Sample records for identical inactivating mutations

  1. Inactivating KISS1 mutation and hypogonadotropic hypogonadism.

    PubMed

    Topaloglu, A Kemal; Tello, Javier A; Kotan, L Damla; Ozbek, Mehmet N; Yilmaz, M Bertan; Erdogan, Seref; Gurbuz, Fatih; Temiz, Fatih; Millar, Robert P; Yuksel, Bilgin

    2012-02-16

    Gonadotropin-releasing hormone (GnRH) is the central regulator of gonadotropins, which stimulate gonadal function. Hypothalamic neurons that produce kisspeptin and neurokinin B stimulate GnRH release. Inactivating mutations in the genes encoding the human kisspeptin receptor (KISS1R, formerly called GPR54), neurokinin B (TAC3), and the neurokinin B receptor (TACR3) result in pubertal failure. However, human kisspeptin loss-of-function mutations have not been described, and contradictory findings have been reported in Kiss1-knockout mice. We describe an inactivating mutation in KISS1 in a large consanguineous family that results in failure of pubertal progression, indicating that functional kisspeptin is important for puberty and reproduction in humans. (Funded by the Scientific and Technological Research Council of Turkey [TÜBİTAK] and others.).

  2. Inactivating Mutations in NPC1L1 and Protection from Coronary Heart Disease

    PubMed Central

    2015-01-01

    Background Ezetimibe lowers plasma levels of low-density lipoprotein (LDL) cholesterol by inhibiting the activity of the Niemann–Pick C1-like 1 (NPC1L1) protein. However, whether such inhibition reduces the risk of coronary heart disease is not known. Human mutations that inactivate a gene encoding a drug target can mimic the action of an inhibitory drug and thus can be used to infer potential effects of that drug. Methods We sequenced the exons of NPC1L1 in 7364 patients with coronary heart disease and in 14,728 controls without such disease who were of European, African, or South Asian ancestry. We identified carriers of inactivating mutations (nonsense, splice-site, or frameshift mutations). In addition, we genotyped a specific inactivating mutation (p.Arg406X) in 22,590 patients with coronary heart disease and in 68,412 controls. We tested the association between the presence of an inactivating mutation and both plasma lipid levels and the risk of coronary heart disease. Results With sequencing, we identified 15 distinct NPC1L1 inactivating mutations; approximately 1 in every 650 persons was a heterozygous carrier for 1 of these mutations. Heterozygous carriers of NPC1L1 inactivating mutations had a mean LDL cholesterol level that was 12 mg per deciliter (0.31 mmol per liter) lower than that in noncarriers (P = 0.04). Carrier status was associated with a relative reduction of 53% in the risk of coronary heart disease (odds ratio for carriers, 0.47; 95% confidence interval, 0.25 to 0.87; P = 0.008). In total, only 11 of 29,954 patients with coronary heart disease had an inactivating mutation (carrier frequency, 0.04%) in contrast to 71 of 83,140 controls (carrier frequency, 0.09%). Conclusions Naturally occurring mutations that disrupt NPC1L1 function were found to be associated with reduced plasma LDL cholesterol levels and a reduced risk of coronary heart disease. (Funded by the National Institutes of Health and others.) PMID:25390462

  3. Germline mutations and somatic inactivation of TRIM28 in Wilms tumour

    PubMed Central

    Halliday, Benjamin J.; Markie, David M.; Grundy, Richard G.; Ludgate, Jackie L.; Black, Michael A.; Weeks, Robert J.; Catchpoole, Daniel R.; Reeve, Anthony E.

    2018-01-01

    Wilms tumour is a childhood tumour that arises as a consequence of somatic and rare germline mutations, the characterisation of which has refined our understanding of nephrogenesis and carcinogenesis. Here we report that germline loss of function mutations in TRIM28 predispose children to Wilms tumour. Loss of function of this transcriptional co-repressor, which has a role in nephrogenesis, has not previously been associated with cancer. Inactivation of TRIM28, either germline or somatic, occurred through inactivating mutations, loss of heterozygosity or epigenetic silencing. TRIM28-mutated tumours had a monomorphic epithelial histology that is uncommon for Wilms tumour. Critically, these tumours were negative for TRIM28 immunohistochemical staining whereas the epithelial component in normal tissue and other Wilms tumours stained positively. These data, together with a characteristic gene expression profile, suggest that inactivation of TRIM28 provides the molecular basis for defining a previously described subtype of Wilms tumour, that has early age of onset and excellent prognosis. PMID:29912901

  4. Calculation of Heavy Ion Inactivation and Mutation Rates in Radial Dose Model of Track Structure

    NASA Technical Reports Server (NTRS)

    Cucinotta, Francis A.; Wilson, John W.; Shavers, Mark R.; Katz, Robert

    1997-01-01

    In the track structure model, the inactivation cross section is found by summing an inactivation probability over all impact parameters from the ion to the sensitive sites within the cell nucleus. The inactivation probability is evaluated by using the dose response of the system to gamma rays and the radial dose of the ions and may be equal to unity at small impact parameters. We apply the track structure model to recent data with heavy ion beams irradiating biological samples of E. Coli, B. Subtilis spores, and Chinese hamster (V79) cells. Heavy ions have observed cross sections for inactivation that approach and sometimes exceed the geometric size of the cell nucleus. We show how the effects of inactivation may be taken into account in the evaluation of the mutation cross sections in the track structure model through correlation of sites for gene mutation and cell inactivation. The model is fit to available data for HPRT (hypoxanthine guanine phosphoribosyl transferase) mutations in V79 cells, and good agreement is found. Calculations show the high probability for mutation by relativistic ions due to the radial extension of ions track from delta rays. The effects of inactivation on mutation rates make it very unlikely that a single parameter such as LET (linear energy transfer) can be used to specify radiation quality for heavy ion bombardment.

  5. Effects of track structure and cell inactivation on the calculation of heavy ion mutation rates in mammalian cells

    NASA Technical Reports Server (NTRS)

    Cucinotta, F. A.; Wilson, J. W.; Shavers, M. R.; Katz, R.

    1996-01-01

    It has long been suggested that inactivation severely effects the probability of mutation by heavy ions in mammalian cells. Heavy ions have observed cross sections of inactivation that approach and sometimes exceed the geometric size of the cell nucleus in mammalian cells. In the track structure model of Katz the inactivation cross section is found by summing an inactivation probability over all impact parameters from the ion to the sensitive sites within the cell nucleus. The inactivation probability is evaluated using the dose-response of the system to gamma-rays and the radial dose of the ions and may be equal to unity at small impact parameters for some ions. We show how the effects of inactivation may be taken into account in the evaluation of the mutation cross sections from heavy ions in the track structure model through correlation of sites for gene mutation and cell inactivation. The model is fit to available data for HPRT mutations in Chinese hamster cells and good agreement is found. The resulting calculations qualitatively show that mutation cross sections for heavy ions display minima at velocities where inactivation cross sections display maxima. Also, calculations show the high probability of mutation by relativistic heavy ions due to the radial extension of ions track from delta-rays in agreement with the microlesion concept. The effects of inactivation on mutations rates make it very unlikely that a single parameter such as LET or Z*2/beta(2) can be used to specify radiation quality for heavy ion bombardment.

  6. Helicase-inactivating mutations as a basis for dominant negative phenotypes

    PubMed Central

    Wu, Yuliang

    2010-01-01

    There is ample evidence from studies of both unicellular and multicellular organisms that helicase-inactivating mutations lead to cellular dysfunction and disease phenotypes. In this review, we will discuss the mechanisms underlying the basis for abnormal phenotypes linked to mutations in genes encoding DNA helicases. Recent evidence demonstrates that a clinically relevant patient missense mutation in Fanconi Anemia Complementation Group J exerts detrimental effects on the biochemical activities of the FANC J helicase, and these molecular defects are responsible for aberrant genomic stability and a poor DNA damage response. The ability of FANC J to use the energy from AT P hydrolysis to produce the force required to unwind duplex or G-quadruplex DNA structures or destabilize protein bound to DNA is required for its DNA repair functions in vivo. Strikingly, helicase-inactivating mutations can exert a spectrum of dominant negative phenotypes, indicating that expression of the mutant helicase protein potentially interferes with normal DNA metabolism and has an effect on basic cellular processes such as DNA replication, the DNA damage response and protein trafficking. This review emphasizes that future studies of clinically relevant mutations in helicase genes will be important to understand the molecular pathologies of the associated diseases and their impact on heterozygote carriers. PMID:20980836

  7. Autosomal-Recessive Hypophosphatemic Rickets Is Associated with an Inactivation Mutation in the ENPP1 Gene

    PubMed Central

    Levy-Litan, Varda; Hershkovitz, Eli; Avizov, Luba; Leventhal, Neta; Bercovich, Dani; Chalifa-Caspi, Vered; Manor, Esther; Buriakovsky, Sophia; Hadad, Yair; Goding, James; Parvari, Ruti

    2010-01-01

    Human disorders of phosphate (Pi) handling and hypophosphatemic rickets have been shown to result from mutations in PHEX, FGF23, and DMP1, presenting as X-linked recessive, autosomal-dominant, and autosomal-recessive patterns, respectively. We present the identification of an inactivating mutation in the ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene causing autosomal-recessive hypophosphatemic rickets (ARHR) with phosphaturia by positional cloning. ENPP1 generates inorganic pyrophosphate (PPi), an essential physiologic inhibitor of calcification, and previously described inactivating mutations in this gene were shown to cause aberrant ectopic calcification disorders, whereas no aberrant calcifications were present in our patients. Our surprising result suggests a different pathway involved in the generation of ARHR and possible additional functions for ENPP1. PMID:20137772

  8. Inherited pain: sodium channel Nav1.7 A1632T mutation causes erythromelalgia due to a shift of fast inactivation.

    PubMed

    Eberhardt, Mirjam; Nakajima, Julika; Klinger, Alexandra B; Neacsu, Cristian; Hühne, Kathrin; O'Reilly, Andrias O; Kist, Andreas M; Lampe, Anne K; Fischer, Kerstin; Gibson, Jane; Nau, Carla; Winterpacht, Andreas; Lampert, Angelika

    2014-01-24

    Inherited erythromelalgia (IEM) causes debilitating episodic neuropathic pain characterized by burning in the extremities. Inherited "paroxysmal extreme pain disorder" (PEPD) differs in its clinical picture and affects proximal body areas like the rectal, ocular, or jaw regions. Both pain syndromes have been linked to mutations in the voltage-gated sodium channel Nav1.7. Electrophysiological characterization shows that IEM-causing mutations generally enhance activation, whereas mutations leading to PEPD alter fast inactivation. Previously, an A1632E mutation of a patient with overlapping symptoms of IEM and PEPD was reported (Estacion, M., Dib-Hajj, S. D., Benke, P. J., Te Morsche, R. H., Eastman, E. M., Macala, L. J., Drenth, J. P., and Waxman, S. G. (2008) NaV1.7 Gain-of-function mutations as a continuum. A1632E displays physiological changes associated with erythromelalgia and paroxysmal extreme pain disorder mutations and produces symptoms of both disorders. J. Neurosci. 28, 11079-11088), displaying a shift of both activation and fast inactivation. Here, we characterize a new mutation of Nav1.7, A1632T, found in a patient suffering from IEM. Although transfection of A1632T in sensory neurons resulted in hyperexcitability and spontaneous firing of dorsal root ganglia (DRG) neurons, whole-cell patch clamp of transfected HEK cells revealed that Nav1.7 activation was unaltered by the A1632T mutation but that steady-state fast inactivation was shifted to more depolarized potentials. This is a characteristic normally attributed to PEPD-causing mutations. In contrast to the IEM/PEPD crossover mutation A1632E, A1632T failed to slow current decay (i.e. open-state inactivation) and did not increase resurgent currents, which have been suggested to contribute to high-frequency firing in physiological and pathological conditions. Reduced fast inactivation without increased resurgent currents induces symptoms of IEM, not PEPD, in the new Nav1.7 mutation, A1632T. Therefore

  9. Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

    NASA Astrophysics Data System (ADS)

    Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

  10. Autosomal-recessive hypophosphatemic rickets is associated with an inactivation mutation in the ENPP1 gene.

    PubMed

    Levy-Litan, Varda; Hershkovitz, Eli; Avizov, Luba; Leventhal, Neta; Bercovich, Dani; Chalifa-Caspi, Vered; Manor, Esther; Buriakovsky, Sophia; Hadad, Yair; Goding, James; Parvari, Ruti

    2010-02-12

    Human disorders of phosphate (Pi) handling and hypophosphatemic rickets have been shown to result from mutations in PHEX, FGF23, and DMP1, presenting as X-linked recessive, autosomal-dominant, and autosomal-recessive patterns, respectively. We present the identification of an inactivating mutation in the ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene causing autosomal-recessive hypophosphatemic rickets (ARHR) with phosphaturia by positional cloning. ENPP1 generates inorganic pyrophosphate (PPi), an essential physiologic inhibitor of calcification, and previously described inactivating mutations in this gene were shown to cause aberrant ectopic calcification disorders, whereas no aberrant calcifications were present in our patients. Our surprising result suggests a different pathway involved in the generation of ARHR and possible additional functions for ENPP1. Copyright (c) 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  11. Distinct Mutations Led to Inactivation of Type 1 Fimbriae Expression in Shigella spp.

    PubMed Central

    Bravo, Verónica; Puhar, Andrea; Sansonetti, Philippe; Parsot, Claude; Toro, Cecilia S.

    2015-01-01

    Shigella spp. are responsible for bacillary dysentery in humans. The acquisition or the modification of the virulence plasmid encoding factors promoting entry of bacteria into and dissemination within epithelial cells was a critical step in the evolution of these bacteria from their Escherichia coli ancestor(s). Incorporation of genomic islands (GI) and gene inactivation also shaped interactions between these pathogens and their human host. Sequence analysis of the GI inserted next to the leuX tRNA gene in S. boydii, S. dysenteriae, S. flexneri, S. sonnei and enteroinvasive E. coli (EIEC) suggests that this region initially carried the fec, yjhATS and fim gene clusters. The fim cluster encoding type I fimbriae is systematically inactivated in both reference strains and clinical isolates and distinct mutations are responsible for this inactivation in at least three phylogenetic groups. To investigate consequences of the presence of fimbriae on the outcome of the interaction of Shigella with host cells, we used a S. flexneri strain harboring a plasmid encoding the E. coli fim operon. Production of fimbriae by this recombinant strain increased the ability of bacteria to adhere to and enter into epithelial cells and had no effect on their ability to disseminate from cell to cell. The observations that production of type I fimbriae increases invasion of epithelial cells and that independent mutations abolish fimbriae production in Shigella suggest that these mutations correspond to pathoadaptive events. PMID:25811616

  12. A helix-breaking mutation in the epithelial Ca2+ channel TRPV5 leads to reduced Ca2+-dependent inactivation

    PubMed Central

    Lee, Kyu Pil; Nair, Anil V.; Grimm, Christian; van Zeeland, Femke; Heller, Stefan; Bindels, René J.M.; Hoenderop, Joost G.J.

    2013-01-01

    TRPV5, a member of transient receptor potential (TRP) superfamily of ion channels, plays a crucial role in epithelial calcium transport in the kidney. This channel has a high selectivity for Ca2+ and is tightly regulated by intracellular Ca2+ concentrations. Recently it was shown that the molecular basis of deafness in varitint-waddler mouse is the result of hair cell death caused by the constitutive activity of transient receptor potential mucolipin 3 (TRPML3) channel carrying a helix breaking mutation, A419P, at the intracellular proximity of the fifth transmembrane domain (TM5). This mutation significantly elevates intracellular Ca2+ concentration and causes rapid cell death. Here we show that substituting the equivalent location in TRPV5, the M490, to proline significantly modulates Ca2+-dependent inactivation of TRPV5. The single channel conductance, time constant of inactivation (τ) and half maximal inhibition constant (IC50) of TRPV5(M490P) were increased compared to TRPV5(WT). Moreover TRPV5(M490P) showed lower Ca2+ permeability. Out of different point mutations created to characterize the importance of M490 in Ca2+-dependent inactivation, only TRPV5(M490P)-expressing cells showed apoptosis and extremely altered Ca2+-dependent inactivation. In conclusion, the TRPV5 channel is susceptible for helix breaking mutations and the proximal intracellular region of TM5 of this channel plays an important role in Ca2+-dependent inactivation. PMID:21035851

  13. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    PubMed

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  14. Analysis of the parental origin of de novo MECP2 mutations and X chromosome inactivation in 24 sporadic patients with Rett syndrome in China.

    PubMed

    Zhu, Xingwang; Li, Meirong; Pan, Hong; Bao, Xinhua; Zhang, Jingjing; Wu, Xiru

    2010-07-01

    Rett syndrome is an X-linked neurodevelopmental disorder that predominantly affects females. It is caused by mutations in methyl-CpG-binding protein 2 gene. Due to the sex-limited expression, it has been suggested that de novo X-linked mutations may exclusively occur in male germ cells and thus only females are affected. In this study, the authors have analyzed the parental origin of mutations and the X-chromosome inactivation status in 24 sporadic patients with identified methyl-CpG-binding protein 2 gene mutations. The results showed that 22 of 24 patients have a paternal origin. Only 2 patients have a maternal origin. Except for 2 cases which were homozygotic at the androgen receptor gene locus, of the remaining 22 cases, 16 cases have a random X-chromosome inactivation pattern; the other 6 cases have a skewed X-chromosome inactivation and they favor expression of the wild allele. The relationship between X-chromosome inactivation and phenotype may need more cases to explore.

  15. Inactivation and mutation induction in Saccharomyces cerevisiae exposed to simulated sunlight: evaluation of action spectra.

    PubMed

    Schenk-Meuser, K; Pawlowsky, K; Kiefer, J

    1992-07-15

    The effectiveness of polychromatic light irradiation was investigated for haploid yeast cells. Inactivation and mutation induction were measured in both a RAD-wildtype strain and an excision-repair defective strain. The behaviour of vegetative "wet" cells was compared to that of dehydrated cells. The aim of the study was to assess the interaction of UVC with other wavelengths in cells of different states of humidity. The irradiation procedure was therefore carried out using a solar simulator either with full spectrum or with a UVC-blocking filter (modified sunlight) added. The results were analysed on the basis of separately determined action spectra. The summation of the efficiency of individual wavelengths was compared to the values obtained from polychromatic irradiation. It is shown that the effects caused by the whole-spectrum irradiation in wet cells can be predicted sufficiently from the calculation, while dried wildtype cells exhibit higher mutation rates. Thus it can be assumed that drying-specific damage leads to lethal and mutagenic lesions which are processed in different ways, causing a synergistic behaviour in mutation induction. Irradiation of vegetative cells with modified sunlight (UVC-) results in less inactivation and lower mutation rates than were calculated. From these results it can be concluded that this antagonistic behaviour is caused by the interaction of near-UV photoproducts.

  16. Predominance of null mutations in ataxia-telangiectasia.

    PubMed

    Gilad, S; Khosravi, R; Shkedy, D; Uziel, T; Ziv, Y; Savitsky, K; Rotman, G; Smith, S; Chessa, L; Jorgensen, T J; Harnik, R; Frydman, M; Sanal, O; Portnoi, S; Goldwicz, Z; Jaspers, N G; Gatti, R A; Lenoir, G; Lavin, M F; Tatsumi, K; Wegner, R D; Shiloh, Y; Bar-Shira, A

    1996-04-01

    Ataxia-telangiectasia (A-T) is an autosomal recessive disorder involving cerebellar degeneration, immunodeficiency, chromosomal instability, radiosensitivity and cancer predisposition. The responsible gene, ATM, was recently identified by positional cloning and found to encode a putative 350 kDa protein with a Pl 3-kinase-like domain, presumably involved in mediating cell cycle arrest in response to radiation-induced DNA damage. The nature and location of A-T mutations should provide insight into the function of the ATM protein and the molecular basis of this pleiotropic disease. Of 44 A-T mutations identified by us to date, 39 (89%) are expected to inactivate the ATM protein by truncating it, by abolishing correct initiation or termination of translation, or by deleting large segments. Additional mutations are four smaller in-frame deletions and insertions, and one substitution of a highly conserved amino acid at the Pl 3-kinase domain. The emerging profile of mutations causing A-T is thus dominated by those expected to completely inactivate the ATM protein. ATM mutations with milder effects may result in phenotypes related, but not identical, to A-T.

  17. Association of Exon 10A and 10B inactivating mutation of follicle stimulating hormone receptor gene (FSHR) and Polycystic Ovarian Syndrome in Vellore cohort

    NASA Astrophysics Data System (ADS)

    Sekar, Nishu; Kulkarni, Rucha; Ozalkar, Sharvari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic ovarian syndrome is the most common heterogenous endocrine disorder in women. Follicle stimulating hormone receptor is associated with normal development as well as maturation of follicles and triggers estrogen production in granulosa cells of the ovary. Inactivating mutation in FSHR gene correlated with reduction of ovarian function in women is due to damage to receptor function. This study aims to investigate whether inactivating mutations, in follicle stimulating hormone receptor gene is related to polycystic ovarian morphology in women with PCOS. Genomic DNA isolated from 15 subjects from Sandhya Hospital, Vellore (10 patients with PCOS and 5 healthy controls) was taken for this study. Patient data included a clinical report, hormonal levels, and ovarian morphological details. DNA isolation was followed by DNA amplification by polymerase chain reaction using Exon 10 A and Exon 10 B primers. The PCR-RFLP analysis was performed using Dde1 restriction enzyme. Here we discuss inactivating mutation found in Exon 10 of FSHR gene in patients with PCOS.The absence of inactivating mutation was observed through PCR-RFLP study on Exon 10A and Exon 10B.

  18. DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

    PubMed

    Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

    2014-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Cell inactivation, repair and mutation induction in bacteria after heavy ion exposure: results from experiments at accelerators and in space.

    PubMed

    Horneck, G; Schafer, M; Baltschukat, K; Weisbrod, U; Micke, U; Facius, R; Bucker, H

    1989-01-01

    To understand the mechanisms of accelerated heavy ions on biological matter, the responses of spores of B. subtilis to this structured high LET radiation was investigated applying two different approaches. 1) By the use of the Biostack concept, the inactivation probability as a function of radial distance to single particles' trajectory (i.e. impact parameter) was determined in space experiments as well as at accelerators using low fluences of heavy ions. It was found that spores can survive even a central hit and that the effective range of inactivation extends far beyond impact parameters where inactivation by delta-ray dose would be effective. Concerning the space experiment, the inactivation cross section exceeds those from comparable accelerator experiments by roughly a factor of 20. 2) From fluence effect curves, cross sections for inactivation and mutation induction, and the efficiency of repair processes were determined. They are influenced by the ions characteristics in a complex manner. According to dependence on LET, at least 3 LET ranges can be differentiated: A low LET range (app. < 200 keV/micrometers), where cross sections for inactivation and mutation induction follow a common curve for different ions and where repair processes are effective; an intermediate LET range of the so-called saturation cross section with negligible mutagenic and repair efficiency; and a high LET range (>1000 keV/micrometers) where the biological endpoints are majorly dependent on atomic mass and energy of the ion under consideration.

  20. Molecular and clinical evidence for an ARMC5 tumor syndrome: concurrent inactivating germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma.

    PubMed

    Elbelt, Ulf; Trovato, Alessia; Kloth, Michael; Gentz, Enno; Finke, Reinhard; Spranger, Joachim; Galas, David; Weber, Susanne; Wolf, Cristina; König, Katharina; Arlt, Wiebke; Büttner, Reinhard; May, Patrick; Allolio, Bruno; Schneider, Jochen G

    2015-01-01

    Primary macronodular adrenal hyperplasia (PMAH) is a rare cause of Cushing's syndrome, which may present in the context of different familial multitumor syndromes. Heterozygous inactivating germline mutations of armadillo repeat containing 5 (ARMC5) have very recently been described as cause for sporadic PMAH. Whether this genetic condition also causes familial PMAH in association with other neoplasias is unclear. The aim of the present study was to delineate the molecular cause in a large family with PMAH and other neoplasias. Whole-genome sequencing and comprehensive clinical and biochemical phenotyping was performed in members of a PMAH affected family. Nodules derived from adrenal surgery and pancreatic and meningeal tumor tissue were analyzed for accompanying somatic mutations in the identified target genes. PMAH presenting either as overt or subclinical Cushing's syndrome was accompanied by a heterozygous germline mutation in ARMC5 (p.A110fs*9) located on chromosome 16. Analysis of tumor tissue showed different somatic ARMC5 mutations in adrenal nodules supporting a second hit hypothesis with inactivation of a tumor suppressor gene. A damaging somatic ARMC5 mutation was also found in a concomitant meningioma (p.R502fs) but not in a pancreatic tumor, suggesting biallelic inactivation of ARMC5 as causal also for the intracranial meningioma. Our analysis further confirms inherited inactivating ARMC5 mutations as a cause of familial PMAH and suggests an additional role for the development of concomitant intracranial meningiomas.

  1. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    PubMed

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  2. PTEN/MMAC1 Mutations in Hepatocellular Carcinomas: Somatic Inactivation of Both Alleles in Tumors

    PubMed Central

    Kawamura, Naoki; Nagai, Hisaki; Bando, Koichi; Koyama, Masaaki; Matsumoto, Satoshi; Tajiri, Takashi; Onda, Masahiko; Fujimoto, Jiro; Ueki, Takahiro; Konishi, Noboru; Shiba, Tadayoshi

    1999-01-01

    Allelic loss of loci on chromosome 10q occurs frequently in hepatocellular carcinomas. Somatic mutations of the PTEN/MMAC1 gene on this chromosome at 10q23 were recently identified in sporadic cancers of the uterus, brain, prostate and breast. To investigate the potential role of PTEN/MMAC1 gene in the genesis of hepatocellular carcinomas, we examined 96 tumors for allelic loss on 10q and also for subtle mutations anywhere within the coding region of PTEN/MMAC1 gene. Allelic loss was identified in 25 of the 89 (27%) tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in five of those tumors: three frameshift mutations, a 1‐bp insertion at codon 83–84 in exon 4 and two 4‐bp deletions, both at codon 318–319 in exon 8; two C‐to‐G transversion mutation, both at ‐9 bp from the initiation codon in the 5’non‐coding region of exon 1. No missense mutation was observed in this panel of tumors. In most of the informative tumors carrying intragenic mutations of one allele, we were able to detect loss of heterozygosity as well. These findings suggest that two alleles of the PTEN/MMAC1 gene may be inactivated by a combination of intragenic point mutation on one allele and loss of chromosomal material on the other allele in some of these tumors. PMID:10363579

  3. Depolarized inactivation overcomes impaired activation to produce DRG neuron hyperexcitability in a Nav1.7 mutation in a patient with distal limb pain.

    PubMed

    Huang, Jianying; Yang, Yang; Dib-Hajj, Sulayman D; van Es, Michael; Zhao, Peng; Salomon, Jody; Drenth, Joost P H; Waxman, Stephen G

    2014-09-10

    Sodium channel Nav1.7, encoded by SCN9A, is expressed in DRG neurons and regulates their excitability. Genetic and functional studies have established a critical contribution of Nav1.7 to human pain disorders. We have now characterized a novel Nav1.7 mutation (R1279P) from a female human subject with distal limb pain, in which depolarized fast inactivation overrides impaired activation to produce hyperexcitability and spontaneous firing in DRG neurons. Whole-cell voltage-clamp recordings in human embryonic kidney (HEK) 293 cells demonstrated that R1279P significantly depolarizes steady-state fast-, slow-, and closed-state inactivation. It accelerates deactivation, decelerates inactivation, and facilitates repriming. The mutation increases ramp currents in response to slow depolarizations. Our voltage-clamp analysis showed that R1279P depolarizes channel activation, a change that was supported by our multistate structural modeling. Because this mutation confers both gain-of-function and loss-of-function attributes on the Nav1.7 channel, we tested the impact of R1279P expression on DRG neuron excitability. Current-clamp studies reveal that R1279P depolarizes resting membrane potential, decreases current threshold, and increases firing frequency of evoked action potentials within small DRG neurons. The populations of spontaneously firing and repetitively firing neurons were increased by expressing R1279P. These observations indicate that the dominant proexcitatory gating changes associated with this mutation, including depolarized steady-state fast-, slow-, and closed-state inactivation, faster repriming, and larger ramp currents, override the depolarizing shift of activation, to produce hyperexcitability and spontaneous firing of nociceptive neurons that underlie pain. Copyright © 2014 the authors 0270-6474/14/3412328-13$15.00/0.

  4. The background puzzle: how identical mutations in the same gene lead to different disease symptoms.

    PubMed

    Kammenga, Jan E

    2017-10-01

    Identical disease-causing mutations can lead to different symptoms in different people. The reason for this has been a puzzling problem for geneticists. Differential penetrance and expressivity of mutations has been observed within individuals with different and similar genetic backgrounds. Attempts have been made to uncover the underlying mechanisms that determine differential phenotypic effects of identical mutations through studies of model organisms. From these studies evidence is accumulating that to understand disease mechanism or predict disease prevalence, an understanding of the influence of genetic background is as important as the putative disease-causing mutations of relatively large effect. This review highlights current insights into phenotypic variation due to gene interactions, epigenetics and stochasticity in model organisms, and discusses their importance for understanding the mutational effect on disease symptoms. © 2017 Federation of European Biochemical Societies.

  5. Comprehensive genomic profiling reveals inactivating SMARCA4 mutations and low tumor mutational burden in small cell carcinoma of the ovary, hypercalcemic-type.

    PubMed

    Lin, Douglas I; Chudnovsky, Yakov; Duggan, Bridget; Zajchowski, Deborah; Greenbowe, Joel; Ross, Jeffrey S; Gay, Laurie M; Ali, Siraj M; Elvin, Julia A

    2017-12-01

    Small cell carcinoma of the ovary, hypercalcemic-type (SCCOHT) is a rare, extremely aggressive neoplasm that usually occurs in young women and is characterized by deleterious germline or somatic SMARCA4 mutations. We performed comprehensive genomic profiling (CGP) to potentially identify additional clinically and pathophysiologically relevant genomic alterations in SCCOHT. CGP assessment of all classes of coding alterations in up to 406 genes commonly altered in cancer and intronic regions for up to 31 genes commonly rearranged in cancer was performed on 18 SCCOHT cases (16 exhibiting classic morphology and 2 cases exhibiting exclusive a large cell variant morphology). In addition, a retrospective database search for clinically advanced ovarian tumors with genomic profiles similar to SCCOHT yielded 3 additional cases originally diagnosed as non-SCCOHT. CGP revealed inactivating SMARCA4 alterations and low tumor mutational burden (TMB) (<6mutations/Mb) in 94% (15/16) of SCCOHT with classic morphology. In contrast, both (2/2) cases exhibiting only large cell variant morphology were hypermutated (TMB scores of 90 and 360mut/Mb) and were wildtype for SMARCA4. In our retrospective search, an index ovarian cancer patient harboring inactivating SMARCA4 alterations, initially diagnosed as endometrioid carcinoma, was re-classified as SCCOHT and responded to an SCCOHT chemotherapy regimen. The vast majority of SCCOHT demonstrate genomic SMARCA4 loss with only rare co-occurring alterations. Our data support a role for CGP in the diagnosis and management of SCCOHT and of other lesions with overlapping histological and clinical features, since identifying the former by genomic profile suggests benefit from an appropriate regimen and treatment decisions, as illustrated by an index patient. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  7. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  8. Determination of influenza B identity and potency in quadrivalent inactivated influenza vaccines using lineage-specific monoclonal antibodies

    PubMed Central

    Verma, Swati; Soto, Jackeline; Vasudevan, Anupama; Schmeisser, Falko; Alvarado-Facundo, Esmeralda; Wang, Wei; Weiss, Carol D.

    2017-01-01

    Co-circulation of two antigenically and genetically distinct lineages of influenza B virus, represented by prototype viruses B/Victoria/2/1987 and B/Yamagata/16/1988, has led to the development of quadrivalent influenza vaccines that contain two influenza B antigens. The inclusion of two influenza B antigens presents challenges for the production and regulation of inactivated quadrivalent vaccines, including the potential for cross-reactivity of the reagents used in identity and potency assays because of the relative close relatedness of the hemagglutinin (HA) from the two virus lineages. Monoclonal antibodies (mAbs) specific for the two lineages of influenza B HA were generated and characterized and used to set-up simple identity tests that distinguish the influenza B antigens in inactivated trivalent and quadrivalent vaccines. The lineage-specific mAbs bound well to the HA of influenza B strains included in influenza vaccines over a period of more than 10 years, suggesting that identity tests using such lineage-specific mAbs would not necessarily have to be updated with every influenza B vaccine strain change. These lineage-specific mAbs were also used in an antibody capture ELISA format to quantify HA in vaccine samples, including monovalent, trivalent, and quadrivalent vaccine samples from various manufacturers. The results demonstrated correlation with HA values determined by the traditional single radial immunodiffusion (SRID) assay. Further, the antibody-capture ELISA was able to distinguish heat-stressed vaccine from unstressed vaccine, and was similar to the SRID in quantifying the resultant loss of potency. These mAb reagents should be useful for further development of antibody-based alternative influenza B identity and potency assays. PMID:28423025

  9. Determination of influenza B identity and potency in quadrivalent inactivated influenza vaccines using lineage-specific monoclonal antibodies.

    PubMed

    Verma, Swati; Soto, Jackeline; Vasudevan, Anupama; Schmeisser, Falko; Alvarado-Facundo, Esmeralda; Wang, Wei; Weiss, Carol D; Weir, Jerry P

    2017-01-01

    Co-circulation of two antigenically and genetically distinct lineages of influenza B virus, represented by prototype viruses B/Victoria/2/1987 and B/Yamagata/16/1988, has led to the development of quadrivalent influenza vaccines that contain two influenza B antigens. The inclusion of two influenza B antigens presents challenges for the production and regulation of inactivated quadrivalent vaccines, including the potential for cross-reactivity of the reagents used in identity and potency assays because of the relative close relatedness of the hemagglutinin (HA) from the two virus lineages. Monoclonal antibodies (mAbs) specific for the two lineages of influenza B HA were generated and characterized and used to set-up simple identity tests that distinguish the influenza B antigens in inactivated trivalent and quadrivalent vaccines. The lineage-specific mAbs bound well to the HA of influenza B strains included in influenza vaccines over a period of more than 10 years, suggesting that identity tests using such lineage-specific mAbs would not necessarily have to be updated with every influenza B vaccine strain change. These lineage-specific mAbs were also used in an antibody capture ELISA format to quantify HA in vaccine samples, including monovalent, trivalent, and quadrivalent vaccine samples from various manufacturers. The results demonstrated correlation with HA values determined by the traditional single radial immunodiffusion (SRID) assay. Further, the antibody-capture ELISA was able to distinguish heat-stressed vaccine from unstressed vaccine, and was similar to the SRID in quantifying the resultant loss of potency. These mAb reagents should be useful for further development of antibody-based alternative influenza B identity and potency assays.

  10. X inactivation in Rett syndrome: A preliminary study showing partial preferential inactivation of paternal X with the M27{beta} probe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Camus, P.; Abbadi, N.; Gilgenkrantz, S.

    1994-04-15

    Rett syndrome (RS) is a severe progressive neurological disorder occurring exclusively in females. Most cases are sporadic. The few familial cases (less than 1%) cannot be explained by a simple mode of inheritance. Several hypotheses have been proposed: X-linked male lethal mutation, maternal uniparental disomy, fresh mutation on the X chromosome, involvement of mitochondrial DNA and differential inactivation with metabolic interference of X-borne alleles. The authors have examined the pattern of X inactivation in 10 affected girls who were selected according to the clinical criteria previously described and accepted by the French Rett Scientific Committee. The X inactivation pattern wasmore » studied by analysis of methylation at the hypervariable locus DXS255 with the M27{beta} probe. The results show a more-or-less skewed inactivation of paternal X in 8 Rett females, and 2 cases of symmetrical inactivation. In control girls, inactivation was symmetrical cases and the maternal X has been preferentially inactivated in the other 2 cases. In no case was a total skewed inactivation observed. Though there was clear evidence for a preferential paternal X inactivation that was statistically significant further studies are necessary to establish a relationship between X inactivation pattern and Rett syndrome.« less

  11. Mutations in the Ada O6-alkylguanine-DNA alkyltransferase conferring sensitivity to inactivation by O6-benzylguanine and 2,4-diamino-6-benzyloxy-5-nitrosopyrimidine.

    PubMed

    Crone, T M; Kanugula, S; Pegg, A E

    1995-08-01

    Although the human O6-alkylguanine-DNA alkyltransferase (AGT) is very sensitive to inactivation by O6-benzylguanine (BG) or 2,4-diamino-6-benzyloxy-5-nitrosopyrimidine (5-nitroso-BP), the equivalent protein formed by the carboxyl terminal domain of the product of the Escherichia coli ada gene (Ada-C) is unaffected by these inhibitors. This difference is remarkable in view of the substantial similarity between these proteins (33% of the residues in the common sequence are identical) and is potentially very important since these inhibitors are under development as drugs to enhance the anti-tumor activity of alkylating agents. In order to understand the reason for the resistance of the Ada-C protein, we have made chimeras between Ada-C and AGT sequences and mutations in the Ada-C protein, expressed the altered proteins in an E. coli strain lacking endogenous alkyltransferase activity and tested the inactivation of the resulting proteins by BG or 5-nitroso-BP. Chimeric alkyltransferase proteins were made in which the residues on the amino side of the cysteine acceptor site came from Ada-C and the residues on the carboxyl side came from AGT and vice versa but these did not show sensitivity to BG suggesting that resistance is produced by residues in both segments of the protein. Analysis of the Ada-C mutant proteins revealed two sites for mutations that confer sensitivity to these inhibitors. One of these was tryptophan-336 and the other was residues lysine-314 and alanine-316. Thus, when the combined mutations of A316P/W336A were made in the Ada-C sequence, the protein was sensitive to inactivation by BG. This A316P/W336A mutant protein was even more sensitive to 5-nitroso-BP and the mutant proteins W336A, K314P/A316P and A316P could also be inhibited by this drug (in decreasing order of sensitivity) although the control Ada-C and a mutant R335S were not inhibited. These results provide strong support for the hypothesis that the resistance of the Ada-C alkyl

  12. SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

    PubMed

    Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

    2015-04-23

    With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

  13. Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

    PubMed Central

    Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

    2013-01-01

    A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

  14. Inactivation of Transcriptional Regulators during Within-Household Evolution of Escherichia coli.

    PubMed

    Kisiela, Dagmara I; Radey, Matthew; Paul, Sandip; Porter, Stephen; Polukhina, Kseniya; Tchesnokova, Veronika; Shevchenko, Sofiya; Chan, Diana; Aziz, Maliha; Johnson, Timothy J; Price, Lance B; Johnson, James R; Sokurenko, Evgeni V

    2017-07-01

    We analyzed the within-household evolution of two household-associated Escherichia coli strains from pandemic clonal group ST131- H 30, using isolates recovered from five individuals within two families, each of which had a distinct strain. Family 1's strain was represented by a urine isolate from the index patient (older sister) with recurrent cystitis and a blood isolate from her younger sister with fatal urosepsis. Family 2's strain was represented by a urine isolate from the index patient (father) with pyelonephritis and renal abscesses, blood and kidney drainage isolates from the daughter with emphysematous pyelonephritis, and urine and fecal isolates from the mother with cystitis. Collectively, the several variants of each family's strain had accumulated a total of 8 (family 1) and 39 (family 2) point mutations; no two isolates were identical. Of the 47 total mutations, 36 resulted in amino acid changes or truncation of coded proteins. Fourteen such mutations (39%) targeted genes encoding transcriptional regulators, and 9 (25%) involved DNA-binding transcription factors (TFs), which significantly exceeded the relative contribution of TF genes to the isolates' genomes (∼6%). At least one-half of the transcriptional regulator mutations were inactivating, based on phenotypic and/or transcriptional analysis. In particular, inactivating mutations in the global regulator LrhA (repressor of type 1 fimbriae and flagella) occurred in the blood isolates from both households and increased the virulence of E. coli strains in a murine sepsis model. The results indicate that E. coli undergoes adaptive evolution between and/or within hosts, generating subpopulations with distinctive phenotypes and virulence potential. IMPORTANCE The clonal evolution of bacterial strains associated with interhost transmission is poorly understood. We characterized the genome sequences of clonal descendants of two Escherichia coli strains, recovered at different time points from multiple

  15. Development of breast tumors in CHEK2, NBN/NBS1 and BLM mutation carriers does not commonly involve somatic inactivation of the wild-type allele.

    PubMed

    Suspitsin, Evgeny N; Yanus, Grigory A; Sokolenko, Anna P; Yatsuk, Olga S; Zaitseva, Olga A; Bessonov, Alexandr A; Ivantsov, Alexandr O; Heinstein, Valeria A; Klimashevskiy, Valery F; Togo, Alexandr V; Imyanitov, Evgeny N

    2014-02-01

    Somatic inactivation of the remaining allele is a characteristic feature of cancers arising in BRCA1 and BRCA2 mutation carriers, which determines their unprecedented sensitivity to some DNA-damaging agents. Data on tumor-specific status of the involved gene in novel varieties of hereditary breast cancer (BC) remain incomplete. We analyzed 32 tumors obtained from 30 patients with non-BRCA1/2 BC-associated germ-line mutations: 25 women were single mutation carriers (7 BLM, 15 CHEK2 and 3 NBN/NBS1) and 5 were double mutation carriers (2 BLM/BRCA1, 1 CHEK2/BLM, 1 CHEK2/BRCA1 and 1 NBN/BLM). Losses of heterozygosity affecting the wild-type allele were detected in none of the tumors from BLM mutation carriers, 3/18 (17 %) CHEK2-associated BC and 1/4 (25 %) NBN/NBS1-driven tumors. The remaining 28 BC were subjected to the sequence analysis of entire coding region of the involved gene; no somatic mutations were identified. We conclude that the tumor-specific loss of the wild-type allele is not characteristic for BC arising in CHEK2, NBN/NBS1 and BLM mutation carriers. Rarity of "second-hit" inactivation of the involved gene in CHEK2-, NBN/NBS1- and BLM-associated BC demonstrates their substantial biological difference from BRCA1/2-driven cancers and makes them poorly suitable for the clinical trials with cisplatin and PARP inhibitors.

  16. Cancer-associated Isocitrate Dehydrogenase Mutations Inactivate NADPH-dependent Reductive Carboxylation*

    PubMed Central

    Leonardi, Roberta; Subramanian, Chitra; Jackowski, Suzanne; Rock, Charles O.

    2012-01-01

    Isocitrate dehydrogenase (IDH) is a reversible enzyme that catalyzes the NADP+-dependent oxidative decarboxylation of isocitrate (ICT) to α-ketoglutarate (αKG) and the NADPH/CO2-dependent reductive carboxylation of αKG to ICT. Reductive carboxylation by IDH1 was potently inhibited by NADP+ and, to a lesser extent, by ICT. IDH1 and IDH2 with cancer-associated mutations at the active site arginines were unable to carry out the reductive carboxylation of αKG. These mutants were also defective in ICT decarboxylation and converted αKG to 2-hydroxyglutarate using NADPH. These mutant proteins were thus defective in both of the normal reactions of IDH. Biochemical analysis of heterodimers between wild-type and mutant IDH1 subunits showed that the mutant subunit did not inactivate reductive carboxylation by the wild-type subunit. Cells expressing the mutant IDH are thus deficient in their capacity for reductive carboxylation and may be compromised in their ability to produce acetyl-CoA under hypoxia or when mitochondrial function is otherwise impaired. PMID:22442146

  17. Enhanced fast-inactivated state stability of cardiac sodium channels by a novel voltage sensor SCN5A mutation, R1632C, as a cause of atypical Brugada syndrome.

    PubMed

    Nakajima, Tadashi; Kaneko, Yoshiaki; Saito, Akihiro; Ota, Masaki; Iijima, Takafumi; Kurabayashi, Masahiko

    2015-11-01

    Mutations in SCN5A, which encodes the cardiac voltage-gated sodium channels, can be associated with multiple electrophysiological phenotypes. A novel SCN5A R1632C mutation, located in the domain IV-segment 4 voltage sensor, was identified in a young male patient who had a syncopal episode during exercise and presented with atrial tachycardia, sinus node dysfunction, and Brugada syndrome. We sought to elucidate the functional consequences of the R1632C mutation. The wild-type (WT) or R1632C SCN5A mutation was coexpressed with β1 subunit in tsA201 cells, and whole-cell sodium currents (INa) were recorded using patch-clamp methods. INa density, measured at -20 mV from a holding potential of -120 mV, for R1632C was significantly lower than that for WT (R1632C: -433 ± 52 pA/pF, n = 14; WT: -672 ± 90 pA/pF, n = 15; P < .05); however, no significant changes were observed in the steady-state activation and fast inactivation rate. The steady-state inactivation curve for R1632C was remarkably shifted to hyperpolarizing potentials compared with that for WT (R1632C: V1/2 = -110.7 ± 0.8 mV, n = 16; WT: V1/2 = -85.9 ± 2.5 mV, n = 17; P < .01). The steady-state fast inactivation curve for R1632C was also shifted to the same degree. Recovery from fast inactivation after a 20-ms depolarizing pulse for R1632C was remarkably delayed compared with that for WT (R1632C: τ = 246.7 ± 14.3 ms, n = 8; WT: τ = 3.7 ± 0.3 ms, n = 8; P < .01). Repetitive depolarizing pulses at various cycle lengths greatly attenuated INa for R1632C than that for WT. R1632C showed a loss of function of INa by an enhanced fast-inactivated state stability because of a pronounced impairment of recovery from fast inactivation, which may explain the phenotypic manifestation observed in our patient. Copyright © 2015 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  18. Inactivation of Smad4 in gastric carcinomas.

    PubMed

    Powell, S M; Harper, J C; Hamilton, S R; Robinson, C R; Cummings, O W

    1997-10-01

    Allelic loss of chromosome 18q has been noted in intestinal type gastric adenocarcinomas. Smad4 is a gene located at 18q that was recently cloned in humans and found to be significantly altered in pancreatic cancers. We sought to determine whether Smad4 genetic alterations played a significant role in gastric tumorigenesis by studying 35 gastric adenocarcinomas of all histopathological types and pathological stages. Microdissected specimens were used for mutational analysis of Smad4 at the nucleotide level, including the entire coding region and intron/exon boundaries. Allelic imbalance was also analyzed at the Smad4 locus using two nearby microsatellite markers. One case of apparent biallelic inactivation of Smad4 was found in our study of 35 gastric carcinomas. A nonsense point mutation at codon 334 was demonstrated, which, similar to other Smad4 mutations, is predicted to truncate the conserved COOH-terminal domain of this protein. This Smad4 C to T transition mutation was proven to be somatically acquired. Allelic loss was also noted on chromosome 18q at a marker near Smad4 in this mutated gastric cancer, apparently producing complete inactivation of Smad4 in this tumor. Significant 18q allelic loss (56% of 34 informative cases) was noted in our gastric carcinomas using microsatellite markers near the Smad4 locus, regardless of histological subtype or pathological stage. Additionally, three cases of microsatellite instability were observed. Thus, Smad4 inactivation was noted in our gastric carcinomas; however, this event was rare. The frequent loss of chromosomal arm 18q observed in gastric cancers suggests the presence of other tumor suppressor genes in this region that are involved in gastric tumorigenesis. Further studies are needed to identify these other targets of inactivation during gastric cancer development.

  19. Proteome-wide search for functional motifs altered in tumors: Prediction of nuclear export signals inactivated by cancer-related mutations

    PubMed Central

    Prieto, Gorka; Fullaondo, Asier; Rodríguez, Jose A.

    2016-01-01

    Large-scale sequencing projects are uncovering a growing number of missense mutations in human tumors. Understanding the phenotypic consequences of these alterations represents a formidable challenge. In silico prediction of functionally relevant amino acid motifs disrupted by cancer mutations could provide insight into the potential impact of a mutation, and guide functional tests. We have previously described Wregex, a tool for the identification of potential functional motifs, such as nuclear export signals (NESs), in proteins. Here, we present an improved version that allows motif prediction to be combined with data from large repositories, such as the Catalogue of Somatic Mutations in Cancer (COSMIC), and to be applied to a whole proteome scale. As an example, we have searched the human proteome for candidate NES motifs that could be altered by cancer-related mutations included in the COSMIC database. A subset of the candidate NESs identified was experimentally tested using an in vivo nuclear export assay. A significant proportion of the selected motifs exhibited nuclear export activity, which was abrogated by the COSMIC mutations. In addition, our search identified a cancer mutation that inactivates the NES of the human deubiquitinase USP21, and leads to the aberrant accumulation of this protein in the nucleus. PMID:27174732

  20. CDKN2A/p16 inactivation mechanisms and their relationship to smoke exposure and molecular features in non-small cell lung cancer

    PubMed Central

    Tam, Kit W.; Zhang, Wei; Soh, Junichi; Stastny, Victor; Chen, Min; Sun, Han; Thu, Kelsie; Rios, Jonathan J.; Yang, Chenchen; Marconett, Crystal N.; Selamat, Suhaida A.; Laird-Offringa, Ite A; Taguchi, Ayumu; Hanash, Samir; Shames, David; Ma, Xiaotu; Zhang, Michael Q; Lam, Wan L.; Gazdar, Adi

    2013-01-01

    Introduction CDKN2A(p16) inactivation is common in lung cancer and occurs via homozygous deletions (HD), methylation of promoter region, or point mutations. While p16 promoter methylation has been linked to KRAS mutation and smoking, the associations between p16 inactivation mechanisms and other common genetic mutations and smoking status are still controversial or unknown. Methods We determined all three p16 inactivation mechanisms using multiple methodologies for genomic status, methylation, RNA and protein expression, and correlated them with EGFR, KRAS, STK11 mutations and smoking status in 40 cell lines and 45 tumor samples of primary NSCLC. We also performed meta-analyses to investigate the impact of smoke exposure on p16 inactivation. Results p16 inactivation was the major mechanism of RB pathway perturbation in NSCLC, with HD being the most frequent method, followed by methylation and the rarer point mutations. Inactivating mechanisms were tightly correlated with loss of mRNA and protein expression. p16 inactivation occurred at comparable frequencies regardless of mutational status of EGFR, KRAS and STK11, however, the major inactivation mechanism of p16 varied. p16 methylation was linked to KRAS mutation but was mutually exclusive with EGFR mutation. Cell lines and tumor samples demonstrated similar results. Our meta-analyses confirmed a modest positive association between p16 promoter methylation and smoking. Conclusions Our results confirm that all of the inactivation mechanisms are truly associated with loss of gene product and identify specific associations between p16 inactivation mechanisms and other genetic changes and smoking status. PMID:24077454

  1. A novel germline inactivating mutation in the CASR gene in an Italian kindred affected by familial hypocalciuric hypercalcemia.

    PubMed

    Falchetti, Alberto; Gozzini, Alessia; Terranegra, Annalisa; Soldati, Laura; Vezzoli, Giuseppe; Leoncini, Gigliola; Giusti, Francesca; Franceschelli, Francesco; Masi, Laura; Tanini, Annalisa; Cavalli, Loredana; Brandi, Maria Luisa

    2012-05-01

    Familial hypocalciuric hypercalcemia (FHH) syndrome is a rare benign condition, inherited as an autosomal dominant trait, in which inactivating mutations of the calcium-sensing receptor (CASR) gene affects the body's ability to regulate calcium homeostasis. Its outcome is featured by increased levels of serum calcium, moderate hypophosphatemia, and inadequately normal or elevated circulating parathyroid hormone levels. Affected patients are mostly asymptomatic and do not benefit from surgical resection of their mildly enlarged parathyroids. We evaluated for hypercalcemia an Italian family that was identified via a young adult male proband referred to our center for parathyroidectomy. The patients and the family members were evaluated both biochemically and genetically as suspected FHH subjects. An in vitro functional study was performed by site-directed mutagenesis, and CASR activity was monitored by measuring intracellular calcium ([Ca(2)(+)](i)). The patient had a novel germline heterozygous CASR mutation (c.361_364GATT; p.D121del/fsX122). The mutation caused a premature stop codon at codon 122, exiting a truncated protein. The biochemical phenotype of all family members carrying the heterozygous deletion was concordant with classic FHH syndrome. Our findings confirm the role of CASR gene mutational analysis to offer a valuable addition for the recognition of FHH in hypercalcemic patients not yet characterized for a positive familial history of hypercalcemia, the only condition that identifies CASR gene mutations in hypercalcemia.

  2. Mutations in the growth hormone releasing hormone receptor: a new form of dwarfism in humans.

    PubMed

    Baumann, G

    1999-06-01

    We describe a recently identified new form of dwarfism due to isolated growth hormone (GH) deficiency, secondary to inactivating mutations in the GH-releasing hormone receptor (GHRHR) gene. The identical nonsense mutations in the extracellular domain of the GHRHR (E72X or E50X, depending on whether the signal peptide is included in the numbering) has been independently described in three families residing on or originating from the Indian subcontinent (Pakistan, the Bombay region, and Delft near Sri Lanka). Another inactivating mutation, involving the donor splice site of intron 1, has been identified in a population in north-eastern Brazil. Genetic transmission is autosomal recessive; the gene is located on the short arm of chromosome 7. Affected subjects have severe isolated GH deficiency and postnatal growth failure, with a mean adult height of 130 cm for men and 114 cm for women (7-8 standard deviations below the norm). Dwarfism is proportional; a characteristic feature is relative microcephaly, which results in a 'miniaturized adult', eumorphic aspect. Bone age and puberty are delayed, but fertility appears normal. This new syndrome corresponds to the human homologue of the previously identified 'little mouse'.

  3. The prognostic relevance of p16 inactivation in head and neck cancer.

    PubMed

    Koscielny, Sven; Dahse, Regine; Ernst, Gunther; von Eggeling, Ferdinand

    2007-01-01

    The inactivation of the tumor suppressor gene p16 plays an important role in the development of malignant tumors. p16 loss can result from point mutations, loss of heterozygosity (LOH) or methylation of the promoter region. A total of 67 samples of tumor tissue from squamous cell carcinoma of the oral cavity, the pharynx and the larynx were analyzed for an inactivation of p16. The results of the molecular-biological investigations were correlated with the known clinical prognostic parameters after a follow-up period of approximately 3 years. Methylation of the promoter region and LOH were the main mechanisms of p16 inactivation. Point mutations presented as rare events. An inactivation of p16 did not have any statistical influence on tumor prognosis. Patients with a p16 gene inactivated by promoter methylation appeared to have a slightly lower tendency for local and regional recurrences. The inactivation of the tumor suppressor gene p16 plays a role in the carcinogenesis of head and neck cancer. Copyright (c) 2007 S. Karger AG, Basel.

  4. Inactivation of human and simian rotaviruses by ozone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vaughn, J.M.; Chen, Y.S.; Lindburg, K.

    1987-09-01

    The inactivation of simian rotavirus Sa-11 and human rotavirus type 2 (Wa) by ozone was compared at 4/sup 0/C by using single-particle virus stocks. Although the human strain was clearly more sensitive, both virus types were rapidly inactivated by ozone concentrations of 0.25 mg/liter or greater at all pH levels tested. Comparison of the virucidal activity of ozone with that of chlorine in identical experiments indicated little significant difference in rotavirus-inactivating efficiencies when the disinfectants were used at concentrations of 0.25 mg/liter or greater.

  5. Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

    PubMed

    Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

    2001-01-01

    The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or

  6. Identical NR5A1 Missense Mutations in Two Unrelated 46,XX Individuals with Testicular Tissues.

    PubMed

    Igarashi, Maki; Takasawa, Kei; Hakoda, Akiko; Kanno, Junko; Takada, Shuji; Miyado, Mami; Baba, Takashi; Morohashi, Ken-Ichirou; Tajima, Toshihiro; Hata, Kenichiro; Nakabayashi, Kazuhiko; Matsubara, Yoichi; Sekido, Ryohei; Ogata, Tsutomu; Kashimada, Kenichi; Fukami, Maki

    2017-01-01

    The role of monogenic mutations in the development of 46,XX testicular/ovotesticular disorders of sex development (DSD) remains speculative. Although mutations in NR5A1 are known to cause 46,XY gonadal dysgenesis and 46,XX ovarian insufficiency, such mutations have not been implicated in testicular development of 46,XX gonads. Here, we identified identical NR5A1 mutations in two unrelated Japanese patients with 46,XX testicular/ovotesticular DSD. The p.Arg92Trp mutation was absent from the clinically normal mothers and from 200 unaffected Japanese individuals. In silico analyses scored p.Arg92Trp as probably pathogenic. In vitro assays demonstrated that compared with wild-type NR5A1, the mutant protein was less sensitive to NR0B1-induced suppression on the SOX9 enhancer element. Other sequence variants found in the patients were unlikely to be associated with the phenotype. The results raise the possibility that specific mutations in NR5A1 underlie testicular development in genetic females. © 2016 WILEY PERIODICALS, INC.

  7. Common structural changes accompany the functional inactivation of HPr by seryl phosphorylation or by serine to aspartate substitution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wittekind, M.; Klevit, R.E.; Reizer, J.

    1989-12-26

    Although many proteins are known to be regulated via reversible phosphorylation, little is known about the mechanism by which the covalent modification of seryl, threonyl, or tyrosyl residues alters the activities of the target systems. To address this question, modified versions of bacillus subtilus HPr, a protein component of the bacterial phosphotransferase system, have been studied by {sup 1}H NMR spectroscopy. Phosphorylation at Ser{sub 46} or a Ser to Asp substitution at this position inactivates HPr. Two-dimensional spectra of these two modified proteins display nearly identical proton chemical shifts that differ significantly from those observed in the spectra of themore » unphosphorylated, wild-type protein and of functionally active HPr mutants. These results demonstrate that the functional inactivation of HPr brought about by the serine to aspartate mutation is accompanied by the same structural changes that occur when HPr is phosphorylated at Ser{sub 46}.« less

  8. Hyperinsulinemic hypoglycemia evolving to gestational diabetes and diabetes mellitus in a family carrying the inactivating ABCC8 E1506K mutation.

    PubMed

    Vieira, Teresa C; Bergamin, Carla S; Gurgel, Lucimary C; Moisés, Regina S

    2010-11-01

    Congenital hyperinsulinism of infancy (CHI) is the most common cause of hypoglycemia in newborns and infants. Several molecular mechanisms are involved in the development of CHI, but the most common genetic defects are inactivating mutations of the ABCC8 or KCNJ11 genes. The classical treatment for CHI has been pancreatectomy that eventually leads to diabetes. More recently, conservative treatment has been attempted in some cases, with encouraging results. Whether or not the patients with heterozygous ABCC8 mutations submitted to conservative treatment may spontaneously develop type 2 diabetes in the long run, is a controversial issue. Here, we report a family carrying the dominant heterozygous germ line E1506K mutation in ABCC8 associated with persistent hypoglycemia in the newborn period and diabetes in adulthood. The mutation occurred as a de novo germ line mutation in the mother of the index patient. Her hypoglycemic symptoms as a child occurred after the fourth year of life and were very mild, but she developed glucose metabolism impairment in adulthood. On the other hand, in her daughter, the clinical manifestations of the disease occurred in the neonatal period and were more severe, leading to episodes of tonic-clonic seizures that were well controlled with octreotide or diazoxide. Our data corroborate the hypothesis that the dominant E1506K ABCC8 mutation, responsible for CHI, predisposes to the development of glucose intolerance and diabetes later in life. © 2009 John Wiley & Sons A/S.

  9. Inactivating Variants in ANGPTL4 and Risk of Coronary Artery Disease

    PubMed Central

    Dewey, Frederick E.; Gusarova, Viktoria; O’Dushlaine, Colm; Gottesman, Omri; Trejos, Jesus; Hunt, Charleen; Van Hout, Cristopher V.; Habegger, Lukas; Buckler, David; Lai, Ka-Man V.; Leader, Joseph B.; Murray, Michael F.; Ritchie, Marylyn D.; Kirchner, H. Lester; Ledbetter, David H.; Penn, John; Lopez, Alexander; Borecki, Ingrid B.; Overton, John D.; Reid, Jeffrey G.; Carey, David J.; Murphy, Andrew J.; Yancopoulos, George D.; Baras, Aris; Gromada, Jesper; Shuldiner, Alan R.

    2016-01-01

    BACKGROUND Higher-than-normal levels of circulating triglycerides are a risk factor for ischemic cardiovascular disease. Activation of lipoprotein lipase, an enzyme that is inhibited by angiopoietin-like 4 (ANGPTL4), has been shown to reduce levels of circulating triglycerides. METHODS We sequenced the exons of ANGPTL4 in samples obtain from 42,930 participants of predominantly European ancestry in the DiscovEHR human genetics study. We performed tests of association between lipid levels and the missense E40K variant (which has been associated with reduced plasma triglyceride levels) and other inactivating mutations. We then tested for associations between coronary artery disease and the E40K variant and other inactivating mutations in 10,552 participants with coronary artery disease and 29,223 controls. We also tested the effect of a human monoclonal antibody against ANGPTL4 on lipid levels in mice and monkeys. RESULTS We identified 1661 heterozygotes and 17 homozygotes for the E40K variant and 75 participants who had 13 other monoallelic inactivating mutations in ANGPTL4. The levels of triglycerides were 13% lower and the levels of high-density lipoprotein (HDL) cholesterol were 7% higher among carriers of the E40K variant than among noncarriers. Carriers of the E40K variant were also significantly less likely than noncarriers to have coronary artery disease (odds ratio, 0.81; 95% confidence interval, 0.70 to 0.92; P = 0.002). K40 homozygotes had markedly lower levels of triglycerides and higher levels of HDL cholesterol than did heterozygotes. Carriers of other inactivating mutations also had lower triglyceride levels and higher HDL cholesterol levels and were less likely to have coronary artery disease than were noncarriers. Monoclonal antibody inhibition of Angptl4 in mice and monkeys reduced triglyceride levels. CONCLUSIONS Carriers of E40K and other inactivating mutations in ANGPTL4 had lower levels of triglycerides and a lower risk of coronary artery

  10. Inactivation of B. subtilis spores by low pressure plasma—influence of optical filters and photon/particle fluxes on the inactivation efficiency

    NASA Astrophysics Data System (ADS)

    Fiebrandt, Marcel; Hillebrand, Bastian; Lackmann, Jan-Wilm; Raguse, Marina; Moeller, Ralf; Awakowicz, Peter; Stapelmann, Katharina

    2018-01-01

    Inactivation experiments were performed with Bacillus subtilis spores in a low pressure double inductively coupled plasma (DICP) system. Argon, nitrogen and oxygen at 5 Pa were used as feed gas to change the emission spectrum in the range of 100 nm to 400 nm, as well as between radical and metastable densities. Optical filters were applied, to block particles and selected wavelengths from the spores. By determining absolute photon fluxes, the sporicidal efficiency of various wavelength ranges was evaluated. The results showed good agreement with other plasma experiments, as well as with monochromatic light inactivation experiments from a synchrotron. The findings indicated that the inactivation rate constants of broadband plasma emission and monochromatic light were identical, and that no synergistic effect exists. Furthermore, the influence of radicals, ions and metastables on the inactivation efficiency was of minor importance in the set-up used, and radiation was the main reason for spore inactivation.

  11. Consequences of SPAK inactivation on Hyperkalemic Hypertension caused by WNK1 mutations: evidence for differential roles of WNK1 and WNK4.

    PubMed

    Rafael, Chloé; Soukaseum, Christelle; Baudrie, Véronique; Frère, Perrine; Hadchouel, Juliette

    2018-02-19

    Mutations of the gene encoding WNK1 [With No lysine (K) kinase 1] or WNK4 cause Familial Hyperkalemic Hypertension (FHHt). Previous studies have shown that the activation of SPAK (Ste20-related Proline/Alanine-rich Kinase) plays a dominant role in the development of FHHt caused by WNK4 mutations. The implication of SPAK in FHHt caused by WNK1 mutation has never been investigated. To clarify this issue, we crossed WNK1 +/FHHt mice with SPAK knock-in mice in which the T-loop Thr243 residue was mutated to alanine to prevent activation by WNK kinases. We show that WNK1 +/FHHT :SPAK 243A/243A mice display an intermediate phenotype, between that of control and SPAK 243A/243A mice, with normal blood pressure but hypochloremic metabolic alkalosis. NCC abundance and phosphorylation levels also decrease below the wild-type level in the double-mutant mice but remain higher than in SPAK 243A/243A mice. This is different from what was observed in WNK4-FHHt mice in which SPAK inactivation completely restored the phenotype and NCC expression to wild-type levels. Although these results confirm that FHHt caused by WNK1 mutations is dependent on the activation of SPAK, they suggest that WNK1 and WNK4 play different roles in the distal nephron.

  12. Interactions of the H5 pore region and hydroxylamine with N-type inactivation in the Shaker K+ channel.

    PubMed Central

    Yool, A J; Schwarz, T L

    1995-01-01

    Mutations at sites in the H5 region of the Shaker B K+ channel were used to analyze the influence of the pore on N-type inactivation. Single-channel and two-electrode voltage clamp analyses showed that mutations at residues T441 and T442, which are thought to lie at the internal mouth of the pore, produced opposite effects on inactivation: the inactivated state is stabilized by T441S and destabilized by T442S. In addition, an ammonium derivative, hydroxylamine (OH-(NH3)+), appears to bind in the pore region of T441S and further decreases the rate of recovery from N-type inactivation. This effect relies on the presence of the amino-terminal. The effect of hydroxylamine on the T441S mutation of this K+ channel shows several properties analogous to those of local anesthetics on the Na+ channel. These results can be interpreted to suggest that part of the H5 region contributes to the receptor for the inactivation particle and that a hydroxylamine ion trapped near that site can stabilize their interaction. Images FIGURE 8 PMID:7696498

  13. Gasdermin C Is Upregulated by Inactivation of Transforming Growth Factor β Receptor Type II in the Presence of Mutated Apc, Promoting Colorectal Cancer Proliferation.

    PubMed

    Miguchi, Masashi; Hinoi, Takao; Shimomura, Manabu; Adachi, Tomohiro; Saito, Yasufumi; Niitsu, Hiroaki; Kochi, Masatoshi; Sada, Haruki; Sotomaru, Yusuke; Ikenoue, Tsuneo; Shigeyasu, Kunitoshi; Tanakaya, Kohji; Kitadai, Yasuhiko; Sentani, Kazuhiro; Oue, Naohide; Yasui, Wataru; Ohdan, Hideki

    2016-01-01

    Mutations in TGFBR2, a component of the transforming growth factor (TGF)-β signaling pathway, occur in high-frequency microsatellite instability (MSI-H) colorectal cancer (CRC). In mouse models, Tgfbr2 inactivation in the intestinal epithelium accelerates the development of malignant intestinal tumors in combination with disruption of the Wnt-β-catenin pathway. However, no studies have further identified the genes influenced by TGFBR2 inactivation following disruption of the Wnt-β-catenin pathway. We previously described CDX2P-G19Cre;Apcflox/flox mice, which is stochastically null for Apc in the colon epithelium. In this study, we generated CDX2P-G19Cre;Apcflox/flox;Tgfbr2flox/flox mice, with simultaneous loss of Apc and Tgfbr2. These mice developed tumors, including adenocarcinoma in the proximal colon. We compared gene expression profiles between tumors of the two types of mice using microarray analysis. Our results showed that the expression of the murine homolog of GSDMC was significantly upregulated by 9.25-fold in tumors of CDX2P-G19Cre;Apcflox/flox;Tgfbr2flox/flox mice compared with those of CDX2P-G19Cre;Apcflox/flox mice. We then investigated the role of GSDMC in regulating CRC tumorigenesis. The silencing of GSDMC led to a significant reduction in the proliferation and tumorigenesis of CRC cell lines, whereas the overexpression of GSDMC enhanced cell proliferation. These results suggested that GSDMC functioned as an oncogene, promoting cell proliferation in colorectal carcinogenesis. In conclusion, combined inactivation of both Apc and Tgfbr2 in the colon epithelium of a CRC mouse model promoted development of adenocarcinoma in the proximal colon. Moreover, GSDMC was upregulated by TGFBR2 mutation in CRC and promoted tumor cell proliferation in CRC carcinogenesis, suggesting that GSDMC may be a promising therapeutic target.

  14. Open- and closed-state fast inactivation in sodium channels

    PubMed Central

    Lehmann-Horn, Frank; Holzherr, Boris D

    2011-01-01

    The role of sodium channel closed-state fast inactivation in membrane excitability is not well understood. We compared open- and closed-state fast inactivation, and the gating charge immobilized during these transitions, in skeletal muscle channel hNaV1.4. A significant fraction of total charge movement and its immobilization occurred in the absence of channel opening. Simulated action potentials in skeletal muscle fibers were attenuated when pre-conditioned by subthreshold depolarization. Anthopleurin A, a site-3 toxin that inhibits gating charge associated with the movement of DIVS4, was used to assess the role of this voltage sensor in closed-state fast inactivation. Anthopleurin elicited opposing effects on the gating mode, kinetics and charge immobilized during open- versus closed-state fast inactivation. This same toxin produced identical effects on recovery of channel availability and remobilization of gating charge, irrespective of route of entry into fast inactivation. Our findings suggest that depolarization promoting entry into fast inactivation from open versus closed states provides access to the IFMT receptor via different rate-limiting conformational translocations of DIVS4. PMID:21099342

  15. Inactivation of the Lactobacillus leichmannii ribonucleoside triphosphate reductase by 2'-chloro-2'-deoxyuridine 5'-triphosphate: stoichiometry of inactivation, site of inactivation, and mechanism of the protein chromophore formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashley, G.W.; Harris, G.; Stubbe, J.A.

    1988-06-14

    The ribonucleoside triphosphate reductase (RTPR) of Lactobacillus leichmannii is inactivated by the substrate analogue 2'-chloro-2'-deoxyuridine 5'-triphosphate (ClUTP). Inactivation is due to alkylation by 2-methylene-3(2H)-furanone, a decomposition product of the enzymic product 3'-keto-2'-deoxyuridine triphosphate. The former has been unambiguously identified as 2-((ethylthio)methyl)-3(2H)-furanone, an ethanethiol trapped adduct, which is identical by /sup 1/H NMR spectroscopy with material synthesized chemically. Subsequent to rapid inactivation, a slow process occurs that results in formation of a new protein-associated chromophore absorbing maximally near 320 nm. The terminal stages of the inactivation have now been investigated in detail. The alkylation and inactivation stoichiometries were studied as amore » function of the ratio of ClUTP to enzyme. The amount of labeling of RTPR increased with increasing ClUTP concentration up to the maximum of approximately 4 labels/RTPR, yet the degree of inactivation did not increase proportionally. This suggests that (1) RTPR may be inactivated by alkylation of a single site and (2) decomposition of 3'-keto-dUTP is not necessarily enzyme catalyzed. The formation of the new protein chromophore was also monitored during inactivation and found to reach its full extent upon the first alkylation . Thus, out of four alkylation sites, only one appears capable of undergoing the subsequent reaction to form the new chromophore. Model studies suggest that the new chromophore is due to addition of an amino group to the 5-position of enzyme-bound furanone, followed by ring opening and tautomerization to give a ..beta..-aminoenone structure.« less

  16. Pressure- and heat-induced inactivation of butyrylcholinesterase: evidence for multiple intermediates and the remnant inactivation process.

    PubMed Central

    Weingand-Ziade, A; Ribes, F; Renault, F; Masson, P

    2001-01-01

    The inactivation process of native (N) human butyrylcholinesterase (BuChE) by pressure and/or heat was found to be multi-step. It led to irreversible formation of an active intermediate (I) state and a denatured state. This series-inactivation process was described by expanding the Lumry-Eyring [Lumry, R. and Eyring, H. (1954) J. Phys. Chem. 58, 110-120] model. The intermediate state (I) was found to have a K(m) identical with that of the native state and a turnover rate (k(cat)) twofold higher than that of the native state with butyrylthiocholine as the substrate. The increased catalytic efficiency (k(cat)/K(m)) of I can be explained by a conformational change in the active-site gorge and/or restructuring of the water-molecule network in the active-site pocket, making the catalytic steps faster. However, a pressure/heat-induced covalent modification of native BuChE, affecting the catalytic machinery, cannot be ruled out. The inactivation process of BuChE induced by the combined action of pressure and heat was found to continue after interruption of pressure/temperature treatment. This secondary inactivation process was termed 'remnant inactivation'. We hypothesized that N and I were in equilibrium with populated metastable N' and I' states. The N' and I' states can either return to the active forms, N and I, or develop into inactive forms, N(')(in) and I(')(in). Both active N' and I' intermediate states displayed different rates of remnant inactivation depending on the pressure and temperature pretreatments and on the storage temperature. A first-order deactivation model describing the kinetics of the remnant inactivation of BuChE is proposed. PMID:11368776

  17. Structural determinants of Kvbeta1.3-induced channel inactivation: a hairpin modulated by PIP2.

    PubMed

    Decher, Niels; Gonzalez, Teresa; Streit, Anne Kathrin; Sachse, Frank B; Renigunta, Vijay; Soom, Malle; Heinemann, Stefan H; Daut, Jürgen; Sanguinetti, Michael C

    2008-12-03

    Inactivation of voltage-gated Kv1 channels can be altered by Kvbeta subunits, which block the ion-conducting pore to induce a rapid ('N-type') inactivation. Here, we investigate the mechanisms and structural basis of Kvbeta1.3 interaction with the pore domain of Kv1.5 channels. Inactivation induced by Kvbeta1.3 was antagonized by intracellular PIP(2). Mutations of R5 or T6 in Kvbeta1.3 enhanced Kv1.5 inactivation and markedly reduced the effects of PIP(2). R5C or T6C Kvbeta1.3 also exhibited diminished binding of PIP(2) compared with wild-type channels in an in vitro lipid-binding assay. Further, scanning mutagenesis of the N terminus of Kvbeta1.3 revealed that mutations of L2 and A3 eliminated N-type inactivation. Double-mutant cycle analysis indicates that R5 interacts with A501 and T480 of Kv1.5, residues located deep within the pore of the channel. These interactions indicate that Kvbeta1.3, in contrast to Kvbeta1.1, assumes a hairpin structure to inactivate Kv1 channels. Taken together, our findings indicate that inactivation of Kv1.5 is mediated by an equilibrium binding of the N terminus of Kvbeta1.3 between phosphoinositides (PIPs) and the inner pore region of the channel.

  18. Inactivation gating determines nicotine blockade of human HERG channels.

    PubMed

    Wang, H Z; Shi, H; Liao, S J; Wang, Z

    1999-09-01

    We have previously found that nicotine blocked multiple K+ currents, including the rapid component of delayed rectifier K+ currents (IKr), by interacting directly with the channels. To shed some light on the mechanisms of interaction between nicotine and channels, we performed detailed analysis on the human ether-à-go-go-related gene (HERG) channels, which are believed to be equivalent to the native I(Kr) when expressed in Xenopus oocytes. Nicotine suppressed the HERG channels in a concentration-dependent manner with greater potency with voltage protocols, which favor channel inactivation. Nicotine caused dramatic shifts of the voltage-dependent inactivation curve to more negative potentials and accelerated the inactivation process. Conversely, maneuvers that weakened the channel inactivation gating considerably relieved the blockade. Elevating the extracellular K+ concentration from 5 to 20 mM increased the nicotine concentration (by approximately 100-fold) needed to achieve the same degree of inhibition. Moreover, nicotine lost its ability to block the HERG channels when a single mutation was introduced to a residue located after transmembrane domain 6 (S631A) to remove the rapid channel inactivation. Our data suggest that the inactivation gating determines nicotine blockade of the HERG channels.

  19. Enhanced vulnerability of human proteins towards disease-associated inactivation through divergent evolution.

    PubMed

    Medina-Carmona, Encarnación; Fuchs, Julian E; Gavira, Jose A; Mesa-Torres, Noel; Neira, Jose L; Salido, Eduardo; Palomino-Morales, Rogelio; Burgos, Miguel; Timson, David J; Pey, Angel L

    2017-09-15

    Human proteins are vulnerable towards disease-associated single amino acid replacements affecting protein stability and function. Interestingly, a few studies have shown that consensus amino acids from mammals or vertebrates can enhance protein stability when incorporated into human proteins. Here, we investigate yet unexplored relationships between the high vulnerability of human proteins towards disease-associated inactivation and recent evolutionary site-specific divergence of stabilizing amino acids. Using phylogenetic, structural and experimental analyses, we show that divergence from the consensus amino acids at several sites during mammalian evolution has caused local protein destabilization in two human proteins linked to disease: cancer-associated NQO1 and alanine:glyoxylate aminotransferase, mutated in primary hyperoxaluria type I. We demonstrate that a single consensus mutation (H80R) acts as a disease suppressor on the most common cancer-associated polymorphism in NQO1 (P187S). The H80R mutation reactivates P187S by enhancing FAD binding affinity through local and dynamic stabilization of its binding site. Furthermore, we show how a second suppressor mutation (E247Q) cooperates with H80R in protecting the P187S polymorphism towards inactivation through long-range allosteric communication within the structural ensemble of the protein. Our results support that recent divergence of consensus amino acids may have occurred with neutral effects on many functional and regulatory traits of wild-type human proteins. However, divergence at certain sites may have increased the propensity of some human proteins towards inactivation due to disease-associated mutations and polymorphisms. Consensus mutations also emerge as a potential strategy to identify structural hot-spots in proteins as targets for pharmacological rescue in loss-of-function genetic diseases. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please

  20. A Conducting State with Properties of a Slow Inactivated State in a Shaker K+ Channel Mutant

    PubMed Central

    Olcese, Riccardo; Sigg, Daniel; Latorre, Ramon; Bezanilla, Francisco; Stefani, Enrico

    2001-01-01

    In Shaker K+ channel, the amino terminus deletion Δ6-46 removes fast inactivation (N-type) unmasking a slow inactivation process. In Shaker Δ6-46 (Sh-IR) background, two additional mutations (T449V-I470C) remove slow inactivation, producing a noninactivating channel. However, despite the fact that Sh-IR-T449V-I470C mutant channels remain conductive, prolonged depolarizations (1 min, 0 mV) produce a shift of the QV curve by about −30 mV, suggesting that the channels still undergo the conformational changes typical of slow inactivation. For depolarizations longer than 50 ms, the tail currents measured during repolarization to −90 mV display a slow component that increases in amplitude as the duration of the depolarizing pulse increases. We found that the slow development of the QV shift had a counterpart in the amplitude of the slow component of the ionic tail current that is not present in Sh-IR. During long depolarizations, the time course of both the increase in the slow component of the tail current and the change in voltage dependence of the charge movement could be well fitted by exponential functions with identical time constant of 459 ms. Single channel recordings revealed that after prolonged depolarizations, the channels remain conductive for long periods after membrane repolarization. Nonstationary autocovariance analysis performed on macroscopic current in the T449V-I470C mutant confirmed that a novel open state appears with increasing prepulse depolarization time. These observations suggest that in the mutant studied, a new open state becomes progressively populated during long depolarizations (>50 ms). An appealing interpretation of these results is that the new open state of the mutant channel corresponds to a slow inactivated state of Sh-IR that became conductive. PMID:11158167

  1. Choosing the Active X: The Human Version of X Inactivation.

    PubMed

    Migeon, Barbara R

    2017-12-01

    Humans and rodents differ in how they carry out X inactivation (XI), the mammalian method to compensate for the different number of X chromosomes in males and females. Evolutionary changes in staging embryogenesis and in mutations within the XI center alter the process among mammals. The mouse model of XI is predicated on X counting and subsequently choosing the X to 'inactivate'. However, new evidence suggests that humans initiate XI by protecting one X in both sexes from inactivation by XIST, the noncoding RNA that silences the inactive X. This opinion article explores the question of how the active X is protected from silencing by its own Xist locus, and the possibility of different solutions for mouse and human. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. To Screen Inactivation Mutation of Exon 1 of FSHR Gene in Polycystic Ovarian Syndrome: A South Indian Cohort Study

    NASA Astrophysics Data System (ADS)

    Sekar, Nishu; Yeole, Samiksha; Pradeep, Rashmi; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

    2017-11-01

    Polycystic ovary syndrome is an endocrine disorder. Irregular menstrual cycle, acne, facial hair and elevated androgen levels are the most common signs for PCOS. PCOS has an estimated prevalence of 4-12% among reproductive age women, thus making it a forerunner in female infertility. FSHR plays an important role in FSH signaling pathway making it an important gene for PCOS. In this study, we aim to focus on any association between the FSHR gene and PCOS. Our study was to evaluate any polymorphism of exon 1 of FSHR gene associated with PCOS.PCR-RFLP technique was performed on the PCOS samples. Hormonal changes were found in the patients. Exon 1 inactivation mutation of FSHR gene was not observed in the patient sample. A study of this association needs to be done using large sample size.

  3. Inactivation of the inhA-Encoded Fatty Acid Synthase II (FASII) Enoyl-Acyl Carrier Protein Reductase Induces Accumulation of the FASI End Products and Cell Lysis of Mycobacterium smegmatis

    PubMed Central

    Vilchèze, Catherine; Morbidoni, Hector R.; Weisbrod, Torin R.; Iwamoto, Hiroyuki; Kuo, Mack; Sacchettini, James C.; Jacobs, William R.

