresented mediators (i.e., directly related items). Following study, participants completed a condition-specific task, math, a recall test with or without a warning about the CL, or tried to guess the CL. On a final recognition test, warnings (vs. math and recall without warning) decreased false recognition for direct lists, and guessing increased mediated false recognition (an ironic effect of guessing) in both age groups. The observed age-invariance of the ironic effect of guessing suggests that processes involved in mediated false memory are preserved in aging and confirms the effect is largely due to activation in semantic networks during encoding and to the strengthening of these networks during the interpolated tasks. PMID:26393390

The ironic effect of guessing: increased false memory for mediated lists in younger and older adults.

PubMed

Coane, Jennifer H; Huff, Mark J; Hutchison, Keith A

2016-01-01

Younger and older adults studied lists of words directly (e.g., creek, water) or indirectly (e.g., beaver, faucet) related to a nonpresented critical lure (CL; e.g., river). Indirect (i.e., mediated) lists presented items that were only related to CLs through nonpresented mediators (i.e., directly related items). Following study, participants completed a condition-specific task, math, a recall test with or without a warning about the CL, or tried to guess the CL. On a final recognition test, warnings (vs. math and recall without warning) decreased false recognition for direct lists, and guessing increased mediated false recognition (an ironic effect of guessing) in both age groups. The observed age-invariance of the ironic effect of guessing suggests that processes involved in mediated false memory are preserved in aging and confirms the effect is largely due to activation in semantic networks during encoding and to the strengthening of these networks during the interpolated tasks.

Constitutive Gαi coupling activity of very large G protein-coupled receptor 1 (VLGR1) and its regulation by PDZD7 protein.

PubMed

Hu, Qiao-Xia; Dong, Jun-Hong; Du, Hai-Bo; Zhang, Dao-Lai; Ren, Hong-Ze; Ma, Ming-Liang; Cai, Yuan; Zhao, Tong-Chao; Yin, Xiao-Lei; Yu, Xiao; Xue, Tian; Xu, Zhi-Gang; Sun, Jin-Peng

2014-08-29

The very large G protein-coupled receptor 1 (VLGR1) is a core component in inner ear hair cell development. Mutations in the vlgr1 gene cause Usher syndrome, the symptoms of which include congenital hearing loss and progressive retinitis pigmentosa. However, the mechanism of VLGR1-regulated intracellular signaling and its role in Usher syndrome remain elusive. Here, we show that VLGR1 is processed into two fragments after autocleavage at the G protein-coupled receptor proteolytic site. The cleaved VLGR1 β-subunit constitutively inhibited adenylate cyclase (AC) activity through Gαi coupling. Co-expression of the Gαiq chimera with the VLGR1 β-subunit changed its activity to the phospholipase C/nuclear factor of activated T cells signaling pathway, which demonstrates the Gαi protein coupling specificity of this subunit. An R6002A mutation in intracellular loop 2 of VLGR1 abolished Gαi coupling, but the pathogenic VLGR1 Y6236fsx1 mutant showed increased AC inhibition. Furthermore, overexpression of another Usher syndrome protein, PDZD7, decreased the AC inhibition of the VLGR1 β-subunit but showed no effect on the VLGR1 Y6236fsx1 mutant. Taken together, we identified an independent Gαi signaling pathway of the VLGR1 β-subunit and its regulatory mechanisms that may have a role in the development of Usher syndrome. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Hybrid Scenario Development Methodology and Tool: An Arctic-Oriented Scenario Example

DTIC Science & Technology

2011-07-01

T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T SECURITY(INC DEFENCE) LEGAL ENVIRONMENTAL...SECURITY(INC DEFENCE) S C E N A R I O D E V E L O P M E N T E N D S T A T E = S C E N A R I O T R I G G E R P O I N T

Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

PubMed

Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

2015-06-26

Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

The Diverse Origins of Neutron-capture Elements in the Metal-poor Star HD 94028: Possible Detection of Products of I-Process Nucleosynthesis

NASA Astrophysics Data System (ADS)

Roederer, Ian U.; Karakas, Amanda I.; Pignatari, Marco; Herwig, Falk

2016-04-01

We present a detailed analysis of the composition and nucleosynthetic origins of the heavy elements in the metal-poor ([Fe/H] = -1.62 ± 0.09) star HD 94028. Previous studies revealed that this star is mildly enhanced in elements produced by the slow neutron-capture process (s process; e.g., [Pb/Fe] = +0.79 ± 0.32) and rapid neutron-capture process (r process; e.g., [Eu/Fe] = +0.22 ± 0.12), including unusually large molybdenum ([Mo/Fe] = +0.97 ± 0.16) and ruthenium ([Ru/Fe] = +0.69 ± 0.17) enhancements. However, this star is not enhanced in carbon ([C/Fe] = -0.06 ± 0.19). We analyze an archival near-ultraviolet spectrum of HD 94028, collected using the Space Telescope Imaging Spectrograph on board the Hubble Space Telescope, and other archival optical spectra collected from ground-based telescopes. We report abundances or upper limits derived from 64 species of 56 elements. We compare these observations with s-process yields from low-metallicity AGB evolution and nucleosynthesis models. No combination of s- and r-process patterns can adequately reproduce the observed abundances, including the super-solar [As/Ge] ratio (+0.99 ± 0.23) and the enhanced [Mo/Fe] and [Ru/Fe] ratios. We can fit these features when including an additional contribution from the intermediate neutron-capture process (I process), which perhaps operated through the ingestion of H in He-burning convective regions in massive stars, super-AGB stars, or low-mass AGB stars. Currently, only the I process appears capable of consistently producing the super-solar [As/Ge] ratios and ratios among neighboring heavy elements found in HD 94028. Other metal-poor stars also show enhanced [As/Ge] ratios, hinting that operation of the I process may have been common in the early Galaxy. These data are associated with Program 072.B-0585(A), PI. Silva. Some data presented in this paper were obtained from the Barbara A. Mikulski Archive for Space Telescopes (MAST). The Space Telescope Science Institute is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS5-26555. These data are associated with Programs GO-7402 and GO-8197. This work is based on data obtained from the European Southern Observatory (ESO) Science Archive Facility. These data are associated with Program 072.B-0585(A). This paper includes data taken at The McDonald Observatory of The University of Texas at Austin.

Silica-coated magnetite nanoparticles core-shell spheres (Fe3O4@SiO2) for natural organic matter removal.

PubMed

Karimi Pasandideh, Elahe; Kakavandi, Babak; Nasseri, Simin; Mahvi, Amir Hossein; Nabizadeh, Ramin; Esrafili, Ali; Rezaei Kalantary, Roshanak

2016-01-01

In this work, the magnetite (Fe 3 O 4 ) nanoparticles (MNPs) and silica-coated magnetite nanoparticles (SMNPs) were synthesized as adsorbents for removing humic acid (HA) from water resources. The adsorption processes were performed in batch experiments with which the influence of pH, reaction time, adsorbent dosage, initial concentrations of HA and temperature were investigated. Specific techniques were applied to characterize the features of both adsorbents (i. e. TECHNIQUES) (SEM, XRD, TEM, BET, EDX and VSM). The maximum saturation magnetization for SMNPs was 30.2 emu/g, which made its separation from the solution by a magnetic field to be easier and faster. The HA adsorption process onto the both adsorbents were best described by the Freundlich isotherm and pseudo-second-order kinetic models. Highest adsorption efficiency of HA by MNPs an d SMNPs occurred at acidic conditions (pH ≈ 3). The mechanisms of adsorption process involved with a physisorption process such as (i. e. hydrogen bonding and electrostatic interaction). The predicted maximum monolayer adsorption capacities obtained by Langmuir isotherm model for MNPs and SMNPs were 96.15 and 196.07 mg/g, respectively. Higher amount of HA adsorption onto the surfaces of SMNPs than MNPs surfaces was observed, reflecting that silica impregnated on MNPs enhances the efficiency of the adsorbent in removing HA.

Modality-specific processing precedes amodal linguistic processing during L2 sign language acquisition: A longitudinal study.

PubMed

Williams, Joshua T; Darcy, Isabelle; Newman, Sharlene D

2016-02-01

The present study tracked activation pattern differences in response to sign language processing by late hearing second language learners of American Sign Language. Learners were scanned before the start of their language courses. They were scanned again after their first semester of instruction and their second, for a total of 10 months of instruction. The study aimed to characterize modality-specific to modality-general processing throughout the acquisition of sign language. Results indicated that before the acquisition of sign language, neural substrates related to modality-specific processing were present. After approximately 45 h of instruction, the learners transitioned into processing signs on a phonological basis (e.g., supramarginal gyrus, putamen). After one more semester of input, learners transitioned once more to a lexico-semantic processing stage (e.g., left inferior frontal gyrus) at which language control mechanisms (e.g., left caudate, cingulate gyrus) were activated. During these transitional steps right hemispheric recruitment was observed, with increasing left-lateralization, which is similar to other native signers and L2 learners of spoken language; however, specialization for sign language processing with activation in the inferior parietal lobule (i.e., angular gyrus), even for late learners, was observed. As such, the present study is the first to track L2 acquisition of sign language learners in order to characterize modality-independent and modality-specific mechanisms for bilingual language processing. Copyright © 2015 Elsevier Ltd. All rights reserved.

10 CFR 2.1011 - Management of electronic information.

Code of Federal Regulations, 2012 CFR

2012-01-01

... production and service: (i) The participants shall make textual (or, where non-text, image) versions of their... set and be in one of the following acceptable formats: ASCII, native word processing (Word, WordPerfect), PDF Normal, or HTML. (iv) Image files must be formatted as TIFF CCITT G4 for bi-tonal images or...

