Shukla, Jayendra Nath; Palli, Subba Reddy
2012-01-01
Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109
Kin5 Knockdown in Tetrahymena thermophila Using RNAi Blocks Cargo Transport of Gef1
Awan, Aashir; Bell, Aaron J.; Satir, Peter
2009-01-01
A critical process that builds and maintains the eukaryotic cilium is intraflagellar transport (IFT). This process utilizes members of the kinesin-2 superfamily to transport cargo into the cilium (anterograde transport) and a dynein motor for the retrograde traffic. Using a novel RNAi knockdown method, we have analyzed the function of the homodimeric IFT kinesin-2, Kin5, in Tetrahymena ciliary transport. In RNAi transformants, Kin5 was severely downregulated and disappeared from the cilia, but cilia did not resorb, although tip structure was affected. After deciliation of the knockdown cell, cilia regrew and cells swam, which suggested that Kin5 is not responsible for the trafficking of axonemal precursors to build the cilium, but could be transporting molecules that act in ciliary signal transduction, such as guanine nucleotide exchange proteins (GEFs). Gef1 is a Tetrahymena ciliary protein, and current coimmunoprecipitation and immunofluorescence studies showed that it is absent in regrowing cilia of the knockdown cells lacking ciliary Kin5. We suggest that one important cargo of Kin5 is Gef1 and knockdown of Kin5 results in cell lethality. PMID:19290045
Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A
2011-02-01
To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...
2016-02-17
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Griffith, Elen; Coutts, Amanda S; Black, Donald M
2005-03-01
TES was originally identified as a candidate tumour suppressor gene and has subsequently been found to encode a novel focal adhesion protein. As well as localising to cell-matrix adhesions, TES localises to cell-cell contacts and to actin stress fibres. TES interacts with a variety of cytoskeletal proteins including zyxin, mena, VASP, talin and actin. There is evidence that TES may function in actin-dependent processes as overexpression of TES results in increased cell spreading and decreased cell motility. Together with TES's interacting partners, these data suggest that TES might be involved in regulation of the actin cytoskeleton. Here, for the first time, we have used RNAi to successfully knockdown TES in HeLa cells and we demonstrate that loss of TES from focal adhesions results in loss of actin stress fibres. Similarly, and as previously reported, RNAi-mediated knockdown of zyxin results in loss of actin stress fibres. TES siRNA treated cells show reduced RhoA activity, suggesting that the Rho GTPase pathway may be involved in the TES RNAi-induced loss of stress fibres. We have also used RNAi to examine the requirement of TES and zyxin for each other's localisation at focal adhesions, and we propose a hierarchy of recruitment, with zyxin being first, followed by VASP and then TES. Cell Motil. Copyright 2005 Wiley-Liss, Inc.
RNAi-mediated knock-down of Dab and Numb attenuate Aβ levels via γ-secretase mediated APP processing
2012-01-01
Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided. PMID:23211096
Xie, Zhongcong; Dong, Yuanlin; Maeda, Uta; Xia, Weiming; Tanzi, Rudolph E
2012-03-22
Amyloid-β-protein (Aβ), the key component of senile plaques in Alzheimer's disease (AD) brain, is produced from amyloid precursor protein (APP) by cleavage of β-secretase and then γ-secretase. APP adaptor proteins with phosphotyrosine-binding (PTB) domains, including Dab (gene: DAB) and Numb (gene: NUMB), can bind to and interact with the conserved YENPTY-motif in the APP C-terminus. Here we describe, for the first time, the effects of RNAi knock-down of Dab and Numb expression on APP processing and Aβ production. RNAi knock-down of Dab and Numb in H4 human neuroglioma cells stably transfected to express either FL-APP (H4-FL-APP cells) or APP-C99 (H4-APP-C99 cells) increased levels of APP-C-terminal fragments (APP-CTFs) and lowered Aβ levels in both cell lines by inhibiting γ-secretase cleavage of APP. Finally, RNAi knock-down of APP also reduced levels of Numb in H4-APP cells. These findings suggest that pharmacologically blocking interaction of APP with Dab and Numb may provide novel therapeutic strategies of AD. The notion of attenuating γ-secretase cleavage of APP via the APP adaptor proteins, Dab and Numb, is particularly attractive with regard to therapeutic potential, given that side effects of γ-secretase inhibition owing to impaired proteolysis of other γ-secretase substrates, e.g. Notch, might be avoided.
Al-Ayedh, Hassan; Rizwan-Ul-Haq, Muhammad; Hussain, Abid; Aljabr, Ahmed M
2016-11-01
Palm trees around the world are prone to notorious Rhynchophorus ferrugineus, which causes heavy losses of palm plantations. In Middle Eastern countries, this pest is a major threat to date palm orchards. Conventional pest control measures with the major share of synthetic insecticides have resulted in insect resistance and environmental issues. Therefore, in order to explore better alternatives, the RNAi approach was employed to knock down the catalase gene in fifth and tenth larval instars with different dsRNA application methods, and their insecticidal potency was studied. dsRNA of 444 bp was prepared to knock down catalase in R. ferrugineus. Out of the three dsRNA application methods, dsRNA injection into larvae was the most effective, followed by dsRNA application by artificial feeding. Both methods resulted in significant catalase knockdown in various tissues, especially the midgut. As a result, the highest growth inhibition of 123.49 and 103.47% and larval mortality of 80 and 40% were observed in fifth-instar larvae, whereas larval growth inhibition remained at 86.83 and 69.08% with larval mortality at 30 and 10% in tenth-instar larvae after dsRNA injection and artificial diet treatment. The topical application method was the least efficient, with the lowest larval growth inhibition of 57.23 and 45.61% and 0% mortality in fifth- and tenth-instar larvae. Generally, better results were noted at the high dsRNA dose of 5 µL. Catalase enzyme is found in most insect body tissues, and thus its dsRNA can cause broad-scale gene knockdown within the insect body, depending upon the application method. Significant larval mortality and growth inhibition after catalase knockdown in R. ferrugineus confirms its insecticidal potency and suggests a bright future for RNAi-based bioinsecticides in pest control. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
Jadiya, Pooja; Nazir, Aamir
2014-01-01
Background The approach of RNAi mediated gene knockdown, employing exogenous dsRNA, is being beneficially exploited in various fields of functional genomics. The immense utility of the approach came to fore from studies with model system C. elegans, but quickly became applicable with varied research models ranging from in vitro to various in vivo systems. Previously, there have been reports on the refractoriness of the neuronal cells to RNAi mediated gene silencing following which several modulators like eri-1 and lin-15 were described in C. elegans which, when present, would negatively impact the gene knockdown. Methodology/Principal Findings Taking a clue from these findings, we went on to screen hypothesis-driven- methodologies towards exploring the efficiency in the process of RNAi under various experimental conditions, wherein these genes would be knocked down preceding to, or concurrently with, the knocking down of a gene of interest. For determining the efficiency of gene knockdown, we chose to study visually stark phenotypes of uncoordinated movement, dumpy body morphology and blistered cuticle obtained by knocking down of genes unc-73, dpy-9 and bli-3 respectively, employing the RNAi-by-feeding protocol in model system C. elegans. Conclusions/Significance Our studies led to a very interesting outcome as the results reveal that amongst various methods tested, pre-incubation with eri-1 dsRNA synthesizing bacteria followed by co-incubation with eri-1 and gene-of-interest dsRNA synthesizing bacteria leads to the most efficient gene silencing as observed by the analysis of marker phenotypes. This provides an approach for effectively employing RNAi induced gene silencing while working with different genetic backgrounds including transgenic and mutant strains. PMID:24475317
Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G
2016-07-14
The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.
Unsupervised automated high throughput phenotyping of RNAi time-lapse movies.
Failmezger, Henrik; Fröhlich, Holger; Tresch, Achim
2013-10-04
Gene perturbation experiments in combination with fluorescence time-lapse cell imaging are a powerful tool in reverse genetics. High content applications require tools for the automated processing of the large amounts of data. These tools include in general several image processing steps, the extraction of morphological descriptors, and the grouping of cells into phenotype classes according to their descriptors. This phenotyping can be applied in a supervised or an unsupervised manner. Unsupervised methods are suitable for the discovery of formerly unknown phenotypes, which are expected to occur in high-throughput RNAi time-lapse screens. We developed an unsupervised phenotyping approach based on Hidden Markov Models (HMMs) with multivariate Gaussian emissions for the detection of knockdown-specific phenotypes in RNAi time-lapse movies. The automated detection of abnormal cell morphologies allows us to assign a phenotypic fingerprint to each gene knockdown. By applying our method to the Mitocheck database, we show that a phenotypic fingerprint is indicative of a gene's function. Our fully unsupervised HMM-based phenotyping is able to automatically identify cell morphologies that are specific for a certain knockdown. Beyond the identification of genes whose knockdown affects cell morphology, phenotypic fingerprints can be used to find modules of functionally related genes.
USDA-ARS?s Scientific Manuscript database
Ecdysteroids play a critical role in coordinating insect growth, development, and reproduction. A suite of cytochrome P450 monooxygenases coded by what are collectively termed Halloween genes mediate ecdysteroid biosynthesis. In this study, we describe cloning and RNAi-mediated knockdown of the CYP3...
Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos
2014-01-01
Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631
Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice
De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.
2006-01-01
RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951
Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki
2009-01-01
Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) has resurged as one of the most troublesome household pests affecting people across the globe. Bed bug infestations have increased in recent years primarily due to the evolution of insecticide resistance and the insect's ability to hitchhike with travelers. vATPases are one of the most evolutionarily conserved holoenzymes in eukaryotes, which are mainly involved in proton transport across the plasma membranes and intracellular organelles. RNA interference (RNAi) has been developed as a promising tool for insect control. In this study, we used RNAi as an approach to knock down subunits A and E of the vATPase gene of bed bugs. Delivery of 0.2 µg/insect of dsRNA specific to vATPase-A and vATPase-E into female bed bugs dramatically impaired the laying and viability of eggs over time. Injection of the vATPase-E dsRNA decreased survival of the bed bugs over 30 d. Our results also showed that the knockdown of mRNA is highly effective and persistent up to 30 d post injection. This research demonstrated that silencing of the two vATPase subunits A and E offers a potential strategy to suppress bed bug populations.
RNAi phenotype profiling of kinases identifies potential therapeutic targets in Ewing's sarcoma.
Arora, Shilpi; Gonzales, Irma M; Hagelstrom, R Tanner; Beaudry, Christian; Choudhary, Ashish; Sima, Chao; Tibes, Raoul; Mousses, Spyro; Azorsa, David O
2010-08-18
Ewing's sarcomas are aggressive musculoskeletal tumors occurring most frequently in the long and flat bones as a solitary lesion mostly during the teen-age years of life. With current treatments, significant number of patients relapse and survival is poor for those with metastatic disease. As part of novel target discovery in Ewing's sarcoma, we applied RNAi mediated phenotypic profiling to identify kinase targets involved in growth and survival of Ewing's sarcoma cells. Four Ewing's sarcoma cell lines TC-32, TC-71, SK-ES-1 and RD-ES were tested in high throughput-RNAi screens using a siRNA library targeting 572 kinases. Knockdown of 25 siRNAs reduced the growth of all four Ewing's sarcoma cell lines in replicate screens. Of these, 16 siRNA were specific and reduced proliferation of Ewing's sarcoma cells as compared to normal fibroblasts. Secondary validation and preliminary mechanistic studies highlighted the kinases STK10 and TNK2 as having important roles in growth and survival of Ewing's sarcoma cells. Furthermore, knockdown of STK10 and TNK2 by siRNA showed increased apoptosis. In summary, RNAi-based phenotypic profiling proved to be a powerful gene target discovery strategy, leading to successful identification and validation of STK10 and TNK2 as two novel potential therapeutic targets for Ewing's sarcoma.