    2000-01-01

    The mechanism of action of isoniazid (INH), a first-line antituberculosis drug, is complex, as mutations in at least five different genes (katG, inhA, ahpC, kasA, and ndh) have been found to correlate with isoniazid resistance. Despite this complexity, a preponderance of evidence implicates inhA, which codes for an enoyl-acyl carrier protein reductase of the fatty acid synthase II (FASII), as the primary target of INH. However, INH treatment of Mycobacterium tuberculosis causes the accumulation of hexacosanoic acid (C26:0), a result unexpected for the blocking of an enoyl-reductase. To test whether inactivation of InhA is identical to INH treatment of mycobacteria, we isolated a temperature-sensitive mutation in the inhA gene of Mycobacterium smegmatis that rendered InhA inactive at 42°C. Thermal inactivation of InhA in M. smegmatis resulted in the inhibition of mycolic acid biosynthesis, a decrease in hexadecanoic acid (C16:0) and a concomitant increase of tetracosanoic acid (C24:0) in a manner equivalent to that seen in INH-treated cells. Similarly, INH treatment of Mycobacterium bovis BCG caused an inhibition of mycolic acid biosynthesis, a decrease in C16:0, and a concomitant accumulation of C26:0. Moreover, the InhA-inactivated cells, like INH-treated cells, underwent a drastic morphological change, leading to cell lysis. These data show that InhA inactivation, alone, is sufficient to induce the accumulation of saturated fatty acids, cell wall alterations, and cell lysis and are consistent with InhA being a primary target of INH. PMID:10869086

  4. Rett syndrome in a 47,XXX patient with a de novo MECP2 mutation.

    PubMed

    Hammer, Sara; Dorrani, Naghmeh; Hartiala, Jaana; Stein, Stuart; Schanen, N Carolyn

    2003-10-15

    Rett syndrome is caused by mutation in MECP2, a gene located on Xq28 and subject to X-inactivation. MECP2 encodes methyl CpG-binding protein 2, a widely expressed transcriptional repressor of methylated DNA. Mutations in MECP2 are primarily de novo events in the male germ line and thus lead to an excess of affected females. Here we report the identification of a unique 47,XXX girl with relatively mild atypical Rett syndrome leading initially to a diagnosis of infantile autism with regression. Mutation analysis of the MECP2 gene identified a de novo MECP2 mutation, L100V. Examination of a panel of X-linked microsatellite markers indicated that her supernumerary X chromosome is maternally derived. X-inactivation patterns were determined by analysis of methylation of the androgen receptor locus, and indicated preferential inactivation of her paternal allele. The parental origin of her MECP2 mutation could not be determined because she was uninformative for intronic polymorphisms flanking her mutation. This is the first reported case of sex chromosome trisomy and MECP2 mutation in a female, and it illustrates the importance of allele dosage on the severity of Rett syndrome phenotype. Copyright 2003 Wiley-Liss, Inc.

  5. Lidocaine reduces the transition to slow inactivation in Nav1.7 voltage-gated sodium channels

    PubMed Central

    Sheets, Patrick L; Jarecki, Brian W; Cummins, Theodore R

    2011-01-01

    BACKGROUND AND PURPOSE The primary use of local anaesthetics is to prevent or relieve pain by reversibly preventing action potential propagation through the inhibition of voltage-gated sodium channels. The tetrodotoxin-sensitive voltage-gated sodium channel subtype Nav1.7, abundantly expressed in pain-sensing neurons, plays a crucial role in perception and transmission of painful stimuli and in inherited chronic pain syndromes. Understanding the interaction of lidocaine with Nav1.7 channels could provide valuable insight into the drug's action in alleviating pain in distinct patient populations. The aim of this study was to determine how lidocaine interacts with multiple inactivated conformations of Nav1.7 channels. EXPERIMENTAL APPROACH We investigated the interactions of lidocaine with wild-type Nav1.7 channels and a paroxysmal extreme pain disorder mutation (I1461T) that destabilizes fast inactivation. Whole cell patch clamp recordings were used to examine the activity of channels expressed in human embryonic kidney 293 cells. KEY RESULTS Depolarizing pulses that increased slow inactivation of Nav1.7 channels also reduced lidocaine inhibition. Lidocaine enhanced recovery of Nav1.7 channels from prolonged depolarizing pulses by decreasing slow inactivation. A paroxysmal extreme pain disorder mutation that destabilizes fast inactivation of Nav1.7 channels decreased lidocaine inhibition. CONCLUSIONS AND IMPLICATIONS Lidocaine decreased the transition of Nav1.7 channels to the slow inactivated state. The fast inactivation gate (domain III–IV linker) is important for potentiating the interaction of lidocaine with the Nav1.7 channel. PMID:21232038

  6. The medaka mutation tintachina sheds light on the evolution of V-ATPase B subunits in vertebrates

    NASA Astrophysics Data System (ADS)

    Müller, Claudia; Maeso, Ignacio; Wittbrodt, Joachim; Martínez-Morales, Juan R.

    2013-11-01

    Vacuolar-type H+ ATPases (V-ATPases) are multimeric protein complexes that play a universal role in the acidification of intracellular compartments in eukaryotic cells. We have isolated the recessive medaka mutation tintachina (tch), which carries an inactivating modification of the conserved glycine residue (G75R) of the proton pump subunit atp6v1Ba/vatB1. Mutant embryos show penetrant pigmentation defects, massive brain apoptosis and lethality before hatching. Strikingly, an equivalent mutation in atp6v1B1 (G78R) has been reported in a family of patients suffering from distal renal tubular acidosis (dRTA), a hereditary disease that causes metabolic acidosis due to impaired kidney function. This poses the question as to how molecularly identical mutations result in markedly different phenotypes in two vertebrate species. Our work offers an explanation for this phenomenon. We propose that, after successive rounds of whole-genome duplication, the emergence of paralogous copies allowed the divergence of the atp6v1B cis-regulatory control in different vertebrate groups.

  7. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation.

    PubMed

    Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D

    2016-03-01

    Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes

  8. Next Generation Sequencing of Cytokeratin 20-Negative Merkel Cell Carcinoma Reveals Ultraviolet Signature Mutations and Recurrent TP53 and RB1 Inactivation

    PubMed Central

    Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.

    2016-01-01

    Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping

  9. Identical mitochondrial somatic mutations unique to chronic periodontitis and coronary artery disease

    PubMed Central

    Pallavi, Tokala; Chandra, Rampalli Viswa; Reddy, Aileni Amarender; Reddy, Bavigadda Harish; Naveen, Anumala

    2016-01-01

    Context: The inflammatory processes involved in chronic periodontitis and coronary artery diseases (CADs) are similar and produce reactive oxygen species that may result in similar somatic mutations in mitochondrial deoxyribonucleic acid (mtDNA). Aims: The aims of the present study were to identify somatic mtDNA mutations in periodontal and cardiac tissues from subjects undergoing coronary artery bypass surgery and determine what fraction was identical and unique to these tissues. Settings and Design: The study population consisted of 30 chronic periodontitis subjects who underwent coronary artery surgery after an angiogram had indicated CAD. Materials and Methods: Gingival tissue samples were taken from the site with deepest probing depth; coronary artery tissue samples were taken during the coronary artery bypass grafting procedures, and blood samples were drawn during this surgical procedure. These samples were stored under aseptic conditions and later transported for mtDNA analysis. Statistical Analysis Used: Complete mtDNA sequences were obtained and aligned with the revised Cambridge reference sequence (NC_012920) using sequence analysis and auto assembler tools. Results: Among the complete mtDNA sequences, a total of 162 variations were spread across the whole mitochondrial genome and present only in the coronary artery and the gingival tissue samples but not in the blood samples. Among the 162 variations, 12 were novel and four of the 12 novel variations were found in mitochondrial NADH dehydrogenase subunit 5 complex I gene (33.3%). Conclusions: Analysis of mtDNA mutations indicated 162 variants unique to periodontitis and CAD. Of these, 12 were novel and may have resulted from destructive oxidative forces common to these two diseases. PMID:27041832

  10. Somatic mutations of the histone H3K27 demethylase, UTX, in human cancer

    PubMed Central

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O’Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Dunmore, Rebecca; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Lee, Mulderrig; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J.; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2010-01-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase, UTX, pointing to histone H3 lysine methylation deregulation in multiple tumour types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene. PMID:19330029

  11. Tsc2 gene inactivation causes a more severe epilepsy phenotype than Tsc1 inactivation in a mouse model of tuberous sclerosis complex.

    PubMed

    Zeng, Ling-Hui; Rensing, Nicholas R; Zhang, Bo; Gutmann, David H; Gambello, Michael J; Wong, Michael

    2011-02-01

    Tuberous Sclerosis Complex (TSC) is an autosomal dominant, multi-system disorder, typically involving severe neurological symptoms, such as epilepsy, cognitive deficits and autism. Two genes, TSC1 and TSC2, encoding the proteins hamartin and tuberin, respectively, have been identified as causing TSC. Although there is a substantial overlap in the clinical phenotype produced by TSC1 and TSC2 mutations, accumulating evidence indicates that TSC2 mutations cause more severe neurological manifestations than TSC1 mutations. In this study, the neurological phenotype of a novel mouse model involving conditional inactivation of the Tsc2 gene in glial-fibrillary acidic protein (GFAP)-positive cells (Tsc2(GFAP1)CKO mice) was characterized and compared with previously generated Tsc1(GFAP1)CKO mice. Similar to Tsc1(GFAP1)CKO mice, Tsc2(GFAP1)CKO mice exhibited epilepsy, premature death, progressive megencephaly, diffuse glial proliferation, dispersion of hippocampal pyramidal cells and decreased astrocyte glutamate transporter expression. However, Tsc2(GFAP1)CKO mice had an earlier onset and higher frequency of seizures, as well as significantly more severe histological abnormalities, compared with Tsc1(GFAP1)CKO mice. The differences between Tsc1(GFAP1)CKO and Tsc2(GFAP1)CKO mice were correlated with higher levels of mammalian target of rapamycin (mTOR) activation in Tsc2(GFAP1)CKO mice and were reversed by the mTOR inhibitor, rapamycin. These findings provide novel evidence in mouse models that Tsc2 mutations intrinsically cause a more severe neurological phenotype than Tsc1 mutations and suggest that the difference in phenotype may be related to the degree to which Tsc1 and Tsc2 inactivation causes abnormal mTOR activation.

  12. Phenotypic variability in patients with ADA2 deficiency due to identical homozygous R169Q mutations.

    PubMed

    Van Montfrans, Joris M; Hartman, Esther A R; Braun, Kees P J; Hennekam, Eric A M; Hak, Elisabeth A; Nederkoorn, Paul J; Westendorp, Willeke F; Bredius, Robbert G M; Kollen, Wouter J W; Schölvinck, Elisabeth H; Legger, G Elizabeth; Meyts, Isabelle; Liston, Adrian; Lichtenbelt, Klaske D; Giltay, Jacques C; Van Haaften, Gijs; De Vries Simons, Gaby M; Leavis, Helen; Sanders, Cornelis J G; Bierings, Marc B; Nierkens, Stefan; Van Gijn, Marielle E

    2016-05-01

    To determine the genotype-phenotype association in patients with adenosine deaminase-2 (ADA2) deficiency due to identical homozygous R169Q mutations inCECR1 METHODS: We present a case series of nine ADA2-deficient patients with an identical homozygous R169Q mutation. Clinical and diagnostic data were collected and available MRI studies were reviewed. We performed genealogy and haplotype analyses and measured serum ADA2 activity. ADA2 activity values were correlated to clinical symptoms. Age of presentation differed widely between the nine presented patients (range: 0 months to 8 years). The main clinical manifestations were (hepato)splenomegaly (8/9), skin involvement (8/9) and neurological involvement (8/9, of whom 6 encountered stroke). Considerable variation was seen in type, frequency and intensity of other symptoms, which included aplastic anaemia, acute myeloid leukaemia and cutaneous ulcers. Common laboratory abnormalities included cytopenias and hypogammaglobulinaemia. ADA2 enzyme activity in patients was significantly decreased compared with healthy controls. ADA2 activity levels tended to be lower in patients with stroke compared with patients without stroke. Genealogical studies did not identify a common ancestor; however, based on allele frequency, a North-West European founder effect can be noted. Three patients underwent haematopoietic cell transplantation, after which ADA2 activity was restored and clinical symptoms resolved. This case series revealed large phenotypic variability in patients with ADA2 deficiency though they were homozygous for the same R169Q mutation inCECR1 Disease modifiers, including epigenetic and environmental factors, thus seem important in determining the phenotype. Furthermore, haematopoietic cell transplantation appears promising for those patients with a severe clinical phenotype. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions

  13. Unlocking the Bottleneck in Forward Genetics Using Whole-Genome Sequencing and Identity by Descent to Isolate Causative Mutations

    PubMed Central

    Siggs, Owen M.; Miosge, Lisa A.; Roots, Carla M.; Enders, Anselm; Bertram, Edward M.; Crockford, Tanya L.; Whittle, Belinda; Potter, Paul K.; Simon, Michelle M.; Mallon, Ann-Marie; Brown, Steve D. M.; Beutler, Bruce; Goodnow, Christopher C.; Lunter, Gerton; Cornall, Richard J.

    2013-01-01

    Forward genetics screens with N-ethyl-N-nitrosourea (ENU) provide a powerful way to illuminate gene function and generate mouse models of human disease; however, the identification of causative mutations remains a limiting step. Current strategies depend on conventional mapping, so the propagation of affected mice requires non-lethal screens; accurate tracking of phenotypes through pedigrees is complex and uncertain; out-crossing can introduce unexpected modifiers; and Sanger sequencing of candidate genes is inefficient. Here we show how these problems can be efficiently overcome using whole-genome sequencing (WGS) to detect the ENU mutations and then identify regions that are identical by descent (IBD) in multiple affected mice. In this strategy, we use a modification of the Lander-Green algorithm to isolate causative recessive and dominant mutations, even at low coverage, on a pure strain background. Analysis of the IBD regions also allows us to calculate the ENU mutation rate (1.54 mutations per Mb) and to model future strategies for genetic screens in mice. The introduction of this approach will accelerate the discovery of causal variants, permit broader and more informative lethal screens to be used, reduce animal costs, and herald a new era for ENU mutagenesis. PMID:23382690

  14. Construction and Characterization of Human Mammary Epithelial Cell Lines Containing Mutations in the p53 or BRCA1 Genes

    DTIC Science & Technology

    1999-01-01

    development of breast cancers. To study the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway, we have...the effects of inactivating mutations in these tumor suppressor genes early in the breast-cancer pathway. The consequences of transduction of these...proposed three approaches for constructing p53-deficient cells; i.e., by mutating the p53 gene directly, by abrogating the protein’s normal cellular

  15. Reciprocal voltage sensor-to-pore coupling leads to potassium channel C-type inactivation

    NASA Astrophysics Data System (ADS)

    Conti, Luca; Renhorn, Jakob; Gabrielsson, Anders; Turesson, Fredrik; Liin, Sara I.; Lindahl, Erik; Elinder, Fredrik

    2016-06-01

    Voltage-gated potassium channels open at depolarized membrane voltages. A prolonged depolarization causes a rearrangement of the selectivity filter which terminates the conduction of ions - a process called slow or C-type inactivation. How structural rearrangements in the voltage-sensor domain (VSD) cause alteration in the selectivity filter, and vice versa, are not fully understood. We show that pulling the pore domain of the Shaker potassium channel towards the VSD by a Cd2+ bridge accelerates C-type inactivation. Molecular dynamics simulations show that such pulling widens the selectivity filter and disrupts the K+ coordination, a hallmark for C-type inactivation. An engineered Cd2+ bridge within the VSD also affect C-type inactivation. Conversely, a pore domain mutation affects VSD gating-charge movement. Finally, C-type inactivation is caused by the concerted action of distant amino acid residues in the pore domain. All together, these data suggest a reciprocal communication between the pore domain and the VSD in the extracellular portion of the channel.

  16. Compound-Specific Effects of Mutations at Val787 in DII-S6 of Nav1.4 Sodium Channels on the Action of Sodium Channel Inhibitor Insecticides

    PubMed Central

    von Stein, Richard T.; Soderlund, David M.

    2012-01-01

    Sodium channel inhibitor (SCI) insecticides are hypothesized to inhibit voltage-gated sodium channels by binding selectively to the slow-inactivated state. Replacement of valine at position 787 in the S6 segment of homology domain II of the rat Nav1.4 sodium channel by lysine (V787K) enchances slow inactivation of this channel whereas replacement by alanine or cysteine (V787A, V787C) inhibits slow inactivation. To test the hypothesis that SCI insecticides bind selectively to the slow-inactivated state, we constructed mutated Nav1.4/V787A, Nav1.4/V787C, and Nav1.4/V787K cDNAs, expressed wildtype and mutated channels with the auxiliary β1 subunit in Xenopus oocytes, and used the two-electrode voltage clamp technique to examine the effects of these mutations on channel inhibition by four SCI insecticides (indoxacarb, its bioactivated metabolite DCJW, metaflumizone, and RH3421). Mutations at Val787 affected SCI insecticide sensitivity in a manner that was independent of mutation-induced changes in slow inactivation gating. Sensitivity to inhibition by 10 μM indoxacarb was significantly increased in all three mutated channels, whereas sensitivity to inhibition by 10 μM metaflumizone was significantly reduced in Nav1.4/V787A channels and completely abolished in Nav1.4/V787K channels. The effects of Val787 mutations on metaflumizone were correlated with the hydrophobicity of the substituted amino acid rather than the extent of slow inactivation. None of the mutations at Val787 significantly affected the sensitivity to inhibition by DCJW or RH3421. These results demonstrate that the impact of mutations at Val787 on sodium channel inhibition by SCI insecticides depends on the specific insecticide examined and is independent of mutation-induced changes in slow inactivation gating. We propose that Val787 may be a unique determinant of metaflumizone binding. PMID:22983119

  17. A BAC transgenic mouse model reveals neuron subtype-specific effects of a Generalized Epilepsy with Febrile Seizures Plus (GEFS+) mutation

    PubMed Central

    Tang, Bin; Dutt, Karoni; Papale, Ligia; Rusconi, Raffaella; Shankar, Anupama; Hunter, Jessica; Tufik, Sergio; Yu, Frank H.; Catterall, William A.; Mantegazza, Massimo; Goldin, Alan L.; Escayg, Andrew

    2009-01-01

    Mutations in the voltage-gated sodium channel SCN1A are responsible for a number of seizure disorders including Generalized Epilepsy with Febrile Seizures Plus (GEFS+) and Severe Myoclonic Epilepsy of Infancy (SMEI). To determine the effects of SCN1A mutations on channel function in vivo, we generated a bacterial artificial chromosome (BAC) transgenic mouse model that expresses the human SCN1A GEFS+ mutation, R1648H. Mice with the R1648H mutation exhibit a more severe response to the proconvulsant kainic acid compared with mice expressing a control Scn1a transgene. Electrophysiological analysis of dissociated neurons from mice with the R1648H mutation reveal delayed recovery from inactivation and increased use-dependent inactivation only in inhibitory bipolar neurons, as well as a hyperpolarizing shift in the voltage dependence of inactivation only in excitatory pyramidal neurons. These results demonstrate that the effects of SCN1A mutations are cell type-dependent and that the R1648H mutation specifically leads to a reduction in interneuron excitability. PMID:19409490

  18. Steroid Biomarkers and Genetic Studies Reveal Inactivating Mutations in Hexose-6-Phosphate Dehydrogenase in Patients with Cortisone Reductase Deficiency

    PubMed Central

    Lavery, Gareth G.; Walker, Elizabeth A.; Tiganescu, Ana; Ride, Jon P.; Shackleton, Cedric H. L.; Tomlinson, Jeremy W.; Connell, John M. C.; Ray, David W.; Biason-Lauber, Anna; Malunowicz, Ewa M.; Arlt, Wiebke; Stewart, Paul M.

    2008-01-01

    Context: Cortisone reductase deficiency (CRD) is characterized by a failure to regenerate cortisol from cortisone via 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1), resulting in increased cortisol clearance, activation of the hypothalamic-pituitary-axis (HPA) and ACTH-mediated adrenal androgen excess. 11β-HSD1 oxoreductase activity requires the reduced nicotinamide adenine dinucleotide phosphate-generating enzyme hexose-6-phosphate dehydrogenase (H6PDH) within the endoplasmic reticulum. CRD manifests with hyperandrogenism resulting in hirsutism, oligo-amenorrhea, and infertility in females and premature pseudopuberty in males. Recent association studies have failed to corroborate findings that polymorphisms in the genes encoding H6PDH (R453Q) and 11β-HSD1 (Intron 3 inserted adenine) interact to cause CRD. Objective: Our objective was to reevaluate the genetics and steroid biochemistry of patients with CRD. Design: We analyzed 24-h urine collection for steroid biomarkers by gas chromatography/mass spectrometry and sequenced the HSD11B1 and H6PD genes in our CRD cohort. Patients: Patients included four cases presenting with hyperandrogenism and biochemical features clearly indicative of CRD. Results: Gas chromatography/mass spectrometry identified steroid biomarkers that correlated with CRD in each case. Three cases were identified as homozygous (R109AfsX3, Y316X, and G359D) and one case identified as compound heterozygous (c.960G→A and D620fsX3) for mutations in H6PD. No mutations affecting enzyme activity were identified in the HSD11B1 gene. Expression and activity assays demonstrate loss of function for all reported H6PDH mutations. Conclusions: CRD is caused by inactivating mutations in the H6PD gene, rendering the 11β-HSD1 enzyme unable to operate as an oxoreductase, preventing local glucocorticoid regeneration. These data highlight the importance of the redox control of cortisol metabolism and the 11β-HSD1-H6PDH pathway in regulating hypothalamic

  19. Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.

    PubMed

    van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

    2009-05-01

    Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

  20. Inactivation gating of Kv7.1 channels does not involve concerted cooperative subunit interactions.

    PubMed

    Meisel, Eshcar; Tobelaim, William; Dvir, Meidan; Haitin, Yoni; Peretz, Asher; Attali, Bernard

    2018-01-01

    Inactivation is an intrinsic property of numerous voltage-gated K + (Kv) channels and can occur by N-type or/and C-type mechanisms. N-type inactivation is a fast, voltage independent process, coupled to activation, with each inactivation particle of a tetrameric channel acting independently. In N-type inactivation, a single inactivation particle is necessary and sufficient to occlude the pore. C-type inactivation is a slower process, involving the outermost region of the pore and is mediated by a concerted, highly cooperative interaction between all four subunits. Inactivation of Kv7.1 channels does not exhibit the hallmarks of N- and C-type inactivation. Inactivation of WT Kv7.1 channels can be revealed by hooked tail currents that reflects the recovery from a fast and voltage-independent inactivation process. However, several Kv7.1 mutants such as the pore mutant L273F generate an additional voltage-dependent slow inactivation. The subunit interactions during this slow inactivation gating remain unexplored. The goal of the present study was to study the nature of subunit interactions along Kv7.1 inactivation gating, using concatenated tetrameric Kv7.1 channel and introducing sequentially into each of the four subunits the slow inactivating pore mutation L273F. Incorporating an incremental number of inactivating mutant subunits did not affect the inactivation kinetics but slowed down the recovery kinetics from inactivation. Results indicate that Kv7.1 inactivation gating is not compatible with a concerted cooperative process. Instead, adding an inactivating subunit L273F into the Kv7.1 tetramer incrementally stabilizes the inactivated state, which suggests that like for activation gating, Kv7.1 slow inactivation gating is not a concerted process.

  1. Mutation induction by heavy ions

    NASA Astrophysics Data System (ADS)

    Kiefer, J.; Stoll, U.; Schneider, E.

    1994-10-01

    Mutation induction by heavy ions is compared in yeast and mammalian cells. Since mutants can only be recovered in survivors the influence of inactivation cross sections has to be taken into account. It is shown that both the size of the sensitive cellular site as well as track structure play an important role. Another parameter which influences the probability of mutation induction is repair: Contrary to naive assumptions primary radiation damage does not directly lead to mutations but requires modification to reconstitute the genetic machinery so that mutants can survive. The molecular structure of mutations was analyzed after exposure to deuterons by amplification with the aid of polymerase chain reaction. The results-although preliminary-demonstrate that even with densely ionizing particles a large fraction does not carry big deletions which suggests that point mutations may also be induced by heavy ions.

  2. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.

    PubMed

    Esteller, M; Toyota, M; Sanchez-Cespedes, M; Capella, G; Peinado, M A; Watkins, D N; Issa, J P; Sidransky, D; Baylin, S B; Herman, J G

    2000-05-01

    O6-methylguanine DNA methyltransferase (MGMT) is a DNA repair protein that removes mutagenic and cytotoxic adducts from the O6 position of guanine. O6-methylguanine mispairs with thymine during replication, and if the adduct is not removed, this results in conversion from a guanine-cytosine pair to an adenine-thymine pair. In vitro assays show that MGMT expression avoids G to A mutations and MGMT transgenic mice are protected against G to A transitions at ras genes. We have recently demonstrated that the MGMT gene is silenced by promoter methylation in many human tumors, including colorectal carcinomas. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of K-ras mutations, we studied 244 colorectal tumor samples for MGMT promoter hypermethylation and K-ras mutational status. Our results show a clear association between the inactivation of MGMT by promoter hypermethylation and the appearance of G to A mutations at K-ras: 71% (36 of 51) of the tumors displaying this particular type of mutation had abnormal MGMT methylation, whereas only 32% (12 of 37) of those with other K-ras mutations not involving G to A transitions and 35% (55 of 156) of the tumors without K-ras mutations demonstrated MGMT methylation (P = 0.002). In addition, MGMT loss associated with hypermethylation was observed in the small adenomas, including those that do not yet contain K-ras mutations. Hypermethylation of other genes such as p16INK4a and p14ARF was not associated with either MGMT hypermethylation or K-ras mutation. Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to a particular genetic change in human cancer, specifically G to A transitions in the K-ras oncogene.

  3. Collagen Gly missense mutations: Effect of residue identity on collagen structure and integrin binding.

    PubMed

    Qiu, Yimin; Mekkat, Arya; Yu, Hongtao; Yigit, Sezin; Hamaia, Samir; Farndale, Richard W; Kaplan, David L; Lin, Yu-Shan; Brodsky, Barbara

    2018-05-11

    Gly missense mutations in type I collagen, which replace a conserved Gly in the repeating (Gly-Xaa-Yaa) n sequence with a larger residue, are known to cause Osteogenesis Imperfecta (OI). The clinical consequences of such mutations range from mild to lethal, with more serious clinical severity associated with larger Gly replacement residues. Here, we investigate the influence of the identity of the residue replacing Gly within and adjacent to the integrin binding 502 GFPGER 507 sequence on triple-helix structure, stability and integrin binding using a recombinant bacterial collagen system. Recombinant collagens were constructed with Gly substituted by Ala, Ser or Val at four positions within the integrin binding region. All constructs formed a stable triple-helix structure with a small decrease in melting temperature. Trypsin was used to probe local disruption of the triple helix, and Gly to Val replacements made the triple helix trypsin sensitive at three of the four sites. Any mutation at Gly505, eliminated integrin binding, while decreased integrin binding affinity was observed in the replacement of Gly residues at Gly502 following the order Val > Ser > Ala. Molecular dynamics simulations indicated that all Gly replacements led to transient disruption of triple-helix interchain hydrogen bonds in the region of the Gly replacement. These computational and experimental results lend insight into the complex molecular basis of the varying clinical severity of OI. Copyright © 2018. Published by Elsevier Inc.

  4. X-chromosomal inactivation directly influences the phenotypic manifestation of X-linked protoporphyria

    PubMed Central

    Brancaleoni, V.; Balwani, M.; Granata, F.; Graziadei, G.; Missineo, P.; Fiorentino, V.; Fustinoni, S.; Cappellini, M.D.; Naik, H.; Desnick, R.J.; Di Pierro, E.

    2015-01-01

    X-linked protoporphyria (XLP), a rare erythropoietic porphyria, results from terminal exon gain-of-function mutations in the ALAS2 gene causing increased ALAS2 activity and markedly increased erythrocyte protoporphyrin levels. Patients present with severe cutaneous photosensitivity and may develop liver dysfunction. XLP was originally reported as X-linked dominant with 100% penetrance in males and females. We characterized 11 heterozygous females from six unrelated XLP families and show markedly varying phenotypic and biochemical heterogeneity, reflecting the degree of X-chromsomal inactivation of the mutant gene. ALAS2 sequencing identified the specific mutation and confirmed heterozygosity among the females. Clinical history, plasma and erythrocyte protoporphyrin levels were determined. Methylation assays of the androgen receptor and zinc-finger MYM type 3 short tandem repeat polymorphisms estimated each heterozygotes X-chromosomal inactivation pattern. Heterozygotes with equal or increased skewing, favoring expression of the wild-type allele had no clinical symptoms and only slightly increased erythrocyte protoporphyrin concentrations and/or frequency of protoporphyrin-containing peripheral blood fluorocytes. When the wild-type allele was preferentially inactivated, heterozygous females manifested the disease phenotype and had both higher erythrocyte protoporphyrin levels and circulating fluorocytes. These findings confirm that the previous dominant classification of XLP is inappropriate and genetically misleading, as the disorder is more appropriately designated XLP. PMID:25615817

  5. K-ras Mutations as the Earliest Driving Force in a Subset of Colorectal Carcinomas

    PubMed Central

    MARGETIS, NIKOLAOS; KOULOUKOUSSA, MYRSINI; PAVLOU, KYRIAKI; VRAKAS, SPYRIDON; MARIOLIS-SAPSAKOS, THEODOROS

    2017-01-01

    K-ras oncogene is a key factor in colorectal cancer. Based on published and our data we propose that K-ras could be the oncogene responsible for the inactivation of the tumor-suppressor gene APC, currently considered as the initial step in colorectal tumorigenesis. K-ras fulfills the criteria of the oncogene-induced DNA damage model, as it can provoke well- established causes for inactivating tumor-suppressors, i.e. DNA double-strand breaks (causing allele deletion) and ROS production (responsible for point mutation). The model we propose is a variation of the currently existing model and hypothesizes that, in a subgroup of colorectal carcinomas, K-ras mutation may precede APC inactivation, representing the earliest driving force and, probably, an early biomarker of colorectal carcinogenesis. This observation is clinically useful, since it may modify the preventive colorectal cancer strategy, restricting numerically patients undergoing colonoscopies to those bearing K-ras mutation in their colorectum, either in benign polyps or the normal accompanying mucosa. PMID:28652417

  6. Slow Inactivation in Shaker K Channels Is Delayed by Intracellular Tetraethylammonium

    PubMed Central

    González-Pérez, Vivian; Neely, Alan; Tapia, Christian; González-Gutiérrez, Giovanni; Contreras, Gustavo; Orio, Patricio; Lagos, Verónica; Rojas, Guillermo; Estévez, Tania; Stack, Katherine; Naranjo, David

    2008-01-01

    provide a framework to explain why constitutively C-inactivated channels exhibit gating charge conversion, and why mutations at the internal exit of the pore, such as those associated to episodic ataxia type I in hKv1.1, cause severe changes in inactivation kinetics. PMID:19029372

  7. Reciprocal voltage sensor-to-pore coupling leads to potassium channel C-type inactivation

    PubMed Central

    Conti, Luca; Renhorn, Jakob; Gabrielsson, Anders; Turesson, Fredrik; Liin, Sara I; Lindahl, Erik; Elinder, Fredrik

    2016-01-01

    Voltage-gated potassium channels open at depolarized membrane voltages. A prolonged depolarization causes a rearrangement of the selectivity filter which terminates the conduction of ions – a process called slow or C-type inactivation. How structural rearrangements in the voltage-sensor domain (VSD) cause alteration in the selectivity filter, and vice versa, are not fully understood. We show that pulling the pore domain of the Shaker potassium channel towards the VSD by a Cd2+ bridge accelerates C-type inactivation. Molecular dynamics simulations show that such pulling widens the selectivity filter and disrupts the K+ coordination, a hallmark for C-type inactivation. An engineered Cd2+ bridge within the VSD also affect C-type inactivation. Conversely, a pore domain mutation affects VSD gating-charge movement. Finally, C-type inactivation is caused by the concerted action of distant amino acid residues in the pore domain. All together, these data suggest a reciprocal communication between the pore domain and the VSD in the extracellular portion of the channel. PMID:27278891

  8. A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

    PubMed Central

    2014-01-01

    Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

  9. Germline Mutation of INI1/SMARCB1 in Familial Schwannomatosis

    PubMed Central

    Hulsebos, Theo J. M.; Plomp, Astrid S.; Wolterman, Ruud A.; Robanus-Maandag, Els C.; Baas, Frank; Wesseling, Pieter

    2007-01-01

    Patients with schwannomatosis develop multiple schwannomas but no vestibular schwannomas diagnostic of neurofibromatosis type 2. We report an inactivating germline mutation in exon 1 of the tumor-suppressor gene INI1 in a father and daughter who both had schwannomatosis. Inactivation of the wild-type INI1 allele, by a second mutation in exon 5 or by clear loss, was found in two of four investigated schwannomas from these patients. All four schwannomas displayed complete loss of nuclear INI1 protein expression in part of the cells. Although the exact oncogenetic mechanism in these schwannomas remains to be elucidated, our findings suggest that INI1 is the predisposing gene in familial schwannomatosis. PMID:17357086

  10. Variable X-chromosome inactivation and enlargement of pericentral glutamine synthetase zones in the liver of heterozygous females with OTC deficiency.

    PubMed

    Musalkova, Dita; Sticova, Eva; Reboun, Martin; Sokolova, Jitka; Krijt, Jakub; Honzikova, Jitka; Gurka, Jiri; Neroldova, Magdalena; Honzik, Tomas; Zeman, Jiri; Jirsa, Milan; Dvorakova, Lenka; Hrebicek, Martin

    2018-06-01

    Ornithine transcarbamylase (OTC) deficiency is an X-linked disorder that causes recurrent and life-threatening episodes of hyperammonemia. The clinical picture in heterozygous females is highly diverse and derives from the genotype and the degree of inactivation of the mutated X chromosome in hepatocytes. Here, we describe molecular genetic, biochemical, and histopathological findings in the livers explanted from two female patients with late-onset OTC deficiency. Analysis of X-inactivation ratios by DNA methylation-based assays showed remarkable intra-organ variation ranging from 46:54 to 82:18 (average 70:30, n = 37), in favor of the active X chromosome carrying the mutation c.583G>C (p.G195R), in the first patient and from 75:25 to 90:10 (average 82:18, n = 20) in favor of the active X chromosome carrying the splicing mutation c.663+1G>A in the second patient. The X-inactivation ratios in liver samples correlated highly with the proportions of OTC-positive hepatocytes calculated from high-resolution image analyses of the immunohistochemically detected OTC in frozen sections that was performed on total area > 5 cm 2 . X-inactivation ratios in blood in both female patients corresponded to the lower limit of the liver values. Our data indicate that the proportion of about 20-30% of hepatocytes expressing the functional OTC protein is not sufficient to maintain metabolic stability. X-inactivation ratios assessed in liver biopsies taken from heterozygous females with X-linked disorders should not be considered representative of the whole liver.

  11. Thrombomodulin Mutations in Atypical Hemolytic–Uremic Syndrome

    PubMed Central

    Delvaeye, Mieke; Noris, Marina; De Vriese, Astrid; Esmon, Charles T.; Esmon, Naomi L.; Ferrell, Gary; Del-Favero, Jurgen; Plaisance, Stephane; Claes, Bart; Lambrechts, Diether; Zoja, Carla; Remuzzi, Giuseppe; Conway, Edward M.

    2012-01-01

    BACKGROUND The hemolytic–uremic syndrome consists of the triad of microangiopathic hemolytic anemia, thrombocytopenia, and renal failure. The common form of the syndrome is triggered by infection with Shiga toxin–producing bacteria and has a favorable outcome. The less common form of the syndrome, called atypical hemolytic–uremic syndrome, accounts for about 10% of cases, and patients with this form of the syndrome have a poor prognosis. Approximately half of the patients with atypical hemolytic–uremic syndrome have mutations in genes that regulate the complement system. Genetic factors in the remaining cases are unknown. We studied the role of thrombomodulin, an endothelial glycoprotein with anticoagulant, antiinflammatory, and cytoprotective properties, in atypical hemolytic–uremic syndrome. METHODS We sequenced the entire thrombomodulin gene (THBD) in 152 patients with atypical hemolytic–uremic syndrome and in 380 controls. Using purified proteins and cell-expression systems, we investigated whether thrombomodulin regulates the complement system, and we characterized the mechanisms. We evaluated the effects of thrombomodulin missense mutations associated with atypical hemolytic–uremic syndrome on complement activation by expressing thrombomodulin variants in cultured cells. RESULTS Of 152 patients with atypical hemolytic–uremic syndrome, 7 unrelated patients had six different heterozygous missense THBD mutations. In vitro, thrombomodulin binds to C3b and factor H (CFH) and negatively regulates complement by accelerating factor I–mediated inactivation of C3b in the presence of cofactors, CFH or C4b binding protein. By promoting activation of the plasma procarboxypeptidase B, thrombomodulin also accelerates the inactivation of anaphylatoxins C3a and C5a. Cultured cells expressing thrombomodulin variants associated with atypical hemolytic–uremic syndrome had diminished capacity to inactivate C3b and to activate procarboxypeptidase B and were

  12. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    PubMed

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  13. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

    PubMed

    Findeisen, Felix; Minor, Daniel L

    2009-03-01

    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  14. Disruption of the IS6-AID Linker Affects Voltage-gated Calcium Channel Inactivation and Facilitation

    PubMed Central

    Findeisen, Felix

    2009-01-01

    Two processes dominate voltage-gated calcium channel (CaV) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The CaVβ/CaVα1-I-II loop and Ca2+/calmodulin (CaM)/CaVα1–C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6–α-interaction domain (AID) linker provides a rigid connection between the pore and CaVβ/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate CaV1.2 (L-type) and CaV2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt CaVβ/I-II association sharply decelerate CDI and reduce a second Ca2+/CaM/CaVα1–C-terminal–mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, CaVβ and the IS6-AID linker, are essential for calcium-dependent modulation, and that both CaVβ-dependent and CaM-dependent components couple to the pore by a common mechanism requiring CaVβ and an intact IS6-AID linker. PMID:19237593

  15. Genetic Manipulation of Palmitoylethanolamide Production and Inactivation in Saccharomyces cerevisiae

    PubMed Central

    Muccioli, Giulio G.; Sia, Angela; Muchowski, Paul J.; Stella, Nephi

    2009-01-01

    Background Lipids can act as signaling molecules, activating intracellular and membrane-associated receptors to regulate physiological functions. To understand how a newly discovered signaling lipid functions, it is necessary to identify and characterize the enzymes involved in their production and inactivation. The signaling lipid N-palmitoylethanolamine (PEA) is known to activate intracellular and membrane-associated receptors and regulate physiological functions, but little is known about the enzymes involved in its production and inactivation. Principal Findings Here we show that Saccharomyces cerevisiae produce and inactivate PEA, suggesting that genetic manipulations of this lower eukaryote may be used to identify the enzymes involved in PEA metabolism. Accordingly, using single gene deletion mutants, we identified yeast genes that control PEA metabolism, including SPO14 (a yeast homologue of the mammalian phospholipase D) that controls PEA production and YJU3 (a yeast homologue of the mammalian monoacylglycerol lipase) that controls PEA inactivation. We also found that PEA metabolism is affected by heterologous expression of two mammalian proteins involved in neurodegenerative diseases, namely huntingtin and α-synuclein. Significance Together these findings show that forward and reverse genetics in S. cerevisiae can be used to identify proteins involved in PEA production and inactivation, and suggest that mutated proteins causing neurodegenerative diseases might affect the metabolism of this important signaling lipid. PMID:19529773

  16. Mutation of the regulatory phosphorylation site of tobacco nitrate reductase results in constitutive activation of the enzyme in vivo and nitrite accumulation.

    PubMed

    Lillo, Cathrine; Lea, Unni S; Leydecker, Marie-Thérèse; Meyer, Christian

    2003-09-01

    In wild-type Nicotiana plumbaginifolia and other higher plants, nitrate reductase (NR) is rapidly inactivated/activated in response to dark/light transitions. Inactivation of NR is believed to be caused by phosphorylation at a special conserved regulatory Ser residue, Ser 521, and interactions with divalent cations and inhibitory 14-3-3 proteins. A transgenic N. plumbaginifolia line (S(521)) was constructed where the Ser 521 had been changed by site-directed mutagenesis into Asp. This mutation resulted in complete abolishment of inactivation in response to light/dark transitions or other treatments known to inactivate NR. During prolonged darkness, NR in wild-type plants is in the inactivated form, whereas NR in the S(521) line is always in the active form. Differences in degradation rate between NR from S(521) and lines with non-mutated NR were not found. Kinetic constants like Km values for NADH and NO3(-) were not changed, but a slightly different pH profile was observed for mutated NR as opposed to non-mutated NR. Under optimal growth conditions, the phenotype of the S(521) plants was not different from the wild type (WT). However, when plants were irrigated with high nitrate concentration, 150 mM, the transgenic plants accumulated nitrite in darkness, and young leaves showed chlorosis.

  17. Charge immobilization of the voltage sensor in domain IV is independent of sodium current inactivation.

    PubMed

    Sheets, Michael F; Hanck, Dorothy A

    2005-02-15

    Recovery from fast inactivation in voltage-dependent Na+ channels is associated with a slow component in the time course of gating charge during repolarization (i.e. charge immobilization), which results from the slow movement of the S4 segments in domains III and IV (S4-DIII and S4-DIV). Previous studies have shown that the non-specific removal of fast inactivation by the proteolytic enzyme pronase eliminated charge immobilization, while the specific removal of fast inactivation (by intracellular MTSET modification of a cysteine substituted for the phenylalanine in the IFM motif, ICMMTSET, in the inactivation particle formed by the linker between domains III and IV) only reduced the amount of charge immobilization by nearly one-half. To investigate the molecular origin of the remaining slow component of charge immobilization we studied the human cardiac Na+ channel (hH1a) in which the outermost arginine in the S4-DIV, which contributes approximately 20% to total gating charge (Qmax), was mutated to a cysteine (R1C-DIV). Gating charge could be fully restored in R1C-DIV by exposure to extracellular MTSEA, a positively charged methanethiosulphonate reagent. The RIC-DIV mutation was combined with ICMMTSET to remove fast inactivation, and the gating currents of R1C-DIV-ICM(MTSET) were recorded before and after modification with MTSEAo. Prior to MTSEAo, the time course of the gating charge during repolarization (off-charge) was best described by a single fast time constant. After MTSEA, the off-charge had both fast and slow components, with the slow component accounting for nearly 35% of Qmax. These results demonstrate that the slow movement of the S4-DIV during repolarization is not dependent upon the normal binding of the inactivation particle.

  18. A novel mutation in FRMD7 causing X-linked idiopathic congenital nystagmus in a large family

    PubMed Central

    He, Xiang; Gu, Feng; Wang, Yujing; Yan, Jinting; Zhang, Meng; Huang, Shangzhi

    2008-01-01

    Purpose To identify the gene responsible for causing an X-linked idiopathic congenital nystagmus (XLICN) in a six-generation Chinese family. Methods Forty-nine members of an XLICN family were recruited and examined after obtaining informed consent. Affected male individuals were genotyped with microsatellite markers around the FRMD7 locus. Mutations were comprehensively screened by direct sequencing using gene specific primers. An X-inactivation pattern was investigated by X chromosome methylation analysis. Results The patients showed phenotypes consistent with XLICN. Genotype analysis showed that male affected individuals in the family shared a common haplotype with the selected markers. Sequencing FRMD7 revealed a G>T transversion (c.812G>T) in exon 9, which caused a conservative substitution of Cys to Phe at codon 271 (p.C271F). This mutation co-segregated with all affected individuals and was present in the obligate, non-penetrant female carriers. However, the mutation was not observed in unaffected familial males or 400 control males. Females with the mutant gene could be affected or carrier and they shared the same inactivated X chromosome harboring the mutation in blood cells, which showed there is no clear causal link between X-inactivation pattern and phenotype. Conclusions We identified a novel mutation in FRMD7 and confirmed the role of this mutation in the pathogenesis of X-linked congenital nystagmus. PMID:18246032

  19. 75 FR 6211 - Prospective Grant of Exclusive License: Purified Inactivated Dengue Tetravalent Vaccine...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-08

    ... Exclusive License: Purified Inactivated Dengue Tetravalent Vaccine Containing a Common 30 Nucleotide Deletion in the 3'-UTR of Dengue Types 1,2,3, and 4 AGENCY: National Institutes of Health, Public Health...., ``Development of Mutations Useful for Attenuating Dengue Viruses and Chimeric Dengue Viruses''-- European Patent...

  20. Sexually localized expression of pseudo-self compatibility (PSC) in Petunia X hybrida Hort : 2. Stylar inactivation.

    PubMed

    Dana, M N; Ascher, P D

    1986-01-01

    A previously identified S-linked stylar-inactivation PSC factor (Flaschenriem and Ascher 1979b) was studied for its location relative to S. Plants exhibiting complete stylar-inactivation PSC were those with higher multigenic PSC background level than plants with only S-linked partial stylar-inactivation PSC. A pollen-mediated pseudo-self compatibility (PMPSC) adjustment factor was offered as a device to focus on stylar-inactivation PSC by removing some male origin, multigenic PSC. The stylar inactivation factor was not tightly linked to S but affected expression of only the allele to which it was linked. A three part interacting association of genetic material governing self incompatibility (SI) is proposed. The parts of S are the SI identity gene, S-specific PSC genes and, finally, PSC genes which are not S-specific in action. The complete association is termed the SI-complex.

  1. Regulation of Na+ channel inactivation by the DIII and DIV voltage-sensing domains.

    PubMed

    Hsu, Eric J; Zhu, Wandi; Schubert, Angela R; Voelker, Taylor; Varga, Zoltan; Silva, Jonathan R

    2017-03-06

    Functional eukaryotic voltage-gated Na + (Na V ) channels comprise four domains (DI-DIV), each containing six membrane-spanning segments (S1-S6). Voltage sensing is accomplished by the first four membrane-spanning segments (S1-S4), which together form a voltage-sensing domain (VSD). A critical Na V channel gating process, inactivation, has previously been linked to activation of the VSDs in DIII and DIV. Here, we probe this interaction by using voltage-clamp fluorometry to observe VSD kinetics in the presence of mutations at locations that have been shown to impair Na V channel inactivation. These locations include the DIII-DIV linker, the DIII S4-S5 linker, and the DIV S4-S5 linker. Our results show that, within the 10-ms timeframe of fast inactivation, the DIV-VSD is the primary regulator of inactivation. However, after longer 100-ms pulses, the DIII-DIV linker slows DIII-VSD deactivation, and the rate of DIII deactivation correlates strongly with the rate of recovery from inactivation. Our results imply that, over the course of an action potential, DIV-VSDs regulate the onset of fast inactivation while DIII-VSDs determine its recovery. © 2017 Hsu et al.

  2. Arid1a Inactivation in an Apc and Pten-defective Mouse Ovarian Cancer Model Enhances Epithelial Differentiation and Prolongs Survival

    PubMed Central

    Zhai, Yali; Kuick, Rork; Tipton, Courtney; Wu, Rong; Sessine, Michael; Wang, Zhong; Baker, Suzanne J.; Fearon, Eric R.; Cho, Kathleen R.

    2015-01-01

    Inactivation of the ARID1A tumor suppressor gene is frequent in ovarian endometrioid (OEC) and clear cell carcinomas (OCCC), often in conjunction with mutations activating the PI3K/AKT and/or canonical Wnt signaling pathways. Prior work has shown that conditional bi-allelic inactivation of the Apc and Pten tumor suppressor genes in the mouse ovarian surface epithelium (OSE) promotes outgrowth of tumors that reflect the biological behavior and gene expression profiles of human OECs harboring comparable Wnt and PI3K/AKT pathway defects, though the mouse tumors are more poorly differentiated than their human tumor counterparts. We found that conditional inactivation of one or both Arid1a alleles in OSE concurrently with Apc and Pten inactivation unexpectedly prolonged survival of tumor-bearing mice and promoted striking epithelial differentiation of the cancer cells, resulting in morphological features akin to those in human OECs. Enhanced epithelial differentiation was linked to reduced expression of mesenchymal markers N-cadherin and vimentin, and increased expression of epithelial markers Crb3 and E-cadherin. Global gene expression profiling showed enrichment for genes associated with mesenchymal-to-epithelial transition in the Arid1a-deficient tumors. We also found that an activating (E545K) Pik3ca mutation, unlike Pten inactivation or Pik3ca H1047R mutation, cannot cooperate with Arid1a loss to promote ovarian cancer development in the mouse. Our results indicate the Arid1a tumor suppressor gene has a key role in regulating OEC differentiation, and paradoxically the mouse cancers with more initiating tumor suppressor gene defects had a less aggressive phenotype than cancers arising from fewer gene alterations. PMID:26279473

  3. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    PubMed

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  4. De Novo Mutation in the SCN5A Gene Associated with Brugada Syndrome.

    PubMed

    Wang, Lumin; Meng, Xiangyun; Yuchi, Zhiguang; Zhao, Zhenghang; Xu, Dehui; Fedida, David; Wang, Zhuren; Huang, Chen

    2015-01-01

    Brugada syndrome (BrS) is a genetically determined cardiac electrical disorder, characterized by typical electrocardiography (ECG) alterations, and it is an arrhythmogenic syndrome that may lead to sudden cardiac death. The most common genotype found among BrS patients is caused by mutations in the SCN5A gene, which lead to a loss of function of the cardiac sodium (Na(+)) channel (Nav1.5) by different mechanisms. The assay of confocal laser microscopy and western blot were used to identify the expression and location of L812Q at the cell surface. Characterization of Nav1.5 L812Q mutant Na(+) channels was text by patch-clamp recordings, and the PHYRE2 server was used to build a model for human Nav1.5 channel. Here, we report that a novel missense SCN5A mutation, L812Q, localized in the DII-S4 transmembrane region of the Nav1.5 channel protein, was identified in an index patient who showed a typical BrS type-1 ECG phenotype. The mutation was absent in the patient's parents and brother. Heterologous expression of the wild-type (WT) and L812Q mutant Nav1.5 channels in human embryonic kidney cells (HEK293 cells) reveals that the mutation results in a reduction of Na(+) current density as well as ∼20 mV hyperpolarizing shift of the voltage dependence of inactivation. The voltage dependence of activation and the time course for recovery from inactivation are not affected by the mutation. The hyperpolarizing shift of the voltage dependence of inactivation caused a reduction of the Na(+) window current as well. In addition, western blot and confocal laser microscopy imaging experiments showed that the mutation causes fewer channel to be expressed at the membrane than WT channel. A large proportion of the mutant channels are retained in the cytoplasm, probably in the endoplasmic reticulum. The decrease of channel expression, hyperpolarizing shift of voltage dependence of inactivation, and a decline of Na(+) window current caused by L812Q mutation lead to a reduction of Na

  5. Target enrichment and high-throughput sequencing of 80 ribosomal protein genes to identify mutations associated with Diamond-Blackfan anaemia.

    PubMed

    Gerrard, Gareth; Valgañón, Mikel; Foong, Hui En; Kasperaviciute, Dalia; Iskander, Deena; Game, Laurence; Müller, Michael; Aitman, Timothy J; Roberts, Irene; de la Fuente, Josu; Foroni, Letizia; Karadimitris, Anastasios

    2013-08-01

    Diamond-Blackfan anaemia (DBA) is caused by inactivating mutations in ribosomal protein (RP) genes, with mutations in 13 of the 80 RP genes accounting for 50-60% of cases. The remaining 40-50% cases may harbour mutations in one of the remaining RP genes, but the very low frequencies render conventional genetic screening as challenging. We, therefore, applied custom enrichment technology combined with high-throughput sequencing to screen all 80 RP genes. Using this approach, we identified and validated inactivating mutations in 15/17 (88%) DBA patients. Target enrichment combined with high-throughput sequencing is a robust and improved methodology for the genetic diagnosis of DBA. © 2013 John Wiley & Sons Ltd.

  6. Genetic characterization in symptomatic female DMD carriers: lack of relationship between X-inactivation, transcriptional DMD allele balancing and phenotype

    PubMed Central

    2012-01-01

    Background Although Duchenne and Becker muscular dystrophies, X-linked recessive myopathies, predominantly affect males, a clinically significant proportion of females manifesting symptoms have also been reported. They represent an heterogeneous group characterized by variable degrees of muscle weakness and/or cardiac involvement. Though preferential inactivation of the normal X chromosome has long been considered the principal mechanism behind disease manifestation in these females, supporting evidence is controversial. Methods Eighteen females showing a mosaic pattern of dystrophin expression on muscle biopsy were recruited and classified as symptomatic (7) or asymptomatic (11), based on the presence or absence of muscle weakness. The causative DMD gene mutations were identified in all cases, and the X-inactivation pattern was assessed in muscle DNA. Transcriptional analysis in muscles was performed in all females, and relative quantification of wild-type and mutated transcripts was also performed in 9 carriers. Dystrophin protein was quantified by immunoblotting in 2 females. Results The study highlighted a lack of relationship between dystrophic phenotype and X-inactivation pattern in females; skewed X-inactivation was found in 2 out of 6 symptomatic carriers and in 5 out of 11 asymptomatic carriers. All females were characterized by biallelic transcription, but no association was found between X-inactivation pattern and allele transcriptional balancing. Either a prevalence of wild-type transcript or equal proportions of wild-type and mutated RNAs was observed in both symptomatic and asymptomatic females. Moreover, very similar levels of total and wild-type transcripts were identified in the two groups of carriers. Conclusions This is the first study deeply exploring the DMD transcriptional behaviour in a cohort of female carriers. Notably, no relationship between X-inactivation pattern and transcriptional behaviour of DMD gene was observed, suggesting that the

  7. Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.

    Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

  8. Mutational signature analysis identifies MUTYH deficiency in colorectal cancers and adrenocortical carcinomas: Mutational signature associated with MUTYH deficiency in cancers

    DOE PAGES

    Pilati, Camilla; Shinde, Jayendra; Alexandrov, Ludmil B.; ...

    2017-03-29

    Germline alterations in DNA repair genes are implicated in cancer predisposition and can result in characteristic mutational signatures. However, specific mutational signatures associated with base excision repair (BER) defects remain to be characterized. Here, by analysing a series of colorectal cancers (CRCs) using exome sequencing, we identified a particular spectrum of somatic mutations characterized by an enrichment of C > A transversions in NpCpA or NpCpT contexts in three tumours from a MUTYH-associated polyposis (MAP) patient and in two cases harbouring pathogenic germline MUTYH mutations. In two series of adrenocortical carcinomas (ACCs), we identified four tumours with a similar signaturemore » also presenting germline MUTYH mutations. Altogether, these findings demonstrate that MUTYH inactivation results in a particular mutational signature, which may serve as a useful marker of BER-related genomic instability in new cancer types.« less

  9. Current Nomenclature of Pseudohypoparathyroidism: Inactivating Parathyroid Hormone/Parathyroid Hormone-Related Protein Signaling Disorder

    PubMed Central

    Turan, Serap

    2017-01-01

    Disorders related to parathyroid hormone (PTH) resistance and PTH signaling pathway impairment are historically classified under the term of pseudohypoparathyroidism (PHP). The disease was first described and named by Fuller Albright and colleagues in 1942. Albright hereditary osteodystrophy (AHO) is described as an associated clinical entity with PHP, characterized by brachydactyly, subcutaneous ossifications, round face, short stature and a stocky build. The classification of PHP is further divided into PHP-Ia, pseudo-PHP (pPHP), PHP-Ib, PHP-Ic and PHP-II according to the presence or absence of AHO, together with an in vivo response to exogenous PTH and the measurement of Gsα protein activity in peripheral erythrocyte membranes in vitro. However, PHP classification fails to differentiate all patients with different clinical and molecular findings for PHP subtypes and classification become more complicated with more recent molecular characterization and new forms having been identified. So far, new classifications have been established by the EuroPHP network to cover all disorders of the PTH receptor and its signaling pathway. Inactivating PTH/PTH-related protein signaling disorder (iPPSD) is the new name proposed for a group of these disorders and which can be further divided into subtypes - iPPSD1 to iPPSD6. These are termed, starting from PTH receptor inactivation mutation (Eiken and Blomstrand dysplasia) as iPPSD1, inactivating Gsα mutations (PHP-Ia, PHP-Ic and pPHP) as iPPSD2, loss of methylation of GNAS DMRs (PHP-Ib) as iPPSD3, PRKAR1A mutations (acrodysostosis type 1) as iPPSD4, PDE4D mutations (acrodysostosis type 2) as iPPSD5 and PDE3A mutations (autosomal dominant hypertension with brachydactyly) as iPPSD6. iPPSDx is reserved for unknown molecular defects and iPPSDn+1 for new molecular defects which are yet to be described. With these new classifications, the aim is to clarify the borders of each different subtype of disease and make the classification

  10. Current Nomenclature of Pseudohypoparathyroidism: Inactivating Parathyroid Hormone/Parathyroid Hormone-Related Protein Signaling Disorder.

    PubMed

    Turan, Serap

    2017-12-30

    Disorders related to parathyroid hormone (PTH) resistance and PTH signaling pathway impairment are historically classified under the term of pseudohypoparathyroidism (PHP). The disease was first described and named by Fuller Albright and colleagues in 1942. Albright hereditary osteodystrophy (AHO) is described as an associated clinical entity with PHP, characterized by brachydactyly, subcutaneous ossifications, round face, short stature and a stocky build. The classification of PHP is further divided into PHP-Ia, pseudo-PHP (pPHP), PHP-Ib, PHP-Ic and PHP-II according to the presence or absence of AHO, together with an in vivo response to exogenous PTH and the measurement of Gsα protein activity in peripheral erythrocyte membranes in vitro. However, PHP classification fails to differentiate all patients with different clinical and molecular findings for PHP subtypes and classification become more complicated with more recent molecular characterization and new forms having been identified. So far, new classifications have been established by the EuroPHP network to cover all disorders of the PTH receptor and its signaling pathway. Inactivating PTH/PTH-related protein signaling disorder (iPPSD) is the new name proposed for a group of these disorders and which can be further divided into subtypes - iPPSD1 to iPPSD6. These are termed, starting from PTH receptor inactivation mutation (Eiken and Blomstrand dysplasia) as iPPSD1, inactivating Gsα mutations (PHP-Ia, PHP-Ic and pPHP) as iPPSD2, loss of methylation of GNAS DMRs (PHP-Ib) as iPPSD3, PRKAR1A mutations (acrodysostosis type 1) as iPPSD4, PDE4D mutations (acrodysostosis type 2) as iPPSD5 and PDE3A mutations (autosomal dominant hypertension with brachydactyly) as iPPSD6. iPPSDx is reserved for unknown molecular defects and iPPSDn+1 for new molecular defects which are yet to be described. With these new classifications, the aim is to clarify the borders of each different subtype of disease and make the classification

  11. Co-Inactivation of GlnR and CodY Regulators Impacts Pneumococcal Cell Wall Physiology.

    PubMed

    Johnston, Calum; Bootsma, Hester J; Aldridge, Christine; Manuse, Sylvie; Gisch, Nicolas; Schwudke, Dominik; Hermans, Peter W M; Grangeasse, Christophe; Polard, Patrice; Vollmer, Waldemar; Claverys, Jean-Pierre

    2015-01-01

    CodY, a nutritional regulator highly conserved in low G+C Gram-positive bacteria, is essential in Streptococcus pneumoniae (the pneumococcus). A published codY mutant possessed suppressing mutations inactivating the fatC and amiC genes, respectively belonging to iron (Fat/Fec) and oligopeptide (Ami) ABC permease operons, which are directly repressed by CodY. Here we analyzed two additional published codY mutants to further explore the essentiality of CodY. We show that one, in which the regulator of glutamine/glutamate metabolism glnR had been inactivated by design, had only a suppressor in fecE (a gene in the fat/fec operon), while the other possessed both fecE and amiC mutations. Independent isolation of three different fat/fec suppressors thus establishes that reduction of iron import is crucial for survival without CodY. We refer to these as primary suppressors, while inactivation of ami, which is not essential for survival of codY mutants and acquired after initial fat/fec inactivation, can be regarded as a secondary suppressor. The availability of codY- ami+ cells allowed us to establish that CodY activates competence for genetic transformation indirectly, presumably by repressing ami which is known to antagonize competence. The glnR codY fecE mutant was then found to be only partially viable on solid medium and hypersensitive to peptidoglycan (PG) targeting agents such as the antibiotic cefotaxime and the muramidase lysozyme. While analysis of PG and teichoic acid composition uncovered no alteration in the glnR codY fecE mutant compared to wildtype, electron microscopy revealed altered ultrastructure of the cell wall in the mutant, establishing that co-inactivation of GlnR and CodY regulators impacts pneumococcal cell wall physiology. In light of rising levels of resistance to PG-targeting antibiotics of natural pneumococcal isolates, GlnR and CodY constitute potential alternative therapeutic targets to combat this debilitating pathogen, as co-inactivation

  12. Inactivation of Caliciviruses

    PubMed Central

    Nims, Raymond; Plavsic, Mark

    2013-01-01

    The Caliciviridae family of viruses contains clinically important human and animal pathogens, as well as vesivirus 2117, a known contaminant of biopharmaceutical manufacturing processes employing Chinese hamster cells. An extensive literature exists for inactivation of various animal caliciviruses, especially feline calicivirus and murine norovirus. The caliciviruses are susceptible to wet heat inactivation at temperatures in excess of 60 °C with contact times of 30 min or greater, to UV-C inactivation at fluence ≥30 mJ/cm2, to high pressure processing >200 MPa for >5 min at 4 °C, and to certain photodynamic inactivation approaches. The enteric caliciviruses (e.g.; noroviruses) display resistance to inactivation by low pH, while the non-enteric species (e.g.; feline calicivirus) are much more susceptible. The caliciviruses are inactivated by a variety of chemicals, including alcohols, oxidizing agents, aldehydes, and β-propiolactone. As with inactivation of viruses in general, inactivation of caliciviruses by the various approaches may be matrix-, temperature-, and/or contact time-dependent. The susceptibilities of the caliciviruses to the various physical and chemical inactivation approaches are generally similar to those displayed by other small, non-enveloped viruses, with the exception that the parvoviruses and circoviruses may require higher temperatures for inactivation, while these families appear to be more susceptible to UV-C inactivation than are the caliciviruses. PMID:24276023

  13. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    PubMed

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  14. Mechanism for acivicin inactivation of triad glutamine amidotransferases.

    PubMed

    Chittur, S V; Klem, T J; Shafer, C M; Davisson, V J

    2001-01-30

    Acivicin [(alphaS,5S)-alpha-amino-3-chloro-4,5-dihydro-5-isoxazoleacetic acid] was investigated as an inhibitor of the triad glutamine amidotransferases, IGP synthase and GMP synthetase. Nucleophilic substitution of the chlorine atom in acivicin results in the formation of an imine-thioether adduct at the active site cysteine. Cys 77 was identified as the site of modification in the heterodimeric IGPS from Escherichia coli (HisHF) by tryptic digest and FABMS. Distinctions in the glutaminase domains of IGPS from E. coli, the bifunctional protein from Saccharomyces cerevisiae (HIS7), and E. coli GMPS were revealed by the differential rates of inactivation. While the ammonia-dependent turnover was unaffected by acivicin, the glutamine-dependent reaction was inhibited with unit stoichiometry. In analogy to the conditional glutaminase activity seen in IGPS and GMPS, the rates of inactivation were accelerated > or =25-fold when a nucleotide substrate (or analogue) was present. The specificity (k(inact)/K(i)app) for acivicin is on the same order of magnitude as the natural substrate glutamine in all three enzymes. The (alphaS,5R) diastereomer of acivicin was tested under identical conditions as acivicin and showed little inhibitory effect on the enzymes indicating that acivicin binds in the glutamine reactive site in a specific conformation. The data indicate that acivicin undergoes a glutamine amidotransferase mechanism-based covalent bond formation in the presence of nucleotide substrates or products. Acivicin and its (alphaS,5R) diastereomer were modeled in the glutaminase active site of GMPS and CPS to confirm that the binding orientation of the dihydroisoxazole ring is identical in all three triad glutamine amidotransferases. Stabilization of the imine-thioether intermediate by the oxyanion hole in triad glutamine amidotransferases appears to confer the high degree of specificity for acivicin inhibition and relates to a common mechanism for inactivation.

  15. Catalytically Active Guanylyl Cyclase B Requires Endoplasmic Reticulum-mediated Glycosylation, and Mutations That Inhibit This Process Cause Dwarfism.

    PubMed

    Dickey, Deborah M; Edmund, Aaron B; Otto, Neil M; Chaffee, Thomas S; Robinson, Jerid W; Potter, Lincoln R

    2016-05-20

    C-type natriuretic peptide activation of guanylyl cyclase B (GC-B), also known as natriuretic peptide receptor B or NPR2, stimulates long bone growth, and missense mutations in GC-B cause dwarfism. Four such mutants (L658F, Y708C, R776W, and G959A) bound (125)I-C-type natriuretic peptide on the surface of cells but failed to synthesize cGMP in membrane GC assays. Immunofluorescence microscopy also indicated that the mutant receptors were on the cell surface. All mutant proteins were dephosphorylated and incompletely glycosylated, but dephosphorylation did not explain the inactivation because the mutations inactivated a "constitutively phosphorylated" enzyme. Tunicamycin inhibition of glycosylation in the endoplasmic reticulum or mutation of the Asn-24 glycosylation site decreased GC activity, but neither inhibition of glycosylation in the Golgi by N-acetylglucosaminyltransferase I gene inactivation nor PNGase F deglycosylation of fully processed GC-B reduced GC activity. We conclude that endoplasmic reticulum-mediated glycosylation is required for the formation of an active catalytic, but not ligand-binding domain, and that mutations that inhibit this process cause dwarfism. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels.

    PubMed

    Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron

    2013-08-01

    Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

  17. Domain model for Ca2(+)-inactivation of Ca2+ channels at low channel density.

    PubMed Central

    Sherman, A; Keizer, J; Rinzel, J

    1990-01-01

    The "shell" model for Ca2(+)-inactivation of Ca2+ channels is based on the accumulation of Ca2+ in a macroscopic shell beneath the plasma membrane. The shell is filled by Ca2+ entering through open channels, with the elevated Ca2+ concentration inactivating both open and closed channels at a rate determined by how fast the shell is filled. In cells with low channel density, the high concentration Ca2+ "shell" degenerates into a collection of nonoverlapping "domains" localized near open channels. These domains form rapidly when channels open and disappear rapidly when channels close. We use this idea to develop a "domain" model for Ca2(+)-inactivation of Ca2+ channels. In this model the kinetics of formation of an inactivated state resulting from Ca2+ binding to open channels determines the inactivation rate, a mechanism identical with that which explains single-channel recordings on rabbit-mesenteric artery Ca2+ channels (Huang Y., J. M. Quayle, J. F. Worley, N. B. Standen, and M. T. Nelson. 1989. Biophys. J. 56:1023-1028). We show that the model correctly predicts five important features of the whole-cell Ca2(+)-inactivation for mouse pancreatic beta-cells (Plants, T. D. 1988. J. Physiol. 404:731-747) and that Ca2(+)-inactivation has only minor effects on the bursting electrical activity of these cells. PMID:2174274

  18. Drosophila QVR/SSS modulates the activation and C-type inactivation kinetics of Shaker K+ channels

    PubMed Central

    Dean, Terry; Xu, Rong; Joiner, William; Sehgal, Amita; Hoshi, Toshinori

    2011-01-01

    The quiver/sleepless (qvr/sss) gene encodes a small, glycosylphosphatidylinositol-anchored protein that plays a critical role in the regulation of sleep in Drosophila. Loss-of-function mutations in qvr/sss severely suppress sleep and effect multiple changes in in situ Shaker K+ currents, including decreased magnitude, slower time-to-peak, and cumulative inactivation. Recently, we demonstrated that SLEEPLESS (SSS) protein modulates Shaker channel activity, possibly through a direct interaction at the plasma membrane. We show here that SSS accelerates the activation of heterologously expressed Shaker channels with no effect on deactivation or fast N-type inactivation. Furthermore, this SSS-induced acceleration is sensitive to the pharmacological disruption of lipid rafts and sufficiently accounts for the slower time-to-peak of in situ Shaker currents seen in qvr/sss mutants. We also find that SSS decreases the rate of C-type inactivation of heterologously expressed Shaker channels, providing a potential mechanism for the cumulative inactivation phenotype induced by qvr/sss loss of function mutations. Kinetic modeling based on the in vitro results suggests that the SSS-dependent regulation of channel kinetics accounts for nearly 40% of the decrease in Shaker current magnitude in flies lacking SSS. Sleep duration in qvr/sss null mutants is restored to normal by a qvr/sss transgene that fully rescues the Shaker kinetic phenotypes but only partially rescues the decrease in current magnitude. Together, these results suggest that the role of SSS in the regulation of sleep in Drosophila correlates more strongly with the effects of SSS on Shaker kinetics than current magnitude. PMID:21813698

  19. Drosophila QVR/SSS modulates the activation and C-type inactivation kinetics of Shaker K(+) channels.

    PubMed

    Dean, Terry; Xu, Rong; Joiner, William; Sehgal, Amita; Hoshi, Toshinori

    2011-08-03

    The quiver/sleepless (qvr/sss) gene encodes a small, glycosylphosphatidylinositol-anchored protein that plays a critical role in the regulation of sleep in Drosophila. Loss-of-function mutations in qvr/sss severely suppress sleep and effect multiple changes in in situ Shaker K(+) currents, including decreased magnitude, slower time-to-peak, and cumulative inactivation. Recently, we demonstrated that SLEEPLESS (SSS) protein modulates Shaker channel activity, possibly through a direct interaction at the plasma membrane. We show here that SSS accelerates the activation of heterologously expressed Shaker channels with no effect on deactivation or fast N-type inactivation. Furthermore, this SSS-induced acceleration is sensitive to the pharmacological disruption of lipid rafts and sufficiently accounts for the slower time-to-peak of in situ Shaker currents seen in qvr/sss mutants. We also find that SSS decreases the rate of C-type inactivation of heterologously expressed Shaker channels, providing a potential mechanism for the cumulative inactivation phenotype induced by qvr/sss loss-of-function mutations. Kinetic modeling based on the in vitro results suggests that the SSS-dependent regulation of channel kinetics accounts for nearly 40% of the decrease in Shaker current magnitude in flies lacking SSS. Sleep duration in qvr/sss-null mutants is restored to normal by a qvr/sss transgene that fully rescues the Shaker kinetic phenotypes but only partially rescues the decrease in current magnitude. Together, these results suggest that the role of SSS in the regulation of sleep in Drosophila correlates more strongly with the effects of SSS on Shaker kinetics than current magnitude.

  20. Histone demethylase JARID1C inactivation triggers genomic instability in sporadic renal cancer

    PubMed Central

    Rondinelli, Beatrice; Rosano, Dalia; Antonini, Elena; Frenquelli, Michela; Montanini, Laura; Huang, DaChuan; Segalla, Simona; Yoshihara, Kosuke; Amin, Samir B.; Lazarevic, Dejan; The, Bin Tean; Verhaak, Roel G.W.; Futreal, P. Andrew; Di Croce, Luciano; Chin, Lynda; Cittaro, Davide; Tonon, Giovanni

    2015-01-01

    Mutations in genes encoding chromatin-remodeling proteins are often identified in a variety of cancers. For example, the histone demethylase JARID1C is frequently inactivated in patients with clear cell renal cell carcinoma (ccRCC); however, it is largely unknown how JARID1C dysfunction promotes cancer. Here, we determined that JARID1C binds broadly to chromatin domains characterized by the trimethylation of lysine 9 (H3K9me3), which is a histone mark enriched in heterochromatin. Moreover, we found that JARID1C localizes on heterochromatin, is required for heterochromatin replication, and forms a complex with established players of heterochromatin assembly, including SUV39H1 and HP1α, as well as with proteins not previously associated with heterochromatin assembly, such as the cullin 4 (CUL4) complex adaptor protein DDB1. Transcription on heterochromatin is tightly suppressed to safeguard the genome, and in ccRCC cells, JARID1C inactivation led to the unrestrained expression of heterochromatic noncoding RNAs (ncRNAs) that in turn triggered genomic instability. Moreover, ccRCC patients harboring JARID1C mutations exhibited aberrant ncRNA expression and increased genomic rearrangements compared with ccRCC patients with tumors endowed with other genetic lesions. Together, these data suggest that inactivation of JARID1C in renal cancer leads to heterochromatin disruption, genomic rearrangement, and aggressive ccRCCs. Moreover, our results shed light on a mechanism that underlies genomic instability in sporadic cancers. PMID:26551685

  1. Detection of new paternal dystrophin gene mutations in isolated cases of dystrophinopathy in females

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pegoraro, E.; Wessel, H.B.; Schwartz, L.

    1994-06-01

    Duchenne muscular dystrophy is one of the most common lethal monogenic disorders and is caused by dystrophin deficiency. The disease is transmitted as an X-linked recessive trait; however, recent biochemical and clinical studies have shown that many girls and women with a primary myopathy have an underlying dystrophinopathy, despite a negative family history for Duchenne dystrophy. These isolated female dystrophinopathy patients carried ambiguous diagnoses with presumed autosomal recessive inheritance (limb-girdle muscular dystrophy) prior to biochemical detection of dystrophin abnormalities in their muscle biopsy. It has been assumed that these female dystrophinopathy patients are heterozygous carries who show preferential inactivation ofmore » the X chromosome harboring the normal dystrophin gene, although this has been shown for only a few X:autosome translocations and for two cases of discordant monozygotic twin female carriers. Here the authors study X-inactivation patterns of 13 female dystrophinopathy patients - 10 isolated cases and 3 cases with a positive family history for Duchenne dystrophy in males. They show that all cases have skewed X-inactivation patterns in peripheral blood DNA. Of the nine isolated cases informative in the assay, eight showed inheritance of the dystrophin gene mutation from the paternal germ line. Only a single case showed maternal inheritance. The 10-fold higher incidence of paternal transmission of dystrophin gene mutations in these cases is at 30-fold variance with Bayesian predictions and gene mutation rates. Thus, the results suggest some mechanistic interaction between new dystrophin gene mutations, paternal inheritance, and skewed X inactivation. The results provide both empirical risk data and a molecular diagnostic test method, which permit genetic counseling and prenatal diagnosis of this new category of patients. 58 refs., 7 figs., 2 tabs.« less

  2. Mechanistic Basis for Type 2 Long QT Syndrome Caused by KCNH2 Mutations that Disrupt Conserved Arginine Residue in the Voltage Sensor

    PubMed Central

    McBride, Christie M.; Smith, Ashley M.; Smith, Jennifer L.; Reloj, Allison R.; Velasco, Ellyn J.; Powell, Jonathan; Elayi, Claude S.; Bartos, Daniel C.; Burgess, Don E.

    2013-01-01

    KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (IKr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing IKr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (IKv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients’ genotypes) mostly corrected the changes in IKv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing IKr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease IKr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient. PMID:23546015

  3. Modeling of Single Noninactivating Na+ Channels: Evidence for Two Open and Several Fast Inactivated States

    PubMed Central

    The, Yu-Kai; Fernandes, Jacqueline; Popa, M. Oana; Alekov, Alexi K.; Timmer, Jens; Lerche, Holger

    2006-01-01

    Voltage-gated Na+ channels play a fundamental role in the excitability of nerve and muscle cells. Defects in fast Na+ channel inactivation can cause hereditary muscle diseases with hyper- or hypoexcitability of the sarcolemma. To explore the kinetics and gating mechanisms of noninactivating muscle Na+ channels on a molecular level, we analyzed single channel currents from wild-type and five mutant Na+ channels. The mutations were localized in different protein regions which have been previously shown to be important for fast inactivation (D3-D4-linker, D3/S4-S5, D4/S4-S5, D4/S6) and exhibited distinct grades of defective fast inactivation with varying levels of persistent Na+ currents caused by late channel reopenings. Different gating schemes were fitted to the data using hidden Markov models with a correction for time interval omission and compared statistically. For all investigated channels including the wild-type, two open states were necessary to describe our data. Whereas one inactivated state was sufficient to fit the single channel behavior of wild-type channels, modeling the mutants with impaired fast inactivation revealed evidence for several inactivated states. We propose a single gating scheme with two open and three inactivated states to describe the behavior of all five examined mutants. This scheme provides a biological interpretation of the collected data, based on previous investigations in voltage-gated Na+ and K+ channels. PMID:16513781

  4. The thyrotropin receptor mutation database: update 2003.

    PubMed

    Führer, Dagmar; Lachmund, Peter; Nebel, Istvan-Tibor; Paschke, Ralf

    2003-12-01

    In 1999 we have created a TSHR mutation database compiling TSHR mutations with their basic characteristics and associated clinical conditions (www.uni-leipzig.de/innere/tshr). Since then, more than 2887 users from 36 countries have logged into the TSHR mutation database and have contributed several valuable suggestions for further improvement of the database. We now present an updated and extended version of the TSHR database to which several novel features have been introduced: 1. detailed functional characteristics on all 65 mutations (43 activating and 22 inactivating mutations) reported to date, 2. 40 pedigrees with detailed information on molecular aspects, clinical courses and treatment options in patients with gain-of-function and loss-of-function germline TSHR mutations, 3. a first compilation of site-directed mutagenesis studies, 4. references with Medline links, 5. a user friendly search tool for specific database searches, user-specific database output and 6. an administrator tool for the submission of novel TSHR mutations. The TSHR mutation database is installed as one of the locus specific HUGO mutation databases. It is listed under index TSHR 603372 (http://ariel.ucs.unimelb.edu.au/~cotton/glsdbq.htm) and can be accessed via www.uni-leipzig.de/innere/tshr.

  5. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx

    PubMed Central

    Suárez, Gabriel A.; Renda, Brian A.; Dasgupta, Aurko

    2017-01-01

    ABSTRACT The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase (dinP) and a DNA damage response regulator (umuDAb [the umuD gene of A. baylyi]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves

  6. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx.

    PubMed

    Suárez, Gabriel A; Renda, Brian A; Dasgupta, Aurko; Barrick, Jeffrey E

    2017-09-01

    The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS 1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS 1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS 1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase ( dinP ) and a DNA damage response regulator ( umuD Ab [the umuD gene of A. baylyi ]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves

  7. Prevalence of deleterious ATM germline mutations in gastric cancer patients.

    PubMed

    Huang, Dong-Sheng; Tao, Hou-Quan; He, Xu-Jun; Long, Ming; Yu, Sheng; Xia, Ying-Jie; Wei, Zhang; Xiong, Zikai; Jones, Sian; He, Yiping; Yan, Hai; Wang, Xiaoyue

    2015-12-01

    Besides CDH1, few hereditary gastric cancer predisposition genes have been previously reported. In this study, we discovered two germline ATM mutations (p.Y1203fs and p.N1223S) in a Chinese family with a history of gastric cancer by screening 83 cancer susceptibility genes. Using a published exome sequencing dataset, we found deleterious germline mutations of ATM in 2.7% of 335 gastric cancer patients of different ethnic origins. The frequency of deleterious ATM mutations in gastric cancer patients is significantly higher than that in general population (p=0.0000435), suggesting an association of ATM mutations with gastric cancer predisposition. We also observed biallelic inactivation of ATM in tumors of two gastric cancer patients. Further evaluation of ATM mutations in hereditary gastric cancer will facilitate genetic testing and risk assessment.

  8. Modulation of slow inactivation in human cardiac Kv1.5 channels by extra- and intracellular permeant cations

    PubMed Central

    Fedida, David; Maruoka, Neil D; Lin, Shunping

    1999-01-01

    The properties and regulation of slow inactivation by intracellular and extracellular cations in the human heart K+ channel hKv1.5 have been investigated. Extensive NH2- and COOH-terminal deletions outside the central core of transmembrane domains did not affect the degree of inactivation. The voltage dependence of steady-state inactivation curves of hKv1.5 channels was unchanged in Rb+ and Cs+, compared with K+, but biexponential inactivation over 10 s was reduced from ∼100% of peak current in Na+ to ∼65% in K+, ∼50% in Rb+ and ∼30% in Cs+. This occurred as a result of a decrease in both fast and slow components of inactivation, with little change in inactivation time constants. Changes in extracellular cation species and concentration (5-300 mM) had only small effects on the rates of inactivation and recovery from inactivation (τrecovery∼1 s). Mutation of residues at a putative regulatory site at R487 in the outer pore mouth did not affect slow inactivation or recovery from inactivation of hKv1.5, although sensitivity to extracellular TEA was conferred. Symmetrical reduction of both intra- and extracellular cation concentrations accelerated and augmented both components of inactivation of K+ (Kd = 34.7 mM) and Cs+ (Kd = 20.5 mM) currents. These effects could be quantitatively accounted for by unilateral reduction of intracellular K+ (Ki+) (Kd = 43.4 mM) or Csi+ with constant 135 mM external ion concentrations. We conclude that inactivation and recovery from inactivation in hKv1.5 were not typically C-type in nature. However, the ion species dependence of inactivation was still closely coupled to ion permeation through the pore. Intracellular ion modulatory actions were more potent than extracellular actions, although still of relatively low affinity. These results suggest the presence of ion binding sites capable of regulating inactivation located on both intracellular and extracellular sides of the pore selectivity filter. PMID:10050000

  9. A mutational signature in gastric cancer suggests therapeutic strategies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, Ludmil B.; Nik-Zainal, Serena; Siu, Hoi Cheong

    Targeting defects in the DNA repair machinery of neoplastic cells, for example, those due to inactivating BRCA1 and/or BRCA2 mutations, has been used for developing new therapies in certain types of breast, ovarian and pancreatic cancers. Recently, a mutational signature was associated with failure of double-strand DNA break repair by homologous recombination based on its high mutational burden in samples harbouring BRCA1 or BRCA2 mutations. In pancreatic cancer, all responders to platinum therapy exhibit this mutational signature including a sample that lacked any defects in BRCA1 or BRCA2. Here, we examine 10,250 cancer genomes across 36 types of cancer andmore » demonstrate that, in addition to breast, ovarian and pancreatic cancers, gastric cancer is another cancer type that exhibits this mutational signature. Furthermore, our results suggest that 7–12% of gastric cancers have defective double-strand DNA break repair by homologous recombination and may benefit from either platinum therapy or PARP inhibitors.« less

  10. A mutational signature in gastric cancer suggests therapeutic strategies

    DOE PAGES

    Alexandrov, Ludmil B.; Nik-Zainal, Serena; Siu, Hoi Cheong; ...