Working Memory in Aphasia: Theory, Measures, and Clinical Implications

ERIC Educational Resources Information Center

Wright, Heather Harris; Shisler, Rebecca J.

2005-01-01

Recently, researchers have suggested that deficits in working memory capacity contribute to language-processing difficulties observed in individuals with aphasia (e.g., I. Caspari, S. Parkinson, L. LaPointe, & R. Katz, 1998; R. A. Downey et al., 2004; N. Friedmann & A. Gvion, 2003; H. H. Wright, M. Newhoff, R. Downey, & S. Austermann, 2003). A…

Effects of Cognitive Load on Speech Recognition

ERIC Educational Resources Information Center

Mattys, Sven L.; Wiget, Lukas

2011-01-01

The effect of cognitive load (CL) on speech recognition has received little attention despite the prevalence of CL in everyday life, e.g., dual-tasking. To assess the effect of CL on the interaction between lexically-mediated and acoustically-mediated processes, we measured the magnitude of the "Ganong effect" (i.e., lexical bias on phoneme…

48 CFR 252.245-7002 - Reporting Loss of Government Property.

Code of Federal Regulations, 2014 CFR

2014-10-01

...) Definitions. As used in this clause— Government property is defined in the clause at FAR 52.245-1, Government...Tools software application for reporting loss of Government property. Reporting value shall be at unit... process variation, e.g., losses due to— (i) Theft; (ii) Inadequate storage; (iii) Lack of physical...

48 CFR 252.245-7002 - Reporting Loss of Government Property.

Code of Federal Regulations, 2013 CFR

2013-10-01

...) Definitions. As used in this clause— Government property is defined in the clause at FAR 52.245-1, Government...Tools software application for reporting loss of Government property. Reporting value shall be at unit... process variation, e.g., losses due to— (i) Theft; (ii) Inadequate storage; (iii) Lack of physical...

48 CFR 252.245-7002 - Reporting Loss of Government Property.

Code of Federal Regulations, 2012 CFR

2012-10-01

...) Definitions. As used in this clause— Government property is defined in the clause at FAR 52.245-1, Government...Tools software application for reporting loss of Government property. Reporting value shall be at unit... process variation, e.g., losses due to— (i) Theft; (ii) Inadequate storage; (iii) Lack of physical...

48 CFR 252.245-7002 - Reporting Loss of Government Property.

Code of Federal Regulations, 2011 CFR

2011-10-01

...) Definitions. As used in this clause— Government property is defined in the clause at FAR 52.245-1, Government...Tools software application for reporting loss of Government property. Reporting value shall be at unit... process variation, e.g., losses due to— (i) Theft; (ii) Inadequate storage; (iii) Lack of physical...

Adaptive Optical Processor

DTIC Science & Technology

1991-08-01

spatial light modulator, Dr. George Brost and I LT Edward Toughlian who helped "trouble-shoot" many of the problems that came up, Mr. Paul Repak and Mr...RADC-TR-89-226, (1989). 8. Welstead, S.T., M.J. Ward, D.M. Blanchard, G.A. Brost , S.L Halby, "Adaptive signal processing using a liquid crystal

Orthographic vs. Phonologic Syllables in Handwriting Production

ERIC Educational Resources Information Center

Kandel, Sonia; Herault, Lucie; Grosjacques, Geraldine; Lambert, Eric; Fayol, Michel

2009-01-01

French children program the words they write syllable by syllable. We examined whether the syllable the children use to segment words is determined phonologically (i.e., is derived from speech production processes) or orthographically. Third, 4th and 5th graders wrote on a digitiser words that were mono-syllables phonologically (e.g.…

Technical Note: Coupling of chemical processes with the Modular Earth Submodel System (MESSy) submodel TRACER

NASA Astrophysics Data System (ADS)

Jöckel, P.; Kerkweg, A.; Buchholz-Dietsch, J.; Tost, H.; Sander, R.; Pozzer, A.

2008-03-01

The implementation of processes related to chemistry into Earth System Models and their coupling within such systems requires the consistent description of the chemical species involved. We provide a tool (written in Fortran95) to structure and manage information about constituents, hereinafter referred to as tracers, namely the Modular Earth Submodel System (MESSy) generic (i.e., infrastructure) submodel TRACER. With TRACER it is possible to define a multitude of tracer sets, depending on the spatio-temporal representation (i.e., the grid structure) of the model. The required information about a specific chemical species is split into the static meta-information about the characteristics of the species, and its (generally in time and space variable) abundance in the corresponding representation. TRACER moreover includes two submodels. One is TRACER_FAMILY, an implementation of the tracer family concept. It distinguishes between two types: type-1 families are usually applied to handle strongly related tracers (e.g., fast equilibrating species) for a specific process (e.g., advection). In contrast to this, type-2 families are applied for tagging techniques. Tagging means the artificial decomposition of one or more species into parts, which are additionally labelled (e.g., by the region of their primary emission) and then processed as the species itself. The type-2 family concept is designed to conserve the linear relationship between the family and its members. The second submodel is TRACER_PDEF, which corrects and budgets numerical negative overshoots that arise in many process implementations due to the numerical limitations (e.g., rounding errors). The submodel therefore guarantees the positive definiteness of the tracers and stabilises the integration scheme. As a by-product, it further provides a global tracer mass diagnostic. Last but not least, we present the submodel PTRAC, which allows the definition of tracers via a Fortran95 namelist, as a complement to the standard tracer definition by application of the TRACER interface routines in the code. TRACER with its submodels and PTRAC can readily be applied to a variety of models without further requirements. The code and a documentation are included in the electronic supplement.

QED-driven laser absorption

NASA Astrophysics Data System (ADS)

Levy, Matthew; Blackburn, T.; Ratan, N.; Sadler, J.; Ridgers, C.; Kasim, M.; Ceurvorst, L.; Holloway, J.; Baring, M.; Bell, A.; Glenzer, S.; Gregori, G.; Ilderton, A.; Marklund, M.; Tabak, M.; Wilks, S.; Norreys, P.

2016-10-01

Absorption covers the physical processes which convert intense photon flux into energetic particles when a high-power laser (I >1018 W cm-2 where I is intensity at 1 μm wavelength) illuminates optically-thick matter. It underpins important applications of petawatt laser systems today, e.g., in isochoric heating of materials. Next-generation lasers such as ELI are anticipated to produce quantum electrodynamical (QED) bursts of γ-rays and anti-matter via the multiphoton Breit-Wheeler process which could enable scaled laboratory probes, e.g., of black hole winds. Here, applying strong-field QED to advances in plasma kinematic theory, we present a model elucidating absorption limited only by an avalanche of self-created electron-positron pairs at ultra-high-field. The model, confirmed by multidimensional QED-PIC simulations, works over six orders of magnitude in optical intensity and reveals this cascade is initiated at 1.8 x 1025 W cm-2 using a realistic linearly-polarized laser pulse. Here the laser couples its energy into highly-collimated electrons, ions, γ-rays, and positrons at 12%, 6%, 58% and 13% efficiency, respectively. We remark on attributes of the QED plasma state and possible applications.

A Complex Organic Slushy Bathing Low-Mass Protostars

NASA Astrophysics Data System (ADS)

Drozdovskaya, Maria; Walsh, Catherine; Visser, Ruud; Harsono, Daniel; van Dishoeck, Ewine

2015-08-01

Complex organic molecules are ubiquitous companions of young forming stars. They were first observed in hot cores surrounding high-mass protostars [e.g., 1], but have since also been detected in the environs of several low-mass counterparts [e.g., 2]. Recent studies have shown that colder envelopes and positions with impinging outflows may also glow with emission from complex organic species [e.g., 3, 4]. For this meeting, I would like to present physicochemical modeling results on the synthesis of complex organics in an envelope-cavity system that is subject to non-thermal processing. This includes wavelength-dependent radiative transfer calculations with RADMC [5] and a comprehensive gas-grain chemical network [6]. The results show that the morphology of such a system delineates three distinct regions: the cavity wall layer with time-dependent and species-variant enhancements; a torus rich in complex organic ices, but not reflected in gas-phase abundances; and the remaining outer envelope abundant in simpler solid and gaseous molecules. Within the adopted paradigm, complex organic molecules are demonstrated to have unique lifetimes and be grouped into early and late species [7]. Key chemical processes for forming and destroying complex organic molecules will be discussed. In addition, the results of adding newly experimentally verified routes [8] into the existing chemical networks will be shown.[1] Blake G. A., Sutton E. C., Masson C. R., Phillips T. G., 1987, ApJ, 315, 621[2] Jørgensen J. K., Favre C., Bisschop S. E., Bourke T. L., van Dishoeck E. F., Schmalzl M., 2012, ApJ, 757, L4[3] Arce H. G., Santiago-García J., Jørgensen J. K., Tafalla M., Bachiller R., 2008, ApJ, 681, L21[4] Öberg K. I., Bottinelli S., Jørgensen J. K., van Dishoeck E. F., 2010, ApJ, 716, 825[5] Dullemond C. P., Dominik C., 2004, A&A, 417, 159[6] Walsh C., Millar T. J., Nomura H., Herbst E., Widicus Weaver S., Aikawa Y., Laas J. C., Vasyunin A. I., 2014, A&A, 563, A33[7] Drozdovskaya M. N., Walsh C., Visser R., Harsono D., van Dishoeck E. F., MNRAS, subm.[8] Fedoseev G., Cuppen H. M., Ioppolo S., Lamberts T., Linnartz H., 2015, MNRAS, 448, 128

Fate of polychlorinated dibenzo-p-dioxins and dibenzofurans in a fly ash treatment plant.