Conditional RNAi: towards a silent gene therapy.
Lee, Sang-Kyung; Kumar, Priti
2009-07-02
RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.
Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang
2014-01-01
Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.
Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang
2014-01-01
Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592
Suzuki, Masataka G.; Ito, Haruka; Aoki, Fugaku
2014-01-01
Sexual differentiation in Bombyx mori is controlled by sex-specific splicing of Bmdsx, which results in the omission of exons 3 and 4 in a male-specific manner. In B. mori, insulin-like growth factor II mRNA-binding protein (Imp) is a male-specific factor involved in male-specific splicing of Bmdsx. Male-specific Imp mRNA results from the male-specific inclusion of exon 8. To verify the link between histone methylation and alternative RNA processing in Imp, we examined the effects of RNAi-mediated knockdown of several histone methyltransferases on the sex-specific mRNA expression of Imp. As a result, male-specific expression of Imp mRNA was completely abolished when expression of the H3K79 methyltransferase DOT1L was repressed to <10% of that in control males. Chromatin immunoprecipitation-quantitative PCR analysis revealed a higher distribution of H3K79me2 in normal males than in normal females across Imp. RNA polymerase II (RNAP II) processivity assays indicated that RNAi knockdown of DOT1L in males caused a twofold decrease in RNAP II processivity compared to that in control males, with almost equivalent levels to those observed in normal females. Inhibition of RNAP II-mediated elongation in male cells repressed the male-specific splicing of Imp. Our data suggest the possibility that H3K79me2 accumulation along Imp is associated with the male-specific alternative processing of Imp mRNA that results from increased RNAP II processivity. PMID:24758924
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).
Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash
2015-01-01
The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S
2011-11-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular
Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen
2011-01-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury
Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2017-01-01
The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039
Firnhaber, Christopher; Hammarlund, Marc
2013-11-01
Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.
Identification of JAK/STAT pathway regulators—Insights from RNAi screens
Müller, Patrick; Boutros, Michael; Zeidler, Martin P.
2008-01-01
While many core JAK/STAT pathway components have been discovered in Drosophila via classical genetic approaches, the identification of pathway regulators has been more challenging. Recently two cell-based RNAi screens for JAK/STAT pathway regulators have been undertaken using libraries of double-stranded RNAs targeting a large proportion of the predicted Drosophila transcriptome. While both screens identified multiple regulators, only relatively few loci are common to both data sets. Here we compare the two screens and discuss these differences. Although many factors are likely to be contributory, differences in the assay design are of key importance. Low levels of stimulation favouring the identification of negative pathway regulators and high levels of stimulation favouring the identification of positively acting factors. Ultimately, the results from both screens are likely to be largely complementary and have identified a range of novel candidate regulators of JAK/STAT pathway activity as a starting point for new research directions in the future. PMID:18586112
Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang
2015-01-01
We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.
ERIC Educational Resources Information Center
Roy, Nicole M.
2013-01-01
RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…
Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F
2015-04-20
Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Establishment of a tissue-specific RNAi system in C. elegans.
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo
2007-10-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.
Establishment of a tissue-specific RNAi system in C. elegans
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo
2011-01-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718
Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan
2013-01-01
RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001
Catalytic in vivo protein knockdown by small-molecule PROTACs
Bondeson, Daniel P; Mares, Alina; Smith, Ian E D; Ko, Eunhwa; Campos, Sebastien; Miah, Afjal H; Mulholland, Katie E; Routly, Natasha; Buckley, Dennis L; Gustafson, Jeffrey L; Zinn, Nico; Grandi, Paola; Shimamura, Satoko; Bergamini, Giovanna; Faelth-Savitski, Maria; Bantscheff, Marcus; Cox, Carly; Gordon, Deborah A; Willard, Ryan R; Flanagan, John J; Casillas, Linda N; Votta, Bartholomew J; den Besten, Willem; Famm, Kristoffer; Kruidenier, Laurens; Carter, Paul S; Harling, John D; Churcher, Ian; Crews, Craig M
2015-01-01
The current predominant theapeutic paradigm is based on maximizing drug-receptor occupancy to achieve clinical benefit. This strategy, however, generally requires excessive drug concentrations to ensure sufficient occupancy, often leading to adverse side effects. Here, we describe major improvements to the proteolysis targeting chimeras (PROTACs) method, a chemical knockdown strategy in which a heterobifunctional molecule recruits a specific protein target to an E3 ubiquitin ligase, resulting in the target’s ubiquitination and degradation. These compounds behave catalytically in their ability to induce the ubiquitination of super-stoichiometric quantities of proteins, providing efficacy that is not limited by equilibrium occupancy. We present two PROTACs that are capable of specifically reducing protein levels by >90% at nanomolar concentrations. In addition, mouse studies indicate that they provide broad tissue distribution and knockdown of the targeted protein in tumor xenografts. Together, these data demonstrate a protein knockdown system combining many of the favorable properties of small-molecule agents with the potent protein knockdown of RNAi and CRISPR. PMID:26075522
Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef
2017-02-01
The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wu, Ke; Hoy, Marjorie A.
2014-01-01
Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis. PMID:25329675
Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis)
Chaoyang Zhao; Miguel A. Alvarez Gonzales; Therese M. Poland; Omprakash Mittapalli
2015-01-01
The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong...
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E
2018-02-01
RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.
Paudel, Jamuna Risal; Davidson, Charlotte; Song, Jun; Maxim, Itkin; Aharoni, Asaph; Tai, Helen H
2017-11-01
Steroidal glycoalkaloids (SGAs) are major secondary metabolites constitutively produced in cultivated potato Solanum tuberosum, and α-solanine and α-chaconine are the most abundant SGAs. SGAs are toxic to humans at high levels but their role in plant protection against pests and pathogens is yet to be established. In this study, levels of SGAs in potato were reduced by RNA interference (RNAi)-mediated silencing of GLYCOALKALOID METABOLISM 4 (GAME4)-a gene encoding cytochrome P450, involved in an oxidation step in the conversion of cholesterol to SGA aglycones. Two GAME4 RNAi lines, T8 and T9, were used to investigate the effects of manipulation of the SGA biosynthetic pathway in potato. Growth and development of an insect pest, Colorado potato beetle (CPB), were affected in these lines. While no effect on CPB leaf consumption or weight gain was observed, early instar larval death and accelerated development of the insect was found while feeding on leaves of GAME4 RNAi lines. Modulation of SGA biosynthetic pathway in GAME4 RNAi plants was associated with a larger alteration to the metabolite profile, including increased levels of one or both the steroidal saponins or phytoecdysteroids, which could affect insect mortality as well as development time. Colonization by Verticillium dahliae on GAME4 RNAi plants was also tested. There were increased pathogen levels in the T8 GAME4 RNAi line but not in the T9. Metabolite differences between T8 and T9 were found and may have contributed to differences in V. dahliae infection. Drought responses created by osmotic stress were not affected by modulation of SGA biosynthetic pathway in potato.
Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.
Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A
2018-05-01
RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Delivery of RNAi reagents in murine models of obesity and diabetes.
Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T
2006-11-29
RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep
Oey, Melanie; Ross, Ian L.; Stephens, Evan; Steinbeck, Janina; Wolf, Juliane; Radzun, Khairul Adzfa; Kügler, Johannes; Ringsmuth, Andrew K.; Kruse, Olaf; Hankamer, Ben
2013-01-01
Single cell green algae (microalgae) are rapidly emerging as a platform for the production of sustainable fuels. Solar-driven H2 production from H2O theoretically provides the highest-efficiency route to fuel production in microalgae. This is because the H2-producing hydrogenase (HYDA) is directly coupled to the photosynthetic electron transport chain, thereby eliminating downstream energetic losses associated with the synthesis of carbohydrate and oils (feedstocks for methane, ethanol and oil-based fuels). Here we report the simultaneous knock-down of three light-harvesting complex proteins (LHCMB1, 2 and 3) in the high H2-producing Chlamydomonas reinhardtii mutant Stm6Glc4 using an RNAi triple knock-down strategy. The resultant Stm6Glc4L01 mutant exhibited a light green phenotype, reduced expression of LHCBM1 (20.6% ±0.27%), LHCBM2 (81.2% ±0.037%) and LHCBM3 (41.4% ±0.05%) compared to 100% control levels, and improved light to H2 (180%) and biomass (165%) conversion efficiencies. The improved H2 production efficiency was achieved at increased solar flux densities (450 instead of ∼100 µE m−2 s−1) and high cell densities which are best suited for microalgae production as light is ideally the limiting factor. Our data suggests that the overall improved photon-to-H2 conversion efficiency is due to: 1) reduced loss of absorbed energy by non-photochemical quenching (fluorescence and heat losses) near the photobioreactor surface; 2) improved light distribution in the reactor; 3) reduced photoinhibition; 4) early onset of HYDA expression and 5) reduction of O2-induced inhibition of HYDA. The Stm6Glc4L01 phenotype therefore provides important insights for the development of high-efficiency photobiological H2 production systems. PMID:23613840
Current issues of RNAi therapeutics delivery and development.
Haussecker, D
2014-12-10
12 years following the discovery of the RNAi mechanism in Man, a number of RNAi therapeutics development candidates have emerged with profiles suggesting that they could become drugs of significant medical importance for diseases like TTR amyloidosis, HBV, solid cancers, and hemophilia. Despite this robust progress, the perception of RNAi therapeutics has been on a roller-coaster ride driven not only by science, but also regulatory trends, the stock markets, and Big Pharma business development decisions [1]. This presentation provides an update on the current state of RNAi therapeutics development with a particular focus on what RNAi delivery can achieve today and key challenges to be overcome to expand therapeutic opportunities. The delivery of RNAi triggers to disease-relevant cell types clearly represents the rate-limiting factor in broadly expanding the applicability of RNAi therapeutics. Today, with at least 3 delivery options (lipid nanoparticles/LNPs, GalNAc-siRNA conjugates, Dynamic PolyConjugates/DPCs) for which profound gene knockdowns have been demonstrated in non-human primates and in the clinic, RNAi therapeutics should in principle be able to address most diseases related to gene expression in the liver. Given the central importance of the liver in systemic physiology, this already represents a significant therapeutic and commercial opportunity rivaling that of e.g. monoclonal antibodies. Beyond the liver, there is a reason to believe that current RNAi therapeutics technologies can address a number of solid tumors (e.g. LNPs), diseases of the eye (e.g. self-delivering RNAi triggers) as well as diseases involving the respiratory epithelium (e.g. aerosolized LNPs), certain phagocytic cells (LNPs), hematopoietic stem cells and their progeny (lentiviral DNA-directed RNAi), vascular endothelial cells (cationic lipoplexes), and certain cell types in the kidney (self-delivering RNAi triggers, DPCs; Table 1). Despite this success, there has been a sense that
2017-01-01
Background Bax inhibitor-1 (BI-1) is an evolutionarily conserved cytoprotective transmembrane protein that acts as a suppressor of Bax-induced apoptosis by regulation of endoplasmic reticulum stress-induced cell death. We knocked down BI-1 in the sensitive dopa decarboxylase (Ddc) expressing neurons of Drosophila melanogaster to investigate its neuroprotective functions. We additionally sought to rescue the BI-1-induced phenotypes by co-expression with the pro-survival Buffy and determined the effect of BI-1 knockdown on the neurodegenerative α-synuclein-induced Parkinson disease (PD) model. Methods We used organismal assays to assess longevity of the flies to determine the effect of the altered expression of BI-1 in the Ddc-Gal4-expressing neurons by employing two RNAi transgenic fly lines. We measured the locomotor ability of these RNAi lines by computing the climbing indices of the climbing ability and compared them to a control line that expresses the lacZ transgene. Finally, we performed biometric analysis of the developing eye, where we counted the number of ommatidia and calculated the area of ommatidial disruption. Results The knockdown of BI-1 in these neurons was achieved under the direction of the Ddc-Gal4 transgene and resulted in shortened lifespan and precocious loss of locomotor ability. The co-expression of Buffy, the Drosophila anti-apoptotic Bcl-2 homologue, with BI-1-RNAi resulted in suppression of the reduced lifespan and impaired climbing ability. Expression of human α-synuclein in Drosophila dopaminergic neurons results in neuronal degeneration, accompanied by the age-dependent loss in climbing ability. We exploited this neurotoxic system to investigate possible BI-1 neuroprotective function. The co-expression of α-synuclein with BI-1-RNAi results in a slight decrease in lifespan coupled with an impairment in climbing ability. In supportive experiments, we employed the neuron-rich Drosophila compound eye to investigate subtle phenotypes
Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses
Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.