    2015-10-29

    Targeting defects in the DNA repair machinery of neoplastic cells, for example, those due to inactivating BRCA1 and/or BRCA2 mutations, has been used for developing new therapies in certain types of breast, ovarian and pancreatic cancers. Recently, a mutational signature was associated with failure of double-strand DNA break repair by homologous recombination based on its high mutational burden in samples harbouring BRCA1 or BRCA2 mutations. In pancreatic cancer, all responders to platinum therapy exhibit this mutational signature including a sample that lacked any defects in BRCA1 or BRCA2. Here, we examine 10,250 cancer genomes across 36 types of cancer andmore » demonstrate that, in addition to breast, ovarian and pancreatic cancers, gastric cancer is another cancer type that exhibits this mutational signature. Furthermore, our results suggest that 7–12% of gastric cancers have defective double-strand DNA break repair by homologous recombination and may benefit from either platinum therapy or PARP inhibitors.« less

  11. Germline BAP1 mutations predispose to malignant mesothelioma

    PubMed Central

    Testa, Joseph R.; Cheung, Mitchell; Pei, Jianming; Below, Jennifer E.; Tan, Yinfei; Sementino, Eleonora; Cox, Nancy J.; Dogan, A. Umran; Pass, Harvey I.; Trusa, Sandra; Hesdorffer, Mary; Nasu, Masaki; Powers, Amy; Rivera, Zeyana; Comertpay, Sabahattin; Tanji, Mika; Gaudino, Giovanni; Yang, Haining; Carbone, Michele

    2011-01-01

    Because only a small fraction of asbestos-exposed individuals develop malignant mesothelioma1, and because mesothelioma clustering is observed in some families1, we searched for genetic predisposing factors. We discovered germline mutations in BAP1 (BRCA1-associated protein 1) in two families with a high incidence of mesothelioma. Somatic alterations affecting BAP1 were observed in familial mesotheliomas, indicating biallelic inactivation. Besides mesothelioma, some BAP1 mutation carriers developed uveal melanoma. Germline BAP1 mutations were also found in two of 26 sporadic mesotheliomas: both patients with mutant BAP1 were previously diagnosed with uveal melanoma. Truncating mutations and aberrant BAP1 expression were common in sporadic mesotheliomas without germline mutations. These results reveal a BAP1-related cancer syndrome characterized by mesothelioma and uveal melanoma. We hypothesize that other cancers may also be involved, and that mesothelioma predominates upon asbestos exposure. These findings will help identify individuals at high risk of mesothelioma who could be targeted for early intervention. PMID:21874000

  12. S1-S3 counter charges in the voltage sensor module of a mammalian sodium channel regulate fast inactivation.

    PubMed

    Groome, James R; Winston, Vern

    2013-05-01

    The movement of positively charged S4 segments through the electric field drives the voltage-dependent gating of ion channels. Studies of prokaryotic sodium channels provide a mechanistic view of activation facilitated by electrostatic interactions of negatively charged residues in S1 and S2 segments, with positive counterparts in the S4 segment. In mammalian sodium channels, S4 segments promote domain-specific functions that include activation and several forms of inactivation. We tested the idea that S1-S3 countercharges regulate eukaryotic sodium channel functions, including fast inactivation. Using structural data provided by bacterial channels, we constructed homology models of the S1-S4 voltage sensor module (VSM) for each domain of the mammalian skeletal muscle sodium channel hNaV1.4. These show that side chains of putative countercharges in hNaV1.4 are oriented toward the positive charge complement of S4. We used mutagenesis to define the roles of conserved residues in the extracellular negative charge cluster (ENC), hydrophobic charge region (HCR), and intracellular negative charge cluster (INC). Activation was inhibited with charge-reversing VSM mutations in domains I-III. Charge reversal of ENC residues in domains III (E1051R, D1069K) and IV (E1373K, N1389K) destabilized fast inactivation by decreasing its probability, slowing entry, and accelerating recovery. Several INC mutations increased inactivation from closed states and slowed recovery. Our results extend the functional characterization of VSM countercharges to fast inactivation, and support the premise that these residues play a critical role in domain-specific gating transitions for a mammalian sodium channel.

  13. PTT analysis of polyps from FAP patients reveals a great majority of APC truncating mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luijt, R.B. van der; Khan, P.M.; Tops, C.M.J.

    The adenomatous polyposis coli (APC) gene plays an important role in colorectal carcinogenesis. Germline APC mutations are associated with familial adenomatous polyposis (FAP), an autosomal dominantly inherited predisposition to colorectal cancer, characterized by the development of numerous adenomatous polyps in the large intestine. In order to investigate whether somatic inactivation of the remaining APC allele is necessary for adenoma formation, we collected multiple adenomatous polyps from individual FAP patients and investigated the presence of somatic mutations in the APC gene. The analysis of somatic APC mutations in these tumor samples was performed using a rapid and sensitive assay, called themore » protein truncation test (PTT). Chain-terminating somatic APC mutations were detected in the great majority of the tumor samples investigated. As expected, these mutations were mainly located in the mutation cluster region (MCR) in exon 15. Our results confirm that somatic mutation of the second APC allele is required for adenoma formation in FAP. Interestingly, in the polyps investigated in our study, the second APC allele is somatically inactivated through point mutation leading to a stop codon rather than by loss of heterozygosity. The observation that somatic second hits in APC are required for tumor development in FAP is in apparent accordance with the Knudson hypothesis for classical tumor suppressor genes. However, it is yet unknown whether chain-terminating APC mutations lead to a truncated protein exerting a dominant-negative effect or whether these mutations result in a null allele. Further investigation of this important issue will hopefully provide a better understanding of the mechanism of action of the mutated APC alleles in colorectal carcinogenesis.« less

  14. Flash Inactivation of Oxygen Evolution

    PubMed Central

    Frasch, Wayne D.; Cheniae, George M.

    1980-01-01

    Brief saturating light flashes were used to probe the mechanism of inactivation of O2 evolution by Tris in chloroplasts. Maximum inactivation with a single flash and an oscillation with period of four on subsequent flashes was observed. Analyses of the oscillations suggested that only the charge-collecting O2-evolving catalyst of photosystem II (S2-state) was a target of inactivation by Tris. This conclusion was supported by the following observations: (a) hydroxylamine preequilibration caused a three-flash delay in the inactivation pattern; (b) the lifetimes of the Tris-inactivable and S2-states were similar; and (c) reagents accelerating S2 deactivation decreased the lifetime of the inactivable state. Inactivation proved to be moderated by F, the precursor of Signal IIs, as shown by a one flash delay with chloroplasts having high abundance of F. Evidence was obtained for cooperativity effects in inactivation and NH3 was shown to be a competitive inhibitor of the Tris-induced inactivation. S2-dependent inactivation was inhibited by glutaraldehyde fixation of chloroplasts, possibly suggesting that inactivation proceeds via conformational changes of the S2-state. PMID:16661270

  15. Mutational Analysis of Cell Types in Tuberous Sclerosis Complex (TSC)

    DTIC Science & Technology

    2009-01-01

    from mutations in the TSC1 or TSC2 genes that is associated with epilepsy, cognitive disability, and autism . TSC1/TSC2 gene mutations lead to...gene inactivation and leads to activation of the mTOR cascade as evidenced by phosphorylation of ribosomal S6 protein (P-S6). We demonstrate that...phosphorylation of the ribosomal S6 protein (phospho-S6 or P-S6), a marker for enhanced mTOR signaling. We find P-S6 expression in cortex as well as

  16. Inactivating mutations in ESCO2 cause SC phocomelia and Roberts syndrome: no phenotype-genotype correlation.

    PubMed

    Schüle, Birgitt; Oviedo, Angelica; Johnston, Kathreen; Pai, Shashidhar; Francke, Uta

    2005-12-01

    The rare, autosomal recessive Roberts syndrome (RBS) is characterized by tetraphocomelia, profound growth deficiency of prenatal onset, craniofacial anomalies, microcephaly, and mental deficiency. SC phocomelia (SC) has a milder phenotype, with a lesser degree of limb reduction and with survival to adulthood. Since heterochromatin repulsion (HR) is characteristic for both disorders and is not complemented in somatic-cell hybrids, it has been hypothesized that the disorders are allelic. Recently, mutations in ESCO2 (establishment of cohesion 1 homolog 2) on 8p21.1 have been reported in RBS. To determine whether ESCO2 mutations are also responsible for SC, we studied three families with SC and two families in which variable degrees of limb and craniofacial abnormalities, detected by fetal ultrasound, led to pregnancy terminations. All cases were positive for HR. We identified seven novel mutations in exons 3-8 of ESCO2. In two families, affected individuals were homozygous--for a 5-nucleotide deletion in one family and a splice-site mutation in the other. In three nonconsanguineous families, probands were compound heterozygous for a single-nucleotide insertion or deletion, a nonsense mutation, or a splice-site mutation. Abnormal splice products were characterized at the RNA level. Since only protein-truncating mutations were identified, regardless of clinical severity, we conclude that genotype does not predict phenotype. Having established that RBS and SC are caused by mutations in the same gene, we delineated the clinical phenotype of the tetraphocomelia spectrum that is associated with HR and ESCO2 mutations and differentiated it from other types of phocomelia that are negative for HR.

  17. Inactivating Mutations in ESCO2 Cause SC Phocomelia and Roberts Syndrome: No Phenotype-Genotype Correlation

    PubMed Central

    Schüle, Birgitt; Oviedo, Angelica; Johnston, Kathreen; Pai, Shashidhar; Francke, Uta

    2005-01-01

    The rare, autosomal recessive Roberts syndrome (RBS) is characterized by tetraphocomelia, profound growth deficiency of prenatal onset, craniofacial anomalies, microcephaly, and mental deficiency. SC phocomelia (SC) has a milder phenotype, with a lesser degree of limb reduction and with survival to adulthood. Since heterochromatin repulsion (HR) is characteristic for both disorders and is not complemented in somatic-cell hybrids, it has been hypothesized that the disorders are allelic. Recently, mutations in ESCO2 (establishment of cohesion 1 homolog 2) on 8p21.1 have been reported in RBS. To determine whether ESCO2 mutations are also responsible for SC, we studied three families with SC and two families in which variable degrees of limb and craniofacial abnormalities, detected by fetal ultrasound, led to pregnancy terminations. All cases were positive for HR. We identified seven novel mutations in exons 3–8 of ESCO2. In two families, affected individuals were homozygous—for a 5-nucleotide deletion in one family and a splice-site mutation in the other. In three nonconsanguineous families, probands were compound heterozygous for a single-nucleotide insertion or deletion, a nonsense mutation, or a splice-site mutation. Abnormal splice products were characterized at the RNA level. Since only protein-truncating mutations were identified, regardless of clinical severity, we conclude that genotype does not predict phenotype. Having established that RBS and SC are caused by mutations in the same gene, we delineated the clinical phenotype of the tetraphocomelia spectrum that is associated with HR and ESCO2 mutations and differentiated it from other types of phocomelia that are negative for HR. PMID:16380922

  18. FAST TRACK COMMUNICATION: Selective inactivation of micro-organisms with near-infrared femtosecond laser pulses

    NASA Astrophysics Data System (ADS)

    Tsen, K. T.; Tsen, Shaw-Wei D.; Sankey, Otto F.; Kiang, Juliann G.

    2007-11-01

    We demonstrate an unconventional and revolutionary method for selective inactivation of micro-organisms by using near-infrared femtosecond laser pulses. We show that if the wavelength and pulse width of the excitation femtosecond laser are appropriately selected, there exists a window in power density that enables us to achieve selective inactivation of target viruses and bacteria without causing cytotoxicity in mammalian cells. This strategy targets the mechanical (vibrational) properties of micro-organisms, and thus its antimicrobial efficacy is likely unaffected by genetic mutation in the micro-organisms. Such a method may be effective against a wide variety of drug resistant micro-organisms and has broad implications in disinfection as well as in the development of novel treatments for viral and bacterial pathogens.

  19. Mechanistic basis for type 2 long QT syndrome caused by KCNH2 mutations that disrupt conserved arginine residues in the voltage sensor.

    PubMed

    McBride, Christie M; Smith, Ashley M; Smith, Jennifer L; Reloj, Allison R; Velasco, Ellyn J; Powell, Jonathan; Elayi, Claude S; Bartos, Daniel C; Burgess, Don E; Delisle, Brian P

    2013-05-01

    KCNH2 encodes the Kv11.1 channel, which conducts the rapidly activating delayed rectifier K+ current (I Kr) in the heart. KCNH2 mutations cause type 2 long QT syndrome (LQT2), which increases the risk for life-threatening ventricular arrhythmias. LQT2 mutations are predicted to prolong the cardiac action potential (AP) by reducing I Kr during repolarization. Kv11.1 contains several conserved basic amino acids in the fourth transmembrane segment (S4) of the voltage sensor that are important for normal channel trafficking and gating. This study sought to determine the mechanism(s) by which LQT2 mutations at conserved arginine residues in S4 (R531Q, R531W or R534L) alter Kv11.1 function. Western blot analyses of HEK293 cells transiently expressing R531Q, R531W or R534L suggested that only R534L inhibited Kv11.1 trafficking. Voltage-clamping experiments showed that R531Q or R531W dramatically altered Kv11.1 current (I Kv11.1) activation, inactivation, recovery from inactivation and deactivation. Coexpression of wild type (to mimic the patients' genotypes) mostly corrected the changes in I Kv11.1 activation and inactivation, but deactivation kinetics were still faster. Computational simulations using a human ventricular AP model showed that accelerating deactivation rates was sufficient to prolong the AP, but these effects were minimal compared to simply reducing I Kr. These are the first data to demonstrate that coexpressing wild type can correct activation and inactivation dysfunction caused by mutations at a critical voltage-sensing residue in Kv11.1. We conclude that some Kv11.1 mutations might accelerate deactivation to cause LQT2 but that the ventricular AP duration is much more sensitive to mutations that decrease I Kr. This likely explains why most LQT2 mutations are nonsense or trafficking-deficient.

  20. SPOP mutation leads to genomic instability in prostate cancer

    PubMed Central

    Boysen, Gunther; Barbieri, Christopher E; Prandi, Davide; Blattner, Mirjam; Chae, Sung-Suk; Dahija, Arun; Nataraj, Srilakshmi; Huang, Dennis; Marotz, Clarisse; Xu, Limei; Huang, Julie; Lecca, Paola; Chhangawala, Sagar; Liu, Deli; Zhou, Pengbo; Sboner, Andrea; de Bono, Johann S

    2015-01-01

    Genomic instability is a fundamental feature of human cancer often resulting from impaired genome maintenance. In prostate cancer, structural genomic rearrangements are a common mechanism driving tumorigenesis. However, somatic alterations predisposing to chromosomal rearrangements in prostate cancer remain largely undefined. Here, we show that SPOP, the most commonly mutated gene in primary prostate cancer modulates DNA double strand break (DSB) repair, and that SPOP mutation is associated with genomic instability. In vivo, SPOP mutation results in a transcriptional response consistent with BRCA1 inactivation resulting in impaired homology-directed repair (HDR) of DSB. Furthermore, we found that SPOP mutation sensitizes to DNA damaging therapeutic agents such as PARP inhibitors. These results implicate SPOP as a novel participant in DSB repair, suggest that SPOP mutation drives prostate tumorigenesis in part through genomic instability, and indicate that mutant SPOP may increase response to DNA-damaging therapeutics. DOI: http://dx.doi.org/10.7554/eLife.09207.001 PMID:26374986

  1. Tissue-Specific Effects of Reduced β-catenin Expression on Adenomatous Polyposis Coli Mutation-Instigated Tumorigenesis in Mouse Colon and Ovarian Epithelium

    PubMed Central

    Feng, Ying; Sakamoto, Naoya; Wu, Rong; Liu, Jie-yu; Wiese, Alexandra; Green, Maranne E.; Green, Megan; Akyol, Aytekin; Roy, Badal C.; Zhai, Yali; Cho, Kathleen R.; Fearon, Eric R.

    2015-01-01

    Adenomatous polyposis coli (APC) inactivating mutations are present in most human colorectal cancers and some other cancers. The APC protein regulates the β-catenin protein pool that functions as a co-activator of T cell factor (TCF)-regulated transcription in Wnt pathway signaling. We studied effects of reduced dosage of the Ctnnb1 gene encoding β-catenin in Apc-mutation-induced colon and ovarian mouse tumorigenesis and cell culture models. Concurrent somatic inactivation of one Ctnnb1 allele, dramatically inhibited Apc mutation-induced colon polyposis and greatly extended Apc-mutant mouse survival. Ctnnb1 hemizygous dose markedly inhibited increases in β-catenin levels in the cytoplasm and nucleus following Apc inactivation in colon epithelium, with attenuated expression of key β-catenin/TCF-regulated target genes, including those encoding the EphB2/B3 receptors, the stem cell marker Lgr5, and Myc, leading to maintenance of crypt compartmentalization and restriction of stem and proliferating cells to the crypt base. A critical threshold for β-catenin levels in TCF-regulated transcription was uncovered for Apc mutation-induced effects in colon epithelium, along with evidence of a feed-forward role for β-catenin in Ctnnb1 gene expression and CTNNB1 transcription. The active β-catenin protein pool was highly sensitive to CTNNB1 transcript levels in colon cancer cells. In mouse ovarian endometrioid adenocarcinomas (OEAs) arising from Apc- and Pten-inactivation, while Ctnnb1 hemizygous dose affected β-catenin levels and some β-catenin/TCF target genes, Myc induction was retained and OEAs arose in a fashion akin to that seen with intact Ctnnb1 gene dose. Our findings indicate Ctnnb1 gene dose exerts tissue-specific differences in Apc mutation-instigated tumorigenesis. Differential expression of selected β-catenin/TCF-regulated genes, such as Myc, likely underlies context-dependent effects of Ctnnb1 gene dosage in tumorigenesis. PMID:26528816

  2. Mutational Survey of the PHEX Gene in Patients with X-linked Hypophosphatemic Rickets

    PubMed Central

    Ichikawa, Shoji; Traxler, Elizabeth A.; Estwick, Selina A.; Curry, Leah R.; Johnson, Michelle L.; Sorenson, Andrea H.; Imel, Erik A.; Econs, Michael J.

    2008-01-01

    X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disorder characterized by renal phosphate wasting, aberrant vitamin D metabolism, and abnormal bone mineralization. XLH is caused by inactivating mutations in PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). In this study, we sequenced the PHEX gene in subjects from 26 kindreds who were clinically diagnosed with XLH. Sequencing revealed 18 different mutations, of which thirteen have not been reported previously. In addition to deletions, splice site mutations, and missense and nonsense mutations, a rare point mutation in the 3’-untranslated region (3’-UTR) was identified as a novel cause of XLH. In summary, we identified a wide spectrum of mutations in the PHEX gene. Our data, in accord with those of others, indicate that there is no single predominant PHEX mutation responsible for XLH. PMID:18625346

  3. Interactions among DIV voltage-sensor movement, fast inactivation, and resurgent Na current induced by the NaVβ4 open-channel blocking peptide

    PubMed Central

    Lewis, Amanda H.

    2013-01-01

    Resurgent Na current flows as voltage-gated Na channels recover through open states from block by an endogenous open-channel blocking protein, such as the NaVβ4 subunit. The open-channel blocker and fast-inactivation gate apparently compete directly, as slowing the onset of fast inactivation increases resurgent currents by favoring binding of the blocker. Here, we tested whether open-channel block is also sensitive to deployment of the DIV voltage sensor, which facilitates fast inactivation. We expressed NaV1.4 channels in HEK293t cells and assessed block by a free peptide replicating the cytoplasmic tail of NaVβ4 (the “β4 peptide”). Macroscopic fast inactivation was disrupted by mutations of DIS6 (L443C/A444W; “CW” channels), which reduce fast-inactivation gate binding, and/or by the site-3 toxin ATX-II, which interferes with DIV movement. In wild-type channels, the β4 peptide competed poorly with fast inactivation, but block was enhanced by ATX. With the CW mutation, large peptide-induced resurgent currents were present even without ATX, consistent with increased open-channel block upon depolarization and slower deactivation after blocker unbinding upon repolarization. The addition of ATX greatly increased transient current amplitudes and further enlarged resurgent currents, suggesting that pore access by the blocker is actually decreased by full deployment of the DIV voltage sensor. ATX accelerated recovery from block at hyperpolarized potentials, however, suggesting that the peptide unbinds more readily when DIV voltage-sensor deployment is disrupted. These results are consistent with two open states in Na channels, dependent on the DIV voltage-sensor position, which differ in affinity for the blocking protein. PMID:23940261

  4. Introducing a frameshift mutation to the POL sequence of HIV-1 provirus and evaluation of the immunogenic characteristics of the mutated virions (RINNL4-3).

    PubMed

    Zabihollahi, Rezvan; Sadat, Seyed Mehdi; Vahabpour, Rouhollah; Salehi, Mansoor; Azadmanesh, Kayhan; Siadat, Seyed Davar; Saraji, Ali Reza Azizi; Pouriavali, Mohamamd Hassan; Momen, Seyed Bahman; Aghasadeghi, Mohamad Reza

    2012-01-01

    Inactivation of the reverse transcriptase (RT) and integrase (IN) enzymes can abolish the replication of the human immunodeficiency virus (HIV) and, thus, its infectivity. Here, inactivated HIV particles convenient for designing virus-like particle (VLP) based vaccines have been produced. Inactivated HIV-provirus was created by introducing a frame shift mutation. HIV provirus DNA was cut in the pol region by Age I restriction enzyme, followed by filling of sticky ends using the Klenow fragment before ligation. The resulting plasmid was named as pRINNL4-3. HEK-293T cells were used as producer, after being transfected with the modified plasmid. Viral particle production and biological activity were assayed by virus capsid protein (p24) quantification and syncytium formation in MT2 cells, respectively. The immunogenicity of the RINNL4-3 virions was investigated in a mouse model. The mutation was expected to inactivate the virus RT and IN enzymes. The results showed that the VLPs were assembled, as measured by the p24 load of the culture supernatant, and contained functional envelope proteins (Env) as monitored by the syncytium formation. However, these VLPs had no ability to infect target MT2 cells, as well as their VSVG (vesicular stomatitis virus-glycoprotein) pseudotyped counterparts infected HEK-293T cells. A high level of antibody response was observed in immunized mice. Since RINNL4-3 virions are replication incompetent, they are convenient for production and use in biomedical studies. Also, RINNL4-3 is a candidate for a vaccine development due to it contains envelope and structural virus proteins which are crucial for triggering neutralizing antibodies and the cellular immune response.

  5. OprD mutations and inactivation in imipenem-resistant Pseudomonas aeruginosa isolates from China.

    PubMed

    Fang, Zhi-Li; Zhang, Li-Yan; Huang, Ying-Min; Qing, Yun; Cao, Kai-Yuan; Tian, Guo-Bao; Huang, Xi

    2014-01-01

    To investigate the mechanisms involved in imipenem resistance of Pseudomonas aeruginosa in southern China, 61 imipenem-resistant P. aeruginosa clinical isolates were collected from 4 hospitals between October 2011 and June 2012. All isolates were resistant to imipenem, whereas 21.3% were susceptible or intermediate to meropenem. Variable degrees of resistance to other β-lactam and non-β-lactam antimicrobials were observed. PFGE revealed high-level of clonal diversity. Among the 61 isolates, 50 isolates had OprD loss by disrupted oprD mutations, including 43 with frameshift mutations of oprD and 7 with a premature stop codon by single point mutation. Six isolates were oprD-negative by PCR, suggestive of a major disruption of oprD genes. Five isolates had intact oprD but had reduced expression of oprD genes. In addition, only one isolate with disrupted oprD mutation by a premature stop codon was confirmed to be a metallo-β-lactamase producer (IMP-9). Our results show that the loss of OprD, as well as reduced expression of oprD and MBL production, were the predominant mechanisms of imipenem resistance in P. aeruginosa in southern China. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Defective Fast Inactivation Recovery of Nav1.4 in Congenital Myasthenic Syndrome

    PubMed Central

    Arnold, W. David; Feldman, Daniel H.; Ramirez, Sandra; He, Liuyuan; Kassar, Darine; Quick, Adam; Klassen, Tara L.; Lara, Marian; Nguyen, Joanna; Kissel, John T.; Lossin, Christoph; Maselli, Ricardo A.

    2015-01-01

    Objective To describe the unique phenotype and genetic findings in a 57-year-old female with a rare form of congenital myasthenic syndrome (CMS) associated with longstanding muscle fatigability, and to investigate the underlying pathophysiology. Methods We used whole-cell voltage clamping to compare the biophysical parameters of wild-type and Arg1457His-mutant Nav1.4. Results Clinical and neurophysiological evaluation revealed features consistent with CMS. Sequencing of candidate genes indicated no abnormalities. However, analysis of SCN4A, the gene encoding the skeletal muscle sodium channel Nav1.4, revealed a homozygous mutation predicting an arginine-to-histidine substitution at position 1457 (Arg1457His), which maps to the channel’s voltage sensor, specifically D4/S4. Whole-cell patch clamp studies revealed that the mutant required longer hyperpolarization to recover from fast inactivation, which produced a profound use-dependent current attenuation not seen in the wild type. The mutant channel also had a marked hyperpolarizing shift in its voltage dependence of inactivation as well as slowed inactivation kinetics. Interpretation We conclude that Arg1457His compromises muscle fiber excitability. The mutant fast-inactivates with significantly less depolarization, and it recovers only after extended hyperpolarization. The resulting enhancement in its use dependence reduces channel availability, which explains the patient’s muscle fatigability. Arg1457His offers molecular insight into a rare form of CMS precipitated by sodium channel inactivation defects. Given this channel’s involvement in other muscle disorders such as paramyotonia congenita and hyperkalemic periodic paralysis, our study exemplifies how variations within the same gene can give rise to multiple distinct dysfunctions and phenotypes, revealing residues important in basic channel function. PMID:25707578

  7. A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.

    PubMed

    Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S

    2016-03-01

    Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Analysis of X chromosome inactivation in autism spectrum disorders

    PubMed Central

    Gong, Xiaohong; Bacchelli, Elena; Blasi, Francesca; Toma, Claudio; Betancur, Catalina; Chaste, Pauline; Delorme, Richard; Durand, Christelle; Fauchereau, Fabien; Botros, Hany Goubran; Leboyer, Marion; Mouren-Simeoni, Marie-Christine; Nygren, Gudrun; Anckarsäter, Henrik; Rastam, Maria; Gillberg, I Carina; Gillberg, Christopher; Moreno-De-Luca, Daniel; Carone, Simona; Nummela, Ilona; Rossi, Mari; Battaglia, Agatino; Jarvela, Irma; Maestrini, Elena; Bourgeron, Thomas

    2008-01-01

    Autism spectrum disorders (ASD) are complex genetic disorders more frequently observed in males. Skewed X chromosome inactivation (XCI) is observed in heterozygous females carrying gene mutations involved in several X-linked syndromes. In this study, we aimed to estimate the role of X-linked genes in the susceptibility to ASD by ascertaining the XCI pattern in a sample of 543 informative mothers of children with ASD and in a sample of 163 affected girls. The XCI pattern was also determined in two control groups (144 adult females and 40 young females) with a similar age distribution to the mothers sample and affected girls sample, respectively. We observed no significant excess of skewed XCI in families with ASD. Interestingly, two mothers and one girl carrying known mutations in X-linked genes (NLGN3, ATRX, MECP2) showed highly skewed XCI, suggesting that ascertainment of XCI could reveal families with X-linked mutations. Linkage analysis was carried out in the subgroup of multiplex families with skewed XCI (80:20) and a modest increased allele sharing was obtained in the Xq27-Xq28 region, with a peak Z-score of 1.75 close to rs719489. In summary, our results suggest that there is no major X-linked gene subject to XCI and expressed in blood cells conferring susceptibility to ASD. However, the possibility that rare mutations in X-linked genes could contribute to ASD cannot be excluded. We propose that the XCI profile could be a useful criteria to prioritize families for mutation screening of X-linked candidate genes. PMID:18361425

  9. Analysis of X chromosome inactivation in autism spectrum disorders.

    PubMed

    Gong, Xiaohong; Bacchelli, Elena; Blasi, Francesca; Toma, Claudio; Betancur, Catalina; Chaste, Pauline; Delorme, Richard; Durand, Christelle M; Fauchereau, Fabien; Botros, Hany Goubran; Leboyer, Marion; Mouren-Simeoni, Marie-Christine; Nygren, Gudrun; Anckarsäter, Henrik; Rastam, Maria; Gillberg, I Carina; Gillberg, Christopher; Moreno-De-Luca, Daniel; Carone, Simona; Nummela, Ilona; Rossi, Mari; Battaglia, Agatino; Jarvela, Irma; Maestrini, Elena; Bourgeron, Thomas

    2008-09-05

    Autism spectrum disorders (ASD) are complex genetic disorders more frequently observed in males. Skewed X chromosome inactivation (XCI) is observed in heterozygous females carrying gene mutations involved in several X-linked syndromes. In this study, we aimed to estimate the role of X-linked genes in ASD susceptibility by ascertaining the XCI pattern in a sample of 543 informative mothers of children with ASD and in a sample of 163 affected girls. The XCI pattern was also determined in two control groups (144 adult females and 40 young females) with a similar age distribution to the mothers sample and affected girls sample, respectively. We observed no significant excess of skewed XCI in families with ASD. Interestingly, two mothers and one girl carrying known mutations in X-linked genes (NLGN3, ATRX, MECP2) showed highly skewed XCI, suggesting that ascertainment of XCI could reveal families with X-linked mutations. Linkage analysis was carried out in the subgroup of multiplex families with skewed XCI (> or = 80:20) and a modest increased allele sharing was obtained in the Xq27-Xq28 region, with a peak Z-score of 1.75 close to rs719489. In summary, our results suggest that there is no major X-linked gene subject to XCI and expressed in blood cells conferring susceptibility to ASD. However, the possibility that rare mutations in X-linked genes could contribute to ASD cannot be excluded. We propose that the XCI profile could be a useful criteria to prioritize families for mutation screening of X-linked candidate genes. 2008 Wiley-Liss, Inc.

  10. Inactivation of DNA mismatch repair by variants of uncertain significance in the PMS2 gene.

    PubMed

    Drost, Mark; Koppejan, Hester; de Wind, Niels

    2013-11-01

    Lynch syndrome (LS) is a common cancer predisposition caused by an inactivating mutation in one of four DNA mismatch repair (MMR) genes. Frequently a variant of uncertain significance (VUS), rather than an obviously pathogenic mutation, is identified in one of these genes. The inability to define pathogenicity of such variants precludes targeted healthcare. Here, we have modified a cell-free assay to test VUS in the MMR gene PMS2 for functional activity. We have analyzed nearly all VUS in PMS2 found thus far and describe loss of MMR activity for five, suggesting the applicability of the assay for diagnosis of LS. © 2013 WILEY PERIODICALS, INC.

  11. Spectrum of cisplatin-induced mutations in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burnouf, D.; Duane, M.; Fuchs, R.P.

    1987-06-01

    Using a forward-mutation assay based on the inactivation of the tetracycline-resistance gene located on plasmid pBR322, we have determined the mutation spectrum induced in Escherichia coli by cisplatin (cis-diamminedichloroplatinum(II)), a widely used antitumor drug. Cisplatin is known to form mainly intrastrand diadducts at ApG and GpG sites. We found that cisplatin efficiently induces mutations in an SOS-dependent way (i.e., dependent upon UV irradiation of the host bacteria). More than 90% of the mutations are single-base-pair substitutions occurring at the potential sites of cisplatin adducts (ApG and GpG). Taking into account the relative proportions of ApG and GpG adducts, we foundmore » that the ApG adducts are at least 5 times more mutagenic than the GpG adducts. Moreover, a strong mutation specificity was seen at the 5' side of the ApG adducts (A X T----T X A transversions). The observation that most mutations occur at the 5' end of the adduct at both ApG and GpG sites is discussed in relation to recent structural data.« less

  12. Inactivation of pathogenic bacteria in food matrices: high pressure processing, photodynamic inactivation and pressure-assisted photodynamic inactivation

    NASA Astrophysics Data System (ADS)

    Cunha, A.; Couceiro, J.; Bonifácio, D.; Martins, C.; Almeida, A.; Neves, M. G. P. M. S.; Faustino, M. A. F.; Saraiva, J. A.

    2017-09-01

    Traditional food processing methods frequently depend on the application of high temperature. However, heat may cause undesirable changes in food properties and often has a negative impact on nutritional value and organoleptic characteristics. Therefore, reducing the microbial load without compromising the desirable properties of food products is still a technological challenge. High-pressure processing (HPP) can be classified as a cold pasteurization technique, since it is a non-thermal food preservation method that uses hydrostatic pressure to inactivate spoilage microorganisms. At the same time, it increases shelf life and retains the original features of food. Photodynamic inactivation (PDI) is also regarded as promising approach for the decontamination of food matrices. In this case, the inactivation of bacterial cells is achieved by the cytotoxic effects of reactive oxygens species (ROS) produced from the combined interaction of a photosensitizer molecule, light and oxygen. This short review examines some recent developments on the application of HPP and PDI with food-grade photosensitizers for the inactivation of listeriae, taken as a food pathogen model. The results of a proof-of-concept trial of the use of high-pressure as a coadjutant to increase the efficiency of photodynamic inactivation of bacterial endospores is also addressed.

  13. The tarantula toxins ProTx-II and huwentoxin-IV differentially interact with human Nav1.7 voltage sensors to inhibit channel activation and inactivation.

    PubMed

    Xiao, Yucheng; Blumenthal, Kenneth; Jackson, James O; Liang, Songping; Cummins, Theodore R

    2010-12-01

    The voltage-gated sodium channel Na(v)1.7 plays a crucial role in pain, and drugs that inhibit hNa(v)1.7 may have tremendous therapeutic potential. ProTx-II and huwentoxin-IV (HWTX-IV), cystine knot peptides from tarantula venoms, preferentially block hNa(v)1.7. Understanding the interactions of these toxins with sodium channels could aid the development of novel pain therapeutics. Whereas both ProTx-II and HWTX-IV have been proposed to preferentially block hNa(v)1.7 activation by trapping the domain II voltage-sensor in the resting configuration, we show that specific residues in the voltage-sensor paddle of domain II play substantially different roles in determining the affinities of these toxins to hNa(v)1.7. The mutation E818C increases ProTx-II's and HWTX-IV's IC(50) for block of hNa(v)1.7 currents by 4- and 400-fold, respectively. In contrast, the mutation F813G decreases ProTx-II affinity by 9-fold but has no effect on HWTX-IV affinity. It is noteworthy that we also show that ProTx-II, but not HWTX-IV, preferentially interacts with hNa(v)1.7 to impede fast inactivation by trapping the domain IV voltage-sensor in the resting configuration. Mutations E1589Q and T1590K in domain IV each decreased ProTx-II's IC(50) for impairment of fast inactivation by ~6-fold. In contrast mutations D1586A and F1592A in domain-IV increased ProTx-II's IC(50) for impairment of fast inactivation by ~4-fold. Our results show that whereas ProTx-II and HWTX-IV binding determinants on domain-II may overlap, domain II plays a much more crucial role for HWTX-IV, and contrary to what has been proposed to be a guiding principle of sodium channel pharmacology, molecules do not have to exclusively target the domain IV voltage-sensor to influence sodium channel inactivation.

  14. Stochastic epigenetic mutations (DNA methylation) increase exponentially in human aging and correlate with X chromosome inactivation skewing in females.

    PubMed

    Gentilini, Davide; Garagnani, Paolo; Pisoni, Serena; Bacalini, Maria Giulia; Calzari, Luciano; Mari, Daniela; Vitale, Giovanni; Franceschi, Claudio; Di Blasio, Anna Maria

    2015-08-01

    In this study we applied a new analytical strategy to investigate the relations between stochastic epigenetic mutations (SEMs) and aging. We analysed methylation levels through the Infinium HumanMethylation27 and HumanMethylation450 BeadChips in a population of 178 subjects ranging from 3 to 106 years. For each CpG probe, epimutated subjects were identified as the extreme outliers with methylation level exceeding three times interquartile ranges the first quartile (Q1-(3 x IQR)) or the third quartile (Q3+(3 x IQR)). We demonstrated that the number of SEMs was low in childhood and increased exponentially during aging. Using the HUMARA method, skewing of X chromosome inactivation (XCI) was evaluated in heterozygotes women. Multivariate analysis indicated a significant correlation between log(SEMs) and degree of XCI skewing after adjustment for age (β = 0.41; confidence interval: 0.14, 0.68; p-value = 0.0053). The PATH analysis tested the complete model containing the variables: skewing of XCI, age, log(SEMs) and overall CpG methylation. After adjusting for the number of epimutations we failed to confirm the well reported correlation between skewing of XCI and aging. This evidence might suggest that the known correlation between XCI skewing and aging could not be a direct association but mediated by the number of SEMs.

  15. Mechanism of Bacillus subtilis Spore Inactivation by and Resistance to Supercritical CO2 plus Peracetic Acid

    PubMed Central

    Setlow, Barbara; Korza, George; Blatt, Kelly M.S.; Fey, Julien P.; Setlow, Peter

    2015-01-01

    Aims Determine how supercritical CO2 (scCO2) plus peracetic acid (PAA) inactivates Bacillus subtilis spores, factors important in spore resistance to scCO2-PAA, and if spores inactivated by scCO2-PAA are truly dead. Methods and Results Spores of wild-type B. subtilis and isogenic mutants lacking spore protective proteins were treated with scCO2-PAA in liquid or dry at 35°C. Wild-type wet spores (aqueous suspension) were more susceptible than dry spores. Treated spores were examined for viability (and were truly dead), dipicolinic acid (DPA), mutations, permeability to nucleic acid stains, germination under different conditions, energy metabolism and outgrowth. ScCO2-PAA-inactivated spores retained DPA, and survivors had no notable DNA damage. However, DPA was released from inactivated spores at a normally innocuous temperature (85°C), and colony formation from treated spores was salt sensitive. The inactivated spores germinated but did not outgrow, and these germinated spores had altered plasma membrane permeability and defective energy metabolism. Wet or dry coat-defective spores had increased scCO2-PAA sensitivity, and dry spores but not wet spores lacking DNA protective proteins were more scCO2-PAA sensitive. Conclusions These findings suggest that scCO2-PAA inactivates spores by damaging spores’ inner membrane. The spore coat provided scCO2-PAA resistance for both wet and dry spores. DNA protective proteins provided scCO2-PAA resistance only for dry spores. Significance and Impact of Study These results provide information on mechanisms of spore inactivation of and resistance to scCO2-PAA, an agent with increasing use in sterilization applications. PMID:26535794

  16. Mechanism of Bacillus subtilis spore inactivation by and resistance to supercritical CO2 plus peracetic acid.

    PubMed

    Setlow, B; Korza, G; Blatt, K M S; Fey, J P; Setlow, P

    2016-01-01

    Determine how supercritical CO2 (scCO2 ) plus peracetic acid (PAA) inactivates Bacillus subtilis spores, factors important in spore resistance to scCO2 -PAA, and if spores inactivated by scCO2 -PAA are truly dead. Spores of wild-type B. subtilis and isogenic mutants lacking spore protective proteins were treated with scCO2 -PAA in liquid or dry at 35°C. Wild-type wet spores (aqueous suspension) were more susceptible than dry spores. Treated spores were examined for viability (and were truly dead), dipicolinic acid (DPA), mutations, permeability to nucleic acid stains, germination under different conditions, energy metabolism and outgrowth. ScCO2 -PAA-inactivated spores retained DPA, and survivors had no notable DNA damage. However, DPA was released from inactivated spores at a normally innocuous temperature (85°C), and colony formation from treated spores was salt sensitive. The inactivated spores germinated but did not outgrow, and these germinated spores had altered plasma membrane permeability and defective energy metabolism. Wet or dry coat-defective spores had increased scCO2 -PAA sensitivity, and dry spores but not wet spores lacking DNA protective proteins were more scCO2 -PAA sensitive. These findings suggest that scCO2 -PAA inactivates spores by damaging spores' inner membrane. The spore coat provided scCO2 -PAA resistance for both wet and dry spores. DNA protective proteins provided scCO2 -PAA resistance only for dry spores. These results provide information on mechanisms of spore inactivation of and resistance to scCO2 -PAA, an agent with increasing use in sterilization applications. © 2015 The Society for Applied Microbiology.

  17. Mechanism-based post-translational modification and inactivation in terpene synthases

    DOE PAGES

    Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.; ...

    2015-09-17

    Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less

  18. Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

    PubMed

    Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

    2018-03-01

    Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

  19. Mutations, mutation rates, and evolution at the hypervariable VNTR loci of Yersinia pestis.

    PubMed

    Vogler, Amy J; Keys, Christine E; Allender, Christopher; Bailey, Ira; Girard, Jessica; Pearson, Talima; Smith, Kimothy L; Wagner, David M; Keim, Paul

    2007-03-01

    VNTRs are able to discriminate among closely related isolates of recently emerged clonal pathogens, including Yersinia pestis the etiologic agent of plague, because of their great diversity. Diversity is driven largely by mutation but little is known about VNTR mutation rates, factors affecting mutation rates, or the mutational mechanisms. The molecular epidemiological utility of VNTRs will be greatly enhanced when this foundational knowledge is available. Here, we measure mutation rates for 43 VNTR loci in Y. pestis using an in vitro generated population encompassing approximately 96,000 generations. We estimate the combined 43-locus rate and individual rates for 14 loci. A comparison of Y. pestis and Escherichia coli O157:H7 VNTR mutation rates and products revealed a similar relationship between diversity and mutation rate in these two species. Likewise, the relationship between repeat copy number and mutation rate is nearly identical between these species, suggesting a generalized relationship that may be applicable to other species. The single- versus multiple-repeat mutation ratios and the insertion versus deletion mutation ratios were also similar, providing support for a general model for the mutations associated with VNTRs. Finally, we use two small sets of Y. pestis isolates to show how this general model and our estimated mutation rates can be used to compare alternate phylogenies, and to evaluate the significance of genotype matches, near-matches, and mismatches found in empirical comparisons with a reference database.

  20. Low-burden TP53 mutations in chronic phase of myeloproliferative neoplasms: association with age, hydroxyurea administration, disease type and JAK2 mutational status

    PubMed Central

    Kubesova, B; Pavlova, S; Malcikova, J; Kabathova, J; Radova, L; Tom, N; Tichy, B; Plevova, K; Kantorova, B; Fiedorova, K; Slavikova, M; Bystry, V; Kissova, J; Gisslinger, B; Gisslinger, H; Penka, M; Mayer, J; Kralovics, R; Pospisilova, S; Doubek, M

    2018-01-01

    The multistep process of TP53 mutation expansion during myeloproliferative neoplasm (MPN) transformation into acute myeloid leukemia (AML) has been documented retrospectively. It is currently unknown how common TP53 mutations with low variant allele frequency (VAF) are, whether they are linked to hydroxyurea (HU) cytoreduction, and what disease progression risk they carry. Using ultra-deep next-generation sequencing, we examined 254 MPN patients treated with HU, interferon alpha-2a or anagrelide and 85 untreated patients. We found TP53 mutations in 50 cases (0.2–16.3% VAF), regardless of disease subtype, driver gene status and cytoreduction. Both therapy and TP53 mutations were strongly associated with older age. Over-time analysis showed that the mutations may be undetectable at diagnosis and slowly increase during disease course. Although three patients with TP53 mutations progressed to TP53-mutated or TP53-wild-type AML, we did not observe a significant age-independent impact on overall survival during the follow-up. Further, we showed that complete p53 inactivation alone led to neither blast transformation nor HU resistance. Altogether, we revealed patient's age as the strongest factor affecting low-burden TP53 mutation incidence in MPN and found no significant age-independent association between TP53 mutations and hydroxyurea. Mutations may persist at low levels for years without an immediate risk of progression. PMID:28744014

  1. Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

    PubMed

    de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

    2018-03-01

    To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  2. Different inactivating mutations of the mineralocorticoid receptor in fourteen families affected by type I pseudohypoaldosteronism.

    PubMed

    Sartorato, Paola; Lapeyraque, Anne-Laure; Armanini, Decio; Kuhnle, Ursula; Khaldi, Yasmina; Salomon, Rémi; Abadie, Véronique; Di Battista, Eliana; Naselli, Arturo; Racine, Alain; Bosio, Maurizio; Caprio, Massimiliano; Poulet-Young, Véronique; Chabrolle, Jean-Pierre; Niaudet, Patrick; De Gennes, Christiane; Lecornec, Marie-Hélène; Poisson, Elodie; Fusco, Anna Maria; Loli, Paola; Lombès, Marc; Zennaro, Maria-Christina

    2003-06-01

    We have analyzed the human mineralocorticoid receptor (hMR) gene in 14 families with autosomal dominant or sporadic pseudohypoaldosteronism (PHA1), a rare form of mineralocorticoid resistance characterized by neonatal renal salt wasting and failure to thrive. Six heterozygous mutations were detected. Two frameshift mutations in exon 2 (insT1354, del8bp537) and one nonsense mutation in exon 4 (C2157A, Cys645stop) generate truncated proteins due to premature stop codons. Three missense mutations (G633R, Q776R, L979P) differently affect hMR function. The DNA binding domain mutant R633 exhibits reduced maximal transactivation, although its binding characteristics and ED(50) of transactivation are comparable with wild-type hMR. Ligand binding domain mutants R776 and P979 present reduced or absent aldosterone binding, respectively, which is associated with reduced or absent ligand-dependent transactivation capacity. Finally, P979 possesses a transdominant negative effect on wild-type hMR activity, whereas mutations G633R and Q776R probably result in haploinsufficiency in PHA1 patients. We conclude that hMR mutations are a common feature of autosomal dominant PHA1, being found in 70% of our familial cases. Their absence in some families underscores the importance of an extensive investigation of the hMR gene and the role of precise diagnostic procedures to allow for identification of other genes potentially involved in the disease.

  3. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  4. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    PubMed

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  5. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    PubMed Central

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

  6. A Direct Demonstration of Closed-State Inactivation of K+ Channels at Low pH

    PubMed Central

    Claydon, Thomas W.; Vaid, Moni; Rezazadeh, Saman; Kwan, Daniel C.H.; Kehl, Steven J.; Fedida, David

    2007-01-01

    Lowering external pH reduces peak current and enhances current decay in Kv and Shaker-IR channels. Using voltage-clamp fluorimetry we directly determined the fate of Shaker-IR channels at low pH by measuring fluorescence emission from tetramethylrhodamine-5-maleimide attached to substituted cysteine residues in the voltage sensor domain (M356C to R362C) or S5-P linker (S424C). One aspect of the distal S3-S4 linker α-helix (A359C and R362C) reported a pH-induced acceleration of the slow phase of fluorescence quenching that represents P/C-type inactivation, but neither site reported a change in the total charge movement at low pH. Shaker S424C fluorescence demonstrated slow unquenching that also reflects channel inactivation and this too was accelerated at low pH. In addition, however, acidic pH caused a reversible loss of the fluorescence signal (pKa = 5.1) that paralleled the reduction of peak current amplitude (pKa = 5.2). Protons decreased single channel open probability, suggesting that the loss of fluorescence at low pH reflects a decreased channel availability that is responsible for the reduced macroscopic conductance. Inhibition of inactivation in Shaker S424C (by raising external K+ or the mutation T449V) prevented fluorescence loss at low pH, and the fluorescence report from closed Shaker ILT S424C channels implied that protons stabilized a W434F-like inactivated state. Furthermore, acidic pH changed the fluorescence amplitude (pKa = 5.9) in channels held continuously at −80 mV. This suggests that low pH stabilizes closed-inactivated states. Thus, fluorescence experiments suggest the major mechanism of pH-induced peak current reduction is inactivation of channels from closed states from which they can activate, but not open; this occurs in addition to acceleration of P/C-type inactivation from the open state. PMID:17470663

  7. Engineering a horseradish peroxidase C stable to radical attacks by mutating multiple radical coupling sites.

    PubMed

    Kim, Su Jin; Joo, Jeong Chan; Song, Bong Keun; Yoo, Young Je; Kim, Yong Hwan

    2015-04-01

    Peroxidases have great potential as industrial biocatalysts. In particular, the oxidative polymerization of phenolic compounds catalyzed by peroxidases has been extensively examined because of the advantage of this method over other conventional chemical methods. However, the industrial application of peroxidases is often limited because of their rapid inactivation by phenoxyl radicals during oxidative polymerization. In this work, we report a novel protein engineering approach to improve the radical stability of horseradish peroxidase isozyme C (HRPC). Phenylalanine residues that are vulnerable to modification by the phenoxyl radicals were identified using mass spectrometry analysis. UV-Vis and CD spectra showed that radical coupling did not change the secondary structure or the active site of HRPC. Four phenylalanine (Phe) residues (F68, F142, F143, and F179) were each mutated to alanine residues to generate single mutants to examine the role of these sites in radical coupling. Despite marginal improvement of radical stability, each single mutant still exhibited rapid radical inactivation. To further reduce inactivation by radical coupling, the four substitution mutations were combined in F68A/F142A/F143A/F179A. This mutant demonstrated dramatic enhancement of radical stability by retaining 41% of its initial activity compared to the wild-type, which was completely inactivated. Structure and sequence alignment revealed that radical-vulnerable Phe residues of HPRC are conserved in homologous peroxidases, which showed the same rapid inactivation tendency as HRPC. Based on our site-directed mutagenesis and biochemical characterization, we have shown that engineering radical-vulnerable residues to eliminate multiple radical coupling can be a good strategy to improve the stability of peroxidases against radical attack. © 2014 Wiley Periodicals, Inc.

  8. KIT D816V-mutated bone marrow mesenchymal stem cells in indolent systemic mastocytosis are associated with disease progression.

    PubMed

    Garcia-Montero, Andres C; Jara-Acevedo, Maria; Alvarez-Twose, Ivan; Teodosio, Cristina; Sanchez-Muñoz, Laura; Muñiz, Carmen; Muñoz-Gonzalez, Javier I; Mayado, Andrea; Matito, Almudena; Caldas, Carolina; Morgado, Jose M; Escribano, Luis; Orfao, Alberto

    2016-02-11

    Multilineage involvement of bone marrow (BM) hematopoiesis by the somatic KIT D816V mutation is present in a subset of adult indolent systemic mastocytosis (ISM) patients in association with a poorer prognosis. Here, we investigated the potential involvement of BM mesenchymal stem cells (MSCs) from ISM patients by the KIT D816V mutation and its potential impact on disease progression and outcome. This mutation was investigated in highly purified BM MSCs and other BM cell populations from 83 ISM patients followed for a median of 116 months. KIT D816V-mutated MSCs were detected in 22 of 83 cases. All MSC-mutated patients had multilineage KIT mutation (100% vs 30%, P = .0001) and they more frequently showed involvement of lymphoid plus myeloid BM cells (59% vs 22%; P = .03) and a polyclonal pattern of inactivation of the X-chromosome of KIT-mutated BM mast cells (64% vs 0%; P = .01) vs other multilineage ISM cases. Moreover, presence of KIT-mutated MSCs was associated with more advanced disease features, a greater rate of disease progression (50% vs 17%; P = .04), and a shorter progression-free survival (P ≤ .003). Overall, these results support the notion that ISM patients with mutated MSCs may have acquired the KIT mutation in a common pluripotent progenitor cell, prior to differentiation into MSCs and hematopoietic precursor cells, before the X-chromosome inactivation process occurs. From a clinical point of view, acquisition of the KIT mutation in an earlier BM precursor cell confers a significantly greater risk for disease progression and a poorer outcome. © 2016 by The American Society of Hematology.

  9. A novel papillation assay for the identification of genes affecting mutation rate in Pseudomonas putida and other pseudomonads.

    PubMed

    Tagel, Mari; Tavita, Kairi; Hõrak, Rita; Kivisaar, Maia; Ilves, Heili

    2016-08-01

    Formation of microcolonies (papillae) permits easy visual screening of mutational events occurring in single colonies of bacteria. In this study, we have established a novel papillation assay employable in a wide range of pseudomonads including Pseudomonas aeruginosa and Pseudomonas putida for monitoring mutation frequency in distinct colonies. With the aid of this assay, we conducted a genome-wide search for the factors affecting mutation frequency in P. putida. Screening ∼27,000 transposon mutants for increased mutation frequency allowed us to identify 34 repeatedly targeted genes. In addition to genes involved in DNA replication and repair, we identified genes participating in metabolism and transport of secondary metabolites, cell motility, and cell wall synthesis. The highest effect on mutant frequency was observed when truA (tRNA pseudouridine synthase), mpl (UDP-N-acetylmuramate-alanine ligase) or gacS (multi-sensor hybrid histidine kinase) were inactivated. Inactivation of truA elevated the mutant frequency only in growing cells, while the deficiency of gacS affected mainly stationary-phase mutagenesis. Thus, our results demonstrate the feasibility of the assay for isolating mutants with elevated mutagenesis in growing as well as stationary-phase bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate.

    PubMed Central

    Julias, J G; Kim, T; Arnold, G; Pathak, V K

    1997-01-01

    It was previously observed that the nucleoside analog 5-azacytidine increased the spleen necrosis virus (SNV) mutation rate 13-fold in one cycle of retrovirus replication (V. K. Pathak and H. M. Temin, J. Virol. 66:3093-3100, 1992). Based on this observation, we hypothesized that nucleoside analogs used as antiviral drugs may also increase retrovirus mutation rates. We sought to determine if 3'-azido-3'-deoxythymidine (AZT), the primary treatment for human immunodeficiency virus type 1 (HIV-1) infection, increases the retrovirus mutation rate. Two assays were used to determine the effects of AZT on retrovirus mutation rates. The strategy of the first assay involved measuring the in vivo rate of inactivation of the lacZ gene in one replication cycle of SNV- and murine leukemia virus-based retroviral vectors. We observed 7- and 10-fold increases in the SNV mutant frequency following treatment of target cells with 0.1 and 0.5 microM AZT, respectively. The murine leukemia virus mutant frequency increased two- and threefold following treatment of target cells with 0.5 and 1.0 microM AZT, respectively. The second assay used an SNV-based shuttle vector containing the lacZ alpha gene. Proviruses were recovered as plasmids in Escherichia coli, and the rate of inactivation of lacZ alpha was measured. The results indicated that treatment of target cells increased the overall mutation rate two- to threefold. DNA sequence analysis of mutant proviruses indicated that AZT increased both the deletion and substitution rates. These results suggest that AZT treatment of HIV-1 infection may increase the degree of viral variation and alter virus evolution or pathogenesis. PMID:9151812

  11. Idiopathic Hypogonadotropic Hypogonadism Caused by Inactivating Mutations in SRA1

    PubMed Central

    Kotan, Leman Damla; Cooper, Charlton; Darcan, Şükran; Carr, Ian M.; Özen, Samim; Yan, Yi; Hamedani, Mohammad K.; Gürbüz, Fatih; Mengen, Eda; Turan, İhsan; Ulubay, Ayça; Akkuş, Gamze; Yüksel, Bilgin; Topaloğlu, A. Kemal; Leygue, Etienne

    2016-01-01

    Objective: What initiates the pubertal process in humans and other mammals is still unknown. We hypothesized that gene(s) taking roles in triggering human puberty may be identified by studying a cohort of idiopathic hypogonadotropic hypogonadism (IHH). Methods: A cohort of IHH cases was studied based on autozygosity mapping coupled with whole exome sequencing. Results: Our studies revealed three independent families in which IHH/delayed puberty is associated with inactivating SRA1 variants. SRA1 was the first gene to be identified to function through its protein as well as noncoding functional ribonucleic acid products. These products act as co-regulators of nuclear receptors including sex steroid receptors as well as SF-1 and LRH-1, the master regulators of steroidogenesis. Functional studies with a mutant SRA1 construct showed a reduced co-activation of ligand-dependent activity of the estrogen receptor alpha, as assessed by luciferase reporter assay in HeLa cells. Conclusion: Our findings strongly suggest that SRA1 gene function is required for initiation of puberty in humans. Furthermore, SRA1 with its alternative products and functionality may provide a potential explanation for the versatility and complexity of the pubertal process. PMID:27086651

  12. S-glutathionylation of an auxiliary subunit confers redox sensitivity to Kv4 channel inactivation.

    PubMed

    Jerng, Henry H; Pfaffinger, Paul J

    2014-01-01

    Reactive oxygen species (ROS) regulate ion channels, modulate neuronal excitability, and contribute to the etiology of neurodegenerative disorders. ROS differentially suppress fast "ball-and-chain" N-type inactivation of cloned Kv1 and Kv3 potassium channels but not of Kv4 channels, likely due to a lack of reactive cysteines in Kv4 N-termini. Recently, we discovered that N-type inactivation of Kv4 channel complexes can be independently conferred by certain N-terminal variants of Kv4 auxiliary subunits (DPP6a, DPP10a). Here, we report that both DPP6a and DPP10a, like Kv subunits with redox-sensitive N-type inactivation, contain a highly conserved cysteine in their N-termini (Cys-13). To test if N-type inactivation mediated by DPP6a or DPP10a is redox sensitive, Xenopus oocyte recordings were performed to examine the effects of two common oxidants, tert-butyl hydroperoxide (tBHP) and diamide. Both oxidants markedly modulate DPP6a- or DPP10a-conferred N-type inactivation of Kv4 channels, slowing the overall inactivation and increasing the peak current. These functional effects are fully reversed by the reducing agent dithiothreitol (DTT) and appear to be due to a selective modulation of the N-type inactivation mediated by these auxiliary subunits. Mutation of DPP6a Cys-13 to serine eliminated the tBHP or diamide effects, confirming the importance of Cys-13 to the oxidative regulation. Biochemical studies designed to elucidate the underlying molecular mechanism show no evidence of protein-protein disulfide linkage formation following cysteine oxidation. Instead, using a biotinylated glutathione (BioGEE) reagent, we discovered that oxidation by tBHP or diamide leads to S-glutathionylation of Cys-13, suggesting that S-glutathionylation underlies the regulation of fast N-type inactivation by redox. In conclusion, our studies suggest that Kv4-based A-type current in neurons may show differential redox sensitivity depending on whether DPP6a or DPP10a is highly expressed

  13. The inhibitory effect of convulsant agents on the enzyme in brain which inactivates nerveside.

    PubMed

    Toh, C C

    1969-07-01

    1. An enzyme which can be extracted from brain inactivates nerveside in the optimum pH range 5.8-7.0.2. The polybasic acids trypan blue and its analogue trypan red, bromphenol blue and its analogue bromthymol blue at concentrations of 0.22 mM and ethylenediaminetetra-acetic acid (EDTA) at a concentration of 1 mM are strong inhibitors of the enzyme.3. Penicillin which is a monobasic carboxylic acid also inhibits the enzyme but only if concentrations as high as 3.6 mM are used. The antibiotic streptomycin which is a basic substance does not inhibit the enzyme.4. Caffeine at a concentration of 7.2 mM only weakly inhibits the enzyme.5. Chymotrypsin and wheat germ acid phosphatase also inactivate nerveside at pH 5.9 and are inhibited by the acidic dyes and penicillin. EDTA inhibits wheat germ phosphatase but activates chymotrypsin.6. Inactivation of nerveside by the brain enzyme and by wheat germ phosphatase is different from the action of chymotrypsin. Nerveside solutions incubated with chymotrypsin completely lose all biological activity whereas if incubation is carried out with either the brain enzyme or wheat germ acid phosphatase a residual biological activity remains even when the concentration of these two enzymes is increased. This residual biological activity is due to a peptide as it is destroyed by chymotrypsin.7. The manner in which nerveside is inactivated by the brain enzyme is uncertain as the preparation of the latter contained phosphodiesterase and protease activities which were similarly inhibited by the acid dyes, penicillin and EDTA.8. Pentylenetetrazole, picrotoxin, strychnine and tetanus toxin do not inhibit the brain enzyme.9. The nerveside-inactivating enzyme is not identical with the Substance P-inactivating enzyme in brain as the former is inhibited by EDTA while the latter is not.

  14. X-chromosome inactivation and escape

    PubMed Central

    DISTECHE, CHRISTINE M.; BERLETCH, JOEL B.

    2016-01-01

    X-chromosome inactivation, which was discovered by Mary Lyon in 1961 results in random silencing of one X chromosome in female mammals. This review is dedicated to Mary Lyon, who passed away last year. She predicted many of the features of X inactivation, for e.g., the existence of an X inactivation center, the role of L1 elements in spreading of silencing and the existence of genes that escape X inactivation. Starting from her published work here we summarize advances in the field. PMID:26690513

  15. Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling.

    PubMed

    Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

    2017-01-01

    Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic

  16. Mutation spectrum of RB1 mutations in retinoblastoma cases from Singapore with implications for genetic management and counselling

    PubMed Central

    Tomar, Swati; Sethi, Raman; Sundar, Gangadhara; Quah, Thuan Chong; Quah, Boon Long; Lai, Poh San

    2017-01-01

    Retinoblastoma (RB) is a rare childhood malignant disorder caused by the biallelic inactivation of RB1 gene. Early diagnosis and identification of carriers of heritable RB1 mutations can improve disease outcome and management. In this study, mutational analysis was conducted on fifty-nine matched tumor and peripheral blood samples from 18 bilateral and 41 unilateral unrelated RB cases by a combinatorial approach of Multiplex Ligation-dependent Probe Amplification (MLPA) assay, deletion screening, direct sequencing, copy number gene dosage analysis and methylation assays. Screening of both blood and tumor samples yielded a mutation detection rate of 94.9% (56/59) while only 42.4% (25/59) of mutations were detected if blood samples alone were analyzed. Biallelic mutations were observed in 43/59 (72.9%) of tumors screened. There were 3 cases (5.1%) in which no mutations could be detected and germline mutations were detected in 19.5% (8/41) of unilateral cases. A total of 61 point mutations were identified, of which 10 were novel. There was a high incidence of previously reported recurrent mutations, occurring at 38.98% (23/59) of all cases. Of interest were three cases of mosaic RB1 mutations detected in the blood from patients with unilateral retinoblastoma. Additionally, two germline mutations previously reported to be associated with low-penetrance phenotypes: missense-c.1981C>T and splice variant-c.607+1G>T, were observed in a bilateral and a unilateral proband, respectively. These findings have implications for genetic counselling and risk prediction for the affected families. This is the first published report on the spectrum of mutations in RB patients from Singapore and shows that further improved mutation screening strategies are required in order to provide a definitive molecular diagnosis for every case of RB. Our findings also underscore the importance of genetic testing in supporting individualized disease management plans for patients and asymptomatic

  17. How mutation affects evolutionary games on graphs

    PubMed Central

    Allen, Benjamin; Traulsen, Arne; Tarnita, Corina E.; Nowak, Martin A.

    2011-01-01

    Evolutionary dynamics are affected by population structure, mutation rates and update rules. Spatial or network structure facilitates the clustering of strategies, which represents a mechanism for the evolution of cooperation. Mutation dilutes this effect. Here we analyze how mutation influences evolutionary clustering on graphs. We introduce new mathematical methods to evolutionary game theory, specifically the analysis of coalescing random walks via generating functions. These techniques allow us to derive exact identity-by-descent (IBD) probabilities, which characterize spatial assortment on lattices and Cayley trees. From these IBD probabilities we obtain exact conditions for the evolution of cooperation and other game strategies, showing the dual effects of graph topology and mutation rate. High mutation rates diminish the clustering of cooperators, hindering their evolutionary success. Our model can represent either genetic evolution with mutation, or social imitation processes with random strategy exploration. PMID:21473871

  18. High resolution identity testing of inactivated poliovirus vaccines

    PubMed Central

    Mee, Edward T.; Minor, Philip D.; Martin, Javier

    2015-01-01

    Background Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. Methods We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. Results All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Conclusion Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. PMID:26049003

  19. High resolution identity testing of inactivated poliovirus vaccines.

    PubMed

    Mee, Edward T; Minor, Philip D; Martin, Javier

    2015-07-09

    Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Growth factor independence-1 (Gfi-1) plays a role in mediating specific granule deficiency (SGD) in a patient lacking a gene-inactivating mutation in the C/EBPϵ gene

    PubMed Central

    Khanna-Gupta, Arati; Sun, Hong; Zibello, Theresa; Lee, Han Myung; Dahl, Richard; Boxer, Laurence A.

    2007-01-01

    Neutrophil-specific granule deficiency (SGD) is a rare congenital disorder marked by recurrent bacterial infections. Neutrophils from SGD patients lack secondary and tertiary granules and their content proteins and lack normal neutrophil functions. Gene-inactivating mutations in the C/EBPϵ gene have been identified in 2 SGD patients. Our studies on a third SGD patient revealed a heterozygous mutation in the C/EBPϵ gene. However, we demonstrate elevated levels of C/EBPϵ and PU.1 proteins in the patient's peripheral blood neutrophils. The expression of the transcription factor growth factor independence-1 (Gfi-1), however, was found to be markedly reduced in our SGD patient despite the absence of an obvious mutation in this gene. This may explain the elevated levels of both C/EBPϵ and PU.1, which are targets of Gfi-1 transcriptional repression. We have generated a growth factor–dependent EML cell line from the bone marrow of Gfi-1+/− and Gfi-1+/+ mice as a model for Gfi-1–deficient SGD, and demonstrate that lower levels of Gfi-1 expression in the Gfi-1+/− EML cells is associated with reduced levels of secondary granule protein (SGP) gene expression. Furthermore, we demonstrate a positive role for Gfi-1 in SGP expression, in that Gfi-1 binds to and up-regulates the promoter of neutrophil collagenase (an SGP gene), in cooperation with wild-type but not with mutant C/EBPϵ. We hypothesize that decreased Gfi-1 levels in our SGD patient, together with the mutant C/EBPϵ, block SGP expression, thereby contributing to the underlying etiology of the disease in our patient. PMID:17244686

  1. Activation of tyrosine kinases by mutation of the gatekeeper threonine

    PubMed Central

    Azam, Mohammad; Seeliger, Markus A; Gray, Nathanael S; Kuriyan, John; Daley, George Q

    2008-01-01

    Protein kinases targeted by small-molecule inhibitors develop resistance through mutation of the ‘gatekeeper’ threonine residue of the active site. Here we show that the gatekeeper mutation in the cellular forms of c-ABL, c-SRC, platelet-derived growth factor receptor-α and -β, and epidermal growth factor receptor activates the kinase and promotes malignant transformation of BaF3 cells. Structural analysis reveals that a network of hydrophobic interactions—the hydrophobic spine—characteristic of the active kinase conformation is stabilized by the gatekeeper substitution. Substitution of glycine for the residues constituting the spine disrupts the hydrophobic connectivity and inactivates the kinase. Furthermore, a small-molecule inhibitor that maximizes complementarity with the dismantled spine (compound 14) inhibits the gatekeeper mutation of BCR-ABL-T315I. These results demonstrate that mutation of the gatekeeper threonine is a common mechanism of activation for tyrosine kinases and provide structural insights to guide the development of next-generation inhibitors. PMID:18794843

  2. X-inactivation patterns in female Leber`s hereditary optic neuropathy patients do not support a strong X-linked determinant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pegoraro, E.; Hoffman, E.P.; Carelli, V.

    1996-02-02

    Leber`s hereditary optic neuropathy (LHON) accounts for about 3% of the cases of blindness in young adult males. The underlying mitochondrial pathogenesis of LHON has been well studied, with specific mitochondrial DNA (mtDNA) mutations of structural genes described and well characterized. However, enigmatic aspects of the disease are not explained by mutation data, such as the higher proportion of affected males, the later onset of the disease in females, and the presence of unaffected individuals with a high proportion of mutant mtDNA. A hypothesis which has been put forward to explain the unusual disease expression is a dual model ofmore » mtDNA and X-linked nuclear gene inheritance. If a nuclear X-linked modifier gene influences the expression of the mitochondrial-linked mutant gene then the affected females should be either homozygous for the nuclear determinant, or if heterozygous, lyonization should favor the mutant X. In order to determine if an X-linked gene predisposes to LHON phenotype we studied X-inactivation patterns in 35 females with known mtDNA mutations from 10 LHON pedigrees. Our results do not support a strong X-linked determinant in LHON cause: 2 of the 10 (20%) manifesting carriers showed skewing of X-inactivation, as did 3 of the 25 (12%) nonmanifesting carriers. 39 refs., 2 figs., 1 tab.« less

  3. Constant p53 Pathway Inactivation in a Large Series of Soft Tissue Sarcomas with Complex Genetics

    PubMed Central

    Pérot, Gaëlle; Chibon, Frédéric; Montero, Audrey; Lagarde, Pauline; de Thé, Hugues; Terrier, Philippe; Guillou, Louis; Ranchère, Dominique; Coindre, Jean-Michel; Aurias, Alain

    2010-01-01

    Alterations of the p53 pathway are among the most frequent aberrations observed in human cancers. We have performed an exhaustive analysis of TP53, p14, p15, and p16 status in a large series of 143 soft tissue sarcomas, rare tumors accounting for around 1% of all adult cancers, with complex genetics. For this purpose, we performed genomic studies, combining sequencing, copy number assessment, and expression analyses. TP53 mutations and deletions are more frequent in leiomyosarcomas than in undifferentiated pleomorphic sarcomas. Moreover, 50% of leiomyosarcomas present TP53 biallelic inactivation, whereas most undifferentiated pleomorphic sarcomas retain one wild-type TP53 allele (87.2%). The spectrum of mutations between these two groups of sarcomas is different, particularly with a higher rate of complex mutations in undifferentiated pleomorphic sarcomas. Most tumors without TP53 alteration exhibit a deletion of p14 and/or lack of mRNA expression, suggesting that p14 loss could be an alternative genotype for direct TP53 inactivation. Nevertheless, the fact that even in tumors altered for TP53, we could not detect p14 protein suggests that other p14 functions, independent of p53, could be implicated in sarcoma oncogenesis. In addition, both p15 and p16 are frequently codeleted or transcriptionally co-inhibited with p14, essentially in tumors with two wild-type TP53 alleles. Conversely, in TP53-altered tumors, p15 and p16 are well expressed, a feature not incompatible with an oncogenic process. PMID:20884963

  4. Establishing the precise evolutionary history of a gene improves prediction of disease-causing missense mutations

    DOE PAGES

    Adebali, Ogun; Reznik, Alexander O.; Ory, Daniel S.; ...

    2016-02-18

    Here, predicting the phenotypic effects of mutations has become an important application in clinical genetic diagnostics. Computational tools evaluate the behavior of the variant over evolutionary time and assume that variations seen during the course of evolution are probably benign in humans. However, current tools do not take into account orthologous/paralogous relationships. Paralogs have dramatically different roles in Mendelian diseases. For example, whereas inactivating mutations in the NPC1 gene cause the neurodegenerative disorder Niemann-Pick C, inactivating mutations in its paralog NPC1L1 are not disease-causing and, moreover, are implicated in protection from coronary heart disease. Methods: We identified major events inmore » NPC1 evolution and revealed and compared orthologs and paralogs of the human NPC1 gene through phylogenetic and protein sequence analyses. We predicted whether an amino acid substitution affects protein function by reducing the organism s fitness. As a result, removing the paralogs and distant homologs improved the overall performance of categorizing disease-causing and benign amino acid substitutions. In conclusion, the results show that a thorough evolutionary analysis followed by identification of orthologs improves the accuracy in predicting disease-causing missense mutations. We anticipate that this approach will be used as a reference in the interpretation of variants in other genetic diseases as well.« less

  5. Establishing the precise evolutionary history of a gene improves prediction of disease-causing missense mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adebali, Ogun; Reznik, Alexander O.; Ory, Daniel S.

    Here, predicting the phenotypic effects of mutations has become an important application in clinical genetic diagnostics. Computational tools evaluate the behavior of the variant over evolutionary time and assume that variations seen during the course of evolution are probably benign in humans. However, current tools do not take into account orthologous/paralogous relationships. Paralogs have dramatically different roles in Mendelian diseases. For example, whereas inactivating mutations in the NPC1 gene cause the neurodegenerative disorder Niemann-Pick C, inactivating mutations in its paralog NPC1L1 are not disease-causing and, moreover, are implicated in protection from coronary heart disease. Methods: We identified major events inmore » NPC1 evolution and revealed and compared orthologs and paralogs of the human NPC1 gene through phylogenetic and protein sequence analyses. We predicted whether an amino acid substitution affects protein function by reducing the organism s fitness. As a result, removing the paralogs and distant homologs improved the overall performance of categorizing disease-causing and benign amino acid substitutions. In conclusion, the results show that a thorough evolutionary analysis followed by identification of orthologs improves the accuracy in predicting disease-causing missense mutations. We anticipate that this approach will be used as a reference in the interpretation of variants in other genetic diseases as well.« less

  6. Germline mutation of CHEK2 in neurofibromatosis 1 and 2: Two case reports.

    PubMed

    Li, Qiang; Zhao, Feilong; Ju, Yan

    2018-06-01

    Neurofibromatosis, including type 1 and type 2, is inherited dominant disease that causes serious consequences. The genetic mechanism of these diseases has been described, but germline mutation of checkpoint 2 kinase gene, together with other DNA repair related genes, has not been fully elucidated in the context of neurofibromatosis. In this article, we reported identical germline mutation of CHEK2 gene (p.R180C) in a 7-year-old Tibetan boy with NF1, and in a 12-year-old Chinese girl with NF2. Neurofibromatosis 1 and 2 with CHECK2 gene germline mutation. Both patients underwent operation to obtain tumor tissue, and peripheral blood of their family was tested. Identical germline mutation of CHEK2 gene (p.R180C) was detected in both patients, and germline mutations of POLE, MUTYH and ATR were also detected. This is the first article to describe CHEK2 mutation in both NF1 and NF2. This article highlights a possible role of CHEK2, in association with other germline genetic mutations, in tumorigenesis of NF1 and NF2.

  7. LKB1 inactivation dictates therapeutic response of non-small cell lung cancer to the metabolism drug phenformin

    PubMed Central

    Shackelford, David B.; Abt, Evan; Gerken, Laurie; Vasquez, Debbie S.; Seki, Atsuko; Leblanc, Mathias; Wei, Liu; Fishbein, Michael C.; Czernin, Johannes; Mischel, Paul S.; Shaw, Reuben J.

    2013-01-01

    SUMMARY The LKB1 (also called STK11) tumor suppressor is mutationally inactivated in ~20% of non-small cell lung cancers (NSCLC). LKB1 is the major upstream kinase activating the energy-sensing kinase AMPK, making LKB1-deficient cells unable to appropriately sense metabolic stress. We tested the therapeutic potential of metabolic drugs in NSCLC and identified phenformin, a mitochondrial inhibitor and analog of the diabetes therapeutic metformin, as selectively inducing apoptosis in LKB1-deficient NSCLC cells. Therapeutic trials in Kras-dependent mouse models of NSCLC revealed that tumors with Kras and Lkb1 mutations, but not those with Kras and p53 mutations showed selective response to phenformin as a single agent, resulting in prolonged survival. This study suggests phenformin as a cancer metabolism-based therapeutic to selectively target LKB1-deficient tumors. PMID:23352126

  8. Mutation induction in haploid yeast after split-dose radiation exposure. II. Combination of UV-irradiation and X-rays.

    PubMed

    Keller, B; Zölzer, F; Kiefer, J

    2004-01-01

    Split-dose protocols can be used to investigate the kinetics of recovery from radiation damage and to elucidate the mechanisms of cell inactivation and mutation induction. In this study, a haploid strain of the yeast, Saccharomyces cerevisiae, wild-type with regard to radiation sensitivity, was irradiated with 254-nm ultraviolet (UV) light and then exposed to X-rays after incubation for 0-6 hr. The cells were incubated either on nutrient medium or salt agar between the treatments. Loss of reproductive ability and mutation to canavanine resistance were measured. When the X-ray exposure immediately followed UV-irradiation, the X-ray survival curves had the same slope irrespective of the pretreatment, while the X-ray mutation induction curves were changed from linear to linear quadratic with increasing UV fluence. Incubations up to about 3 hr on nutrient medium between the treatments led to synergism with respect to cell inactivation and antagonism with respect to mutation, but after 4-6 hr the two treatments acted independently. Incubation on salt agar did not cause any change in the survival curves, but there was a strong suppression of X-ray-induced mutation with increasing UV fluence. On the basis of these results, we suggest that mutation after combined UV and X-ray exposure is affected not only by the induction and suppression of DNA repair processes, but also by radiation-induced modifications of cell-cycle progression and changes in the expression of the mutant phenotype. Copyright 2004 Wiley-Liss, Inc.

  9. FISH-detected delay in replication timing of mutated FMR1 alleles on both active and inactive X-chromosomes.

    PubMed

    Yeshaya, J; Shalgi, R; Shohat, M; Avivi, L

    1999-01-01

    X-chromosome inactivation and the size of the CGG repeat number are assumed to play a role in the clinical, physical, and behavioral phenotype of female carriers of a mutated FMR1 allele. In view of the tight relationship between replication timing and the expression of a given DNA sequence, we have examined the replication timing of FMR1 alleles on active and inactive X-chromosomes in cell samples (lymphocytes or amniocytes) of 25 females: 17 heterozygous for a mutated FMR1 allele with a trinucleotide repeat number varying from 58 to a few hundred, and eight homozygous for a wild-type allele. We have applied two-color fluorescence in situ hybridization (FISH) with FMR1 and X-chromosome alpha-satellite probes to interphase cells of the various genotypes: the alpha-satellite probe was used to distinguish between early replicating (active) and late replicating (inactive) X-chromosomes, and the FMR1 probe revealed the replication pattern of this locus. All samples, except one with a large trinucleotide expansion, showed an early replicating FMR1 allele on the active X-chromosome and a late replicating allele on the inactive X-chromosome. In samples of mutation carriers, both the early and the late alleles showed delayed replication compared with normal alleles, regardless of repeat size. We conclude therefore that: (1) the FMR1 locus is subjected to X-inactivation; (2) mutated FMR1 alleles, regardless of repeat size, replicate later than wild-type alleles on both the active and inactive X-chromosomes; and (3) the delaying effect of the trinucleotide expansion, even with a low repeat size, is superimposed on the delay in replication associated with X-inactivation.

  10. The inactivation of RNase G reduces the Stenotrophomonas maltophilia susceptibility to quinolones by triggering the heat shock response.

    PubMed

    Bernardini, Alejandra; Corona, Fernando; Dias, Ricardo; Sánchez, Maria B; Martínez, Jose L

    2015-01-01

    Quinolone resistance is usually due to mutations in the genes encoding bacterial topoisomerases. However, different reports have shown that neither clinical quinolone resistant isolates nor in vitro obtained Stenotrophomonas maltophilia mutants present mutations in such genes. The mechanisms so far described consist on efflux pumps' overexpression. Our objective is to get information on novel mechanisms of S. maltophilia quinolone resistance. For this purpose, a transposon-insertion mutant library was obtained in S. maltophilia D457. One mutant presenting reduced susceptibility to nalidixic acid was selected. Inverse PCR showed that the inactivated gene encodes RNase G. Complementation of the mutant with wild-type RNase G allele restored the susceptibility to quinolones. Transcriptomic and real-time RT-PCR analyses showed that several genes encoding heat-shock response proteins were expressed at higher levels in the RNase defective mutant than in the wild-type strain. In agreement with this situation, heat-shock reduces the S. maltophilia susceptibility to quinolone. We can then conclude that the inactivation of the RNase G reduces the susceptibility of S. maltophilia to quinolones, most likely by regulating the expression of heat-shock response genes. Heat-shock induces a transient phenotype of quinolone resistance in S. maltophilia.

  11. De novo mutations of KIAA2022 in females cause intellectual disability and intractable epilepsy.

    PubMed

    de Lange, Iris M; Helbig, Katherine L; Weckhuysen, Sarah; Møller, Rikke S; Velinov, Milen; Dolzhanskaya, Natalia; Marsh, Eric; Helbig, Ingo; Devinsky, Orrin; Tang, Sha; Mefford, Heather C; Myers, Candace T; van Paesschen, Wim; Striano, Pasquale; van Gassen, Koen; van Kempen, Marjan; de Kovel, Carolien G F; Piard, Juliette; Minassian, Berge A; Nezarati, Marjan M; Pessoa, André; Jacquette, Aurelia; Maher, Bridget; Balestrini, Simona; Sisodiya, Sanjay; Warde, Marie Therese Abi; De St Martin, Anne; Chelly, Jamel; van 't Slot, Ruben; Van Maldergem, Lionel; Brilstra, Eva H; Koeleman, Bobby P C

    2016-12-01

    Mutations in the KIAA2022 gene have been reported in male patients with X-linked intellectual disability, and related female carriers were unaffected. Here, we report 14 female patients who carry a heterozygous de novo KIAA2022 mutation and share a phenotype characterised by intellectual disability and epilepsy. Reported females were selected for genetic testing because of substantial developmental problems and/or epilepsy. X-inactivation and expression studies were performed when possible. All mutations were predicted to result in a frameshift or premature stop. 12 out of 14 patients had intractable epilepsy with myoclonic and/or absence seizures, and generalised in 11. Thirteen patients had mild to severe intellectual disability. This female phenotype partially overlaps with the reported male phenotype which consists of more severe intellectual disability, microcephaly, growth retardation, facial dysmorphisms and, less frequently, epilepsy. One female patient showed completely skewed X-inactivation, complete absence of RNA expression in blood and a phenotype similar to male patients. In the six other tested patients, X-inactivation was random, confirmed by a non-significant twofold to threefold decrease of RNA expression in blood, consistent with the expected mosaicism between cells expressing mutant or normal KIAA2022 alleles. Heterozygous loss of KIAA2022 expression is a cause of intellectual disability in females. Compared with its hemizygous male counterpart, the heterozygous female disease has less severe intellectual disability, but is more often associated with a severe and intractable myoclonic epilepsy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  12. Can robots patch-clamp as well as humans? Characterization of a novel sodium channel mutation

    PubMed Central

    Estacion, M; Choi, J S; Eastman, E M; Lin, Z; Li, Y; Tyrrell, L; Yang, Y; Dib-Hajj, S D; Waxman, S G

    2010-01-01

    Ion channel missense mutations cause disorders of excitability by changing channel biophysical properties. As an increasing number of new naturally occurring mutations have been identified, and the number of other mutations produced by molecular approaches such as in situ mutagenesis has increased, the need for functional analysis by patch-clamp has become rate limiting. Here we compare a patch-clamp robot using planar-chip technology with human patch-clamp in a functional assessment of a previously undescribed Nav1.7 sodium channel mutation, S211P, which causes erythromelalgia. This robotic patch-clamp device can increase throughput (the number of cells analysed per day) by 3- to 10-fold. Both modes of analysis show that the mutation hyperpolarizes activation voltage dependence (−8 mV by manual profiling, −11 mV by robotic profiling), alters steady-state fast inactivation so that it requires an additional Boltzmann function for a second fraction of total current (∼20% manual, ∼40% robotic), and enhances slow inactivation (hyperpolarizing shift −15 mV by human, −13 mV robotic). Manual patch-clamping demonstrated slower deactivation and enhanced (∼2-fold) ramp response for the mutant channel while robotic recording did not, possibly due to increased temperature and reduced signal-to-noise ratio on the robotic platform. If robotic profiling is used to screen ion channel mutations, we recommend that each measurement or protocol be validated by initial comparison to manual recording. With this caveat, we suggest that, if results are interpreted cautiously, robotic patch-clamp can be used with supervision and subsequent confirmation from human physiologists to facilitate the initial profiling of a variety of electrophysiological parameters of ion channel mutations. PMID:20123784

  13. Structure-Functional Prediction and Analysis of Cancer Mutation Effects in Protein Kinases

    PubMed Central

    Dixit, Anshuman; Verkhivker, Gennady M.