PubMed

Li, Hsing-Wang; Wu, Yee-Lin; Lee, Wen-Jhy; Chang-Chien, Guo-Ping

2007-09-01

To understand the fate of polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs) in a fly ash treatment plant that used the Waelz rotary kiln process (hereafter the Waelz process), the samples of input and output media were collected and analyzed. The most important PCDD/F source in input mass was electric arc furnace (EAF) fly ash, which had a mean PCDD/F content of 18.51 ng/g and contributed more than 99% of PCDD/F input mass, whereas the PCDD/F input mass fractions contributed by the coke, sand, and ambient air were only 0.04%, 0.02%, and 0.000002%, respectively. For the PCDD/F output mass in the Waelz process, the major total PCDD/F contents of 43.73 and 10.78 ng/g were in bag-filter and cyclone ashes, which accounted for approximately 69% and 17%, respectively, whereas those of stack flue gas and slag were 14% and 0.423%, respectively. The Waelz process has a dechlorination mechanism for higher chlorinated congeners, but it is difficult to decompose the aromatic rings of PCDD/Fs. Therefore, this resulted in the accumulation of lower chlorinated congeners. The output/input ratio of total PCDD/F mass and total PCDD/F international toxicity equivalence (I-TEQ) was 0.62 and 1.19, respectively. Thus, the Waelz process for the depletion effect of total PCDD/F mass was positive but minor, whereas the effect for total PCDD/F I-TEQ was adverse overall.

A causal test of the motor theory of speech perception: A case of impaired speech production and spared speech perception

PubMed Central

Stasenko, Alena; Bonn, Cory; Teghipco, Alex; Garcea, Frank E.; Sweet, Catherine; Dombovy, Mary; McDonough, Joyce; Mahon, Bradford Z.

2015-01-01

In the last decade, the debate about the causal role of the motor system in speech perception has been reignited by demonstrations that motor processes are engaged during the processing of speech sounds. However, the exact role of the motor system in auditory speech processing remains elusive. Here we evaluate which aspects of auditory speech processing are affected, and which are not, in a stroke patient with dysfunction of the speech motor system. The patient’s spontaneous speech was marked by frequent phonological/articulatory errors, and those errors were caused, at least in part, by motor-level impairments with speech production. We found that the patient showed a normal phonemic categorical boundary when discriminating two nonwords that differ by a minimal pair (e.g., ADA-AGA). However, using the same stimuli, the patient was unable to identify or label the nonword stimuli (using a button-press response). A control task showed that he could identify speech sounds by speaker gender, ruling out a general labeling impairment. These data suggest that the identification (i.e. labeling) of nonword speech sounds may involve the speech motor system, but that the perception of speech sounds (i.e., discrimination) does not require the motor system. This means that motor processes are not causally involved in perception of the speech signal, and suggest that the motor system may be used when other cues (e.g., meaning, context) are not available. PMID:25951749

Effects of dietary genistein on GH/IGF-I axis of Nile tilapia Oreochromis niloticus

NASA Astrophysics Data System (ADS)

Chen, Dong; Wang, Wei; Ru, Shaoguo

2016-09-01

There is considerable concern that isoflavones, such as genistein in fish feed composed of soybean protein, aff ects somatic growth in fish. Our previous works demonstrated that 30 and 300 μg/g dietary genistein had no significant eff ect on growth performance in Nile tilapia ( Oreochromis niloticus), but the higher level of genistein (3 000 μg/g) significantly depressed growth. This study was conducted to further examine the eff ects of dietary genistein on the endocrine disruption on growth hormone/insulin-like growth factor-I (GH/IGF-I) axis in Nile tilapia ( O. niloticus). Juvenile fish were fed by hand twice daily to satiation with one of four isonitrogenous and isoenergetic diets, each containing either 0, 30, 300 or 3 000 μg/g genistein. Following an 8-week feeding period, plasma GH and IGF-I levels were investigated by radioimmunoassay and gene expression levels of gh, ghrelin, gnrhs, ghr, npy, npyrs, pacap, ghrs, i gf-I, igf-Ir, and igfbp3 were examined by real-time PCR. The results show that no significant change in plasma GH and IGF-I levels in fish fed with diets containing 30 μg/g and 300 μg/g genistein. mRNA expression of genes along the GH/IGF-I axis remained unaff ected, except for igf-Ir, which was stimulated by the 300 μg/g genistein diet. While in fish fed the 3 000 μg/g genistein diet, the plasma GH and IGF-I levels decreased, and mRNA expression of gh, ghr2, npyr1, igf-I, and igf-Ir were also significantly depressed. In contrast, npy and igfbp3 mRNA expression were enhanced. This study provides convincing evidence for growth impediment by genistein by disturbing the GH/IGF-I axis in Nile tilapia O. niloticus.

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection.

PubMed

Sateanchok, Suphasinee; Wangkarn, Sunanta; Saenjum, Chalermpong; Grudpan, Kate

2018-01-15

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection has been investigated. Standard and sample solutions flow along a bunch of cotton thread treated with sodium hydroxide via microfluidic behaviors without external pumping. The analyte solution reacts with the reagents that have been immobilized on the paper strip fixed at the end of the cotton bunch. The developed platforms were used for the assays of total phenolic content and antioxidant capacity by employing Folin-Ciocalteu and 2, 2-diphenyl-1-picryhydrazyl (DPPH) respectively. Simple detection can be made by employing a mobile phone camera (iPhone 4S) with Image J or Photoshop for image processing and evaluation. Gallic acid was used as a reference standard in this work, as its polyphenol structures can be found in many plants. The total phenolic content is expressed as gallic acid equivalents (GAE) (mg/g material). Inhibition capacity is calculated by the equation: % I = [(I o - I s )/ I o ] × 100, where I s is the relative magenta intensity (CMYK mode) of sample, and I o the relative magenta intensity of DPPH•. IC 50 inhibition can be estimated from the graph and can be used for the antioxidant capacity consideration. Applications to the assay green tea samples were demonstrated. The total phenolic contents in the green tea samples were found to be 48-105mg/g, with %RSD of less than 10 for that of higher 50 GAE mg/g and IC 50 values of the samples studied were 25-50mg/L. The results obtained by the developed methods agree with that of the standard methods. Copyright © 2017 Elsevier B.V. All rights reserved.

[G-DRG system 2009: relevant changes for rheumatology].

PubMed

Fiori, W; Liedtke-Dyong, A; Lakomek, H-J; Buscham, K; Lehmann, H; Liman, W; Fuchs, A-K; Bessler, F; Roeder, N

2009-08-01

The following article presents the main general and specific changes in the G-DRG (German diagnosis-related groups) system in terms of the classification systems for diagnoses and procedures as well as the billing process for 2009. Of fundamental relevance is the national weighting of the G-DRG I97Z (complex rheumatologic treatment), which up to now had to be negotiated individually by each hospital. Emphasis is also put on case auditing by the health insurers. Being primarily a tool for redistribution of resources, every hospital has to analyze the economic effects of the 2009 G-DRG system by applying the G-DRG transition grouper to its own cases. Depending on their clinical focus rheumatological departments may experience positive or negative consequences from the development. The strain imposed on hospitals by inadequate refunding of rising costs has to be assessed separately from the effects of redistribution by the G-DRG system.

MMX-I: A data-processing software for multi-modal X-ray imaging and tomography

NASA Astrophysics Data System (ADS)

Bergamaschi, A.; Medjoubi, K.; Messaoudi, C.; Marco, S.; Somogyi, A.

2017-06-01

Scanning hard X-ray imaging allows simultaneous acquisition of multimodal information, including X-ray fluorescence, absorption, phase and dark-field contrasts, providing structural and chemical details of the samples. Combining these scanning techniques with the infrastructure developed for fast data acquisition at Synchrotron Soleil permits to perform multimodal imaging and tomography during routine user experiments at the Nanoscopium beamline. A main challenge of such imaging techniques is the online processing and analysis of the generated very large volume (several hundreds of Giga Bytes) multimodal data-sets. This is especially important for the wide user community foreseen at the user oriented Nanoscopium beamline (e.g. from the fields of Biology, Life Sciences, Geology, Geobiology), having no experience in such data-handling. MMX-I is a new multi-platform open-source freeware for the processing and reconstruction of scanning multi-technique X-ray imaging and tomographic datasets. The MMX-I project aims to offer, both expert users and beginners, the possibility of processing and analysing raw data, either on-site or off-site. Therefore we have developed a multi-platform (Mac, Windows and Linux 64bit) data processing tool, which is easy to install, comprehensive, intuitive, extendable and user-friendly. MMX-I is now routinely used by the Nanoscopium user community and has demonstrated its performance in treating big data.