2017-01-01
Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327
GenomeRNAi: a database for cell-based RNAi phenotypes.
Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael
2007-01-01
RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.
Bacterial delivery of RNAi effectors: transkingdom RNAi.
Lage, Hermann; Krühn, Andrea
2010-08-18
RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was
GenomeRNAi: a database for cell-based RNAi phenotypes
Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael
2007-01-01
RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at PMID:17135194
Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K
2018-03-22
Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.
miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction
Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A
2015-01-01
RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908
Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili
2016-01-01
Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.
RNAi screen for rapid therapeutic target identification in leukemia patients
Tyner, Jeffrey W.; Deininger, Michael W.; Loriaux, Marc M.; Chang, Bill H.; Gotlib, Jason R.; Willis, Stephanie G.; Erickson, Heidi; Kovacsovics, Tibor; O'Hare, Thomas; Heinrich, Michael C.; Druker, Brian J.
2009-01-01
Targeted therapy has vastly improved outcomes in certain types of cancer. Extension of this paradigm across a broad spectrum of malignancies will require an efficient method to determine the molecular vulnerabilities of cancerous cells. Improvements in sequencing technology will soon enable high-throughput sequencing of entire genomes of cancer patients; however, determining the relevance of identified sequence variants will require complementary functional analyses. Here, we report an RNAi-assisted protein target identification (RAPID) technology that individually assesses targeting of each member of the tyrosine kinase gene family. We demonstrate that RAPID screening of primary leukemia cells from 30 patients identifies targets that are critical to survival of the malignant cells from 10 of these individuals. We identify known, activating mutations in JAK2 and K-RAS, as well as patient-specific sensitivity to down-regulation of FLT1, CSF1R, PDGFR, ROR1, EPHA4/5, JAK1/3, LMTK3, LYN, FYN, PTK2B, and N-RAS. We also describe a previously undescribed, somatic, activating mutation in the thrombopoietin receptor that is sensitive to down-stream pharmacologic inhibition. Hence, the RAPID technique can quickly identify molecular vulnerabilities in malignant cells. Combination of this technique with whole-genome sequencing will represent an ideal tool for oncogenic target identification such that specific therapies can be matched with individual patients. PMID:19433805
High throughput RNAi assay optimization using adherent cell cytometry.
Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W
2011-04-25
siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.
High throughput RNAi assay optimization using adherent cell cytometry
2011-01-01
Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450
NASA Astrophysics Data System (ADS)
Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Yoon, Ho Sup; Swee Chuan, Tjin; Yong, Ken-Tye
2015-09-01
RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications.
Sugahara, Ryohei; Tanaka, Seiji; Shiotsuki, Takahiro
2017-09-01
The Halloween gene SPOOK (SPO) is involved in the production of the active metabolite of ecdysteroid, 20-hydroxyecdysone (20E), in insects. A previous study showed that RNAi-mediated knockdown of SPO in Schistocerca gregaria last instar nymphs markedly reduced the hemolymph 20E titer, but did not affect metamorphosis. In the present study, the effects of SPO interference on development were re-examined in this locust. Injections of SPO double-stranded RNA (dsSPO) into nymphs at mid and late instars significantly delayed nymphal development and interfered with molting. The 20E levels of dsSPO-treated nymphs were generally low, with a delayed, small peak, suggesting that disturbance of the 20E levels caused the above developmental abnormalities. A small proportion of the dsSPO-injected nymphs metamorphosed precociously, producing adults and adultoids. Precocious adults were characterized by small body size, short wings with abbreviated venation, and normal reproductive activity. Fourth instar nymphs that precociously metamorphosed at the following instar exhibited temporal expression patterns of ecdysone-induced protein 93F and the juvenile hormone (JH) early-inducible gene Krüppel homolog 1 similar to those observed at the last instar in normal nymphs. Adultoids displayed mating behavior and adultoid females developed eggs, but never laid eggs. JH injection around the expected time of the 20E peak in the dsSPO-injected nymphs completely inhibited the appearance of adultoids, suggesting that appearance of adultoids might be due to a reduced titer of JH rather than of 20E. These results suggest that SPO plays an important role in controlling morphogenesis, metamorphosis, and reproduction in S. gregaria. Copyright © 2017 Elsevier Inc. All rights reserved.
Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella.
Hameed, Muhammad Salman; Wang, Zhengbing; Vasseur, Liette; Yang, Guang
2018-04-20
Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella ( PxAgo3 ) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella .
Stable SET knockdown in breast cell carcinoma inhibits cell migration and invasion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Key Laboratory of Modern Toxicology of Shenzhen, Shenzhen Center for Disease Control and Prevention, Shenzhen; Yang, Xi-fei
2014-10-10
Highlights: • We employed RNA interference to knockdown SET expression in breast cancer cells. • Knockdown of SET expression inhibits cell proliferation, migration and invasion. • Knockdown of SET expression increases the activity and expression of PP2A. • Knockdown of SET expression decreases the expression of MMP-9. - Abstract: Breast cancer is the most malignant tumor for women, however, the mechanisms underlying this devastating disease remain unclear. SET is an endogenous inhibitor of protein phosphatase 2A (PP2A) and involved in many physiological and pathological processes. SET could promote the occurrence of tumor through inhibiting PP2A. In this study, we exploremore » the role of SET in the migration and invasion of breast cancer cells MDA-MB-231 and ZR-75-30. The stable suppression of SET expression through lentivirus-mediated RNA interference (RNAi) was shown to inhibit the growth, migration and invasion of breast cancer cells. Knockdown of SET increases the activity and expression of PP2Ac and decrease the expression of matrix metalloproteinase 9 (MMP-9). These data demonstrate that SET may be involved in the pathogenic processes of breast cancer, indicating that SET can serve as a potential therapeutic target for the treatment of breast cancer.« less
Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi.
Swevers, Luc; Liu, Jisheng; Smagghe, Guy
2018-05-01
RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products.
Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi
Liu, Jisheng
2018-01-01
RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products. PMID:29723993
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smialowska, Agata, E-mail: smialowskaa@gmail.com; School of Life Sciences, Södertörn Högskola, Huddinge 141-89; Djupedal, Ingela
Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its rolemore » in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.« less
USDA-ARS?s Scientific Manuscript database
RNAi-mediated knockdown of target transcripts offers great potential, both in terms of insect functional genomics and the development of novel insect pest management strategies. Frequently, dsRNAs targeting transcripts of interest are introduced orally to the target organism via feeding. This delive...
RNAi screening comes of age: improved techniques and complementary approaches
Mohr, Stephanie E.; Smith, Jennifer A.; Shamu, Caroline E.; Neumüller, Ralph A.; Perrimon, Norbert
2014-01-01
Gene silencing through sequence-specific targeting of mRNAs by RNAi has enabled genome-wide functional screens in cultured cells and in vivo in model organisms. These screens have resulted in the identification of new cellular pathways and potential drug targets. Considerable progress has been made to improve the quality of RNAi screen data through the development of new experimental and bioinformatics approaches. The recent availability of genome-editing strategies, such as the CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system, when combined with RNAi, could lead to further improvements in screen data quality and follow-up experiments, thus promoting our understanding of gene function and gene regulatory networks. PMID:25145850
Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
Hameed, Muhammad Salman; Wang, Zhengbing; Yang, Guang
2018-01-01
Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella (PxAgo3) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella. PMID:29677157
Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A
2010-09-01
shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.
Seyhan, Attila A; Varadarajan, Usha; Choe, Sung; Liu, Wei; Ryan, Terence E
2012-04-01
Neratinib (HKI-272) is a small molecule tyrosine kinase inhibitor of the ErbB receptor family currently in Phase III clinical trials. Despite its efficacy, the mechanism of potential cellular resistance to neratinib and genes involved with it remains unknown. We have used a pool-based lentiviral genome-wide functional RNAi screen combined with a lethal dose of neratinib to discover chemoresistant interactions with neratinib. Our screen has identified a collection of genes whose inhibition by RNAi led to neratinib resistance including genes involved in oncogenesis (e.g. RAB33A, RAB6A and BCL2L14), transcription factors (e.g. FOXP4, TFEC, ZNF), cellular ion transport (e.g. CLIC3, TRAPPC2P1, P2RX2), protein ubiquitination (e.g. UBL5), cell cycle (e.g. CCNF), and genes known to interact with breast cancer-associated genes (e.g. CCNF, FOXP4, TFEC, several ZNF factors, GNA13, IGFBP1, PMEPA1, SOX5, RAB33A, RAB6A, FXR1, DDO, TFEC, OLFM2). The identification of novel mediators of cellular resistance to neratinib could lead to the identification of new or neoadjuvant drug targets. Their use as patient or treatment selection biomarkers could make the application of anti-ErbB therapeutics more clinically effective.
Development of RNAi methods for Peregrinus maidis, the corn planthopper.
Yao, Jianxiu; Rotenberg, Dorith; Afsharifar, Alireza; Barandoc-Alviar, Karen; Whitfield, Anna E
2013-01-01
The corn planthopper, Peregrinus maidis, is a major pest of agronomically-important crops. Peregrinus maidis has a large geographical distribution and transmits Maize mosaic rhabdovirus (MMV) and Maize stripe tenuivirus (MSpV). The objective of this study was to develop effective RNAi methods for P. maidis. Vacuolar-ATPase (V-ATPase) is an essential enzyme for hydrolysis of ATP and for transport of protons out of cells thereby maintaining membrane ion balance, and it has been demonstrated to be an efficacious target for RNAi in other insects. In this study, two genes encoding subunits of P. maidis V-ATPase (V-ATPase B and V-ATPase D) were chosen as RNAi target genes. The open reading frames of V-ATPase B and D were generated and used for constructing dsRNA fragments. Experiments were conducted using oral delivery and microinjection of V-ATPase B and V-ATPase D dsRNA to investigate the effectiveness of RNAi in P. maidis. Real-time quantitative reverse transcriptase-PCR (qRT-PCR) analysis indicated that microinjection of V-ATPase dsRNA led to a minimum reduction of 27-fold in the normalized abundance of V-ATPase transcripts two days post injection, while ingestion of dsRNA resulted in a two-fold reduction after six days of feeding. While both methods of dsRNA delivery resulted in knockdown of target transcripts, the injection method was more rapid and effective. The reduction in V-ATPase transcript abundance resulted in observable phenotypes. Specifically, the development of nymphs injected with 200 ng of either V-ATPase B or D dsRNA was impaired, resulting in higher mortality and lower fecundity than control insects injected with GFP dsRNA. Microscopic examination of these insects revealed that female reproductive organs did not develop normally. The successful development of RNAi in P. maidis to target specific genes will enable the development of new insect control strategies and functional analysis of vital genes and genes associated with interactions between P
Brain gene expression changes elicited by peripheral vitellogenin knockdown in the honey bee.