    2014-01-01

    A central goal of cancer research is to discover and characterize the functional effects of mutated genes that contribute to tumorigenesis. In this study, we provide a detailed structural classification and analysis of functional dynamics for members of protein kinase families that are known to harbor cancer mutations. We also present a systematic computational analysis that combines sequence and structure-based prediction models to characterize the effect of cancer mutations in protein kinases. We focus on the differential effects of activating point mutations that increase protein kinase activity and kinase-inactivating mutations that decrease activity. Mapping of cancer mutations onto the conformational mobility profiles of known crystal structures demonstrated that activating mutations could reduce a steric barrier for the movement from the basal “low” activity state to the “active” state. According to our analysis, the mechanism of activating mutations reflects a combined effect of partial destabilization of the kinase in its inactive state and a concomitant stabilization of its active-like form, which is likely to drive tumorigenesis at some level. Ultimately, the analysis of the evolutionary and structural features of the major cancer-causing mutational hotspot in kinases can also aid in the correlation of kinase mutation effects with clinical outcomes. PMID:24817905

  14. Structure-functional prediction and analysis of cancer mutation effects in protein kinases.

    PubMed

    Dixit, Anshuman; Verkhivker, Gennady M

    2014-01-01

    A central goal of cancer research is to discover and characterize the functional effects of mutated genes that contribute to tumorigenesis. In this study, we provide a detailed structural classification and analysis of functional dynamics for members of protein kinase families that are known to harbor cancer mutations. We also present a systematic computational analysis that combines sequence and structure-based prediction models to characterize the effect of cancer mutations in protein kinases. We focus on the differential effects of activating point mutations that increase protein kinase activity and kinase-inactivating mutations that decrease activity. Mapping of cancer mutations onto the conformational mobility profiles of known crystal structures demonstrated that activating mutations could reduce a steric barrier for the movement from the basal "low" activity state to the "active" state. According to our analysis, the mechanism of activating mutations reflects a combined effect of partial destabilization of the kinase in its inactive state and a concomitant stabilization of its active-like form, which is likely to drive tumorigenesis at some level. Ultimately, the analysis of the evolutionary and structural features of the major cancer-causing mutational hotspot in kinases can also aid in the correlation of kinase mutation effects with clinical outcomes.

  15. SMARCB1/INI1 inactivation in renal medullary carcinoma.

    PubMed

    Calderaro, Julien; Moroch, Julien; Pierron, Gaelle; Pedeutour, Florence; Grison, Camille; Maillé, Pascale; Soyeux, Pascale; de la Taille, Alexandre; Couturier, Jérome; Vieillefond, Annick; Rousselet, Marie Christine; Delattre, Olivier; Allory, Yves

    2012-09-01

    Renal medullary carcinoma (RMC), a rare and highly aggressive tumour which occurs in patients with sickle-cell disease, shares many clinicopathological features with collecting duct carcinoma (CDC). The molecular mechanisms underlying RMC and CDC are mainly unknown, and there is ongoing debate about their status as distinct entities. Loss of expression of SMARCB1/INI1, a chromatin remodelling regulator and repressor of cyclin D1 transcription, has been reported recently in RMC. The aim of our study was to investigate if such loss of expression is specific for RMC. SMARCB1/INI1 genetic alterations and cyclin D1 expression were also studied. Using immunochemistry, neoplastic cells showed complete loss of SMARCB1/INI1 expression in all six cases of RMC but in only one of 22 cases of CDC. In two RMC cases investigated, comparative genomic hybridization demonstrated complete loss of one SMARCB1/INI1 allele, with no other genomic imbalances, and no mutations were found on the remaining allele. Cyclin D1 was expressed in all RMCs, suggesting that SMARCB1/INI1 inactivation may result in increased cyclin D1 transcription. The specific SMARCB1/INI1 inactivation observed in RMCs suggests that RMC and CDC are different entities. © 2012 Blackwell Publishing Ltd.

  16. Determination of Time Dependent Virus Inactivation Rates

    NASA Astrophysics Data System (ADS)

    Chrysikopoulos, C. V.; Vogler, E. T.

    2003-12-01

    A methodology is developed for estimating temporally variable virus inactivation rate coefficients from experimental virus inactivation data. The methodology consists of a technique for slope estimation of normalized virus inactivation data in conjunction with a resampling parameter estimation procedure. The slope estimation technique is based on a relatively flexible geostatistical method known as universal kriging. Drift coefficients are obtained by nonlinear fitting of bootstrap samples and the corresponding confidence intervals are obtained by bootstrap percentiles. The proposed methodology yields more accurate time dependent virus inactivation rate coefficients than those estimated by fitting virus inactivation data to a first-order inactivation model. The methodology is successfully applied to a set of poliovirus batch inactivation data. Furthermore, the importance of accurate inactivation rate coefficient determination on virus transport in water saturated porous media is demonstrated with model simulations.

  17. Selenocysteine Confers Resistance to Inactivation by Oxidation in Thioredoxin Reductase: Comparison of Selenium and Sulfur Enzymes†

    PubMed Central

    Snider, Gregg W.; Ruggles, Erik; Khan, Nadeem; Hondal, Robert J.

    2013-01-01

    Mammalian thioredoxin reductase (TR) is a selenocysteine (Sec)-containing homodimeric pyridine nucleotide oxidoreductase which catalyzes the reduction of oxidized thioredoxin. We have previously demonstrated the full-length mitochondrial mammalian TR (mTR3) enzyme to be resistant to inactivation from exposure to 50 mM H2O2. Because a Sec residue oxidizes more rapidly than a cysteine (Cys) residue, it has been previously thought that Sec-containing enzymes are “sensitive to oxidation” compared to Cys-orthologs. Here we show for the first time a direct comparison of the abilities of Sec-containing mTR3 and the Cys-ortholog from D. melanogaster (DmTR) to resist inactivation by oxidation from a variety of oxidants including H2O2, hydroxyl radical, peroxynitrite, hypochlorous acid, hypobromous acid, and hypothiocyanous acid. The results show that the Sec-containing TR is far superior to the Cys-ortholog TR in resisting inactivation by oxidation. To further test our hypothesis that the use of Sec confers strong resistance to inactivation by oxidation, we constructed a chimeric enzyme in which we replaced the active site Cys nucleophile of DmTR with a Sec residue using semisynthesis. The chimeric Sec-containing enzyme has similar ability to resist inactivation by oxidation as the wild type Sec-containing TR from mouse mitochondria. The use of Sec in the chimeric enzyme “rescued” the enzyme from oxidant-induced inactivation for all of the oxidants tested in this study, in direct contrast to previous understanding. We discuss two possibilities for this rescue effect from inactivation under identical conditions of oxidative stress: (i) Sec resists over-oxidation and inactivation, whereas a Cys residue can be permanently over-oxidized to the sulfinic acid form, and (ii) Sec protects the body of the enzyme from harmful oxidation by allowing the enzyme to metabolize (turnover) various oxidants much better than a Cys-containing TR. PMID:23865454

  18. Ftx is a non-coding RNA which affects Xist expression and chromatin structure within the X-inactivation center region.

    PubMed

    Chureau, Corinne; Chantalat, Sophie; Romito, Antonio; Galvani, Angélique; Duret, Laurent; Avner, Philip; Rougeulle, Claire

    2011-02-15

    X chromosome inactivation (XCI) is an essential epigenetic process which involves several non-coding RNAs (ncRNAs), including Xist, the master regulator of X-inactivation initiation. Xist is flanked in its 5' region by a large heterochromatic hotspot, which contains several transcription units including a gene of unknown function, Ftx (five prime to Xist). In this article, we describe the characterization and functional analysis of murine Ftx. We present evidence that Ftx produces a conserved functional long ncRNA, and additionally hosts microRNAs (miR) in its introns. Strikingly, Ftx partially escapes X-inactivation and is upregulated specifically in female ES cells at the onset of X-inactivation, an expression profile which closely follows that of Xist. We generated Ftx null ES cells to address the function of this gene. In these cells, only local changes in chromatin marks are detected within the hotspot, indicating that Ftx is not involved in the global maintenance of the heterochromatic structure of this region. The Ftx mutation, however, results in widespread alteration of transcript levels within the X-inactivation center (Xic) and particularly important decreases in Xist RNA levels, which were correlated with increased DNA methylation at the Xist CpG island. Altogether our results indicate that Ftx is a positive regulator of Xist and lead us to propose that Ftx is a novel ncRNA involved in XCI.

  19. Selection of tRNA(Asp) amber suppressor mutants having alanine, arginine, glutamine, and lysine identity.

    PubMed Central

    Martin, F; Reinbolt, J; Dirheimer, G; Gangloff, J; Eriani, G

    1996-01-01

    Elements that confer identity to a tRNA in the cellular environment, where all aminoacyl-tRNA synthetases are competing for substrates, may be delineated by in vivo experiments using suppressor tRNAs. Here we describe the selection of active Escherichia coli tRNAAsp amber mutants and analyze their identity. Starting from a library containing randomly mutated tRNA(CUA)Asp genes, we isolated four amber suppressors presenting either lysine, alanine, or glutamine activity. Two of them, presenting mainly alanine or lysine activity, were further submitted to a second round of mutagenesis selection in order to improve their efficiency of suppression. Eleven suppressors were isolated, each containing two or three mutations. Ten presented identities of the two parental mutants, whereas one had switched from lysine to arginine identity. Analysis of the different mutants revealed (or confirmed for some nucleotides) their role as positive and/or negative determinants in AlaRS, LysRS, and ArgRS recognition. More generally, it appears that tRNAAsp presents identity characteristics closely related to those of tRNALys, as well as a structural basis for acquiring alanine or arginine identity upon moderate mutational changes; these consist of addition or suppression of the corresponding positive or negative determinants, as well as tertiary interactions. Failure to isolate aspartic acid-inserting suppressors is probably due to elimination of the important G34 identity element and its replacement by an antideterminant when changing the anticodon of the tRNAAsp to the CUA triplet. PMID:8809018

  20. Infectivity of RNA from inactivated poliovirus.

    PubMed

    Nuanualsuwan, Suphachai; Cliver, Dean O

    2003-03-01

    During inactivation of poliovirus type 1 (PV-1) by exposure to UV, hypochlorite, and heat (72 degrees C), the infectivity of the virus was compared with that of its RNA. DEAE-dextran (1-mg/ml concentration in Dulbecco's modified Eagle medium buffered with 0.05 M Tris, pH 7.4) was used to facilitate transfecting PV-1 RNA into FRhK-4 host cells. After interaction of PV-1 RNA with cell monolayer at room temperature (21 to 22 degrees C) for 20 min, the monolayers were washed with 5 ml of Hanks balanced salt solution. The remainder of the procedure was the same as that for the conventional plaque technique, which was also used for quantifying the PV-1 whole-particle infectivity. Plaque formation by extracted RNA was approximately 100,000-fold less efficient than that by whole virions. The slopes of best-fit regression lines of inactivation curves for virion infectivity and RNA infectivity were compared to determine the target of inactivation. For UV and hypochlorite inactivation the slopes of inactivation curves of virion infectivity and RNA infectivity were not statistically different. However, the difference of slopes of inactivation curves of virion infectivity and RNA infectivity was statistically significant for thermal inactivation. The results of these experiments indicate that viral RNA is a primary target of UV and hypochlorite inactivations but that the sole target of thermal inactivation is the viral capsid.

  1. Infectivity of RNA from Inactivated Poliovirus

    PubMed Central

    Nuanualsuwan, Suphachai; Cliver, Dean O.

    2003-01-01

    During inactivation of poliovirus type 1 (PV-1) by exposure to UV, hypochlorite, and heat (72°C), the infectivity of the virus was compared with that of its RNA. DEAE-dextran (1-mg/ml concentration in Dulbecco's modified Eagle medium buffered with 0.05 M Tris, pH 7.4) was used to facilitate transfecting PV-1 RNA into FRhK-4 host cells. After interaction of PV-1 RNA with cell monolayer at room temperature (21 to 22°C) for 20 min, the monolayers were washed with 5 ml of Hanks balanced salt solution. The remainder of the procedure was the same as that for the conventional plaque technique, which was also used for quantifying the PV-1 whole-particle infectivity. Plaque formation by extracted RNA was approximately 100,000-fold less efficient than that by whole virions. The slopes of best-fit regression lines of inactivation curves for virion infectivity and RNA infectivity were compared to determine the target of inactivation. For UV and hypochlorite inactivation the slopes of inactivation curves of virion infectivity and RNA infectivity were not statistically different. However, the difference of slopes of inactivation curves of virion infectivity and RNA infectivity was statistically significant for thermal inactivation. The results of these experiments indicate that viral RNA is a primary target of UV and hypochlorite inactivations but that the sole target of thermal inactivation is the viral capsid. PMID:12620852

  2. The SCN8A encephalopathy mutation p.Ile1327Val displays elevated sensitivity to the anticonvulsant phenytoin.

    PubMed

    Barker, Bryan S; Ottolini, Matteo; Wagnon, Jacy L; Hollander, Rachel M; Meisler, Miriam H; Patel, Manoj K

    2016-09-01

    SCN8A encephalopathy (early infantile epileptic encephalopathy; EIEE13) is caused by gain-of-function mutations resulting in hyperactivity of the voltage-gated sodium channel Nav 1.6. The channel is concentrated at the axon initial segment (AIS) and is involved in establishing neuronal excitability. Clinical features of SCN8A encephalopathy include seizure onset between 0 and 18 months of age, intellectual disability, and developmental delay. Seizures are often refractory to treatment with standard antiepileptic drugs, and sudden unexpected death in epilepsy (SUDEP) has been reported in approximately 10% of patients. In a recent study, high doses of phenytoin were effective in four patients with SCN8A encephalopathy. In view of this observation, we have investigated the relationship between the functional effect of the SCN8A mutation p.Ile1327Val and its response to phenytoin. The mutation was introduced into the Scn8a cDNA by site-directed mutagenesis. Channel activity was characterized in transfected ND7/23 cells. The effects of phenytoin (100 μm) on mutant and wild-type (WT) channels were compared. Channel activation parameters were shifted in a hyperpolarizing direction in the mutant channel, whereas inactivation parameters were shifted in a depolarizing direction, increasing Na channel window current. Macroscopic current decay was slowed in I1327V channels, indicating an impairment in the transition from open state to inactivated state. Channel deactivation was also delayed, allowing more channels to remain in the open state. Phenytoin (100 μm) resulted in hyperpolarized activation and inactivation curves as well as greater tonic block and use-dependent block of I1327V mutant channels relative to WT. SCN8A - I1327V is a gain-of-function mutation with altered features that are predicted to increase neuronal excitability and seizure susceptibility. Phenytoin is an effective inhibitor of the mutant channel and may be of use in treating patients with gain

  3. The SCN8A encephalopathy mutation p.Ile1327Val displays elevated sensitivity to the anticonvulsant phenytoin

    PubMed Central

    Barker, Bryan S.; Ottolini, Matteo; Wagnon, Jacy L.; Hollander, Rachel; Meisler, Miriam H.; Patel, Manoj K.

    2016-01-01

    Objective SCN8A encephalopathy (EIEE13) is caused by gain-of-function mutations resulting in hyperactivity of the voltage-gated sodium channel Nav1.6. The channel is concentrated at the axon initial segment (AIS) and is involved in establishing neuronal excitability. Clinical features of SCN8A encephalopathy include seizure onset between 0–18 months of age, intellectual disability, and developmental delay. Seizures are often refractory to treatment with standard anti-epileptic drugs, and sudden unexpected death in epilepsy (SUDEP) has been reported in approximately 10% of patients. In a recent study, high doses of phenytoin were effective in four patients with SCN8A encephalopathy. In view of this observation, we have investigated the relationship between the functional effect of the SCN8A mutation p.Ile1327Val and its response to phenytoin. Methods The mutation was introduced into the Scn8a cDNA by site-directed mutagenesis. Channel activity was characterized in transfected ND7/23 cells. The effects of phenytoin (100 μM) on mutant and wild type (WT) channels were compared. Results Channel activation parameters were shifted in a hyperpolarizing direction in the mutant channel, while inactivation parameters were shifted in a depolarizing direction, increasing Na channel window current. Macroscopic current decay was slowed in I1327V channels, indicating an impairment in the transition from open state to inactivated state. Channel deactivation was also delayed, allowing more channels to remain in the open state. Phenytoin (100 μM) resulted in hyperpolarized activation and inactivation curves as well as greater tonic block and use dependent block of I1327V mutant channels relative to WT. Significance SCN8A – I1327V is a gain-of-function mutation with altered features that are predicted to increase neuronal excitability and seizure susceptibility. Phenytoin is an effective inhibitor of the mutant channel and may be of use in treating patients with gain

  4. Inactivation of the Gastrokine 1 gene in gastric adenomas and carcinomas.

    PubMed

    Yoon, Jung Hwan; Song, Jae Hwi; Zhang, Cao; Jin, Meishan; Kang, Young Hwi; Nam, Suk Woo; Lee, Jung Young; Park, Won Sang

    2011-04-01

    Gastrokine 1 (GKN1) plays a role in the gastric mucosal defence mechanism and may be a gastric tumour suppressor. We have investigated whether inactivation of the GKN1 gene is involved in the development and/or progression of gastric cancers. GKN1 protein expression was examined in gastric adenomas and cancer and we also analysed GKN1 mutation and epigenetic alteration, DNA copy number change and mRNA transcript expression. The effect of GKN1 on cell proliferation and death was examined in wild-type GKN1-transfected AGS gastric cancer cells. Reduced or loss of GKN1 expression was detected in 36 (90%) and 170 (89.5%) of 40 adenomas and 190 gastric cancers, respectively. Statistically, there was no significant relationship between altered expression of GKN1 protein and clinicopathological parameters, including depth of invasion, location and lymph node metastasis (χ(2) test, p > 0.05). In western blot analysis, absence or reduced expression was found in 21 (84.0%) of 25 gastric carcinomas. No mutation was detected in gastric tumours, and hypermethylation of GKN1 gene was found in two tumours. DNA copy number and mRNA transcript of GKN1 were significantly decreased in gastric cancers. In functional analysis, AGS gastric cancer cells transfected with GKN1 wild-type showed marked inhibition of cell proliferation and induction of cell death. These data suggest that inactivation of the GKN1 gene may play an important role in the development of sporadic gastric cancers, as an early event. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  5. BTKbase, mutation database for X-linked agammaglobulinemia (XLA).

    PubMed Central

    Vihinen, M; Brandau, O; Brandén, L J; Kwan, S P; Lappalainen, I; Lester, T; Noordzij, J G; Ochs, H D; Ollila, J; Pienaar, S M; Riikonen, P; Saha, B K; Smith, C I

    1998-01-01

    X-linked agammaglobulinemia (XLA) is an immunodeficiency caused by mutations in the gene coding for Bruton's agammaglobulinemia tyrosine kinase (BTK). A database (BTKbase) of BTK mutations has been compiled and the recent update lists 463 mutation entries from 406 unrelated families showing 303 unique molecular events. In addition to mutations, the database also lists variants or polymorphisms. Each patient is given a unique patient identity number (PIN). Information is included regarding the phenotype including symptoms. Mutations in all the five domains of BTK have been noticed to cause the disease, the most common event being missense mutations. The mutations appear almost uniformly throughout the molecule and frequently affect CpG sites that code for arginine residues. The putative structural implications of all the missense mutations are given in the database. The improved version of the registry having a number of new features is available at http://www. helsinki.fi/science/signal/btkbase.html PMID:9399844

  6. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    PubMed

    Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana

    2016-07-18

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis.

  7. Unique sex chromosome systems in Ellobius: How do male XX chromosomes recombine and undergo pachytene chromatin inactivation?

    PubMed Central

    Matveevsky, Sergey; Bakloushinskaya, Irina; Kolomiets, Oxana

    2016-01-01

    Most mammalian species have heteromorphic sex chromosomes in males, except for a few enigmatic groups such as the mole voles Ellobius, which do not have the Y chromosome and Sry gene. The Ellobius (XX ♀♂) system of sex chromosomes has no analogues among other animals. The structure and meiotic behaviour of the two X chromosomes were investigated for males of the sibling species Ellobius talpinus and Ellobius tancrei. Their sex chromosomes, despite their identical G-structure, demonstrate short synaptic fragments and crossover-associated MLH1 foci in both telomeric regions only. The chromatin undergoes modifications in the meiotic sex chromosomes. SUMO-1 marks a small nucleolus-like body of the meiotic XX. ATR and ubiH2A are localized in the asynaptic area and the histone γH2AFX covers the entire XX bivalent. The distribution of some markers of chromatin inactivation differentiates sex chromosomes of mole voles from those of other mammals. Sex chromosomes of both studied species have identical recombination and meiotic inactivation patterns. In Ellobius, similar chromosome morphology masks the functional heteromorphism of the male sex chromosomes, which can be seen at meiosis. PMID:27425629

  8. The relationship between glucocerebrosidase mutations and Parkinson disease.

    PubMed

    Migdalska-Richards, Anna; Schapira, Anthony H V

    2016-10-01

    Parkinson disease (PD) is the second most common neurodegenerative disorder after Alzheimer disease, whereas Gaucher disease (GD) is the most frequent lysosomal storage disorder caused by homozygous mutations in the glucocerebrosidase (GBA1) gene. Increased risk of developing PD has been observed in both GD patients and carriers. It has been estimated that GBA1 mutations confer a 20- to 30-fold increased risk for the development of PD, and that at least 7-10% of PD patients have a GBA1 mutation. To date, mutations in the GBA1 gene constitute numerically the most important risk factor for PD. The type of PD associated with GBA1 mutations (PD-GBA1) is almost identical to idiopathic PD, except for a slightly younger age of onset and a tendency to more cognitive impairment. Importantly, the pathology of PD-GBA1 is identical to idiopathic PD, with nigral dopamine cell loss, Lewy bodies, and neurites containing alpha-synuclein. The mechanism by which GBA1 mutations increase the risk for PD is still unknown. However, given that clinical manifestation and pathological findings in PD-GBA1 patients are almost identical to those in idiopathic PD individuals, it is likely that, as in idiopathic PD, alpha-synuclein accumulation, mitochondrial dysfunction, autophagic impairment, oxidative and endoplasmic reticulum stress may contribute to the development and progression of PD-GBA1. Here, we review the GBA1 gene, its role in GD, and its link with PD. The impact of glucocerebrosidase 1 (GBA1) mutations on functioning of endoplasmic reticulum (ER), lysosomes, and mitochondria. GBA1 mutations resulting in production of misfolded glucocerebrosidase (GCase) significantly affect the ER functioning. Misfolded GCase trapped in the ER leads to both an increase in the ubiquitin-proteasome system (UPS) and the ER stress. The presence of ER stress triggers the unfolded protein response (UPR) and/or endoplasmic reticulum-associated degradation (ERAD). The prolonged activation of UPR and ERAD

  9. Characterization of Oxygen-Induced Retinopathy in Mice Carrying an Inactivating Point Mutation in the Catalytic Site of ADAM15

    PubMed Central

    Maretzky, Thorsten; Blobel, Carl P.; Guaiquil, Victor

    2014-01-01

    Purpose. Retinal neovascularization is found in diseases such as macular degeneration, diabetic retinopathy, or retinopathy of prematurity and is usually caused by alterations in oxygen supply. We have previously described that mice lacking the membrane-anchored metalloproteinase ADAM15 (a Disintegrin and Metalloprotease 15) have decreased pathological neovascularization of the retina in the oxygen-induced retinopathy (OIR) model. The main purpose of the present study was to determine the contribution of the catalytic activity of ADAM15 to OIR. Methods. To address this question, we generated knock-in mice carrying an inactivating Glutamate to Alanine (E>A) point mutation in the catalytic site of ADAM15 (Adam15E>A mice) and subjected these animals to the OIR model and a heterotopic tumor model. Moreover, we used cell-based assays to determine whether ADAM15 can process cell surface receptors involved in angiogenesis. Results. We found that pathological neovascularization in the OIR model in Adam15E>A mice was comparable to that observed in wild type mice, but tumor implantation by heterotopically injected melanoma cells was reduced. In cell-based assays, overexpressed ADAM15 could process the FGFR2iiib, but was unable to process several receptors with roles in angiogenesis. Conclusions. Collectively, these results suggest that the catalytic activity of ADAM15 is not crucial for its function in promoting pathological neovascularization in the mouse OIR model, most likely because of the very limited substrate repertoire of ADAM15. Instead, other noncatalytic functions of ADAM15 must be important for its role in the OIR model. PMID:25249606

  10. Targeted inactivation of fh1 causes proliferative renal cyst development and activation of the hypoxia pathway.

    PubMed

    Pollard, Patrick J; Spencer-Dene, Bradley; Shukla, Deepa; Howarth, Kimberley; Nye, Emma; El-Bahrawy, Mona; Deheragoda, Maesha; Joannou, Maria; McDonald, Stuart; Martin, Alison; Igarashi, Peter; Varsani-Brown, Sunita; Rosewell, Ian; Poulsom, Richard; Maxwell, Patrick; Stamp, Gordon W; Tomlinson, Ian P M

    2007-04-01

    Germline mutations in the fumarate hydratase (FH) tumor suppressor gene predispose to leiomyomatosis, renal cysts, and renal cell cancer (HLRCC). HLRCC tumors overexpress HIF1alpha and hypoxia pathway genes. We conditionally inactivated mouse Fh1 in the kidney. Fh1 mutants developed multiple clonal renal cysts that overexpressed Hif1alpha and Hif2alpha. Hif targets, such as Glut1 and Vegf, were upregulated. We found that Fh1-deficient murine embryonic stem cells and renal carcinomas from HLRCC showed similar overexpression of HIF and hypoxia pathway components to the mouse cysts. Our data have shown in vivo that pseudohypoxic drive, resulting from HIF1alpha (and HIF2alpha) overexpression, is a direct consequence of Fh1 inactivation. Our mouse may be useful for testing therapeutic interventions that target angiogenesis and HIF-prolyl hydroxylation.

  11. Inactivation, DNA double strand break induction and their rejoining in bacterial cells irradiated with heavy ions

    NASA Technical Reports Server (NTRS)

    Schaefer, M.; Zimmermann, H.; Schmitz, C.

    1994-01-01

    Besides inactivation one of the major interests in our experiments is to study the primary damage in the DNA double strand breaks (DSB) after heavy ion irradiation. These damages lead not only to cell death but also under repair activities to mutations. In further experiments we have investigated the inactivation with two different strains of Deinococcus radiodurans (R1, Rec 30) and the induction of DSB as well as the rejoining of DSB in stationary cells of E. coli (strain B/r) irradiated with radiations of different quality. In the latter case irradiations were done so that the cell survival was roughly at the same level. We measured the DSB using the pulse field gelelectrophoresis which allows to separate between intact (circular) and damaged (linear) DNA. The irradiated cells were transferred to NB medium and incubated for different times to allow rejoining.

  12. Glucokinase gene mutations (MODY 2) in Asian Indians.

    PubMed

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  13. Computational design and experimental study of tighter binding peptides to an inactivated mutant of HIV-1 protease

    PubMed Central

    Altman, Michael D.; Nalivaika, Ellen A.; Prabu-Jeyabalan, Moses; Schiffer, Celia A.; Tidor, Bruce

    2009-01-01

    Drug resistance in HIV-1 protease, a barrier to effective treatment, is generally caused by mutations in the enzyme that disrupt inhibitor binding but still allow for substrate processing. Structural studies with mutant, inactive enzyme, have provided detailed information regarding how the substrates bind to the protease yet avoid resistance mutations; insights obtained inform the development of next generation therapeutics. Although structures have been obtained of complexes between substrate peptide and inactivated (D25N) protease, thermodynamic studies of peptide binding have been challenging due to low affinity. Peptides that bind tighter to the inactivated protease than the natural substrates would be valuable for thermodynamic studies as well as to explore whether the structural envelope observed for substrate peptides is a function of weak binding. Here, two computational methods — namely, charge optimization and protein design — were applied to identify peptide sequences predicted to have higher binding affinity to the inactivated protease, starting from an RT–RH derived substrate peptide. Of the candidate designed peptides, three were tested for binding with isothermal titration calorimetry, with one, containing a single threonine to valine substitution, measured to have more than a ten-fold improvement over the tightest binding natural substrate. Crystal structures were also obtained for the same three designed peptide complexes; they show good agreement with computational prediction. Thermodynamic studies show that binding is entropically driven, more so for designed affinity enhanced variants than for the starting substrate. Structural studies show strong similarities between natural and tighter-binding designed peptide complexes, which may have implications in understanding the molecular mechanisms of drug resistance in HIV-1 protease. PMID:17729291

  14. Mutations in the Gardos channel (KCNN4) are associated with hereditary xerocytosis.

    PubMed

    Glogowska, Edyta; Lezon-Geyda, Kimberly; Maksimova, Yelena; Schulz, Vincent P; Gallagher, Patrick G

    2015-09-10

    Hereditary xerocytosis (HX; MIM 194380) is an autosomal-dominant hemolytic anemia characterized by primary erythrocyte dehydration. In many patients, heterozygous mutations associated with delayed channel inactivation have been identified in PIEZO1. This report describes patients from 2 well-phenotyped HX kindreds, including from one of the first HX kindreds described, who lack predicted heterozygous PIEZO1-linked variants. Whole-exome sequencing identified novel, heterozygous mutations affecting the Gardos channel, encoded by the KCNN4 gene, in both kindreds. Segregation analyses confirmed transmission of the Gardos channel mutations with disease phenotype in affected individuals. The KCNN4 variants were different mutations in the same residue, which is highly conserved across species and within members of the small-intermediate family of calcium-activated potassium channel proteins. Both mutations were predicted to be deleterious by mutation effect algorithms. In sickle erythrocytes, the Gardos channel is activated under deoxy conditions, leading to cellular dehydration due to salt and water loss. The identification of KCNN4 mutations in HX patients supports recent studies that indicate it plays a critical role in normal erythrocyte deformation in the microcirculation and participates in maintenance of erythrocyte volume homeostasis. © 2015 by The American Society of Hematology.

  15. Mutations in the Gardos channel (KCNN4) are associated with hereditary xerocytosis

    PubMed Central

    Glogowska, Edyta; Lezon-Geyda, Kimberly; Maksimova, Yelena; Schulz, Vincent P.

    2015-01-01

    Hereditary xerocytosis (HX; MIM 194380) is an autosomal-dominant hemolytic anemia characterized by primary erythrocyte dehydration. In many patients, heterozygous mutations associated with delayed channel inactivation have been identified in PIEZO1. This report describes patients from 2 well-phenotyped HX kindreds, including from one of the first HX kindreds described, who lack predicted heterozygous PIEZO1-linked variants. Whole-exome sequencing identified novel, heterozygous mutations affecting the Gardos channel, encoded by the KCNN4 gene, in both kindreds. Segregation analyses confirmed transmission of the Gardos channel mutations with disease phenotype in affected individuals. The KCNN4 variants were different mutations in the same residue, which is highly conserved across species and within members of the small-intermediate family of calcium-activated potassium channel proteins. Both mutations were predicted to be deleterious by mutation effect algorithms. In sickle erythrocytes, the Gardos channel is activated under deoxy conditions, leading to cellular dehydration due to salt and water loss. The identification of KCNN4 mutations in HX patients supports recent studies that indicate it plays a critical role in normal erythrocyte deformation in the microcirculation and participates in maintenance of erythrocyte volume homeostasis. PMID:26198474

  16. Repurposing Pan-HDAC Inhibitors for ARID1A-Mutated Ovarian Cancer.

    PubMed

    Fukumoto, Takeshi; Park, Pyoung Hwa; Wu, Shuai; Fatkhutdinov, Nail; Karakashev, Sergey; Nacarelli, Timothy; Kossenkov, Andrew V; Speicher, David W; Jean, Stephanie; Zhang, Lin; Wang, Tian-Li; Shih, Ie-Ming; Conejo-Garcia, Jose R; Bitler, Benjamin G; Zhang, Rugang

    2018-03-27

    ARID1A, a subunit of the SWI/SNF complex, is among the most frequently mutated genes across cancer types. ARID1A is mutated in more than 50% of ovarian clear cell carcinomas (OCCCs), diseases that have no effective therapy. Here, we show that ARID1A mutation confers sensitivity to pan-HDAC inhibitors such as SAHA in ovarian cancers. This correlated with enhanced growth suppression induced by the inhibition of HDAC2 activity in ARID1A-mutated cells. HDAC2 interacts with EZH2 in an ARID1A status-dependent manner. HDAC2 functions as a co-repressor of EZH2 to suppress the expression of EZH2/ARID1A target tumor suppressor genes such as PIK3IP1 to inhibit proliferation and promote apoptosis. SAHA reduced the growth and ascites of the ARID1A-inactivated OCCCs in both orthotopic and genetic mouse models. This correlated with a significant improvement of survival of mice bearing ARID1A-mutated OCCCs. These findings provided preclinical rationales for repurposing FDA-approved pan-HDAC inhibitors for treating ARID1A-mutated cancers. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Xeroderma Pigmentosum: Low Prevalence of Germline XPA Mutations in a Brazilian XP Population

    PubMed Central

    Santiago, Karina Miranda; França de Nóbrega, Amanda; Rocha, Rafael Malagoli; Rogatto, Silvia Regina; Achatz, Maria Isabel

    2015-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by DNA repair defects that cause photophobia, sunlight-induced cancers, and neurodegeneration. Prevalence of germline mutations in the nucleotide excision repair gene XPA vary significantly in different populations. No Brazilian patients have been reported to carry a germline mutation in this gene. In this study, the germline mutational status of XPA was determined in Brazilian patients exhibiting major clinical features of XP syndrome. The study was conducted on 27 unrelated patients from select Brazilian families. A biallelic inactivating transition mutation c.619C>T (p.Arg207Ter) was identified in only one patient with a history of neurological impairment and mild skin abnormalities. These findings suggest that XP syndrome is rarely associated with inherited disease-causing XPA mutations in the Brazilian population. Additionally, this report demonstrates the effectiveness of genotype-phenotype correlation as a valuable tool to guide direct genetic screening. PMID:25913378

  18. Xeroderma pigmentosum: low prevalence of germline XPA mutations in a Brazilian XP population.

    PubMed

    Santiago, Karina Miranda; França de Nóbrega, Amanda; Rocha, Rafael Malagoli; Rogatto, Silvia Regina; Achatz, Maria Isabel

    2015-04-22

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by DNA repair defects that cause photophobia, sunlight-induced cancers, and neurodegeneration. Prevalence of germline mutations in the nucleotide excision repair gene XPA vary significantly in different populations. No Brazilian patients have been reported to carry a germline mutation in this gene. In this study, the germline mutational status of XPA was determined in Brazilian patients exhibiting major clinical features of XP syndrome. The study was conducted on 27 unrelated patients from select Brazilian families. A biallelic inactivating transition mutation c.619C>T (p.Arg207Ter) was identified in only one patient with a history of neurological impairment and mild skin abnormalities. These findings suggest that XP syndrome is rarely associated with inherited disease-causing XPA mutations in the Brazilian population. Additionally, this report demonstrates the effectiveness of genotype-phenotype correlation as a valuable tool to guide direct genetic screening.

  19. Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis.

    PubMed

    Estoup, Arnaud; Jarne, Philippe; Cornuet, Jean-Marie

    2002-09-01

    Homoplasy has recently attracted the attention of population geneticists, as a consequence of the popularity of highly variable stepwise mutating markers such as microsatellites. Microsatellite alleles generally refer to DNA fragments of different size (electromorphs). Electromorphs are identical in state (i.e. have identical size), but are not necessarily identical by descent due to convergent mutation(s). Homoplasy occurring at microsatellites is thus referred to as size homoplasy. Using new analytical developments and computer simulations, we first evaluate the effect of the mutation rate, the mutation model, the effective population size and the time of divergence between populations on size homoplasy at the within and between population levels. We then review the few experimental studies that used various molecular techniques to detect size homoplasious events at some microsatellite loci. The relationship between this molecularly accessible size homoplasy size and the actual amount of size homoplasy is not trivial, the former being considerably influenced by the molecular structure of microsatellite core sequences. In a third section, we show that homoplasy at microsatellite electromorphs does not represent a significant problem for many types of population genetics analyses realized by molecular ecologists, the large amount of variability at microsatellite loci often compensating for their homoplasious evolution. The situations where size homoplasy may be more problematic involve high mutation rates and large population sizes together with strong allele size constraints.

  20. Drug-drug interactions via mechanism-based cytochrome P450 inactivation: points to consider for risk assessment from in vitro data and clinical pharmacologic evaluation.

    PubMed

    Venkatakrishnan, Karthik; Obach, R Scott

    2007-06-01

    This commentary discusses the approaches to, and key considerations in the in vitro-in vivo extrapolation of drug-drug interactions (DDI) resulting from mechanism-based inactivation (MBI) of cytochrome P450 (CYP) enzymes and clinical pharmacologic implications. In vitro kinetic assessment and prediction of DDI produced via reversible inhibition and MBI rely on operationally and conceptually distinct approaches. DDI risk assessment for inactivators requires estimation of maximal inactivation rate (k(inact)) and inactivator potency (KI) in vitro, that need to be considered in context of the biological turnover rate of the enzyme (kdeg) and clinical exposures of the inactivator (I), respectively, to predict interaction magnitude. Risk assessment cannot be performed by a simple comparison of inactivator potency against in vivo exposure since inactivation is both concentration and time-dependent. MBI contour plots tracking combinations of I:KI and k(inact):k(deg) resulting in identical fold-reductions in intrinsic clearance are proposed as a useful framework for DDI risk assessment. Additionally, substrate-specific factors like fraction of the total clearance of the object drug via the enzyme being inactivated (f(m(CYP) )) and the bioavailability fraction across the intestine for CYP3A substrates (F(G)) are important determinants of interaction magnitude. Sensitivity analysis of predicted DDI magnitude to uncertainty in input parameters is recommended to inform confidence in predictions. The time course of reversal of DDI resulting from CYP inactivation is determined by the half-life of the enzyme which is an important consideration in the design and interpretation of clinical DDI studies with inactivators.

  1. LKB1 inactivation dictates therapeutic response of non-small cell lung cancer to the metabolism drug phenformin.

    PubMed

    Shackelford, David B; Abt, Evan; Gerken, Laurie; Vasquez, Debbie S; Seki, Atsuko; Leblanc, Mathias; Wei, Liu; Fishbein, Michael C; Czernin, Johannes; Mischel, Paul S; Shaw, Reuben J

    2013-02-11

    The LKB1 (also called STK11) tumor suppressor is mutationally inactivated in ∼20% of non-small cell lung cancers (NSCLC). LKB1 is the major upstream kinase activating the energy-sensing kinase AMPK, making LKB1-deficient cells unable to appropriately sense metabolic stress. We tested the therapeutic potential of metabolic drugs in NSCLC and identified phenformin, a mitochondrial inhibitor and analog of the diabetes therapeutic metformin, as selectively inducing apoptosis in LKB1-deficient NSCLC cells. Therapeutic trials in Kras-dependent mouse models of NSCLC revealed that tumors with Kras and Lkb1 mutations, but not those with Kras and p53 mutations, showed selective response to phenformin as a single agent, resulting in prolonged survival. This study suggests phenformin as a cancer metabolism-based therapeutic to selectively target LKB1-deficient tumors. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Epigenetic inactivation of TCF2 in ovarian cancer and various cancer cell lines

    PubMed Central

    Terasawa, K; Toyota, M; Sagae, S; Ogi, K; Suzuki, H; Sonoda, T; Akino, K; Maruyama, R; Nishikawa, N; Imai, K; Shinomura, Y; Saito, T; Tokino, T

    2006-01-01

    Transcription factor 2 gene (TCF2) encodes hepatocyte nuclear factor 1β (HNF1β), a transcription factor associated with development and metabolism. Mutation of TCF2 has been observed in renal cell cancer, and by screening aberrantly methylated genes, we have now identified TCF2 as a target for epigenetic inactivation in ovarian cancer. TCF2 was methylated in 53% of ovarian cancer cell lines and 26% of primary ovarian cancers, resulting in loss of the gene's expression. TCF2 expression was restored by treating cells with a methyltransferase inhibitor, 5-aza-2′deoxycitidine (5-aza-dC). In addition, chromatin immunoprecipitation showed deacetylation of histone H3 in methylated cells and, when combined with 5-aza-dC, the histone deacetylase inhibitor trichostatin A synergistically induced TCF2 expression. Epigenetic inactivation of TCF2 was also seen in colorectal, gastric and pancreatic cell lines, suggesting general involvement of epigenetic inactivation of TCF2 in tumorigenesis. Restoration of TCF2 expression induced expression of HNF4α, a transcriptional target of HNF1β, indicating that epigenetic silencing of TCF2 leads to alteration of the hepatocyte nuclear factor network in tumours. These results suggest that TCF2 is involved in the development of ovarian cancers and may represent a useful target for their detection and treatment. PMID:16479257

  3. The episodic ataxia type 1 mutation I262T alters voltage-dependent gating and disrupts protein biosynthesis of human Kv1.1 potassium channels.

    PubMed

    Chen, Szu-Han; Fu, Ssu-Ju; Huang, Jing-Jia; Tang, Chih-Yung

    2016-01-18

    Voltage-gated potassium (Kv) channels are essential for setting neuronal membrane excitability. Mutations in human Kv1.1 channels are linked to episodic ataxia type 1 (EA1). The EA1-associated mutation I262T was identified from a patient with atypical phenotypes. Although a previous report has characterized its suppression effect, several key questions regarding the impact of the I262T mutation on Kv1.1 as well as other members of the Kv1 subfamily remain unanswered. Herein we show that the dominant-negative effect of I262T on Kv1.1 current expression is not reversed by co-expression with Kvβ1.1 or Kvβ2 subunits. Biochemical examinations indicate that I262T displays enhanced protein degradation and impedes membrane trafficking of Kv1.1 wild-type subunits. I262T appears to be the first EA1 mutation directly associated with impaired protein stability. Further functional analyses demonstrate that I262T changes the voltage-dependent activation and Kvβ1.1-mediated inactivation, uncouples inactivation from activation gating, and decelerates the kinetics of cumulative inactivation of Kv1.1 channels. I262T also exerts similar dominant effects on the gating of Kv1.2 and Kv1.4 channels. Together our data suggest that I262T confers altered channel gating and reduced functional expression of Kv1 channels, which may account for some of the phenotypes of the EA1 patient.

  4. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    PubMed

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  5. NaV1.4 mutations cause hypokalaemic periodic paralysis by disrupting IIIS4 movement during recovery

    PubMed Central

    Lehmann-Horn, Frank; Fan, Chunxiang; Wolf, Markus; Winston, Vern; Merlini, Luciano

    2014-01-01

    Hypokalaemic periodic paralysis is typically associated with mutations of voltage sensor residues in calcium or sodium channels of skeletal muscle. To date, causative sodium channel mutations have been studied only for the two outermost arginine residues in S4 voltage sensor segments of domains I to III. These mutations produce depolarization of skeletal muscle fibres in response to reduced extracellular potassium, owing to an inward cation-selective gating pore current activated by hyperpolarization. Here, we describe mutations of the third arginine, R3, in the domain III voltage sensor i.e. an R1135H mutation which was found in two patients in separate families and a novel R1135C mutation identified in a third patient in another family. Muscle fibres from a patient harbouring the R1135H mutation showed increased depolarization tendency at normal and reduced extracellular potassium compatible with the diagnosis. Additionally, amplitude and rise time of action potentials were reduced compared with controls, even for holding potentials at which all NaV1.4 are fully recovered from inactivation. These findings may be because of an outward omega current activated at positive potentials. Expression of R1135H/C in mammalian cells indicates further gating defects that include significantly enhanced entry into inactivation and prolonged recovery that may additionally contribute to action potential inhibition at the physiological resting potential. After S4 immobilization in the outward position, mutant channels produce an inward omega current that most likely depolarizes the resting potential and produces the hypokalaemia-induced weakness. Gating current recordings reveal that mutations at R3 inhibit S4 deactivation before recovery, and molecular dynamics simulations suggest that this defect is caused by disrupted interactions of domain III S2 countercharges with S4 arginines R2 to R4 during repolarization of the membrane. This work reveals a novel mechanism of disrupted S

  6. Inactivation of coliphage Q beta by potassium ferrate.

    PubMed

    Kazama, F

    1994-05-15

    The kinetics of inactivation of a bacteriophage by potassium ferrate were studied with the F-specific RNA-coliphage Q beta. Inactivation in phosphate buffer (pH 6, 7 and 8) containing ferrate could be described by Hom's model. The inactivation rate depended on the pH. However, the relative effects of ferrate concentration and exposure time on inactivation were not affected by a change in pH from 6 to 8. In a study of the mechanism by which ferrate inactivated the virus, the efficiency of viral inactivation after ferrate decomposed in buffer was assayed. Inactivation was still effective and still followed Hom's equation after the complete decomposition of ferrate ion; however, the efficiency of that inactivation disappeared when sodium thiosulfate was added, suggesting that long-lived oxidative intermediates capable of viral inactivation were generated during the decomposition of ferrate ions.

  7. Bacterial inactivation of the anticancer drug doxorubicin.

    PubMed

    Westman, Erin L; Canova, Marc J; Radhi, Inas J; Koteva, Kalinka; Kireeva, Inga; Waglechner, Nicholas; Wright, Gerard D

    2012-10-26

    Microbes are exposed to compounds produced by members of their ecological niche, including molecules with antibiotic or antineoplastic activities. As a result, even bacteria that do not produce such compounds can harbor the genetic machinery to inactivate or degrade these molecules. Here, we investigated environmental actinomycetes for their ability to inactivate doxorubicin, an aminoglycosylated anthracycline anticancer drug. One strain, Streptomyces WAC04685, inactivates doxorubicin via a deglycosylation mechanism. Activity-based purification of the enzymes responsible for drug inactivation identified the NADH dehydrogenase component of respiratory electron transport complex I, which was confirmed by gene inactivation studies. A mechanism where reduction of the quinone ring of the anthracycline by NADH dehydrogenase leads to deglycosylation is proposed. This work adds anticancer drug inactivation to the enzymatic inactivation portfolio of actinomycetes and offers possibilities for novel applications in drug detoxification. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  9. In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

    PubMed

    Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

    2004-04-14

    In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

  10. Sodium channel slow inactivation as a therapeutic target for myotonia congenita

    PubMed Central

    Novak, Kevin R; Norman, Jennifer; Mitchell, Jacob R; Pinter, Martin J; Rich, Mark M

    2014-01-01

    Objective Patients with myotonia congenita have muscle hyperexcitability due to loss-of-function mutations in the chloride channel in skeletal muscle, which causes spontaneous firing of muscle action potentials (myotonia), producing muscle stiffness. In patients, muscle stiffness lessens with exercise, a change known as the warm-up phenomenon. Our goal was to identify the mechanism underlying warm up and to use this information to guide development of novel therapy. Methods To determine the mechanism underlying warm-up, we used a recently discovered drug to eliminate muscle contraction, thus allowing prolonged intracellular recording from individual muscle fibers during induction of warm-up in a mouse model of myotonia congenita. Results Changes in action potentials suggested slow inactivation of sodium channels as an important contributor to warm-up. These data suggested enhancing slow inactivation of sodium channels might offer effective therapy for myotonia. Lacosamide and ranolazine enhance slow inactivation of sodium channels and are FDA-approved for other uses in patients. We compared the efficacy of both drugs to mexiletine, a sodium channel blocker currently used to treat myotonia. In vitro studies suggested both lacosamide and ranolazine were superior to mexiletine. However, in vivo studies in a mouse model of myotonia congenita suggested side effects could limit the efficacy of lacosamide. Ranolazine produced fewer side effects and was as effective as mexiletine at a dose that produced none of mexiletine’s hypoexcitability side effects. Interpretation We conclude ranolazine has excellent therapeutic potential for treatment of patients with myotonia congenita. PMID:25515836

  11. Effective Chemical Inactivation of Ebola Virus

    PubMed Central

    Haddock, Elaine; Feldmann, Friederike

    2016-01-01

    Reliable inactivation of specimens before removal from high-level biocontainment is crucial for safe operation. To evaluate efficacy of methods of chemical inactivation, we compared in vitro and in vivo approaches using Ebola virus as a surrogate pathogen. Consequently, we have established parameters and protocols leading to reliable and effective inactivation. PMID:27070504

  12. P16 UV mutations in human skin epithelial tumors.

    PubMed

    Soufir, N; Molès, J P; Vilmer, C; Moch, C; Verola, O; Rivet, J; Tesniere, A; Dubertret, L; Basset-Seguin, N

    1999-09-23

    The p16 gene expresses two alternative transcripts (p16alpha and p16beta) involved in tumor suppression via the retinoblastoma (Rb) or p53 pathways. Disruption of these pathways can occur through inactivation of p16 or p53, or activating mutations of cyclin dependant kinase 4 gene (Cdk4). We searched for p16, Cdk4 and p53 gene mutations in 20 squamous cell carcinomas (SSCs), 1 actinic keratosis (AK), and 28 basal cell carcinomas (BCCs), using PCR-SSCP. A deletion and methylation analysis of p16 was also performed. Six different mutations (12%) were detected in exon 2 of p16 (common to p16alpha and p16beta), in five out of 21 squamous lesions (24%) (one AK and four SCCs) and one out of 28 BCCs (3.5%). These included four (66%) ultraviolet (UV)-type mutations (two tandems CC : GG to TT : AA transitions and two C : G to T : A transitions at dipyrimidic site) and two transversions. P53 mutations were present in 18 samples (37%), mostly of UV type. Of these, only two (one BCC and one AK) harboured simultaneously mutations of p16, but with no consequence on p16beta transcript. Our data demonstrate for the first time the presence of p16 UV induced mutations in non melanoma skin cancer, particularly in the most aggressive SCC type, and support that p16 and p53 are involved in two independent pathways in skin carcinogenesis.

  13. Mild and severe muscular dystrophy caused by a single {gamma}-sarcoglycan mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McNally, E.M.; Boennemann, C.G.; Lidov, H.G.W.

    1996-11-01

    Autosomal recessive muscular dystrophy is genetically heterogeneous. One form of this disorder, limb-girdle muscular dystrophy type 2C (LGMD 2C), is prevalent in northern Africa and has been shown to be associated with a single mutation in the gene encoding the dystrophin-associated protein {gamma}-sarcoglycan. The previous mutation analysis of {gamma}-sarcoglycan required the availability of muscle biopsies. To establish a mutation assay for genomic DNA, the intron-exon structure of the {gamma}-sarcoglycan gene was determined, and primers were designed to amplify each of the exons encoding {gamma}-sarcoglycan. We studied a group of Brazilian muscular dystrophy patients for mutations in the {gamma}-sarcoglycan gene. Thesemore » patients were selected on the basis of autosomal inheritance and/or the presence of normal dystrophin and/or deficiency of {alpha}-sarcoglycan immunostaining. Four of 19 patients surveyed had a single, homozygous mutation in the {gamma}-sarcoglycan gene. The mutation identified in these patients, all of African-Brazilian descent, is identical to that seen in the North African population, suggesting that even patients of remote African descent may carry this mutation. The phenotype in these patients varied considerably. Of four families with an identical mutation, three have a severe Duchenne-like muscular dystrophy. However, one family has much milder symptoms, suggesting that other loci may be present that modify the severity of the clinical course resulting from {gamma}-sarcoglycan gene mutations. 19 refs., 5 figs., 3 tabs.« less

  14. Exploring growth-defence trade-offs in Arabidopsis: phytochrome B inactivation requires JAZ10 to suppress plant immunity but not to trigger shade-avoidance responses.

    PubMed

    Cerrudo, Ignacio; Caliri-Ortiz, M Emilia; Keller, Mercedes M; Degano, M Eugenia; Demkura, Patricia V; Ballaré, Carlos L

    2017-05-01

    Under conditions that involve a high risk of competition for light among neighbouring plants, shade-intolerant species often display increased shoot elongation and greater susceptibility to pathogens and herbivores. The functional links between morphological and defence responses to crowding are not well understood. In Arabidopsis, the protein JAZ10 is thought to play a key role connecting the inactivation of the photoreceptor phytochrome B (phyB), which takes place under competition for light, with the repression of jasmonate-mediated plant defences. Here, we show that a null mutation of the JAZ10 gene in Arabidopsis did not affect plant growth nor did it suppress the shade-avoidance responses elicited by phyB inactivation. However, the jaz10 mutation restored many of the defence traits that are missing in the phyB mutant, including the ability to express robust responses to jasmonate and to accumulate indolic glucosinolates. Furthermore, the jaz10phyB double mutant showed a significantly increased resistance to the pathogenic fungus Botrytis cinerea compared with the phyB parental line. Our results demonstrate that, by inactivating JAZ10, it is possible to partially uncouple shade avoidance from defence suppression in Arabidopsis. These findings may provide clues to improve plant resistance to pathogens in crops that are planted at high density. © 2016 John Wiley & Sons Ltd.

  15. A Novel Method to Screen for Dominant Negative ATM Mutations in Familial Breast Cancer

    DTIC Science & Technology

    2005-04-01

    carry dominant negative mutation in ATM due to natural variation amongst LCLs. Microarrays have been performed to determine differences in gene expression... genes that are altered in their expression in ATMmutation carriers. The validation of this data in carriers of different ATM mutation indicated that the...heterozygous carriers of T727 1 G mutation display a gene expression phenotype that appears identical to carriers of protein truncating mutations in

  16. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  17. Structural Analysis of Single-Point Mutations Given an RNA Sequence: A Case Study with RNAMute

    NASA Astrophysics Data System (ADS)

    Churkin, Alexander; Barash, Danny

    2006-12-01

    We introduce here for the first time the RNAMute package, a pattern-recognition-based utility to perform mutational analysis and detect vulnerable spots within an RNA sequence that affect structure. Mutations in these spots may lead to a structural change that directly relates to a change in functionality. Previously, the concept was tried on RNA genetic control elements called "riboswitches" and other known RNA switches, without an organized utility that analyzes all single-point mutations and can be further expanded. The RNAMute package allows a comprehensive categorization, given an RNA sequence that has functional relevance, by exploring the patterns of all single-point mutants. For illustration, we apply the RNAMute package on an RNA transcript for which individual point mutations were shown experimentally to inactivate spectinomycin resistance in Escherichia coli. Functional analysis of mutations on this case study was performed experimentally by creating a library of point mutations using PCR and screening to locate those mutations. With the availability of RNAMute, preanalysis can be performed computationally before conducting an experiment.

  18. Chlorine inactivation of Tubifex tubifex in drinking water and the synergistic effect of sequential inactivation with UV irradiation and chlorine.

    PubMed

    Nie, Xiao-Bao; Li, Zhi-Hong; Long, Yuan-Nan; He, Pan-Pan; Xu, Chao

    2017-06-01

    The inactivation of Tubifex tubifex is important to prevent contamination of drinking water. Chlorine is a widely-used disinfectant and the key factor in the inactivation of T. tubifex. This study investigated the inactivation kinetics of chlorine on T. tubifex and the synergistic effect of the sequential use of chlorine and UV irradiation. The experimental results indicated that the Ct (concentration × time reaction ) concept could be used to evaluate the inactivation kinetics of T. tubifex with chlorine, thus allowing for the use of a simpler Ct approach for the assessment of T. tubifex chlorine inactivation requirements. The inactivation kinetics of T. tubifex by chlorine was found to be well-fitted to a delayed pseudo first-order Chick-Watson expression. Sequential experiments revealed that UV irradiation and chlorine worked synergistically to effectively inactivate T. tubifex as a result of the decreased activation energy, E a , induced by primary UV irradiation. Furthermore, the inactivation effectiveness of T. tubifex by chlorine was found to be affected by several drinking water quality parameters including pH, turbidity, and chemical oxygen demand with potassium permanganate (COD Mn ) concentration. High pH exhibited pronounced inactivation effectiveness and the decrease in turbidity and COD Mn concentrations contributed to the inactivation of T. tubifex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biernat, W.; Aguzzi, A.; Sure, U.

    Gliosarcomas are morphologically heterogeneous tumors of the central nervous system composed of gliomatous and sarcomatous components. The histogenesis of the latter is still a matter of debate. As mutations of the p53 tumor suppressor gene represent an early event in the development of gliomas, we attempted to determine whether both components of gliosarcomas share identical alterations of the p53 gene. Using single-strand conformation analysis (SSCA) and direct DNA sequencing of the p53 gene, we analyzed dissected gliomatous and sarcomatous parts of 12 formalin-fixed, paraffin-embedded gliosarcomas. The two tumors that contained a p53 alteration were found to carry the identical mutationmore » (exon 5; codon 151, CCC {r_arrow} TCC; codon 173, GTG {r_arrow} GTA) in the gliomatous and the sarcomatous components. These findings suggest a common origin of the two cellular components from neoplastic glial cells. 37 refs., 3 figs., 1 tab.« less

  20. Mutational analysis of BRAF and KRAS in ovarian serous borderline (atypical proliferative) tumours and associated peritoneal implants

    PubMed Central

    Ardighieri, Laura; Zeppernick, Felix; Hannibal, Charlotte G; Vang, Russell; Cope, Leslie; Junge, Jette; Kjaer, Susanne K; Kurman, Robert J; Shih, Ie-Ming

    2014-01-01

    There is debate as to whether peritoneal implants associated with serous borderline tumours/atypical proliferative serous tumours (SBT/APSTs) of the ovary are derived from the primary ovarian tumour or arise independently in the peritoneum. We analysed 57 SBT/APSTs from 45 patients with advanced-stage disease identified from a nation-wide tumour registry in Denmark. Mutational analysis for hotspots in KRAS and BRAF was successful in 55 APSTs and demonstrated KRAS mutations in 34 (61.8%) and BRAF mutations in eight (14.5%). Mutational analysis was successful in 56 peritoneal implants and revealed KRAS mutations in 34 (60.7%) and BRAF mutations in seven (12.5%). Mutational analysis could not be performed in two primary tumours and in nine implants, either because DNA amplification failed or because there was insufficient tissue for mutational analysis. For these specimens we performed VE1 immunohistochemistry, which was shown to be a specific and sensitive surrogate marker for a V600E BRAF mutation. VE1 staining was positive in one of two APSTs and seven of nine implants. Thus, among 63 implants for which mutation status was known (either by direct mutational analysis or by VE1 immunohistochemistry), 34 (53.9%) had KRAS mutations and 14 (22%) had BRAF mutations, of which identical KRAS mutations were found in 34 (91%) of 37 SBT/APST–implant pairs and identical BRAF mutations in 14 (100%) of 14 SBT/APST–implant pairs. Wild-type KRAS and BRAF (at the loci investigated) were found in 11 (100%) of 11 SBT/APST–implant pairs. Overall concordance of KRAS and BRAF mutations was 95% in 59 of 62 SBT/APST–implant (non-invasive and invasive) pairs (p < 0.00001). This study provides cogent evidence that the vast majority of peritoneal implants, non-invasive and invasive, harbour the identical KRAS or BRAF mutations that are present in the associated SBT/APST, supporting the view that peritoneal implants are derived from the primary ovarian tumour. PMID:24307542

  1. Inactivation of thermogenic UCP1 as a historical contingency in multiple placental mammal clades

    PubMed Central

    Gaudry, Michael J.; Jastroch, Martin; Treberg, Jason R.; Hofreiter, Michael; Paijmans, Johanna L. A.; Starrett, James; Wales, Nathan; Signore, Anthony V.; Springer, Mark S.; Campbell, Kevin L.

    2017-01-01

    Mitochondrial uncoupling protein 1 (UCP1) is essential for nonshivering thermogenesis in brown adipose tissue and is widely accepted to have played a key thermoregulatory role in small-bodied and neonatal placental mammals that enabled the exploitation of cold environments. We map ucp1 sequences from 133 mammals onto a species tree constructed from a ~51-kb sequence alignment and show that inactivating mutations have occurred in at least 8 of the 18 traditional placental orders, thereby challenging the physiological importance of UCP1 across Placentalia. Selection and timetree analyses further reveal that ucp1 inactivations temporally correspond with strong secondary reductions in metabolic intensity in xenarthrans and pangolins, or in six other lineages coincided with a ~30 million–year episode of global cooling in the Paleogene that promoted sharp increases in body mass and cladogenesis evident in the fossil record. Our findings also demonstrate that members of various lineages (for example, cetaceans, horses, woolly mammoths, Steller’s sea cows) evolved extreme cold hardiness in the absence of UCP1-mediated thermogenesis. Finally, we identify ucp1 inactivation as a historical contingency that is linked to the current low species diversity of clades lacking functional UCP1, thus providing the first evidence for species selection related to the presence or absence of a single gene product. PMID:28706989

  2. The Landscape of Somatic Genetic Alterations in Breast Cancers From ATM Germline Mutation Carriers.

    PubMed

    Weigelt, Britta; Bi, Rui; Kumar, Rahul; Blecua, Pedro; Mandelker, Diana L; Geyer, Felipe C; Pareja, Fresia; James, Paul A; Couch, Fergus J; Eccles, Diana M; Blows, Fiona; Pharoah, Paul; Li, Anqi; Selenica, Pier; Lim, Raymond S; Jayakumaran, Gowtham; Waddell, Nic; Shen, Ronglai; Norton, Larry; Wen, Hannah Y; Powell, Simon N; Riaz, Nadeem; Robson, Mark E; Reis-Filho, Jorge S; Chenevix-Trench, Georgia

    2018-02-28

    Pathogenic germline variants in ataxia-telangiectasia mutated (ATM), a gene that plays a role in DNA damage response and cell cycle checkpoints, confer an increased breast cancer (BC) risk. Here, we investigated the phenotypic characteristics and landscape of somatic genetic alterations in 24 BCs from ATM germline mutation carriers by whole-exome and targeted sequencing. ATM-associated BCs were consistently hormone receptor positive and largely displayed minimal immune infiltrate. Although 79.2% of these tumors exhibited loss of heterozygosity of the ATM wild-type allele, none displayed high activity of mutational signature 3 associated with defective homologous recombination DNA (HRD) repair. No TP53 mutations were found in the ATM-associated BCs. Analysis of an independent data set confirmed that germline ATM variants and TP53 somatic mutations are mutually exclusive. Our findings indicate that ATM-associated BCs often harbor bi-allelic inactivation of ATM, are phenotypically distinct from BRCA1/2-associated BCs, lack HRD-related mutational signatures, and that TP53 and ATM genetic alterations are likely epistatic.

  3. Thermodynamic coupling between activation and inactivation gating in potassium channels revealed by free energy molecular dynamics simulations.

    PubMed

    Pan, Albert C; Cuello, Luis G; Perozo, Eduardo; Roux, Benoît

    2011-12-01

    The amount of ionic current flowing through K(+) channels is determined by the interplay between two separate time-dependent processes: activation and inactivation gating. Activation is concerned with the stimulus-dependent opening of the main intracellular gate, whereas inactivation is a spontaneous conformational transition of the selectivity filter toward a nonconductive state occurring on a variety of timescales. A recent analysis of multiple x-ray structures of open and partially open KcsA channels revealed the mechanism by which movements of the inner activation gate, formed by the inner helices from the four subunits of the pore domain, bias the conformational changes at the selectivity filter toward a nonconductive inactivated state. This analysis highlighted the important role of Phe103, a residue located along the inner helix, near the hinge position associated with the opening of the intracellular gate. In the present study, we use free energy perturbation molecular dynamics simulations (FEP/MD) to quantitatively elucidate the thermodynamic basis for the coupling between the intracellular gate and the selectivity filter. The results of the FEP/MD calculations are in good agreement with experiments, and further analysis of the repulsive, van der Waals dispersive, and electrostatic free energy contributions reveals that the energetic basis underlying the absence of inactivation in the F103A mutation in KcsA is the absence of the unfavorable steric interaction occurring with the large Ile100 side chain in a neighboring subunit when the intracellular gate is open and the selectivity filter is in a conductive conformation. Macroscopic current analysis shows that the I100A mutant indeed relieves inactivation in KcsA, but to a lesser extent than the F103A mutant.

  4. Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

    PubMed

    Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

    2003-04-01

    Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

  5. Natural mismatch repair mutations mediate phenotypic diversity and drug resistance in Cryptococcus deuterogattii.

    PubMed

    Billmyre, R Blake; Clancey, Shelly Applen; Heitman, Joseph

    2017-09-26

    Pathogenic microbes confront an evolutionary conflict between the pressure to maintain genome stability and the need to adapt to mounting external stresses. Bacteria often respond with elevated mutation rates, but little evidence exists of stable eukaryotic hypermutators in nature. Whole genome resequencing of the human fungal pathogen Cryptococcus deuterogattii identified an outbreak lineage characterized by a nonsense mutation in the mismatch repair component MSH2. This defect results in a moderate mutation rate increase in typical genes, and a larger increase in genes containing homopolymer runs. This allows facile inactivation of genes with coding homopolymer runs including FRR1 , which encodes the target of the immunosuppresive antifungal drugs FK506 and rapamycin. Our study identifies a eukaryotic hypermutator lineage spread over two continents and suggests that pathogenic eukaryotic microbes may experience similar selection pressures on mutation rate as bacterial pathogens, particularly during long periods of clonal growth or while expanding into new environments.

  6. Heterozygous ABCC8 mutations are a cause of MODY.

    PubMed

    Bowman, P; Flanagan, S E; Edghill, E L; Damhuis, A; Shepherd, M H; Paisey, R; Hattersley, A T; Ellard, S

    2012-01-01

    The ABCC8 gene encodes the sulfonylurea receptor 1 (SUR1) subunit of the pancreatic beta cell ATP-sensitive potassium (K(ATP)) channel. Inactivating mutations cause congenital hyperinsulinism (CHI) and activating mutations cause transient neonatal diabetes (TNDM) or permanent neonatal diabetes (PNDM) that can usually be treated with sulfonylureas. Sulfonylurea sensitivity is also a feature of HNF1A and HNF4A MODY, but patients referred for genetic testing with clinical features of these types of diabetes do not always have mutations in the HNF1A/4A genes. Our aim was to establish whether mutations in the ABCC8 gene cause MODY that is responsive to sulfonylurea therapy. We sequenced the ABCC8 gene in 85 patients with a BMI <30 kg/m², no family history of neonatal diabetes and who were deemed sensitive to sulfonylureas by the referring clinician or were sulfonylurea-treated. All had tested negative for mutations in the HNF1A and HNF4A genes. ABCC8 mutations were found in seven of the 85 (8%) probands. Four patients were heterozygous for previously reported mutations and four novel mutations, E100K, G214R, Q485R and N1245D, were identified. Only four probands fulfilled MODY criteria, with two diagnosed after 25 years and one patient, who had no family history of diabetes, as a result of a proven de novo mutation. ABCC8 mutations can cause MODY in patients whose clinical features are similar to those with HNF1A/4A MODY. Therefore, sequencing of ABCC8 in addition to the known MODY genes should be considered if such features are present, to facilitate optimal clinical management of these patients.

  7. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients

    PubMed Central

    2014-01-01

    Background Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. Methods The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. Results De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Conclusions Mutations in CDKL

  8. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    PubMed

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  9. Inactivation of the olfactory marker protein (OMP) gene in river dolphins and other odontocete cetaceans.

    PubMed

    Springer, Mark S; Gatesy, John

    2017-04-01

    Various toothed whales (Odontoceti) are unique among mammals in lacking olfactory bulbs as adults and are thought to be anosmic (lacking the olfactory sense). At the molecular level, toothed whales have high percentages of pseudogenic olfactory receptor genes, but species that have been investigated to date retain an intact copy of the olfactory marker protein gene (OMP), which is highly expressed in olfactory receptor neurons and may regulate the temporal resolution of olfactory responses. One hypothesis for the retention of intact OMP in diverse odontocete lineages is that this gene is pleiotropic with additional functions that are unrelated to olfaction. Recent expression studies provide some support for this hypothesis. Here, we report OMP sequences for representatives of all extant cetacean families and provide the first molecular evidence for inactivation of this gene in vertebrates. Specifically, OMP exhibits independent inactivating mutations in six different odontocete lineages: four river dolphin genera (Platanista, Lipotes, Pontoporia, Inia), sperm whale (Physeter), and harbor porpoise (Phocoena). These results suggest that the only essential role of OMP that is maintained by natural selection is in olfaction, although a non-olfactory role for OMP cannot be ruled out for lineages that retain an intact copy of this gene. Available genome sequences from cetaceans and close outgroups provide evidence of inactivating mutations in two additional genes (CNGA2, CNGA4), which imply further pseudogenization events in the olfactory cascade of odontocetes. Selection analyses demonstrate that evolutionary constraints on all three genes (OMP, CNGA2, CNGA4) have been greatly reduced in Odontoceti, but retain a signature of purifying selection on the stem Cetacea branch and in Mysticeti (baleen whales). This pattern is compatible with the 'echolocation-priority' hypothesis for the evolution of OMP, which posits that negative selection was maintained in the common

  10. Mutation-selection equilibrium in games with multiple strategies.

    PubMed

    Antal, Tibor; Traulsen, Arne; Ohtsuki, Hisashi; Tarnita, Corina E; Nowak, Martin A

    2009-06-21

    In evolutionary games the fitness of individuals is not constant but depends on the relative abundance of the various strategies in the population. Here we study general games among n strategies in populations of large but finite size. We explore stochastic evolutionary dynamics under weak selection, but for any mutation rate. We analyze the frequency dependent Moran process in well-mixed populations, but almost identical results are found for the Wright-Fisher and Pairwise Comparison processes. Surprisingly simple conditions specify whether a strategy is more abundant on average than 1/n, or than another strategy, in the mutation-selection equilibrium. We find one condition that holds for low mutation rate and another condition that holds for high mutation rate. A linear combination of these two conditions holds for any mutation rate. Our results allow a complete characterization of nxn games in the limit of weak selection.

  11. Rare deleterious mutations are associated with disease in bipolar disorder families.

    PubMed

    Rao, A R; Yourshaw, M; Christensen, B; Nelson, S F; Kerner, B

    2017-07-01

    Bipolar disorder (BD) is a common, complex and heritable psychiatric disorder characterized by episodes of severe mood swings. The identification of rare, damaging genomic mutations in families with BD could inform about disease mechanisms and lead to new therapeutic interventions. To determine whether rare, damaging mutations shared identity-by-descent in families with BD could be associated with disease, exome sequencing was performed in multigenerational families of the NIMH BD Family Study followed by in silico functional prediction. Disease association and disease specificity was determined using 5090 exomes from the Sweden-Schizophrenia (SZ) Population-Based Case-Control Exome Sequencing study. We identified 14 rare and likely deleterious mutations in 14 genes that were shared identity-by-descent among affected family members. The variants were associated with BD (P<0.05 after Bonferroni's correction) and disease specificity was supported by the absence of the mutations in patients with SZ. In addition, we found rare, functional mutations in known causal genes for neuropsychiatric disorders including holoprosencephaly and epilepsy. Our results demonstrate that exome sequencing in multigenerational families with BD is effective in identifying rare genomic variants of potential clinical relevance and also disease modifiers related to coexisting medical conditions. Replication of our results and experimental validation are required before disease causation could be assumed.

  12. Functional Consequences of Seven Novel Mutations in the CYP11B1 Gene: Four Mutations Associated with Nonclassic and Three Mutations Causing Classic 11β-Hydroxylase Deficiency

    PubMed Central

    Parajes, Silvia; Loidi, Lourdes; Reisch, Nicole; Dhir, Vivek; Rose, Ian T.; Hampel, Rainer; Quinkler, Marcus; Conway, Gerard S.; Castro-Feijóo, Lidia; Araujo-Vilar, David; Pombo, Manuel; Dominguez, Fernando; Williams, Emma L.; Cole, Trevor R.; Kirk, Jeremy M.; Kaminsky, Elke; Rumsby, Gill; Arlt, Wiebke; Krone, Nils

    2010-01-01

    Context: Steroid 11β-hydroxylase (CYP11B1) deficiency (11OHD) is the second most common form of congenital adrenal hyperplasia (CAH). Cases of nonclassic 11OHD are rare compared with the incidence of nonclassic 21-hydroxylase deficiency. Objective: The aim of the study was to analyze the functional consequences of seven novel CYP11B1 mutations (p.M88I, p.W116G, p.P159L, p.A165D, p.K254_A259del, p.R366C, p.T401A) found in three patients with classic 11OHD, two patients with nonclassic 11OHD, and three heterozygous carriers for CYP11B1 mutations. Methods: We conducted functional studies employing a COS7 cell in vitro expression system comparing wild-type (WT) and mutant CYP11B1 activity. Mutants were examined in a computational three-dimensional model of the CYP11B1 protein. Results: All mutations (p.W116G, p.A165D, p.K254_A259del) found in patients with classic 11OHD have absent or very little 11β-hydroxylase activity relative to WT. The mutations detected in patients with nonclassic 11OHD showed partial functional impairment, with one patient being homozygous (p.P159L; 25% of WT) and the other patient compound heterozygous for a novel mild p.M88I (40% of WT) and the known severe p.R383Q mutation. The two mutations detected in heterozygous carriers (p.R366C, p.T401A) also reduced CYP11B1 activity by 23 to 37%, respectively. Conclusion: Functional analysis results allow for the classification of novel CYP11B1 mutations as causative for classic and nonclassic 11OHD, respectively. Four partially inactivating mutations are predicted to result in nonclassic 11OHD. These findings double the number of mild CYP11B1 mutations previously described as associated with mild 11OHD. Our data are important to predict phenotypic expression and provide important information for clinical and genetic counseling in 11OHD. PMID:20089618

  13. Evaluation of some physical and chemical treatments for inactivating microsporidian spores isolated from fish.

    PubMed

    Leiro, José M; Piazzon, Carla; Domínguez, Berta; Mallo, Natalia; Lamas, Jesús

    2012-05-15

    Microsporidia are a large diverse group of intracellular parasites now considered as fungi. They are particularly prevalent in fish and are recognized as important opportunistic parasites in humans. Although the mode of transmission of microsporidia has not been fully clarified, the consumption and manipulation of infected fish may be a risk factor for humans. Comparative analysis of rDNA sequence revealed that the microsporidians used in the present study had 99-100% identity with anglerfish microsporidians of the genus Spraguea and very low identity with microsporidians that infect humans. Microsporidian spores were exposed to different physical and chemical treatments: freezing at -20°C for 24-78 h, heating at 60°C for 5-15 min, microwaving at 700 W, 2.45 GHz for 15-60s, and treatment with ethanol at concentrations of between 1 and 70% for 15 min. The viability of the spores after each treatment was evaluated by two methods: a) haemocytometer counts, measuring the extrusion of the polar filament in control and treated spores, and b) a fluorometric method, testing the membrane integrity by propidium iodide exclusion. The results of both methods were concordant. Spores were inactivated by freezing at -20°C for more than 48 h, by heating to 60°C for 10 min and by microwaving at 750 W, for 20s. Exposure to 70% ethanol for 15 min also inactivated microsporidian spores. The results suggest that both freezing and heating are effective treatments for destroying microsporidian spores in European white anglerfish, and that 70% ethanol could be used by fish processors to disinfect their hands and the utensils used in processing fish. The fluorometric method can be used as an alternative to haemocytometer counts in disinfection studies aimed at establishing strategies for inactivating and reducing the viability and the potential infectivity of microsporidians present in fish or in the environment. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Removal of inactivation causes time-invariant sodium current decays

    PubMed Central

    1988-01-01

    The kinetic properties of the closing of Na channels were studied in frog skeletal muscle to obtain information about the dependence of channel closing on the past history of the channel. Channel closing was studied in normal and modified channels. Chloramine-T was used to modify the channels so that inactivation was virtually removed. A series of depolarizing prepulse potentials was used to activate Na channels, and a -140-mV postpulse was used to monitor the closing of the channels. Unmodified channels decay via a biexponential process with time constants of 72 and 534 microseconds at 12 degrees C. The observed time constants do not depend upon the potential used to activate the channels. The contribution of the slow component to the total decay increases as the activating prepulse is lengthened. After inactivation is removed, the biexponential character of the decay is retained, with no change in the magnitude of the time constants. However, increases in the duration of the activating prepulse over the range where the current is maximal 1-75 ms) produce identical biexponential decays. The presence of biexponential decays suggests that either two subtypes of Na channels are found in muscle, or Na channels can exist in one of two equally conductive states. The time- invariant decays observed suggest that channel closure does not depend upon their past history. PMID:2852208

  15. Importance of cell damage causing growth delay for high pressure inactivation of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Nanba, Masaru; Nomura, Kazuki; Nasuhara, Yusuke; Hayashi, Manabu; Kido, Miyuki; Hayashi, Mayumi; Iguchi, Akinori; Shigematsu, Toru; Hirayama, Masao; Ueno, Shigeaki; Fujii, Tomoyuki

    2013-06-01

    A high pressure (HP) tolerant (barotolerant) mutant a2568D8 and a variably barotolerant mutant a1210H12 were generated from Saccharomyces cerevisiae using ultra-violet mutagenesis. The two mutants, a barosensitive mutant a924E1 and the wild-type strain, were pressurized (225 MPa), and pressure inactivation behavior was analyzed. In the wild-type strain, a proportion of the growth-delayed cells were detected after exposure to HP. In a924E1, the proportion of growth-delayed cells significantly decreased compared with the wild-type. In a2568D8, the proportion of growth-delayed cells increased and the proportion of inactivated cells decreased compared with the wild-type. In a1210H12, the growth-delayed cells could not be detected within 120 s of exposure to HP. The proportion of growth-delayed cells, which incurred the damage, would affect the survival ratio by HP. These results suggested that cellular changes in barotolerance caused by mutations are remarkably affected by the ability to recover from cellular damage, which results in a growth delay.

  16. Effects of Bacterial Inactivation Methods on Downstream Proteomic Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Andy; Merkley, Eric D.; Clowers, Brian H.

    2015-05-01

    Inactivation of pathogenic microbial samples is often necessary for the protection of researchers and to comply with local and federal regulations. By its nature, biological inactivation causes changes to microbial samples, potentially affecting observed experimental results. While inactivation induced damage to materials such as DNA has been evaluated, the effect of various inactivation strategies on proteomic data, to our knowledge, has not been discussed. To this end, we inactivated samples of Yersinia pestis and Escherichia coli by autoclave, ethanol, or irradiation treatment to determine how inactivation changes liquid chromatography tandem mass spectrometry data quality as well as apparent protein contentmore » of cells. Proteomic datasets obtained from aliquots of samples inactivated by different methods were highly similar, with Pearson correlation coefficients ranging from 0.822 to 0.985 and 0.816 to 0.985 for E. coli and Y. pestis, respectively, suggesting that inactivation had only slight impacts on the set of proteins identified. In addition, spectral quality metrics such as distributions of various database search algorithm scores remained constant across inactivation methods, indicating that inactivation does not appreciably degrade spectral quality. Though overall changes resulting from inactivation were small, there were detectable trends. For example, one-sided Fischer exact tests determined that periplasmic proteins decrease in observed abundance after sample inactivation by autoclaving (α = 1.71x10-2 for E. coli, α = 4.97x10-4 for Y. pestis) and irradiation (α = 9.43x10-7 for E. coli, α = 1.21x10-5 for Y. pestis) when compared to controls that were not inactivated. Based on our data, if sample inactivation is necessary, we recommend inactivation with ethanol treatment with secondary preference given to irradiation.« less

  17. Hematopoietic stem cells are acutely sensitive to Acd shelterin gene inactivation

    PubMed Central

    Jones, Morgan; Osawa, Gail; Regal, Joshua A.; Weinberg, Daniel N.; Taggart, James; Kocak, Hande; Friedman, Ann; Ferguson, David O.; Keegan, Catherine E.; Maillard, Ivan

    2013-01-01

    The shelterin complex plays dual functions in telomere homeostasis by recruiting telomerase and preventing the activation of a DNA damage response at telomeric ends. Somatic stem cells require telomerase activity, as evidenced by progressive stem cell loss leading to bone marrow failure in hereditary dyskeratosis congenita. Recent work demonstrates that dyskeratosis congenita can also arise from mutations in specific shelterin genes, although little is known about shelterin functions in somatic stem cells. We found that mouse hematopoietic stem cells (HSCs) are acutely sensitive to inactivation of the shelterin gene Acd, encoding TPP1. Homozygosity for a hypomorphic acd allele preserved the emergence and expansion of fetal HSCs but led to profoundly defective function in transplantation assays. Upon complete Acd inactivation, HSCs expressed p53 target genes, underwent cell cycle arrest, and were severely depleted within days, leading to hematopoietic failure. TPP1 loss induced increased telomeric fusion events in bone marrow progenitors. However, unlike in epidermal stem cells, p53 deficiency did not rescue TPP1-deficient HSCs, indicating that shelterin dysfunction has unique effects in different stem cell populations. Because the consequences of telomere shortening are progressive and unsynchronized, acute loss of shelterin function represents an attractive alternative for studying telomere crisis in hematopoietic progenitors. PMID:24316971

  18. Enzyme reactor design under thermal inactivation.

    PubMed

    Illanes, Andrés; Wilson, Lorena

    2003-01-01

    Temperature is a very relevant variable for any bioprocess. Temperature optimization of bioreactor operation is a key aspect for process economics. This is especially true for enzyme-catalyzed processes, because enzymes are complex, unstable catalysts whose technological potential relies on their operational stability. Enzyme reactor design is presented with a special emphasis on the effect of thermal inactivation. Enzyme thermal inactivation is a very complex process from a mechanistic point of view. However, for the purpose of enzyme reactor design, it has been oversimplified frequently, considering one-stage first-order kinetics of inactivation and data gathered under nonreactive conditions that poorly represent the actual conditions within the reactor. More complex mechanisms are frequent, especially in the case of immobilized enzymes, and most important is the effect of catalytic modulators (substrates and products) on enzyme stability under operation conditions. This review focuses primarily on reactor design and operation under modulated thermal inactivation. It also presents a scheme for bioreactor temperature optimization, based on validated temperature-explicit functions for all the kinetic and inactivation parameters involved. More conventional enzyme reactor design is presented merely as a background for the purpose of highlighting the need for a deeper insight into enzyme inactivation for proper bioreactor design.