Genetic Variations at ABCG5/G8 Genes Modulate Plasma Lipids Concentrations in Patients with Familial Hypercholesterolemia

PubMed Central

Garcia-Rios, A; Perez-Martinez, P; Fuentes, F; Mata, P; Lopez-Miranda, J; Alonso, R; Rodriguez, F; Garcia-Olid, A; Ruano, J; Ordovas, JM; Perez-Jimenez, F

2010-01-01

Objective To investigate the association of four common single nucleotide polymorphisms (SNPs) at ABCG5 (i7892A>G, i18429C>T, Gln604GluC>G, i11836G>A) and five at ABCG8 (5U145T>G, Tyr54CysA>G, Asp19HisG>C, i14222T>C, and Thr400LysG>T) with plasma lipids concentrations and to explore the interaction between those SNPs and smoking in patients with FH. Methods and Results ABCG5/G8 SNPs were genotyped in 500 subjects with genetic diagnosis of FH. Carriers of the minor A allele at the ABCG5_i11836G>A SNP displayed significantly higher HDL-C concentrations (P=0.023) than G/G subjects. In addition, carriers of the minor G allele at the ABCG5_Gln604GluC>G SNP had significantly lower VLDL-C (P=0.011) and lower TG (P=0.017) concentrations than homozygous C/C. Interestingly, a significant gene-smoking interaction was found, in which carriers of the minor alleles at ABCG5 (i7892A>G, i18429C>T, i11836G>A) SNPs displayed significantly lower HDL-C, higher TC and higher TG respectively, only in smokers. On the other hand, non-smokers carriers of the minor alleles at ABCG5 (i18429C>T and Gln604GluC>G) SNPs had significantly lower TG concentrations (P=0.012 and P=0.035) compared with homozygous for the major allele. Conclusions Our data support the notion that ABCG5/G8 genetic variants modulate plasma lipids concentrations in patients with FH and confirm that this effect could be influenced by smoking. Therefore, these results suggest that gene-environmental interactions can affect the clinical phenotype of FH. PMID:20172523

Microstructure and Macrosegregation Study of Directionally Solidified Al-7Si Samples Processed Terrestrially and Aboard the International Space Station

NASA Technical Reports Server (NTRS)

Angart, Samuel; Erdman, R. G.; Poirier, David R.; Tewari, S.N.; Grugel, R. N.

2014-01-01

This talk reports research that has been carried out under the aegis of NASA as part of a collaboration between ESA and NASA for solidification experiments on the International Space Station (ISS). The focus has been on the effect of convection on the microstructural evolution and macrosegregation in hypoeutectic Al-Si alloys during directional solidification (DS). The DS-experiments have been carried out under 1-g at Cleveland State University (CSU) and under low-g on the International Space Station (ISS). The thermal processing-history of the experiments is well defined for both the terrestrially-processed samples and the ISS-processed samples. We have observed that the primary dendrite arm spacings of two samples grown in the low-g environment of the ISS show good agreement with a dendrite-growth model based on diffusion controlled growth. The gravity-driven convection (i.e., thermosolutal convection) in terrestrially grown samples has the effect of decreasing the primary dendrite arm spacings and causes macrosgregation. In order to process DS-samples aboard the ISS, dendritic-seed crystals have to partially remelted in a stationary thermal gradient before the DS is carried out. Microstructural changes and macrosegregation effects during this period are described.

[Active carbon from Thalia dealbata residues: its preparation and adsorption performance to crystal violet].

PubMed

Chu, Shu-Yi; Yang, Min; Xiao, Ji-Bo; Zhang, Jun; Zhu, Yan-Ping; Yan, Xiang-Jun; Tian, Guang-Ming

2013-06-01

By using phosphoric acid as activation agent, active carbon was prepared from Thalia dealbata residues. The BET specific surface area of the active carbon was 1174.13 m2 x g(-1), micropore area was 426.99 m2 x g(-1), and average pore diameter was 3.23 nm. An investigation was made on the adsorption performances of the active carbon for crystal violet from aqueous solution under various conditions of pH, initial concentration of crystal violet, contact time, and contact temperature. It was shown that the adsorbed amount of crystal violet was less affected by solution pH, and the adsorption process could be divided into two stages, i. e., fast adsorption and slow adsorption, which followed the pseudo-second-order kinetics model. At the temperature 293, 303, and 313 K, the adsorption process was more accordance with Langmuir isotherm model, and the maximum adsorption capacity was 409.83, 425.53, and 438.59 mg x g(-1), respectively. In addition, the adsorption process was spontaneous and endothermic, and the randomness of crystal violet molecules increased.

Adsorptive removal of aniline by granular activated carbon from aqueous solutions with catechol and resorcinol.

PubMed

Suresh, S; Srivastava, V C; Mishrab, I M

2012-01-01

In the present paper, the removal of aniline by adsorption process onto granular activated carbon (GAC) is reported from aqueous solutions containing catechol and resorcinol separately. The Taguchi experimental design was applied to study the effect of such parameters as the initial component concentrations (C(0,i)) of two solutes (aniline and catechol or aniline and resorcinol) in the solution, temperature (T), adsorbent dosage (m) and contact time (t). The L27 orthogonal array consisting of five parameters each with three levels was used to determine the total amount of solutes adsorbed on GAC (q(tot), mmol/g) and the signal-to-noise ratio. The analysis of variance (ANOVA) was used to determine the optimum conditions. Under these conditions, the ANOVA shows that m is the most important parameter in the adsorption process. The most favourable levels of process parameters were T = 303 K, m = 10 g/l and t = 660 min for both the systems, qtot values in the confirmation experiments carried out at optimum conditions were 0.73 and 0.95 mmol/g for aniline-catechol and aniline-resorcinol systems, respectively.

Cu-modified alkalinized g-C3N4 as photocatalytically assisted heterogeneous Fenton-like catalyst

NASA Astrophysics Data System (ADS)

Dong, Qimei; Chen, Yingying; Wang, Lingli; Ai, Shasha; Ding, Hanming

2017-12-01

Alkalinized graphitic carbon nitride (CNK-OH) has been synthesized by one-step thermal poly-condensation method, and Cu-modified alkalinized g-C3N4 (Cu-CNK-OH) has been prepared by impregnation approach over CNK-OH. These copper species in Cu-CNK-OH are embedded in the frame of CNK-OH mostly via the Cu-N bonds. Cu-CNK-OH has been employed as a heterogeneous Fenton-like catalyst to degrade rhodamine B (RhB). Both the production efficiency of hydroxyl radicals and the transformation rate of Cu(II)/Cu(I) redox pair increase under visible-light irradiation. As a result, Cu-CNK-OH exhibits improved Fenton-like catalytic activity on the degradation of RhB. The synergetic interaction between Fenton-like process and photocatalytic process also contributes such improvement. The hydroxyl radicals and holes are the major reactive species in the photocatalytically assisted Fenton-like process. This study provides a valuable strategy for metal modification of alkalinized g-C3N4 with enhanced Fenton-like catalytic performance for the degradation of organic contaminants.

Glycines from the APP GXXXG/GXXXA Transmembrane Motifs Promote Formation of Pathogenic Aβ Oligomers in Cells

PubMed Central

Decock, Marie; Stanga, Serena; Octave, Jean-Noël; Dewachter, Ilse; Smith, Steven O.; Constantinescu, Stefan N.; Kienlen-Campard, Pascal

2016-01-01

Alzheimer’s disease (AD) is the most common neurodegenerative disorder characterized by progressive cognitive decline leading to dementia. The amyloid precursor protein (APP) is a ubiquitous type I transmembrane (TM) protein sequentially processed to generate the β-amyloid peptide (Aβ), the major constituent of senile plaques that are typical AD lesions. There is a growing body of evidence that soluble Aβ oligomers correlate with clinical symptoms associated with the disease. The Aβ sequence begins in the extracellular juxtamembrane region of APP and includes roughly half of the TM domain. This region contains GXXXG and GXXXA motifs, which are critical for both TM protein interactions and fibrillogenic properties of peptides derived from TM α-helices. Glycine-to-leucine mutations of these motifs were previously shown to affect APP processing and Aβ production in cells. However, the detailed contribution of these motifs to APP dimerization, their relation to processing, and the conformational changes they can induce within Aβ species remains undefined. Here, we describe highly resistant Aβ42 oligomers that are produced in cellular membrane compartments. They are formed in cells by processing of the APP amyloidogenic C-terminal fragment (C99), or by direct expression of a peptide corresponding to Aβ42, but not to Aβ40. By a point-mutation approach, we demonstrate that glycine-to-leucine mutations in the G29XXXG33 and G38XXXA42 motifs dramatically affect the Aβ oligomerization process. G33 and G38 in these motifs are specifically involved in Aβ oligomerization; the G33L mutation strongly promotes oligomerization, while G38L blocks it with a dominant effect on G33 residue modification. Finally, we report that the secreted Aβ42 oligomers display pathological properties consistent with their suggested role in AD, but do not induce toxicity in survival assays with neuronal cells. Exposure of neurons to these Aβ42 oligomers dramatically affects neuronal differentiation and, consequently, neuronal network maturation. PMID:27242518

Relating physicochemical and microbiological safety indicators during processing of linguiça, a Portuguese traditional dry-fermented sausage.