Wheeler, M M; Ament, S A; Rodriguez-Zas, S L; Robinson, G E
2013-10-01
Vitellogenin (Vg) is best known as a yolk protein precursor. Vg also functions to regulate behavioural maturation in adult honey bee workers, but the underlying molecular mechanisms by which it exerts this novel effect are largely unknown. We used abdominal vitellogenin (vg) knockdown with RNA interference (RNAi) and brain transcriptomic profiling to gain insights into how Vg influences honey bee behavioural maturation. We found that vg knockdown caused extensive gene expression changes in the bee brain, with much of this transcriptional response involving changes in central biological functions such as energy metabolism. vg knockdown targeted many of the same genes that show natural, maturation-related differences, but the direction of change for the genes in these two contrasts was not correlated. By contrast, vg knockdown targeted many of the same genes that are regulated by juvenile hormone (JH) and there was a significant correlation for the direction of change for the genes in these two contrasts. These results indicate that the tight coregulatory relationship that exists between JH and Vg in the regulation of honey bee behavioural maturation is manifest at the genomic level and suggest that these two physiological factors act through common pathways to regulate brain gene expression and behaviour. © 2013 Royal Entomological Society.
Gene silencing techniques are widely used to control gene expression and have potential for RNAi-based therapeutics. In this report, transgenic mouse lines were created for conditional knockdown of Srsf3 (SRp20) expression in liver and mammary gland tissues by expressing Srsf3-specific shRNAs driven by a U6 promoter.
Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L
2017-01-01
Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.
Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.
Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung
2016-07-01
Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update
Horn, Thomas; Boutros, Michael
2010-01-01
The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868
Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk
2013-01-01
As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077
Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu
2015-01-01
The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. PMID:26516985
Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W
2004-01-01
We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.
Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei
2013-01-01
The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited "half-ecdysis". In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control.
Zhang, Zan; Xing, Yanru; Li, Fei
2013-01-01
The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1st to 5th instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4th instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20–94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (P<0.05). About 80% of the surviving insects in the siRNA-treated group of five genes (PGCP, chitinase1, tubulin1, tubulin2 and helicase) showed retarded development. In chitinase1-siRNA and chitinase7-siRNA administered groups, 12.5% survivors exhibited “half-ecdysis”. In arf1-siRNA and arf2-siRNA groups, the body color of 15% became black 48 h after injections. In summary, the transcriptome could be a valuable genetic resource for identification of genes in S. exigua and this study provided putative targets for RNAi pest control. PMID
Wang, Jitao; Li, Zhi; Zuo, Changzeng; Xie, Qingfan; Li, Hui; Jia, Junhong; Zhen, Zhongguang; Qi, Ruizhao; Li, Zhiwei; Liu, Dengxiang; Sun, Baijun
2017-10-01
In recent years it was found that the synthesis and biological activity of ribosomes are closely associated with tumor cell growth, tumorigenesis, and malignant transformation. However, the role of regulator of ribosome synthesis 1 (RRS1) in hepatocellular carcinoma (HCC) has not yet been reported. In the present study, we aimed to examine the potential role of RRS1 in tumor cell growth by using a lentivirus-mediated RNA interference (RNAi) system in the HCC cell line SMMC-7721 in vitro. Compared with that of the negative control group (Lv-shCon), the mRNA and protein expression levels of RRS1 in SMMC-7721 cells transfected with Lv-shRRS1 were significantly decreased. Further experiments found that silencing of RRS1 gene expression in SMMC-7721 cells significantly suppressed cell proliferation, inhibited colony formation capacity, increased apoptosis and arrested cells in the G1 phase. These results suggest that the RRS1 gene plays a critical role in cell proliferation, colony formation, cell apoptosis and cell cycle distribution in human HCC cells, and that silencing of RRS1 by RNAi is a promising therapeutic approach for the treatment of HCC, and should be further developed.
Seyhan, Attila A; Varadarajan, Usha; Choe, Sung; Liu, Yan; McGraw, John; Woods, Matthew; Murray, Stuart; Eckert, Amy; Liu, Wei; Ryan, Terence E
2011-06-01
ErbB2 is frequently activated in tumors, and influences a wide array of cellular functions, including proliferation, apoptosis, cell motility and adhesion. HKI-272 (neratinib) is a small molecule pan-kinase inhibitor of the ErbB family of receptor tyrosine kinases, and shows strong antiproliferative activity in ErbB2-overexpressing breast cancer cells. We undertook a genome-wide pooled lentiviral RNAi screen to identify synthetic lethal or enhancer (synthetic modulator screen) genes that interact with neratinib in a human breast cancer cell line (SKBR-3). These genes upon knockdown would modulate cell viability in the presence of subeffective concentrations of neratinib. We discovered a diverse set of genes whose depletion selectively impaired or enhanced the viability of SKBR-3 cells in the presence of neratinib. We observed diverse pathways including EGFR, hypoxia, cAMP, and protein ubiquitination that, when co-treated with RNAi and neratinib, resulted in arrest of cell proliferation. Examining the changes of these genes and their protein products also led to a rationale for clinically relevant drug combination treatments. Treatment of cells with either paclitaxel or cytarabine in combination with neratinib resulted in a strong antiproliferative effect. The identification of novel mediators of cellular response to neratinib and the development of potential drug combination treatments have expanded our understanding of neratinib's mode-of-action for the development of more effective therapeutic regimens. Notably, our findings support a paclitaxel and neratinib phase III clinical trial in breast cancer patients.
The FLIGHT Drosophila RNAi database
Bursteinas, Borisas; Jain, Ekta; Gao, Qiong; Baum, Buzz; Zvelebil, Marketa
2010-01-01
FLIGHT (http://flight.icr.ac.uk/) is an online resource compiling data from high-throughput Drosophila in vivo and in vitro RNAi screens. FLIGHT includes details of RNAi reagents and their predicted off-target effects, alongside RNAi screen hits, scores and phenotypes, including images from high-content screens. The latest release of FLIGHT is designed to enable users to upload, analyze, integrate and share their own RNAi screens. Users can perform multiple normalizations, view quality control plots, detect and assign screen hits and compare hits from multiple screens using a variety of methods including hierarchical clustering. FLIGHT integrates RNAi screen data with microarray gene expression as well as genomic annotations and genetic/physical interaction datasets to provide a single interface for RNAi screen analysis and datamining in Drosophila. PMID:20855970
Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens
2011-10-01
vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens
Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor
2015-09-03
Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.
Xu, Sheng; Wang, Lijuan; Zhang, Bo; Han, Bin; Xie, Yanjie; Yang, Jie; Zhong, Weigong; Chen, Huiping; Wang, Ren; Wang, Ning; Cui, Weiti; Shen, Wenbiao
2012-09-01
Plant heme oxygenase (HO) catalyzes the oxygenation of heme to biliverdin, carbon monoxide (CO), and free iron (Fe(2+))-and Arabidopsis and rice (Oryza sativa) HOs are involved in light signaling. Here, we identified that the rice PHOTOPERIOD SENSITIVITY 5 (SE5) gene, which encoded a putative HO with high similarity to HO-1 from Arabidopsis (HY1), exhibited HO activity, and localized in the chloroplasts. Rice RNAi mutants silenced for SE5 were generated and displayed early flowering under long-day conditions, consistent with phenotypes of the null mutation in SE5 gene reported previously (se5 and s73). The herbicide methyl viologen (MV), which produces reactive oxygen species (ROS), was applied to determine whether SE5 regulates oxidative stress response. Compared with wild-type, SE5 RNAi transgenic plants aggravated seedling growth inhibition, chlorophyll loss and ROS overproduction, and decreased the transcripts of some representative antioxidative genes. By contrast, administration of exogenous CO partially rescued corresponding MV hypersensitivity in the SE5 RNAi plants. Alleviation of seed germination inhibition, chlorophyll loss and ROS overproduction, as well as the induction of antioxidant defense were further observed when SE5 or HY1 was overexpressed in transgenic Arabidopsis plants, indicating that SE5 may be useful for molecular breeding designed to improve plant tolerance to oxidative stress.
Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke
2014-01-01
In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938
Shiobara, Yumiko; Harada, Chiaki; Shiota, Takeshi; Sakamoto, Kimitoshi; Kita, Kiyoshi; Tanaka, Saeko; Tabata, Kenta; Sekie, Kiyoteru; Yamamoto, Yorihiro; Sugiyama, Tomoyasu
2015-12-01
The freshwater planarian is a model organism used to study tissue regeneration that occupies an important position among multicellular organisms. Planarian genomic databases have led to the identification of genes that are required for regeneration, with implications for their roles in its underlying mechanism. Coenzyme Q (CoQ) is a fundamental lipophilic molecule that is synthesized and expressed in every cell of every organism. Furthermore, CoQ levels affect development, life span, disease and aging in nematodes and mice. Because CoQ can be ingested in food, it has been used in preventive nutrition. In this study, we investigated the role of CoQ in planarian regeneration. Planarians synthesize both CoQ9 and rhodoquinone 9 (RQ9). Knockdown of Smed-dlp1, a trans-prenyltransferase gene that encodes an enzyme that synthesizes the CoQ side chain, led to a decrease in CoQ9 and RQ9 levels. However, ATP levels did not consistently decrease in these animals. Knockdown animals exhibited tissue regression and curling. The number of mitotic cells decreased in Smed-dlp1 (RNAi) animals. These results suggested a failure in physiological cell turnover and stem cell function. Accordingly, regenerating planarians died from lysis or exhibited delayed regeneration. Interestingly, the observed phenotypes were partially rescued by ingesting food supplemented with α-tocopherol. Taken together, our results suggest that oxidative stress induced by reduced CoQ9 levels affects planarian regeneration and tissue homeostasis. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Spracklin, George; Fields, Brandon; Wan, Gang; Becker, Diveena; Wallig, Ashley; Shukla, Aditi; Kennedy, Scott
2017-07-01
Gene silencing mediated by dsRNA (RNAi) can persist for multiple generations in Caenorhabditis elegans (termed RNAi inheritance). Here we describe the results of a forward genetic screen in C. elegans that has identified six factors required for RNAi inheritance: GLH-1/VASA, PUP-1/CDE-1, MORC-1, SET-32, and two novel nematode-specific factors that we term here (heritable RNAi defective) HRDE-2 and HRDE-4 The new RNAi inheritance factors exhibit mortal germline (Mrt) phenotypes, which we show is likely caused by epigenetic deregulation in germ cells. We also show that HRDE-2 contributes to RNAi inheritance by facilitating the binding of small RNAs to the inheritance Argonaute (Ago) HRDE-1 Together, our results identify additional components of the RNAi inheritance machinery whose conservation provides insights into the molecular mechanism of RNAi inheritance, further our understanding of how the RNAi inheritance machinery promotes germline immortality, and show that HRDE-2 couples the inheritance Ago HRDE-1 with the small RNAs it needs to direct RNAi inheritance and germline immortality. Copyright © 2017 by the Genetics Society of America.