  19. Modeling the Etiology of p53-mutated Cancer Cells*

    PubMed Central

    Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

    2016-01-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

  20. PHENOTYPIC VARIABILITY IN INDIVIDUALS WITH TYPE V OSTEOGENESIS IMPERFECTA WITH IDENTICAL IFITM5 MUTATIONS

    PubMed Central

    Fitzgerald, Jamie; Holden, Paul; Wright, Hollis; Wilmot, Beth; Hata, Abigail; Steiner, Robert D.; Basel, Don

    2016-01-01

    Background Osteogenesis imperfecta (OI) type V is a dominantly inherited skeletal dysplasia characterized by fractures and progressive deformity of long bones. In addition, patients often present with radial head dislocation, hyperplastic callus, and calcification of the forearm interosseous membrane. Recently, a specific mutation in the IFITM5 gene was found to be responsible for OI type V. This mutation, a C to T transition 14 nucleotides upstream from the endogenous start codon, creates a new start methionine that appears to be preferentially used by the translational machinery. However, the mechanism by which the lengthened protein results in a dominant type of OI is unknown. Methods and Results We report 7 ethnically diverse (African-American, Caucasian, Hispanic, and African) individuals with OI type V from 2 families and 2 sporadic cases. Exome sequencing failed to identify a causative mutation. Using Sanger sequencing, we found that all affected individuals in our cohort possess the c.−14 IFITM5 variant, further supporting the notion that OI type V is caused by a single, discrete mutation. Our patient cohort demonstrated inter-and intrafamilial phenotypic variability, including a father with classic OI type V whose daughter had a phenotype similar to OI type I. This clinical variability suggests that modifier genes influence the OI type V phenotype. We also confirm that the mutation creates an aberrant IFITM5 protein containing an additional 5 amino acids at the N-terminus. Conclusions The variable clinical signs in these cases illustrate the significant variability of the OI type V phenotype caused by the c.−14 IFITM5 mutation. The affected individuals are more ethnically diverse than previously reported. PMID:28824928

  1. A Disease Mutation Causing Episodic Ataxia Type I in the S1 Links Directly to the Voltage Sensor and the Selectivity Filter in Kv Channels.

    PubMed

    Petitjean, Dimitri; Kalstrup, Tanja; Zhao, Juan; Blunck, Rikard

    2015-09-02

    The mutation F184C in Kv1.1 leads to development of episodic ataxia type I (EA1). Although the mutation has been said to alter activation kinetics and to lower expression, we show here that the underlying molecular mechanisms may be more complex. Although F184 is positioned in the "peripheral" S1 helix, it occupies a central position in the 3D fold. We show in cut-open oocyte voltage-clamp recordings of gating and ionic currents of the Shaker Kv channel expressed in Xenopus oocytes that F184 not only interacts directly with the gating charges of the S4, but also creates a functional link to the selectivity filter of the neighboring subunit. This link leads to impaired fast and slow inactivation. The effect on fast inactivation is of an allosteric nature considering that fast inactivation is caused by a linked cytosolic ball peptide. The extensive effects of F184C provide a new mechanism underlying EA. Episodic ataxia (EA) is an inherited disease that leads to occasional loss of motor control in combination with variable other symptoms such as vertigo or migraine. EA type I (EA1), studied here, is caused by mutations in a voltage-gated potassium channel that contributes to the generation of electrical signals in the brain. The mechanism by which mutations in voltage-gated potassium channels lead to EA is still unknown and there is no consistent pharmacological treatment. By studying in detail one disease-causing mutation in Kv1.1, we describe a novel molecular mechanism distinct from mechanisms described previously. This mechanism contributes to the understanding of potassium channel function in general and might lead to a better understanding of how EA develops. Copyright © 2015 the authors 0270-6474/15/3512198-09$15.00/0.

  2. Biallelic inactivation of REV7 is associated with Fanconi anemia.

    PubMed

    Bluteau, Dominique; Masliah-Planchon, Julien; Clairmont, Connor; Rousseau, Alix; Ceccaldi, Raphael; Dubois d'Enghien, Catherine; Bluteau, Olivier; Cuccuini, Wendy; Gachet, Stéphanie; Peffault de Latour, Régis; Leblanc, Thierry; Socié, Gérard; Baruchel, André; Stoppa-Lyonnet, Dominique; D'Andrea, Alan D; Soulier, Jean

    2016-09-01

    Fanconi anemia (FA) is a recessive genetic disease characterized by congenital abnormalities, chromosome instability, progressive bone marrow failure (BMF), and a strong predisposition to cancer. Twenty FA genes have been identified, and the FANC proteins they encode cooperate in a common pathway that regulates DNA crosslink repair and replication fork stability. We identified a child with severe BMF who harbored biallelic inactivating mutations of the translesion DNA synthesis (TLS) gene REV7 (also known as MAD2L2), which encodes the mutant REV7 protein REV7-V85E. Patient-derived cells demonstrated an extended FA phenotype, which included increased chromosome breaks and G2/M accumulation upon exposure to DNA crosslinking agents, γH2AX and 53BP1 foci accumulation, and enhanced p53/p21 activation relative to cells derived from healthy patients. Expression of WT REV7 restored normal cellular and functional phenotypes in the patient's cells, and CRISPR/Cas9 inactivation of REV7 in a non-FA human cell line produced an FA phenotype. Finally, silencing Rev7 in primary hematopoietic cells impaired progenitor function, suggesting that the DNA repair defect underlies the development of BMF in FA. Taken together, our genetic and functional analyses identified REV7 as a previously undescribed FA gene, which we term FANCV.

  3. Biallelic inactivation of REV7 is associated with Fanconi anemia

    PubMed Central

    Masliah-Planchon, Julien; Clairmont, Connor; Rousseau, Alix; Ceccaldi, Raphael; Dubois d’Enghien, Catherine; Bluteau, Olivier; Cuccuini, Wendy; Gachet, Stéphanie; Peffault de Latour, Régis; Leblanc, Thierry; Socié, Gérard; Baruchel, André; Stoppa-Lyonnet, Dominique; D’Andrea, Alan D.

    2016-01-01

    Fanconi anemia (FA) is a recessive genetic disease characterized by congenital abnormalities, chromosome instability, progressive bone marrow failure (BMF), and a strong predisposition to cancer. Twenty FA genes have been identified, and the FANC proteins they encode cooperate in a common pathway that regulates DNA crosslink repair and replication fork stability. We identified a child with severe BMF who harbored biallelic inactivating mutations of the translesion DNA synthesis (TLS) gene REV7 (also known as MAD2L2), which encodes the mutant REV7 protein REV7-V85E. Patient-derived cells demonstrated an extended FA phenotype, which included increased chromosome breaks and G2/M accumulation upon exposure to DNA crosslinking agents, γH2AX and 53BP1 foci accumulation, and enhanced p53/p21 activation relative to cells derived from healthy patients. Expression of WT REV7 restored normal cellular and functional phenotypes in the patient’s cells, and CRISPR/Cas9 inactivation of REV7 in a non-FA human cell line produced an FA phenotype. Finally, silencing Rev7 in primary hematopoietic cells impaired progenitor function, suggesting that the DNA repair defect underlies the development of BMF in FA. Taken together, our genetic and functional analyses identified REV7 as a previously undescribed FA gene, which we term FANCV. PMID:27500492

  4. Ras mutations are rare in solitary cold and toxic thyroid nodules.

    PubMed

    Krohn, K; Reske, A; Ackermann, F; Müller, A; Paschke, R

    2001-08-01

    Activation of ras proto-oncogenes as a result of point mutations is detectable in a significant percentage of most types of tumour. Similar to neoplasms of other organs, mutations of all three ras genes can be found in thyroid tumours. H-, K- and N-ras mutations have been detected in up to 20% of follicular adenomas and adenomatous nodules which were not functionally characterized. This raises the question as to whether ras mutations are specific for hypofunctional nodules and TSH receptor mutations for hyperfunctioning nodules. To investigate ras and TSH receptor mutations with respect to functional differentiation we studied 41 scintigraphically cold nodules and 47 toxic thyroid nodules. To address the likelihood of a somatic mutation we also studied the clonal origin of these tumours. Genomic DNA was extracted from nodular and surrounding tissue. Mutational hot spots in exons 1 and 2 of the H- and K-ras gene were PCR amplified and sequenced using big dye terminator chemistry. Denaturing gradient gel electrophoresis (DGGE) was used to verify sequencing results for the H-ras gene and to analyse the N-ras gene because its greater sensitivity in detecting somatic mutations. Clonality of nodular thyroid tissue was evaluated using X-Chromosome inactivation based on PCR amplification of the human androgen receptor locus. Monoclonal origin was detectable in 14 of 23 informative samples from cold thyroid nodules. In toxic thyroid nodules the frequency of clonal tissue was 20 in 30 informative cases. Only one point mutation could be found in the N-ras gene codon 61 (Gly to Arg) in a cold adenomatous nodule which was monoclonal. In toxic thyroid nodules no ras mutation was detectable. Our study suggests that ras mutations are rare in solitary cold and toxic thyroid nodules and that the frequent monoclonal origin of these tumours implies somatic mutations in genes other than H-, K- and N-ras.

  5. CCDC141 Mutations in Idiopathic Hypogonadotropic Hypogonadism.

    PubMed

    Turan, Ihsan; Hutchins, B Ian; Hacihamdioglu, Bulent; Kotan, L Damla; Gurbuz, Fatih; Ulubay, Ayca; Mengen, Eda; Yuksel, Bilgin; Wray, Susan; Topaloglu, A Kemal

    2017-06-01

    Gonadotropin-releasing hormone neurons originate outside the central nervous system in the olfactory placode and migrate into the central nervous system, becoming integral components of the hypothalamic-pituitary-gonadal axis. Failure of this migration can lead to idiopathic hypogonadotropic hypogonadism (IHH)/Kallmann syndrome (KS). We have previously shown that CCDC141 knockdown leads to impaired migration of GnRH neurons but not of olfactory receptor neurons. The aim of this study was to further describe the phenotype and prevalence of CCDC141 mutations in IHH/KS. Using autozygosity mapping, candidate gene screening, whole-exome sequencing, and Sanger sequencing, those individuals carrying deleterious CDCD141 variants and their phenotypes were determined in a cohort of 120 IHH/KS families. No interventions were made. Our studies revealed nine affected individuals from four independent families in which IHH/KS is associated with inactivating CCDC141 variants, revealing a prevalence of 3.3%. Affected individuals (with the exception of those from family 1 who concomitantly have FEZF1 mutations) have normal olfactory function and anatomically normal olfactory bulbs. Four affected individuals show evidence of clinical reversibility. In three of the families, there was at least one more potentially deleterious variant in other known puberty genes with evidence of allelic heterogeneity within respective pedigrees. These studies confirm that inactivating CCDC141 variants cause normosmic IHH but not KS. This is consistent with our previous in vitro experiments showing exclusively impaired embryonic migration of GnRH neurons upon CCDC141 knockdown. These studies expand the clinical and genetic spectrum of IHH and also attest to the complexity of phenotype and genotype in IHH. Copyright © 2017 by the Endocrine Society

  6. Thermal Inactivation of Viruses

    DTIC Science & Technology

    1977-10-01

    thermal inactivation . 12 Bibliography 20 Table 3. Thermal inactivation of viruses in foods 25 Bibliography 31 Table 4, Agents modifying...the presence of protective agents that reduce the lethal effect of heat on the viruses at temperatures below 60 C In addition, whtn solid foods...systems but were observed j when animal inoculation was utilized. It is possible that free virus nucl’lc < acid may have been the causative agent in

  7. Photodynamic-induced inactivation of Propionibacterium acnes

    NASA Astrophysics Data System (ADS)

    Koenig, Karsten; Teschke, M.; Eick, Stephen G.; Pfister, W.; Meyer, Herbert; Halbhuber, Karl-Juergen

    1998-05-01

    We report on photodynamically induced inactivation of the skin bacterium Propionibacterium acnes (P. acnes) using endogenous as well as exogenous photosensitizers and red light sources. P. acnes is involved in the pathogenesis of the skin disease acne vulgaris. The skin bacterium is able to synthesize the metal-free fluorescent porphyrins protoporphyrin IX (PP) and coproporphyrin (CP) as shown by in situ spectrally-resolved detection of natural autofluorescence of human skin and bacteria colonies. These naturally occurring intracellular porphyrins act as efficient endogenous photosensitizers. Inactivation of P. acnes suspensions was achieved by irradiation with He-Ne laser light in the red spectral region (632.8 nm). We monitored the photodynamically-induced death of single bacteria using a fluorescent viability kit in combination with confocal laser scanning microscopy. In addition, the photo-induced inactivation was calculated by CFU (colony forming units) determination. We found 633 nm-induced inactivation (60 mW, 0.12 cm2 exposure area, 1 hour irradiation) of 72% in the case of non-incubated bacteria based on the destructive effect of singlet oxygen produced by red light excited endogenous porphyrins and subsequent energy transfer to molecular oxygen. In order to achieve a nearly complete inactivation within one exposure procedure, the exogenous photosensitizer Methylene Blue (Mb) was added. Far red exposure of Mb-labeled bacteria using a krypton ion laser at 647 nm and 676 nm resulted in 99% inactivation.

  8. High-Pressure Inactivation of Rotaviruses: Role of Treatment Temperature and Strain Diversity in Virus Inactivation

    PubMed Central

    Araud, Elbashir; DiCaprio, Erin; Yang, Zhihong; Li, Xinhui; Lou, Fangfei; Hughes, John H.; Chen, Haiqiang

    2015-01-01

    Rotavirus (RV) is the major etiological agent of acute gastroenteritis in infants worldwide. Although high-pressure processing (HPP) is a popular method to inactivate enteric pathogens in food, the sensitivity of different virus strains within same species and serotype to HPP is variable. This study aimed to compare the barosensitivities of seven RV strains derived from four serotypes (serotype G1, strains Wa, Ku, and K8; serotype G2, strain S2; serotype G3, strains SA-11 and YO; and serotype G4, strain ST3) following high-pressure treatment. RV strains showed various responses to HPP based on the initial temperature and had different inactivation profiles. Ku, K8, S2, SA-11, YO, and ST3 showed enhanced inactivation at 4°C compared to 20°C. In contrast, strain Wa was not significantly impacted by the initial treatment temperature. Within serotype G1, strain Wa was significantly (P < 0.05) more resistant to HPP than strains Ku and K8. Overall, the resistance of the human RV strains to HPP at 4°C can be ranked as Wa > Ku = K8 > S2 > YO > ST3, and in terms of serotype the ranking is G1 > G2 > G3 > G4. In addition, pressure treatment of 400 MPa for 2 min was sufficient to eliminate the Wa strain, the most pressure-resistant RV, from oyster tissues. HPP disrupted virion structure but did not degrade viral protein or RNA, providing insight into the mechanism of viral inactivation by HPP. In conclusion, HPP is capable of inactivating RV at commercially acceptable pressures, and the efficacy of inactivation is strain dependent. PMID:26187961

  9. U2AF1 mutations alter splice site recognition in hematological malignancies.

    PubMed

    Ilagan, Janine O; Ramakrishnan, Aravind; Hayes, Brian; Murphy, Michele E; Zebari, Ahmad S; Bradley, Philip; Bradley, Robert K

    2015-01-01

    Whole-exome sequencing studies have identified common mutations affecting genes encoding components of the RNA splicing machinery in hematological malignancies. Here, we sought to determine how mutations affecting the 3' splice site recognition factor U2AF1 alter its normal role in RNA splicing. We find that U2AF1 mutations influence the similarity of splicing programs in leukemias, but do not give rise to widespread splicing failure. U2AF1 mutations cause differential splicing of hundreds of genes, affecting biological pathways such as DNA methylation (DNMT3B), X chromosome inactivation (H2AFY), the DNA damage response (ATR, FANCA), and apoptosis (CASP8). We show that U2AF1 mutations alter the preferred 3' splice site motif in patients, in cell culture, and in vitro. Mutations affecting the first and second zinc fingers give rise to different alterations in splice site preference and largely distinct downstream splicing programs. These allele-specific effects are consistent with a computationally predicted model of U2AF1 in complex with RNA. Our findings suggest that U2AF1 mutations contribute to pathogenesis by causing quantitative changes in splicing that affect diverse cellular pathways, and give insight into the normal function of U2AF1's zinc finger domains. © 2015 Ilagan et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Mechanisms of Inactivation of Dry Escherichia coli by High-Pressure Carbon Dioxide

    PubMed Central

    Chen, Yuan Yao; Temelli, Feral

    2017-01-01

    ABSTRACT High-pressure carbon dioxide processing is a promising technology for nonthermal food preservation. However, few studies have determined the lethality of high-pressure CO2 on dry bacterial cells, and the mechanism of inactivation remains unknown. This study explored the mechanisms of inactivation by using Escherichia coli AW1.7 and mutant strains differing in heat and acid resistance, in membrane composition based on disruption of the locus of heat resistance, and in genes coding for glutamate decarboxylases and cyclopropane fatty acid synthase. The levels of lethality of treatments with liquid, gaseous, and supercritical CO2 were compared. The cell counts of E. coli AW1.7 and mutants with a water activity (aW) of 1.0 were reduced by more than 3 log10 (CFU/ml) after supercritical CO2 treatment at 35°C for 15 min; increasing the pressure generally enhanced inactivation, except for E. coli AW1.7 ΔgadAB. E. coli AW1.7 Δcfa was more susceptible than E. coli AW1.7 after treatment at 10 and 40 MPa; other mutations did not affect survival. Dry cells of E. coli were resistant to treatments with supercritical and liquid CO2 at any temperature. Treatments with gaseous CO2 at 65°C were more bactericidal than those with supercritical CO2 or treatments at 65°C only. Remarkably, E. coli AW1.7 was more susceptible than E. coli AW1.7 Δcfa when subjected to the gaseous CO2 treatment. This study identified CO2-induced membrane fluidization and permeabilization as causes of supercritical mediated microbial inactivation, and diffusivity was a dominant factor for gaseous CO2. IMPORTANCE The safety of dry foods is of increasing concern for public health. Desiccated microorganisms, including pathogens, remain viable over long periods of storage and generally tolerate environmental insults that are lethal to the same organisms at high water activity. This study explored the use of high-pressure carbon dioxide to determine its lethality for dried Escherichia coli and to

  11. Mechanisms of Inactivation of Dry Escherichia coli by High-Pressure Carbon Dioxide.

    PubMed

    Chen, Yuan Yao; Temelli, Feral; Gänzle, Michael G

    2017-05-15

    High-pressure carbon dioxide processing is a promising technology for nonthermal food preservation. However, few studies have determined the lethality of high-pressure CO 2 on dry bacterial cells, and the mechanism of inactivation remains unknown. This study explored the mechanisms of inactivation by using Escherichia coli AW1.7 and mutant strains differing in heat and acid resistance, in membrane composition based on disruption of the locus of heat resistance, and in genes coding for glutamate decarboxylases and cyclopropane fatty acid synthase. The levels of lethality of treatments with liquid, gaseous, and supercritical CO 2 were compared. The cell counts of E. coli AW1.7 and mutants with a water activity (a W ) of 1.0 were reduced by more than 3 log 10 (CFU/ml) after supercritical CO 2 treatment at 35°C for 15 min; increasing the pressure generally enhanced inactivation, except for E. coli AW1.7 Δ gadAB E. coli AW1.7 Δ cfa was more susceptible than E. coli AW1.7 after treatment at 10 and 40 MPa; other mutations did not affect survival. Dry cells of E. coli were resistant to treatments with supercritical and liquid CO 2 at any temperature. Treatments with gaseous CO 2 at 65°C were more bactericidal than those with supercritical CO 2 or treatments at 65°C only. Remarkably, E. coli AW1.7 was more susceptible than E. coli AW1.7 Δ cfa when subjected to the gaseous CO 2 treatment. This study identified CO 2 -induced membrane fluidization and permeabilization as causes of supercritical mediated microbial inactivation, and diffusivity was a dominant factor for gaseous CO 2 IMPORTANCE The safety of dry foods is of increasing concern for public health. Desiccated microorganisms, including pathogens, remain viable over long periods of storage and generally tolerate environmental insults that are lethal to the same organisms at high water activity. This study explored the use of high-pressure carbon dioxide to determine its lethality for dried Escherichia coli and to

  12. Capsid functions of inactivated human picornaviruses and feline calicivirus.

    PubMed

    Nuanualsuwan, Suphachai; Cliver, Dean O

    2003-01-01

    The exceptional stability of enteric viruses probably resides in their capsids. The capsid functions of inactivated human picornaviruses and feline calicivirus (FCV) were determined. Viruses were inactivated by UV, hypochlorite, high temperature (72 degrees C), and physiological temperature (37 degrees C), all of which are pertinent to transmission via food and water. Poliovirus (PV) and hepatitis A virus (HAV) are transmissible via water and food, and FCV is the best available surrogate for the Norwalk-like viruses, which are leading causes of food-borne and waterborne disease in the United States. The capsids of all 37 degrees C-inactivated viruses still protected the viral RNA against RNase, even in the presence of proteinase K, which contrasted with findings with viruses inactivated at 72 degrees C. The loss of ability of the virus to attach to homologous cell receptors was universal, regardless of virus type and inactivation method, except for UV-inactivated HAV, and so virus inactivation was almost always accompanied by the loss of virus attachment. Inactivated HAV and FCV were captured by homologous antibodies. However, inactivated PV type 1 (PV-1) was not captured by homologous antibody and 37 degrees C-inactivated PV-1 was only partially captured. The epitopes on the capsids of HAV and FCV are evidently discrete from the receptor attachment sites, unlike those of PV-1. These findings indicate that the primary target of UV, hypochlorite, and 72 degrees C inactivation is the capsid and that the target of thermal inactivation (37 degrees C versus 72 degrees C) is temperature dependent.

  13. Photodynamic Inactivation of Mammalian Viruses and Bacteriophages

    PubMed Central

    Costa, Liliana; Faustino, Maria Amparo F.; Neves, Maria Graça P. M. S.; Cunha, Ângela; Almeida, Adelaide

    2012-01-01

    Photodynamic inactivation (PDI) has been used to inactivate microorganisms through the use of photosensitizers. The inactivation of mammalian viruses and bacteriophages by photosensitization has been applied with success since the first decades of the last century. Due to the fact that mammalian viruses are known to pose a threat to public health and that bacteriophages are frequently used as models of mammalian viruses, it is important to know and understand the mechanisms and photodynamic procedures involved in their photoinactivation. The aim of this review is to (i) summarize the main approaches developed until now for the photodynamic inactivation of bacteriophages and mammalian viruses and, (ii) discuss and compare the present state of the art of mammalian viruses PDI with phage photoinactivation, with special focus on the most relevant mechanisms, molecular targets and factors affecting the viral inactivation process. PMID:22852040

  14. The Novel Mouse Mutation Oblivion Inactivates the PMCA2 Pump and Causes Progressive Hearing Loss

    PubMed Central

    de Angelis, Martin Hrabé; Fuchs, Helmut; Lim, Dmitry; Ortolano, Saida; Ingham, Neil J.; Brini, Marisa; Carafoli, Ernesto; Mammano, Fabio; Steel, Karen P.

    2008-01-01

    Progressive hearing loss is common in the human population, but we have few clues to the molecular basis. Mouse mutants with progressive hearing loss offer valuable insights, and ENU (N-ethyl-N-nitrosourea) mutagenesis is a useful way of generating models. We have characterised a new ENU-induced mouse mutant, Oblivion (allele symbol Obl), showing semi-dominant inheritance of hearing impairment. Obl/+ mutants showed increasing hearing impairment from post-natal day (P)20 to P90, and loss of auditory function was followed by a corresponding base to apex progression of hair cell degeneration. Obl/Obl mutants were small, showed severe vestibular dysfunction by 2 weeks of age, and were completely deaf from birth; sensory hair cells were completely degenerate in the basal turn of the cochlea, although hair cells appeared normal in the apex. We mapped the mutation to Chromosome 6. Mutation analysis of Atp2b2 showed a missense mutation (2630C→T) in exon 15, causing a serine to phenylalanine substitution (S877F) in transmembrane domain 6 of the PMCA2 pump, the resident Ca2+ pump of hair cell stereocilia. Transmembrane domain mutations in these pumps generally are believed to be incompatible with normal targeting of the protein to the plasma membrane. However, analyses of hair cells in cultured utricular maculae of Obl/Obl mice and of the mutant Obl pump in model cells showed that the protein was correctly targeted to the plasma membrane. Biochemical and biophysical characterisation showed that the pump had lost a significant portion of its non-stimulated Ca2+ exporting ability. These findings can explain the progressive loss of auditory function, and indicate the limits in our ability to predict mechanism from sequence alone. PMID:18974863

  15. Common mutation underlying primary hyperoxaluria type1 in three Indian children

    PubMed Central

    Chanchlani, R.; Sinha, A.; Gulati, A.; Agarwal, V.; Bagga, A.

    2012-01-01

    Primary hyperoxaluria is an autosomal recessive disorder caused by deficiency of alanine-glyoxylate aminotransferase, which is encoded by the AGXT gene. We report three Indian children with primary hyperoxaluria type1 having a common mutation in this gene. All patients had evidence of chronic kidney disease at the time of diagnosis, with subsequent progression to end-stage renal disease. The detection of an identical mutation in the AGXT gene suggests that specific genetic screening for this mutation may be useful when considering the diagnosis of primary hyperoxaluria type1. PMID:23439734

  16. Common mutation underlying primary hyperoxaluria type1 in three Indian children.

    PubMed

    Chanchlani, R; Sinha, A; Gulati, A; Agarwal, V; Bagga, A

    2012-11-01

    Primary hyperoxaluria is an autosomal recessive disorder caused by deficiency of alanine-glyoxylate aminotransferase, which is encoded by the AGXT gene. We report three Indian children with primary hyperoxaluria type1 having a common mutation in this gene. All patients had evidence of chronic kidney disease at the time of diagnosis, with subsequent progression to end-stage renal disease. The detection of an identical mutation in the AGXT gene suggests that specific genetic screening for this mutation may be useful when considering the diagnosis of primary hyperoxaluria type1.

  17. Adjuvants and Inactivated Polio Vaccine: A Systematic Review

    PubMed Central

    Hawken, Jennifer; Troy, Stephanie B.

    2012-01-01

    Poliomyelitis is nearing universal eradication; in 2011, there were 650 cases reported globally. When wild polio is eradicated, global oral polio vaccine (OPV) cessation followed by universal use of inactivated polio vaccine (IPV) is believed to be the safest vaccination strategy as IPV does not mutate or run the risk of vaccine derived outbreaks that OPV does. However, IPV is significantly more expensive than OPV. One strategy to make IPV more affordable is to reduce the dose by adding adjuvants, compounds that augment the immune response to the vaccine. No adjuvants are currently utilized in stand-alone IPV; however, several have been explored over the past six decades. From aluminum, used in many licensed vaccines, to newer and more experimental adjuvants such as synthetic DNA, a diverse group of compounds has been assessed with varying strengths and weaknesses. This review summarizes the studies to date evaluating the efficacy and safety of adjuvants used with IPV. PMID:23041122

  18. Adjuvants and inactivated polio vaccine: a systematic review.

    PubMed

    Hawken, Jennifer; Troy, Stephanie B

    2012-11-19

    Poliomyelitis is nearing universal eradication; in 2011, there were 650 cases reported globally. When wild polio is eradicated, global oral polio vaccine (OPV) cessation followed by use of universal inactivated polio vaccine (IPV) is believed to be the safest vaccination strategy as IPV does not mutate or run the risk of vaccine derived outbreaks that OPV does. However, IPV is significantly more expensive than OPV. One strategy to make IPV more affordable is to reduce the dose by adding adjuvants, compounds that augment the immune response to the vaccine. No adjuvants are currently utilized in stand-alone IPV; however, several have been explored over the past six decades. From aluminum, used in many licensed vaccines, to newer and more experimental adjuvants such as synthetic DNA, a diverse group of compounds has been assessed with varying strengths and weaknesses. This review summarizes the studies to date evaluating the efficacy and safety of adjuvants used with IPV. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Rates of Spontaneous Mutation in Bacteriophage T4 Are Independent of Host Fidelity Determinants

    PubMed Central

    Santos, M. E.; Drake, J. W.

    1994-01-01

    Bacteriophage T4 encodes most of the genes whose products are required for its DNA metabolism, and host (Escherichia coli) genes can only infrequently complement mutationally inactivated T4 genes. We screened the following host mutator mutations for effects on spontaneous mutation rates in T4: mutT (destruction of aberrant dGTPs), polA, polB and polC (DNA polymerases), dnaQ (exonucleolytic proofreading), mutH, mutS, mutL and uvrD (methyl-directed DNA mismatch repair), mutM and mutY (excision repair of oxygen-damaged DNA), mutA (function unknown), and topB and osmZ (affecting DNA topology). None increased T4 spontaneous mutation rates within a resolving power of about twofold (nor did optA, which is not a mutator but overexpresses a host dGTPase). Previous screens in T4 have revealed strong mutator mutations only in the gene encoding the viral DNA polymerase and proofreading 3'-exonuclease, plus weak mutators in several polymerase accessory proteins or determinants of dNTP pool sizes. T4 maintains a spontaneous mutation rate per base pair about 30-fold greater than that of its host. Thus, the joint high fidelity of insertion by T4 DNA polymerase and proofreading by its associated 3'-exonuclease appear to determine the T4 spontaneous mutation rate, whereas the host requires numerous additional systems to achieve high replication fidelity. PMID:7851754

  20. Mesenchymal stromal cells having inactivated RB1 survive following low irradiation and accumulate damaged DNA: Hints for side effects following radiotherapy.

    PubMed

    Alessio, Nicola; Capasso, Stefania; Di Bernardo, Giovanni; Cappabianca, Salvatore; Casale, Fiorina; Calarco, Anna; Cipollaro, Marilena; Peluso, Gianfranco; Galderisi, Umberto

    2017-02-01

    Following radiotherapy, bone sarcomas account for a significant percentage of recurring tumors. This risk is further increased in patients with hereditary retinoblastoma that undergo radiotherapy. We analyzed the effect of low and medium dose radiation on mesenchymal stromal cells (MSCs) with inactivated RB1 gene to gain insights on the molecular mechanisms that can induce second malignant neoplasm in cancer survivors. MSC cultures contain subpopulations of mesenchymal stem cells and committed progenitors that can differentiate into mesodermal derivatives: adipocytes, chondrocytes, and osteocytes. These stem cells and committed osteoblast precursors are the cell of origin in osteosarcoma, and RB1 gene mutations have a strong role in its pathogenesis. Following 40 and 2000 mGy X-ray exposure, MSCs with inactivated RB1 do not proliferate and accumulate high levels of unrepaired DNA as detected by persistence of gamma-H2AX foci. In samples with inactivated RB1 the radiation treatment did not increase apoptosis, necrosis or senescence versus untreated cells. Following radiation, CFU analysis showed a discrete number of cells with clonogenic capacity in cultures with silenced RB1. We extended our analysis to the other members of retinoblastoma gene family: RB2/P130 and P107. Also in the MSCs with silenced RB2/P130 and P107 we detected the presence of cells with unrepaired DNA following X-ray irradiation. Cells with unrepaired DNA may represent a reservoir of cells that may undergo neoplastic transformation. Our study suggests that, following radiotherapy, cancer patients with mutations of retinoblastoma genes may be under strict controls to evaluate onset of secondary neoplasms following radiotherapy.

  1. Microbial Inactivation by Ultrasound Assisted Supercritical Fluids

    NASA Astrophysics Data System (ADS)

    Benedito, Jose; Ortuño, Carmen; Castillo-Zamudio, Rosa Isela; Mulet, Antonio

    A method combining supercritical carbon dioxide (SC-CO2) and high power ultrasound (HPU) has been developed and tested for microbial/enzyme inactivation purposes, at different process conditions for both liquid and solid matrices. In culture media, using only SC-CO2, the inactivation rate of E. coli and S. cerevisiae increased with pressure and temperature; and the total inactivation (7-8 log-cycles) was attained after 25 and 140 min of SC-CO2 (350 bar, 36 °C) treatment, respectively. Using SC-CO2+HPU, the time for the total inactivation of both microorganisms was reduced to only 1-2 min, at any condition selected. The SC-CO2+HPU inactivation of both microorganisms was slower in juices (avg. 4.9 min) than in culture media (avg. 1.5 min). In solid samples (chicken, turkey ham and dry-cured pork cured ham) treated with SC-CO2 and SC-CO2+HPU, the inactivation rate of E. coli increased with temperature. The application of HPU to the SC-CO2 treatments accelerated the inactivation rate of E. coli and that effect was more pronounced in treatments with isotonic solution surrounding the solid food samples. The application of HPU enhanced the SC-CO2 inactivation mechanisms of microorganisms, generating a vigorous agitation that facilitated the CO2 solubilization and the mass transfer process. The cavitation generated by HPU could damage the cell walls accelerating the extraction of vital constituents and the microbial death. Thus, using the combined technique, reasonable industrial processing times and mild process conditions could be used which could result into a cost reduction and lead to the minimization in the food nutritional and organoleptic changes.

  2. A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

    PubMed

    Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

    2016-08-01

    Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Quasi-specific access of the potassium channel inactivation gate

    PubMed Central

    Venkataraman, Gaurav; Srikumar, Deepa; Holmgren, Miguel

    2014-01-01

    Many voltage-gated potassium channels open in response to membrane depolarization and then inactivate within milliseconds. Neurons use these channels to tune their excitability. In Shaker K+ channels, inactivation is caused by the cytoplasmic amino terminus, termed the inactivation gate. Despite having four such gates, inactivation is caused by the movement of a single gate into a position that occludes ion permeation. The pathway that this single inactivation gate takes into its inactivating position remains unknown. Here we show that a single gate threads through the intracellular entryway of its own subunit, but the tip of the gate has sufficient freedom to interact with all four subunits deep in the pore, and does so with equal probability. This pathway demonstrates that flexibility afforded by the inactivation peptide segment at the tip of the N-terminus is used to mediate function. PMID:24909510

  4. Characterizing genomic differences of human cancer stratified by the TP53 mutation status.

    PubMed

    Wang, Mengyao; Yang, Chao; Zhang, Xiuqing; Li, Xiangchun

    2018-06-01

    The key roles of the TP53 mutation in cancer have been well established. TP53 is the most frequently mutated gene, and its inactivation is widespread among human cancer types. However, the landscape of genomic alterations in human cancers stratified by the TP53 mutation has not yet been described. We obtained somatic mutation and copy number change data of 6551 regular-mutated samples from the Cancer Genome Atlas (TCGA) and compared significantly mutated genes (SMGs), copy number alterations, mutational signatures and mutational strand asymmetries between cancer samples with and without the TP53 mutation. We identified 126 SMGs, 30 of which were statistically significant in both the TP53 mutant and wild-type groups. Several SMGs, such as VHL, SMAD4 and PTEN, showed a mutation bias towards the TP53 wild-type group, whereas ATRX, IDH1 and RB1 were more prevalent in the TP53 mutant group. Five mutational signatures were extracted from the combined TCGA dataset on which mutational asymmetry analysis was performed, revealing that the TP53 mutant group exhibited substantially greater replication and transcription biases. Furthermore, we found that alterations of multiple genes in a merged mutually exclusive network composed of BRAF, EGFR, PAK1, PIK3CA, PTEN, APC and TERT were related to shortened survival in the TP53 wild-type group. In summary, we characterized the genomic differences and similarities underlying human cancers stratified by the TP53 mutation and identified multi-gene alterations of a merged mutually exclusive network to be a poor prognostic factor for the TP53 wild-type group.

  5. Evaluation of Chlorine Treatment Levels for Inactivation of Human Norovirus and MS2 Bacteriophage during Sewage Treatment.

    PubMed

    Kingsley, David H; Fay, Johnna P; Calci, Kevin; Pouillot, Régis; Woods, Jacquelina; Chen, Haiqiang; Niemira, Brendan A; Van Doren, Jane M

    2017-12-01

    This study examined the inactivation of human norovirus (HuNoV) GI.1 and GII.4 by chlorine under conditions mimicking sewage treatment. Using a porcine gastric mucin-magnetic bead (PGM-MB) assay, no statistically significant loss in HuNoV binding (inactivation) was observed for secondary effluent treatments of ≤25 ppm total chlorine; for both strains, 50 and 100 ppm treatments resulted in ≤0.8-log 10 unit and ≥3.9-log 10 unit reductions, respectively. Treatments of 10, 25, 50, and 100 ppm chlorine inactivated 0.31, 1.35, >5, and >5 log 10 units, respectively, of the norovirus indicator MS2 bacteriophage. Evaluation of treatment time indicated that the vast majority of MS2 and HuNoV inactivation occurred in the first 5 min for 0.2-μm-filtered, prechlorinated secondary effluent. Free chlorine measurements of secondary effluent seeded with MS2 and HuNoV demonstrated substantial oxidative burdens. With 25, 50, and 100 ppm treatments, free chlorine levels after 5 min of exposure ranged from 0.21 to 0.58 ppm, from 0.28 to 16.7 ppm, and from 11.6 to 53 ppm, respectively. At chlorine treatment levels of >50 ppm, statistically significant differences were observed between reductions for PGM-MB-bound HuNoV (potentially infectious) particles and those for unbound (noninfectious) HuNoV particles or total norovirus particles. While results suggested that MS2 and HuNoV (measured as PGM-MB binding) behave similarly, although not identically, both have limited susceptibility to chlorine treatments of ≤25 ppm total chlorine. Since sewage treatment is performed at ≤25 ppm total chlorine, targeting free chlorine levels of 0.5 to 1.0 ppm, these results suggest that traditional chlorine-based sewage treatment does not inactivate HuNoV efficiently. IMPORTANCE HuNoV is ubiquitous in sewage. A receptor binding assay was used to assess inactivation of HuNoV by chlorine-based sewage treatment, given that the virus cannot be routinely propagated in vitro Results reported here

  6. Evaluation of Chlorine Treatment Levels for Inactivation of Human Norovirus and MS2 Bacteriophage during Sewage Treatment

    PubMed Central

    Fay, Johnna P.; Calci, Kevin; Pouillot, Régis; Woods, Jacquelina; Chen, Haiqiang; Niemira, Brendan A.; Van Doren, Jane M.

    2017-01-01

    ABSTRACT This study examined the inactivation of human norovirus (HuNoV) GI.1 and GII.4 by chlorine under conditions mimicking sewage treatment. Using a porcine gastric mucin-magnetic bead (PGM-MB) assay, no statistically significant loss in HuNoV binding (inactivation) was observed for secondary effluent treatments of ≤25 ppm total chlorine; for both strains, 50 and 100 ppm treatments resulted in ≤0.8-log10 unit and ≥3.9-log10 unit reductions, respectively. Treatments of 10, 25, 50, and 100 ppm chlorine inactivated 0.31, 1.35, >5, and >5 log10 units, respectively, of the norovirus indicator MS2 bacteriophage. Evaluation of treatment time indicated that the vast majority of MS2 and HuNoV inactivation occurred in the first 5 min for 0.2-μm-filtered, prechlorinated secondary effluent. Free chlorine measurements of secondary effluent seeded with MS2 and HuNoV demonstrated substantial oxidative burdens. With 25, 50, and 100 ppm treatments, free chlorine levels after 5 min of exposure ranged from 0.21 to 0.58 ppm, from 0.28 to 16.7 ppm, and from 11.6 to 53 ppm, respectively. At chlorine treatment levels of >50 ppm, statistically significant differences were observed between reductions for PGM-MB-bound HuNoV (potentially infectious) particles and those for unbound (noninfectious) HuNoV particles or total norovirus particles. While results suggested that MS2 and HuNoV (measured as PGM-MB binding) behave similarly, although not identically, both have limited susceptibility to chlorine treatments of ≤25 ppm total chlorine. Since sewage treatment is performed at ≤25 ppm total chlorine, targeting free chlorine levels of 0.5 to 1.0 ppm, these results suggest that traditional chlorine-based sewage treatment does not inactivate HuNoV efficiently. IMPORTANCE HuNoV is ubiquitous in sewage. A receptor binding assay was used to assess inactivation of HuNoV by chlorine-based sewage treatment, given that the virus cannot be routinely propagated in vitro. Results reported

  7. Inactivation and magnetic separation of bacteria from liquid suspensions using electrosprayed and nonelectrosprayed nZVI particles: observations and mechanisms.

    PubMed

    Chen, Qi; Gao, Min; Li, Jing; Shen, Fangxia; Wu, Yan; Xu, Zhenqiang; Yao, Maosheng

    2012-02-21

    Here, nonelectrosprayed nanoscale zerovalent iron (NE-nZVI), electrosprayed nZVI (E-nZVI) and preoxidized nZVI (O-nZVI) particles were applied to inactivating Bacillus subtilis, Escherichia coli as well as bacteria in various wastewater samples. In addition, magnetic separation was applied to the mixture of 0.2 mL bacterial sample and 1.8 mL E-nZVI or NE-nZVI suspensions. Bacterial concentrations and optical density of the supernatants were analyzed using culturing, optical adsorption and qPCR tests. In general, for wastewater samples the inactivations were shown to range from 1-log to 3-log. PCR-DGGE analysis indicated that no gene mutation occurred when bacteria were treated with nZVI. Using magnetic separation, significant physical removals, revealed as a function of nZVI type (NE-,E- and O-nZVI) and bacterial concentration, up to 6-log were obtained. E-nZVI and NE-nZVI were shown to react differently with B. subtilis and E. coli, although exhibiting similar inactivation rates. qPCR tests detected higher amount of DNA in the supernatants from mixing E. coli with NE-nZVI, but less for E-nZVI. However, the opposite was observed with B. subtilis. Our data together with optical adsorption analysis suggested that the inactivation and magnetic separation mainly depend on Fe(0)/Fe(3)O(4) shell compositions, the type of bacteria (aerobic and anaerobic) and their concentrations.

  8. Undifferentiated and Dedifferentiated Endometrial Carcinomas With POLE Exonuclease Domain Mutations Have a Favorable Prognosis.

    PubMed

    Espinosa, Iñigo; Lee, Cheng-Han; D'Angelo, Emanuela; Palacios, José; Prat, Jaime

    2017-08-01

    POLE exonuclease domain mutations have recently been described in undifferentiated endometrial carcinoma but, because of the rarity of this aggressive type of endometrial cancer, their prognostic significance is unknown. We have analyzed the immunophenotype (ARID1A, MLH1, PMS2, MSH2, MSH6, p53, β-catenin, and SMARCB1) and mutational status (POLE, PIK3CA, and PTEN) of 21 undifferentiated carcinomas (8 undifferentiated and 13 dedifferentiated carcinomas). Loss of ARID1A expression was observed in 9 of 19 cases (47%), loss of expression of at least 1 DNA mismatch repair protein in 7 (7/21; 33%), and p53 immunoreaction was aberrant (mutated/inactivated) in 11 cases (11/21; 52%). All tumors were negative for β-catenin. Normal nuclear SMARCB1 (INI1) staining was found in all but 1 dedifferentiated case. Two undifferentiated and 7 dedifferentiated carcinomas showed POLE exonuclease domain mutations (9/21; 42%). PIK3CA mutations occurred in six tumors (6/21; 28%) (2 undifferentiated and 4 dedifferentiated carcinomas). PTEN mutations were found in 7 of 15 cases (47%) (4 undifferentiated and 3 dedifferentiated carcinomas). POLE-mutated undifferentiated and dedifferentiated endometrial carcinomas were more frequently stage I tumors than similar carcinomas lacking exonuclease domain mutations (7/9; 78% vs. 3/12; 25%; P=0.023) and patients had significantly better outcome (disease-specific survival) than those without POLE exonuclease domain mutations (P=0.02). Determination of the POLE mutation status is important for the management of these patients.

  9. Patterns of Immunodominance in HIV-1–specific Cytotoxic T Lymphocyte Responses in Two Human Histocompatibility Leukocyte Antigens (HLA)-identical Siblings with HLA-A*0201 Are Influenced by Epitope Mutation

    PubMed Central

    Goulder, P.J.R.; Sewell, A.K.; Lalloo, D.G.; Price, D.A.; Whelan, J.A.; Evans, J.; Taylor, G.P.; Luzzi, G.; Giangrande, P.; Phillips, R.E.; McMichael, A.J.

    1997-01-01

    Primary human immunodeficiency virus (HIV) infection is controlled principally by HIV-specific cytotoxic T lymphocytes (CTL) to a steady-state level of virus load, which strongly influences the ultimate rate of progression to disease. Epitope selection by CTL may be an important determinant of the degree of immune control over the virus. This report describes the CTL responses of two HLA-identical hemophiliac brothers who were exposed to identical batches of Factor VIII and became seropositive within 10 wk of one another. Both have HLA-A*0201. The CTL responses of the two siblings were very dissimilar, one donor making strong responses to two epitopes within p17 Gag (HLA-A*0201–restricted SLYNTVATL and HLA-A3–restricted RLRPGGKKK). The sibling responded to neither epitope, but made strong responses to two epitopes presented by HLA-B7. This was not the result of differences in presentation of the epitopes. However, mutations in both immunodominant epitopes of the p17 Gag responder were seen in proviral sequences of the nonresponder. We then documented the CTL responses to two HLA-A*0201–restricted epitopes, in Gag (SLYNTVATL) and Pol (ILKEPVHGV) in 22 other HIV-infected donors with HLA-A*0201. The majority (71%) generated responses to the Gag epitope. In the 29% of donors failing to respond to the Gag epitope in standard assays, there was evidence of low frequency memory CTL responses using peptide stimulation of PBMC, and most of these donors also showed mutations in or around the Gag epitope. We concluded that HLA class I genotype determines epitope selection initially but that mutation in immunodominant epitopes can profoundly alter the pattern of CTL response. PMID:9126923

  10. Small Cell Lung Cancer Exhibits Frequent Inactivating Mutations in the Histone Methyltransferase KMT2D/MLL2: CALGB 151111 (Alliance)

    PubMed Central

    Augert, Arnaud; Zhang, Qing; Bates, Breanna; Cui, Min; Wang, Xiaofei; Wildey, Gary; Dowlati, Afshin; MacPherson, David

    2017-01-01

    Introduction SCLC is a lethal neuroendocrine tumor type that is highly prone to metastasis. There is an urgency to understand the mutated genes that promote SCLC, as there are no approved targeted therapies yet available. SCLC is rarely resected, limiting the number of samples available for genomic analyses of somatic mutations. Methods To identify potential driver mutations in human SCLC we sequenced the whole exomes of 18 primary SCLCs and seven cell lines along with matched normal controls. We extended these data by resequencing a panel of genes across 40 primary SCLCs and 48 cell lines. Results We report frequent mutations in the lysine methyltransferase 2D gene (KMT2D) (also known as MLL2), a key regulator of transcriptional enhancer function. KMT2D exhibited truncating nonsense/frameshift/splice site mutations in 8% of SCLC tumors and 17% of SCLC cell lines. We found that KMT2D mutation in human SCLC cell lines was associated with reduced lysine methyltransferase 2D protein levels and reduced monomethylation of histone H3 lysine 4, a mark associated with transcriptional enhancers. We also found mutations in other genes associated with transcriptional enhancer control, including CREB binding protein gene (CREBBP), E1A binding protein p300 gene (EP300), and chromodomain helicase DNA binding protein 7 gene (CHD7), and we report mutations in additional chromatin remodeling genes such as polybromo 1 gene (PBRM1). Conclusions These data indicate that KMT2D is one of the major mutated genes in SCLC, and they point to perturbation of transcriptional enhancer control as potentially contributing to SCLC. PMID:28007623

  11. Non-thermal plasma for inactivated-vaccine preparation.

    PubMed

    Wang, Guomin; Zhu, Ruihao; Yang, Licong; Wang, Kaile; Zhang, Qian; Su, Xia; Yang, Bing; Zhang, Jue; Fang, Jing

    2016-02-17

    Vaccines are of great importance in controlling the spread of infectious diseases in poultry farming. The safety and efficacy of vaccines are also essential. To explore the feasibility of a novel technology (non-thermal plasma) in inactivated vaccine preparation, an alternating current atmospheric pressure non-thermal plasma (NTP) jet with Ar/O2/N2 as the operating gas was used to inactivate a Newcastle disease virus (NDV, LaSota) strain and H9N2 avian influenza virus (AIV, A/Chicken/Hebei/WD/98) for vaccine preparation. The results showed that complete inactivation could be achieved with 2 min of NTP treatment for both NDV and AIV. Moreover, a proper NTP treatment time is needed for inactivation of a virus without destruction of the antigenic determinants. Compared to traditional formaldehyde-inactivated vaccine, the vaccine made from NDV treated by NTP for 2 min (NTP-2 min-NDV-vaccine) could induce a higher NDV-specific antibody titer in specific pathogen-free (SPF) chickens, and the results of a chicken challenge experiment showed that NTP-2 min-NDV-vaccine could protect SPF chickens from a lethal NDV challenge. Vaccines made from AIV treated by NTP for 2 min (NTP-2 min-AIV-vaccine) also showed a similar AIV-specific antibody titer compared with traditional AIV vaccines prepared using formaldehyde inactivation. Studies of the morphological changes of the virus, chemical analysis of NDV allantoic fluid and optical emission spectrum analysis of NTP suggested that reactive oxygen species and reactive nitrogen species produced by NTP played an important role in the virus inactivation process. All of these results demonstrated that it could be feasible to use non-thermal NTP as an alternative strategy to prepare inactivated vaccines for Newcastle disease and avian influenza. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Genetic Inactivation of ATRX Leads to a Decrease in the Amount of Telomeric Cohesin and Level of Telomere Transcription in Human Glioma Cells

    PubMed Central

    Eid, Rita; Demattei, Marie-Véronique; Episkopou, Harikleia; Augé-Gouillou, Corinne; Decottignies, Anabelle; Grandin, Nathalie

    2015-01-01

    Mutations in ATRX (alpha thalassemia/mental retardation syndrome X-linked), a chromatin-remodeling protein, are associated with the telomerase-independent ALT (alternative lengthening of telomeres) pathway of telomere maintenance in several types of cancer, including human gliomas. In telomerase-positive glioma cells, we found by immunofluorescence that ATRX localized not far from the chromosome ends but not exactly at the telomere termini. Chromatin immunoprecipitation (ChIP) experiments confirmed a subtelomeric localization for ATRX, yet short hairpin RNA (shRNA)-mediated genetic inactivation of ATRX failed to trigger the ALT pathway. Cohesin has been recently shown to be part of telomeric chromatin. Here, using ChIP, we showed that genetic inactivation of ATRX provoked diminution in the amount of cohesin in subtelomeric regions of telomerase-positive glioma cells. Inactivation of ATRX also led to diminution in the amount of TERRAs, noncoding RNAs resulting from transcription of telomeric DNA, as well as to a decrease in RNA polymerase II (RNAP II) levels at the telomeres. Our data suggest that ATRX might establish functional interactions with cohesin on telomeric chromatin in order to control TERRA levels and that one or the other or both of these events might be relevant to the triggering of the ALT pathway in cancer cells that exhibit genetic inactivation of ATRX. PMID:26055325

  13. Sexy transgenes: the impact of gene transfer and gene inactivation technologies on the understanding of mammalian sex determination.

    PubMed

    Vaiman, Daniel

    2003-06-01

    Amongst the various developmental pathways ending in a sound mammal, sex determination presents the peculiarity of a choice between two equally viable options: female or male. Therefore, destroying a 'male-determining gene' or a 'female-determining gene' should generally not be lethal. Genetic sex determination is divided into two consecutive steps: construction of the bipotential gonad, and then sex determination per se. The genes involved in the first step are in fact involved in the development of various body compartments, and their mutation is generally far from innocuous. From transgenic and inactivation studies carried out on the laboratory mouse, a complete picture of the two steps is beginning to emerge, where the gonad itself and the necessary ducts are shown to evolve in a very coordinate way, with well-defined sex-specificities. Compared with testis determination, the ovarian side of the picture is still relatively empty, but this situation can change rapidly as candidate ovarian genes for inactivation studies are beginning to be identified.

  14. Inactivation of Penicillins by Thiol Broth

    PubMed Central

    Murray, Patrick R.; Niles, Ann C.

    1982-01-01

    Thiol broth with sodium polyanetholesulfonate inactivated penicillin G, carbenicillin, nafcillin, oxacillin, and gentamicin, but had no effect on cephalothin, cefoxitin, clindamycin, chloramphenicol, erythromycin, and tetracycline. Only Thiol broth was capable of this inactivation, which was not influenced by the presence of blood. PMID:7153352

  15. Ancestral Mutations Acquired in Refrex-1, a Restriction Factor against Feline Retroviruses, during its Cooption and Domestication

    PubMed Central

    Ito, Jumpei; Baba, Takuya; Kawasaki, Junna

    2015-01-01

    ABSTRACT Endogenous retroviruses (ERVs) are remnants of ancestral retroviral infections of germ cells. Retroviral endogenization is an adaptation process for the host genome, and ERVs are gradually attenuated or inactivated by mutation. However, some ERVs that have been “domesticated” by their hosts eventually gain physiological functions, such as placentation or viral resistance. We previously reported the discovery of Refrex-1, a soluble antiretroviral factor in domestic cats that specifically inhibits infection by feline leukemia virus subgroup D (FeLV-D), a chimeric virus of FeLV, and a feline ERV, ERV-DC. Refrex-1 is a truncated envelope protein (Env) encoded by both ERV-DC7 and ERV-DC16 proviral loci. Here, we reconstituted ancestral and functional Env from ERV-DC7 and ERV-DC16 envelope genes (env) by inducing reverse mutations. Unexpectedly, ERV-DC7 and ERV-DC16 full-length Env (ERV-DC7 fl and ERV-DC16 fl), reconstructed by removing stop codons, did not produce infectious viral particles. ERV-DC7 fl and ERV-DC16 fl were highly expressed in cells but were not cleaved into surface subunits (SU) and transmembrane subunits, nor were they incorporated into virions. G407R/N427I-A429T and Y431D substitutions within the SU C-terminal domain of ERV-DC7 fl and ERV-DC16 fl, respectively, caused these dysfunctions. The residues glycine 407 and tyrosine 431 are relatively conserved among infectious gammaretroviruses, and their substitution causes the same dysfunctions as the tested retroviruses. Our results reveal that specific mutations within the SU C-terminal domain suppressed Env cleavage and incorporation into virions and indicate that these mutations contributed to the domestication of Refrex-1 through multistep events that occurred in the postintegration period. IMPORTANCE Domestic cats are colonized with various exogenous retroviruses (exRVs), such as feline leukemia virus (FeLV), and their genomes contain numerous ERVs, some of which are replication

  16. High frequency of coexistent mutations of PIK3CA and PTEN genes in endometrial carcinoma.

    PubMed

    Oda, Katsutoshi; Stokoe, David; Taketani, Yuji; McCormick, Frank

    2005-12-01

    The phosphatidylinositol 3'-kinase (PI3K) pathway is activated in many human cancers. In addition to inactivation of the PTEN tumor suppressor gene, mutations or amplifications of the catalytic subunit alpha of PI3K (PIK3CA) have been reported. However, the coexistence of mutations in these two genes seems exceedingly rare. As PTEN mutations occur at high frequency in endometrial carcinoma, we screened 66 primary endometrial carcinomas for mutations in the helical and catalytic domains of PIK3CA. We identified a total of 24 (36%) mutations in this gene and coexistence of PIK3CA/PTEN mutations at high frequency (26%). PIK3CA mutations were more common in tumors with PTEN mutations (17 of 37, 46%) compared with those without PTEN mutations (7 of 29, 24%). Array comparative genomic hybridization detected 3q24-qter amplification, which covers the PIK3CA gene (3q26.3), in one of nine tumors. Knocking down PTEN expression in the HEC-1B cell line, which possesses both K-Ras and PIK3CA mutations, further enhances phosphorylation of Akt (Ser473), indicating that double mutation of PIK3CA and PTEN has an additive effect on PI3K activation. Our data suggest that the PI3K pathway is extensively activated in endometrial carcinomas, and that combination of PIK3CA/PTEN alterations might play an important role in development of these tumors.

  17. Voltage Sensor Inactivation in Potassium Channels

    PubMed Central

    Bähring, Robert; Barghaan, Jan; Westermeier, Regina; Wollberg, Jessica

    2012-01-01

    In voltage-gated potassium (Kv) channels membrane depolarization causes movement of a voltage sensor domain. This conformational change of the protein is transmitted to the pore domain and eventually leads to pore opening. However, the voltage sensor domain may interact with two distinct gates in the pore domain: the activation gate (A-gate), involving the cytoplasmic S6 bundle crossing, and the pore gate (P-gate), located externally in the selectivity filter. How the voltage sensor moves and how tightly it interacts with these two gates on its way to adopt a relaxed conformation when the membrane is depolarized may critically determine the mode of Kv channel inactivation. In certain Kv channels, voltage sensor movement leads to a tight interaction with the P-gate, which may cause conformational changes that render the selectivity filter non-conductive (“P/C-type inactivation”). Other Kv channels may preferably undergo inactivation from pre-open closed-states during voltage sensor movement, because the voltage sensor temporarily uncouples from the A-gate. For this behavior, known as “preferential” closed-state inactivation, we introduce the term “A/C-type inactivation”. Mechanistically, P/C- and A/C-type inactivation represent two forms of “voltage sensor inactivation.” PMID:22654758

  18. Lack of X inactivation associated with maternal X isodisomy: evidence for a counting mechanism prior to X inactivation during human embryogenesis.

    PubMed

    Migeon, B R; Jeppesen, P; Torchia, B S; Fu, S; Dunn, M A; Axelman, J; Schmeckpeper, B J; Fantes, J; Zori, R T; Driscoll, D J

    1996-01-01

    We have previously reported functional disomy for X-linked genes in females with tiny ring X chromosomes and a phenotype significantly more abnormal than Turner syndrome. In such cases the disomy results from failure of these X chromosomes to inactivate because they lack DNA sequences essential for cis X inactivation. Here we describe a novel molecular mechanism for functional X disomy that is associated with maternal isodisomy. In this case, the severe mental retardation and multiple congenital abnormalities in a female with a mosaic 45,X/ 46,X,del(X)(q21.3-qter)/ 46X,r(X) karyotype are associated with overexpression of the genes within Xpter to Xq21.31 in many of her cells. Her normal X, ring X, and deleted linear X chromosomes originate from the same maternal X chromosome, and all are transcriptionally active. None expresses X inactive specific transcript (XIST), although the locus and region of the putative X inactivation center (XIC) are present on both normal and linear deleted X chromosomes. To our knowledge, this is the first report of a functional maternal X isodisomy, and the largest X chromosome to escape inactivation. In addition, these results (1) show that cis inactivation does not invariably occur in human females with two X chromosomes, even when the XIC region is present on both of them; (2) provide evidence for a critical time prior to the visible onset of X inactivation in the embryo when decisions about X inactivation are made; and (3) support the hypothesis that the X chromosome counting mechanism involves chromosomal imprinting, occurs prior to the onset of random inactivation, and is required for subsequent inactivation of the chromosome.

  19. Concomitant mutation and epimutation of the MLH1 gene in a Lynch syndrome family.

    PubMed

    Cini, Giulia; Carnevali, Ileana; Quaia, Michele; Chiaravalli, Anna Maria; Sala, Paola; Giacomini, Elisa; Maestro, Roberta; Tibiletti, Maria Grazia; Viel, Alessandra

    2015-04-01

    Lynch syndrome (LS) is an inherited predisposition cancer syndrome, typically caused by germline mutations in the mismatch repair genes MLH1, MSH2, MSH6 and PMS2. In the last years, a role for epimutations of the same genes has also been reported. MLH1 promoter methylation is a well known mechanism of somatic inactivation in tumors, and more recently, several cases of constitutional methylation have been identified. In four subjects affected by multiple tumors and belonging to a suspected LS family, we detected a novel secondary MLH1 gene epimutation. The methylation of MLH1 promoter was always linked in cis with a 997 bp-deletion (c.-168_c.116+713del), that removed exon 1 and partially involved the promoter of the same gene. Differently from cases with constitutional primary MLH1 inactivation, this secondary methylation was allele-specific and CpGs of the residual promoter region were totally methylated, leading to complete allele silencing. In the colon tumor of the proband, MLH1 and PMS2 expression was completely lost as a consequence of a pathogenic somatic point mutation (MLH1 c.199G>A, p.Gly67Arg) that also abrogated local methylation by destroying a CpG site. The evidences obtained highlight how MLH1 mutations and epimutations can reciprocally influence each other and suggest that an altered structure of the MLH1 locus results in epigenetic alteration. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Inactivation of virus in solution by cold atmospheric pressure plasma: identification of chemical inactivation pathways

    NASA Astrophysics Data System (ADS)

    Aboubakr, Hamada A.; Gangal, Urvashi; Youssef, Mohammed M.; Goyal, Sagar M.; Bruggeman, Peter J.

    2016-05-01

    Cold atmospheric pressure plasma (CAP) inactivates bacteria and virus through in situ production of reactive oxygen and nitrogen species (RONS). While the bactericidal and virucidal efficiency of plasmas is well established, there is limited knowledge about the chemistry leading to the pathogen inactivation. This article describes a chemical analysis of the CAP reactive chemistry involved in the inactivation of feline calicivirus. We used a remote radio frequency CAP produced in varying gas mixtures leading to different plasma-induced chemistries. A study of the effects of selected scavengers complemented with positive control measurements of relevant RONS reveal two distinctive pathways based on singlet oxygen and peroxynitrous acid. The first mechanism is favored in the presence of oxygen and the second in the presence of air when a significant pH reduction is induced in the solution by the plasma. Additionally, smaller effects of the H2O2, O3 and \\text{NO}2- produced were also found. Identification of singlet oxygen-mediated 2-imidazolone/2-oxo-His (His  +14 Da)—an oxidative modification of His 262 comprising the capsid protein of feline calicivirus links the plasma induced singlet oxygen chemistry to viral inactivation.

  1. Hotspot mutation panel testing reveals clonal evolution in a study of 265 paired primary and metastatic tumors.

    PubMed

    Goswami, Rashmi S; Patel, Keyur P; Singh, Rajesh R; Meric-Bernstam, Funda; Kopetz, E Scott; Subbiah, Vivek; Alvarez, Ricardo H; Davies, Michael A; Jabbar, Kausar J; Roy-Chowdhuri, Sinchita; Lazar, Alexander J; Medeiros, L Jeffrey; Broaddus, Russell R; Luthra, Rajyalakshmi; Routbort, Mark J

    2015-06-01

    We used a clinical next-generation sequencing (NGS) hotspot mutation panel to investigate clonal evolution in paired primary and metastatic tumors. A total of 265 primary and metastatic tumor pairs were sequenced using a 46-gene cancer mutation panel capable of detecting one or more single-nucleotide variants as well as small insertions/deletions. Mutations were tabulated together with tumor type and percentage, mutational variant frequency, time interval between onset of primary tumor and metastasis, and neoadjuvant therapy status. Of note, 227 of 265 (85.7%) tumor metastasis pairs showed identical mutation calls. Of the tumor pairs with identical mutation calls, 160 (60.4%) possessed defining somatic mutation signatures and 67 (25.3%) did not exhibit any somatic mutations. There were 38 (14.3%) cases that showed at least one novel mutation call between the primary and metastasis. Metastases were almost two times more likely to show novel mutations (n = 20, 7.5%) than primary tumors (n = 12, 4.5%). TP53 was the most common additionally mutated gene in metastatic lesions, followed by PIK3CA and SMAD4. PIK3CA mutations were more often associated with metastasis in colon carcinoma samples. Clinical NGS hotspot panels can be useful in analyzing clonal evolution within tumors as well as in determining subclonal mutations that can expand in future metastases. PIK3CA, SMAD4, and TP53 are most often involved in clonal divergence, providing potential targets that may help guide the clinical management of tumor progression or metastases. ©2015 American Association for Cancer Research.

  2. Kinetics of Ozone Inactivation of Infectious Prion Protein

    PubMed Central

    Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Mitchell, Gordon; Belosevic, Miodrag

    2013-01-01

    The kinetics of ozone inactivation of infectious prion protein (PrPSc, scrapie 263K) was investigated in ozone-demand-free phosphate-buffered saline (PBS). Diluted infectious brain homogenates (IBH) (0.01%) were exposed to a predetermined ozone dose (10.8 ± 2.0 mg/liter) at three pHs (pH 4.4, 6.0, and 8.0) and two temperatures (4°C and 20°C). The inactivation of PrPSc was quantified by determining the in vitro destruction of PrPSc templating properties using the protein misfolding cyclic amplification (PMCA) assay and bioassay, which were shown to correlate well. The inactivation kinetics were characterized by both Chick-Watson (CW) and efficiency factor Hom (EFH) models. It was found that the EFH model fit the experimental data more appropriately. The efficacy of ozone inactivation of PrPSc was both pH and temperature dependent. Based on the EFH model, CT (disinfectant concentration multiplied by contact time) values were determined for 2-log10, 3-log10, and 4-log10 inactivation at the conditions under which they were achieved. Our results indicated that ozone is effective for prion inactivation in ozone-demand-free water and may be applied for the inactivation of infectious prion in prion-contaminated water and wastewater. PMID:23416994

  3. Condensin II mutation causes T-cell lymphoma through tissue-specific genome instability

    PubMed Central

    Woodward, Jessica; Taylor, Gillian C.; Soares, Dinesh C.; Boyle, Shelagh; Sie, Daoud; Read, David; Chathoth, Keerthi; Vukovic, Milica; Tarrats, Nuria; Jamieson, David; Campbell, Kirsteen J.; Blyth, Karen; Acosta, Juan Carlos; Ylstra, Bauke; Arends, Mark J.; Kranc, Kamil R.; Jackson, Andrew P.; Bickmore, Wendy A.

    2016-01-01

    Chromosomal instability is a hallmark of cancer, but mitotic regulators are rarely mutated in tumors. Mutations in the condensin complexes, which restructure chromosomes to facilitate segregation during mitosis, are significantly enriched in cancer genomes, but experimental evidence implicating condensin dysfunction in tumorigenesis is lacking. We report that mice inheriting missense mutations in a condensin II subunit (Caph2nes) develop T-cell lymphoma. Before tumors develop, we found that the same Caph2 mutation impairs ploidy maintenance to a different extent in different hematopoietic cell types, with ploidy most severely perturbed at the CD4+CD8+ T-cell stage from which tumors initiate. Premalignant CD4+CD8+ T cells show persistent catenations during chromosome segregation, triggering DNA damage in diploid daughter cells and elevated ploidy. Genome sequencing revealed that Caph2 single-mutant tumors are near diploid but carry deletions spanning tumor suppressor genes, whereas P53 inactivation allowed Caph2 mutant cells with whole-chromosome gains and structural rearrangements to form highly aggressive disease. Together, our data challenge the view that mitotic chromosome formation is an invariant process during development and provide evidence that defective mitotic chromosome structure can promote tumorigenesis. PMID:27737961

  4. No GIST-type c-kit gain of function mutations in neuroblastic tumours

    PubMed Central

    Korja, M; Finne, J; Salmi, T T; Haapasalo, H; Tanner, M; Isola, J

    2005-01-01

    Aims: Neuroblastic tumours (NTs) have been shown to respond to imatinib treatment in vivo and in vitro, possibly via inactivating the c-kit receptor. The purpose of this study was to identify gastrointestinal stromal tumour (GIST)-type c-kit gene associated mutations in exons 9, 11, 13, and 17 in NTs to recognise a subset of tumours that would probably respond to imatinib treatment. Methods: Expression of the c-kit protein was detected immunohistochemically in a total of 37 archival paraffin wax embedded NTs using polyclonal rabbit antihuman c-kit antibody. After immunohistochemistry, c-kit gene associated chromosomal mutations in all cases of NT were detected with denaturing high performance liquid chromatography (HPLC). Results: Denaturing HLPC analysis did not reveal GIST-type mutations in four immunohistochemically detected c-kit positive or in 33 c-kit negative NTs. Conclusions: c-kit receptor expression and GIST-type c-kit gene mutations are rare events in NTs. Oncogenic activation of c-kit in NTs presumably differs from that of GISTs, which may influence their responsiveness to imatinib treatment. Whether c-kit has an essential role in the pathogenesis of NTs remains to be investigated. PMID:15976348

  5. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis

    PubMed Central

    Ichikawa, Shoji; Imel, Erik A.; Kreiter, Mary L.; Yu, Xijie; Mackenzie, Donald S.; Sorenson, Andrea H.; Goetz, Regina; Mohammadi, Moosa; White, Kenneth E.; Econs, Michael J.

    2007-01-01

    Familial tumoral calcinosis is characterized by ectopic calcifications and hyperphosphatemia due to inactivating mutations in FGF23 or UDP-N-acetyl-α-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GALNT3). Herein we report a homozygous missense mutation (H193R) in the KLOTHO (KL) gene of a 13-year-old girl who presented with severe tumoral calcinosis with dural and carotid artery calcifications. This patient exhibited defects in mineral ion homeostasis with marked hyperphosphatemia and hypercalcemia as well as elevated serum levels of parathyroid hormone and FGF23. Mapping of H193R mutation onto the crystal structure of myrosinase, a plant homolog of KL, revealed that this histidine residue was at the base of the deep catalytic cleft and mutation of this histidine to arginine should destabilize the putative glycosidase domain (KL1) of KL, thereby attenuating production of membrane-bound and secreted KL. Indeed, compared with wild-type KL, expression and secretion of H193R KL were markedly reduced in vitro, resulting in diminished ability of FGF23 to signal via its cognate FGF receptors. Taken together, our findings provide what we believe to be the first evidence that loss-of-function mutations in human KL impair FGF23 bioactivity, underscoring the essential role of KL in FGF23-mediated phosphate and vitamin D homeostasis in humans. PMID:17710231

  6. Bacterial spore inactivation induced by cold plasma.

    PubMed

    Liao, Xinyu; Muhammad, Aliyu Idris; Chen, Shiguo; Hu, Yaqin; Ye, Xingqian; Liu, Donghong; Ding, Tian

    2018-04-05

    Cold plasma has emerged as a non-thermal technology for microbial inactivation in the food industry over the last decade. Spore-forming microorganisms pose challenges for microbiological safety and for the prevention of food spoilage. Inactivation of spores induced by cold plasma has been reported by several studies. However, the exact mechanism of spore deactivation by cold plasma is poorly understood; therefore, it is difficult to control this process and to optimize cold plasma processing for efficient spore inactivation. In this review, we summarize the factors that affect the resistance of spores to cold plasma, including processing parameters, environmental elements, and spore properties. We then describe possible inactivation targets in spore cells (e.g., outer structure, DNA, and metabolic proteins) that associated with inactivation by cold plasma according to previous studies. Kinetic models of the sporicidal activity of cold plasma have also been described here. A better understanding of the interaction between spores and cold plasma is essential for the development and optimization of cold plasma technology in food the industry.

  7. Mutations in PROP1 cause familial combined pituitary hormone deficiency.

    PubMed

    Wu, W; Cogan, J D; Pfäffle, R W; Dasen, J S; Frisch, H; O'Connell, S M; Flynn, S E; Brown, M R; Mullis, P E; Parks, J S; Phillips, J A; Rosenfeld, M G

    1998-02-01

    Combined pituitary hormone deficiency (CPHD) in man denotes impaired production of growth hormone (GH) and one or more of the other five anterior pituitary hormones. Mutations of the pituitary transcription factor gene POU1F1 (the human homologue of mouse Pit1) are responsible for deficiencies of GH, prolactin and thyroid stimulating hormone (TSH) in Snell and Jackson dwarf mice and in man, while the production of adrenocorticotrophic hormone (ACTH), luteinizing hormone (LH) and follicle stimulating hormone (FSH) is preserved. The Ames dwarf (df) mouse displays a similar phenotype, and appears to be epistatic to Snell and Jackson dwarfism. We have recently positionally cloned the putative Ames dwarf gene Prop1, which encodes a paired-like homeodomain protein that is expressed specifically in embryonic pituitary and is necessary for Pit1 expression. In this report, we have identified four CPHD families with homozygosity or compound heterozygosity for inactivating mutations of PROP1. These mutations in the human PROP1 gene result in a gene product with reduced DNA-binding and transcriptional activation ability in comparison to the product of the murine df mutation. In contrast to individuals with POU1F1 mutations, those with PROP1 mutations cannot produce LH and FSH at a sufficient level and do not enter puberty spontaneously. Our results identify a major cause of CPHD in humans and suggest a direct or indirect role for PROP1 in the ontogenesis of pituitary gonadotropes, as well as somatotropes, lactotropes and caudomedial thyrotropes.

  8. Randomized Trials Comparing Inactivated Vaccine After Medium- or High-titer Measles Vaccine With Standard Titer Measles Vaccine After Inactivated Vaccine: A Meta-analysis.

    PubMed

    Aaby, Peter; Ravn, Henrik; Benn, Christine S; Rodrigues, Amabelia; Samb, Badara; Ibrahim, Salah A; Libman, Michael D; Whittle, Hilton C

    2016-11-01

    Observational studies have suggested that girls have higher mortality if their most recent immunization is an inactivated vaccine rather than a live vaccine. We therefore reanalyzed 5 randomized trials of early measles vaccine (MV) in which it was possible to compare an inactivated vaccines [after medium-titer MV (MTMV) or high-titer MV (HTMV)] and a live standard titer MV (after an initial inactivated vaccine). The trials were conducted in Sudan, Senegal, The Gambia and Guinea-Bissau. The intervention group received live MTMV or HTMV from 4 to 5 months and then an inactivated vaccine from 9 to 10 months of age; the control children received inactivated vaccine/placebo from 4 to 5 months and standard titer MV from 9 to 10 months of age. We compared mortality from 9 months until end of study at 3 to 5 years of age for children who received inactivated vaccine (after MTMV or HTMV) and standard titer MV (after inactivated vaccine), respectively. The original datasets were analyzed using a Cox proportional hazards model stratified by trial. The mortality rate ratio (MRR) was 1.38 (95% confidence interval: 1.05-1.83) after an inactivated vaccine (after MTMV or HTMV) compared with a standard titer MV (after inactivated vaccine). Girls had a MRR of 1.89 (1.27-2.80), whereas there was no effect for boys, the sex-differential effect being significant (P = 0.02). Excluding measles cases did not alter these conclusions, the MRR after inactivated vaccines (after MTMV or HTMV) being 1.40 (1.06-1.86) higher overall and 1.92 (1.29-2.86) for girls. Control for variations in national immunization schedules for other vaccines did not modify these results. After 9 months of age, all children had been immunized against measles, and mortality in girls was higher when they had received inactivated vaccines (after MTMV or HTMV) rather than live standard titer MV (after an inactivated vaccine).

  9. Prevalence of Novel MAGED2 Mutations in Antenatal Bartter Syndrome.

    PubMed

    Legrand, Anne; Treard, Cyrielle; Roncelin, Isabelle; Dreux, Sophie; Bertholet-Thomas, Aurélia; Broux, Françoise; Bruno, Daniele; Decramer, Stéphane; Deschenes, Georges; Djeddi, Djamal; Guigonis, Vincent; Jay, Nadine; Khalifeh, Tackwa; Llanas, Brigitte; Morin, Denis; Morin, Gilles; Nobili, François; Pietrement, Christine; Ryckewaert, Amélie; Salomon, Rémi; Vrillon, Isabelle; Blanchard, Anne; Vargas-Poussou, Rosa

    2018-02-07

    Mutations in the MAGED2 gene, located on the X chromosome, have been recently detected in males with a transient form of antenatal Bartter syndrome or with idiopathic polyhydramnios. The aim of this study is to analyze the proportion of the population with mutations in this gene in a French cohort of patients with antenatal Bartter syndrome. The French cohort of patients with antenatal Bartter syndrome encompasses 171 families. Mutations in genes responsible for types 1-4 have been detected in 75% of cases. In patients without identified genetic cause ( n =42), transient antenatal Bartter syndrome was reported in 12 cases. We analyzed the MAGED2 gene in the entire cohort of negative cases by Sanger sequencing and retrospectively collected clinical data regarding pregnancy as well as the postnatal outcome for positive cases. We detected mutations in MAGED2 in 17 patients, including the 12 with transient antenatal Bartter syndrome, from 16 families. Fifteen different mutations were detected (one whole deletion, three frameshift, three splicing, three nonsense, two inframe deletions, and three missense); 13 of these mutations had not been previously described. Interestingly, two patients are females; in one of these patients our data are consistent with selective inactivation of chromosome X explaining the severity. The phenotypic presentation in our patients was variable and less severe than that of the originally described cases. MAGED2 mutations explained 9% of cases of antenatal Bartter syndrome in a French cohort, and accounted for 38% of patients without other characterized mutations and for 44% of male probands of negative cases. Our study confirmed previously published data and showed that females can be affected. As a result, this gene must be included in the screening of the most severe clinical form of Bartter syndrome. Copyright © 2018 by the American Society of Nephrology.

  10. Mycobacteria inactivation using Engineered Water Nanostructures (EWNS).

    PubMed

    Pyrgiotakis, Georgios; McDevitt, James; Gao, Ya; Branco, Alan; Eleftheriadou, Mary; Lemos, Bernardo; Nardell, Edward; Demokritou, Philip

    2014-08-01

    Airborne transmitted pathogens such as Mycobacterium tuberculosis (Mtb) cause serious, often fatal infectious disease with enormous global health implications. Due to their unique cell wall and slow growth, mycobacteria are among the most resilient microbial forms. Herein we evaluate the ability of an emerging, chemical-free, nanotechnology-based method to inactivate M. parafortuitum (Mtb surrogate). This method is based on the transformation of atmospheric water vapor into engineered water nano-structures (EWNS) via electrospray. We demonstrate that the EWNS can interact with and inactivate airborne mycobacteria, reducing their concentration levels significantly. Additionally, EWNS can inactivate M. parafortuitum on surfaces eight times faster than the control. The mechanism of mycobacteria inactivation was also investigated in this study. It was demonstrated that the EWNS effectively deliver the reactive oxygen species, encapsulated during the electrospray process, to the bacteria oxidizing their cell membrane resulting into inactivation. Overall, this is a method with the potential to become an effective intervention technology in the battle against airborne infections. This study demonstrates the feasibility of mycobacterium inactivation in airborne form or on contact surfaces using electrospray activated water nano-structures. Given that the method is free of toxic chemicals, this might become an important tool in the prevention of mycobacterial infections, which are notoriously hard to treat. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Evaluation of the Efficiency of the Sample Inactivation Reagent in the Abbott RealTime MTB Assay for Inactivation of Mycobacterium tuberculosis

    PubMed Central

    Wallis, Carole; Pahalawatta, Vihanga; Frank, Andrea; Ramdin, Neeshan; Viana, Raquel; Abravaya, Klara; Leckie, Gregor; Tang, Ning

    2015-01-01

    The Abbott RealTime MTB assay is a nucleic acid amplification test (NAAT) for the detection of Mycobacterium tuberculosis complex DNA. The sample inactivation procedure used in the assay, consisting of one part sample treated with 3 parts inactivation reagent for 60 min, effectively reduced viscosity and inactivated M. tuberculosis in clinical specimens. PMID:26085611

  12. Molecular Viability Testing of UV-Inactivated Bacteria.

    PubMed

    Weigel, Kris M; Nguyen, Felicia K; Kearney, Moira R; Meschke, John S; Cangelosi, Gerard A

    2017-05-15

    PCR is effective in detecting bacterial DNA in samples, but it is unable to differentiate viable bacteria from inactivated cells or free DNA fragments. New PCR-based analytical strategies have been developed to address this limitation. Molecular viability testing (MVT) correlates bacterial viability with the ability to rapidly synthesize species-specific rRNA precursors (pre-rRNA) in response to brief nutritional stimulation. Previous studies demonstrated that MVT can assess bacterial inactivation by chlorine, serum, and low-temperature pasteurization. Here, we demonstrate that MVT can detect inactivation of Escherichia coli , Aeromonas hydrophila , and Enterococcus faecalis cells by UV irradiation. Some UV-inactivated E. coli cells transiently retained the ability to synthesize pre-rRNA postirradiation (generating false-positive MVT results), but this activity ceased within 1 h following UV exposure. Viable but transiently undetectable (by culture) E. coli cells were consistently detected by MVT. An alternative viability testing method, viability PCR (vPCR), correlates viability with cell envelope integrity. This method did not distinguish viable bacteria from UV-inactivated bacteria under some conditions, indicating that the inactivated cells retained intact cell envelopes. MVT holds promise as a means to rapidly assess microbial inactivation by UV treatment. IMPORTANCE UV irradiation is increasingly being used to disinfect water, food, and other materials for human use. Confirming the effectiveness of UV disinfection remains a challenging task. In particular, microbiological methods that rely on rapid detection of microbial DNA can yield misleading results, due to the detection of remnant DNA associated with dead microbial cells. This report describes a novel method that rapidly distinguishes living microbial cells from dead microbial cells after UV disinfection. Copyright © 2017 American Society for Microbiology.