PubMed

Gonzales-Barron, U; Cadavez, V; Pereira, A P; Gomes, A; Araújo, J P; Saavedra, M J; Estevinho, L; Butler, F; Pires, P; Dias, T

2015-12-01

Linguiça is a Portuguese traditional fermented sausage whose microbiological quality and safety can be highly variable. In order to elucidate risk factors and the particularities of the manufacturing technology that explain the between-batch variability in total viable counts (TVC), Enterobacteriaceae, Staphylococcus aureus and Listeria monocytogenes in the product; microbiological and physicochemical characterisation of linguiça at five stages of production (i.e., raw pork meat, mixed with ingredients, macerated, smoked and ripened) was carried out. A total of six production batches were surveyed from two factories; one utilised curing salts and polyphosphate in their formulation (Factory II). The delayed fermentation in the nitrite-formulated sausages was partly responsible for the increase (p<0.01) in Enterobacteriaceae, S. aureus and L. monocytogenes from raw meat (3.21logCFU/g, 1.30logCFU/g and 22.2CFU/g, respectively) to the end of maceration (4.14logCFU/g, 2.10logCFU/g and 140CFU/g, respectively) while the better acidification process in the nitrite-free sausages (Factory I) led to lower counts of S. aureus (2.64logCFU/g) and L. monocytogenes (10CFU/g) in the finished products. In Factory II, although L. monocytogenes entered the chain at the point of mixing, it became steadily inactivated during smoking and ripening (<50CFU/g), despite the initially-delayed fermentation. Nitrite had a strong effect on reducing Enterobacteriaceae throughout smoking (r=-0.73) and ripening (r=-0.59), while it failed to control the growth of S. aureus. The main hurdle preventing the development of S. aureus in linguiça is the pH, and other factors contributing to its control are: longer ripening days (p=0.019), low S. aureus in raw meat (p=0.098), properly-washed casings (p=0.094), and less contamination during mixing (p=0.199). In the case of L. monocytogenes, at least three hurdles hinder its development in linguiça: low a w (p=0.004), low pH (p=0.040) and nitrite (p=0.060), and other factors contributing to its control are: longer ripening (p=0.072) and maceration (p=0.106) periods, lower a w at the end of smoking (p=0.076) and properly-washed casings (p=0.099). Results have shown that there is a need to standardise the productive process of linguiça, to optimise the initial acidification process, and to reinforce proper programmes of quality control of ingredients and good hygiene practices, so as to minimise the introduction of Enterobacteriaceae and pathogens from external sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

Microscopic vertical orientation of nano-interspaced graphene architectures in deposit films as electrodes for enhanced supercapacitor performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, Gyoung Gug; Song, Bo; Li, Liyi

This paper reported a novel two-step process to fabricate high-performance supercapacitor films that contain microscale domains of nano-interspaced, re-stacked graphene sheets oriented perpendicular to the surface of current collector substrate, i.e., carbon fiber paper. In the two-step process, we first used ligand molecules to modify the surface of graphene oxide (GO) sheets and manipulate the interspacing between the re-stacked GO sheets. The ligand-modified GOs, i.e., m-GOs, were then reduced to obtain more conductive graphene (m-rGO), where X-ray diffraction measurement results indicated well-controlled interlayer spacing between the restacked m-rGO sheets up to 1 nm. The typical lateral dimension of the restackedmore » m-rGO sheets were ~40 µm. Then, electrical field was introduced during m-rGO slurry deposition process to induce the vertical orientation of the m-rGO sheets/stacks in the film deposit. The direct current electrical field induced the orientation of the domains of m-rGO stacks along the direction perpendicular to the surface of deposit film, i.e., direction of electric field. Also, the applied electric field increased the interlayer spacing further, which should enhance the diffusion and accessibility of electrolyte ions. As compared with the traditionally deposited “control” films, the field-processed film deposits that contain oriented structure of graphene sheets/stacks have shown up to ~1.6 times higher values in capacitance (430 F/g at 0.5 A/g) and ~67% reduction in equivalent series resistance. Finally, the approach of using electric field to tailor the microscopic architecture of graphene-based deposit films is effective to fabricate film electrodes for high performance supercapacitors.« less

Microscopic vertical orientation of nano-interspaced graphene architectures in deposit films as electrodes for enhanced supercapacitor performance

DOE PAGES

Jang, Gyoung Gug; Song, Bo; Li, Liyi; ...

2016-12-14

This paper reported a novel two-step process to fabricate high-performance supercapacitor films that contain microscale domains of nano-interspaced, re-stacked graphene sheets oriented perpendicular to the surface of current collector substrate, i.e., carbon fiber paper. In the two-step process, we first used ligand molecules to modify the surface of graphene oxide (GO) sheets and manipulate the interspacing between the re-stacked GO sheets. The ligand-modified GOs, i.e., m-GOs, were then reduced to obtain more conductive graphene (m-rGO), where X-ray diffraction measurement results indicated well-controlled interlayer spacing between the restacked m-rGO sheets up to 1 nm. The typical lateral dimension of the restackedmore » m-rGO sheets were ~40 µm. Then, electrical field was introduced during m-rGO slurry deposition process to induce the vertical orientation of the m-rGO sheets/stacks in the film deposit. The direct current electrical field induced the orientation of the domains of m-rGO stacks along the direction perpendicular to the surface of deposit film, i.e., direction of electric field. Also, the applied electric field increased the interlayer spacing further, which should enhance the diffusion and accessibility of electrolyte ions. As compared with the traditionally deposited “control” films, the field-processed film deposits that contain oriented structure of graphene sheets/stacks have shown up to ~1.6 times higher values in capacitance (430 F/g at 0.5 A/g) and ~67% reduction in equivalent series resistance. Finally, the approach of using electric field to tailor the microscopic architecture of graphene-based deposit films is effective to fabricate film electrodes for high performance supercapacitors.« less

Four-Stranded Dna Formed by Isoguanine Quartets: Complex Stoichiometry, Thermal Stability and Resistance Against Exonucleases

NASA Astrophysics Data System (ADS)

Seela, Frank; Wei, Changfu; Melenewski, Alexander

1997-12-01

Single stranded DNA-fragments containing short runs of isoguanine such as d(T_4iG_4T_4) (5) or d(iG_4T_4) (6) form quartet structures by self-assembly of the isoguanine residues. The stoichiometry of the complexes is deduced from mixed aggregates formed between d(T_4iG_4T_4) and d(iG_4T_4). The iG_d-tetrads are more stable with regard to their thermal denaturation and to their resistance against enzymatic phosphodiester hydrolysis than those formed by dG.

Mutational analysis of residues in human arsenic (III) methyltransferase (hAS3MT) belonging to 5 Å around S-adenosylmethionine (SAM).

PubMed

Li, Xiangli; Geng, Zhirong; Chang, Jiayin; Song, Xiaoli; Wang, Zhilin

2014-12-01

The functions of residues 57-RY-58, G60, L77, 80-GSGR-83, I101, T104, 134-GY-135, N155, V157 and 160-LV-161 in human arsenic (III) methyltransferase (hAS3MT) 5 Å around S-adenosylmethionine (SAM) have not been studied. Herein, sixteen mutants were designed by substituting these residues with Ala. Mutants G60A, G80A, I101A, N155A and L160A were completely inactive. Only MMA was detected when mutants R57A, Y58A, G82A and T104A were used as the enzymes, which suggested that their catalytic activities were seriously impaired compared with that of wild type (WT). The catalytic capacities of other mutants were also lower than that of WT-hAS3MT. The KM(SAM) values of mutants were 1.9–8.7 times that of WT, suggesting their affinities to SAM were weakened. As evidenced by the experimental data herein, earlier literature and the model of hAS3MT-SAM, 57-RYYG-60, G78, G80, G82 and 155-NCV-157 interacted with the methionine of SAM, and 101-IDMT-104 and 135-YIE-137 were associated with the nucleotide adenosine of SAM. Since C156 and L160 were the common residues between 5 Å around SAM and 5 Å around As, and C156S and L160A were inactive, we proposed that C156 and L160 functioned in the methyl transfer process. G78, G80 and G82 belonging to the consensus GxGxG were located in a loop connecting the first β-strand and α-helix in the Rossmann fold core. Y59, N155, C156 and L160 oriented S(+)-CH(3) during its approach to the arsenic lone pair, and further activated methyl transfer. G78, D102, M103, T104, I136 and N155 formed hydrogen bonds with SAM.

Analysis of exhaled breath by laser detection

NASA Astrophysics Data System (ADS)

Thrall, Karla D.; Toth, James J.; Sharpe, Steven W.

1996-04-01

The goal of our work is two fold: (1) to develop a portable rapid laser based breath analyzer for monitoring metabolic processes, and (2) predict these metabolic processes through physiologically based pharmacokinetic (PBPK) modeling. Small infrared active molecules such as ammonia, carbon monoxide, carbon dioxide, methane and ethane are present in exhaled breath and can be readily detected by laser absorption spectroscopy. In addition, many of the stable isotopomers of these molecules can be accurately detected, making it possible to follow specific metabolic processes. Potential areas of applications for this technology include the diagnosis of certain pathologies (e.g. Helicobacter Pylori infection), detection of trauma due to either physical or chemical causes and monitoring nutrient uptake (i.e., malnutrition). In order to understand the origin and elucidate the metabolic processes associated with these small molecules, we are employing physiologically based pharmacokinetic (PBPK) models. A PBPK model is founded on known physiological processes (i.e., blood flow rates, tissue volumes, breathing rate, etc.), chemical-specific processes (i.e., tissue solubility coefficients, molecular weight, chemical density, etc.), and on metabolic processes (tissue site and rate of metabolic biotransformation). Since many of these processes are well understood, a PBPK model can be developed and validated against the more readily available experimental animal data, and then by extrapolating the parameters to apply to man, the model can predict chemical behavior in humans.

46 CFR Table 151.05 to Subpart 151... - Summary of Minimum Requirements

Code of Federal Regulations, 2011 CFR

2011-10-01

...% or more Phenol, see Phenol Cresylate spent caustic Atmos. Amb. III 1 i i 2 i Integral Gravity Open... spent caustic Crotonaldehyde Atmos. Amb. II 1 i i 2 i i Integral Gravity PV Restr. II G-1 NR Vent F Yes.... II G-2 NR Vent N Yes .50-73 NA NA G Caustic potash solution Atmos. Amb.Elev. III 1 i 2 i Integral...

46 CFR Table 151.05 to Subpart 151... - Summary of Minimum Requirements

Code of Federal Regulations, 2014 CFR

2014-10-01

...% or more Phenol, see Phenol Cresylate spent caustic Atmos. Amb. III 1 i i 2 i Integral Gravity Open... spent caustic Crotonaldehyde Atmos. Amb. II 1 i i 2 i i Integral Gravity PV Restr. II G-1 NR Vent F Yes.... II G-2 NR Vent N Yes .50-73 NA NA G Caustic potash solution Atmos. Amb.Elev. III 1 i 2 i Integral...