Environmental RNAi in herbivorous insects.
Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R
2015-05-01
Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Towards the elements of successful insect RNAi.
Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E
2013-12-01
RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.
Tang, Zhong; Fan, Xiaorong; Li, Qing; Feng, Huimin; Miller, Anthony J.; Shen, Qirong; Xu, Guohua
2012-01-01
Root nitrate uptake is well known to adjust to the plant’s nitrogen demand for growth. Long-distance transport and/or root storage pools are thought to provide negative feedback signals regulating root uptake. We have characterized a vascular specific nitrate transporter belonging to the high-affinity Nitrate Transporter2 (NRT2) family, OsNRT2.3a, in rice (Oryza sativa ssp. japonica ‘Nipponbare’). Localization analyses using protoplast expression, in planta promoter-β-glucuronidase assay, and in situ hybridization showed that OsNRT2.3a was located in the plasma membrane and mainly expressed in xylem parenchyma cells of the stele of nitrate-supplied roots. Knockdown expression of OsNRT2.3a by RNA interference (RNAi) had impaired xylem loading of nitrate and decreased plant growth at low (0.5 mm) nitrate supply. In comparison with the wild type, the RNAi lines contained both nitrate and total nitrogen significantly higher in the roots and lower in the shoots. The short-term [15N]NO3− influx (5 min) in entire roots and NO3− fluxes in root surfaces showed that the knockdown of OsNRT2.3a in comparison with the wild type did not affect nitrate uptake by roots. The RNAi plants showed no significant changes in the expression of some root nitrate transporters (OsNRT2.3b, OsNRT2.4, and OsNAR2.1), but transcripts for nia1 (nitrate reductase) had increased and OsNRT2.1 and OsNRT2.2 had decreased when the plants were supplied with nitrate. Taken together, the data demonstrate that OsNRT2.3a plays a key role in long-distance nitrate transport from root to shoot at low nitrate supply level in rice. PMID:23093362
RNAi Screening in Spodoptera frugiperda.
Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K
2016-01-01
RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.
In vivo RNAi: Today and Tomorrow
Perrimon, Norbert; Ni, Jian-Quan; Perkins, Lizabeth
2010-01-01
SUMMARY RNA interference (RNAi) provides a powerful reverse genetics approach to analyze gene functions both in tissue culture and in vivo. Because of its widespread applicability and effectiveness it has become an essential part of the tool box kits of model organisms such as Caenorhabditis elegans, Drosophila, and the mouse. In addition, the use of RNAi in animals in which genetic tools are either poorly developed or nonexistent enables a myriad of fundamental questions to be asked. Here, we review the methods and applications of in vivo RNAi to characterize gene functions in model organisms and discuss their impact to the study of developmental as well as evolutionary questions. Further, we discuss the applications of RNAi technologies to crop improvement, pest control and RNAi therapeutics, thus providing an appreciation of the potential for phenomenal applications of RNAi to agriculture and medicine. PMID:20534712
Gene expression analysis upon lncRNA DDSR1 knockdown in human fibroblasts
Jia, Li; Sun, Zhonghe; Wu, Xiaolin; Misteli, Tom; Sharma, Vivek
2015-01-01
Long non-coding RNAs (lncRNAs) play important roles in regulating diverse biological processes including DNA damage and repair. We have recently reported that the DNA damage inducible lncRNA DNA damage-sensitive RNA1 (DDSR1) regulates DNA repair by homologous recombination (HR). Since lncRNAs also modulate gene expression, we identified gene expression changes upon DDSR1 knockdown in human fibroblast cells. Gene expression analysis after RNAi treatment targeted against DDSR1 revealed 119 genes that show differential expression. Here we provide a detailed description of the microarray data (NCBI GEO accession number GSE67048) and the data analysis procedure associated with the publication by Sharma et al., 2015 in EMBO Reports [1]. PMID:26697398
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Li, Jianwei; Zhang, Guifen; Wan, Fanghao
2015-01-01
The transformer (tra) gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2) gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel). Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest. PMID:26057559
Liu, Guiqing; Wu, Qiang; Li, Jianwei; Zhang, Guifen; Wan, Fanghao
2015-01-01
The transformer (tra) gene appears to act as the genetic switch that promotes female development by interaction with the transformer2 (tra-2) gene in several dipteran species including the Medfly, housefly and Drosophila melanogaster. In this study, we describe the isolation, expression and function of tra and tra-2 in the economically important agricultural pest, the oriental fruit fly, Bactrocera dorsalis (Hendel). Bdtra and Bdtra-2 are similar to their homologs from other tephritid species. Bdtra demonstrated sex-specific transcripts: one transcript in females and two transcripts in males. In contrast, Bdtra-2 only had one transcript that was common to males and females, which was transcribed continuously in different adult tissues and developmental stages. Bdtra-2 and the female form of Bdtra were maternally inherited in eggs, whereas the male form of Bdtra was not detectable until embryos of 1 and 2 h after egg laying. Function analyses of Bdtra and Bdtra-2 indicated that both were indispensable for female development, as nearly 100% males were obtained with embryonic RNAi against either Bdtra or Bdtra-2. The fertility of these RNAi-generated males was subsequently tested. More than 80% of RNAi-generated males could mate and the mated females could lay eggs, but only 40-48.6% males gave rise to progeny. In XX-reversed males and intersex individuals, no clear female gonadal morphology was observed after dissection. These results shed light on the development of a genetic sexing system with male-only release for this agricultural pest.
Considering RNAi experimental design in parasitic helminths.
Dalzell, Johnathan J; Warnock, Neil D; McVeigh, Paul; Marks, Nikki J; Mousley, Angela; Atkinson, Louise; Maule, Aaron G
2012-04-01
Almost a decade has passed since the first report of RNA interference (RNAi) in a parasitic helminth. Whilst much progress has been made with RNAi informing gene function studies in disparate nematode and flatworm parasites, substantial and seemingly prohibitive difficulties have been encountered in some species, hindering progress. An appraisal of current practices, trends and ideals of RNAi experimental design in parasitic helminths is both timely and necessary for a number of reasons: firstly, the increasing availability of parasitic helminth genome/transcriptome resources means there is a growing need for gene function tools such as RNAi; secondly, fundamental differences and unique challenges exist for parasite species which do not apply to model organisms; thirdly, the inherent variation in experimental design, and reported difficulties with reproducibility undermine confidence. Ideally, RNAi studies of gene function should adopt standardised experimental design to aid reproducibility, interpretation and comparative analyses. Although the huge variations in parasite biology and experimental endpoints make RNAi experimental design standardization difficult or impractical, we must strive to validate RNAi experimentation in helminth parasites. To aid this process we identify multiple approaches to RNAi experimental validation and highlight those which we deem to be critical for gene function studies in helminth parasites.
Feretzaki, Marianna; Billmyre, R Blake; Clancey, Shelly Applen; Wang, Xuying; Heitman, Joseph
2016-03-01
RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein) and Qip1 (a homolog of N. crassa Qip) were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor) and Fzc28 (a transcription factor) are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.
The interaction of fungi with the environment orchestrated by RNAi.
Villalobos-Escobedo, José Manuel; Herrera-Estrella, Alfredo; Carreras-Villaseñor, Nohemí
2016-01-01
The fungal kingdom has been key in the investigation of the biogenesis and function of small RNAs (sRNAs). The discovery of phenomena such as quelling in Neurospora crassa represents pioneering work in the identification of the main elements of the RNA interference (RNAi) machinery. Recent discoveries in the regulatory mechanisms in some yeast and filamentous fungi are helping us reach a deeper understanding of the transcriptional and post-transcriptional gene-silencing mechanisms involved in genome protection against viral infections, DNA damage and transposon activity. Although most of these mechanisms are reasonably well understood, their role in the physiology, response to the environment and interaction of fungi with other organisms had remained elusive. Nevertheless, studies in fungi such as Mucor circinelloides, Magnaporthe oryzae, Cryptococcus neoformans, Trichoderma atroviride, Botrytis cinerea and others have started to shed light on the relevance of the RNAi pathway. In these fungi gene regulation by RNAi is important for growth, reproduction, control of viral infections and transposon activity, as well as in the development of antibiotic resistance and interactions with their hosts. Moreover, the increasing number of reports of the discovery of microRNA-like RNAs in fungi under different conditions highlights the importance of fungi as models for understanding adaptation to the environment using regulation by sRNAs. The goal of this review is to provide the reader with an up-to-date overview of the importance of RNAi in the interaction of fungi with their environment. © 2016 by The Mycological Society of America.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi.
Choi, Jaeyoung; Kim, Ki-Tae; Jeon, Jongbum; Wu, Jiayao; Song, Hyeunjeong; Asiegbu, Fred O; Lee, Yong-Hwan
2014-01-01
RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi.
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
An RNAi Screen To Identify Protein Phosphatases That Function Within the Drosophila Circadian Clock.
Agrawal, Parul; Hardin, Paul E
2016-12-07
Circadian clocks in eukaryotes keep time via cell-autonomous transcriptional feedback loops. A well-characterized example of such a transcriptional feedback loop is in Drosophila, where CLOCK-CYCLE (CLK-CYC) complexes activate transcription of period (per) and timeless (tim) genes, rising levels of PER-TIM complexes feed-back to repress CLK-CYC activity, and degradation of PER and TIM permits the next cycle of CLK-CYC transcription. The timing of CLK-CYC activation and PER-TIM repression is regulated posttranslationally, in part through rhythmic phosphorylation of CLK, PER, and TIM. Previous behavioral screens identified several kinases that control CLK, PER, and TIM levels, subcellular localization, and/or activity, but two phosphatases that function within the clock were identified through the analysis of candidate genes from other pathways or model systems. To identify phosphatases that play a role in the clock, we screened clock cell-specific RNA interference (RNAi) knockdowns of all annotated protein phosphatases and protein phosphatase regulators in Drosophila for altered activity rhythms. This screen identified 19 protein phosphatases that lengthened or shortened the circadian period by ≥1 hr (p ≤ 0.05 compared to controls) or were arrhythmic. Additional RNAi lines, transposon inserts, overexpression, and loss-of-function mutants were tested to independently confirm these RNAi phenotypes. Based on genetic validation and molecular analysis, 15 viable protein phosphatases remain for future studies. These candidates are expected to reveal novel features of the circadian timekeeping mechanism in Drosophila that are likely to be conserved in all animals including humans. Copyright © 2016 Agrawal and Hardin.
Asian citrus psyllid RNAi pathway - RNAi evidence
USDA-ARS?s Scientific Manuscript database
In silico analyses of the draft genome of Diaphorina citri, the Asian citrus psyllid, for genes within the Ribonucleic acid interference(RNAi), pathway was successful. The psyllid is the vector of the plant-infecting bacterium, Candidatus Liberibacter asiaticus (CLas), which is linked to citrus gree...
Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E.; ...
2015-03-31
Here, we document a collection of ~7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstratemore » reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates.« less
Flavivirus RNAi suppression: decoding non-coding RNA.
Pijlman, Gorben P
2014-08-01
Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.
RNAi for functional genomics in plants.