  13. Inactivation of p53 Rescues the Maintenance of High Risk HPV DNA Genomes Deficient in Expression of E6

    PubMed Central

    Lorenz, Laurel D.; Rivera Cardona, Jessenia; Lambert, Paul F.

    2013-01-01

    The human papillomavirus DNA genome undergoes three distinct stages of replication: establishment, maintenance and amplification. We show that the HPV16 E6 protein is required for the maintenance of the HPV16 DNA genome as an extrachromosomal, nuclear plasmid in its natural host cell, the human keratinocyte. Based upon mutational analyses, inactivation of p53 by E6, but not necessarily E6-mediated degradation of p53, was found to correlate with the ability of E6 to support maintenance of the HPV16 genome as a nuclear plasmid. Inactivation of p53 with dominant negative p53 rescued the ability of HPV16 E6STOP and E6SAT mutant genomes to replicate as extrachromosomal genomes, though not to the same degree as observed for the HPV16 E6 wild-type (WT) genome. Inactivation of p53 also rescued the ability of HPV18 and HPV31 E6-deficient genomes to be maintained at copy numbers comparable to that of HPV18 and HPV31 E6WT genomes at early passages, though upon further passaging copy numbers for the HPV18 and 31 E6-deficient genomes lessened compared to that of the WT genomes. We conclude that inactivation of p53 is necessary for maintenance of HPV16 and for HPV18 and 31 to replicate at WT copy number, but that additional functions of E6 independent of inactivating p53 must also contribute to the maintenance of these genomes. Together these results suggest that re-activation of p53 may be a possible means for eradicating extrachromosomal HPV16, 18 or 31 genomes in the context of persistent infections. PMID:24204267

  14. Novel USH2A mutations in Japanese Usher syndrome type 2 patients: marked differences in the mutation spectrum between the Japanese and other populations.

    PubMed

    Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Usami, Shin-Ichi; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

    2011-07-01

    Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 2 (USH2) is the most common type of USH and is frequently caused by mutations in USH2A. In a recent mutation screening of USH2A in Japanese USH2 patients, we identified 11 novel mutations in 10 patients and found the possible frequent mutation c.8559-2A>G in 4 of 10 patients. To obtain a more precise mutation spectrum, we analyzed further nine Japanese patients in this study. We identified nine mutations, of which eight were novel. This result indicates that the mutation spectrum for USH2A among Japanese patients largely differs from Caucasian, Jewish and Palestinian patients. Meanwhile, we did not find the c.8559-2A>G in this study. Haplotype analysis of the c.8559-2G (mutated) alleles using 23 single nucleotide polymorphisms surrounding the mutation revealed an identical haplotype pattern of at least 635 kb in length, strongly suggesting that the mutation originated from a common ancestor. The fact that all patients carrying c.8559-2A>G came from western Japan suggests that the mutation is mainly distributed in that area; indeed, most of the patients involved in this study came from eastern Japan, which contributed to the absence of c.8559-2A>G.

  15. The E1784K mutation in SCN5A is associated with mixed clinical phenotype of type 3 long QT syndrome

    PubMed Central

    Makita, Naomasa; Behr, Elijah; Shimizu, Wataru; Horie, Minoru; Sunami, Akihiko; Crotti, Lia; Schulze-Bahr, Eric; Fukuhara, Shigetomo; Mochizuki, Naoki; Makiyama, Takeru; Itoh, Hideki; Christiansen, Michael; McKeown, Pascal; Miyamoto, Koji; Kamakura, Shiro; Tsutsui, Hiroyuki; Schwartz, Peter J.; George, Alfred L.; Roden, Dan M.

    2008-01-01

    Phenotypic overlap of type 3 long QT syndrome (LQT3) with Brugada syndrome (BrS) is observed in some carriers of mutations in the Na channel SCN5A. While this overlap is important for patient management, the clinical features, prevalence, and mechanisms underlying such overlap have not been fully elucidated. To investigate the basis for this overlap, we genotyped a cohort of 44 LQT3 families of multiple ethnicities from 7 referral centers and found a high prevalence of the E1784K mutation in SCN5A. Of 41 E1784K carriers, 93% had LQT3, 22% had BrS, and 39% had sinus node dysfunction. Heterologously expressed E1784K channels showed a 15.0-mV negative shift in the voltage dependence of Na channel inactivation and a 7.5-fold increase in flecainide affinity for resting-state channels, properties also seen with other LQT3 mutations associated with a mixed clinical phenotype. Furthermore, these properties were absent in Na channels harboring the T1304M mutation, which is associated with LQT3 without a mixed clinical phenotype. These results suggest that a negative shift of steady-state Na channel inactivation and enhanced tonic block by class IC drugs represent common biophysical mechanisms underlying the phenotypic overlap of LQT3 and BrS and further indicate that class IC drugs should be avoided in patients with Na channels displaying these behaviors. PMID:18451998

  16. Inactivation of the Carney complex gene 1 (PRKAR1A) alters spatiotemporal regulation of cAMP and cAMP-dependent protein kinase: a study using genetically encoded FRET-based reporters.

    PubMed

    Cazabat, Laure; Ragazzon, Bruno; Varin, Audrey; Potier-Cartereau, Marie; Vandier, Christophe; Vezzosi, Delphine; Risk-Rabin, Marthe; Guellich, Aziz; Schittl, Julia; Lechêne, Patrick; Richter, Wito; Nikolaev, Viacheslav O; Zhang, Jin; Bertherat, Jérôme; Vandecasteele, Grégoire

    2014-03-01

    Carney complex (CNC) is a hereditary disease associating cardiac myxoma, spotty skin pigmentation and endocrine overactivity. CNC is caused by inactivating mutations in the PRKAR1A gene encoding PKA type I alpha regulatory subunit (RIα). Although PKA activity is enhanced in CNC, the mechanisms linking PKA dysregulation to endocrine tumorigenesis are poorly understood. In this study, we used Förster resonance energy transfer (FRET)-based sensors for cAMP and PKA activity to define the role of RIα in the spatiotemporal organization of the cAMP/PKA pathway. RIα knockdown in HEK293 cells increased basal as well as forskolin or prostaglandin E1 (PGE1)-stimulated total cellular PKA activity as reported by western blots of endogenous PKA targets and the FRET-based global PKA activity reporter, AKAR3. Using variants of AKAR3 targeted to subcellular compartments, we identified similar increases in the response to PGE1 in the cytoplasm and at the outer mitochondrial membrane. In contrast, at the plasma membrane, the response to PGE1 was decreased along with an increase in basal FRET ratio. These results were confirmed by western blot analysis of basal and PGE1-induced phosphorylation of membrane-associated vasodilator-stimulated phosphoprotein. Similar differences were observed between the cytoplasm and the plasma membrane in human adrenal cells carrying a RIα inactivating mutation. RIα inactivation also increased cAMP in the cytoplasm, at the outer mitochondrial membrane and at the plasma membrane, as reported by targeted versions of the cAMP indicator Epac1-camps. These results show that RIα inactivation leads to multiple, compartment-specific alterations of the cAMP/PKA pathway revealing new aspects of signaling dysregulation in tumorigenesis.

  17. Cancer-Associated Mutations in Endometriosis without Cancer

    PubMed Central

    Anglesio, M.S.; Papadopoulos, N.; Ayhan, A.; Nazeran, T.M.; Noë, M.; Horlings, H.M.; Lum, A.; Jones, S.; Senz, J.; Seckin, T.; Ho, J.; Wu, R.-C.; Lac, V.; Ogawa, H.; Tessier-Cloutier, B.; Alhassan, R.; Wang, A.; Wang, Y.; Cohen, J.D.; Wong, F.; Hasanovic, A.; Orr, N.; Zhang, M.; Popoli, M.; McMahon, W.; Wood, L.D.; Mattox, A.; Allaire, C.; Segars, J.; Williams, C.; Tomasetti, C.; Boyd, N.; Kinzler, K.W.; Gilks, C.B.; Diaz, L.; Wang, T.-L.; Vogelstein, B.; Yong, P.J.; Huntsman, D.G.; Shih, I.-M.

    2017-01-01

    BACKGROUND Endometriosis, defined as the presence of ectopic endometrial stroma and epithelium, affects approximately 10% of reproductive-age women and can cause pelvic pain and infertility. Endometriotic lesions are considered to be benign inflammatory lesions but have cancerlike features such as local invasion and resistance to apoptosis. METHODS We analyzed deeply infiltrating endometriotic lesions from 27 patients by means of exomewide sequencing (24 patients) or cancer-driver targeted sequencing (3 patients). Mutations were validated with the use of digital genomic methods in micro-dissected epithelium and stroma. Epithelial and stromal components of lesions from an additional 12 patients were analyzed by means of a droplet digital polymerase-chain-reaction (PCR) assay for recurrent activating KRAS mutations. RESULTS Exome sequencing revealed somatic mutations in 19 of 24 patients (79%). Five patients harbored known cancer driver mutations in ARID1A, PIK3CA, KRAS, or PPP2R1A, which were validated by Safe-Sequencing System or immunohistochemical analysis. The likelihood of driver genes being affected at this rate in the absence of selection was estimated at P = 0.001 (binomial test). Targeted sequencing and a droplet digital PCR assay identified KRAS mutations in 2 of 3 patients and 3 of 12 patients, respectively, with mutations in the epithelium but not the stroma. One patient harbored two different KRAS mutations, c.35G→T and c.35G→C, and another carried identical KRAS c.35G→A mutations in three distinct lesions. CONCLUSIONS We found that lesions in deep infiltrating endometriosis, which are associated with virtually no risk of malignant transformation, harbor somatic cancer driver mutations. Ten of 39 deep infiltrating lesions (26%) carried driver mutations; all the tested somatic mutations appeared to be confined to the epithelial compartment of endometriotic lesions. PMID:28489996

  18. Drosophila as a model for epilepsy: bss is a gain-of-function mutation in the para sodium channel gene that leads to seizures.

    PubMed

    Parker, Louise; Padilla, Miguel; Du, Yuzhe; Dong, Ke; Tanouye, Mark A

    2011-02-01

    We report the identification of bang senseless (bss), a Drosophila melanogaster mutant exhibiting seizure-like behaviors, as an allele of the paralytic (para) voltage-gated Na(+) (Na(V)) channel gene. Mutants are more prone to seizure episodes than normal flies because of a lowered seizure threshold. The bss phenotypes are due to a missense mutation in a segment previously implicated in inactivation, termed the "paddle motif" of the Na(V) fourth homology domain. Heterologous expression of cDNAs containing the bss(1) lesion, followed by electrophysiology, shows that mutant channels display altered voltage dependence of inactivation compared to wild type. The phenotypes of bss are the most severe of the bang-sensitive mutants in Drosophila and can be ameliorated, but not suppressed, by treatment with anti-epileptic drugs. As such, bss-associated seizures resemble those of pharmacologically resistant epilepsies caused by mutation of the human Na(V) SCN1A, such as severe myoclonic epilepsy in infants or intractable childhood epilepsy with generalized tonic-clonic seizures.

  19. A double tyrosine motif in the cardiac sodium channel domain III-IV linker couples calcium-dependent calmodulin binding to inactivation gating.

    PubMed

    Sarhan, Maen F; Van Petegem, Filip; Ahern, Christopher A

    2009-11-27

    Voltage-gated sodium channels maintain the electrical cadence and stability of neurons and muscle cells by selectively controlling the transmembrane passage of their namesake ion. The degree to which these channels contribute to cellular excitability can be managed therapeutically or fine-tuned by endogenous ligands. Intracellular calcium, for instance, modulates sodium channel inactivation, the process by which sodium conductance is negatively regulated. We explored the molecular basis for this effect by investigating the interaction between the ubiquitous calcium binding protein calmodulin (CaM) and the putative sodium channel inactivation gate composed of the cytosolic linker between homologous channel domains III and IV (DIII-IV). Experiments using isothermal titration calorimetry show that CaM binds to a novel double tyrosine motif in the center of the DIII-IV linker in a calcium-dependent manner, N-terminal to a region previously reported to be a CaM binding site. An alanine scan of aromatic residues in recombinant DIII-DIV linker peptides shows that whereas multiple side chains contribute to CaM binding, two tyrosines (Tyr(1494) and Tyr(1495)) play a crucial role in binding the CaM C-lobe. The functional relevance of these observations was then ascertained through electrophysiological measurement of sodium channel inactivation gating in the presence and absence of calcium. Experiments on patch-clamped transfected tsA201 cells show that only the Y1494A mutation of the five sites tested renders sodium channel steady-state inactivation insensitive to cytosolic calcium. The results demonstrate that calcium-dependent calmodulin binding to the sodium channel inactivation gate double tyrosine motif is required for calcium regulation of the cardiac sodium channel.

  20. Evaluation of the Efficiency of the Sample Inactivation Reagent in the Abbott RealTime MTB Assay for Inactivation of Mycobacterium tuberculosis.

    PubMed

    Qi, Chao; Wallis, Carole; Pahalawatta, Vihanga; Frank, Andrea; Ramdin, Neeshan; Viana, Raquel; Abravaya, Klara; Leckie, Gregor; Tang, Ning

    2015-09-01

    The Abbott RealTime MTB assay is a nucleic acid amplification test (NAAT) for the detection of Mycobacterium tuberculosis complex DNA. The sample inactivation procedure used in the assay, consisting of one part sample treated with 3 parts inactivation reagent for 60 min, effectively reduced viscosity and inactivated M. tuberculosis in clinical specimens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Heterogeneity of Clonal Expansion and Maturation-Linked Mutation Acquisition in Hematopoietic Progenitors in Human Acute Myeloid Leukemia

    PubMed Central

    Walter, Roland B.; Laszlo, George S.; Lionberger, Jack M.; Pollard, Jessica A.; Harrington, Kimberly H.; Gudgeon, Chelsea J.; Othus, Megan; Rafii, Shahin; Meshinchi, Soheil; Appelbaum, Frederick R.; Bernstein, Irwin D.

    2014-01-01

    Recent technological advances led to an appreciation of the genetic complexity of human acute myeloid leukemia (AML) but underlying progenitor cells remain poorly understood because their rarity precludes direct study. We developed a co-culture method integrating hypoxia, aryl hydrocarbon receptor inhibition, and micro-environmental support via human endothelial cells to isolate these cells. X-chromosome inactivation studies of the least mature precursors derived following prolonged culture of CD34+/CD33− cells revealed polyclonal growth in highly curable AMLs, suggesting mutations necessary for clonal expansion were acquired in more mature progenitors. Consistently, in core-binding factor (CBF) leukemias with known complementing mutations, immature precursors derived following prolonged culture of CD34+/CD33− cells harbored neither mutation or the CBF mutation alone, whereas more mature precursors often carried both mutations. These results were in contrast to those with leukemias with poor prognosis that showed clonal dominance in the least mature precursors. These data indicate heterogeneity among progenitors in human AML that may have prognostic and therapeutic implications. PMID:24721792

  2. Integrative genomic and functional analysis of human oral squamous cell carcinoma cell lines reveals synergistic effects of FAT1 and CASP8 inactivation.

    PubMed

    Hayes, Tyler F; Benaich, Nathan; Goldie, Stephen J; Sipilä, Kalle; Ames-Draycott, Ashley; Cai, Wenjun; Yin, Guangliang; Watt, Fiona M

    2016-12-01

    Oral squamous cell carcinoma (OSCC) is genetically highly heterogeneous, which contributes to the challenges of treatment. To create an in vitro model that accurately reflects this heterogeneity, we generated a panel of HPV-negative OSCC cell lines. By whole exome sequencing of the lines and matched patient blood samples, we demonstrate that the mutational spectrum of the lines is representative of primary OSCC in The Cancer Genome Atlas. We show that loss of function mutations in FAT1 (an atypical cadherin) and CASP8 (Caspase 8) frequently occur in the same tumour. OSCC cells with inactivating FAT1 mutations exhibited reduced intercellular adhesion. Knockdown of FAT1 and CASP8 individually or in combination in OSCC cells led to increased cell migration and clonal growth, resistance to Staurosporine-induced apoptosis and, in some cases, increased terminal differentiation. The OSCC lines thus represent a valuable resource for elucidating the impact of different mutations on tumour behaviour. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  3. Coexistence of CLCN1 and SCN4A mutations in one family suffering from myotonia.

    PubMed

    Maggi, Lorenzo; Ravaglia, Sabrina; Farinato, Alessandro; Brugnoni, Raffaella; Altamura, Concetta; Imbrici, Paola; Camerino, Diana Conte; Padovani, Alessandro; Mantegazza, Renato; Bernasconi, Pia; Desaphy, Jean-François; Filosto, Massimiliano

    2017-12-01

    Non-dystrophic myotonias are characterized by clinical overlap making it challenging to establish genotype-phenotype correlations. We report clinical and electrophysiological findings in a girl and her father concomitantly harbouring single heterozygous mutations in SCN4A and CLCN1 genes. Functional characterization of N1297S hNav1.4 mutant was performed by patch clamp. The patients displayed a mild phenotype, mostly resembling a sodium channel myotonia. The CLCN1 c.501C>G (p.F167L) mutation has been already described in recessive pedigrees, whereas the SCN4A c.3890A>G (p.N1297S) variation is novel. Patch clamp experiments showed impairment of fast and slow inactivation of the mutated Nav1.4 sodium channel. The present findings suggest that analysis of both SCN4A and CLCN1 genes should be considered in myotonic patients with atypical clinical and neurophysiological features.

  4. Random X inactivation in the mule and horse placenta.

    PubMed

    Wang, Xu; Miller, Donald C; Clark, Andrew G; Antczak, Douglas F

    2012-10-01

    In eutherian mammals, dosage compensation of X-linked genes is achieved by X chromosome inactivation. X inactivation is random in embryonic and adult tissues, but imprinted X inactivation (paternal X silencing) has been identified in the extra-embryonic membranes of the mouse, rat, and cow. Few other species have been studied for this trait, and the data from studies of the human placenta have been discordant or inconclusive. Here, we quantify X inactivation using RNA sequencing of placental tissue from reciprocal hybrids of horse and donkey (mule and hinny). In placental tissue from the equid hybrids and the horse parent, the allelic expression pattern was consistent with random X inactivation, and imprinted X inactivation can clearly be excluded. We characterized horse and donkey XIST gene and demonstrated that XIST allelic expression in female hybrid placental and fetal tissues is negatively correlated with the other X-linked genes chromosome-wide, which is consistent with the XIST-mediated mechanism of X inactivation discovered previously in mice. As the most structurally and morphologically diverse organ in mammals, the placenta also appears to show diverse mechanisms for dosage compensation that may result in differences in conceptus development across species.

  5. INACTIVATION OF CRYPTOSPORIDIUM PARVUM OOCYSTS WITH OZONE

    EPA Science Inventory

    Ozone inactivation rates for Cryptosporidium parvum (C. parvum) oocysts were determined with an in-vitro excystation method based on excysted sporozoite counts. Results were consistent with published animal infectivity data for the same C. parvum strain. The inactivation kinetics...

  6. Cationic antimicrobial peptides inactivate Shiga toxin-encoding bacteriophages

    NASA Astrophysics Data System (ADS)

    Del Cogliano, Manuel E.; Hollmann, Axel; Martinez, Melina; Semorile, Liliana; Ghiringhelli, Pablo D.; Maffía, Paulo C.; Bentancor, Leticia V.

    2017-12-01

    Shiga toxin (Stx) is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC) infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs) are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: 1) direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, 2) cationic properties are necessary but not sufficient for bacteriophage inactivation, and 3) inactivation by cationic peptides could be sequence (or structure) specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

  7. Genetic Inactivation of ATRX Leads to a Decrease in the Amount of Telomeric Cohesin and Level of Telomere Transcription in Human Glioma Cells.

    PubMed

    Eid, Rita; Demattei, Marie-Véronique; Episkopou, Harikleia; Augé-Gouillou, Corinne; Decottignies, Anabelle; Grandin, Nathalie; Charbonneau, Michel

    2015-08-01

    Mutations in ATRX (alpha thalassemia/mental retardation syndrome X-linked), a chromatin-remodeling protein, are associated with the telomerase-independent ALT (alternative lengthening of telomeres) pathway of telomere maintenance in several types of cancer, including human gliomas. In telomerase-positive glioma cells, we found by immunofluorescence that ATRX localized not far from the chromosome ends but not exactly at the telomere termini. Chromatin immunoprecipitation (ChIP) experiments confirmed a subtelomeric localization for ATRX, yet short hairpin RNA (shRNA)-mediated genetic inactivation of ATRX failed to trigger the ALT pathway. Cohesin has been recently shown to be part of telomeric chromatin. Here, using ChIP, we showed that genetic inactivation of ATRX provoked diminution in the amount of cohesin in subtelomeric regions of telomerase-positive glioma cells. Inactivation of ATRX also led to diminution in the amount of TERRAs, noncoding RNAs resulting from transcription of telomeric DNA, as well as to a decrease in RNA polymerase II (RNAP II) levels at the telomeres. Our data suggest that ATRX might establish functional interactions with cohesin on telomeric chromatin in order to control TERRA levels and that one or the other or both of these events might be relevant to the triggering of the ALT pathway in cancer cells that exhibit genetic inactivation of ATRX. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Glucocerebrosidase Mutations in Parkinson Disease.

    PubMed

    O'Regan, Grace; deSouza, Ruth-Mary; Balestrino, Roberta; Schapira, Anthony H

    2017-01-01

    Following the discovery of a higher than expected incidence of Parkinson Disease (PD) in Gaucher disease, a lysosomal storage disorder, mutations in the glucocerebrocidase (GBA) gene, which encodes a lysosomal enzyme involved in sphingolipid degradation were explored in the context of idiopathic PD. GBA mutations are now known to be the single largest risk factor for development of idiopathic PD. Clinically, on imaging and pharmacologically, GBA PD is almost identical to idiopathic PD, other than certain features that can be identified in the specialist research setting but not in routine clinical practice. In patients with a known GBA mutation, it is possible to monitor for prodromal signs of PD. The clinical similarity with idiopathic PD and the chance to identify PD at a pre-clinical stage provides a unique opportunity to research therapeutic options for early PD, before major irreversible neurodegeneration occurs. However, to date, the molecular mechanisms which lead to this increased PD risk in GBA mutation carriers are not fully elucidated. Experimental models to define the molecular mechanisms and test therapeutic options include cell culture, transgenic mice and other in vivo models amenable to genetic manipulation, such as drosophilia. Some key pathological pathways of interest in the context of GBA mutations include alpha synuclein aggregation, lysosomal-autophagy axis changes and endoplasmic reticulum stress. Therapeutic agents that exploit these pathways are being developed and include the small molecule chaperone Ambroxol. This review aims to summarise the main features of GBA-PD and provide insights into the pathological relevance of GBA mutations on molecular pathways and the therapeutic implications for PD resulting from investigation of the role of GBA in PD.

  9. Genetic susceptibility to neuroblastoma

    PubMed Central

    Tolbert, Vanessa P.; Coggins, Grace E.; Maris, John M.

    2017-01-01

    Until recently, the genetic basis of neuroblastoma, a heterogeneous neoplasm arising from the developing sympathetic nervous system, remained undefined. The discovery of gain-of-function mutations in the ALK receptor tyrosine kinase gene as the major cause of familial neuroblastoma led to the discovery of identical somatic mutations and rapid advancement of ALK as a tractable therapeutic target. Inactivating mutations in a master regulator of neural crest development, PHOX2B, have also been identified in a subset of familial neuroblastomas. Other high penetrance susceptibility alleles likely exist, but together these heritable mutations account for less than 10% of neuroblastoma cases. A genome-wide association study of a large neuroblastoma cohort identified common and rare polymorphisms highly associated with the disease. Ongoing resequencing efforts aim to further define the genetic landscape of neuroblastoma. PMID:28458126

  10. Gain-of-function mutation of a voltage-gated sodium channel NaV1.7 associated with peripheral pain and impaired limb development.

    PubMed

    Tanaka, Brian S; Nguyen, Phuong T; Zhou, Eray Yihui; Yang, Yong; Yarov-Yarovoy, Vladimir; Dib-Hajj, Sulayman D; Waxman, Stephen G

    2017-06-02

    Dominant mutations in voltage-gated sodium channel Na V 1.7 cause inherited erythromelalgia, a debilitating pain disorder characterized by severe burning pain and redness of the distal extremities. Na V 1.7 is preferentially expressed within peripheral sensory and sympathetic neurons. Here, we describe a novel Na V 1.7 mutation in an 11-year-old male with underdevelopment of the limbs, recurrent attacks of burning pain with erythema, and swelling in his feet and hands. Frequency and duration of the episodes gradually increased with age, and relief by cooling became less effective. The patient's sister had short stature and reported similar complaints of erythema and burning pain, but with less intensity. Genetic analysis revealed a novel missense mutation in Na V 1.7 (2567G>C; p.Gly856Arg) in both siblings. The G856R mutation, located within the DII/S4-S5 linker of the channel, substitutes a highly conserved non-polar glycine by a positively charged arginine. Voltage-clamp analysis of G856R currents revealed that the mutation hyperpolarized (-11.2 mV) voltage dependence of activation and slowed deactivation but did not affect fast inactivation, compared with wild-type channels. A mutation of Gly-856 to aspartic acid was previously found in a family with limb pain and limb underdevelopment, and its functional assessment showed hyperpolarized activation, depolarized fast inactivation, and increased ramp current. Structural modeling using the Rosetta computational modeling suite provided structural clues to the divergent effects of the substitution of Gly-856 by arginine and aspartic acid. Although the proexcitatory changes in gating properties of G856R contribute to the pathophysiology of inherited erythromelalgia, the link to limb underdevelopment is not well understood. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Key clinical features to identify girls with CDKL5 mutations.

    PubMed

    Bahi-Buisson, Nadia; Nectoux, Juliette; Rosas-Vargas, Haydeé; Milh, Mathieu; Boddaert, Nathalie; Girard, Benoit; Cances, Claude; Ville, Dorothée; Afenjar, Alexandra; Rio, Marlène; Héron, Delphine; N'guyen Morel, Marie Ange; Arzimanoglou, Alexis; Philippe, Christophe; Jonveaux, Philippe; Chelly, Jamel; Bienvenu, Thierry

    2008-10-01

    Mutations in the human X-linked cyclin-dependent kinase-like 5 (CDKL5) gene have been shown to cause infantile spasms as well as Rett syndrome (RTT)-like phenotype. To date, less than 25 different mutations have been reported. So far, there are still little data on the key clinical diagnosis criteria and on the natural history of CDKL5-associated encephalopathy. We screened the entire coding region of CDKL5 for mutations in 183 females with encephalopathy with early seizures by denaturing high liquid performance chromatography and direct sequencing, and we identified in 20 unrelated girls, 18 different mutations including 7 novel mutations. These mutations were identified in eight patients with encephalopathy with RTT-like features, five with infantile spasms and seven with encephalopathy with refractory epilepsy. Early epilepsy with normal interictal EEG and severe hypotonia are the key clinical features in identifying patients likely to have CDKL5 mutations. Our study also indicates that these patients clearly exhibit some RTT features such as deceleration of head growth, stereotypies and hand apraxia and that these RTT features become more evident in older and ambulatory patients. However, some RTT signs are clearly absent such as the so called RTT disease profile (period of nearly normal development followed by regression with loss of acquired fine finger skill in early childhood and characteristic intensive eye communication) and the characteristic evolution of the RTT electroencephalogram. Interestingly, in addition to the overall stereotypical symptomatology (age of onset and evolution of the disease) resulting from CDKL5 mutations, atypical forms of CDKL5-related conditions have also been observed. Our data suggest that phenotypic heterogeneity does not correlate with the nature or the position of the mutations or with the pattern of X-chromosome inactivation, but most probably with the functional transcriptional and/or translational consequences of CDKL5

  12. Glu¹⁰⁶ in the Orai1 pore contributes to fast Ca²⁺-dependent inactivation and pH dependence of Ca²⁺ release-activated Ca²⁺ (CRAC) current.

    PubMed

    Scrimgeour, Nathan R; Wilson, David P; Rychkov, Grigori Y

    2012-01-15

    FCDI (fast Ca²⁺-dependent inactivation) is a mechanism that limits Ca²⁺ entry through Ca²⁺ channels, including CRAC (Ca²⁺ release-activated Ca²⁺) channels. This phenomenon occurs when the Ca²⁺ concentration rises beyond a certain level in the vicinity of the intracellular mouth of the channel pore. In CRAC channels, several regions of the pore-forming protein Orai1, and STIM1 (stromal interaction molecule 1), the sarcoplasmic/endoplasmic reticulum Ca²⁺ sensor that communicates the Ca²⁺ load of the intracellular stores to Orai1, have been shown to regulate fast Ca²⁺-dependent inactivation. Although significant advances in unravelling the mechanisms of CRAC channel gating have occurred, the mechanisms regulating fast Ca²⁺-dependent inactivation in this channel are not well understood. We have identified that a pore mutation, E106D Orai1, changes the kinetics and voltage dependence of the ICRAC (CRAC current), and the selectivity of the Ca²⁺-binding site that regulates fast Ca²⁺-dependent inactivation, whereas the V102I and E190Q mutants when expressed at appropriate ratios with STIM1 have fast Ca²⁺-dependent inactivation similar to that of WT (wild-type) Orai1. Unexpectedly, the E106D mutation also changes the pH dependence of ICRAC. Unlike WT ICRAC, E106D-mediated current is not inhibited at low pH, but instead the block of Na⁺ permeation through the E106D Orai1 pore by Ca²⁺ is diminished. These results suggest that Glu¹⁰⁶ inside the CRAC channel pore is involved in co-ordinating the Ca²⁺-binding site that mediates fast Ca²⁺-dependent inactivation.

  13. Mutations of the KISS1 gene in disorders of puberty.

    PubMed

    Silveira, L G; Noel, S D; Silveira-Neto, A P; Abreu, A P; Brito, V N; Santos, M G; Bianco, S D C; Kuohung, W; Xu, S; Gryngarten, M; Escobar, M E; Arnhold, I J P; Mendonca, B B; Kaiser, U B; Latronico, A C

    2010-05-01

    Kisspeptin, encoded by the KISS1 gene, is a key stimulatory factor of GnRH secretion and puberty onset. Inactivating mutations of its receptor (KISS1R) cause isolated hypogonadotropic hypogonadism (IHH). A unique KISS1R-activating mutation was described in central precocious puberty (CPP). Our objective was to investigate KISS1 mutations in patients with idiopathic CPP and normosmic IHH. Eighty-three children with CPP (77 girls) and 61 patients with IHH (40 men) were studied. The control group consisted of 200 individuals with normal pubertal development. The promoter region and the three exons of KISS1 were amplified and sequenced. Cells expressing KISS1R were stimulated with synthetic human wild-type or mutant kisspeptin-54 (kp54), and inositol phosphate accumulation was measured. In a second set of experiments, kp54 was preincubated in human serum before stimulation of the cells. Two novel KISS1 missense mutations, p.P74S and p.H90D, were identified in three unrelated children with idiopathic CPP. Both mutations were absent in 400 control alleles. The p.P74S mutation was identified in the heterozygous state in a boy who developed CPP at 1 yr of age. The p.H90D mutation was identified in the homozygous state in two unrelated girls with CPP. In vitro studies revealed that the capacity of the P74S and H90D mutants to stimulate IP production was similar to the wild type. After preincubation of wild-type and mutant kp54 in human serum, the capacity to stimulate signal transduction was significantly greater for P74S compared with the wild type, suggesting that the p.P74S variant is more stable. Only polymorphisms were found in the IHH group. Two KISS1 mutations were identified in unrelated patients with idiopathic CPP. The p.P74S variant was associated with higher kisspeptin resistance to degradation in comparison with the wild type, suggesting a role for this mutation in the precocious puberty phenotype.

  14. Influence of anoxia on the induction of mutations by phenylalanine radicals during gamma-irradiation of plasmid DNA in aqueous solution.

    PubMed

    Kuipers, Gitta K; Slotman, Ben J; Reitsma-Wijker, Carola A; van Andel, Rob J; Poldervaart, Hester A; Lafleur, M Vincent M

    2004-12-21

    When DNA is irradiated in aqueous solution, most of the damage is inflicted by water-derived radicals. This is called the indirect effect of ionizing radiation. However in whole cells not only the primary formed water radicals play a role, because some cellular compounds form secondary radicals which can also damage DNA. It is known that the amino acid phenylalanine is able to react with water radicals, resulting in the production of secondary phenylalanine radicals which can damage and inactivate DNA. In a previous study the influence of the presence of phenylalanine during gamma-irradiation of DNA in aqueous solution under oxic conditions was studied. Under anoxic irradiation conditions different amounts and types of reactive water-derived radicals are formed compared to oxic conditions and also different phenylalanine radicals are formed. Therefore, this study examines the influence of the presence of phenylalanine under anoxic conditions on the gamma-radiation-induced mutation spectrum. The results indicate that phenylalanine radicals are damaging to DNA, but less effective compared to primary water radicals. On the mutational level, in the presence of phenylalanine radicals under anoxic conditions, the amount of mutations on G:C base pairs was significantly decreased as compared to oxic conditions. Furthermore, the results of this study indicate that nucleotide excision repair is involved in repair of both inactivating and mutagenic damage induced by phenylalanine radicals under anoxic conditions.

  15. Kinome-wide Decoding of Network-Attacking Mutations Rewiring Cancer Signaling

    PubMed Central

    Creixell, Pau; Schoof, Erwin M.; Simpson, Craig D.; Longden, James; Miller, Chad J.; Lou, Hua Jane; Perryman, Lara; Cox, Thomas R.; Zivanovic, Nevena; Palmeri, Antonio; Wesolowska-Andersen, Agata; Helmer-Citterich, Manuela; Ferkinghoff-Borg, Jesper; Itamochi, Hiroaki; Bodenmiller, Bernd; Erler, Janine T.; Turk, Benjamin E.; Linding, Rune

    2015-01-01

    Summary Cancer cells acquire pathological phenotypes through accumulation of mutations that perturb signaling networks. However, global analysis of these events is currently limited. Here, we identify six types of network-attacking mutations (NAMs), including changes in kinase and SH2 modulation, network rewiring, and the genesis and extinction of phosphorylation sites. We developed a computational platform (ReKINect) to identify NAMs and systematically interpreted the exomes and quantitative (phospho-)proteomes of five ovarian cancer cell lines and the global cancer genome repository. We identified and experimentally validated several NAMs, including PKCγ M501I and PKD1 D665N, which encode specificity switches analogous to the appearance of kinases de novo within the kinome. We discover mutant molecular logic gates, a drift toward phospho-threonine signaling, weakening of phosphorylation motifs, and kinase-inactivating hotspots in cancer. Our method pinpoints functional NAMs, scales with the complexity of cancer genomes and cell signaling, and may enhance our capability to therapeutically target tumor-specific networks. PMID:26388441

  16. Demonstration of a novel Xp22.2 microdeletion as the cause of familial extreme skewing of X-inactivation utilizing case-parent trio SNP microarray analysis.

    PubMed

    Mason, Jane A; Aung, Hnin T; Nandini, Adayapalam; Woods, Rickie G; Fairbairn, David J; Rowell, John A; Young, David; Susman, Rachel D; Brown, Simon A; Hyland, Valentine J; Robertson, Jeremy D

    2018-05-01

    We report a kindred referred for molecular investigation of severe hemophilia A in a young female in which extremely skewed X-inactivation was observed in both the proband and her clinically normal mother. Bidirectional Sanger sequencing of all F8 gene coding regions and exon/intron boundaries was undertaken. Methylation-sensitive restriction enzymes were utilized to investigate skewed X-inactivation using both a classical human androgen receptor (HUMARA) assay, and a novel method targeting differential methylation patterns in multiple informative X-chromosome SNPs. Illumina Whole-Genome Infinium microarray analysis was performed in the case-parent trio (proband and both parents), and the proband's maternal grandmother. The proband was a cytogenetically normal female with severe hemophilia A resulting from a heterozygous F8 pathogenic variant inherited from her similarly affected father. No F8 mutation was identified in the proband's mother, however, both the proband and her mother both demonstrated completely skewed X-chromosome inactivation (100%) in association with a previously unreported 2.3 Mb deletion at Xp22.2. At least three disease-associated genes (FANCB, AP1S2, and PIGA) were contained within the deleted region. We hypothesize that true "extreme" skewing of X-inactivation (≥95%) is a rare occurrence, but when defined correctly there is a high probability of finding an X-chromosome disease-causing variant or larger deletion resulting in X-inactivation through a survival disadvantage or cell lethal mechanism. We postulate that the 2.3 Mb Xp22.2 deletion identified in our kindred arose de novo in the proband's mother (on the grandfather's homolog), and produced extreme skewing of X-inactivation via a "cell lethal" mechanism. We introduce a novel multitarget approach for X-inactivation analysis using multiple informative differentially methylated SNPs, as an alternative to the classical single locus (HUMARA) method. We propose that for females with

  17. Interplay between DMD Point Mutations and Splicing Signals in Dystrophinopathy Phenotypes

    PubMed Central

    Juan-Mateu, Jonàs; González-Quereda, Lidia; Rodríguez, Maria José; Verdura, Edgard; Lázaro, Kira; Jou, Cristina; Nascimento, Andrés; Jiménez-Mallebrera, Cecilia; Colomer, Jaume; Monges, Soledad; Lubieniecki, Fabiana; Foncuberta, Maria Eugenia; Pascual-Pascual, Samuel Ignacio; Molano, Jesús; Baiget, Montserrat; Gallano, Pia

    2013-01-01

    DMD nonsense and frameshift mutations lead to severe Duchenne muscular dystrophy while in-frame mutations lead to milder Becker muscular dystrophy. Exceptions are found in 10% of cases and the production of alternatively spliced transcripts is considered a key modifier of disease severity. Several exonic mutations have been shown to induce exon-skipping, while splice site mutations result in exon-skipping or activation of cryptic splice sites. However, factors determining the splicing pathway are still unclear. Point mutations provide valuable information regarding the regulation of pre-mRNA splicing and elements defining exon identity in the DMD gene. Here we provide a comprehensive analysis of 98 point mutations related to clinical phenotype and their effect on muscle mRNA and dystrophin expression. Aberrant splicing was found in 27 mutations due to alteration of splice sites or splicing regulatory elements. Bioinformatics analysis was performed to test the ability of the available algorithms to predict consequences on mRNA and to investigate the major factors that determine the splicing pathway in mutations affecting splicing signals. Our findings suggest that the splicing pathway is highly dependent on the interplay between splice site strength and density of regulatory elements. PMID:23536893

  18. Qualitation and Quantitation on Microplasma Jet for Bacteria Inactivation.

    PubMed

    Du, ChangMing; Liu, Ya; Huang, YaNi; Li, ZiMing; Men, Rui; Men, Yue; Tang, Jun

    2016-01-06

    In this work, a self-made microplasma jet system was used to conduct the qualitation and quantitation of inactivation with Escherichia coli as the target bacteria. The logarithmic concentration and the size of antimicrobial rings served as the evaluation parameters, respectively. The effect of various parameters on inactivation effect was studied. The results showed that the majority of bacteria had been inactivated in 30 s. The inactivation effect enhanced and then weakened with the increase of air flow rate, and receded as the extension of treatment distance. The effect with different carrier gases showed as follows: oxygen > air > nitrogen > argon. Meanwhile, the effect of different components of microplasma was studied in the optimum conditions (The flow rate was 5 L/min; inactivation distance was 2 cm). The results showed that electrically neutral active species was the main factor of inactivation rather than heating effect, ultraviolet radiation and charged particles. Finally the experiments of thallus change proved that microplasma jet had etching effect on cell membrane. It also found that microplasma could degrade organic material like protein. Furthermore, the images of scanning electron microscope (SEM) revealed the change of cell morphology step by step in the whole process of inactivation.

  19. Qualitation and Quantitation on Microplasma Jet for Bacteria Inactivation

    NASA Astrophysics Data System (ADS)

    Du, Changming; Liu, Ya; Huang, Yani; Li, Ziming; Men, Rui; Men, Yue; Tang, Jun

    2016-01-01

    In this work, a self-made microplasma jet system was used to conduct the qualitation and quantitation of inactivation with Escherichia coli as the target bacteria. The logarithmic concentration and the size of antimicrobial rings served as the evaluation parameters, respectively. The effect of various parameters on inactivation effect was studied. The results showed that the majority of bacteria had been inactivated in 30 s. The inactivation effect enhanced and then weakened with the increase of air flow rate, and receded as the extension of treatment distance. The effect with different carrier gases showed as follows: oxygen > air > nitrogen > argon. Meanwhile, the effect of different components of microplasma was studied in the optimum conditions (The flow rate was 5 L/min inactivation distance was 2 cm). The results showed that electrically neutral active species was the main factor of inactivation rather than heating effect, ultraviolet radiation and charged particles. Finally the experiments of thallus change proved that microplasma jet had etching effect on cell membrane. It also found that microplasma could degrade organic material like protein. Furthermore, the images of scanning electron microscope (SEM) revealed the change of cell morphology step by step in the whole process of inactivation.

  20. Qualitation and Quantitation on Microplasma Jet for Bacteria Inactivation

    PubMed Central

    Du, ChangMing; Liu, Ya; Huang, YaNi; Li, ZiMing; Men, Rui; Men, Yue; Tang, Jun

    2016-01-01

    In this work, a self-made microplasma jet system was used to conduct the qualitation and quantitation of inactivation with Escherichia coli as the target bacteria. The logarithmic concentration and the size of antimicrobial rings served as the evaluation parameters, respectively. The effect of various parameters on inactivation effect was studied. The results showed that the majority of bacteria had been inactivated in 30 s. The inactivation effect enhanced and then weakened with the increase of air flow rate, and receded as the extension of treatment distance. The effect with different carrier gases showed as follows: oxygen > air > nitrogen > argon. Meanwhile, the effect of different components of microplasma was studied in the optimum conditions (The flow rate was 5 L/min; inactivation distance was 2 cm). The results showed that electrically neutral active species was the main factor of inactivation rather than heating effect, ultraviolet radiation and charged particles. Finally the experiments of thallus change proved that microplasma jet had etching effect on cell membrane. It also found that microplasma could degrade organic material like protein. Furthermore, the images of scanning electron microscope (SEM) revealed the change of cell morphology step by step in the whole process of inactivation. PMID:26732987

  1. Kinetics of Hydrothermal Inactivation of Endotoxins ▿

    PubMed Central

    Li, Lixiong; Wilbur, Chris L.; Mintz, Kathryn L.

    2011-01-01

    A kinetic model was established for the inactivation of endotoxins in water at temperatures ranging from 210°C to 270°C and a pressure of 6.2 × 106 Pa. Data were generated using a bench scale continuous-flow reactor system to process feed water spiked with endotoxin standard (Escherichia coli O113:H10). Product water samples were collected and quantified by the Limulus amebocyte lysate assay. At 250°C, 5-log endotoxin inactivation was achieved in about 1 s of exposure, followed by a lower inactivation rate. This non-log-linear pattern is similar to reported trends in microbial survival curves. Predictions and parameters of several non-log-linear models are presented. In the fast-reaction zone (3- to 5-log reduction), the Arrhenius rate constant fits well at temperatures ranging from 120°C to 250°C on the basis of data from this work and the literature. Both biphasic and modified Weibull models are comparable to account for both the high and low rates of inactivation in terms of prediction accuracy and the number of parameters used. A unified representation of thermal resistance curves for a 3-log reduction and a 3 D value associated with endotoxin inactivation and microbial survival, respectively, is presented. PMID:21193667

  2. Herpes Simplex Virus Type 2 Glycoprotein G-Negative Clinical Isolates Are Generated by Single Frameshift Mutations

    PubMed Central

    Liljeqvist, Jan-Åke; Svennerholm, Bo; Bergström, Tomas

    1999-01-01

    Herpes simplex virus (HSV) codes for several envelope glycoproteins, including glycoprotein G-2 (gG-2) of HSV type 2 (HSV-2), which are dispensable for replication in cell culture. However, clinical isolates which are deficient in such proteins occur rarely. We describe here five clinical HSV-2 isolates which were found to be unreactive to a panel of anti-gG-2 monoclonal antibodies and therefore considered phenotypically gG-2 negative. These isolates were further examined for expression of the secreted amino-terminal and cell-associated carboxy-terminal portions of gG-2 by immunoblotting and radioimmunoprecipitation. The gG-2 gene was completely inactivated in four isolates, with no expression of the two protein products. For one isolate a normally produced secreted portion and a truncated carboxy-terminal portion of gG-2 were detected in virus-infected cell medium. Sequencing of the complete gG-2 gene identified a single insertion or deletion of guanine or cytosine nucleotides in all five strains, resulting in a premature termination codon. The frameshift mutations were localized within runs of five or more guanine or cytosine nucleotides and were dispersed throughout the gene. For the isolate for which a partially inactivated gG-2 gene was detected, the frameshift mutation was localized upstream of but adjacent to the nucleotides coding for the transmembranous region. Thus, this study demonstrates the existence of clinical HSV-2 isolates which do not express an envelope glycoprotein and identifies the underlying molecular mechanism to be a single frameshift mutation. PMID:10559290

  3. 21 CFR 610.11a - Inactivated influenza vaccine, general safety test.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 7 2013-04-01 2013-04-01 false Inactivated influenza vaccine, general safety test... Inactivated influenza vaccine, general safety test. For inactivated influenza vaccine, the general safety test... subcutaneous or intraperitoneal injection of 5.0 milliliters of inactivated influenza vaccine into each guinea...

  4. 21 CFR 610.11a - Inactivated influenza vaccine, general safety test.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 7 2011-04-01 2010-04-01 true Inactivated influenza vaccine, general safety test... Inactivated influenza vaccine, general safety test. For inactivated influenza vaccine, the general safety test... subcutaneous or intraperitoneal injection of 5.0 milliliters of inactivated influenza vaccine into each guinea...

  5. 21 CFR 610.11a - Inactivated influenza vaccine, general safety test.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 7 2012-04-01 2012-04-01 false Inactivated influenza vaccine, general safety test... Inactivated influenza vaccine, general safety test. For inactivated influenza vaccine, the general safety test... subcutaneous or intraperitoneal injection of 5.0 milliliters of inactivated influenza vaccine into each guinea...

  6. 21 CFR 610.11a - Inactivated influenza vaccine, general safety test.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 7 2014-04-01 2014-04-01 false Inactivated influenza vaccine, general safety test... Inactivated influenza vaccine, general safety test. For inactivated influenza vaccine, the general safety test... subcutaneous or intraperitoneal injection of 5.0 milliliters of inactivated influenza vaccine into each guinea...

  7. Search for Novel Candidate Mutations for Metronidazole Resistance in Helicobacter pylori Using Next-Generation Sequencing

    PubMed Central

    Binh, Tran Thanh; Suzuki, Rumiko; Trang, Tran Thi Huyen; Kwon, Dong Hyeon

    2015-01-01

    Metronidazole resistance is a key factor associated with Helicobacter pylori treatment failure. Although this resistance is mainly associated with mutations in the rdxA and frxA genes, the question of whether metronidazole resistance is caused by the inactivation of frxA alone is still debated. Furthermore, it is unclear whether there are other mutations involved in addition to the two genes that are associated with resistance. A metronidazole-resistant strain was cultured from the metronidazole-susceptible H. pylori strain 26695-1 by exposure to low concentrations of metronidazole. The genome sequences of both susceptible and resistant H. pylori strains were determined by Illumina next-generation sequencing, from which putative candidate resistance mutations were identified. Natural transformation was used to introduce PCR products containing candidate mutations into the susceptible parent strain 26695-1, and the metronidazole MIC was determined for each strain. Mutations in frxA (hp0642), rdxA (hp0954), and rpsU (hp0562) were confirmed by the Sanger method. The mutated sequence in rdxA was successfully transformed into strain 26695-1, and the transformants showed resistance to metronidazole. The transformants containing a single mutation in rdxA showed a low MIC (16 mg/liter), while those containing mutations in both rdxA and frxA showed a higher MIC (48 mg/liter). No transformants containing a single mutation in frxA or rpsU were obtained. Next-generation sequencing was used to identify mutations related to drug resistance. We confirmed that the mutations in rdxA are mainly associated with metronidazole resistance, and mutations in frxA are able to enhance H. pylori resistance only in the presence of rdxA mutations. Moreover, mutations in rpsU may play a role in metronidazole resistance. PMID:25645832

  8. Plac8 links oncogenic mutations to regulation of autophagy and is critical to pancreatic cancer progression

    PubMed Central

    Kinsey, Conan; Balakrishnan, Vijaya; O’Dell, Michael R.; Huang, Jing Li; Newman, Laurel; Whitney-Miller, Christa L.; Hezel, Aram F.; Land, Hartmut

    2014-01-01

    Summary Mutations in p53 and RAS potently cooperate in oncogenic transformation and correspondingly these genetic alterations frequently coexist in pancreatic ductal adenocarcinoma (PDA) and other human cancers. Previously we identified a set of genes synergistically activated by combined RAS and p53 mutations as frequent downstream mediators of tumorigenesis. Here, we show that the synergistically activated gene Plac8 is critical for pancreatic cancer growth. Silencing of Plac8 in cell lines suppresses tumor formation by blocking autophagy, a process essential for maintaining metabolic homeostasis in PDA, and genetic inactivation in an engineered mouse model inhibits PDA progression. We show that Plac8 is a critical regulator of the autophagic machinery, localizing to the lysosomal compartment and facilitating lysosome-autophagosome fusion. Plac8 thus provides a mechanistic link between primary oncogenic mutations and the induction of autophagy, a central mechanism of metabolic reprogramming, during PDA progression. PMID:24794439

  9. Inactivation of Escherichia coli by citral.

    PubMed

    Somolinos, M; García, D; Condón, S; Mackey, B; Pagán, R

    2010-06-01

    The aim was to evaluate (i) the resistance of Escherichia coli BJ4 to citral in a buffer system as a function of citral concentration, treatment medium pH, storage time and initial inoculum size, (ii) the role of the sigma factor RpoS on citral resistance of E. coli, (iii) the role of the cell envelope damage in the mechanism of microbial inactivation by citral and (iiii) possible synergistic effects of mild heat treatment and pulsed electric fields (PEF) treatment combined with citral. The initial inoculum size greatly affected the efficacy of citral against E. coli cells. Exposure to 200 microl l(-1) of citral at pH 4.0 for 24 h at 20 degrees C caused the inactivation of more than 5 log(10) cycles of cells starting at an inoculum size of 10(6) or 10(7) CFU ml(-1), whereas increasing the cell concentration to 10(9) CFU ml(-1) caused <1 log(10) cycle of inactivation. Escherichia coli showed higher resistance to citral at pH 4.0 than pH 7.0. The rpoS null mutant strain E. coli BJ4L1 was less resistant to citral than the wild-type strain. Occurrence of sublethal injury to both the cytoplasmic and outer membranes was demonstrated by adding sodium chloride or bile salts to the recovery media. The majority of sublethally injured cells by citral required energy and lipid synthesis for repair. A strongly synergistic lethal effect was shown by mild heat treatment combined with citral but the presence of citral during the application of a PEF treatment did not show any advantage. This work confirms that cell envelope damage is an important event in citral inactivation of bacteria, and it describes the key factors on the inactivation of E. coli cells by citral. Knowledge about the mechanism of microbial inactivation by citral helps establish successful combined preservation treatments.

  10. Mutational definition of functional domains within the Rev homolog encoded by human endogenous retrovirus K.

    PubMed

    Bogerd, H P; Wiegand, H L; Yang, J; Cullen, B R

    2000-10-01

    Nuclear export of the incompletely spliced mRNAs encoded by several complex retroviruses, including human immunodeficiency virus type 1 (HIV-1), is dependent on a virally encoded adapter protein, termed Rev in HIV-1, that directly binds both to a cis-acting viral RNA target site and to the cellular Crm1 export factor. Human endogenous retrovirus K, a family of ancient endogenous retroviruses that is not related to the exogenous retrovirus HIV-1, was recently shown to also encode a Crm1-dependent nuclear RNA export factor, termed K-Rev. Although HIV-1 Rev and K-Rev display little sequence identity, they share the ability not only to bind to Crm1 and to RNA but also to form homomultimers and shuttle between nucleus and cytoplasm. We have used mutational analysis to identify sequences in the 105-amino-acid K-Rev protein required for each of these distinct biological activities. While mutations in K-Rev that inactivate any one of these properties also blocked K-Rev-dependent nuclear RNA export, several K-Rev mutants were comparable to wild type when assayed for any of these individual activities yet nevertheless defective for RNA export. Although several nonfunctional K-Rev mutants acted as dominant negative inhibitors of K-Rev-, but not HIV-1 Rev-, dependent RNA export, these were not defined by their inability to bind to Crm1, as is seen with HIV-1 Rev. In total, this analysis suggests a functional architecture for K-Rev that is similar to, but distinct from, that described for HIV-1 Rev and raises the possibility that viral RNA export mediated by the approximately 25 million-year-old K-Rev protein may require an additional cellular cofactor that is not required for HIV-1 Rev function.

  11. [Decrease of spontaneous mutations in Haemophilus influenzae caused by transformation with its own DNA irradiated with near-ultraviolet light].

    PubMed

    Alarcón-Hernández, E; Cabrera-Juárez, E

    1992-01-01

    Transforming DNA containing the streptomycin resistance marker, was irradiated for 8 h with broad near ultraviolet light (325-400 nm) at pH 4.8, and the inactivation kinetics determined. After selection of streptomycin resistant transformants, they were grown until a turbidity of 150-200 Klett units. In these cultures we looked for new markers coming from the irradiated transforming DNA. We looked and found the novobiocin resistance marker and one that conveys to protoporphyrin IX utilization, measured as an increase in the mutation frequency of these markers in the streptomycin resistant population. In other experiments, we found a decline in spontaneous mutation frequency for the same markers in the cells transformed with irradiated DNA. This last finding rises the possibility of alterations on the mutator genes as a result of near ultraviolet irradiation.

  12. Inactivation of Lassa, Marburg, and Ebola viruses by gamma irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, L.H.; McCormick, J.B.; Johnson, K.M.

    1982-10-01

    Because of the cumbersome conditions experienced in a maximum containment laboratory, methods for inactivating highly pathogenic viruses were investigated. The infectivity of Lassa, Marburg, and Ebola viruses was inactivated without altering the immunological activity after radiation with /sup 60/Co gamma rays. At 4 degrees C, Lassa virus was the most difficult to inactivate with a rate of 5.3 X 10(-6) log 50% tissue culture infective dose per rad of /sup 60/Co radiation, as compared with 6.8 X 10(-6) log 50% tissue culture infective dose per rad for Ebola virus and 8.4 X 10(-6) log 50% tissue culture infective dose permore » rad for Marburg virus. Experimental inactivation curves, as well as curves giving the total radiation needed to inactivate a given concentration of any of the three viruses, are presented. We found this method of inactivation to be superior to UV light or beta-propiolactone inactivation and now routinely use it for preparation of material for protein-chemistry studies or for preparation of immunological reagents.« less

  13. Inactivation of Lassa, Marburg, and Ebola viruses by gamma irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, L.H.; McCormick, J.B.; Johnson, K.M.

    1982-10-01

    Because of the cumbersome conditions experienced in a maximum containment laboratory, methods for inactivating highly pathogenic viruses were investigated. The infectivity of Lassa, Marburg, and Ebola viruses was inactivated without altering the immunological activity after radiation with /sup 60/CO gamma rays. At 4 degrees C, Lassa virus was the most difficult to inactivate with a rate of 5.3 X 10(-6) log 50% tissue culture infective dose per rad of /sup 60/CO radiation, as compared with 6.8 X 10(-6) log 50% tissue culture infective dose per rad for Ebola virus and 8.4 X 10(-6) log 50% tissue culture infective dose permore » rad for Marburg virus. Experimental inactivation curves, as well as curves giving the total radiation needed to inactivate a given concentration of any of the three viruses, are presented. The authors found this method of inactivation to be superior to UV light or beta-propiolactone inactivation and now routinely use it for preparation of material for protein-chemistry studies or for preparation of immunological reagents.« less

  14. Structure of suicide-inactivated. beta. -hydroxydecanoyl-thioester dehydrase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schwab, J.M.; Ho, C.K.; Li, W.B.

    ..beta..-Hydroxydecanoylthioester dehydrase, the key enzyme in biosynthesis of unsaturated fatty acids under anaerobic conditions, equilibrates thioesters of (R)-3-hydroxydecanoic acid, E-2-decenoic acid, and Z-3-decenoic acid. Dehydrase is irreversibly inactivated by the N-acetylcysteamine thioester of 3-decynoic acid (3-decynoyl-NAC), via dehydrase-catalyzed isomerization to 2,3-decadienoyl-NAC. To probe the relationship between normal catalysis and suicide inactivation, the structure of the inactivated enzyme has been studied. 3-(2-/sup 13/C)Decynoyl-NAC was synthesized and incubated with dehydrase. /sup 13/C NMR showed that attack of 2,3-decadienoyl-NAC by the active site histidine gives 3-histidinyl-3-decenoyl-NAC, which slowly rearranges to the more stable ..delta../sup 2/ isomer. Model histidine-allene adducts have been made andmore » characterized. Analysis of NMR data show that the C=C configuration of the decenoyl moiety of enzyme-bound inactivator is E. The suggestion that the mechanism of dehydrase inactivation parallels its normal mechanism of action is supported these findings.« less

  15. Inactivation of Cg10062, a cis-3-chloroacrylic acid dehalogenase homologue in Corynebacterium glutamicum, by (R)- and (S)-oxirane-2-carboxylate: analysis and implications.

    PubMed

    Robertson, Brooklyn A; Johnson, William H; Lo, Herng-Hsiang; Whitman, Christian P

    2008-08-19

    ( R)- and ( S)-oxirane-2-carboxylate were determined to be active site-directed irreversible inhibitors of the cis-3-chloroacrylic acid dehalogenase ( cis-CaaD) homologue Cg10062 found in Corynebacterium glutamicum. Kinetic analysis indicates that the ( R) enantiomer binds more tightly and is the more potent inhibitor, likely reflecting more favorable interactions with active site residues. Pro-1 is the sole site of covalent modification by the ( R) and ( S) enantiomers. Pro-1, Arg-70, Arg-73, and Glu-114, previously identified as catalytic residues in Cg10062, have also been implicated in the inactivation mechanism. Pro-1, Arg-70, and Arg-73 are essential residues for the process as indicated by the observation that the enzymes with the corresponding alanine mutations are not covalently modified by either enantiomer. The E114Q mutant slows covalent modification of Cg10062 but does not prevent it. The results are comparable to those found for the irreversible inactivation of cis-CaaD by ( R)-oxirane-2-carboxylate with two important distinctions: the alkylation of cis-CaaD is stereospecific, and Glu-114 does not take part in the cis-CaaD inactivation mechanism. Cg10062 exhibits low-level cis-CaaD and trans-3-chloroacrylic acid dehalogenase (CaaD) activities, with the cis-CaaD activity predominating. Hence, the preference of Cg10062 for the cis isomer correlates with the observation that the ( R) enantiomer is the more potent inactivator. Moreover, the factors responsible for the relaxed substrate specificity of Cg10062 may account for the stereoselective inactivation by the enantiomeric epoxides. Delineation of these factors would provide a more complete picture of the substrate specificity determinants for cis-CaaD. This study represents an important step toward this goal by setting the stage for a crystallographic analysis of inactivated Cg10062.

  16. Photodynamic inactivation of foodborne bacteria by eosin Y.

    PubMed

    Bonin, E; Dos Santos, A R; Fiori da Silva, A; Ribeiro, L H; Favero, M E; Campanerut-Sá, P A Z; de Freitas, C F; Caetano, W; Hioka, N; Mikcha, J M G

    2018-06-01

    The aim of this study was evaluate the effect of photodynamic inactivation mediated by eosin Y in Salmonella enterica serotype Typhimurium ATCC 14028, Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 25923 and Bacillus cereus ATCC 11778. Bacteria (10 7 CFU per ml) were incubated with eosin Y at concentrations ranging from 0·1 to 10 μmol l -1 , irradiated by green LED (λ max 490-570 nm) for 5, 10 and 15 min and the cellular viability was determined. Pseudomonas aeruginosa was completely inactivated when treated with 10 μmol l -1 eosin Y for 10 min. Treatments reduced B. cereus and Salm. Typhimurium counts to 2·7 log CFU per ml and 1·7 log CFU per ml, respectively. Escherichia coli counts were slightly reduced. Staphylococcus aureus presented the highest sensitivity, being completely inactivated by eosin Y at 5 μmol l -1 and 5 min of illumination. The reduction of cellular viability of photoinactivated Staph. aureus was also demonstrated by flow cytometry and morphological changes were observed by scanning electron microscopy. Eosin Y in combination with LED produced bacterial inactivation, being a potential candidate for photodynamic inactivation. This study evidenced the efficacy of photodynamic inactivation as a novel and promising alternative to bacterial control. © 2018 The Society for Applied Microbiology.

  17. HPRT mutations in V79 Chinese hamster cells induced by accelerated Ni, Au and Pb ions.

    PubMed

    Stoll, U; Barth, B; Scheerer, N; Schneider, E; Kiefer, J

    1996-07-01

    Mutation induction by accelerated heavy ions to 6-TG resistance (HPRT system) in V79 Chinese hamster cells was investigated with Ni (6-630 Me V/u), Au (2.2, 8.7 Me V/u) and Pb ions (11.6-980 Me V/u) corresponding to a LET range between 180 and 12895 ke V/microns. Most experiments could only be performed once due to technical limitations using accelerator beam times. Survival curves were exponential, mutation induction curves linear with fluence. From their slopes inactivation- and mutation-induction cross-sections were derived. If they are plotted versus LET, single, ion-specific curves are obtained. It is shown that other parameters like ion energy and effective charge play an important role. In the case of Au and Pb ions the cross-sections follow a common line, since these ions have nearly the same atomic weight, so that they should have similar spatial ionization patterns in matter at the same energies. Calculated RBEs were higher for mutation induction than for killing for all LETs.

  18. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.

    PubMed

    Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A

    1990-11-30

    Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.

  19. Pak1 Kinase Maintains Apical Membrane Identity in Epithelia.

    PubMed

    Aguilar-Aragon, Mario; Elbediwy, Ahmed; Foglizzo, Valentina; Fletcher, Georgina C; Li, Vivian S W; Thompson, Barry J

    2018-02-13

    Epithelial cells are polarized along their apical-basal axis by the action of the small GTPase Cdc42, which is known to activate the aPKC kinase at the apical domain. However, loss of aPKC kinase activity was reported to have only mild effects on epithelial cell polarity. Here, we show that Cdc42 also activates a second kinase, Pak1, to specify apical domain identity in Drosophila and mammalian epithelia. aPKC and Pak1 phosphorylate an overlapping set of polarity substrates in kinase assays. Inactivating both aPKC kinase activity and the Pak1 kinase leads to a complete loss of epithelial polarity and morphology, with cells losing markers of apical polarization such as Crumbs, Par3/Bazooka, or ZO-1. This function of Pak1 downstream of Cdc42 is distinct from its role in regulating integrins or E-cadherin. Our results define a conserved dual-kinase mechanism for the control of apical membrane identity in epithelia. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. An inactivated vaccine made from a U.S. field isolate of porcine epidemic disease virus is immunogenic in pigs as demonstrated by a dose-titration.

    PubMed

    Collin, Emily A; Anbalagan, Srivishnupriya; Okda, Faten; Batman, Ron; Nelson, Eric; Hause, Ben M

    2015-03-15

    Porcine epidemic diarrhea virus (PEDV), a highly pathogenic and transmissible virus in swine, was first detected in the U.S. in May, 2013, and has caused tremendous losses to the swine industry. Due to the difficulty in isolating and growing this virus in cell culture, few vaccine studies using cell culture propagated PEDV have been performed on U.S. strains in pigs. Therefore, the objective of this study was to evaluate the humoral immune response to the selected inactivated PEDV vaccine candidate in a dose-titration manner. PEDV was isolated from a pig with diarrhea and complete genome sequencing found >99% nucleotide identity to other U.S. PEDV. Inactivated adjuvanted monovalent vaccines were administered intramuscularly to five week old pigs in a dose titration experimental design, ranging from 6.0-8.0 log10 tissue culture infective dose (TCID50/mL), to evaluate immunogenicity using a fluorescent foci neutralization assay (FFN), fluorescent microsphere immunoassay (FMIA), and enzyme-linked immunosorbent assay (ELISA) on sera. Pigs vaccinated with 8.0 log10 TCID50/mL inactivated virus showed significantly higher FFN titers as well as FMIA and ELISA values than 6.0 log10 TCID50/mL vaccinates and the negative controls. These results demonstrate the immunogenicity of a PEDV inactivated viral vaccine with a U.S. strain via dose-titration. A future vaccination-challenge study would illustrate the efficacy of an inactivated vaccine and help evaluate protective FFN titers and ELISA and FMIA responses.

  1. Adaptation of yellow fever virus 17D to Vero cells is associated with mutations in structural and non-structural protein genes.

    PubMed

    Beasley, David W C; Morin, Merribeth; Lamb, Ashley R; Hayman, Edward; Watts, Douglas M; Lee, Cynthia K; Trent, Dennis W; Monath, Thomas P

    2013-09-01

    Serial passaging of yellow fever virus 17D in Vero cells was employed to derive seed material for a novel inactivated vaccine, XRX-001. Two independent passaging series identified a novel lysine to arginine mutation at amino acid 160 of the envelope protein, a surface-exposed residue in structural domain I. A third passage series resulted in an isoleucine to methionine mutation at residue 113 of the NS4B protein, a central membrane spanning region of the protein which has previously been associated with Vero cell adaptation of other mosquito-borne flaviviruses. These studies confirm that flavivirus adaptation to growth in Vero cells can be mediated by structural or non-structural protein mutations. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Inhibition of oxidative metabolism leads to p53 genetic inactivation and transformation in neural stem cells

    PubMed Central

    Bartesaghi, Stefano; Graziano, Vincenzo; Galavotti, Sara; Henriquez, Nick V.; Betts, Joanne; Saxena, Jayeta; Minieri, Valentina; A, Deli; Karlsson, Anna; Martins, L. Miguel; Capasso, Melania; Nicotera, Pierluigi; Brandner, Sebastian; De Laurenzi, Vincenzo; Salomoni, Paolo

    2015-01-01

    Alterations of mitochondrial metabolism and genomic instability have been implicated in tumorigenesis in multiple tissues. High-grade glioma (HGG), one of the most lethal human neoplasms, displays genetic modifications of Krebs cycle components as well as electron transport chain (ETC) alterations. Furthermore, the p53 tumor suppressor, which has emerged as a key regulator of mitochondrial respiration at the expense of glycolysis, is genetically inactivated in a large proportion of HGG cases. Therefore, it is becoming evident that genetic modifications can affect cell metabolism in HGG; however, it is currently unclear whether mitochondrial metabolism alterations could vice versa promote genomic instability as a mechanism for neoplastic transformation. Here, we show that, in neural progenitor/stem cells (NPCs), which can act as HGG cell of origin, inhibition of mitochondrial metabolism leads to p53 genetic inactivation. Impairment of respiration via inhibition of complex I or decreased mitochondrial DNA copy number leads to p53 genetic loss and a glycolytic switch. p53 genetic inactivation in ETC-impaired neural stem cells is caused by increased reactive oxygen species and associated oxidative DNA damage. ETC-impaired cells display a marked growth advantage in the presence or absence of oncogenic RAS, and form undifferentiated tumors when transplanted into the mouse brain. Finally, p53 mutations correlated with alterations in ETC subunit composition and activity in primary glioma-initiating neural stem cells. Together, these findings provide previously unidentified insights into the relationship between mitochondria, genomic stability, and tumor suppressive control, with implications for our understanding of brain cancer pathogenesis. PMID:25583481

  3. Inactivation of Viruses by Benzalkonium Chloride

    PubMed Central

    Armstrong, J. A.; Froelich, E. J.

    1964-01-01

    Benzalkonium chloride (as Roccal or Zephiran) was found to inactivate influenza, measles, canine distemper, rabies, fowl laryngotracheitis, vaccinia, Semliki Forest, feline pneumonitis, meningopneumonitis, and herpes simplex viruses after 10 min of exposure at 30 C or at room temperature. Poliovirus and encephalomyocarditis virus were not inactivated under the same conditions. It was concluded that all viruses tested were sensitive except members of the picorna group. The literature was reviewed. PMID:4288740

  4. A novel truncating AIP mutation, p.W279*, in a familial isolated pituitary adenoma (FIPA) kindred.

    PubMed

    Cansu, Güven Barış; Taşkıran, Bengür; Trivellin, Giampaolo; Faucz, Fabio R; Stratakis, Constantine A

    2016-07-01

    Familial isolated pituitary adenomas (FIPA) constitute 2-3% of pituitary tumours. AIP is the most commonly mutated gene in FIPA. We herein report a novel germline mutation of the AIP gene in a family with FIPA. We present two patients, a father and his 12-year-old daughter, diagnosed clinically and using laboratory measures with acromegaly-gigantism. Both underwent transsphenoidal hypophyseal surgery for macroadenomas. We initially detected a novel heterozygous germline AIP mutation, c.836G>A (p.W279*), in the father's DNA. We then found the same mutation in his affected daughter. Pituitary adenomas associated with AIP mutations mostly present as FIPA (68%) at an early age (78% occur at <30 years old). They are often growth hormone (GH) - or prolactin - secreting macroadenomas (88%) that have already extended beyond the sella at the time of diagnosis. Acromegalic cases are resistant to somatostatin analogues and multimodal management is frequently essential to control the disease. Our patients had normalized GH/IGF-1 values soon after surgery, although enough time may not have elapsed to reach final cure. While penetrance of the disease can be as low as 10% in FIPA, especially children and young patients with somatotropinoma and prolactinoma should be surveyed for inactivating mutations or deletions in AIP. Determining the causative mutations may be of assistance in early diagnosis, treatment success, and genetic counseling.

  5. Viral capsid mobility: a dynamic conduit for inactivation.

    PubMed

    Broo, K; Wei, J; Marshall, D; Brown, F; Smith, T J; Johnson, J E; Schneemann, A; Siuzdak, G

    2001-02-27

    Mass spectrometry and fluorescent probes have provided direct evidence that alkylating agents permeate the protein capsid of naked viruses and chemically inactivate the nucleic acid. N-acetyl-aziridine and a fluorescent alkylating agent, dansyl sulfonate aziridine, inactivated three different viruses, flock house virus, human rhinovirus-14, and foot and mouth disease virus. Mass spectral studies as well as fluorescent probes showed that alkylation of the genome was the mechanism of inactivation. Because particle integrity was not affected by selective alkylation (as shown by electron microscopy and sucrose gradient experiments), it was reasoned that the dynamic nature of the viral capsid acts as a conduit to the interior of the particle. Potential applications include fluorescent labeling for imaging viral genomes in living cells, the sterilization of blood products, vaccine development, and viral inactivation in vivo.

  6. Heme impairs the ball-and-chain inactivation of potassium channels.

    PubMed

    Sahoo, Nirakar; Goradia, Nishit; Ohlenschläger, Oliver; Schönherr, Roland; Friedrich, Manfred; Plass, Winfried; Kappl, Reinhard; Hoshi, Toshinori; Heinemann, Stefan H

    2013-10-15

    Fine-tuned regulation of K(+) channel inactivation enables excitable cells to adjust action potential firing. Fast inactivation present in some K(+) channels is mediated by the distal N-terminal structure (ball) occluding the ion permeation pathway. Here we show that Kv1.4 K(+) channels are potently regulated by intracellular free heme; heme binds to the N-terminal inactivation domain and thereby impairs the inactivation process, thus enhancing the K(+) current with an apparent EC50 value of ∼20 nM. Functional studies on channel mutants and structural investigations on recombinant inactivation ball domain peptides encompassing the first 61 residues of Kv1.4 revealed a heme-responsive binding motif involving Cys13:His16 and a secondary histidine at position 35. Heme binding to the N-terminal inactivation domain induces a conformational constraint that prevents it from reaching its receptor site at the vestibule of the channel pore.

  7. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.

    PubMed

    Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R

    1999-05-01

    The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.

  8. Inactivation of Mycobacterium avium with free chlorine.

    PubMed

    Luh, Jeanne; Mariñas, Benito J

    2007-07-15

    The inactivation kinetics of Mycobacterium avium with free chlorine was characterized by two stages: an initial phase at a relatively fast rate followed by a slower second stage of pseudo first-order kinetics. The inactivation rate of each stage was approximately the same for all experiments performed at a certain condition of pH and temperature; however, variability was observed for the disinfectant exposure at which the transition between the two stages occurred. This variability was not a function of the initial disinfectant concentration, the initial bacterial density, or the bacterial stock. However, the transition to the second stage varied more significantly at high temperatures (30 degrees C), while lower variability was observed at lower temperatures (5 and 20 degrees C). Experiments conducted at pH values in the range of 6-9 revealed that the inactivation of M. avium was primarily due to hypochlorous acid, with little contribution from hypochlorite ion within this pH range. The inactivation kinetics was represented with a two-population model. The activation energies for the resulting pseudo first-order rate constants for the populations with fast and slow kinetics were 100.3 and 96.5 kJ/mol, respectively. The magnitude of these values suggested that for waters of relatively high pH and low temperatures, little inactivation of M. avium would be achieved within treatment plants, providing a seeding source for distribution systems.

  9. Mechanism-based inactivation of CYP2C9 by linderane.

    PubMed

    Wang, Hui; Wang, Kai; Mao, Xu; Zhang, Qingqing; Yao, Tong; Peng, Ying; Zheng, Jiang

    2015-01-01

    1. Linderane (LDR), a furan-containing sesquiterpenoid, is found in Lindera aggregata (Sims) Kosterm, a common traditional Chinese herbal medicine. We thoroughly studied the irreversible inhibitory effect of LDR on cytochrome P450 2C9 (CYP2C9). 2. LDR caused a time- and concentration-dependent inactivation of CYP2C9. In addition, the inactivation of CYP2C9 by LDR was NADPH-dependent and irreversible. More than 50% of CYP2C9 activity was lost after its incubation with LDR at the concentration of 10 μM for 15 min at 30 °C. The maximal rate constant for inactivation (kinact) was found to be 0.0419 min(-1), and the concentration required for half-maximal inactivation (KI) was 1.26 μM, respectively. Glutathione (GSH), catalase, and superoxide dismutase (SOD) failed to protect CYP2C9 against inactivation by LDR. Diclofenac, a substrate of CYP2C9, prevented the enzyme from inactivation produced by LDR. The estimated partition ratio of the inactivation was approximately 227. 3. Two reactive intermediates, including furanoepoxide and γ-ketoenal, might be responsible for the observed enzyme inactivation. The formation of the intermediates was verified by chemical synthesis. Multiple P450 enzymes, including CYPs 1A2, 2B6, 2C9, 2C19, 2D6, 3A4, and 3A5, were found to be involved in the metabolic activation of LDR. In conclusion, LDR was characterized as a mechanism-based inactivator of CYP2C9.

  10. Biallelic germline and somatic mutations in malignant mesothelioma: multiple mutations in transcription regulators including mSWI/SNF genes.

    PubMed

    Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Otsuki, Taiichiro; Fukuoka, Kazuya; Hasegawa, Seiki; Nakano, Takashi; Hashimoto-Tamaoki, Tomoko

    2015-02-01

    We detected low levels of acetylation for histone H3 tail lysines in malignant mesothelioma (MM) cell lines resistant to histone deacetylase inhibitors. To identify the possible genetic causes related to the low histone acetylation levels, whole-exome sequencing was conducted with MM cell lines established from eight patients. A mono-allelic variant of BRD1 was common to two MM cell lines with very low acetylation levels. We identified 318 homozygous protein-damaging variants/mutations (18-78 variants/mutations per patient); annotation analysis showed enrichment of the molecules associated with mammalian SWI/SNF (mSWI/SNF) chromatin remodeling complexes and co-activators that facilitate initiation of transcription. In seven of the patients, we detected a combination of variants in histone modifiers or transcription factors/co-factors, in addition to variants in mSWI/SNF. Direct sequencing showed that homozygous mutations in SMARCA4, PBRM1 and ARID2 were somatic. In one patient, homozygous germline variants were observed for SMARCC1 and SETD2 in chr3p22.1-3p14.2. These exhibited extended germline homozygosity and were in regions containing somatic mutations, leading to a loss of BAP1 and PBRM1 expression in MM cell line. Most protein-damaging variants were heterozygous in normal tissues. Heterozygous germline variants were often converted into hemizygous variants by mono-allelic deletion, and were rarely homozygous because of acquired uniparental disomy. Our findings imply that MM might develop through the somatic inactivation of mSWI/SNF complex subunits and/or histone modifiers, including BAP1, in subjects that have rare germline variants of these transcription regulators and/or transcription factors/co-factors, and in regions prone to mono-allelic deletion during oncogenesis. © 2014 UICC.

  11. Inactivation of MS2 bacteriophage by streamer corona discharge in water.

    PubMed

    Lee, Changha; Kim, Jaeeun; Yoon, Jeyong

    2011-02-01

    Electrical discharge processes are emerging as water treatment technologies applicable to both the degradation of organic contaminants as well as inactivation of pathogens. Particularly as a disinfection technology, electrical discharge processes do not produce toxic byproducts, and effectively inactivate a wide spectrum of microorganisms by multiple lethal actions generated by the formation of plasma channels. This study demonstrates the inactivation of a virus using the streamer corona discharge process (SCDP) with MS2 phage as a surrogate. A rapid inactivation of MS2 phage (i.e., approximately 4 log inactivation in 5 min) was observed in all experimental runs conducted. Discharge conditions such as applied voltage and storage capacitance significantly affected the inactivation efficiency of MS2 phage, whereas the influence of water quality parameters was minor. In order to elucidate the mechanism of MS2 phage inactivation, potentially lethal factors that can be generated by the SCDP were selected, and their roles in the inactivation of MS2 phage were examined. As a result, effects of UV radiation, chemical oxidants, and pulsed electric fields were found to be insignificant. The shockwave generated upon plasma channel formation appears to be the most important factor responsible for MS2 phage inactivation. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Long Non-coding RNAs in the X-inactivation Center

    PubMed Central

    Kalantry, Sundeep

    2014-01-01

    The X-inactivation center is a hotbed of functional long non-coding RNAs in eutherian mammals. These RNAs are thought to help orchestrate the epigenetic transcriptional states of the two X-chromosomes in females as well as of the single X-chromosome in males. To balance X-linked gene expression between the sexes, females undergo transcriptional silencing of most genes on one of the two X-chromosomes in a process termed X-chromosome inactivation. While one X-chromosome is inactivated, the other X-chromosome remains active. Moreover, with a few notable exceptions, the originally established epigenetic transcriptional profiles of the two is maintained as such through many rounds of cell division, essentially for the life of the organism. The stable divergent transcriptional fates of the two X-chromosomes, despite residing in a shared nucleoplasm, make X-inactivation a paradigm of epigenetic transcriptional regulation. Originally proposed in 1961 by Mary Lyon, the X-inactivation hypothesis has been validated through much experimentation over the last fifty years. In the last 25 years, the discovery and functional characterization has firmly established X-linked long non-coding RNAs as key players in choreographing X-chromosome inactivation. PMID:24297756

  13. Free chlorine inactivation of fungi in drinking water sources.

    PubMed

    Pereira, V J; Marques, R; Marques, M; Benoliel, M J; Barreto Crespo, M T

    2013-02-01

    The effectiveness of free chlorine for the inactivation of fungi present in settled surface water was tested. In addition, free chlorine inactivation rate constants of Cladosporium tenuissimum, Cladosporium cladosporioides, Phoma glomerata, Aspergillus terreus, Aspergillus fumigatus, Penicillium griseofulvum, and Penicillium citrinum that were found to occur in different source waters were determined in different water matrices (laboratory grade water and settled water). The effect of using different disinfectant concentrations (1 and 3 mg/l), temperatures (21 and 4 °C), and pH levels (6 and 7) was addressed. The sensitivity degree of different fungi isolates to chlorine disinfection varied among different genera with some species showing a higher resistance to disinfection and others expected to be more prone to protection from inactivation by the water matrix components. When the disinfection efficiency measured in terms of the chlorine concentration and contact time (Ct) values needed to achieve 99% inactivation were compared with the Ct values reported as being able to achieve the same degree of inactivation of other microorganisms, fungi were found to be more resistant to chlorine inactivation than bacteria and viruses and less resistant than Cryptosporidium oocysts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. INACTIVATION OF SOME SEMISYNTHETIC PENICILLINS BY GRAM-NEGATIVE BACILLI

    PubMed Central

    Sabath, Leon; Finland, Maxwell

    1963-01-01

    Sabath, Leon (Boston City Hospital, Boston, Mass.) and Maxwell Finland. Inactivation of some semisynthetic penicillins by gram-negative bacilli. J. Bacteriol. 85:314–321. 1963.—An agar diffusion method was used to test 55 strains of gram-negative bacilli for their ability to inactivate penicillin G, methicillin, biphenylpenicillin, oxacillin, and ampicillin; 26 strains inactivated one or more of them. All strains of Klebsiella-Aerobacter, nearly all of Escherichia coli, and some of Pseudomonas aeruginosa, but not those of Proteus or Salmonella, were active by this method. Penicillin G was inactivated by the largest number of strains, biphenylpenicillin and ampicillin by somewhat fewer, and oxacillin and methicillin by about half as many. When the five penicillins were incubated with four strains of different bacteria in broth at 37 C, all were inactivated to a considerable extent by all the strains, each penicillin to a different degree, but to about the same extent by all the strains. Adsorption alone did not account for the loss of activity. The results suggest that there are qualitative, as well as quantitative, differences among species or even strains of gram-negative bacilli in their ability to inactivate the various penicillins. Images PMID:13975857

  15. SURFACE INACTIVATION OF BACTERIAL VIRUSES AND OF PROTEINS

    PubMed Central

    Adams, Mark H.