46 CFR Table 151.05 to Subpart 151... - Summary of Minimum Requirements

Code of Federal Regulations, 2013 CFR

2013-10-01

...% or more Phenol, see Phenol Cresylate spent caustic Atmos. Amb. III 1 i i 2 i Integral Gravity Open... spent caustic Crotonaldehyde Atmos. Amb. II 1 i i 2 i i Integral Gravity PV Restr. II G-1 NR Vent F Yes.... II G-2 NR Vent N Yes .50-73 NA NA G Caustic potash solution Atmos. Amb.Elev. III 1 i 2 i Integral...

46 CFR Table 151.05 to Subpart 151... - Summary of Minimum Requirements

Code of Federal Regulations, 2012 CFR

2012-10-01

...% or more Phenol, see Phenol Cresylate spent caustic Atmos. Amb. III 1 i i 2 i Integral Gravity Open... spent caustic Crotonaldehyde Atmos. Amb. II 1 i i 2 i i Integral Gravity PV Restr. II G-1 NR Vent F Yes... G-2 NR Vent N Yes .50-73 NA NA G Caustic potash solution Atmos. Amb.Elev. III 1 i 2 i Integral...

SIRT1 overexpression ameliorates a mouse model of SOD1-linked amyotrophic lateral sclerosis via HSF1/HSP70i chaperone system.

PubMed

Watanabe, Seiji; Ageta-Ishihara, Natsumi; Nagatsu, Shinji; Takao, Keizo; Komine, Okiru; Endo, Fumito; Miyakawa, Tsuyoshi; Misawa, Hidemi; Takahashi, Ryosuke; Kinoshita, Makoto; Yamanaka, Koji

2014-08-29

Dominant mutations in superoxide dismutase 1 (SOD1) cause degeneration of motor neurons in a subset of inherited amyotrophic lateral sclerosis (ALS). The pathogenetic process mediated by misfolded and/or aggregated mutant SOD1 polypeptides is hypothesized to be suppressed by protein refolding. This genetic study is aimed to test whether mutant SOD1-mediated ALS pathology recapitulated in mice could be alleviated by overexpressing a longevity-related deacetylase SIRT1 whose substrates include a transcription factor heat shock factor 1 (HSF1), the master regulator of the chaperone system. We established a line of transgenic mice that chronically overexpress SIRT1 in the brain and spinal cord. While inducible HSP70 (HSP70i) was upregulated in the spinal cord of SIRT1 transgenic mice (PrP-Sirt1), no neurological and behavioral alterations were detected. To test hypothetical benefits of SIRT1 overexpression, we crossbred PrP-Sirt1 mice with two lines of ALS model mice: A high expression line that exhibits a severe phenotype (SOD1G93A-H) or a low expression line with a milder phenotype (SOD1G93A-L). The Sirt1 transgene conferred longer lifespan without altering the time of symptomatic onset in SOD1G93A-L. Biochemical analysis of the spinal cord revealed that SIRT1 induced HSP70i expression through deacetylation of HSF1 and that SOD1G93A-L/PrP-Sirt1 double transgenic mice contained less insoluble SOD1 than SOD1G93A-L mice. Parallel experiments showed that Sirt1 transgene could not rescue a more severe phenotype of SOD1G93A-H transgenic mice partly because their HSP70i level had peaked out. The genetic supplementation of SIRT1 can ameliorate a mutant SOD1-linked ALS mouse model partly through the activation of the HSF1/HSP70i chaperone system. Future studies shall include testing potential benefits of pharmacological enhancement of the deacetylation activity of SIRT1 after the onset of the symptom.

[The lysate and recombinant antigens in ELISA-test-systems for diagnostic of herpes simplex].

PubMed

Ganova, L A; Kovtoniuk, G V; Korshun, L N; Kiseleva, E K; Tereshchenko, M I; Vudmaska, M I; Moĭsa, L N; Shevchuk, V A; Spivak, N Ia

2014-08-01

The lysate and recombinant antigens of various production included informula of ELISA-test-systems were analyzed. The ELISA-test-systems are used for detection of IgG to Herpes simplex virus type I and II. For testing the panel of serums PTH 201 (BBI Inc.) were used. The samples of this panel contain antibodies to Herpes simplex virus type I and II in mixed titers. The 69 serums of donors were used too (17 samples had IgG to Herpes simplex virus type I, 23 samples to Herpes simplex virus type II and 29 samples had no antibodies to Herpes simplex virus). The diagnostic capacity of mixture of recombinant antigens gG1 Herpes simplex virus type I and gG2 Herpes simplex virus type II (The research-and-production complex "DiaprofMed") was comparable with mixture of lysate antigen Herpes simplex virus type I and II (Membrane) EIE Antigen ("Virion Ltd."). In the test-systems for differentiation of IgG to Herpes simplex virus type I the recombinant antigen gG1 Herpes simplex virus type I proved to be comparable with commercial analogue Herpes simplex virus-1 gG1M ("Viral Therapeutics Inc."'). At the same time, capacity to detect IgG to Herpes simplex virus type II in recombinant protein gG2 Herpes simplex virus type II is significantly higher than in its analogue Herpes simplex virus-2 gG2c ("Viral Therapeutics Inc.").

Biosorption of Cd(II) and Cs(I) from aqueous solution by live and dead cells of Saccharomyces carlsbergensis PTCC 5051.

PubMed

Sayyadi, Shayan; Ahmady-Asbchin, Salman; Kamali, Kasra

2018-02-01

The biosorption characteristics of Cd(II) and Cs(I) using live and dead cells of Saccharomyces carlsbergensis PTCC 5051 as biosorbents have been investigated in the present research. The influence of different experimental parameters such as initial pH (pHi), shaking rate, sorption time and initial metal concentration was evaluated. The optimum pH was obtained as 4 for Cd(II) and 7 for Cs(I). The experimental adsorption data were fitted to the Langmuir linear equation adsorption model. The highest metal uptake values of 0.593 and 0.473 mmol g -1 were calculated for Cd(II) and Cs(I), respectively. The results of Fourier transform infrared analysis suggested the involvement of amine, carboxyl and hydroxyl groups during the biosorption process and also indicated that more functional groups were involved in the biosorption process of live adsorbents, compared with those linked to dead biomass. The results showed that the biomass of S. carlsbergensis PTCC 5051 is a suitable biosorbent for the removal of Cd(II) and Cs(I) from the aqueous solutions.

High-level waste borosilicate glass: A compendium of corrosion characteristics. Volume 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cunnane, J.C.; Bates, J.K.; Bradley, C.R.

The objective of this document is to summarize scientific information pertinent to evaluating the extent to which high-level waste borosilicate glass corrosion and the associated radionuclide release processes are understood for the range of environmental conditions to which waste glass may be exposed in service. Alteration processes occurring within the bulk of the glass (e.g., devitrification and radiation-induced changes) are discussed insofar as they affect glass corrosion.This document is organized into three volumes. Volumes I and II represent a tiered set of information intended for somewhat different audiences. Volume I is intended to provide an overview of waste glass corrosion,more » and Volume 11 is intended to provide additional experimental details on experimental factors that influence waste glass corrosion. Volume III contains a bibliography of glass corrosion studies, including studies that are not cited in Volumes I and II. Volume I is intended for managers, decision makers, and modelers, the combined set of Volumes I, II, and III is intended for scientists and engineers working in the field of high-level waste.« less

International Symposium on Stratified Flows (4th) Held in Grenoble, France on June 29-July 2, 1994. Volume 1

DTIC Science & Technology

1994-10-10

Baroclinic Vortex Shedding from Hydrothermal Plumes ", J. Geophys. Res. 96, (C7), 12,511-12,518. Jirka, G.H. (1982), "Turbulent Buoyant Jets in Shallow...boundary layers and transport boundary current - 251 processes effected by buoyancy - 239 D. Obaton, G. Chaben’ dHibres; E. I. Nikitorovich, N . F . Yurchenko...assumed at angle 0 to the vertical, is N 2h cos 0 per unit -iass; which, in opposing the acceleration of fluid (02h/Ot2 )sec 0, gives rise to

Applicant Perspectives on the Otolaryngology Residency Application Process

DTIC Science & Technology

2017-09-09

REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 ; ’ ; ; -’~ .!"_ e•ti.:"at~d- t ’ ; ; ’ " ; ’ d, ~nd _comple_~lng 3 -nd...6. z ,_ "" ... Q. Q ,. It :;; c:: 3 w ;c ... o-i3 (1) ro n 0 ..., f5 0 g_ .... 3 .... 6 ’ ---+-. "" 𔃺 0 = ,., 3 )> ~. g .,. X! m ""C...0 3 II’ -c 1 ,_ :::::s s a. -ID Q. -· m n QJ a. "’ r-+ .. ..:., -· Q 0 :::J tn ., . . J 0 Suggestions From Applicants Respondents

Fusion of raft-like lipid bilayers operated by a membranotropic domain of the HSV-type I glycoprotein gH occurs through a cholesterol-dependent mechanism.