McGinnis, Karen M
2010-03-01
RNAi refers to several different types of gene silencing mediated by small, dsRNA molecules. Over the course of 20 years, the scientific understanding of RNAi has developed from the initial observation of unexpected expression patterns to a sophisticated understanding of a multi-faceted, evolutionarily conserved network of mechanisms that regulate gene expression in many organisms. It has also been developed as a genetic tool that can be exploited in a wide range of species. Because transgene-induced RNAi has been effective at silencing one or more genes in a wide range of plants, this technology also bears potential as a powerful functional genomics tool across the plant kingdom. Transgene-induced RNAi has indeed been shown to be an effective mechanism for silencing many genes in many organisms, but the results from multiple projects which attempted to exploit RNAi on a genome-wide scale suggest that there is a great deal of variation in the silencing efficacy between transgenic events, silencing targets and silencing-induced phenotype. The results from these projects indicate several important variables that should be considered in experimental design prior to the initiation of functional genomics efforts based on RNAi silencing. In recent years, alternative strategies have been developed for targeted gene silencing, and a combination of approaches may also enhance the use of targeted gene silencing for functional genomics.
A status report on RNAi therapeutics
2010-01-01
Fire and Mello initiated the current explosion of interest in RNA interference (RNAi) biology with their seminal work in Caenorhabditis elegans. These observations were closely followed by the demonstration of RNAi in Drosophila melanogaster. However, the full potential of these new discoveries only became clear when Tuschl and colleagues showed that 21-22 bp RNA duplexes with 3" overhangs, termed small interfering (si)RNAs, could reliably execute RNAi in a range of mammalian cells. Soon afterwards, it became clear that many different human cell types had endogenous machinery, the RNA-induced silencing complex (RISC), which could be harnessed to silence any gene in the genome. Beyond the availability of a novel way to dissect biology, an important target validation tool was now available. More importantly, two key properties of the RNAi pathway - sequence-mediated specificity and potency - suggested that RNAi might be the most important pharmacological advance since the advent of protein therapeutics. The implications were profound. One could now envisage selecting disease-associated targets at will and expect to suppress proteins that had remained intractable to inhibition by conventional methods, such as small molecules. This review attempts to summarize the current understanding on siRNA lead discovery, the delivery of RNAi therapeutics, typical in vivo pharmacological profiles, preclinical safety evaluation and an overview of the 14 programs that have already entered clinical practice. PMID:20615220
Zhou, Yinjian; Zhang, Chunling; Liang, Wei
2014-11-10
RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.
Effects of HBV Genetic Variability on RNAi Strategies
Panjaworayan, Nattanan; Brown, Chris M.
2011-01-01
RNAi strategies present promising antiviral strategies against HBV. RNAi strategies require base pairing between short RNAi effectors and targets in the HBV pregenome or other RNAs. Natural variation in HBV genotypes, quasispecies variation, or mutations selected by the RNAi strategy could potentially make these strategies less effective. However, current and proposed antiviral strategies against HBV are being, or could be, designed to avoid this. This would involve simultaneous targeting of multiple regions of the genome, or regions in which variation or mutation is not tolerated. RNAi strategies against single genotypes or against variable regions of the genome would need to have significant other advantages to be part of robust therapies. PMID:21760994
Nagarkar-Jaiswal, Sonal; Lee, Pei-Tseng; Campbell, Megan E; Chen, Kuchuan; Anguiano-Zarate, Stephanie; Cantu Gutierrez, Manuel; Busby, Theodore; Lin, Wen-Wen; He, Yuchun; Schulze, Karen L; Booth, Benjamin W; Evans-Holm, Martha; Venken, Koen JT; Levis, Robert W; Spradling, Allan C; Hoskins, Roger A; Bellen, Hugo J
2015-01-01
Here, we document a collection of ∼7434 MiMIC (Minos Mediated Integration Cassette) insertions of which 2854 are inserted in coding introns. They allowed us to create a library of 400 GFP-tagged genes. We show that 72% of internally tagged proteins are functional, and that more than 90% can be imaged in unfixed tissues. Moreover, the tagged mRNAs can be knocked down by RNAi against GFP (iGFPi), and the tagged proteins can be efficiently knocked down by deGradFP technology. The phenotypes associated with RNA and protein knockdown typically correspond to severe loss of function or null mutant phenotypes. Finally, we demonstrate reversible, spatial, and temporal knockdown of tagged proteins in larvae and adult flies. This new strategy and collection of strains allows unprecedented in vivo manipulations in flies for many genes. These strategies will likely extend to vertebrates. DOI: http://dx.doi.org/10.7554/eLife.05338.001 PMID:25824290
Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection
Wooddell, Christine I; Rozema, David B; Hossbach, Markus; John, Matthias; Hamilton, Holly L; Chu, Qili; Hegge, Julia O; Klein, Jason J; Wakefield, Darren H; Oropeza, Claudia E; Deckert, Jochen; Roehl, Ingo; Jahn-Hofmann, Kerstin; Hadwiger, Philipp; Vornlocher, Hans-Peter; McLachlan, Alan; Lewis, David L
2013-01-01
RNA interference (RNAi)-based therapeutics have the potential to treat chronic hepatitis B virus (HBV) infection in a fundamentally different manner than current therapies. Using RNAi, it is possible to knock down expression of viral RNAs including the pregenomic RNA from which the replicative intermediates are derived, thus reducing viral load, and the viral proteins that result in disease and impact the immune system's ability to eliminate the virus. We previously described the use of polymer-based Dynamic PolyConjugate (DPC) for the targeted delivery of siRNAs to hepatocytes. Here, we first show in proof-of-concept studies that simple coinjection of a hepatocyte-targeted, N-acetylgalactosamine-conjugated melittin-like peptide (NAG-MLP) with a liver-tropic cholesterol-conjugated siRNA (chol-siRNA) targeting coagulation factor VII (F7) results in efficient F7 knockdown in mice and nonhuman primates without changes in clinical chemistry or induction of cytokines. Using transient and transgenic mouse models of HBV infection, we show that a single coinjection of NAG-MLP with potent chol-siRNAs targeting conserved HBV sequences resulted in multilog repression of viral RNA, proteins, and viral DNA with long duration of effect. These results suggest that coinjection of NAG-MLP and chol-siHBVs holds great promise as a new therapeutic for patients chronically infected with HBV. PMID:23439496
RNAi screen of DAF-16/FOXO target genes in C. elegans links pathogenesis and dauer formation.
Jensen, Victor L; Simonsen, Karina T; Lee, Yu-Hui; Park, Donha; Riddle, Donald L
2010-12-31
The DAF-16/FOXO transcription factor is the major downstream output of the insulin/IGF1R signaling pathway controlling C. elegans dauer larva development and aging. To identify novel downstream genes affecting dauer formation, we used RNAi to screen candidate genes previously identified to be regulated by DAF-16. We used a sensitized genetic background [eri-1(mg366); sdf-9(m708)], which enhances both RNAi efficiency and constitutive dauer formation (Daf-c). Among 513 RNAi clones screened, 21 displayed a synthetic Daf-c (SynDaf) phenotype with sdf-9. One of these genes, srh-100, was previously identified to be SynDaf, but twenty have not previously been associated with dauer formation. Two of the latter genes, lys-1 and cpr-1, are known to participate in innate immunity and six more are predicted to do so, suggesting that the immune response may contribute to the dauer decision. Indeed, we show that two of these genes, lys-1 and clc-1, are required for normal resistance to Staphylococcus aureus. clc-1 is predicted to function in epithelial cohesion. Dauer formation exhibited by daf-8(m85), sdf-9(m708), and the wild-type N2 (at 27°C) were all enhanced by exposure to pathogenic bacteria, while not enhanced in a daf-22(m130) background. We conclude that knockdown of the genes required for proper pathogen resistance increases pathogenic infection, leading to increased dauer formation in our screen. We propose that dauer larva formation is a behavioral response to pathogens mediated by increased dauer pheromone production.
Begnis, Martina; Apte, Manasi S; Masuda, Hirohisa; Jain, Devanshi; Wheeler, David Lee; Cooper, Julia Promisel
2018-04-01
The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI rDNA " chromosomes), it is dispensable for HAATI rDNA maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI rDNA genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device. © 2018 Begnis et al.; Published by Cold Spring Harbor Laboratory Press.
RNAi and retroviruses: are they in RISC?
Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri
2013-02-01
RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
Welborn, Joshua P.; Davis, Matthew G.; Ebers, Steven D.; Stodden, Genna R.; Hayashi, Kanako; Cheatwood, Joseph L.; Rao, Manjeet K.; MacLean, James A.
2015-01-01
The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. PMID:25972016
White, Pamela M; Serbus, Laura R; Debec, Alain; Codina, Adan; Bray, Walter; Guichet, Antoine; Lokey, R Scott; Sullivan, William
2017-04-01
Wolbachia are gram-negative, obligate, intracellular bacteria carried by a majority of insect species worldwide. Here we use a Wolbachia -infected Drosophila cell line and genome-wide RNA interference (RNAi) screening to identify host factors that influence Wolbachia titer. By screening an RNAi library targeting 15,699 transcribed host genes, we identified 36 candidate genes that dramatically reduced Wolbachia titer and 41 that increased Wolbachia titer. Host gene knockdowns that reduced Wolbachia titer spanned a broad array of biological pathways including genes that influenced mitochondrial function and lipid metabolism. In addition, knockdown of seven genes in the host ubiquitin and proteolysis pathways significantly reduced Wolbachia titer. To test the in vivo relevance of these results, we found that drug and mutant inhibition of proteolysis reduced levels of Wolbachia in the Drosophila oocyte. The presence of Wolbachia in either cell lines or oocytes dramatically alters the distribution and abundance of ubiquitinated proteins. Functional studies revealed that maintenance of Wolbachia titer relies on an intact host Endoplasmic Reticulum (ER)-associated protein degradation pathway (ERAD). Accordingly, electron microscopy studies demonstrated that Wolbachia is intimately associated with the host ER and dramatically alters the morphology of this organelle. Given Wolbachia lack essential amino acid biosynthetic pathways, the reliance of Wolbachia on high rates of host proteolysis via ubiquitination and the ERAD pathways may be a key mechanism for provisioning Wolbachia with amino acids. In addition, the reliance of Wolbachia on the ERAD pathway and disruption of ER morphology suggests a previously unsuspected mechanism for Wolbachia ' s potent ability to prevent RNA virus replication. Copyright © 2017 by the Genetics Society of America.
Raut, Sandeep; Mallik, Bhagaban; Parichha, Arpan; Amrutha, Valsakumar; Sahi, Chandan; Kumar, Vimlesh
2017-07-05
Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C -Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development. Copyright © 2017 Raut et al.
Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David
2013-01-01
The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852
Stacking up CRISPR against RNAi for therapeutic gene inhibition.
Haussecker, Dirk
2016-09-01
Both RNA interference (RNAi) and clustered regularly-interspaced short palindromic repeats (CRISPR) technologies allow for the sequence-specific inhibition of gene function and therefore have the potential to be used as therapeutic modalities. By judging the current public and scientific journal interest, it would seem that CRISPR, by enabling clean, durable knockouts, will dominate therapeutic gene inhibition, also at the expense of RNAi. This review aims to look behind prevailing sentiments and to more clearly define the likely scope of the therapeutic applications of the more recently developed CRISPR technology and its relative strengths and weaknesses with regards to RNAi. It is found that largely because of their broadly overlapping delivery constraints, while CRISPR presents formidable competition for DNA-directed RNAi strategies, its impact on RNAi therapeutics triggered by synthetic oligonucleotides will likely be more moderate. Instead, RNAi and genome editing, and in particular CRISPR, are poised to jointly promote a further shift toward sequence-targeted precision medicines. © 2016 Federation of European Biochemical Societies.