    1948-01-01

    1. The seven bacterial viruses of the T group active against E. coli, are rapidly inactivated at gas-liquid interfaces. 2. The kinetics of this inactivation whether brought about by shaking or by bubbling with nitrogen are those of a first order reaction. 3. This inactivation may be prevented by the addition of enough protein to maintain the gas-liquid interface in a saturated condition. 4. The analogy between this phenomenon and the surface denaturation of proteins is pointed out and discussed. PMID:18917025

  16. Arginine inactivates human herpesvirus 2 and inhibits genital herpesvirus infection.

    PubMed

    Ikeda, Keiko; Yamasaki, Hisashi; Minami, Sawako; Suzuki, Yukiko; Tsujimoto, Kazuko; Sekino, Yoshihisa; Irie, Hiroshi; Arakawa, Tsutomu; Koyama, A Hajime

    2012-12-01

    Arginine, among the amino acids, has demonstrated unique properties, including suppression of protein-protein interactions and virus inactivation. We investigated the effects of arginine on the infectivity of human herpesvirus 2 (HHV-2) and the potential application of arginine as a chemotherapeutic agent against genital herpes. Arginine directly inactivated HHV-2 and characterization of the inactivation demonstrated that 1 M arginine at pH 4.3 inactivated the virus more efficiently compared to 0.1 M citrate or 1 M sodium chloride, indicating that neither acidic pH nor ionic strength alone is sufficient for virus inactivation. The effect of arginine was rapid and concentration-dependent. Although virus inactivation was efficient at an acidic pH, arginine inactivated the virus even at a neutral pH, provided that a higher arginine concentration and prolonged incubation time were used. In addition, arginine suppressed the multiplication of HHV-2 under the conditions at which its effect on cell viability was insignificant. Pilot mouse model studies revealed a marked suppression of death by arginine when the mice were infected with HHV-2 through the vaginal route, followed by an intermittent application of acidic arginine by vaginal instillation.

  17. Thermal inactivation and chaperonin-mediated renaturation of mitochondrial aspartate aminotransferase.

    PubMed Central

    Lawton, J M; Doonan, S

    1998-01-01

    Mitochondrial aspartate aminotransferase is inactivated irreversibly on heating. The inactivated protein aggregates, but aggregation is prevented by the presence of the chaperonin 60 from Escherichia coli (GroEL). The chaperonin increases the rate of thermal inactivation in the temperature range 55-65 degrees C but not at lower temperatures. It has previously been shown [Twomey and Doonan (1997) Biochim. Biophys. Acta 1342, 37-44] that the enzyme switches to a modified, but catalytically active, conformation at approx. 55-60 degrees C and the present results show that this conformation is recognized by and binds to GroEL. The thermally inactivated protein can be released from GroEL in an active form by the addition of chaperonin 10 from E. coli (GroES)/ATP, showing that inactivation is not the result of irreversible chemical changes. These results suggest that the irreversibility of thermal inactivation is due to the formation of an altered conformation with a high kinetic barrier to refolding rather than to any covalent changes. In the absence of chaperonin the unfolded molecules aggregate but this is a consequence, rather than the cause, of irreversible inactivation. PMID:9693123

  18. Inactivation of Zika virus by solvent/detergent treatment of human plasma and other plasma-derived products and pasteurization of human serum albumin.

    PubMed

    Kühnel, Denis; Müller, Sebastian; Pichotta, Alexander; Radomski, Kai Uwe; Volk, Andreas; Schmidt, Torben

    2017-03-01

    In 2016 the World Health Organization declared the mosquito-borne Zika virus (ZIKV) a "public health emergency of international concern." ZIKV is a blood-borne pathogen, which therefore causes concerns regarding the safety of human plasma-derived products due to potential contamination of the blood supply. This study investigated the effectiveness of viral inactivation steps used during the routine manufacturing of various plasma-derived products to reduce ZIKV infectivity. Human plasma and intermediates from the production of various plasma-derived products were spiked with ZIKV and subjected to virus inactivation using the identical techniques (either solvent/detergent [S/D] treatment or pasteurization) and conditions used for the actual production of the respective products. Samples were taken and the viral loads measured before and after inactivation. After S/D treatment of spiked intermediates of the plasma-derived products Octaplas(LG), Octagam, and Octanate, the viral loads were below the limit of detection in all cases. The mean log reduction factor (LRF) was at least 6.78 log for Octaplas(LG), at least 7.00 log for Octagam, and at least 6.18 log for Octanate after 60, 240, and 480 minutes of S/D treatment, respectively. For 25% human serum albumin (HSA), the mean LRF for ZIKV was at least 7.48 log after pasteurization at 60°C for 120 minutes. These results demonstrate that the commonly used virus inactivation processes utilized during the production of human plasma and plasma-derived products, namely, S/D treatment or pasteurization, are effective for inactivation of ZIKV. © 2016 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  19. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

    PubMed Central

    Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

    2010-01-01

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

  20. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

    PubMed

    Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

    2010-01-12

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

  1. Low pH inactivation for xenotropic gamma retrovirus in recombinant human TNF-α receptor immunoglobulin G and mechanism of inactivation.

    PubMed

    Ma, Rong; Cui, Xiaolan

    2014-01-01

    CHO-derived recombinant proteins for human therapeutic are used commonly. There are noninfectious endogenous retroviruses in CHO cells. Validation study for inactivation process is required. Murine xenotropic gamma retrovirus (X-MulV) is a model virus in validation study. In our previous study, optimum conditions for X-MulV inactivation were sifted. In this study, we performed a further research on low pH inactivation for evaluation of X-MulV clearance in manufacturing of recombinant human TNF-α receptor immunoglobulin G fusion proteins (rhTNF-α) for injection. Cell-based infectivity assay was used for the evaluation of X-MulV clearance. RhTNF-α were spiked with X-MulV and were inactivated at pH 3.60 ∼ 3.90, 25 ± 2 °C, and 0 ∼ 240 min, respectively. Samples incubated at the conditions for 15 ∼ 180 min were not inactivated effectively. For 4 h incubation, log10 reductions were achieved 5.0 log10. Biological activity of rhTNF-α incubated at pH 3.60, 25 °C for 4 h, which was assayed on murine L929 fibroblasts cells, was not affected by low pH. Env gene of X-MulV, which was detected by conventional PCR method for the first time, was not detected after incubation at pH 3.60, and it may be the mechanism of low pH inactivation. Copyright © 2013. Published by Elsevier Ltd.

  2. Initial steps of inactivation at the K+ channel selectivity filter

    PubMed Central

    Thomson, Andrew S.; Heer, Florian T.; Smith, Frank J.; Hendron, Eunan; Bernèche, Simon; Rothberg, Brad S.

    2014-01-01

    K+ efflux through K+ channels can be controlled by C-type inactivation, which is thought to arise from a conformational change near the channel’s selectivity filter. Inactivation is modulated by ion binding near the selectivity filter; however, the molecular forces that initiate inactivation remain unclear. We probe these driving forces by electrophysiology and molecular simulation of MthK, a prototypical K+ channel. Either Mg2+ or Ca2+ can reduce K+ efflux through MthK channels. However, Ca2+, but not Mg2+, can enhance entry to the inactivated state. Molecular simulations illustrate that, in the MthK pore, Ca2+ ions can partially dehydrate, enabling selective accessibility of Ca2+ to a site at the entry to the selectivity filter. Ca2+ binding at the site interacts with K+ ions in the selectivity filter, facilitating a conformational change within the filter and subsequent inactivation. These results support an ionic mechanism that precedes changes in channel conformation to initiate inactivation. PMID:24733889

  3. Inactivation of complement by Loxosceles reclusa spider venom.

    PubMed

    Gebel, H M; Finke, J H; Elgert, K D; Cambell, B J; Barrett, J T

    1979-07-01

    Zymosan depletion of serum complement in guinea pigs rendered them highly resistant to lesion by Loxosceles reclusa spider venom. Guinea pigs deficient in C4 of the complement system are as sensitive to the venom as normal guinea pigs. The injection of 35 micrograms of whole recluse venom intradermally into guinea pigs lowered their complement level by 35.7%. Brown recluse spider venom in concentrations as slight as 0.02 micrograms protein/ml can totally inactivate one CH50 of guinea pig complement in vitro. Bee, scorpion, and other spider venoms had no influence on the hemolytic titer of complement. Fractionation of recluse spider venom by Sephadex G-200 filtration separated the complement-inactivating property of the venom into three major regions which could be distinguished on the basis of heat stability as well as size. None was neutralized by antivenom. Polyacrylamide gel electrophoresis of venom resolved the complement inactivators into five fractions. Complement inactivated by whole venom or the Sephadex fractions could be restored to hemolytic activity by supplements of fresh serum but not by heat-inactivated serum, pure C3, pure C5, or C3 and C5 in combination.

  4. Significance of Inactivated Genes in Leukemia: Pathogenesis and Prognosis

    PubMed Central

    Heidari, Nazanin; Abroun, Saeid; Bertacchini, Jessika; Vosoughi, Tina; Rahim, Fakher; Saki, Najmaldin

    2017-01-01

    Epigenetic and genetic alterations are two mechanisms participating in leukemia, which can inactivate genes involved in leukemia pathogenesis or progression. The purpose of this review was to introduce various inactivated genes and evaluate their possible role in leukemia pathogenesis and prognosis. By searching the mesh words “Gene, Silencing AND Leukemia” in PubMed website, relevant English articles dealt with human subjects as of 2000 were included in this study. Gene inactivation in leukemia is largely mediated by promoter’s hypermethylation of gene involving in cellular functions such as cell cycle, apoptosis, and gene transcription. Inactivated genes, such as ASPP1, TP53, IKZF1 and P15, may correlate with poor prognosis in acute lymphoid leukemia (ALL), chronic lymphoid leukemia (CLL), chronic myelogenous leukemia (CML) and acute myeloid leukemia (AML), respectively. Gene inactivation may play a considerable role in leukemia pathogenesis and prognosis, which can be considered as complementary diagnostic tests to differentiate different leukemia types, determine leukemia prognosis, and also detect response to therapy. In general, this review showed some genes inactivated only in leukemia (with differences between B-ALL, T-ALL, CLL, AML and CML). These differences could be of interest as an additional tool to better categorize leukemia types. Furthermore; based on inactivated genes, a diverse classification of Leukemias could represent a powerful method to address a targeted therapy of the patients, in order to minimize side effects of conventional therapies and to enhance new drug strategies. PMID:28580304

  5. DNA hydroxymethylation profiling reveals that WT1 mutations result in loss of TET2 function in acute myeloid leukemia

    PubMed Central

    Rampal, Raajit; Alkalin, Altuna; Madzo, Jozef; Vasanthakumar, Aparna; Pronier, Elodie; Patel, Jay; Li, Yushan; Ahn, Jihae; Abdel-Wahab, Omar; Shih, Alan; Lu, Chao; Ward, Patrick S.; Tsai, Jennifer J.; Hricik, Todd; Tosello, Valeria; Tallman, Jacob E.; Zhao, Xinyang; Daniels, Danette; Dai, Qing; Ciminio, Luisa; Aifantis, Iannis; He, Chuan; Fuks, Francois; Tallman, Martin S.; Ferrando, Adolfo; Nimer, Stephen; Paietta, Elisabeth; Thompson, Craig B.; Licht, Jonathan D.; Mason, Chris; Godley, Lucy A.; Melnick, Ari; Figueroa, Maria E.; Levine, Ross L.

    2014-01-01

    Summary Somatic mutations in IDH1/2 and TET2 result in impaired TET2 mediated conversion of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC). The observation that WT1 inactivating mutations anti-correlate with TET2/IDH1/2 mutations in AML led us to hypothesize that WT1 mutations may impact TET2 function. WT1 mutant acute myeloid leukemia (AML) patients have reduced 5-hmC levels similar to TET2/IDH1/2-mutant AML. These mutations are characterized by convergent, site-specific alterations in DNA hydroxymethylation, which drive differential gene expression more than alterations in DNA promoter methylation. WT1 overexpression increases global levels of 5-hmC, and WT1 silencing reduced 5-hmC levels. WT1 physically interacts with TET2 and TET3, and WT1 loss of function results in a similar hematopoietic differentiation phenotype as observed with TET2 deficiency. These data provide a novel role for WT1 in regulating DNA hydroxymethylation and suggest that TET2 IDH1/2, and WT1 mutations define a novel AML subtype defined by dysregulated DNA hydroxymethylation. PMID:25482556

  6. Inactivation of Bacillus atrophaeus by OH radicals

    NASA Astrophysics Data System (ADS)

    Ono, Ryo; Yonetamari, Kenta; Tokumitsu, Yusuke; Yonemori, Seiya; Yasuda, Hachiro; Mizuno, Akira

    2016-08-01

    The inactivation of Bacillus atrophaeus by OH radicals is measured. This study aims to evaluate the bactericidal effects of OH radicals produced by atmospheric-pressure nonthermal plasma widely used for plasma medicine; however, in this study, OH radicals are produced by vacuum ultraviolet (VUV) photolysis of water vapor instead of plasma to allow the production of OH radicals with almost no other reactive species. A 172 nm VUV light from a Xe2 excimer lamp irradiates a He-H2O mixture flowing in a quartz tube to photodissociate H2O to produce OH, H, O, HO2, H2O2, and O3. The produced reactive oxygen species (ROS) flow out of the quartz tube nozzle to the bacteria on an agar plate and cause inactivation. The inactivation by OH radicals among the six ROS is observed by properly setting the experimental conditions with the help of simulations calculating the ROS densities. A 30 s treatment with approximately 0.1 ppm OH radicals causes visible inactivation.

  7. Germination and Inactivation of Alicyclobacillus acidoterrestris Spores Induced by Moderate Hydrostatic Pressure.

    PubMed

    Sokołowska, Barbara; Skapska, Sylwia; Fonberg-Broczek, Monika; Niezgoda, Jolanta; Porebska, Izabela; Dekowska, Agnieszka; Rzoska, Sylwester J

    2015-01-01

    Given the importance of spoilage caused by Alicyclobacillus acidoterrestris for the fruit juice industry, the objective of this work was to study the germination and inactivation of A. acidoterrestris spores induced by moderate hydrostatic pressure. Hydrostatic pressure treatment can induce the germination and inactivation of A. acidoterrestris spores. At low pH, spore germination of up to 3.59-3.75 log and inactivation of 1.85-2.04 log was observed in a low pressure window (200-300 MPa) applied at 50 degrees C for 20 min. Neutral pH suppressed inactivation, the number of spores inactivated at pH 7.0 was only 0.24-1.06 log. The pressurization temperature significantly affected spore germination and inactivation. The degree of germination in apple juice after pressurization for 30 min with 200 MPa at 20 degrees C was 2.04 log, with only 0.61 log of spores being inactivated, while at 70 degrees C spore germination was 5.94 log and inactivation 4.72 log. This temperature strongly stimulated germination and inactivation under higher (500 MPa) than lower (200 MPa) pressure. When the oscillatory mode was used, the degree of germination and inactivation was slightly higher than at continuous mode. The degree of germination and inactivation was inversely proportional to the soluble solids content and was lowest in concentrated apple juice.

  8. Inactivation of RNA Viruses by Gamma Irradiation: A Study on Mitigating Factors

    PubMed Central

    Hume, Adam J.; Ames, Joshua; Rennick, Linda J.; Duprex, W. Paul; Marzi, Andrea; Tonkiss, John; Mühlberger, Elke

    2016-01-01

    Effective inactivation of biosafety level 4 (BSL-4) pathogens is vital in order to study these agents safely. Gamma irradiation is a commonly used method for the inactivation of BSL-4 viruses, which among other advantages, facilitates the study of inactivated yet morphologically intact virions. The reported values for susceptibility of viruses to inactivation by gamma irradiation are sometimes inconsistent, likely due to differences in experimental protocols. We analyzed the effects of common sample attributes on the inactivation of a recombinant vesicular stomatitis virus expressing the Zaire ebolavirus glycoprotein and green fluorescent protein. Using this surrogate virus, we found that sample volume and protein content of the sample modulated viral inactivation by gamma irradiation but that air volume within the sample container and the addition of external disinfectant surrounding the sample did not. These data identify several factors which alter viral susceptibility to inactivation and highlight the usefulness of lower biosafety level surrogate viruses for such studies. Our results underscore the need to validate inactivation protocols of BSL-4 pathogens using “worst-case scenario” procedures to ensure complete sample inactivation. PMID:27455307

  9. [Effect of various factors on ozone inactivating Giardia in water].

    PubMed

    Ran, Zhi-Lin; Li, Shao-Feng; Huang, Jun-Li; Yuan, Yi-Xing; Cui, Chong-Wei

    2010-06-01

    In order to study the effect of O3 inactivating Giardia in water, different factors (CT value, pH, temperature, turbidity, organic content and inorganic ions) which might influence the inactivation were investigated by using fluorescence staining method. The results indicated that the whole process of O3 inactivating Giardia could be divided into two periods, the inactivated rate in log phase was significantly faster than it in the slow phase [k1 = (5.64 +/- 0.023) x 10(-1) mg x min, k2 = (2.72 +/- 0.002) x 10(-2) mg x min, k1 > k2]. When the turbidity was 0.1 to 20. 0NTU, temperature was 5 to 35 degrees C, pH was 6.0 to 9.0, HA content was 0.5 to 10.0 mg/L, the turbidity was lower, the higher inactivating ratio could be received. With the increasing of temperature, the inactivating effect was decreased. The ability of O3 inactivating Giardia was stronger under acidic condition than it was in alkali circumstance. When the reaction system contained higher concentration of organics, the competition reaction might take place between Giardia and organics with O3, which might reduce inactivation ratio. The sequence of affecting disinfectant ability of O3 was NO3- > None > SO4(2-) > HCO3-, while inorganic cations (Ca2+, Mg2+ and Cu2+) promoted the inactive reaction to a certain extent. If the CT value of O3 was more than 15.0 min x mg/L, the ratio of inactivation could exceed 99.0% during disinfecting drinking water.

  10. Structural and Molecular Basis of the Peroxynitrite-mediated Nitration and Inactivation of Trypanosoma cruzi Iron-Superoxide Dismutases (Fe-SODs) A and B

    PubMed Central

    Martinez, Alejandra; Peluffo, Gonzalo; Petruk, Ariel A.; Hugo, Martín; Piñeyro, Dolores; Demicheli, Verónica; Moreno, Diego M.; Lima, Analía; Batthyány, Carlos; Durán, Rosario; Robello, Carlos; Martí, Marcelo A.; Larrieux, Nicole; Buschiazzo, Alejandro; Trujillo, Madia; Radi, Rafael; Piacenza, Lucía

    2014-01-01

    Trypanosoma cruzi, the causative agent of Chagas disease, contains exclusively iron-dependent superoxide dismutases (Fe-SODs) located in different subcellular compartments. Peroxynitrite, a key cytotoxic and oxidizing effector biomolecule, reacted with T. cruzi mitochondrial (Fe-SODA) and cytosolic (Fe-SODB) SODs with second order rate constants of 4.6 ± 0.2 × 104 m−1 s−1 and 4.3 ± 0.4 × 104 m−1 s−1 at pH 7.4 and 37 °C, respectively. Both isoforms are dose-dependently nitrated and inactivated by peroxynitrite. Susceptibility of T. cruzi Fe-SODA toward peroxynitrite was similar to that reported previously for Escherichia coli Mn- and Fe-SODs and mammalian Mn-SOD, whereas Fe-SODB was exceptionally resistant to oxidant-mediated inactivation. We report mass spectrometry analysis indicating that peroxynitrite-mediated inactivation of T. cruzi Fe-SODs is due to the site-specific nitration of the critical and universally conserved Tyr35. Searching for structural differences, the crystal structure of Fe-SODA was solved at 2.2 Å resolution. Structural analysis comparing both Fe-SOD isoforms reveals differences in key cysteines and tryptophan residues. Thiol alkylation of Fe-SODB cysteines made the enzyme more susceptible to peroxynitrite. In particular, Cys83 mutation (C83S, absent in Fe-SODA) increased the Fe-SODB sensitivity toward peroxynitrite. Molecular dynamics, electron paramagnetic resonance, and immunospin trapping analysis revealed that Cys83 present in Fe-SODB acts as an electron donor that repairs Tyr35 radical via intramolecular electron transfer, preventing peroxynitrite-dependent nitration and consequent inactivation of Fe-SODB. Parasites exposed to exogenous or endogenous sources of peroxynitrite resulted in nitration and inactivation of Fe-SODA but not Fe-SODB, suggesting that these enzymes play distinctive biological roles during parasite infection of mammalian cells. PMID:24616096

  11. Drosophila as a Model for Epilepsy: bss Is a Gain-of-Function Mutation in the Para Sodium Channel Gene That Leads to Seizures

    PubMed Central

    Parker, Louise; Padilla, Miguel; Du, Yuzhe; Dong, Ke; Tanouye, Mark A.

    2011-01-01

    We report the identification of bang senseless (bss), a Drosophila melanogaster mutant exhibiting seizure-like behaviors, as an allele of the paralytic (para) voltage-gated Na+ (NaV) channel gene. Mutants are more prone to seizure episodes than normal flies because of a lowered seizure threshold. The bss phenotypes are due to a missense mutation in a segment previously implicated in inactivation, termed the “paddle motif” of the NaV fourth homology domain. Heterologous expression of cDNAs containing the bss1 lesion, followed by electrophysiology, shows that mutant channels display altered voltage dependence of inactivation compared to wild type. The phenotypes of bss are the most severe of the bang-sensitive mutants in Drosophila and can be ameliorated, but not suppressed, by treatment with anti-epileptic drugs. As such, bss-associated seizures resemble those of pharmacologically resistant epilepsies caused by mutation of the human NaV SCN1A, such as severe myoclonic epilepsy in infants or intractable childhood epilepsy with generalized tonic-clonic seizures. PMID:21115970

  12. Experimental design to evaluate directed adaptive mutation in Mammalian cells.

    PubMed

    Bordonaro, Michael; Chiaro, Christopher R; May, Tobias

    2014-12-09

    We describe the experimental design for a methodological approach to determine whether directed adaptive mutation occurs in mammalian cells. Identification of directed adaptive mutation would have profound practical significance for a wide variety of biomedical problems, including disease development and resistance to treatment. In adaptive mutation, the genetic or epigenetic change is not random; instead, the presence and type of selection influences the frequency and character of the mutation event. Adaptive mutation can contribute to the evolution of microbial pathogenesis, cancer, and drug resistance, and may become a focus of novel therapeutic interventions. Our experimental approach was designed to distinguish between 3 types of mutation: (1) random mutations that are independent of selective pressure, (2) undirected adaptive mutations that arise when selective pressure induces a general increase in the mutation rate, and (3) directed adaptive mutations that arise when selective pressure induces targeted mutations that specifically influence the adaptive response. The purpose of this report is to introduce an experimental design and describe limited pilot experiment data (not to describe a complete set of experiments); hence, it is an early report. An experimental design based on immortalization of mouse embryonic fibroblast cells is presented that links clonal cell growth to reversal of an inactivating polyadenylation site mutation. Thus, cells exhibit growth only in the presence of both the countermutation and an inducing agent (doxycycline). The type and frequency of mutation in the presence or absence of doxycycline will be evaluated. Additional experimental approaches would determine whether the cells exhibit a generalized increase in mutation rate and/or whether the cells show altered expression of error-prone DNA polymerases or of mismatch repair proteins. We performed the initial stages of characterizing our system and have limited preliminary data

  13. Role of GnRH receptor mutations in patients with a wide spectrum of pubertal delay

    PubMed Central

    Beneduzzi, Daiane; Trarbach, Ericka B.; Min, Le; Jorge, Alexander A. L.; Garmes, Heraldo M.; Renk, Alessandra Covallero; Fichna, Marta; Fichna, Piotr; Arantes, Karina A.; Costa, Elaine M. F.; Zhang, Anna; Adeola, Oluwaseun; Wen, Junping; Carroll, Rona S.; Mendonça, Berenice B.; Kaiser, Ursula B.; Latronico, Ana Claudia; Silveira, Letícia F. G.

    2014-01-01

    Objective To analyze the GNRHR in patients with normosmic isolated hypogonadotropic hypogonadism (IHH) and constitutional delay of growth and puberty (CDGP). Design Molecular analysis and in vitro experiments correlated with phenotype. Setting Academic medical center. Patient(s) 110 individuals with normosmic IHH (74 males) and 50 with CGDP. Intervention(s) GNRHR coding region was amplified and sequenced. Main Outcome Measure(s) Novel variants were submitted to in vitro analysis. Frequency of mutations and genotype-phenotype correlation were analyzed. Microsatellite markers flanking GNRHR were examined in patients carrying the same mutation to investigate a possible founder effect. Result(s) Eleven IHH patients (10%) carried biallelic GNRHR mutations. In vitro analysis of novel variants (p.Y283H and p.V134G) demonstrated complete inactivation. The founder effect study revealed that Brazilian patients carrying the p.R139H mutation shared the same haplotype. Phenotypic spectrum in patients with GNRHR mutations varied from complete GnRH deficiency to partial and reversible IHH, with a relatively good genotype-phenotype correlation. One boy with CDGP was heterozygous for the p.Q106R variant, which was not considered pathogenic. Conclusion(s) GNRHR mutations are a frequent cause of congenital normosmic IHH and should be the first candidate gene for genetic screening in this condition, especially in autosomal recessive familial cases. The founder effect study suggested that the p.R139H mutation arises from a common ancestor in the Brazilian population. Finally, mutations in GNRHR do not appear to be involved in the pathogenesis of CDGP. PMID:25016926

  14. Design and Mechanism of Tetrahydrothiophene-based GABA Aminotransferase Inactivators

    PubMed Central

    Le, Hoang V.; Hawker, Dustin D.; Wu, Rui; Doud, Emma; Widom, Julia; Sanishvili, Ruslan; Liu, Dali; Kelleher, Neil L.; Silverman, Richard B.

    2015-01-01

    Low levels of γ-aminobutyric acid (GABA), one of two major neurotransmitters that regulate brain neuronal activity, are associated with many neurological disorders, such as epilepsy, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, and cocaine addiction. One of the main methods to raise the GABA level in human brain is to use small molecules that cross the blood-brain barrier and inhibit the activity of γ-aminobutyric acid aminotransferase (GABA-AT), the enzyme that degrades GABA. We have designed a series of conformationally-restricted, tetrahydrothiophene-based GABA analogs with a properly-positioned leaving group that could facilitate a ring-opening mechanism, leading to inactivation of GABA-AT. One compound in the series is eight times more efficient an inactivator of GABA-AT than vigabatrin, the only FDA-approved inactivator of GABA-AT. Our mechanistic studies show that the compound inactivates GABA-AT by a new mechanism. The metabolite resulting from inactivation does not covalently bind to amino acid residues of GABA-AT but stays in the active site via H-bond interactions with Arg-192, a π-π interaction with Phe-189, and a weak nonbonded S···O=C interaction with Glu-270, thereby inactivating the enzyme. PMID:25781189

  15. High pressure inactivation of Brettanomyces bruxellensis in red wine.

    PubMed

    van Wyk, Sanelle; Silva, Filipa V M

    2017-05-01

    Brettanomyces bruxellensis ("Brett") is a major spoilage concern for the wine industry worldwide, leading to undesirable sensory properties. Sulphur dioxide, is currently the preferred method for wine preservation. However, due to its negative effects on consumers, the use of new alternative non-thermal technologies are increasingly being investigated. The aim of this study was to determine and model the effect of high pressure processing (HPP) conditions and yeast strain on the inactivation of "Brett" in Cabernet Sauvignon wine. Processing at 200 MPa for 3 min resulted in 5.8 log reductions. However higher pressure is recommended to achieve high throughput in the wine industry, for example >6.0 log reductions were achieved after 400 MPa for 5 s. The inactivation of B. bruxellensis is pressure and time dependent, with increased treatment time and pressure leading to increased yeast inactivation. It was also found that yeast strain had a significant effect on HPP inactivation, with AWRI 1499 being the most resistant strain. The Weibull model successfully described the HPP "Brett" inactivation. HPP is a viable alternative for the inactivation of B. bruxellensis in wine, with the potential to reduce the industry's reliance on sulphur dioxide. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Thermal Inactivation of Feline Calicivirus in Pet Food Processing.

    PubMed

    Haines, J; Patel, M; Knight, A I; Corley, D; Gibson, G; Schaaf, J; Moulin, J; Zuber, S

    2015-12-01

    Extrusion is the most common manufacturing process used to produce heat-treated dry dog and cat food (pet food) for domestic use and international trade. Due to reoccurring outbreaks of notifiable terrestrial animal diseases and their impact on international trade, experiments were undertaken to demonstrate the effectiveness of heat-treated extruded pet food on virus inactivation. The impact of extrusion processing in a pet food matrix on virus inactivation has not been previously reported and very few inactivation studies have examined the thermal inactivation of viruses in complex food matrices. The feline calicivirus vaccine strain FCV F-9 was used as a surrogate model RNA virus pathogen. Small-scale heat inactivation experiments using animal-derived pet food raw materials showed that a > 4 log10 reduction (log10 R) in infectivity occurred at 70 °C prior to reaching the minimum extrusion manufacturing operating temperature of 100 °C. As anticipated, small-scale pressure studies at extrusion pressure (1.6 MPa) showed no apparent effect on FCV F-9 inactivation. Additionally, FCV F-9 was shown not to survive the acidic conditions used to produce pet food palatants of animal origin that are typically used as a coating after the extrusion process.

  17. Identification of a novel mutation in a patient with pseudohypoparathyroidism type Ia

    PubMed Central

    Lee, Ye Seung; Kim, Hui Kwon; Kim, Hye Rim; Lee, Jong Yoon; Choi, Joong Wan; Bae, Eun Ju; Oh, Phil Soo; Park, Won Il; Ki, Chang Seok

    2014-01-01

    Pseudohypoparathyroidism type Ia (PHP Ia) is a disorder characterized by multiform hormonal resistance including parathyroid hormone (PTH) resistance and Albright hereditary osteodystrophy (AHO). It is caused by heterozygous inactivating mutations within the Gs alpha-encoding GNAS exons. A 9-year-old boy presented with clinical and laboratory abnormalities including hypocalcemia, hyperphosphatemia, PTH resistance, multihormone resistance and AHO (round face, short stature, obesity, brachydactyly and osteoma cutis) which were typical of PHP Ia. He had a history of repeated convulsive episodes that started from the age of 2 months. A cranial computed tomography scan showed bilateral calcifications in the basal ganglia and his intelligence quotient testing indicated mild mental retardation. Family history revealed that the patient's maternal relatives, including his grandmother and 2 of his mother's siblings, had features suggestive of AHO. Sequencing of the GNAS gene of the patient identified a heterozygous nonsense mutation within exon 11 (c.637 C>T). The C>T transversion results in an amino acid substitution from Gln to stop codon at codon 213 (p.Gln213*). To our knowledge, this is a novel mutation in GNAS. PMID:25045367

  18. Recurrent SETBP1 mutations in atypical chronic myeloid leukemia.

    PubMed

    Piazza, Rocco; Valletta, Simona; Winkelmann, Nils; Redaelli, Sara; Spinelli, Roberta; Pirola, Alessandra; Antolini, Laura; Mologni, Luca; Donadoni, Carla; Papaemmanuil, Elli; Schnittger, Susanne; Kim, Dong-Wook; Boultwood, Jacqueline; Rossi, Fabio; Gaipa, Giuseppe; De Martini, Greta P; di Celle, Paola Francia; Jang, Hyun Gyung; Fantin, Valeria; Bignell, Graham R; Magistroni, Vera; Haferlach, Torsten; Pogliani, Enrico Maria; Campbell, Peter J; Chase, Andrew J; Tapper, William J; Cross, Nicholas C P; Gambacorti-Passerini, Carlo

    2013-01-01

    Atypical chronic myeloid leukemia (aCML) shares clinical and laboratory features with CML, but it lacks the BCR-ABL1 fusion. We performed exome sequencing of eight aCMLs and identified somatic alterations of SETBP1 (encoding a p.Gly870Ser alteration) in two cases. Targeted resequencing of 70 aCMLs, 574 diverse hematological malignancies and 344 cancer cell lines identified SETBP1 mutations in 24 cases, including 17 of 70 aCMLs (24.3%; 95% confidence interval (CI) = 16-35%). Most mutations (92%) were located between codons 858 and 871 and were identical to changes seen in individuals with Schinzel-Giedion syndrome. Individuals with mutations had higher white blood cell counts (P = 0.008) and worse prognosis (P = 0.01). The p.Gly870Ser alteration abrogated a site for ubiquitination, and cells exogenously expressing this mutant exhibited higher amounts of SETBP1 and SET protein, lower PP2A activity and higher proliferation rates relative to those expressing the wild-type protein. In summary, mutated SETBP1 represents a newly discovered oncogene present in aCML and closely related diseases.

  19. Conjugated Polymers/DNA Hybrid Materials for Protein Inactivation.

    PubMed

    Zhao, Likun; Zhang, Jiangyan; Xu, Huiming; Geng, Hao; Cheng, Yongqiang

    2016-09-07

    Chromophore-assisted light inactivation (CALI) is a powerful tool for analyzing protein functions due to the high degree of spatial and temporal resolution. In this work, we demonstrate a CALI approach based on conjugated polymers (CPs)/DNA hybrid material for protein inactivation. The target protein is conjugated with single-stranded DNA in advance. Single-stranded DNA can form CPs/DNA hybrid material with cationic CPs via electrostatic and hydrophobic interactions. Through the formation of CPs/DNA hybrid material, the target protein that is conjugated with DNA is brought into close proximity to CPs. Under irradiation, CPs harvest light and generate reactive oxygen species (ROS), resulting in the inactivation of the adjacent target protein. This approach can efficiently inactivate any target protein which is conjugated with DNA and has good specificity and universality, providing a new strategy for studies of protein function and adjustment of protein activity.

  20. Validating the Inactivation Effectiveness of Chemicals on Ebola Virus.

    PubMed

    Haddock, Elaine; Feldmann, Friederike

    2017-01-01

    While viruses such as Ebola virus must be handled in high-containment laboratories, there remains the need to process virus-infected samples for downstream research testing. This processing often includes removal to lower containment areas and therefore requires assurance of complete viral inactivation within the sample before removal from high-containment. Here we describe methods for the removal of chemical reagents used in inactivation procedures, allowing for validation of the effectiveness of various inactivation protocols.

  1. Selective Destruction of Protein Function by Chromophore-Assisted Laser Inactivation

    NASA Astrophysics Data System (ADS)

    Jay, Daniel G.

    1988-08-01

    Chromophore-assisted laser inactivation of protein function has been achieved. After a protein binds a specific ligand or antibody conjugated with malachite green (C.I. 42000), it is selectively inactivated by laser irradiation at a wavelength of light absorbed by the dye but not significantly absorbed by cellular components. Ligand-bound proteins in solution and on the surfaces of cells can be denatured without other proteins in the same samples being affected. Chromophore-assisted laser inactivation can be used to study cell surface phenomena by inactivating the functions of single proteins on living cells, a molecular extension of cellular laser ablation. It has an advantage over genetics and the use of specific inhibitors in that the protein function of a single cell within the organism can be inactivated by focusing the laser beam.

  2. Chlorophyll mediated photodynamic inactivation of blue laser on Streptococcus mutans

    NASA Astrophysics Data System (ADS)

    Astuti, Suryani Dyah; Zaidan, A.; Setiawati, Ernie Maduratna; Suhariningsih

    2016-03-01

    Photodynamic inactivation is an inactivation method in microbial pathogens that utilize light and photosensitizer. This study was conducted to investigate photodynamic inactivation effects of low intensity laser exposure with various dose energy on Streptococcus mutans bacteria. The photodynamic inactivation was achieved with the addition of chlorophyll as photosensitizers. To determine the survival percentage of Streptococcus mutans bacteria after laser exposure, the total plate count method was used. For this study, the wavelength of the laser is 405 nm and variables of energy doses are 1.44, 2.87, 4.31, 5.74, 7.18, and 8.61 in J/cm2. The results show that exposure to laser with energy dose of 7.18 J/cm2 has the best photodynamic inactivation with a decrease of 78% in Streptococcus

  3. Stochastic and deterministic model of microbial heat inactivation.

    PubMed

    Corradini, Maria G; Normand, Mark D; Peleg, Micha

    2010-03-01

    Microbial inactivation is described by a model based on the changing survival probabilities of individual cells or spores. It is presented in a stochastic and discrete form for small groups, and as a continuous deterministic model for larger populations. If the underlying mortality probability function remains constant throughout the treatment, the model generates first-order ("log-linear") inactivation kinetics. Otherwise, it produces survival patterns that include Weibullian ("power-law") with upward or downward concavity, tailing with a residual survival level, complete elimination, flat "shoulder" with linear or curvilinear continuation, and sigmoid curves. In both forms, the same algorithm or model equation applies to isothermal and dynamic heat treatments alike. Constructing the model does not require assuming a kinetic order or knowledge of the inactivation mechanism. The general features of its underlying mortality probability function can be deduced from the experimental survival curve's shape. Once identified, the function's coefficients, the survival parameters, can be estimated directly from the experimental survival ratios by regression. The model is testable in principle but matching the estimated mortality or inactivation probabilities with those of the actual cells or spores can be a technical challenge. The model is not intended to replace current models to calculate sterility. Its main value, apart from connecting the various inactivation patterns to underlying probabilities at the cellular level, might be in simulating the irregular survival patterns of small groups of cells and spores. In principle, it can also be used for nonthermal methods of microbial inactivation and their combination with heat.

  4. Next-Generation Sequencing of Matched Primary and Metastatic Rectal Adenocarcinomas Demonstrates Minimal Mutation Gain and Concordance to Colonic Adenocarcinomas.

    PubMed

    Crumley, Suzanne M; Pepper, Kristi L; Phan, Alexandria T; Olsen, Randall J; Schwartz, Mary R; Portier, Bryce P

    2016-06-01

    -Colorectal carcinoma is the third most common cause of cancer death in males and females in the United States. Rectal adenocarcinoma can have distinct therapeutic and surgical management from colonic adenocarcinoma owing to its location and anatomic considerations. -To determine the oncologic driver mutations and better understand the molecular pathogenesis of rectal adenocarcinoma in relation to colon adenocarcinoma. -Next-generation sequencing was performed on 20 cases of primary rectal adenocarcinoma with a paired lymph node or solid organ metastasis by using an amplicon-based assay of more than 2800 Catalogue of Somatic Mutations in Cancer (COSMIC)-identified somatic mutations. -Next-generation sequencing data were obtained on both the primary tumor and metastasis from 16 patients. Most rectal adenocarcinoma cases demonstrated identical mutations in the primary tumor and metastasis (13 of 16, 81%). The mutations identified, listed in order of frequency, included TP53, KRAS, APC, FBXW7, GNAS, FGFR3, BRAF, NRAS, PIK3CA, and SMAD4. -The somatic mutations identified in our rectal adenocarcinoma cohort showed a strong correlation to those previously characterized in colonic adenocarcinoma. In addition, most rectal adenocarcinomas harbored identical somatic mutations in both the primary tumor and metastasis. These findings demonstrate evidence that rectal adenocarcinoma follows a similar molecular pathogenesis as colonic adenocarcinoma and that sampling either the primary or metastatic lesion is valid for initial evaluation of somatic mutations and selection of possible targeted therapy.

  5. Mutations of the KISS1 Gene in Disorders of Puberty

    PubMed Central

    Silveira, L. G.; Noel, S. D.; Silveira-Neto, A. P.; Abreu, A. P.; Brito, V. N.; Santos, M. G.; Bianco, S. D. C.; Kuohung, W.; Xu, S.; Gryngarten, M.; Escobar, M. E.; Arnhold, I. J. P.; Mendonca, B. B.; Kaiser, U. B.; Latronico, A. C.

    2010-01-01

    Context: Kisspeptin, encoded by the KISS1 gene, is a key stimulatory factor of GnRH secretion and puberty onset. Inactivating mutations of its receptor (KISS1R) cause isolated hypogonadotropic hypogonadism (IHH). A unique KISS1R-activating mutation was described in central precocious puberty (CPP). Objective: Our objective was to investigate KISS1 mutations in patients with idiopathic CPP and normosmic IHH. Patients: Eighty-three children with CPP (77 girls) and 61 patients with IHH (40 men) were studied. The control group consisted of 200 individuals with normal pubertal development. Methods: The promoter region and the three exons of KISS1 were amplified and sequenced. Cells expressing KISS1R were stimulated with synthetic human wild-type or mutant kisspeptin-54 (kp54), and inositol phosphate accumulation was measured. In a second set of experiments, kp54 was preincubated in human serum before stimulation of the cells. Results: Two novel KISS1 missense mutations, p.P74S and p.H90D, were identified in three unrelated children with idiopathic CPP. Both mutations were absent in 400 control alleles. The p.P74S mutation was identified in the heterozygous state in a boy who developed CPP at 1 yr of age. The p.H90D mutation was identified in the homozygous state in two unrelated girls with CPP. In vitro studies revealed that the capacity of the P74S and H90D mutants to stimulate IP production was similar to the wild type. After preincubation of wild-type and mutant kp54 in human serum, the capacity to stimulate signal transduction was significantly greater for P74S compared with the wild type, suggesting that the p.P74S variant is more stable. Only polymorphisms were found in the IHH group. Conclusion: Two KISS1 mutations were identified in unrelated patients with idiopathic CPP. The p.P74S variant was associated with higher kisspeptin resistance to degradation in comparison with the wild type, suggesting a role for this mutation in the precocious puberty phenotype

  6. Development and Testing of a Method for Validating Chemical Inactivation of Ebola Virus.

    PubMed

    Alfson, Kendra J; Griffiths, Anthony

    2018-03-13

    Complete inactivation of infectious Ebola virus (EBOV) is required before a sample may be removed from a Biosafety Level 4 laboratory. The United States Federal Select Agent Program regulations require that procedures used to demonstrate chemical inactivation must be validated in-house to confirm complete inactivation. The objective of this study was to develop a method for validating chemical inactivation of EBOV and then demonstrate the effectiveness of several commonly-used inactivation methods. Samples containing infectious EBOV ( Zaire ebolavirus ) in different matrices were treated, and the sample was diluted to limit the cytopathic effect of the inactivant. The presence of infectious virus was determined by assessing the cytopathic effect in Vero E6 cells. Crucially, this method did not result in a loss of infectivity in control samples, and we were able to detect less than five infectious units of EBOV ( Zaire ebolavirus ). We found that TRIzol LS reagent and RNA-Bee inactivated EBOV in serum; TRIzol LS reagent inactivated EBOV in clarified cell culture media; TRIzol reagent inactivated EBOV in tissue and infected Vero E6 cells; 10% neutral buffered formalin inactivated EBOV in tissue; and osmium tetroxide vapors inactivated EBOV on transmission electron microscopy grids. The methods described herein are easily performed and can be adapted to validate inactivation of viruses in various matrices and by various chemical methods.

  7. Sunlight inactivation of somatic coliphage in the presence of natural organic matter.

    PubMed

    Sun, Chen-Xi; Kitajima, Masaaki; Gin, Karina Yew-Hoong

    2016-01-15

    Long wavelengths of sunlight spectrum (UVA and visible light), as well as natural organic matter (NOM) are important environmental factors affecting survival of viruses in aquatic environment through direct and indirect inactivation. In order to understand the virus inactivation kinetics under such conditions, this study investigated the effects of Suwannee River natural organic matter (NOM) on the inactivation of a somatic coliphage, phiX174, by UVA and visible light. Experiments were carried out to examine the virucidal effects of UVA/visible light, assess the influence of SRNOM at different concentrations, and identify the effective ROS in virus inactivation. The results from this study showed that the presence of NOM could either enhance virus inactivation or reduce virus inactivation depending on the concentration, where the inactivation rate followed a parabolic relationship against NOM concentration. The results indicated that moderate levels of NOM (11 ppm) had the strongest antiviral activity, while very low or very high NOM concentrations prolonged virus survival. The results also showed that OH▪ was the primary ROS in causing phiX174 (ssDNA virus) inactivation, unlike previous findings where (1)O2 was the primary ROS causing MS2 (ssRNA virus) inactivation. The phiX174 inactivation by OH∙ could be described as k=3.7 ✕ 10(13)[OH∙]+1.404 (R(2)=0.8527). Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Tumor Mutational Burden Guides Therapy in a Treatment Refractory POLE-Mutant Uterine Carcinosarcoma.

    PubMed

    Bhangoo, Munveer S; Boasberg, Peter; Mehta, Pareen; Elvin, Julia A; Ali, Siraj M; Wu, Winnie; Klempner, Samuel J

    2018-05-01

    Gynecologic carcinosarcomas, previously known as malignant mixed Müllerian tumors, are uncommon malignancies that demonstrate an aggressive biology and lack a standard therapeutic approach. Molecular analyses have revealed recurrent alterations in chromatin remodeling genes, but clinical support for therapeutic significance is lacking. We prospectively identified a patient with refractory uterine carcinosarcoma whose tumor was subject to molecular profiling at diagnosis and again at radiographic progression. Initial molecular testing did not assess tumor mutational burden, DNA polymerase ɛ ( POLE ), or microsatellite status. After the failure of several lines of chemotherapy, comprehensive genomic profiling of a repeat biopsy identified two missense mutations of the exonuclease domain of POLE (P286R and T323A). Tumor mutational burden was elevated (169 mutations per DNA megabase), consistent with an ultramutator phenotype. As seen in previously reported POLE -endometrioid cases, our patient harbored alterations in PIK3CA , ARID1A , and PTEN and was microsatellite stable, with appreciable tumor-infiltrating lymphocytes. She achieved an ongoing durable response with pembrolizumab. This is the first report of programmed cell death protein 1 response in uterine carcinosarcoma. Uterine carcinosarcoma is an uncommon and aggressive histologic variant of endometrial carcinoma with a poor prognosis.Inactivating DNA polymerase ɛ ( POLE ) mutations have been associated with high tumor mutational burden (TMB) and response to immune checkpoint inhibition.To the authors' knowledge, this is the first report of response to immune checkpoint inhibitor therapy in a patient with uterine carcinosarcoma.This case further supports expanding genomic profiling to include assessment of tumor mutational burden across tumor types, given the potential for immune checkpoint inhibitor therapy in TMB-high tumors. © AlphaMed Press 2018.

  9. Hydrazine vapor inactivates Bacillus spores

    NASA Astrophysics Data System (ADS)

    Schubert, Wayne W.; Engler, Diane L.; Beaudet, Robert A.

    2016-05-01

    NASA policy restricts the total number of bacterial spores that can remain on a spacecraft traveling to any planetary body which might harbor life or have evidence of past life. Hydrazine, N2H4, is commonly used as a propellant on spacecraft. Hydrazine as a liquid is known to inactivate bacterial spores. We have now verified that hydrazine vapor also inactivates bacterial spores. After Bacillus atrophaeus ATCC 9372 spores deposited on stainless steel coupons were exposed to saturated hydrazine vapor in closed containers, the spores were recovered from the coupons, serially diluted, pour plated and the surviving bacterial colonies were counted. The exposure times required to reduce the spore population by a factor of ten, known as the D-value, were 4.70 ± 0.50 h at 25 °C and 2.85 ± 0.13 h at 35 °C. These inactivation rates are short enough to ensure that the bioburden of the surfaces and volumes would be negligible after prolonged exposure to hydrazine vapor. Thus, all the propellant tubing and internal tank surfaces exposed to hydrazine vapor do not contribute to the total spore count.

  10. Interallelic complementation of mutations in propionic acidemia by microinjection of mutant cDNAs into fibroblasts of affected patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loyer, M.; Leclerc, D.; Gravel, R.A.

    1994-09-01

    Propionic acidemia is a rare autosomal recessive disorder resulting from defects of the {alpha} or {beta} subunit of biotin-dependent propionyl-CoA carboxylase (PCC). Mutations are assigned to defects of the PCCA ({alpha} subunit) or PCCB ({beta} subunit) gene through complementation studies after somatic fusion of patient cell lines. About two-thirds of patients with {beta} subunit defects (complementation group pccBC) show interallelic complementation in cell fusion experiments (subgroups pccB and pccC), monitored by the PCC-dependent metabolisms of {sup 14}C-propionate. Most patient cell lines are heteroallelic for two different mutations, leaving ambiguous the identity of the mutation participating in interallelic complementation. To identifymore » the complementing mutations, we have expressed {beta}-subunit cDNAs containing individual mutations by microinjection of the cDNAs in recipient cells from patients with {beta} subunit defects. Correction of the PCC defect was monitored by autoradiography of {sup 14}C-propionate incorporation. In some experiments, cDNAs were co-injected with a plasmid expressing the E. coli lacZ gene as a positive control for successful injection. Two mutations from the pccB subgroup showed complementation when injected into pccC cells; dupKICK140-143 and Pro228Leu. Similarly, two mutations from the pccC subgroup complemented after injection into pccB cells; {Delta}Ile408 and Arg410Trp. No mutation complemented with mutation of the pccBC group which are classified as non-complementing in cell fusion experiments. The results show that the complementing pccB mutations are found in the N-terminal half of the {beta} subunit, while the complementing pccC mutations cluxter at a site in the C-terminal half. The latter site is a candidate for the propionyl-CoA binding site based on sequence identity with a region of transcarboxylase from Propionibacterium shermanii.« less

  11. Glycogen storage disease type 1a in Israel: biochemical, clinical, and mutational studies.

    PubMed

    Parvari, R; Lei, K J; Bashan, N; Hershkovitz, E; Korman, S H; Barash, V; Lerman-Sagie, T; Mandel, H; Chou, J Y; Moses, S W

    1997-10-31

    Glycogen storage disease type 1a (von Gierke disease, GSD 1a) is caused by the deficiency of microsomal glucose-6-phosphatase (G6Pase) activity which catalyzes the final common step of glycogenolysis and gluconeogenesis. The recent cloning of the G6Pase cDNA and characterization of the human G6Pase gene enabled the characterization of the mutations causing GSD 1a. This, in turn, allows the introduction of a noninvasive DNA-based diagnosis that provides reliable carrier testing and prenatal diagnosis. In this study, we report the biochemical and clinical characteristics as well as mutational analyses of 12 Israeli GSD 1a patients of different families, who represent most GSD 1a patients in Israel. The mutations, G6Pase activity, and glycogen content of 7 of these patients were reported previously. The biochemical data and clinical findings of all patients were similar and compatible with those described in other reports. All 9 Jewish patients, as well as one Muslim Arab patient, presented the R83C mutation. Two Muslim Arab patients had the V166G mutation which was not found in other patients' populations. The V166G mutation, which was introduced into the G6Pase cDNA by site-directed mutagenesis following transient expression in COS-1 cells, was shown to cause complete inactivation of the G6Pase. The characterization of all GSD 1a mutations in the Israeli population lends itself to carrier testing in these families as well as to prenatal diagnosis, which was carried out in 2 families. Since all Ashkenzai Jewish patients harbor the same mutation, our study suggests that DNA-based diagnosis may be used as an initial diagnostic step in Ashkenazi Jews suspected of having GSD 1a, thereby avoiding liver biopsy.

  12. Thermal and high pressure inactivation kinetics of blueberry peroxidase.

    PubMed

    Terefe, Netsanet Shiferaw; Delon, Antoine; Versteeg, Cornelis

    2017-10-01

    This study for the first time investigated the stability and inactivation kinetics of blueberry peroxidase in model systems (McIlvaine buffer, pH=3.6, the typical pH of blueberry juice) during thermal (40-80°C) and combined high pressure-thermal processing (0.1-690MPa, 30-90°C). At 70-80°C, the thermal inactivation kinetics was best described by a biphasic model with ∼61% labile and ∼39% stable fractions at temperature between 70 and 75°C. High pressure inhibited the inactivation of the enzyme with no inactivation at pressures as high as 690MPa and temperatures less than 50°C. The inactivation kinetics of the enzyme at 60-70°C, and pressures higher than 500MPa was best described by a first order biphasic model with ∼25% labile fraction and 75% stable fraction. The activation energy values at atmospheric pressure were 548.6kJ/mol and 324.5kJ/mol respectively for the stable and the labile fractions. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  13. Ribosome-inactivating proteins: potent poisons and molecular tools.

    PubMed

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-11-15

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.

  14. Thermal inactivation kinetics of β-galactosidase during bread baking.

    PubMed

    Zhang, Lu; Chen, Xiao Dong; Boom, Remko M; Schutyser, Maarten A I

    2017-06-15

    In this study, β-galactosidase was utilized as a model enzyme to investigate the mechanism of enzyme inactivation during bread baking. Thermal inactivation of β-galactosidase was investigated in a wheat flour/water system at varying temperature-moisture content combinations, and in bread during baking at 175 or 205°C. In the wheat flour/water system, the thermostability of β-galactosidase increased with decreased moisture content, and a kinetic model was accurately fitted to the corresponding inactivation data (R 2 =0.99). Interestingly, the residual enzyme activity in the bread crust (about 30%) was hundredfold higher than that in the crumb (about 0.3%) after baking, despite the higher temperature in the crust throughout baking. This result suggested that the reduced moisture content in the crust increased the thermostability of the enzyme. Subsequently, the kinetic model reasonably predicted the enzyme inactivation in the crumb using the same parameters derived from the wheat flour/water system. However, the model predicted a lower residual enzyme activity in the crust compared with the experimental result, which indicated that the structure of the crust may influence the enzyme inactivation mechanism during baking. The results reported can provide a quantitative understanding of the thermal inactivation kinetics of enzyme during baking, which is essential to better retain enzymatic activity in bakery products supplemented with heat-sensitive enzymes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Selective inactivation of glutaredoxin by sporidesmin and other epidithiopiperazinediones.

    PubMed

    Srinivasan, Usha; Bala, Aveenash; Jao, Shu-chuan; Starke, David W; Jordan, T William; Mieyal, John J

    2006-07-25

    Glutaredoxin (thioltransferase) is a thiol-disulfide oxidoreductase that displays efficient and specific catalysis of protein-SSG deglutathionylation and is thereby implicated in homeostatic regulation of the thiol-disulfide status of cellular proteins. Sporidesmin is an epidithiopiperazine-2,5-dione (ETP) fungal toxin that disrupts cellular functions likely via oxidative alteration of cysteine residues on key proteins. In the current study sporidesmin inactivated human glutaredoxin in a time- and concentration-dependent manner. Under comparable conditions other thiol-disulfide oxidoreductase enzymes, glutathione reductase, thioredoxin, and thioredoxin reductase, were unaffected by sporidesmin. Inactivation of glutaredoxin required the reduced (dithiol) form of the enzyme, the oxidized (intramolecular disulfide) form of sporidesmin, and molecular oxygen. The inactivated glutaredoxin could be reactivated by dithiothreitol only in the presence of urea, followed by removal of the denaturant, indicating that inactivation of the enzyme involves a conformationally inaccessible disulfide bond(s). Various cysteine-to-serine mutants of glutaredoxin were resistant to inactivation by sporidesmin, suggesting that the inactivation reaction specifically involves at least two of the five cysteine residues in human glutaredoxin. The relative ability of various epidithiopiperazine-2,5-diones to inactivate glutaredoxin indicated that at least one phenyl substituent was required in addition to the epidithiodioxopiperazine moiety for inhibitory activity. Mass spectrometry of the modified protein is consistent with formation of intermolecular disulfides, containing one adducted toxin per glutaredoxin but with elimination of two sulfur atoms from the detected product. We suggest that the initial reaction is between the toxin sulfurs and cysteine 22 in the glutaredoxin active site. This study implicates selective modification of sulfhydryls of target proteins in some of the cytotoxic

  16. Inactivation of particle-associated coliforms by chlorine and monochloramine.

    PubMed Central

    Berman, D; Rice, E W; Hoff, J C

    1988-01-01

    Sieves and nylon screens were used to separate primary sewage effluent solids into particle fractions of less than 7- or greater than 7-micron size. The efficiency of separation was determined by using a particle counter. Indigenous coliforms associated with the particle fractions were tested for their resistance to chlorine and monochloramine. Coliforms associated with the less than 7-microns fraction were inactivated more rapidly by 0.5 mg of chlorine per liter at 5 degrees C and pH 7 than coliforms associated with the greater than 7-microns fraction. Homogenization of the greater than 7-microns fraction not only resulted in an increase in the number of less than 7-microns particles, but also increased the rate of inactivation to a rate similar to that of the less than 7-microns fraction. With 1 mg of monochloramine per liter at 5 degrees C and pH 7, particle size had no appreciable effect on the rate of inactivation. At pH 8, however, the less than 7-micron fraction was inactivated more rapidly than the greater than 7-micron fraction. The time required for 99% inactivation of the particle fractions with monochloramine at pH 7 or 8 was 20- to 50-fold greater than the time required for the same amount of inactivation with chlorine at pH 7. The results indicate that coliforms associated with sewage effluent particles are inactivated more rapidly with 0.5 mg of chlorine per liter than with 1.0 mg of monochloramine per liter. However, greater than 7-micron particles can have a protective effect against the disinfecting action of chlorine. PMID:3355136

  17. Inactivation of bacteriophage MS2 with potassium ferrate(VI).

    PubMed

    Hu, Lanhua; Page, Martin A; Sigstam, Therese; Kohn, Tamar; Mariñas, Benito J; Strathmann, Timothy J

    2012-11-06

    Ferrate [Fe(VI); FeO(4)(2-)] is an emerging oxidizing agent capable of controlling chemical and microbial water contaminants. Here, inactivation of MS2 coliphage by Fe(VI) was examined. The inactivation kinetics observed in individual batch experiments was well described by a Chick-Watson model with first-order dependences on disinfectant and infective phage concentrations. The inactivation rate constant k(i) at a Fe(VI) dose of 1.23 mgFe/L (pH 7.0, 25 °C) was 2.27(±0.05) L/(mgFe × min), corresponding to 99.99% inactivation at a Ct of ~4 (mgFe × min)/L. Measured k(i) values were found to increase with increasing applied Fe(VI) dose (0.56-2.24 mgFe/L), increasing temperature (5-30 °C), and decreasing pH conditions (pH 6-11). The Fe(VI) dose effect suggested that an unidentified Fe byproduct also contributed to inactivation. Temperature dependence was characterized by an activation energy of 39(±6) kJ mol(-1), and k(i) increased >50-fold when pH decreased from 11 to 6. The pH effect was quantitatively described by parallel reactions with HFeO(4)(-) and FeO(4)(2-). Mass spectrometry and qRT-PCR analyses demonstrated that both capsid protein and genome damage increased with the extent of inactivation, suggesting that both may contribute to phage inactivation. Capsid protein damage, localized in the two regions containing oxidant-sensitive cysteine residues, and protein cleavage in one of the two regions may facilitate genome damage by increasing Fe(VI) access to the interior of the virion.

  18. Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

    PubMed

    Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

    2011-04-01

    Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

  19. Functional phosphodiesterase 11A mutations may modify the risk of familial and bilateral testicular germ cell tumors

    PubMed Central

    Horvath, Anelia; Korde, Larissa; Greene, Mark H.; Libe, Rosella; Osorio, Paulo; Faucz, Fabio Rueda; Raffin-Sanson, Marie Laure; Tsang, Kit Man; Drori-Herishanu, Limor; Patronas, Yianna; Remmers, Elaine F; Nikita, Maria-Elena; Moran, Jason; Greene, Joseph; Nesterova, Maria; Merino, Maria; Bertherat, Jerome; Stratakis, Constantine A.

    2009-01-01

    Inactivating germline mutations in phosphodiesterase 11A (PDE11A) have been implicated in adrenal tumor susceptibility. PDE11A is highly-expressed in endocrine steroidogenic tissues, especially the testis, and mice with inactivated Pde11a exhibit male infertility, a known testicular germ cell tumor (TGCT) risk factor. We sequenced the PDE11A gene-coding region in 95 patients with TGCT from 64 unrelated kindreds. We identified 8 non-synonymous substitutions in 20 patients from 15 families: four (R52T; F258Y; G291R; V820M) were newly-recognized, three (R804H; R867G; M878V) were functional variants previously implicated in adrenal tumor predisposition, and one (Y727C) was a known polymorphism. We compared the frequency of these variants in our patients to unrelated controls that had been screened and found negative for any endocrine diseases: only the two previously-reported variants, R804H and R867G, known to be frequent in general population, were detected in these controls. The frequency of all PDE11A-gene variants (combined) was significantly higher among patients with TGCT (P=0.0002), present in 19% of the families of our cohort. Most variants were detected in the general population, but functional studies showed that all these mutations reduced PDE activity, and that PDE11A protein expression was decreased (or absent) in TGCT samples from carriers. This is the first demonstration of a PDE gene’s involvement in TGCT, although the cAMP signaling pathway has been investigated extensively in other reproductive organs and their diseases. In conclusion, we report that PDE11A-inactivating sequence variants may modify the risk of familial and bilateral TGCT. PMID:19549888

  20. Physiology of the Inactivation of Vegetative Bacteria by Thermal Treatments: Mode of Action, Influence of Environmental Factors and Inactivation Kinetics

    PubMed Central

    Condón, Santiago; Mañas, Pilar

    2017-01-01

    Heat has been used extensively in the food industry as a preservation method, especially due to its ability to inactivate microorganisms present in foods. However, many aspects regarding the mechanisms of bacterial inactivation by heat and the factors affecting this process are still not fully understood. The purpose of this review is to offer a general overview of the most important aspects of the physiology of the inactivation or survival of microorganisms, particularly vegetative bacteria, submitted to heat treatments. This could help improve the design of current heat processes methods in order to apply milder and/or more effective treatments that could fulfill consumer requirements for fresh-like foods while maintaining the advantages of traditional heat treatments. PMID:29189748

  1. Modeling-independent elucidation of inactivation pathways in recombinant and native A-type Kv channels.

    PubMed

    Fineberg, Jeffrey D; Ritter, David M; Covarrubias, Manuel

    2012-11-01

    A-type voltage-gated K(+) (Kv) channels self-regulate their activity by inactivating directly from the open state (open-state inactivation [OSI]) or by inactivating before they open (closed-state inactivation [CSI]). To determine the inactivation pathways, it is often necessary to apply several pulse protocols, pore blockers, single-channel recording, and kinetic modeling. However, intrinsic hurdles may preclude the standardized application of these methods. Here, we implemented a simple method inspired by earlier studies of Na(+) channels to analyze macroscopic inactivation and conclusively deduce the pathways of inactivation of recombinant and native A-type Kv channels. We investigated two distinct A-type Kv channels expressed heterologously (Kv3.4 and Kv4.2 with accessory subunits) and their native counterparts in dorsal root ganglion and cerebellar granule neurons. This approach applies two conventional pulse protocols to examine inactivation induced by (a) a simple step (single-pulse inactivation) and (b) a conditioning step (double-pulse inactivation). Consistent with OSI, the rate of Kv3.4 inactivation (i.e., the negative first derivative of double-pulse inactivation) precisely superimposes on the profile of the Kv3.4 current evoked by a single pulse because the channels must open to inactivate. In contrast, the rate of Kv4.2 inactivation is asynchronous, already changing at earlier times relative to the profile of the Kv4.2 current evoked by a single pulse. Thus, Kv4.2 inactivation occurs uncoupled from channel opening, indicating CSI. Furthermore, the inactivation time constant versus voltage relation of Kv3.4 decreases monotonically with depolarization and levels off, whereas that of Kv4.2 exhibits a J-shape profile. We also manipulated the inactivation phenotype by changing the subunit composition and show how CSI and CSI combined with OSI might affect spiking properties in a full computational model of the hippocampal CA1 neuron. This work unambiguously

  2. Modeling-independent elucidation of inactivation pathways in recombinant and native A-type Kv channels

    PubMed Central

    Fineberg, Jeffrey D.; Ritter, David M.

    2012-01-01

    A-type voltage-gated K+ (Kv) channels self-regulate their activity by inactivating directly from the open state (open-state inactivation [OSI]) or by inactivating before they open (closed-state inactivation [CSI]). To determine the inactivation pathways, it is often necessary to apply several pulse protocols, pore blockers, single-channel recording, and kinetic modeling. However, intrinsic hurdles may preclude the standardized application of these methods. Here, we implemented a simple method inspired by earlier studies of Na+ channels to analyze macroscopic inactivation and conclusively deduce the pathways of inactivation of recombinant and native A-type Kv channels. We investigated two distinct A-type Kv channels expressed heterologously (Kv3.4 and Kv4.2 with accessory subunits) and their native counterparts in dorsal root ganglion and cerebellar granule neurons. This approach applies two conventional pulse protocols to examine inactivation induced by (a) a simple step (single-pulse inactivation) and (b) a conditioning step (double-pulse inactivation). Consistent with OSI, the rate of Kv3.4 inactivation (i.e., the negative first derivative of double-pulse inactivation) precisely superimposes on the profile of the Kv3.4 current evoked by a single pulse because the channels must open to inactivate. In contrast, the rate of Kv4.2 inactivation is asynchronous, already changing at earlier times relative to the profile of the Kv4.2 current evoked by a single pulse. Thus, Kv4.2 inactivation occurs uncoupled from channel opening, indicating CSI. Furthermore, the inactivation time constant versus voltage relation of Kv3.4 decreases monotonically with depolarization and levels off, whereas that of Kv4.2 exhibits a J-shape profile. We also manipulated the inactivation phenotype by changing the subunit composition and show how CSI and CSI combined with OSI might affect spiking properties in a full computational model of the hippocampal CA1 neuron. This work unambiguously

  3. Thermoradiation inactivation of naturally occurring organisms in soil

    NASA Technical Reports Server (NTRS)

    Reynolds, M. C.; Lindell, K. F.; David, T. J.

    1973-01-01

    Samples of soil collected from Kennedy Space Center near spacecraft assembly facilities were found to contain microorganisms very resistant to conventional sterilization techniques. The inactivation behavior of the naturally occurring spores in soil was investigated using dry heat and ionizing radiation, first separately, then in combination. Dry heat inactivation rates of spores were determined for 105 and 125 C. Radiation inactivation rates were determined for dose rates of 660 and 76 krad/hr at 25 C. Simultaneous combinations of heat and radiation were then investigated at 105, 110, 115, 120, and 125 C. Combined treatment was found to be highly synergistic requiring greatly reduced radiation doses to accomplish sterilization.

  4. Kinetics of inactivation of indicator pathogens during thermophilic anaerobic digestion.

    PubMed

    Popat, Sudeep C; Yates, Marylynn V; Deshusses, Marc A

    2010-12-01

    Thermophilic anaerobic sludge digestion is a promising process to divert waste to beneficial use, but an important question is the required temperature and holding time to achieve a given degree of pathogen inactivation. In this study, the kinetics of inactivation of Ascaris suum and vaccine strain poliovirus type 1 (PVS-1), selected as indicators for helminth ova and enteric viruses respectively, were determined during anaerobic digestion at temperatures ranging from 51 to 56 °C. Inactivation of both indicator organisms was fast with greater than two log reductions achieved within 2 h for A. suum and three log reductions for PVS-1, suggesting that the current U.S. regulations are largely conservative. The first-order inactivation rate constants k followed Arrhenius relationship with activation energies of 105 and 39 KJ mol(-1) for A. suum and PVS-1, respectively indicating that A. suum was more sensitive to temperature. Although inactivation was fast, the presence of compounds in the sludge that are known to be protective of pathogen inactivation was observed, suggesting that composition-dependent time-temperature relationships are necessary. Copyright © 2010 Elsevier Ltd. All rights reserved.

  5. Null mutation in the rhodopsin kinase gene slows recovery kinetics of rod and cone phototransduction in man

    PubMed Central

    Cideciyan, Artur V.; Zhao, Xinyu; Nielsen, Lori; Khani, Shahrokh C.; Jacobson, Samuel G.; Palczewski, Krzysztof

    1998-01-01

    Rhodopsin kinase (RK), a specialized G-protein-coupled receptor kinase expressed in retina, is involved in quenching of light-induced signal transduction in photoreceptors. The role of RK in recovery after photoactivation has been explored in vitro and in vivo experimentally but has not been specifically defined in humans. We investigated the effects on human vision of a mutation in the RK gene causing Oguchi disease, a recessively inherited retinopathy. In vitro experiments demonstrated that the mutation, a deletion of exon 5, abolishes the enzymatic activity of RK and is likely a null. Both a homozygote and heterozygote with this RK mutation had recovery phase abnormalities of rod-isolated photoresponses by electroretinography (ERG); photoactivation was normal. Kinetics of rod bleaching adaptation by psychophysics were dramatically slowed in the homozygote but normal final thresholds were attained. Light adaptation was normal at low backgrounds but became abnormal at higher backgrounds. A slight slowing of cone deactivation kinetics in the homozygote was detected by ERG. Cone bleaching adaptation and background adaptation were normal. In this human in vivo condition without a functional RK and probable lack of phosphorylation and arrestin binding to activated rhodopsin, reduction of photolyzed chromophore and regeneration processes with 11-cis-retinal probably constitute the sole pathway for recovery of rod sensitivity. The role of RK in rods would thus be to accelerate inactivation of activated rhodopsin molecules that in concert with regeneration leads to the normal rate of recovery of sensitivity. Cones may rely mainly on regeneration for the inactivation of photolyzed visual pigment, but RK also contributes to cone recovery. PMID:9419375

  6. Growth and inactivation of Salmonella at low refrigerated storage temperatures and thermal inactivation on raw chicken meat and laboratory media: mixed effect meta-analysis.

    PubMed

    Smadi, Hanan; Sargeant, Jan M; Shannon, Harry S; Raina, Parminder

    2012-12-01

    Growth and inactivation regression equations were developed to describe the effects of temperature on Salmonella concentration on chicken meat for refrigerated temperatures (⩽10°C) and for thermal treatment temperatures (55-70°C). The main objectives were: (i) to compare Salmonella growth/inactivation in chicken meat versus laboratory media; (ii) to create regression equations to estimate Salmonella growth in chicken meat that can be used in quantitative risk assessment (QRA) modeling; and (iii) to create regression equations to estimate D-values needed to inactivate Salmonella in chicken meat. A systematic approach was used to identify the articles, critically appraise them, and pool outcomes across studies. Growth represented in density (Log10CFU/g) and D-values (min) as a function of temperature were modeled using hierarchical mixed effects regression models. The current meta-analysis analysis found a significant difference (P⩽0.05) between the two matrices - chicken meat and laboratory media - for both growth at refrigerated temperatures and inactivation by thermal treatment. Growth and inactivation were significantly influenced by temperature after controlling for other variables; however, no consistent pattern in growth was found. Validation of growth and inactivation equations against data not used in their development is needed. Copyright © 2012 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  7. Actionable mutations in canine hemangiosarcoma.

    PubMed

    Wang, Guannan; Wu, Ming; Maloneyhuss, Martha A; Wojcik, John; Durham, Amy C; Mason, Nicola J; Roth, David B

    2017-01-01

    Angiosarcomas (AS) are rare in humans, but they are a deadly subtype of soft tissue sarcoma. Discovery sequencing in AS, especially the visceral form, is hampered by the rarity of cases. Most diagnostic material exists as archival formalin fixed, paraffin embedded tissue which serves as a poor source of high quality DNA for genome-wide sequencing. We approached this problem through comparative genomics. We hypothesized that exome sequencing a histologically similar tumor, hemangiosarcoma (HSA), that occurs in approximately 50,000 dogs per year, may lead to the identification of potential oncogenic drivers and druggable targets that could also occur in angiosarcoma. Splenic hemangiosarcomas are common in dogs, which allowed us to collect a cohort of archived matched tumor and normal tissue samples suitable for whole exome sequencing. Mapping of the reads to the latest canine reference genome (Canfam3) demonstrated that >99% of the targeted exomal regions were covered, with >80% at 20X coverage and >90% at 10X coverage. Sequence analysis of 20 samples identified somatic mutations in PIK3CA, TP53, PTEN, and PLCG1, all of which correspond to well-known tumor drivers in human cancer, in more than half of the cases. In one case, we identified a mutation in PLCG1 identical to a mutation observed previously in this gene in human visceral AS. Activating PIK3CA mutations present novel therapeutic targets, and clinical trials of targeted inhibitors are underway in human cancers. Our results lay a foundation for similar clinical trials in canine HSA, enabling a precision medicine approach to this disease.

  8. A risk of essential thrombocythemia in carriers of constitutional CHEK2 gene mutations.

    PubMed

    Janiszewska, Hanna; Bak, Aneta; Pilarska, Maria; Heise, Marta; Junkiert-Czarnecka, Anna; Kuliszkiewicz-Janus, Małgorzata; Całbecka, Małgorzata; Jaźwiec, Bozena; Wołowiec, Dariusz; Kuliczkowski, Kazimierz; Haus, Olga

    2012-03-01

    Germline mutations of the CHEK2 gene have been reported in some myeloid and lymphoid malignancies, but their impact on development of essential thrombocythemia has not been studied. In 16 out of 106 (15.1%) consecutive patients, newly diagnosed with essential thrombocythemia, we found one of four analyzed CHEK2 mutations: I157T, 1100delC, IVS2+1G>A or del5395. They were associated with the increased risk of disease (OR=3.8; P=0.002). The median age at ET diagnosis among CHEK2+/JAK2V617F+ patients was seven years lower than that among CHEK2-/JAK2V617F+ (52 vs. 59 years; P=0.04), whereas there was no difference in the medians of hematologic parameters between these groups. The results obtained suggest that CHEK2 mutations could potentially contribute to the susceptibility to essential thrombocythemia. The germline inactivation of CHEK2, as it seems, has no direct impact on the development of disease, but it could cause disruption of cell cycle checkpoints and initiate or support the cancerogenic process of essential thrombocythemia at a younger age.

  9. A risk of essential thrombocythemia in carriers of constitutional CHEK2 gene mutations

    PubMed Central

    Janiszewska, Hanna; Bąk, Aneta; Pilarska, Maria; Heise, Marta; Junkiert-Czarnecka, Anna; Kuliszkiewicz-Janus, Małgorzata; Całbecka, Małgorzata; JaŸwiec, Bożena; Wołowiec, Dariusz; Kuliczkowski, Kazimierz; Haus, Olga

    2012-01-01

    Germline mutations of the CHEK2 gene have been reported in some myeloid and lymphoid malignancies, but their impact on development of essential thrombocythemia has not been studied. In 16 out of 106 (15.1%) consecutive patients, newly diagnosed with essential thrombocythemia, we found one of four analyzed CHEK2 mutations: I157T, 1100delC, IVS2+1G>A or del5395. They were associated with the increased risk of disease (OR=3.8; P=0.002). The median age at ET diagnosis among CHEK2+/JAK2V617F+ patients was seven years lower than that among CHEK2−/JAK2V617F+ (52 vs. 59 years; P=0.04), whereas there was no difference in the medians of hematologic parameters between these groups. The results obtained suggest that CHEK2 mutations could potentially contribute to the susceptibility to essential thrombocythemia. The germline inactivation of CHEK2, as it seems, has no direct impact on the development of disease, but it could cause disruption of cell cycle checkpoints and initiate or support the cancerogenic process of essential thrombocythemia at a younger age. PMID:22058216

  10. PMS2 gene mutation results in DNA mismatch repair system failure in a case of adult granulosa cell tumor.

    PubMed

    Wang, Wen-Chung; Lee, Ya-Ting; Lai, Yen-Chein

    2017-03-27

    Granulosa cell tumors are rare ovarian malignancies. Their characteristics include unpredictable indolent growth with malignant potential and late recurrence. Approximately 95% are of adult type. Recent molecular studies have characterized the FOXL2 402C > G mutation in adult granulosa cell tumor. Our previous case report showed that unique FOXL2 402C > G mutation and defective DNA mismatch repair system are associated with the development of adult granulosa cell tumor. In this study, the DNA sequences of four genes, MSH2, MLH1, MSH6, and PMS2, in the DNA mismatch repair system were determined via direct sequencing to elucidate the exact mechanism for the development of this granulosa cell tumor. The results showed that two missense germline mutations, T485K and N775L, inactivate the PMS2 gene. The results of this case study indicated that although FOXL2 402C > G mutation determines the development of granulosa cell tumor, PMS2 mutation may be the initial driver of carcinogenesis. Immunohistochemistry-based tumor testing for mismatch repair gene expression may be necessary for granulosa cell tumors to determine their malignant potential or if they are part of Lynch syndrome.

  11. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  12. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    PubMed

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  13. Thermal inactivation of enzymes and pathogens in biosamples for MS analysis.

    PubMed

    Ahnoff, Martin; Cazares, Lisa H; Sköld, Karl

    2015-01-01

    Protein denaturation is the common basis for enzyme inactivation and inactivation of pathogens, necessary for preservation and safe handling of biosamples for downstream analysis. While heat-stabilization technology has been used in proteomic and peptidomic research since its introduction in 2009, the advantages of using the technique for simultaneous pathogen inactivation have only recently been addressed. The time required for enzyme inactivation by heat (≈1 min) is short compared with chemical treatments, and inactivation is irreversible in contrast to freezing. Heat stabilization thus facilitates mass spectrometric studies of biomolecules with a fast conversion rate, and expands the chemical space of potential biomarkers to include more short-lived entities, such as phosphorylated proteins, in tissue samples as well as whole-blood (dried blood sample) samples.

  14. Functional analysis of Discoidin domain receptor 2 mutation and expression in squamous cell lung cancer.

    PubMed

    Kobayashi-Watanabe, Naomi; Sato, Akemi; Watanabe, Tatsuro; Abe, Tomonori; Nakashima, Chiho; Sueoka, Eisaburo; Kimura, Shinya; Sueoka-Aragane, Naoko

    2017-08-01

    Discoidin domain receptor (DDR) 2 mutations have recently been reported to be candidate targets of molecular therapy in lung squamous cell carcinoma (SQCC). However, the status of DDR2 expression and mutations, as well as their precise roles in lung SQCC, have not been clarified. We here report DDR2 mutation and expression status in clinical samples and its role of lung SQCC. We investigated DDR2 expression and mutation status in 44 human clinical samples and 7 cell lines. Biological functions of DDR2 were assessed by in vitro cell invasion assay and animal model experiments. Endogenous DDR2 protein expression levels were high in one cell line, PC-1, and immunohistochemistry of lung cancer tissue array showed high levels of DDR2 protein in 29% of lung SQCC patients. A mutation (T681I) identified in lung SQCC and the cell line EBC-1 was detected among 44 primary lung SQCC samples and 7 lung SQCC cell lines. Although Forced expression of DDR2 and its mutant (T681I) led to induce SQCC cell invasion in vitro, only wild type DDR2 enhanced lung metastasis in an animal model. We also found that ectopic expression of DDR2 induced MMP-1 mRNA expression accompanied by phosphorylation of c-Jun after treatment with its ligand, collagen type I, but DDR2 with the T681I mutation did not, suggesting that T681I mutation is an inactivating mutation. Overexpression of DDR2 might contribute to tumor progression in lung SQCC. The overexpression of DDR2 could be potential molecular target of lung SQCC. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Kinetic analysis of Legionella inactivation using ozone in wastewater.

    PubMed

    Li, Jun; Li, Kunquan; Zhou, Yan; Li, Xuebin; Tao, Tao

    2017-02-01

    Legionella inactivation using ozone was studied in wastewater using kinetic analysis and modeling. The experimental results indicate that the relationship between the ozone concentration, germ concentration, and chemical oxygen demand (COD) can be used to predict variations in germ and COD concentrations. The ozone reaction with COD and inactivation of Legionella occurred simultaneously, but the reaction with COD likely occurred at a higher rate than the inactivation, as COD is more easily oxidized by ozone than Legionella. Higher initial COD concentrations resulted in a lower inactivation rate and higher lnN/N 0 . Higher temperature led to a higher inactivation efficiency. The relationship of the initial O 3 concentration and Legionella inactivation rate was not linear, and thus, the Ct value required for a 99.99% reduction was not constant. The initial O 3 concentration was more important than the contact time, and a reduction of the initial O 3 concentration could not be compensated by increasing the contact time. The Ct values were compared over a narrow range of initial concentrations; the Ct values could only be contrasted when the initial O 3 concentrations were very similar. A higher initial O 3 concentration led to a higher inflection point value for the lnN/N 0 vs C 0 t curve. Energy consumption using a plasma corona was lower than when using boron-doped diamond electrodes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. [Dynamic mutations--a newly detected category of mutations which is the basis for certain neurologic diseases].

    PubMed

    Mardesić, D

    1995-01-01

    This review offers some basic information on the discovery of a new type of mutations being the cause of some significant neurologic diseases: myotonic dystrophy, Huntington's disease, spinocerebellar ataxia type 1, spinobulbar pallido-louysian muscular atrophy, fragile X syndrome and some other, up to a total of ten entities. The basis of the so-called dynamic mutations is an abnormal multiplication of a trinucleotide producing sequences of several hundreds or even thousands of identical copies in the respective gene. The result is designated as expanded or amplified trinucleotide (or triplet) repeat. These sequences are not stable, but increase (or exceptionally decrease) in length during cell multiplication in successive generations. They segregate within families with the affected members, demonstrating a significant correlation between the length of the repeat sequence, the severity of the pathologic phenotype and an inverse correlation with the age at the clinical manifestation of the disease. Thus, at least, a formal explanation for the anticipation phenomenon of the age at which the disease is manifested within a family is offered. The importance of the discovery of dynamic mutations lies in the possibility for more precise and reliable genetic counselling. The discovery has opened a lot of new questions giving a new impetus for intensive research.