PubMed

Vitiello, Giuseppe; Falanga, Annarita; Petruk, Ariel Alcides; Merlino, Antonello; Fragneto, Giovanna; Paduano, Luigi; Galdiero, Stefania; D'Errico, Gerardino

2015-04-21

A wealth of evidence indicates that lipid rafts are involved in the fusion of the viral lipid envelope with the target cell membrane. However, the interplay between these sterol- and sphingolipid-enriched ordered domains and viral fusion glycoproteins has not yet been clarified. In this work we investigate the molecular mechanism by which a membranotropic fragment of the glycoprotein gH of the Herpes Simplex Virus (HSV) type I (gH625) drives fusion of lipid bilayers formed by palmitoyl oleoyl phosphatidylcholine (POPC)-sphingomyelin (SM)-cholesterol (CHOL) (1 : 1 : 1 wt/wt/wt), focusing on the role played by each component. The comparative analysis of the liposome fusion assays, Dynamic Light Scattering (DLS), spectrofluorimetry, Neutron Reflectivity (NR) and Electron Spin Resonance (ESR) experiments, and Molecular Dynamics (MD) simulations shows that CHOL is fundamental for liposome fusion to occur. In detail, CHOL stabilizes the gH625-bilayer association by specific interactions with the peptide Trp residue. The interaction with gH625 causes an increased order of the lipid acyl chains, whose local rotational motion is significantly hampered. SM plays only a minor role in the process, favoring the propagation of lipid perturbation to the bilayer inner core. The stiffening of the peptide-interacting bilayer leaflet results in an asymmetric perturbation of the membrane, which is locally destabilized thus favoring fusion events. Our results show that viral fusion glycoproteins are optimally suited to exert a high fusogenic activity on lipid rafts and support the relevance of cholesterol as a key player of membrane-related processes.

Silver versus gold catalysis in tandem reactions of carbonyl functions onto alkynes: a versatile access to furoquinoline and pyranoquinoline cores.

PubMed

Godet, Thomas; Vaxelaire, Carine; Michel, Carine; Milet, Anne; Belmont, Philippe

2007-01-01

An efficient and versatile tandem process of acetalization and cycloisomerization reactions has been developed for the reactions of 1-alkynyl-2-carbonylquinoline substrates. The reaction occurs thanks to Au(I) and Ag(I) catalysis. Silver(I) catalysis has been extensively studied (11 different silver species) on a broad range of quinoline derivatives (variation of alkyne substituent, of carbonyl function and of nucleophiles), leading to a variety of furoquinoline and pyranoquinoline moieties. An insight is given for the presumed mechanism along with DFT-B3 LYP/6-31G** calculations to address the 6-endo and 5-exo regioselectivities observed.

Maritime Security. Coast Guard Inspections Identify and Correct Facility Deficiencies, but More Analysis Needed of Program’s Staffing, Practices, and Data

DTIC Science & Technology

2008-02-01

to the process to increase security may have economic consequences.7 Actions to improve security are undertaken with the knowledge that total ...inspections, and improve its facility compliance data. The Department of Homeland Security agreed with GAO’s recommendations. W r f e i o c r U p d w...A c U i s a c c g c r T p u w o a d c i T S To view the full product , including the scope and methodology, click on GAO-08-12. For more

Gas-assisted gravity drainage (GAGD) process for improved oil recovery

DOEpatents

Rao, Dandina N [Baton Rouge, LA

2012-07-10

A rapid and inexpensive process for increasing the amount of hydrocarbons (e.g., oil) produced and the rate of production from subterranean hydrocarbon-bearing reservoirs by displacing oil downwards within the oil reservoir and into an oil recovery apparatus is disclosed. The process is referred to as "gas-assisted gravity drainage" and comprises the steps of placing one or more horizontal producer wells near the bottom of a payzone (i.e., rock in which oil and gas are found in exploitable quantities) of a subterranean hydrocarbon-bearing reservoir and injecting a fluid displacer (e.g., CO.sub.2) through one or more vertical wells or horizontal wells. Pre-existing vertical wells may be used to inject the fluid displacer into the reservoir. As the fluid displacer is injected into the top portion of the reservoir, it forms a gas zone, which displaces oil and water downward towards the horizontal producer well(s).

Neighing, barking, and drumming horses-object related sounds help and hinder picture naming.

PubMed

Mädebach, Andreas; Wöhner, Stefan; Kieseler, Marie-Luise; Jescheniak, Jörg D

2017-09-01

The study presented here investigated how environmental sounds influence picture naming. In a series of four experiments participants named pictures (e.g., the picture of a horse) while hearing task-irrelevant sounds (e.g., neighing, barking, or drumming). Experiments 1 and 2 established two findings, facilitation from congruent sounds (e.g., picture: horse, sound: neighing) and interference from semantically related sounds (e.g., sound: barking), both relative to unrelated sounds (e.g., sound: drumming). Experiment 3 replicated the effects in a situation in which participants were not familiarized with the sounds prior to the experiment. Experiment 4 replicated the congruency facilitation effect, but showed that semantic interference was not obtained with distractor sounds which were not associated with target pictures (i.e., were not part of the response set). The general pattern of facilitation from congruent sound distractors and interference from semantically related sound distractors resembles the pattern commonly observed with distractor words. This parallelism suggests that the underlying processes are not specific to either distractor words or distractor sounds but instead reflect general aspects of semantic-lexical selection in language production. The results indicate that language production theories need to include a competitive selection mechanism at either the lexical processing stage, or the prelexical processing stage, or both. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Formation of Globular Clusters with Internal Abundance Spreads in r -Process Elements: Strong Evidence for Prolonged Star Formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bekki, Kenji; Tsujimoto, Takuji

Several globular clusters (GCs) in the Galaxy are observed to show internal abundance spreads in r -process elements (e.g., Eu). We propose a new scenario that explains the origin of these GCs (e.g., M5 and M15). In this scenario, stars with no/little abundance variations first form from a massive molecular cloud (MC). After all of the remaining gas of the MC is expelled by numerous supernovae, gas ejected from asymptotic giant branch stars can be accumulated in the central region of the GC to form a high-density intracluster medium (ICM). Merging of neutron stars then occurs to eject r -processmore » elements, which can be efficiently trapped in and subsequently mixed with the ICM. New stars formed from the ICM can have r -process abundances that are quite different from those of earlier generations of stars within the GC. This scenario can explain both (i) why r -process elements can be trapped within GCs and (ii) why GCs with internal abundance spreads in r -process elements do not show [Fe/H] spreads. Our model shows (i) that a large fraction of Eu-rich stars can be seen in Na-enhanced stellar populations of GCs, as observed in M15, and (ii) why most of the Galactic GCs do not exhibit such internal abundance spreads. Our model demonstrates that the observed internal spreads of r -process elements in GCs provide strong evidence for prolonged star formation (∼10{sup 8} yr).« less

Negative cooperativity in binding of muscarinic receptor agonists and GDP as a measure of agonist efficacy.

PubMed

Jakubík, J; Janíčková, H; El-Fakahany, E E; Doležal, V

2011-03-01

Conventional determination of agonist efficacy at G-protein coupled receptors is measured by stimulation of guanosine-5'-γ-thiotriphosphate (GTPγS) binding. We analysed the role of guanosine diphosphate (GDP) in the process of activation of the M₂ muscarinic acetylcholine receptor and provide evidence that negative cooperativity between agonist and GDP binding is an alternative measure of agonist efficacy. Filtration and scintillation proximity assays measured equilibrium binding as well as binding kinetics of [³⁵S]GTPγS and [³H]GDP to a mixture of G-proteins as well as individual classes of G-proteins upon binding of structurally different agonists to the M₂ muscarinic acetylcholine receptor. Agonists displayed biphasic competition curves with the antagonist [³H]-N-methylscopolamine. GTPγS (1 µM) changed the competition curves to monophasic with low affinity and 50 µM GDP produced a similar effect. Depletion of membrane-bound GDP increased the proportion of agonist high-affinity sites. Carbachol accelerated the dissociation of [³H]GDP from membranes. The inverse agonist N-methylscopolamine slowed GDP dissociation and GTPγS binding without changing affinity for GDP. Carbachol affected both GDP association with and dissociation from G(i/o) G-proteins but only its dissociation from G(s/olf) G-proteins. These findings suggest the existence of a low-affinity agonist-receptor conformation complexed with GDP-liganded G-protein. Also the negative cooperativity between GDP and agonist binding at the receptor/G-protein complex determines agonist efficacy. GDP binding reveals differences in action of agonists versus inverse agonists as well as differences in activation of G(i/o) versus G(s/olf) G-proteins that are not identified by conventional GTPγS binding. © 2011 The Authors. British Journal of Pharmacology © 2011 The British Pharmacological Society.

Making a move in exercise referral: co-development of a physical activity referral scheme.

PubMed

Buckley, B J R; Thijssen, D H J; Murphy, R C; Graves, L E F; Whyte, G; Gillison, F B; Crone, D; Wilson, P M; Watson, P M

2018-04-24

Translational research is required to ensure exercise referral schemes (ERSs) are evidence-based and reflect local needs. This article reports process data from the co-development phase of an ERS, providing an insight into (i) factors that must be considered when translating evidence to practice in an ERS setting, and (ii) challenges and facilitators of conducting participatory research involving multiple stakeholders. An ERS was iteratively co-developed by a multidisciplinary stakeholder group (commissioners, managers, practitioners, patients and academics) via five participatory meetings and an online survey. Audio data (e.g. group discussions) and visual data (e.g. whiteboard notes) were recorded and analysed using NVivo-10 electronic software. Factors to consider when translating evidence to practice in an ERS setting included (i) current ERS culture; (ii) skills, safety and accountability; and (iii) resources and capacity. The co-development process was facilitated by needs-analysis, open questions, multidisciplinary debate and reflective practice. Challenges included contrasting views, irregular attendance and (mis)perceptions of evaluation. The multidisciplinary co-development process highlighted cultural and pragmatic issues related to exercise referral provision, resulting in an evidence-based intervention framework designed to be implemented within existing infrastructures. Further work is required to establish the feasibility and effectiveness of the co-developed intervention in practice.