RNAi KNOCKDOWN OF BmRab3 LED TO LARVA AND PUPA LETHALITY IN SILKWORM Bombyx mori L.
Singh, Chabungbam Orville; Xin, Hu-hu; Chen, Rui-ting; Wang, Mei-xian; Liang, Shuang; Lu, Yan; Cai, Zi-zheng; Zhang, Deng-pan; Miao, Yun-gen
2015-06-01
Rab3 GTPases are known to play key a role in vesicular trafficking, and express highest in brain and endocrine tissues. In mammals, Rab3 GTPases are paralogs unlike in insect. In this study, we cloned Rab3 from the silk gland tissue of silkworm Bombyx mori, and identified it as BmRab3. Our in silico analysis indicated that BmRab3 is an isoform with a theoretical isoelectric point and molecular weight of 5.52 and 24.3 kDa, respectively. Further, BmRab3 showed the C-terminal hypervariability for GGT2 site but having two other putative guanine nucleotide exchange factor/GDP dissociation inhibitor interaction sites. Multiple alignment sequence indicated high similarities of BmRab3 with Rab3 isoforms of other species. The phylogeny tree showed BmRab3 clustered between the species of Tribolium castaneum and Aedes aegypti. Meanwhile, the expression analysis of BmRab3 showed the highest expression in middle silk glands (MSGs) than all other tissues in the third day of fifth-instar larva. Simultaneously, we showed the differential expression of BmRab3 in the early instar larva development, followed by higher expression in male than female pupae. In vivo dsRNA interference of BmRab3 reduced the expression of BmRab3 by 75% compared to the control in the MSGs in the first day. But as the worm grew to the third day, the difference of BmRab3 between knockdown and control was only about 10%. The knockdown later witnessed underdevelopment of the larvae and pharate pupae lethality in the overall development of silkworm B. mori L. © 2015 Wiley Periodicals, Inc.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Welborn, Joshua P; Davis, Matthew G; Ebers, Steven D; Stodden, Genna R; Hayashi, Kanako; Cheatwood, Joseph L; Rao, Manjeet K; MacLean, James A
2015-07-01
The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. © 2015 by the Society for the Study of Reproduction, Inc.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
Autonomously folded α-helical lockers promote RNAi*
NASA Astrophysics Data System (ADS)
Guyader, Christian P. E.; Lamarre, Baptiste; de Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.
2016-10-01
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.
Autonomously folded α-helical lockers promote RNAi*
Guyader, Christian P. E.; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.
2016-01-01
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi. PMID:27721465
Autonomously folded α-helical lockers promote RNAi.
Guyader, Christian P E; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E; Slater, Nigel K; Ryadnov, Maxim G
2016-10-10
RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.
RNAi therapeutics for brain cancer: current advancements in RNAi delivery strategies.
Malhotra, Meenakshi; Toulouse, André; Godinho, Bruno M D C; Mc Carthy, David John; Cryan, John F; O'Driscoll, Caitriona M
2015-10-01
Malignant primary brain tumors are aggressive cancerous cells that invade the surrounding tissues of the central nervous system. The current treatment options for malignant brain tumors are limited due to the inability to cross the blood-brain barrier. The advancements in current research has identified and characterized certain molecular markers that are essential for tumor survival, progression, metastasis and angiogenesis. These molecular markers have served as therapeutic targets for the RNAi based therapies, which enable site-specific silencing of the gene responsible for tumor proliferation. However, to bring about therapeutic success, an efficient delivery carrier that can cross the blood-brain barrier and reach the targeted site is essential. The current review focuses on the potential of targeted, non-viral and viral particles containing RNAi therapeutic molecules as delivery strategies specifically for brain tumors.
Lin, Wei-Hsiang; He, Miaomiao; Fan, Yuen Ngan; Baines, Richard A
2018-05-02
Despite availability of a diverse range of anti-epileptic drugs (AEDs), only about two-thirds of epilepsy patients respond well to drug treatment. Thus, novel targets are required to catalyse the design of next-generation AEDs. Manipulation of neuron firing-rate homoeostasis, through enhancing Pumilio (Pum) activity, has been shown to be potently anticonvulsant in Drosophila. In this study, we performed a genome-wide RNAi screen in S2R + cells, using a luciferase-based dPum activity reporter and identified 1166 genes involved in dPum regulation. Of these genes, we focused on 699 genes that, on knock-down, potentiate dPum activity/expression. Of this subgroup, 101 genes are activity-dependent based on comparison with genes previously identified as activity-dependent by RNA-sequencing. Functional cluster analysis shows these genes are enriched in pathways involved in DNA damage, regulation of cell cycle and proteasomal protein catabolism. To test for anticonvulsant activity, we utilised an RNA-interference approach in vivo. RNAi-mediated knockdown showed that 57/101 genes (61%) are sufficient to significantly reduce seizure duration in the characterized seizure mutant, para bss . We further show that chemical inhibitors of protein products of some of the genes targeted are similarly anticonvulsant. Finally, to establish whether the anticonvulsant activity of identified compounds results from increased dpum transcription, we performed a luciferase-based assay to monitor dpum promoter activity. Third instar larvae exposed to sodium fluoride, gemcitabine, metformin, bestatin, WP1066 or valproic acid all showed increased dpum promoter activity. Thus, this study validates Pum as a favourable target for AED design and, moreover, identifies a number of lead compounds capable of increasing the expression of this homeostatic regulator.
RNAi as a Routine Route Toward Breast Cancer Therapy
2013-09-01
Award Number: W81XWH-08-1-0572 TITLE: RNAi as a Routine Route Toward Breast Cancer Therapy...To) 1 SEP 2012 - 31 AUG 2013 4. TITLE AND SUBTITLE RNAi as a Routine Route Toward Breast Cancer Therapy 5a. CONTRACT NUMBER...generation RNAi library and made that available to the breast cancer community. This resource has nearly 75,000 independent, sequence verified clones
Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.
2010-01-01
Background RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or Caenorhabditis elegans, often large dsRNAs are used. One of the drawbacks of RNAi technology is that unwanted gene products with sequence similarity to the gene of interest can be down regulated too. To verify the outcome of an RNAi experiment and to avoid these unwanted off-target effects, an additional non-overlapping dsRNA can be used to down-regulate the same gene. However it has never been tested whether this approach is sufficient to reduce the risk of off-targets. Methodology We created a novel tool to analyse the occurance of off-target effects in Drosophila and we analyzed 99 randomly chosen genes. Principal Findings Here we show that nearly all genes contain non-overlapping internal sequences that do show overlap in a common off-target gene. Conclusion Based on our in silico findings, off-target effects should not be ignored and our presented on-line tool enables the identification of two RNA interference constructs, free of overlapping off-targets, from any gene of interest. PMID:20957038
Automated microscopy for high-content RNAi screening
2010-01-01
Fluorescence microscopy is one of the most powerful tools to investigate complex cellular processes such as cell division, cell motility, or intracellular trafficking. The availability of RNA interference (RNAi) technology and automated microscopy has opened the possibility to perform cellular imaging in functional genomics and other large-scale applications. Although imaging often dramatically increases the content of a screening assay, it poses new challenges to achieve accurate quantitative annotation and therefore needs to be carefully adjusted to the specific needs of individual screening applications. In this review, we discuss principles of assay design, large-scale RNAi, microscope automation, and computational data analysis. We highlight strategies for imaging-based RNAi screening adapted to different library and assay designs. PMID:20176920
Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi
van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.
2014-01-01
The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815
Joshi, Rohit; Sahoo, Khirod Kumar; Tripathi, Amit Kumar; Kumar, Ritesh; Gupta, Brijesh Kumar; Pareek, Ashwani; Singla-Pareek, Sneh Lata
2018-05-01
Cytokinins play a significant role in determining grain yield in plants. Cytokinin oxidases catalyse irreversible degradation of cytokinins and hence modulate cellular cytokinin levels. Here, we studied the role of an inflorescence meristem-specific rice cytokinin oxidase - OsCKX2 - in reducing yield penalty under salinity stress conditions. We utilized an RNAi-based approach to study the function of OsCKX2 in maintaining grain yield under salinity stress condition. Ultra-performance liquid chromatography-based estimation revealed a significant increase in cytokinins in the inflorescence meristem of OsCKX2-knockdown plants. To determine if there exists a correlation between OsCKX2 levels and yield under salinity stress condition, we assessed the growth, physiology and grain yield of OsCKX2-knockdown plants vis-à-vis the wild type. OsCKX2-knockdown plants showed better vegetative growth, higher relative water content and photosynthetic efficiency and reduced electrolyte leakage as compared with the wild type under salinity stress. Importantly, we found a negative correlation between OsCKX2 expression and plant productivity as evident by assessment of agronomical parameters such as panicle branching, filled grains per plant and harvest index both under control and salinity stress conditions. These results suggest that OsCKX2, via controlling cytokinin levels, regulates floral primordial activity modulating rice grain yield under normal as well as abiotic stress conditions. © 2017 John Wiley & Sons Ltd.
Targeting the undruggable: Advances and obstacles in current RNAi therapy
Wu, Sherry Y.; Lopez-Berestein, Gabriel; Calin, George A.; Sood, Anil K.
2014-01-01
RNA interference (RNAi) therapeutics represents a rapidly emerging platform for personalized cancer treatment. Recent advances in delivery, target selection, and safety of RNAi cancer therapy provide unprecedented opportunities for clinical translation. Here, we discuss these advances and present strategies for making RNAi-based therapy a viable part of cancer management. PMID:24920658
2010-01-01
Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks
RNAi revised--target mRNA-dependent enhancement of gene silencing.
Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias
2015-12-15
The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
RNAi functionalized scaffold for scarless skin regeneration
Liu, Xing; Ma, Lie; Gao, Changyou
2013-01-01
Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756
OfftargetFinder: a web tool for species-specific RNAi design.
Good, R T; Varghese, T; Golz, J F; Russell, D A; Papanicolaou, A; Edwards, O; Robin, C
2016-04-15
RNA interference (RNAi) technology is being developed as a weapon for pest insect control. To maximize the specificity that such an approach affords we have developed a bioinformatic web tool that searches the ever-growing arthropod transcriptome databases so that pest-specific RNAi sequences can be identified. This will help technology developers finesse the design of RNAi sequences and suggests which non-target species should be assessed in the risk assessment process. http://rnai.specifly.org crobin@unimelb.edu.au. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Bian, Chen; Huang, Yan; Zhu, Haitao; Zhao, Yangang; Zhao, Jikai; Zhang, Jiqiang
2018-05-01
Steroids have been demonstrated to play profound roles in the regulation of hippocampal function by acting on their receptors, which need coactivators for their transcriptional activities. Previous studies have shown that steroid receptor coactivator-1 (SRC-1) is the predominant coactivator in the hippocampus, but its exact role and the underlying mechanisms remain unclear. In this study, we constructed SRC-1 RNA interference (RNAi) lentiviruses, injected them into the hippocampus of male mice, and then examined the changes in the expression of selected synaptic proteins, CA1 synapse density, postsynaptic density (PSD) thickness, and in vivo long-term potentiation (LTP). Spatial learning and memory behavior changes were investigated using the Morris water maze. We then transfected the lentiviruses into cultured hippocampal cells and examined the changes in synaptic protein and phospho-cyclic AMP response element-binding protein (pCREB) expression. The in vivo results showed that SRC-1 knockdown significantly decreased the expression of synaptic proteins and CA1 synapse density as well as PSD thickness; SRC-1 knockdown also significantly impaired in vivo LTP and disrupted spatial learning and memory. The in vitro results showed that while the expression of synaptic proteins was significantly decreased by SRC-1 knockdown, pCREB expression was also significantly decreased. The above results suggest a pivotal role of SRC-1 in the regulation of hippocampal synaptic plasticity and spatial learning and memory, strongly indicating SRC-1 may serve as a novel therapeutic target for hippocampus-dependent memory disorders. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.