  17. G protein-coupled receptor mutations and human genetic disease.

    PubMed

    Thompson, Miles D; Hendy, Geoffrey N; Percy, Maire E; Bichet, Daniel G; Cole, David E C

    2014-01-01

    Genetic variations in G protein-coupled receptor genes (GPCRs) disrupt GPCR function in a wide variety of human genetic diseases. In vitro strategies and animal models have been used to identify the molecular pathologies underlying naturally occurring GPCR mutations. Inactive, overactive, or constitutively active receptors have been identified that result in pathology. These receptor variants may alter ligand binding, G protein coupling, receptor desensitization and receptor recycling. Receptor systems discussed include rhodopsin, thyrotropin, parathyroid hormone, melanocortin, follicle-stimulating hormone (FSH), luteinizing hormone, gonadotropin-releasing hormone (GNRHR), adrenocorticotropic hormone, vasopressin, endothelin-β, purinergic, and the G protein associated with asthma (GPRA or neuropeptide S receptor 1 (NPSR1)). The role of activating and inactivating calcium-sensing receptor (CaSR) mutations is discussed in detail with respect to familial hypocalciuric hypercalcemia (FHH) and autosomal dominant hypocalemia (ADH). The CASR mutations have been associated with epilepsy. Diseases caused by the genetic disruption of GPCR functions are discussed in the context of their potential to be selectively targeted by drugs that rescue altered receptors. Examples of drugs developed as a result of targeting GPCRs mutated in disease include: calcimimetics and calcilytics, therapeutics targeting melanocortin receptors in obesity, interventions that alter GNRHR loss from the cell surface in idiopathic hypogonadotropic hypogonadism and novel drugs that might rescue the P2RY12 receptor congenital bleeding phenotype. De-orphanization projects have identified novel disease-associated receptors, such as NPSR1 and GPR35. The identification of variants in these receptors provides genetic reagents useful in drug screens. Discussion of the variety of GPCRs that are disrupted in monogenic Mendelian disorders provides the basis for examining the significance of common

  18. Genome-Wide Mutation Avalanches Induced in Diploid Yeast Cells by a Base Analog or an APOBEC Deaminase

    PubMed Central

    Lada, Artem G.; Stepchenkova, Elena I.; Waisertreiger, Irina S. R.; Noskov, Vladimir N.; Dhar, Alok; Eudy, James D.; Boissy, Robert J.; Hirano, Masayuki; Rogozin, Igor B.; Pavlov, Youri I.

    2013-01-01

    Genetic information should be accurately transmitted from cell to cell; conversely, the adaptation in evolution and disease is fueled by mutations. In the case of cancer development, multiple genetic changes happen in somatic diploid cells. Most classic studies of the molecular mechanisms of mutagenesis have been performed in haploids. We demonstrate that the parameters of the mutation process are different in diploid cell populations. The genomes of drug-resistant mutants induced in yeast diploids by base analog 6-hydroxylaminopurine (HAP) or AID/APOBEC cytosine deaminase PmCDA1 from lamprey carried a stunning load of thousands of unselected mutations. Haploid mutants contained almost an order of magnitude fewer mutations. To explain this, we propose that the distribution of induced mutation rates in the cell population is uneven. The mutants in diploids with coincidental mutations in the two copies of the reporter gene arise from a fraction of cells that are transiently hypersensitive to the mutagenic action of a given mutagen. The progeny of such cells were never recovered in haploids due to the lethality caused by the inactivation of single-copy essential genes in cells with too many induced mutations. In diploid cells, the progeny of hypersensitive cells survived, but their genomes were saturated by heterozygous mutations. The reason for the hypermutability of cells could be transient faults of the mutation prevention pathways, like sanitization of nucleotide pools for HAP or an elevated expression of the PmCDA1 gene or the temporary inability of the destruction of the deaminase. The hypothesis on spikes of mutability may explain the sudden acquisition of multiple mutational changes during evolution and carcinogenesis. PMID:24039593

  19. Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

    PubMed

    Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

    2010-01-01

    Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

  20. An Amish founder mutation disrupts a PI(3)P-WHAMM-Arp2/3 complex–driven autophagosomal remodeling pathway

    PubMed Central

    Mathiowetz, Alyssa J.; Baple, Emma; Russo, Ashley J.; Coulter, Alyssa M.; Carrano, Eric; Brown, Judith D.; Jinks, Robert N.; Crosby, Andrew H.; Campellone, Kenneth G.

    2017-01-01

    Actin nucleation factors function to organize, shape, and move membrane-bound organelles, yet they remain poorly defined in relation to disease. Galloway-Mowat syndrome (GMS) is an inherited disorder characterized by microcephaly and nephrosis resulting from mutations in the WDR73 gene. This core clinical phenotype appears frequently in the Amish, where virtually all affected individuals harbor homozygous founder mutations in WDR73 as well as the closely linked WHAMM gene, which encodes a nucleation factor. Here we show that patient cells with both mutations exhibit cytoskeletal irregularities and severe defects in autophagy. Reintroduction of wild-type WHAMM restored autophagosomal biogenesis to patient cells, while inactivation of WHAMM in healthy cell lines inhibited lipidation of the autophagosomal protein LC3 and clearance of ubiquitinated protein aggregates. Normal WHAMM function involved binding to the phospholipid PI(3)P and promoting actin nucleation at nascent autophagosomes. These results reveal a cytoskeletal pathway controlling autophagosomal remodeling and illustrate several molecular processes that are perturbed in Amish GMS patients. PMID:28720660

  1. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Qing-lin; Xu, Jia; Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai 200233

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related genemore » with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.« less

  2. Rapid Bedside Inactivation of Ebola Virus for Safe Nucleic Acid Tests.

    PubMed

    Rosenstierne, Maiken Worsøe; Karlberg, Helen; Bragstad, Karoline; Lindegren, Gunnel; Stoltz, Malin Lundahl; Salata, Cristiano; Kran, Anne-Marte Bakken; Dudman, Susanne Gjeruldsen; Mirazimi, Ali; Fomsgaard, Anders

    2016-10-01

    Rapid bedside inactivation of Ebola virus would be a solution for the safety of medical and technical staff, risk containment, sample transport, and high-throughput or rapid diagnostic testing during an outbreak. We show that the commercially available Magna Pure lysis/binding buffer used for nucleic acid extraction inactivates Ebola virus. A rapid bedside inactivation method for nucleic acid tests is obtained by simply adding Magna Pure lysis/binding buffer directly into vacuum blood collection EDTA tubes using a thin needle and syringe prior to sampling. The ready-to-use inactivation vacuum tubes are stable for more than 4 months, and Ebola virus RNA is preserved in the Magna Pure lysis/binding buffer for at least 5 weeks independent of the storage temperature. We also show that Ebola virus RNA can be manually extracted from Magna Pure lysis/binding buffer-inactivated samples using the QIAamp viral RNA minikit. We present an easy and convenient method for bedside inactivation using available blood collection vacuum tubes and reagents. We propose to use this simple method for fast, safe, and easy bedside inactivation of Ebola virus for safe transport and routine nucleic acid detection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Maternal-Effect Lethal Mutations on Linkage Group II of Caenorhabditis Elegans

    PubMed Central

    Kemphues, K. J.; Kusch, M.; Wolf, N.

    1988-01-01

    We have analyzed a set of linkage group (LG) II maternal-effect lethal mutations in Caenorhabditis elegans isolated by a new screening procedure. Screens of 12,455 F(1) progeny from mutagenized adults resulted in the recovery of 54 maternal-effect lethal mutations identifying 29 genes. Of the 54 mutations, 39 are strict maternal-effect mutations defining 17 genes. These 17 genes fall into two classes distinguished by frequency of mutation to strict maternal-effect lethality. The smaller class, comprised of four genes, mutated to strict maternal-effect lethality at a frequency close to 5 X 10(-4), a rate typical of essential genes in C. elegans. Two of these genes are expressed during oogenesis and required exclusively for embryogenesis (pure maternal genes), one appears to be required specifically for meiosis, and the fourth has a more complex pattern of expression. The other 13 genes were represented by only one or two strict maternal alleles each. Two of these are identical genes previously identified by nonmaternal embryonic lethal mutations. We interpret our results to mean that although many C. elegans genes can mutate to strict maternal-effect lethality, most genes mutate to that phenotype rarely. Pure maternal genes, however, are among a smaller class of genes that mutate to maternal-effect lethality at typical rates. If our interpretation is correct, we are near saturation for pure maternal genes in the region of LG II balanced by mnC1. We conclude that the number of pure maternal genes in C. elegans is small, being probably not much higher than 12. PMID:3224814

  4. DNA Polymerase λ Inactivation by Oxidized Abasic Sites&

    PubMed Central

    Stevens, Adam J.; Guan, Lirui; Bebenek, Katarzyna; Kunkel, Thomas A.; Greenberg, Marc M.

    2013-01-01

    Base excision repair plays a vital role in maintaining genomic integrity in mammalian cells. DNA polymerase λ is believed to play a backup role to DNA polymerase β in base excision repair. Two oxidized abasic lesions that are produced by a variety of DNA damaging agents, including several antitumor antibiotics, the C4′-oxidized abasic site following Ape1 incision (pC4-AP) and 5′-(2-phosphoryl-1,4-dioxobutane) (DOB), irreversibly inactivate Pol β and Pol λ. The interactions of DOB and pC4-AP with Pol λ are examined in detail using DNA substrates containing these lesions at defined sites. Single turnover kinetic experiments show that Pol λ excises DOB almost 13-times more slowly than a 5′-phosphorylated 2-deoxyribose (dRP). pC4-AP is excised approximately twice as fast as DOB. The absolute rate constants are considerably slower than those reported for Pol β at the respective reactions, suggesting that Pol λ may be an inefficient backup in BER. DOB inactivates Pol λ approximately 3-fold less efficiently than it does Pol β and the difference is attributable to a higher KI (33 ± 7 nM). Inactivation of Pol λ’s lyase activity by DOB also prevents the enzyme from carrying out polymerization following preincubation of the protein and DNA. Mass spectral analysis of GluC digested Pol λ inactivated by DOB shows that Lys324 is modified. There is inferential support that Lys312 may also be modified. Both residues are within the Pol λ lyase active site. Protein modification involves reaction with released but-2-ene-1,4-dial. When acting on pC4-AP, Pol λ achieves approximately 4 turnovers on average before being inactivated. Lyase inactivation by pC4-AP is also accompanied by loss of polymerase activity and mass spectrometry indicates that Lys312 and Lys324 are modified by the lesion. The ability of DOB and pC4-AP to inactivate Pol λ provides additional evidence that these lesions are significant sources of the cytotoxicity of DNA damaging agents that

  5. A History of the Discovery of Random X Chromosome Inactivation in the Human Female and its Significance

    PubMed Central

    Balderman, Sophia; Lichtman, Marshall A.

    2011-01-01

    Genetic determinants of sex in placental mammals developed by the evolution of primordial autosomes into the male and female sex chromosomes. The Y chromosome determines maleness by the action of the gene SRY, which encodes a protein that initiates a sequence of events prompting the embryonic gonads to develop into testes. The X chromosome in the absence of a Y chromosome results in a female by permitting the conversion of the embryonic gonads into ovaries. We trace the historical progress that resulted in the discovery that one X chromosome in the female is randomly inactivated in early embryogenesis, accomplishing approximate equivalency of X chromosome gene dosage in both sexes. This event results in half of the somatic cells in a tissue containing proteins encoded by the genes of the maternal X chromosome and half having proteins encoded by the genes of the paternal X chromosome, on average, accounting for the phenotype of a female heterozygote with an X chromosome mutation. The hypothesis of X chromosome inactivation as a random event early in embryogenesis was first described as a result of studies of variegated coat color in female mice. Similar results were found in women using the X chromosome-linked gene, glucose-6-phosphate dehydrogenase, studied in red cells. The random inactivation of the X chromosome-bearing genes for isoenzyme types A and B of glucose-6-phosphate dehydrogenase was used to establish the clonal origin of neoplasms in informative women with leiomyomas. Behind these discoveries are the stories of the men and women scientists whose research enlightened these aspects of X chromosome function and their implication for medicine. PMID:23908816

  6. Recurrent SETBP1 mutations in atypical chronic myeloid leukemia

    PubMed Central

    Piazza, Rocco; Valletta, Simona; Winkelmann, Nils; Redaelli, Sara; Spinelli, Roberta; Pirola, Alessandra; Antolini, Laura; Mologni, Luca; Donadoni, Carla; Papaemmanuil, Elli; Schnittger, Susanne; Kim, Dong-Wook; Boultwood, Jacqueline; Rossi, Fabio; Gaipa, Giuseppe; De Martini, Greta P; di Celle, Paola Francia; Jang, Hyun Gyung; Fantin, Valeria; Bignell, Graham R; Magistroni, Vera; Haferlach, Torsten; Pogliani, Enrico Maria; Campbell, Peter J; Chase, Andrew J; Tapper, William J; Cross, Nicholas C P; Gambacorti-Passerini, Carlo

    2013-01-01

    Atypical chronic myeloid leukemia (aCML) shares clinical and laboratory features with CML, but it lacks the BCR-ABL1 fusion. We performed exome sequencing of eight aCMLs and identified somatic alterations of SETBP1 (encoding a p.Gly870Ser alteration) in two cases. Targeted resequencing of 70 aCMLs, 574 diverse hematological malignancies and 344 cancer cell lines identified SETBP1 mutations in 24 cases, including 17 of 70 aCMLs (24.3%; 95% confidence interval (CI) = 16–35%). Most mutations (92%) were located between codons 858 and 871 and were identical to changes seen in individuals with Schinzel-Giedion syndrome. Individuals with mutations had higher white blood cell counts (P = 0.008) and worse prognosis (P = 0.01). The p.Gly870Ser alteration abrogated a site for ubiquitination, and cells exogenously expressing this mutant exhibited higher amounts of SETBP1 and SET protein, lower PP2A activity and higher proliferation rates relative to those expressing the wild-type protein. In summary, mutated SETBP1 represents a newly discovered oncogene present in aCML and closely related diseases. PMID:23222956

  7. Founder Fukutin mutation causes Walker-Warburg syndrome in four Ashkenazi Jewish families†

    PubMed Central

    Chang, Wendy; Winder, Thomas L.; LeDuc, Charles A.; Simpson, Lynn L.; Millar, William S.; Dungan, Jeffrey; Ginsberg, Norman; Plaga, Stacey; Moore, Steven A.; Chung, Wendy K.

    2009-01-01

    Objective Walker-Warburg syndrome (WWS) is a genetically heterogeneous congenital muscular dystrophy caused by abnormal glycosylation of α-dystroglycan (α-DG) that is associated with brain malformations and eye anomalies. The Fukutin (FKTN) gene, which causes autosomal recessively inherited WWS is most often associated with Fukuyama congenital muscular dystrophy in Japan. We describe the clinical features of four nonconsanguinous Ashkenazi Jewish families with WWS and identify the underlying genetic basis for WWS. Method We screened for mutations in POMGnT1, POMT1, POMT2, and FKTN, genes causing WWS, by dideoxy sequence analysis. Results We identified an identical homozygous c.1167insA mutation in the FKTN gene on a common haplotype in all four families and identified 2/299 (0.7%) carriers for the c.1167insA mutation among normal American Ashkenazi Jewish adults. Conclusion These data suggest that the c.1167insA FKTN mutation described by us is a founder mutation that can be used to target diagnostic testing and carrier screening in the Ashkenazi Jewish population. PMID:19266496

  8. Founder Fukutin mutation causes Walker-Warburg syndrome in four Ashkenazi Jewish families.

    PubMed

    Chang, Wendy; Winder, Thomas L; LeDuc, Charles A; Simpson, Lynn L; Millar, William S; Dungan, Jeffrey; Ginsberg, Norman; Plaga, Stacey; Moore, Steven A; Chung, Wendy K

    2009-06-01

    Walker-Warburg syndrome (WWS) is a genetically heterogeneous congenital muscular dystrophy caused by abnormal glycosylation of alpha-dystroglycan (alpha-DG) that is associated with brain malformations and eye anomalies. The Fukutin (FKTN) gene, which causes autosomal recessively inherited WWS is most often associated with Fukuyama congenital muscular dystrophy in Japan. We describe the clinical features of four nonconsanguinous Ashkenazi Jewish families with WWS and identify the underlying genetic basis for WWS. We screened for mutations in POMGnT1, POMT1, POMT2, and FKTN, genes causing WWS, by dideoxy sequence analysis. We identified an identical homozygous c.1167insA mutation in the FKTN gene on a common haplotype in all four families and identified 2/299 (0.7%) carriers for the c.1167insA mutation among normal American Ashkenazi Jewish adults. These data suggest that the c.1167insA FKTN mutation described by us is a founder mutation that can be used to target diagnostic testing and carrier screening in the Ashkenazi Jewish population. Copyright (c) 2009 John Wiley & Sons, Ltd.

  9. BSE Case Associated with Prion Protein Gene Mutation

    PubMed Central

    Richt, Jürgen A.; Hall, S. Mark

    2008-01-01

    Bovine spongiform encephalopathy (BSE) is a transmissible spongiform encephalopathy (TSE) of cattle and was first detected in 1986 in the United Kingdom. It is the most likely cause of variant Creutzfeldt-Jakob disease (CJD) in humans. The origin of BSE remains an enigma. Here we report an H-type BSE case associated with the novel mutation E211K within the prion protein gene (Prnp). Sequence analysis revealed that the animal with H-type BSE was heterozygous at Prnp nucleotides 631 through 633. An identical pathogenic mutation at the homologous codon position (E200K) in the human Prnp has been described as the most common cause of genetic CJD. This finding represents the first report of a confirmed case of BSE with a potential pathogenic mutation within the bovine Prnp gene. A recent epidemiological study revealed that the K211 allele was not detected in 6062 cattle from commercial beef processing plants and 42 cattle breeds, indicating an extremely low prevalence of the E211K variant (less than 1 in 2000) in cattle. PMID:18787697

  10. Inactivation of Gating Currents of L-Type Calcium Channels

    PubMed Central

    Shirokov, Roman; Ferreira, Gonzalo; Yi, Jianxun; Ríos, Eduardo

    1998-01-01

    In studies of gating currents of rabbit cardiac Ca channels expressed as α1C/β2a or α1C/β2a/α2δ subunit combinations in tsA201 cells, we found that long-lasting depolarization shifted the distribution of mobile charge to very negative potentials. The phenomenon has been termed charge interconversion in native skeletal muscle (Brum, G., and E. Ríos. 1987. J. Physiol. (Camb.). 387:489–517) and cardiac Ca channels (Shirokov, R., R. Levis, N. Shirokova, and E. Ríos. 1992. J. Gen. Physiol. 99:863–895). Charge 1 (voltage of half-maximal transfer, V1/2 ≃ 0 mV) gates noninactivated channels, while charge 2 (V1/2 ≃ −90 mV) is generated in inactivated channels. In α1C/β2a cells, the available charge 1 decreased upon inactivating depolarization with a time constant τ ≃ 8, while the available charge 2 decreased upon recovery from inactivation (at −200 mV) with τ ≃ 0.3 s. These processes therefore are much slower than charge movement, which takes <50 ms. This separation between the time scale of measurable charge movement and that of changes in their availability, which was even wider in the presence of α2δ, implies that charges 1 and 2 originate from separate channel modes. Because clear modal separation characterizes slow (C-type) inactivation of Na and K channels, this observation establishes the nature of voltage-dependent inactivation of L-type Ca channels as slow or C-type. The presence of the α2δ subunit did not change the V1/2 of charge 2, but sped up the reduction of charge 1 upon inactivation at 40 mV (to τ ≃ 2 s), while slowing the reduction of charge 2 upon recovery (τ ≃ 2 s). The observations were well simulated with a model that describes activation as continuous electrodiffusion (Levitt, D. 1989. Biophys. J. 55:489–498) and inactivation as discrete modal change. The effects of α2δ are reproduced assuming that the subunit lowers the free energy of the inactivated mode. PMID:9607938

  11. Thermal Inactivation of Bacillus anthracis Spores Using Rapid Resistive Heating

    DTIC Science & Technology

    2016-03-24

    thermal inactivation research. However, the research conducted to support this thesis utilizes the B.a. Sterne strain which is used in livestock vaccines...methodology conducted for this research including hard surface recovery, thermal inactivation of Bacillus anthracis spores, and the rapid resistive heating...to 500°C range but again, many of the thermal inactivation studies were conducted in the 350 to 2000°C range. Sample plots will be discussed in

  12. Mechanism of Cd2+-coordination during Slow Inactivation in Potassium Channels

    PubMed Central

    Raghuraman, H.; Cordero-Morales, Julio F.; Jogini, Vishwanath; Pan, Albert C.; Kollewe, Astrid; Roux, Benoît; Perozo, Eduardo

    2013-01-01

    Summary In K+ channels, rearrangements of the pore outer-vestibule have been associated with C-type inactivation gating. Paradoxically, the crystal structure of Open/C-type inactivated KcsA suggest these movements to be modest in magnitude. Here, we show that under physiological conditions, the KcsA outer-vestibule undergoes relatively large dynamic rearrangements upon inactivation. External Cd2+ enhances the rate of C-type inactivation in an outer-vestibule cysteine mutant (Y82C) via metal-bridge formation. This effect is not present in a non-inactivating mutant (E71A/Y82C). Tandem dimer and tandem tetramer constructs of equivalent cysteine mutants in KcsA and Shaker K+ channels demonstrate that these Cd2+ metal bridges are formed only between adjacent subunits. This is well supported by molecular dynamics simulations. Based on the crystal structure of Cd2+-bound Y82C-KcsA in the closed state, together with EPR distance measurements in the KcsA outer-vestibule, we suggest that subunits must dynamically come in close proximity as the channels undergo inactivation. PMID:22771214

  13. Quantitative analysis of wet-heat inactivation in bovine spongiform encephalopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsuura, Yuichi; Ishikawa, Yukiko; Bo, Xiao

    2013-03-01

    Highlights: ► We quantitatively analyzed wet-heat inactivation of the BSE agent. ► Infectivity of the BSE macerate did not survive 155 °C wet-heat treatment. ► Once the sample was dehydrated, infectivity was observed even at 170 °C. ► A quantitative PMCA assay was used to evaluate the degree of BSE inactivation. - Abstract: The bovine spongiform encephalopathy (BSE) agent is resistant to conventional microbial inactivation procedures and thus threatens the safety of cattle products and by-products. To obtain information necessary to assess BSE inactivation, we performed quantitative analysis of wet-heat inactivation of infectivity in BSE-infected cattle spinal cords. Using amore » highly sensitive bioassay, we found that infectivity in BSE cattle macerates fell with increase in temperatures from 133 °C to 150 °C and was not detected in the samples subjected to temperatures above 155 °C. In dry cattle tissues, infectivity was detected even at 170 °C. Thus, BSE infectivity reduces with increase in wet-heat temperatures but is less affected when tissues are dehydrated prior to the wet-heat treatment. The results of the quantitative protein misfolding cyclic amplification assay also demonstrated that the level of the protease-resistant prion protein fell below the bioassay detection limit by wet-heat at 155 °C and higher and could help assess BSE inactivation. Our results show that BSE infectivity is strongly resistant to wet-heat inactivation and that it is necessary to pay attention to BSE decontamination in recycled cattle by-products.« less

  14. Inactivation of biofilm bacteria.

    PubMed Central

    LeChevallier, M W; Cawthon, C D; Lee, R G

    1988-01-01

    The current project was developed to examine inactivation of biofilm bacteria and to characterize the interaction of biocides with pipe surfaces. Unattached bacteria were quite susceptible to the variety of disinfectants tested. Viable bacterial counts were reduced 99% by exposure to 0.08 mg of hypochlorous acid (pH 7.0) per liter (1 to 2 degrees C) for 1 min. For monochloramine, 94 mg/liter was required to kill 99% of the bacteria within 1 min. These results were consistent with those found by other investigators. Biofilm bacteria grown on the surfaces of granular activated carbon particles, metal coupons, or glass microscope slides were 150 to more than 3,000 times more resistant to hypochlorous acid (free chlorine, pH 7.0) than were unattached cells. In contrast, resistance of biofilm bacteria to monochloramine disinfection ranged from 2- to 100-fold more than that of unattached cells. The results suggested that, relative to inactivation of unattached bacteria, monochloramine was better able to penetrate and kill biofilm bacteria than free chlorine. For free chlorine, the data indicated that transport of the disinfectant into the biofilm was a major rate-limiting factor. Because of this phenomenon, increasing the level of free chlorine did not increase disinfection efficiency. Experiments where equal weights of disinfectants were used suggested that the greater penetrating power of monochloramine compensated for its limited disinfection activity. These studies showed that monochloramine was as effective as free chlorine for inactivation of biofilm bacteria. The research provides important insights into strategies for control of biofilm bacteria. Images PMID:2849380

  15. THE ANTIGENIC POTENCY OF EPIDEMIC INFLUENZA VIRUS FOLLOWING INACTIVATION BY ULTRAVIOLET RADIATION

    PubMed Central

    Salk, Jonas E.; Lavin, G. I.; Francis, Thomas

    1940-01-01

    A study of the antigenic potency of influenza virus inactivated by ultraviolet radiation has been made. Virus so inactivated is still capable of functioning as an immunizing agent when given to mice by the intraperitoneal route. In high concentrations inactivated virus appears to be nearly as effective as active virus but when quantitative comparisons of the immunity induced by different dilutions are made, it is seen that a hundredfold loss in immunizing capacity occurs during inactivation. Virus in suspensions prepared from the lungs of infected mice is inactivated more rapidly than virus in tissue culture medium. A standard for the comparison of vaccines of epidemic influenza virus is proposed. PMID:19871057

  16. SDHAF2 mutations in familial and sporadic paraganglioma and phaeochromocytoma.

    PubMed

    Bayley, Jean-Pierre; Kunst, Henricus P M; Cascon, Alberto; Sampietro, Maria Lourdes; Gaal, José; Korpershoek, Esther; Hinojar-Gutierrez, Adolfo; Timmers, Henri J L M; Hoefsloot, Lies H; Hermsen, Mario A; Suárez, Carlos; Hussain, A Karim; Vriends, Annette H J T; Hes, Frederik J; Jansen, Jeroen C; Tops, Carli M; Corssmit, Eleonora P; de Knijff, Peter; Lenders, Jacques W M; Cremers, Cor W R J; Devilee, Peter; Dinjens, Winand N M; de Krijger, Ronald R; Robledo, Mercedes

    2010-04-01

    Paragangliomas and phaeochromocytomas are neuroendocrine tumours associated frequently with germline mutations of SDHD, SDHC, and SDHB. Previous studies have shown the imprinted SDHAF2 gene to be mutated in a large Dutch kindred with paragangliomas. We aimed to identify SDHAF2 mutation carriers, assess the clinical genetic significance of SDHAF2, and describe the associated clinical phenotype. We undertook a multicentre study in Spain and The Netherlands in 443 apparently sporadic patients with paragangliomas and phaeochromocytomas who did not have mutations in SDHD, SDHC, or SDHB. We analysed DNA of 315 patients for germline mutations of SDHAF2; a subset (n=200) was investigated for gross gene deletions. DNA from a group of 128 tumours was studied for somatic mutations. We also examined a Spanish family with head and neck paragangliomas with a young age of onset for the presence of SDHAF2 mutations, undertook haplotype analysis in this kindred, and assessed their clinical phenotype. We did not identify any germline or somatic mutations of SDHAF2, and no gross gene deletions were noted in the subset of apparently sporadic patients analysed. Investigation of the Spanish family identified a pathogenic germline DNA mutation of SDHAF2, 232G-->A (Gly78Arg), identical to the Dutch kindred. SDHAF2 mutations do not have an important role in phaeochromocytoma and are rare in head and neck paraganglioma. Identification of a second family with the Gly78Arg mutation suggests that this is a crucial residue for the function of SDHAF2. We conclude that SDHAF2 mutation analysis is justified in very young patients with isolated head and neck paraganglioma without mutations in SDHD, SDHC, or SDHB, and in individuals with familial antecedents who are negative for mutations in all other risk genes. Dutch Cancer Society, European Union 6th Framework Program, Fondo Investigaciones Sanitarias, Fundación Mutua Madrileña, and Red Temática de Investigación Cooperativa en Cáncer. 2010

  17. Point mutation impairs centromeric CENH3 loading and induces haploid plants.

    PubMed

    Karimi-Ashtiyani, Raheleh; Ishii, Takayoshi; Niessen, Markus; Stein, Nils; Heckmann, Stefan; Gurushidze, Maia; Banaei-Moghaddam, Ali Mohammad; Fuchs, Jörg; Schubert, Veit; Koch, Kerstin; Weiss, Oda; Demidov, Dmitri; Schmidt, Klaus; Kumlehn, Jochen; Houben, Andreas

    2015-09-08

    The chromosomal position of the centromere-specific histone H3 variant CENH3 (also called "CENP-A") is the assembly site for the kinetochore complex of active centromeres. Any error in transcription, translation, modification, or incorporation can affect the ability to assemble intact CENH3 chromatin and can cause centromere inactivation [Allshire RC, Karpen GH (2008) Nat Rev Genet 9 (12):923-937]. Here we show that a single-point amino acid exchange in the centromere-targeting domain of CENH3 leads to reduced centromere loading of CENH3 in barley, sugar beet, and Arabidopsis thaliana. Haploids were obtained after cenh3 L130F-complemented cenh3-null mutant plants were crossed with wild-type A. thaliana. In contrast, in a noncompeting situation (i.e., centromeres possessing only mutated or only wild-type CENH3), no uniparental chromosome elimination occurs during early embryogenesis. The high degree of evolutionary conservation of the identified mutation site offers promising opportunities for application in a wide range of crop species in which haploid technology is of interest.

  18. Point mutation impairs centromeric CENH3 loading and induces haploid plants

    PubMed Central

    Karimi-Ashtiyani, Raheleh; Ishii, Takayoshi; Niessen, Markus; Stein, Nils; Heckmann, Stefan; Gurushidze, Maia; Banaei-Moghaddam, Ali Mohammad; Fuchs, Jörg; Schubert, Veit; Koch, Kerstin; Weiss, Oda; Demidov, Dmitri; Schmidt, Klaus; Kumlehn, Jochen; Houben, Andreas

    2015-01-01

    The chromosomal position of the centromere-specific histone H3 variant CENH3 (also called “CENP-A”) is the assembly site for the kinetochore complex of active centromeres. Any error in transcription, translation, modification, or incorporation can affect the ability to assemble intact CENH3 chromatin and can cause centromere inactivation [Allshire RC, Karpen GH (2008) Nat Rev Genet 9 (12):923–937]. Here we show that a single-point amino acid exchange in the centromere-targeting domain of CENH3 leads to reduced centromere loading of CENH3 in barley, sugar beet, and Arabidopsis thaliana. Haploids were obtained after cenh3 L130F-complemented cenh3-null mutant plants were crossed with wild-type A. thaliana. In contrast, in a noncompeting situation (i.e., centromeres possessing only mutated or only wild-type CENH3), no uniparental chromosome elimination occurs during early embryogenesis. The high degree of evolutionary conservation of the identified mutation site offers promising opportunities for application in a wide range of crop species in which haploid technology is of interest. PMID:26294252

  19. Recessive and dominant mutations in COL12A1 cause a novel EDS/myopathy overlap syndrome in humans and mice

    PubMed Central

    Zou, Yaqun; Zwolanek, Daniela; Izu, Yayoi; Gandhy, Shreya; Schreiber, Gudrun; Brockmann, Knut; Devoto, Marcella; Tian, Zuozhen; Hu, Ying; Veit, Guido; Meier, Markus; Stetefeld, Jörg; Hicks, Debbie; Straub, Volker; Voermans, Nicol C.; Birk, David E.; Barton, Elisabeth R.; Koch, Manuel; Bönnemann, Carsten G.

    2014-01-01

    Collagen VI-related myopathies are disorders of connective tissue presenting with an overlap phenotype combining clinical involvement from the muscle and from the connective tissue. Not all patients displaying related overlap phenotypes between muscle and connective tissue have mutations in collagen VI. Here, we report a homozygous recessive loss of function mutation and a de novo dominant mutation in collagen XII (COL12A1) as underlying a novel overlap syndrome involving muscle and connective tissue. Two siblings homozygous for a loss of function mutation showed widespread joint hyperlaxity combined with weakness precluding independent ambulation, while the patient with the de novo missense mutation was more mildly affected, showing improvement including the acquisition of walking. A mouse model with inactivation of the Col12a1 gene showed decreased grip strength, a delay in fiber-type transition and a deficiency in passive force generation while the muscle seems more resistant to eccentric contraction induced force drop, indicating a role for a matrix-based passive force-transducing elastic element in the generation of the weakness. This new muscle connective tissue overlap syndrome expands on the emerging importance of the muscle extracellular matrix in the pathogenesis of muscle disease. PMID:24334604

  20. Clinical profile and mutation analysis of xeroderma pigmentosum in Indian patients.

    PubMed

    Tamhankar, Parag M; Iyer, Shruti V; Ravindran, Shyla; Gupta, Neerja; Kabra, Madhulika; Nayak, Chitra; Kura, Mahendra; Sanghavi, Swapnil; Joshi, Rajesh; Chennuri, Vasundhara Sridhar; Khopkar, Uday

    2015-01-01

    Xeroderma pigmentosum (XP) is an autosomal recessive genetic disorder characterized by cutaneous and ocular photosensitivity and an increased risk of developing cutaneous neoplasms. Progressive neurological abnormalities develop in a quarter of XP patients. To study the clinical profile and perform a mutation analysis in Indian patients with xeroderma pigmentosum. Ten families with 13 patients with XP were referred to our clinic over 2 years. The genes XPA, XPB and XPC were sequentially analyzed till a pathogenic mutation was identified. Homozygous mutations in the XPA gene were seen in patients with moderate to severe mental retardation (6/10 families) but not in those without neurological features. Two unrelated families with a common family name and belonging to the same community from Maharashtra were found to have an identical mutation in the XPA gene, namely c.335_338delTTATinsCATAAGAAA (p.F112SfsX2). Testing of the XPC gene in two families with four affected children led to the identification of the novel mutations c.1243C>T or p.R415X and c.1677C>A or p.Y559X. In two families, mutations could not be identified in XPA, XPB and XPC genes. The sample size is small. Indian patients who have neurological abnormalities associated with XP should be screened for mutations in the XPA gene.

  1. Mechanism of poliovirus inactivation by ammonia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ward, R.L.

    1978-05-01

    Poliovirus inactivation by ammonia causes a slight reduction in the sedimentation coefficients of viral particles, but has no detectable effect on either the electrophoretic pattern of viral capsid proteins or the isoelectric points of inactivated particles. These virions still attach to cells, but are unable to repress host translation or stimulate the synthesis of detectable amounts of viral RNA. Although ammonia has no detectable effect on naked poliovirus RNA, it causes cleavage of this RNA when still within viral particles. Therefore, the RNA genome appears to be the only component of poliovirus significantly affected by ammonia.

  2. Method for determining virus inactivation during sludge treatment processes.

    PubMed Central

    Traub, F; Spillmann, S K; Wyler, R

    1986-01-01

    A simple and reliable method is described which allows determination of virus inactivation rates during sludge treatment processes in situ. Bacteriophage f2 was adsorbed onto an electropositive membrane filter which was then sandwiched between two polycarbonate membranes with pores smaller than the virus diameter. The resulting sandwich was fixed in an open filter holder, and several such devices were connected before being exposed in sludge-digesting tanks. The device described prevented uncontrolled virus escape, but allowed direct contact of the various inactivating or stabilizing substances present in the environment tested with the virus adsorbed to the carrier membrane. After exposure to an environment, the surviving fraction of virus was eluted from the inner filter and determined by plaque counting. By using polycarbonate membranes without pores for sandwiching, the influence of temperature alone on virus inactivation could be measured. Thermophilic fermentation at 60 degrees C and at 65 kPa pressure led to a bacteriophage f2 titer reduction of 3.5 log10 units per h, whereas during thermophilic digestion at 54.5 degrees C titers decreased 1.2 log10 units per h. During mesophilic digestion an inactivation rate of only 0.04 log10 units per h was observed. Under these latter conditions, temperature had only a minor effect (19%) on virus inactivation, whereas at 54.5 degrees C during thermophilic digestion heat accounted for 32% of the total inactivation, and during thermophilic fermentation at 60 degrees C temperature and pressure were 100% responsible for virus denaturation. PMID:3532955

  3. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  4. Insight into a novel p53 single point mutation (G389E) by Molecular Dynamics Simulations.

    PubMed

    Pirolli, Davide; Carelli Alinovi, Cristiana; Capoluongo, Ettore; Satta, Maria Antonia; Concolino, Paola; Giardina, Bruno; De Rosa, Maria Cristina

    2010-12-30

    The majority of inactivating mutations of p53 reside in the central core DNA binding domain of the protein. In this computational study, we investigated the structural effects of a novel p53 mutation (G389E), identified in a patient with congenital adrenal hyperplasia, which is located within the extreme C-terminal domain (CTD) of p53, an unstructured, flexible region (residues 367-393) of major importance for the regulation of the protein. Based on the three-dimensional structure of a carboxyl-terminal peptide of p53 in complex with the S100B protein, which is involved in regulation of the tumor suppressor activity, a model of wild type (WT) and mutant extreme CTD was developed by molecular modeling and molecular dynamics simulation. It was found that the G389E amino acid replacement has negligible effects on free p53 in solution whereas it significantly affects the interactions of p53 with the S100B protein. The results suggest that the observed mutation may interfere with p53 transcription activation and provide useful information for site-directed mutagenesis experiments.

  5. Fullerene C60 and graphene photosensibiles for photodynamic virus inactivation

    NASA Astrophysics Data System (ADS)

    Belousova, I.; Hvorostovsky, A.; Kiselev, V.; Zarubaev, V.; Kiselev, O.; Piotrovsky, L.; Anfimov, P.; Krisko, T.; Muraviova, T.; Rylkov, V.; Starodubzev, A.; Sirotkin, A.; Grishkanich, A.; Kudashev, I.; Kancer, A.; Kustikova, M.; Bykovskaya, E.; Mayurova, A.; Stupnikov, A.; Ruzankina, J.; Afanasyev, M.; Lukyanov, N.; Redka, D.; Paklinov, N.

    2018-02-01

    A solid-phase photosensitizer based on aggregated C60 fullerene and graphene oxide for photodynamic inactivation of pathogens in biological fluids was studied. The most promising technologies of inactivation include the photodynamic effect, which consists in the inactivation of infectious agents by active oxygen forms (including singlet oxygen), formed when light is activated by the photosensitizer introduced into the plasma. Research shows features of solid-phase systems based on graphene and fullerene C60 oxide, which is a combination of an effective inactivating pathogens (for example, influenza viruses) reactive oxygen species formed upon irradiation of the photosensitizer in aqueous and biological fluids, a high photostability fullerene coatings and the possibility of full recovery photosensitizer from the biological environment after the photodynamic action.

  6. Inactivation of the Prelimbic Cortex Attenuates Context-Dependent Operant Responding

    PubMed Central

    Shipman, Megan L.; Bouton, Mark E.

    2017-01-01

    Operant responding in rats provides an analog to voluntary behavior in humans and is used to study maladaptive behaviors, such as overeating, drug taking, or relapse. In renewal paradigms, extinguished behavior recovers when tested outside the context where extinction was learned. Inactivation of the prelimbic (PL) region of the medial prefrontal cortex by baclofen/muscimol (B/M) during testing attenuates renewal when tested in the original acquisition context after extinction in another context (ABA renewal). Two experiments tested the hypothesis that the PL is important in context-dependent responding learned during conditioning. In the first, rats learned to lever-press for a sucrose-pellet reward. Following acquisition, animals were infused with either B/M or vehicle in the PL and tested in the acquisition context (A) and in a different context (B). All rats showed a decrement in responding when switched from Context A to Context B, but PL inactivation decreased responding only in Context A. Experiment 2a examined the effects of PL inactivation on ABC renewal in the same rats. Here, following reacquisition of the response, responding was extinguished in a new context (C). Following infusions of B/M or vehicle in the PL, responding was tested in Context C and another new context (D). The rats exhibited ACD renewal regardless of PL inactivation. Experiment 2b demonstrated that PL inactivation attenuated the ABA renewal effect in the same animals, replicating earlier results and demonstrating that cannulae were still functional. The results suggest that, rather than attenuating renewal generally, PL inactivation specifically affects ABA renewal by reducing responding in the conditioning context. SIGNIFICANCE STATEMENT Extinguished operant behavior can recover (“renew”) when tested outside the extinction context. This suggests that behaviors, such as overeating or drug taking, might be especially prone to relapse following treatment. In rats, inactivation of

  7. Resistance of Bovine Spongiform Encephalopathy (BSE) Prions to Inactivation

    PubMed Central

    Giles, Kurt; Glidden, David V.; Beckwith, Robyn; Seoanes, Rose; Peretz, David; DeArmond, Stephen J.; Prusiner, Stanley B.

    2008-01-01

    Distinct prion strains often exhibit different incubation periods and patterns of neuropathological lesions. Strain characteristics are generally retained upon intraspecies transmission, but may change on transmission to another species. We investigated the inactivation of two related prions strains: BSE prions from cattle and mouse-passaged BSE prions, termed 301V. Inactivation was manipulated by exposure to sodium dodecyl sulfate (SDS), variations in pH, and different temperatures. Infectivity was measured using transgenic mouse lines that are highly susceptible to either BSE or 301V prions. Bioassays demonstrated that BSE prions are up to 1,000-fold more resistant to inactivation than 301V prions while Western immunoblotting showed that short acidic SDS treatments reduced protease-resistant PrPSc from BSE prions and 301V prions at similar rates. Our findings argue that despite being derived from BSE prions, mouse 301V prions are not necessarily a reliable model for cattle BSE prions. Extending these comparisons to human sporadic Creutzfeldt-Jakob disease and hamster Sc237 prions, we found that BSE prions were 10- and 106-fold more resistant to inactivation, respectively. Our studies contend that any prion inactivation procedures must be validated by bioassay against the prion strain for which they are intended to be used. PMID:19008948

  8. Thermal inactivation of the wine spoilage yeasts Dekkera/Brettanomyces.

    PubMed

    Couto, José António; Neves, Filipe; Campos, Francisco; Hogg, Tim

    2005-10-25

    The heat resistance of three strains of Dekkera/Brettanomyces (Dekkera anomala PYCC 5,153, Dekkera bruxellensis PYCC 4,801 and Dekkera/Brettanomyces 093) was evaluated at different temperatures between 32.5 and 55 degrees C. Thermal inactivation tests were performed in tartrate buffer solution (pH 4.0) and in wines. In the studies employing buffer as the heating menstruum, measurable thermal inactivation began only at temperatures of 50 degrees C. When heating was performed in wine, significant inactivation begins at 35 degrees C. Subsequent thermal inactivation tests were performed in buffer at various levels of pH, ethanol concentration, and various phenolic acids. Results from experiments in buffer with added ethanol suggest that the greater heat sensitivity shown in wines can be largely attributed to ethanol, although potentiation of this effect might be due to the phenolic content, particularly from ferulic acid. In the range of pH values tested (2.5-4.5), this factor had no influence in the heat inactivation kinetics. Relevant data, in the form of D and Z values calculated in the various environments, potentially useful for the establishment of regimes of thermal control of Dekkera/Brettanomyces yeasts in wine and contaminated equipment is presented.

  9. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

    1997-01-01

    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  10. Role of KEAP1/NRF2 and TP53 mutations in lung squamous cell carcinoma development and radiotherapy response prediction

    PubMed Central

    Jeong, Youngtae; Hoang, Ngoc T.; Lovejoy, Alexander; Stehr, Henning; Newman, Aaron M.; Gentles, Andrew J.; Kong, William; Truong, Diana; Martin, Shanique; Chaudhuri, Aadel; Heiser, Diane; Zhou, Li; Say, Carmen; Carter, Justin N.; Hiniker, Susan M.; Loo, Billy W.; West, Robert B.; Beachy, Philip; Alizadeh, Ash A.; Diehn, Maximilian

    2016-01-01

    Lung squamous cell carcinomas (LSCC) pathogenesis remains incompletely understood and biomarkers predicting treatment response remain lacking. Here we describe novel murine LSCC models driven by loss of Trp53 and Keap1, both of which are frequently mutated in human LSCCs. Homozygous inactivation of Keap1 or Trp53 promoted airway basal stem cell (ABSC) self-renewal, suggesting that mutations in these genes lead to expansion of mutant stem cell clones. Deletion of Trp53 and Keap1 in ABSCs, but not more differentiated tracheal cells, produced tumors recapitulating histological and molecular features of human LSCCs, indicating that they represent the likely cell of origin in this model. Deletion of Keap1 promoted tumor aggressiveness, metastasis, and resistance to oxidative stress and radiotherapy (RT). KEAP1/NRF2 mutation status predicted risk of local recurrence after RT in non-small lung cancer (NSCLC) patients and could be non-invasively identified in circulating tumor DNA. Thus, KEAP1/NRF2 mutations could serve as predictive biomarkers for personalization of therapeutic strategies for NSCLCs. PMID:27663899

  11. Virus inactivation by silver doped titanium dioxide nanoparticles for drinking water treatment.

    PubMed

    Liga, Michael V; Bryant, Erika L; Colvin, Vicki L; Li, Qilin

    2011-01-01

    Photocatalytic inactivation of viruses and other microorganisms is a promising technology that has been increasingly utilized in recent years. In this study, photocatalytic silver doped titanium dioxide nanoparticles (nAg/TiO(2)) were investigated for their capability of inactivating Bacteriophage MS2 in aqueous media. Nano-sized Ag deposits were formed on two commercial TiO(2) nanopowders using a photochemical reduction method. The MS2 inactivation kinetics of nAg/TiO(2) was compared to the base TiO(2) material and silver ions leached from the catalyst. The inactivation rate of MS2 was enhanced by more than 5 fold depending on the base TiO(2) material, and the inactivation efficiency increased with increasing silver content. The increased production of hydroxyl free radicals was found to be responsible for the enhanced viral inactivation. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Mouse interleukin-2 structure-function studies: substitutions in the first alpha-helix can specifically inactivate p70 receptor binding and mutations in the fifth alpha-helix can specifically inactivate p55 receptor binding.

    PubMed Central

    Zurawski, S M; Zurawski, G

    1989-01-01

    The function of two alpha-helical regions of mouse interleukin-2 were analyzed by saturation substitution analysis. The functional parts of the first alpha-helix (A) was defined as residues 31-39 by the observation that proline substitutions within this region inactivate the protein. Four residues within alpha-helix A, Leu31, Asp34, Leu35 and Leu38, were found to be crucial for biological activity. Structural modeling suggested that these four residues are clustered on one face of alpha-helix A. Residues 31 and 35 had to remain hydrophobic for the molecule to be functional. At residue 38 there was a preference for hydrophobic side chain residues, while at residue 34 some small side chain residues as well as acidic or amide side chain residues were functionally acceptable. Inactivating changes at residue 34 had no effect upon the ability of the protein to interact with the p55 receptor. Disruption of the fifth alpha-helix (E), which had little effect upon biological activity, resulted in an inability of the protein to interact with the p55 receptor. Mutagenesis of the alpha-helix E region demonstrated that alpha-helicity and the nature of the side chain residues in this region were unimportant for biological activity. The region immediately proximal to alpha-helix E was important only for the single intramolecular disulfide linkage. PMID:2583124

  13. Pretreatment to avoid positive RT-PCR results with inactivated viruses.

    PubMed

    Nuanualsuwan, Suphachai; Cliver, Dean O

    2002-07-01

    Enteric viruses that are important causes of human disease must often be detected by reverse transcription-polymerase chain reaction (RT-PCR), a method that commonly yields positive results with samples that contain only inactivated virus. This study was intended to develop a pretreatment for samples, so that inactivated viruses would not be detected by the RT-PCR procedure. Model viruses were human hepatitis A virus, vaccine poliovirus 1 and feline calicivirus as a surrogate for the Norwalk-like viruses. Each virus was inactivated (from an initial titer of approximately 10(3) PFU/ml) by ultraviolet light, hypochlorite or heating at 72 degrees C. Inactivated viruses, that were treated with proteinase K and ribonuclease for 30 min at 37 degrees C before RT-PCR, gave a negative result, which is to say that no amplicon was detected after the reaction was completed. This antecedent to the RT-PCR method may be applicable to other types of viruses, to viruses inactivated in other ways and to other molecular methods of virus detection.

  14. Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

    1986-11-01

    A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

  15. Identification of novel mutations in X-linked retinitis pigmentosa families and implications for diagnostic testing

    PubMed Central

    Glaus, Esther; Lorenz, Birgit; Netzer, Christian; Li, Yün; Schambeck, Maria; Wittmer, Mariana; Feil, Silke; Kirschner-Schwabe, Renate; Rosenberg, Thomas; Cremers, Frans P.M.; Bergen, Arthur A.B.; Barthelmes, Daniel; Baraki, Husnia; Schmid, Fabian; Tanner, Gaby; Fleischhauer, Johannes; Orth, Ulrike; Becker, Christian; Wegscheider, Erika; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno Jörn; Gal, Andreas; Berger, Wolfgang

    2008-01-01

    Purpose The goal of this study was to identify mutations in X-chromosomal genes associated with retinitis pigmentosa (RP) in patients from Germany, The Netherlands, Denmark, and Switzerland. Methods In addition to all coding exons of RP2, exons 1 through 15, 9a, ORF15, 15a and 15b of RPGR were screened for mutations. PCR products were amplified from genomic DNA extracted from blood samples and analyzed by direct sequencing. In one family with apparently dominant inheritance of RP, linkage analysis identified an interval on the X chromosome containing RPGR, and mutation screening revealed a pathogenic variant in this gene. Patients of this family were examined clinically and by X-inactivation studies. Results This study included 141 RP families with possible X-chromosomal inheritance. In total, we identified 46 families with pathogenic sequence alterations in RPGR and RP2, of which 17 mutations have not been described previously. Two of the novel mutations represent the most 3’-terminal pathogenic sequence variants in RPGR and RP2 reported to date. In exon ORF15 of RPGR, we found eight novel and 14 known mutations. All lead to a disruption of open reading frame. Of the families with suggested X-chromosomal inheritance, 35% showed mutations in ORF15. In addition, we found five novel mutations in other exons of RPGR and four in RP2. Deletions in ORF15 of RPGR were identified in three families in which female carriers showed variable manifestation of the phenotype. Furthermore, an ORF15 mutation was found in an RP patient who additionally carries a 6.4 kbp deletion downstream of the coding region of exon ORF15. We did not identify mutations in 39 sporadic male cases from Switzerland. Conclusions RPGR mutations were confirmed to be the most frequent cause of RP in families with an X-chromosomal inheritance pattern. We propose a screening strategy to provide molecular diagnostics in these families. PMID:18552978

  16. Genetic and epigenetic inactivation of SESTRIN1 controls mTORC1 and response to EZH2 inhibition in follicular lymphoma

    PubMed Central

    Oricchio, Elisa; Katanayeva, Natalya; Donaldson, Maria Christine; Sungalee, Stephanie; Pasion, Joyce P.; Béguelin, Wendy; Battistello, Elena; Sanghvi, Viraj R.; Jiang, Man; Jiang, Yanwen; Teater, Matt; Parmigiani, Anita; Budanov, Andrei V.; Chan, Fong Chun; Shah, Sohrab P.; Kridel, Robert; Melnick, Ari M.; Ciriello, Giovanni; Wendel, Hans-Guido

    2017-01-01

    Follicular lymphoma (FL) is an incurable form of B cell lymphoma. Genomic studies have cataloged common genetic lesions in FL such as translocation t(14;18), frequent losses of chromosome 6q, and mutations in epigenetic regulators such as EZH2. Using a focused genetic screen, we identified SESTRIN1 as a relevant target of the 6q deletion and demonstrate tumor suppression by SESTRIN1 in vivo. Moreover, SESTRIN1 is a direct target of the lymphoma-specific EZH2 gain-of-function mutation (EZH2Y641X). SESTRIN1 inactivation disrupts p53-mediated control of mammalian target of rapamycin complex 1 (mTORC1) and enables mRNA translation under genotoxic stress. SESTRIN1 loss represents an alternative to RRAGC mutations that maintain mTORC1 activity under nutrient starvation. The antitumor efficacy of pharmacological EZH2 inhibition depends on SESTRIN1, indicating that mTORC1 control is a critical function of EZH2 in lymphoma. Conversely, EZH2Y641X mutant lymphomas show increased sensitivity to RapaLink-1, a bifunctional mTOR inhibitor. Hence, SESTRIN1 contributes to the genetic and epigenetic control of mTORC1 in lymphoma and influences responses to targeted therapies. PMID:28659443

  17. Actionable mutations in canine hemangiosarcoma

    PubMed Central

    Wang, Guannan; Wu, Ming; Maloneyhuss, Martha A.; Wojcik, John; Durham, Amy C.; Mason, Nicola J.

    2017-01-01

    Background Angiosarcomas (AS) are rare in humans, but they are a deadly subtype of soft tissue sarcoma. Discovery sequencing in AS, especially the visceral form, is hampered by the rarity of cases. Most diagnostic material exists as archival formalin fixed, paraffin embedded tissue which serves as a poor source of high quality DNA for genome-wide sequencing. We approached this problem through comparative genomics. We hypothesized that exome sequencing a histologically similar tumor, hemangiosarcoma (HSA), that occurs in approximately 50,000 dogs per year, may lead to the identification of potential oncogenic drivers and druggable targets that could also occur in angiosarcoma. Methods Splenic hemangiosarcomas are common in dogs, which allowed us to collect a cohort of archived matched tumor and normal tissue samples suitable for whole exome sequencing. Mapping of the reads to the latest canine reference genome (Canfam3) demonstrated that >99% of the targeted exomal regions were covered, with >80% at 20X coverage and >90% at 10X coverage. Results and conclusions Sequence analysis of 20 samples identified somatic mutations in PIK3CA, TP53, PTEN, and PLCG1, all of which correspond to well-known tumor drivers in human cancer, in more than half of the cases. In one case, we identified a mutation in PLCG1 identical to a mutation observed previously in this gene in human visceral AS. Activating PIK3CA mutations present novel therapeutic targets, and clinical trials of targeted inhibitors are underway in human cancers. Our results lay a foundation for similar clinical trials in canine HSA, enabling a precision medicine approach to this disease. PMID:29190660

  18. A novel CDKL5 mutation in a 47,XXY boy with the early-onset seizure variant of Rett syndrome.

    PubMed

    Sartori, Stefano; Di Rosa, Gabriella; Polli, Roberta; Bettella, Elisa; Tricomi, Giovanni; Tortorella, Gaetano; Murgia, Alessandra

    2009-02-01

    Mutations of the cyclin-dependent kinase-like 5 gene (CDKL5), reported almost exclusively in female subjects, have been recently found to be the cause of a phenotype overlapping Rett syndrome with early-onset epileptic encephalopathy. We describe the first CDKL5 mutation detected in a male individual with 47,XXY karyotype. This previously unreported, de novo, mutation truncates the large CDKL5 COOH-terminal region, thought to be crucial for the proper sub-cellular localization of the CDKL5 protein. The resulting phenotype is characterized by a severe early-onset epileptic encephalopathy, global developmental delay, and profound intellectual and motor impairment with features reminiscent of Rett syndrome. In light of the data presented we discuss the possible phenotypic modulatory effects of the supernumerary wild type X allele and pattern of X chromosome inactivation and stress the importance of considering the causal involvement of CDKL5 in developmentally delayed males with early-onset seizures. (c) 2009 Wiley-Liss, Inc.

  19. Inactivation Strategies for Clostridium perfringens Spores and Vegetative Cells.

    PubMed

    Talukdar, Prabhat K; Udompijitkul, Pathima; Hossain, Ashfaque; Sarker, Mahfuzur R

    2017-01-01

    Clostridium perfringens is an important pathogen to human and animals and causes a wide array of diseases, including histotoxic and gastrointestinal illnesses. C. perfringens spores are crucial in terms of the pathogenicity of this bacterium because they can survive in a dormant state in the environment and return to being live bacteria when they come in contact with nutrients in food or the human body. Although the strategies to inactivate C. perfringens vegetative cells are effective, the inactivation of C. perfringens spores is still a great challenge. A number of studies have been conducted in the past decade or so toward developing efficient inactivation strategies for C. perfringens spores and vegetative cells, which include physical approaches and the use of chemical preservatives and naturally derived antimicrobial agents. In this review, different inactivation strategies applied to control C. perfringens cells and spores are summarized, and the potential limitations and challenges of these strategies are discussed. Copyright © 2016 American Society for Microbiology.

  20. Inactivation Strategies for Clostridium perfringens Spores and Vegetative Cells

    PubMed Central

    Talukdar, Prabhat K.; Udompijitkul, Pathima; Hossain, Ashfaque

    2016-01-01

    ABSTRACT Clostridium perfringens is an important pathogen to human and animals and causes a wide array of diseases, including histotoxic and gastrointestinal illnesses. C. perfringens spores are crucial in terms of the pathogenicity of this bacterium because they can survive in a dormant state in the environment and return to being live bacteria when they come in contact with nutrients in food or the human body. Although the strategies to inactivate C. perfringens vegetative cells are effective, the inactivation of C. perfringens spores is still a great challenge. A number of studies have been conducted in the past decade or so toward developing efficient inactivation strategies for C. perfringens spores and vegetative cells, which include physical approaches and the use of chemical preservatives and naturally derived antimicrobial agents. In this review, different inactivation strategies applied to control C. perfringens cells and spores are summarized, and the potential limitations and challenges of these strategies are discussed. PMID:27795314

  1. Infective and inactivated filamentous phage as carriers for immunogenic peptides.

    PubMed

    Samoylova, Tatiana I; Norris, Mandy D; Samoylov, Alexandre M; Cochran, Anna M; Wolfe, Karen G; Petrenko, Valery A; Cox, Nancy R

    2012-07-01

    The focus of this study is on development of vaccines using filamentous phage as a delivery vector for immunogenic peptides. The use of phage as a carrier for immunogenic peptides provides significant benefits such as high immunogenicity, low production costs, and high stability of phage preparations. However, introduction of live recombinant phage into the environment might represent a potential ecological problem. This, for example, may occur when vaccines are used in oral or nasal formulations in field conditions for wild and feral animals. To address this issue, comparative studies of antigenic properties of live and inactivated (non-viable) phage were accomplished. Inactivated phage, if released, will not propagate and will degrade as any other protein. In these experiments, a model phage clone that was previously selected from a phage display library and shown to stimulate production of anti-sperm antibodies with contraceptive properties was used. Multiple methods of phage inactivation were tested, including drying, freezing, autoclaving, heating, and UV irradiation. Under studied conditions, heating at 76°C for 3h, UV irradiation, and autoclaving resulted in complete phage inactivation. Phage samples treated by heat and UV were characterized by spectrophotometry and electron microscopy. To test antigenicity, live and inactivated phage preparations were injected into mice and antibody responses assayed by ELISA. It was found that phage killed by heat causes little to no immune responses, probably due to destruction of phage particles. In contrast, UV-inactivated phage stimulated production of IgG serum antibodies at the levels comparable to live phage. Thus, vaccines formulated to include UV-inactivated filamentous phage might represent environmentally safe alternatives to live phage vaccines. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Strategy to inactivate Clostridium perfringens spores in meat products.

    PubMed

    Akhtar, Saeed; Paredes-Sabja, Daniel; Torres, J Antonio; Sarker, Mahfuzur R

    2009-05-01

    The current study aimed to develop an inactivation strategy for Clostridium perfringens spores in meat through a combination of spore activation at low pressure (100-200 MPa, 7 min) and elevated temperature (80 degrees C, 10 min); spore germination at high temperatures (55, 60 or 65 degrees C); and inactivation of germinated spores with elevated temperatures (80 and 90 degrees C, 10 and 20 min) and high pressure (586 MPa, at 23 and 73 degrees C, 10 min). Low pressures (100-200 MPa) were insufficient to efficiently activate C. perfringens spores for germination. However, C. perfringens spores were efficiently activated with elevated temperature (80 degrees C, 10 min), and germinated at temperatures lethal for vegetative cells (>or= 55 degrees C) when incubated for 60 min with a mixture of L-asparagine and KCl (AK) in phosphate buffer (pH 7) and in poultry meat. Inactivation of spores (approximately 4 decimal reduction) in meat by elevated temperatures (80-90 degrees C for 20 min) required a long germination period (55 degrees C for 60 min). However, similar inactivation level was reached with shorter germination period (55 degrees C for 15 min) when spore contaminated-meat was treated with pressure-assisted thermal processing (568 MPa, 73 degrees C, 10 min). Therefore, the most efficient strategy to inactivate C. perfringens spores in poultry meat containing 50 mM AK consisted: (i) a primary heat treatment (80 degrees C, 10 min) to pasteurize and denature the meat proteins and to activate C. perfringens spores for germination; (ii) cooling of the product to 55 degrees C in about 20 min and further incubation at 55 degrees C for about 15 min for spore germination; and (iii) inactivation of germinated spores by pressure-assisted thermal processing (586 MPa at 73 degrees C for 10 min). Collectively, this study demonstrates the feasibility of an alternative and novel strategy to inactivate C. perfringens spores in meat products formulated with germinants specific for C

  3. Combined mutation and copy-number variation detection by targeted next-generation sequencing in uveal melanoma.

    PubMed

    Smit, Kyra N; van Poppelen, Natasha M; Vaarwater, Jolanda; Verdijk, Robert; van Marion, Ronald; Kalirai, Helen; Coupland, Sarah E; Thornton, Sophie; Farquhar, Neil; Dubbink, Hendrikus-Jan; Paridaens, Dion; de Klein, Annelies; Kiliç, Emine

    2018-05-01

    Uveal melanoma is a highly aggressive cancer of the eye, in which nearly 50% of the patients die from metastasis. It is the most common type of primary eye cancer in adults. Chromosome and mutation status have been shown to correlate with the disease-free survival. Loss of chromosome 3 and inactivating mutations in BAP1, which is located on chromosome 3, are strongly associated with 'high-risk' tumors that metastasize early. Other genes often involved in uveal melanoma are SF3B1 and EIF1AX, which are found to be mutated in intermediate- and low-risk tumors, respectively. To obtain genetic information of all genes in one test, we developed a targeted sequencing method that can detect mutations in uveal melanoma genes and chromosomal anomalies in chromosome 1, 3, and 8. With as little as 10 ng DNA, we obtained enough coverage on all genes to detect mutations, such as substitutions, deletions, and insertions. These results were validated with Sanger sequencing in 28 samples. In >90% of the cases, the BAP1 mutation status corresponded to the BAP1 immunohistochemistry. The results obtained in the Ion Torrent single-nucleotide polymorphism assay were confirmed with several other techniques, such as fluorescence in situ hybridization, multiplex ligation-dependent probe amplification, and Illumina SNP array. By validating our assay in 27 formalin-fixed paraffin-embedded and 43 fresh uveal melanomas, we show that mutations and chromosome status can reliably be obtained using targeted next-generation sequencing. Implementing this technique as a diagnostic pathology application for uveal melanoma will allow prediction of the patients' metastatic risk and potentially assess eligibility for new therapies.

  4. Heat-Denatured Lysozyme Inactivates Murine Norovirus as a Surrogate Human Norovirus.

    PubMed

    Takahashi, Hajime; Nakazawa, Moemi; Ohshima, Chihiro; Sato, Miki; Tsuchiya, Tomoki; Takeuchi, Akira; Kunou, Masaaki; Kuda, Takashi; Kimura, Bon

    2015-07-02

    Human norovirus infects humans through the consumption of contaminated food, contact with the excrement or vomit of an infected person, and through airborne droplets that scatter the virus through the air. Being highly infectious and highly viable in the environment, inactivation of the norovirus requires a highly effective inactivating agent. In this study, we have discovered the thermal denaturing capacity of a lysozyme with known antimicrobial activity against gram-positive bacteria, as well as its inactivating effect on murine norovirus. This study is the first report on the norovirus-inactivating effects of a thermally denatured lysozyme. We observed that lysozymes heat-treated for 40 min at 100 °C caused a 4.5 log reduction in infectivity of norovirus. Transmission electron microscope analysis showed that virus particles exposed to thermally denatured lysozymes were expanded, compared to the virus before exposure. The amino acid sequence of the lysozyme was divided into three sections and the peptides of each artificially synthesised, in order to determine the region responsible for the inactivating effect. These results suggest that thermal denaturation of the lysozyme changes the protein structure, activating the region responsible for imparting an inactivating effect against the virus.

  5. Design and mechanism of tetrahydrothiophene-based γ-aminobutyric acid aminotransferase inactivators.

    PubMed

    Le, Hoang V; Hawker, Dustin D; Wu, Rui; Doud, Emma; Widom, Julia; Sanishvili, Ruslan; Liu, Dali; Kelleher, Neil L; Silverman, Richard B

    2015-04-08

    Low levels of γ-aminobutyric acid (GABA), one of two major neurotransmitters that regulate brain neuronal activity, are associated with many neurological disorders, such as epilepsy, Parkinson's disease, Alzheimer's disease, Huntington's disease, and cocaine addiction. One of the main methods to raise the GABA level in human brain is to use small molecules that cross the blood-brain barrier and inhibit the activity of γ-aminobutyric acid aminotransferase (GABA-AT), the enzyme that degrades GABA. We have designed a series of conformationally restricted tetrahydrothiophene-based GABA analogues with a properly positioned leaving group that could facilitate a ring-opening mechanism, leading to inactivation of GABA-AT. One compound in the series is 8 times more efficient an inactivator of GABA-AT than vigabatrin, the only FDA-approved inactivator of GABA-AT. Our mechanistic studies show that the compound inactivates GABA-AT by a new mechanism. The metabolite resulting from inactivation does not covalently bind to amino acid residues of GABA-AT but stays in the active site via H-bonding interactions with Arg-192, a π-π interaction with Phe-189, and a weak nonbonded S···O═C interaction with Glu-270, thereby inactivating the enzyme.

  6. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  7. Dog response to inactivated canine parvovirus and feline panleukopenia virus vaccines.

    PubMed

    Pollock, R V; Carmichael, L E

    1982-01-01

    Inactivated canine parvovirus (CPV) and inactivated feline panleukopenia virus (FPV) vaccines were evaluated in dogs. Maximal serologic response occurred within 1-2 weeks after vaccination. Antibody titers then declined rapidly to low levels that persisted at least 20 weeks. Immunity to CPV, defined as complete resistance to infection, was correlated with serum antibody titer and did not persist longer than 6 weeks after vaccination with inactivated virus. However, protection against generalized infection was demonstrated 20 weeks after vaccination. In unvaccinated dogs, viremia and generalized infection occurred after oronasal challenge with virulent CPV. In contrast, viral replication was restricted to the intestinal tract and gut-associated lymphoid tissue of vaccinated dogs. Canine parvovirus was inactivated by formalin, beta-propiolactone (BPL), and binary ethylenimine (BEI) in serum-free media; inactivation kinetics were determined. Formalin resulted in a greater loss of viral HA than either BEI of BPL, and antigenicity was correspondingly reduced.

  8. Homozygous p.V116* mutation in C12orf65 results in Leigh syndrome.

    PubMed

    Imagawa, Eri; Fattal-Valevski, Aviva; Eyal, Ori; Miyatake, Satoko; Saada, Ann; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Saitsu, Hirotomo; Miyake, Noriko; Matsumoto, Naomichi

    2016-02-01

    Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder associated with mitochondrial dysfunction. LS is characterised by elevated lactate and pyruvate and bilateral symmetric hyperintense lesions in the basal ganglia, thalamus, brainstem, cerebral white matter or spinal cord on T2-weighted MRI. LS is a genetically heterogeneous disease, and to date mutations in approximately 40 genes related to mitochondrial function have been linked to the disorder. We investigated a pair of female monozygotic twins diagnosed with LS from consanguineous healthy parents of Indian origin. Their common clinical features included optic atrophy, ophthalmoplegia, spastic paraparesis and mild intellectual disability. High-blood lactate and high-intensity signal in the brainstem on T2-weighted MRI were consistent with a clinical diagnosis of LS. To identify the genetic cause of their condition, we performed whole exome sequencing. We identified a homozygous nonsense mutation in C12orf65 (NM_001143905; c.346delG, p.V116*) in the affected twins. Interestingly, the identical mutation was previously reported in an Indian family with Charcot-Marie Tooth disease type 6, which displayed some overlapping clinical features with the twins. We demonstrate that the identical nonsense mutation in C12orf65 can result in different clinical features, suggesting the involvement of unknown modifiers. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  9. Mouse cones require an arrestin for normal inactivation of phototransduction.

    PubMed

    Nikonov, Sergei S; Brown, Bruce M; Davis, Jason A; Zuniga, Freddi I; Bragin, Alvina; Pugh, Edward N; Craft, Cheryl M

    2008-08-14

    Arrestins are proteins that arrest the activity of G protein-coupled receptors (GPCRs). While it is well established that normal inactivation of photoexcited rhodopsin, the GPCR of rod phototransduction, requires arrestin (Arr1), it has been controversial whether the same requirement holds for cone opsin inactivation. Mouse cone photoreceptors express two distinct visual arrestins: Arr1 and Arr4. By means of recordings from cones of mice with one or both arrestins knocked out, this investigation establishes that a visual arrestin is required for normal cone inactivation. Arrestin-independent inactivation is 70-fold more rapid in cones than in rods, however. Dual arrestin expression in cones could be a holdover from ancient genome duplication events that led to multiple isoforms of arrestin, allowing evolutionary specialization of one form while the other maintains the basic function.

  10. Heat inactivation of poliovirus in wastewater sludge

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ward, R.L.; Ashley, C.S.; Moseley, R.H.

    1976-09-01

    The effect of raw and anaerobically digested sludge on heat inactivation of poliovirus was investigated. Raw sludge was found to be very protective of poliovirus plaque-forming ability at all temperatures studied, but digested sludge had variable effects that were highly dependent upon the experimental conditions. In low concentrations and at relatively low inactivation temperatures, digested sludge is nearly as protective of poliovirus as raw sludge. However, at higher temperatures and concentrations, digested sludge caused a significant acceleration of poliovirus inactivation. The difference between the protective capability of raw and digested sludge is not due to loss of protective material, becausemore » this component is present in the solids of digested sludge as well as in those of raw sludge. Instead, the difference is due to a virucidal agent acquired during digestion. Addition of this agent to the solids of either raw or digested sludge reverses the protective potential of these solids during heat treatment of poliovirus.« less

  11. E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

    PubMed

    Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

    2017-01-01

    Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

  12. Novel H6PDH mutations in two girls with premature adrenarche: 'apparent' and 'true' CRD can be differentiated by urinary steroid profiling.

    PubMed

    Lavery, G G; Idkowiak, J; Sherlock, M; Bujalska, I; Ride, J P; Saqib, K; Hartmann, M F; Hughes, B; Wudy, S A; De Schepper, J; Arlt, W; Krone, N; Shackleton, C H; Walker, E A; Stewart, P M

    2013-02-01

    Inactivating mutations in the enzyme hexose-6-phosphate dehydrogenase (H6PDH, encoded by H6PD) cause apparent cortisone reductase deficiency (ACRD). H6PDH generates cofactor NADPH for 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1, encoded by HSD11B1) oxo-reductase activity, converting cortisone to cortisol. Inactivating mutations in HSD11B1 cause true cortisone reductase deficiency (CRD). Both ACRD and CRD present with hypothalamic-pituitary-adrenal (HPA) axis activation and adrenal hyperandrogenism. To describe the clinical, biochemical and molecular characteristics of two additional female children with ACRD and to illustrate the diagnostic value of urinary steroid profiling in identifying and differentiating a total of six ACRD and four CRD cases. Clinical, biochemical and genetic assessment of two female patients presenting during childhood. In addition, results of urinary steroid profiling in a total of ten ACRD/CRD patients were compared to identify distinguishing characteristics. Case 1 was compound heterozygous for R109AfsX3 and a novel P146L missense mutation in H6PD. Case 2 was compound heterozygous for novel nonsense mutations Q325X and Y446X in H6PD. Mutant expression studies confirmed loss of H6PDH activity in both cases. Urinary steroid metabolite profiling by gas chromatography/mass spectrometry suggested ACRD in both cases. In addition, we were able to establish a steroid metabolite signature differentiating ACRD and CRD, providing a basis for genetic diagnosis and future individualised management. Steroid profile analysis of a 24-h urine collection provides a diagnostic method for discriminating between ACRD and CRD. This will provide a useful tool in stratifying unresolved adrenal hyperandrogenism in children with premature adrenarche and adult females with polycystic ovary syndrome (PCOS).

  13. Intragenic SNP haplotypes associated with 84dup18 mutation in TNFRSF11A in four FEO pedigrees suggest three independent origins for this mutation.

    PubMed

    Elahi, Elahe; Shafaghati, Yousef; Asadi, Sareh; Absalan, Farnaz; Goodarzi, Hani; Gharaii, Nava; Karimi-Nejad, Mohammad Hassan; Shahram, Farhad; Hughes, Anne E

    2007-01-01

    Familial expansile osteolysis (FEO) is a rare disorder causing bone dysplasia. The clinical features of FEO include early-onset hearing loss, tooth destruction, and progressive lytic expansion within limb bones causing pain, fracture, and deformity. An 18-bp duplication in the first exon of the TNFRSF11A gene encoding RANK has been previously identified in four FEO pedigrees. Despite having the identical mutation, phenotypic variations among affected individuals of the same and different pedigrees were noted. Another 18-bp duplication, one base proximal to the duplication previously reported, was subsequently found in two unrelated FEO patients. Finally, mutations overlapping with the mutations found in the FEO pedigrees have been found in ESH and early-onset PDB pedigrees. An Iranian FEO pedigree that contains six affected individuals dispersed in three generations has previously been introduced; here, the clinical features of the proband are reported in greater detail, and the genetic defect of the pedigree is presented. Direct sequencing of the entire coding region and upstream and downstream noncoding regions of TNFRSF11A in her DNA revealed the same 18-bp duplication mutation as previously found in the four FEO pedigrees. Additionally, eight sequence variations as compared to the TNFRSF11A reference sequence were identified, and a haplotype linked to the mutation based on these variations was defined. Although the mutation in the Iranian and four of the previously described FEO pedigrees was the same, haplotypes based on the intragenic SNPs suggest that the mutations do not share a common descent.

  14. Paternal GNAS Mutations Lead to Severe Intrauterine Growth Retardation (IUGR) and Provide Evidence for a Role of XLαs in Fetal Development

    PubMed Central

    Richard, Nicolas; Molin, Arnaud; Coudray, Nadia; Rault-Guillaume, Pauline; Jüppner, Harald

    2013-01-01

    Context: Heterozygous GNAS inactivating mutations cause pseudohypoparathyroidism type Ia (PHP-Ia) when maternally inherited and pseudopseudohypoparathyroidism (PPHP)/progressive osseous heteroplasia (POH) when paternally inherited. Recent studies have suggested that mutations on the paternal, but not the maternal, GNAS allele could be associated with intrauterine growth retardation (IUGR) and thus small size for gestational age. Objectives: The aim of the study was to confirm and expand these findings in a large number of patients presenting with either PHP-Ia or PPHP/POH. Patients and Methods: We collected birth parameters (ie, gestational age, weight, length, and head circumference) of patients with either PHP-Ia (n = 29) or PPHP/POH (n = 26) with verified GNAS mutations. The parental allele carrying the mutation was assessed by investigating the parents or, when a de novo mutation was identified, through informative intragenic polymorphisms. Results: Heterozygous GNAS mutations on either parental allele were associated with IUGR. However, when these mutations are located on the paternal GNAS allele, IUGR was considerably more pronounced than with mutations on the maternal allele. Moreover, birth weights were lower with paternal GNAS mutations affecting exons 2–13 than with exon 1/intron 1 mutations. Conclusions: These data indicate that a paternally derived GNAS transcript, possibly XLαs, is required for normal fetal growth and development and that this transcript affects placental functions. Thus, similar to other imprinted genes, GNAS controls growth and/or fetal development. PMID:23884777

  15. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations

    PubMed Central

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-01-01

    Objective(s): The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. Materials and Methods: The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. Results: Results showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. Conclusions: The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin. PMID:24570831

  16. Expression of acrA and acrB Genes in Esherichia coli Mutants with or without marR or acrR Mutations.

    PubMed

    Pourahmad Jaktaji, Razieh; Jazayeri, Nasim

    2013-12-01

    The major antibiotic efflux pump of Esherichia coli is AcrAB-TolC. The first part of the pump, AcrAB, is encoded by acrAB operon. The expression of this operon can be kept elevated by overexpression of an activator, MarA following inactivation of MarR and AcrR repressors due to mutation in encoding genes, marR and acrR, respectively. The aims of this research were to use E. coli mutants with or without mutation in marR to search for the presence of possible mutation in acrR and to quantify the expression of acrAB. The DNA binding region of acrR gene in these mutants were amplified by PCR and sequenced. The relative expression of acrA and acrB were determined by real time PCR. RESULTS showed that W26 and C14 had the same mutation in acrR, but none of the mutants overexpressed acrA and acrB in comparison with wild type strain. The effect of marR or acrR mutation on acrAB overexpression is dependent on levels of resistance to tetracycline and ciprofloxacin.

  17. Increased skewing of X chromosome inactivation in Rett syndrome patients and their mothers.

    PubMed

    Knudsen, Gun Peggy S; Neilson, Tracey C S; Pedersen, June; Kerr, Alison; Schwartz, Marianne; Hulten, Maj; Bailey, Mark E S; Orstavik, Karen Helene

    2006-11-01

    Rett syndrome is a largely sporadic, X-linked neurological disorder with a characteristic phenotype, but which exhibits substantial phenotypic variability. This variability has been partly attributed to an effect of X chromosome inactivation (XCI). There have been conflicting reports regarding incidence of skewed X inactivation in Rett syndrome. In rare familial cases of Rett syndrome, favourably skewed X inactivation has been found in phenotypically normal carrier mothers. We have investigated the X inactivation pattern in DNA from blood and buccal cells of sporadic Rett patients (n=96) and their mothers (n=84). The mean degree of skewing in blood was higher in patients (70.7%) than controls (64.9%). Unexpectedly, the mothers of these patients also had a higher mean degree of skewing in blood (70.8%) than controls. In accordance with these findings, the frequency of skewed (XCI > or =80%) X inactivation in blood was also higher in both patients (25%) and mothers (30%) than in controls (11%). To test whether the Rett patients with skewed X inactivation were daughters of skewed mothers, 49 mother-daughter pairs were analysed. Of 14 patients with skewed X inactivation, only three had a mother with skewed X inactivation. Among patients, mildly affected cases were shown to be more skewed than more severely affected cases, and there was a trend towards preferential inactivation of the paternally inherited X chromosome in skewed cases. These findings, particularly the greater degree of X inactivation skewing in Rett syndrome patients, are of potential significance in the analysis of genotype-phenotype correlations in Rett syndrome.

  18. Analysis of transcription factors key for mouse pancreatic development establishes NKX2-2 and MNX1 mutations as causes of neonatal diabetes in man.

    PubMed

    Flanagan, Sarah E; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M; Edge, Julie A; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A L; Edghill, Emma L; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T

    2014-01-07

    Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Analysis of Transcription Factors Key for Mouse Pancreatic Development Establishes NKX2-2 and MNX1 Mutations as Causes of Neonatal Diabetes in Man

    PubMed Central

    Flanagan, Sarah E.; De Franco, Elisa; Lango Allen, Hana; Zerah, Michele; Abdul-Rasoul, Majedah M.; Edge, Julie A.; Stewart, Helen; Alamiri, Elham; Hussain, Khalid; Wallis, Sam; de Vries, Liat; Rubio-Cabezas, Oscar; Houghton, Jayne A.L.; Edghill, Emma L.; Patch, Ann-Marie; Ellard, Sian; Hattersley, Andrew T.

    2014-01-01

    Summary Understanding transcriptional regulation of pancreatic development is required to advance current efforts in developing beta cell replacement therapies for patients with diabetes. Current knowledge of key transcriptional regulators has predominantly come from mouse studies, with rare, naturally occurring mutations establishing their relevance in man. This study used a combination of homozygosity analysis and Sanger sequencing in 37 consanguineous patients with permanent neonatal diabetes to search for homozygous mutations in 29 transcription factor genes important for murine pancreatic development. We identified homozygous mutations in 7 different genes in 11 unrelated patients and show that NKX2-2 and MNX1 are etiological genes for neonatal diabetes, thus confirming their key role in development of the human pancreas. The similar phenotype of the patients with recessive mutations and mice with inactivation of a transcription factor gene support there being common steps critical for pancreatic development and validate the use of rodent models for beta cell development. PMID:24411943

  20. Correlation between Relatives given Complete Genotypes: from Identity by Descent to Identity by Function

    PubMed Central

    Sverdlov, Serge; Thompson, Elizabeth A.

    2013-01-01

    In classical quantitative genetics, the correlation between the phenotypes of individuals with unknown genotypes and a known pedigree relationship is expressed in terms of probabilities of IBD states. In existing approaches to the inverse problem where genotypes are observed but pedigree relationships are not, dependence between phenotypes is either modeled as Bayesian uncertainty or mapped to an IBD model via inferred relatedness parameters. Neither approach yields a relationship between genotypic similarity and phenotypic similarity with a probabilistic interpretation corresponding to a generative model. We introduce a generative model for diploid allele effect based on the classic infinite allele mutation process. This approach motivates the concept of IBF (Identity by Function). The phenotypic covariance between two individuals given their diploid genotypes is expressed in terms of functional identity states. The IBF parameters define a genetic architecture for a trait without reference to specific alleles or population. Given full genome sequences, we treat a gene-scale functional region, rather than a SNP, as a QTL, modeling patterns of dominance for multiple alleles. Applications demonstrated by simulation include phenotype and effect prediction and association, and estimation of heritability and classical variance components. A simulation case study of the Missing Heritability problem illustrates a decomposition of heritability under the IBF framework into Explained and Unexplained components. PMID:23851163