Guideline on terminology and definitions of updating clinical guidelines: The Updating Glossary.

PubMed

Martínez García, Laura; Pardo-Hernández, Hector; Sanabria, Andrea Juliana; Alonso-Coello, Pablo; Penman, Katrina; McFarlane, Emma

2018-03-01

The Guidelines International Network (G-I-N) Updating Guidelines Working Group launched an initiative to develop a glossary (the Updating Glossary) with domains, terms, definitions, and synonyms related to updating of clinical guidelines (CGs). The steering committee developed an initial list of domains, terms, definitions, and synonyms through brainstorming and discussion. The panel members participated in three rounds of feedback to discuss, refine, and clarify the proposed terms, definitions, and synonyms. Finally, the panel members were surveyed to assess their level of agreement regarding the glossary. Eighteen terms were identified and defined: (1) continuous updating, (2) decision to update, (3) fixed updating, (4) full updating, (5) impact of the new evidence, (6) partial updating, (7) prioritization process, (8) reporting process, (9) signal for an update, (10) surveillance process, (11) time of validity, (12) timeframe, (13) tools and resources, (14) up to date, (15) update cycle, (16) update unit, (17) updated version, and (18) updating strategy. Consensus was reached for all terms, definitions, and synonyms (median agreement scores ≥ 6); except for one term. The G-I-N Updating Guidelines Working Group assembled the Updating Glossary to facilitate and improve the knowledge exchange among CGs developers, researchers, and users. Copyright © 2017 Elsevier Inc. All rights reserved.

Comparative transcriptomic evidence for Tween80-enhanced biodegradation of phenanthrene by Sphingomonas sp. GY2B.

PubMed

Liu, Shasha; Guo, Chuling; Lin, Weijia; Wu, Fengji; Lu, Guining; Lu, Jing; Dang, Zhi

2017-12-31

Previous study of the effects of surfactants on the biodegradation of phenanthrene focused on investigating alterations of the cell characteristics of Sphingomonas sp. GY2B. However, genes regulation associated with biodegradation and biological processes in response to the presence of surfactants, remains unclear. In this study, comparative transcriptome analysis was conducted to observe the gene expression of GY2B during phenanthrene biodegradation in the presence and absence of Tween80. A diverse set of genes was regulated by Tween80, leading to increased biodegradation of phenanthrene by GY2B: (i) Tween80 increased expression of genes related to H + transport in the plasma membrane to provide a driving force (i.e., ATP) for accelerating transmembrane transport of phenanthrene with increasing Tween80 concentrations, thereby enhancing the uptake and degradation of phenanthrene by GY2B; (ii) Tween80 (1 and 8 CMC) promoted intracellular biodegradation of phenanthrene by stimulating expression of genes encoding dioxygenases and monooxygenase, increasing expression of genes involved in intracellular metabolic processes (e.g., TCA cycle); and (iii) Tween80 likely increased GY2B vitality and growth by inducing expression of genes associated with ABC transporters and protein transport, regulating genes involved in other biological processes (e.g., transcription, translation). Copyright © 2017. Published by Elsevier B.V.

Encoding the world around us: motor-related processing influences verbal memory.

PubMed

Madan, Christopher R; Singhal, Anthony

2012-09-01

It is known that properties of words such as their imageability can influence our ability to remember those words. However, it is not known if other object-related properties can also influence our memory. In this study we asked whether a word representing a concrete object that can be functionally interacted with (i.e., high-manipulability word) would enhance the memory representations for that item compared to a word representing a less manipulable object (i.e., low-manipulability word). Here participants incidentally encoded high-manipulability (e.g., CAMERA) and low-manipulability words (e.g., TABLE) while making word judgments. Using a between-subjects design, we varied the depth-of-processing involved in the word judgment task: participants judged the words based on personal experience (deep/elaborative processing), word length (shallow), or functionality (intermediate). Participants were able to remember high-manipulability words better than low-manipulability words in both the personal experience and word length groups; thus presenting the first evidence that manipulability can influence memory. However, we observed better memory for low- than high-manipulability words in the functionality group. We explain this surprising interaction between manipulability and memory as being mediated by automatic vs. controlled motor-related cognition. Copyright © 2012 Elsevier Inc. All rights reserved.

46 CFR Table 151.05 to Subpart 151... - Summary of Minimum Requirements

Code of Federal Regulations, 2010 CFR

2010-10-01

..., see Phenol Cresylate spent caustic Atmos. Amb. III 1 i i 2 i Integral Gravity Open Open II G-1 NR Vent N No .50-73.55-1(b) NA NA G Cresylic acid, sodium salt solution, see Cresylate spent caustic.... II G-2 NR Vent N Yes .50-73 NA NA G Caustic potash solution Atmos. Amb.Elev. III 1 i 2 i Integral...

Nitric oxide is involved in the hypothyroidism with significant morphology changes in female Wistar rats induced by chronic exposure to high water iodine from potassium iodate.

PubMed

Rong, Shengzhong; Gao, Yanhui; Yang, Yanmei; Shao, Hanwen; Okekunle, Akinkunmi Paul; Lv, Chunpeng; Du, Yang; Sun, Hongna; Jiang, Yuting; Darko, Gottfried M; Sun, Dianjun

2018-05-03

Epidemiological studies indicated that chronic exposure to high water iodine is associated with primary hypothyroidism (PH) and subclinical hypothyroidism (SCH). However, the mechanism is not well understood. In this study, we explored whether chronic exposure to high water iodine from potassium iodate (KIO 3 ) can induce hypothyroidism in addition to determining if nitric oxide (NO) is involved in the pathogenesis. 96 female Wistar rats were divided into six groups: control, I 1000μg/L , I 3000μg/L , I 6000μg/L , N-nitro-L-arginine methylester (L-NAME) and L-NAME+I 6000μg/L . After 3 months, urine iodine concentration, thyroid hormone, NO and nitric oxide synthase (NOS) serum levels were determined. Additionally, thyroid expression of inducible nitric oxide synthase (iNOS) was also investigated. Thyroid morphology was observed under light microscopy and transmission electron microscope. SCH as indicated by elevated serum thyrotropin (TSH) was induced among rats exposed to 3000 μg/L I - , while rats treated with 6000 μg/L I - presented PH characterized by elevated TSH and lowered total thyroxine in serum. Moreover, serum NO, NOS and iNOS expression in the thyroid were significantly increased in I 3000μg/L and I 6000μg/L groups. Changes in thyroid function and morphology in the L-NAME+I 6000μg/L group were extenuated compared to I 6000μg/L group. These findings suggested that chronic exposure to high water iodine from KIO 3 likely induces hypothyroidism with significant morphology changes in female Wistar rats and NO appears to be involved in the pathogenesis. Copyright © 2018 Elsevier Ltd. All rights reserved.

Quantum communication and information processing

NASA Astrophysics Data System (ADS)

Beals, Travis Roland

Quantum computers enable dramatically more efficient algorithms for solving certain classes of computational problems, but, in doing so, they create new problems. In particular, Shor's Algorithm allows for efficient cryptanalysis of many public-key cryptosystems. As public key cryptography is a critical component of present-day electronic commerce, it is crucial that a working, secure replacement be found. Quantum key distribution (QKD), first developed by C.H. Bennett and G. Brassard, offers a partial solution, but many challenges remain, both in terms of hardware limitations and in designing cryptographic protocols for a viable large-scale quantum communication infrastructure. In Part I, I investigate optical lattice-based approaches to quantum information processing. I look at details of a proposal for an optical lattice-based quantum computer, which could potentially be used for both quantum communications and for more sophisticated quantum information processing. In Part III, I propose a method for converting and storing photonic quantum bits in the internal state of periodically-spaced neutral atoms by generating and manipulating a photonic band gap and associated defect states. In Part II, I present a cryptographic protocol which allows for the extension of present-day QKD networks over much longer distances without the development of new hardware. I also present a second, related protocol which effectively solves the authentication problem faced by a large QKD network, thus making QKD a viable, information-theoretic secure replacement for public key cryptosystems.

Novel Differential Measurement of Natural and Added Phosphorus in Preserved versus Non-Enhanced Ham

PubMed Central

Cupisti, Adamasco; Benini, Omar; Ferretti, Valerio; Gianfaldoni, Daniela; Kalantar-Zadeh, Kamyar

2018-01-01

Accurate assessment of the quantity and chemical type of phosphorus (P) content in processed meat products may have major clinical implications for management of kidney disease patients. We examined 40 lots of cooked ham including 20 without and 20 with P-containing preservatives. Novel spectro-photometrical methods were employed to measure total P and 3 different P subtypes, i.e., water-soluble (inorganic) P including added preservatives and natural P derived from phospholipids and phosphoproteins separately. Total Nitrogen and fat contents were assayed, as well. There was 66% more inorganic P in preserved vs. non-enhanced ham, i.e., 169±36 vs. 102±16 mg/100g (p<0.001), respectively; there were no significant differences in P contents derived from proteins or lipids. The P-to-protein ratio in preserved and non-enhanced ham was 16.1±4.0 and 9.8±0.8 mg/g, respectively (p<0.001). The sum of measured inorganic P and P from phospholipids and phosphoproteins was 91%±4 % of measured total P (207.1±50.7 vs 227.2±54.4 mg/100g, p>0.05), indicating a small portion of unspecified P and/or undermeasurement Novel differential dietary P measurement detects added P-containing preservatives. Processed cooked ham has 66% more measurable inorganic P and 64% higher P-to-protein ratio than non-enhanced product. The contribution of processed food to global dietary phosphorus burden can negatively influence CKD outcome and counteract the efficacy of P-binder medications. PMID:22406120