Beyond insects: current status, achievements and future perspectives of RNAi in mite pests.
Niu, Jinzhi; Shen, Guangmao; Christiaens, Olivier; Smagghe, Guy; He, Lin; Wang, Jinjun
2018-05-11
Mites comprise a group of key agricultural pests on a wide range of crops. They cause harm through feeding on the plant and transferring dangerous pathogens, and the rapid evolution of pesticide resistance in mites highlights the need for novel control methods. Currently, RNA interference (RNAi) shows a great potential for insect pest control. Here, we review the literature associated with RNAi in mite pests. We discuss different target genes and RNAi efficiency in various mite species, a promising Varroa control program through RNAi, the synergy of RNAi with plant defense mechanisms and microorganisms, and the current understandings of systemic movement of dsRNA. Based on this, we can conclude that there is a clear potential for an RNAi-based mite control application but further research on several aspects is needed, including: (i) the factors influencing the RNAi efficiency, (ii) the mechanism of environmental RNAi and cross-kingdom dsRNA trafficking, (iii) the mechanism of possible systemic and parental RNAi, and (iv) non-target effects, specifically in predatory mites, should be considered during the RNAi target selection. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.
Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi
2011-01-01
Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.
The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight
Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi
2011-01-01
Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804
Delivery of RNAi Therapeutics to the Airways-From Bench to Bedside.
Qiu, Yingshan; Lam, Jenny K W; Leung, Susan W S; Liang, Wanling
2016-09-20
RNA interference (RNAi) is a potent and specific post-transcriptional gene silencing process. Since its discovery, tremendous efforts have been made to translate RNAi technology into therapeutic applications for the treatment of different human diseases including respiratory diseases, by manipulating the expression of disease-associated gene(s). Similar to other nucleic acid-based therapeutics, the major hurdle of RNAi therapy is delivery. Pulmonary delivery is a promising approach of delivering RNAi therapeutics directly to the airways for treating local conditions and minimizing systemic side effects. It is a non-invasive route of administration that is generally well accepted by patients. However, pulmonary drug delivery is a challenge as the lungs pose a series of anatomical, physiological and immunological barriers to drug delivery. Understanding these barriers is essential for the development an effective RNA delivery system. In this review, the different barriers to pulmonary drug delivery are introduced. The potential of RNAi molecules as new class of therapeutics, and the latest preclinical and clinical studies of using RNAi therapeutics in different respiratory conditions are discussed in details. We hope this review can provide some useful insights for moving inhaled RNAi therapeutics from bench to bedside.
Bhinder, Bhavneet; Shum, David; Djaballah, Hakim
2014-02-01
RNAi screening in combination with the genome-sequencing projects would constitute the Holy Grail of modern genetics; enabling discovery and validation towards a better understanding of fundamental biology leading to novel targets to combat disease. Hit discordance at inter-screen level together with the lack of reproducibility is emerging as the technology's main pitfalls. To examine some of the underlining factors leading to such discrepancies, we reasoned that perhaps there is an inherent difference in knockdown efficiency of the various RNAi technologies. For this purpose, we utilized the two most popular ones, chemically synthesized siRNA duplex and plasmid-based shRNA hairpin, in order to perform a head to head comparison. Using a previously developed gain-of-function assay probing modulators of the miRNA biogenesis pathway, we first executed on a siRNA screen against the Silencer Select V4.0 library (AMB) nominating 1,273, followed by an shRNA screen against the TRC1 library (TRC1) nominating 497 gene candidates. We observed a poor overlap of only 29 hits given that there are 15,068 overlapping genes between the two libraries; with DROSHA as the only common hit out of the seven known core miRNA biogenesis genes. Distinct genes interacting with the same biogenesis regulators were observed in both screens, with a dismal cross-network overlap of only 3 genes (DROSHA, TGFBR1, and DIS3). Taken together, our study demonstrates differential knockdown activities between the two technologies, possibly due to the inefficient intracellular processing and potential cell-type specificity determinants in generating intended targeting sequences for the plasmid-based shRNA hairpins; and suggests this observed inefficiency as potential culprit in addressing the lack of reproducibility.
Mleczko-Sanecka, Katarzyna; Roche, Franziska; Rita da Silva, Ana; Call, Debora; D’Alessio, Flavia; Ragab, Anan; Lapinski, Philip E.; Ummanni, Ramesh; Korf, Ulrike; Oakes, Christopher; Damm, Georg; D’Alessandro, Lorenza A.; Klingmüller, Ursula; King, Philip D.; Boutros, Michael; Hentze, Matthias W.
2014-01-01
The hepatic hormone hepcidin is a key regulator of systemic iron metabolism. Its expression is largely regulated by 2 signaling pathways: the “iron-regulated” bone morphogenetic protein (BMP) and the inflammatory JAK-STAT pathways. To obtain broader insights into cellular processes that modulate hepcidin transcription and to provide a resource to identify novel genetic modifiers of systemic iron homeostasis, we designed an RNA interference (RNAi) screen that monitors hepcidin promoter activity after the knockdown of 19 599 genes in hepatocarcinoma cells. Interestingly, many of the putative hepcidin activators play roles in signal transduction, inflammation, or transcription, and affect hepcidin transcription through BMP-responsive elements. Furthermore, our work sheds light on new components of the transcriptional machinery that maintain steady-state levels of hepcidin expression and its responses to the BMP- and interleukin-6–triggered signals. Notably, we discover hepcidin suppression mediated via components of Ras/RAF MAPK and mTOR signaling, linking hepcidin transcriptional control to the pathways that respond to mitogen stimulation and nutrient status. Thus using a combination of RNAi screening, reverse phase protein arrays, and small molecules testing, we identify links between the control of systemic iron homeostasis and critical liver processes such as regeneration, response to injury, carcinogenesis, and nutrient metabolism. PMID:24385536
Kakrana, Atul; Kumar, Anil; Satheesh, Viswanathan; Abdin, M. Z.; Subramaniam, Kuppuswamy; Bhattacharya, R. C.; Srinivasan, Ramamurthy; Sirohi, Anil; Jain, Pradeep K.
2017-01-01
The root-knot nematode (RKN), Meloidogyne incognita, is an obligate, sedentary endoparasite that infects a large number of crops and severely affects productivity. The commonly used nematode control strategies have their own limitations. Of late, RNA interference (RNAi) has become a popular approach for the development of nematode resistance in plants. Transgenic crops capable of expressing dsRNAs, specifically in roots for disrupting the parasitic process, offer an effective and efficient means of producing resistant crops. We identified nematode-responsive and root-specific (NRRS) promoters by using microarray data from the public domain and known conserved cis-elements. A set of 51 NRRS genes was identified which was narrowed down further on the basis of presence of cis-elements combined with minimal expression in the absence of nematode infection. The comparative analysis of promoters from the enriched NRRS set, along with earlier reported nematode-responsive genes, led to the identification of specific cis-elements. The promoters of two candidate genes were used to generate transgenic plants harboring promoter GUS constructs and tested in planta against nematodes. Both promoters showed preferential expression upon nematode infection, exclusively in the root in one and galls in the other. One of these NRRS promoters was used to drive the expression of splicing factor, a nematode-specific gene, for generating host-delivered RNAi-mediated nematode-resistant plants. Transgenic lines expressing dsRNA of splicing factor under the NRRS promoter exhibited upto a 32% reduction in number of galls compared to control plants. PMID:29312363
Ortega-Arellano, Hector Flavio; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos
2017-05-01
Autosomal recessive Juvenile Parkinsonism (AR-JP) is a chronic, progressive neurodegenerative disorder caused by mutation in the PARKIN gene, and invariably associated with dopaminergic (DAergic) neuronal loss and brain iron accumulation. Since current medical therapy is symptomatic and lacks significant disease-modifying effects, other treatment approaches are urgently needed it. In the present work, we investigate the role of minocycline (MC) in paraquat (PQ)/iron-induced neurotoxicity in the Drosophila TH>parkin-RNAi/+ (w[*]; UAS-parkin-RNAi; TH-GAL4) fly and have shown the following: (i) MC increased life span and restored the locomotor activity of knockdown (KD) transgenic parkin flies in comparison with the control (vehicle) group; (ii) MC at low (0.1 and 0.3mM) and middle (0.5mM) concentrations protected, rescued and prevented KD parkin Drosophila against PQ toxicity. However, MC at high (1mM) concentration aggravated the toxic effect of PQ; (iii) MC protected and rescued DAergic neurons against the PQ toxic effect according to tyrosine hydroxylase (TH)>green-fluorescent protein (GFP) reporter protein microscopy and anti-TH Western blotting analysis; (iv) MC protected DAergic neurons against PQ/iron toxicity; (v) MC significantly abridged lipid peroxidation (LPO) in the protection, rescue and prevention treatment in TH>parkin-RNAi/+ flies against PQ or iron alone or combined (PQ/iron)-induced neuronal oxidative stress (OS). Our results suggest that MC exerts neuroprotection against PQ/iron-induced OS in DAergic neurons most probably by the scavenging activity of reactive oxygen species (ROS), and by chelating iron. Therefore, MC might be a potential therapeutic drug to delay, revert, or prevent AR-JP. Copyright © 2017 Elsevier B.V. All rights reserved.
Intelligent Interfaces for Mining Large-Scale RNAi-HCS Image Databases
Lin, Chen; Mak, Wayne; Hong, Pengyu; Sepp, Katharine; Perrimon, Norbert
2010-01-01
Recently, High-content screening (HCS) has been combined with RNA interference (RNAi) to become an essential image-based high-throughput method for studying genes and biological networks through RNAi-induced cellular phenotype analyses. However, a genome-wide RNAi-HCS screen typically generates tens of thousands of images, most of which remain uncategorized due to the inadequacies of existing HCS image analysis tools. Until now, it still requires highly trained scientists to browse a prohibitively large RNAi-HCS image database and produce only a handful of qualitative results regarding cellular morphological phenotypes. For this reason we have developed intelligent interfaces to facilitate the application of the HCS technology in biomedical research. Our new interfaces empower biologists with computational power not only to effectively and efficiently explore large-scale RNAi-HCS image databases, but also to apply their knowledge and experience to interactive mining of cellular phenotypes using Content-Based Image Retrieval (CBIR) with Relevance Feedback (RF) techniques. PMID:21278820
Therapeutic application of RNAi: is mRNA targeting finally ready for prime time?
Grimm, Dirk; Kay, Mark A.
2007-01-01
With unprecedented speed, RNA interference (RNAi) has advanced from its basic discovery in lower organisms to becoming a powerful genetic tool and perhaps our single most promising biotherapeutic for a wide array of diseases. Numerous studies document RNAi efficacy in laboratory animals, and the first clinical trials are underway and thus far suggest that RNAi is safe to use in humans. Yet substantial hurdles have also surfaced and must be surmounted before therapeutic RNAi applications can become a standard therapy. Here we review the most critical roadblocks and concerns for clinical RNAi transition, delivery, and safety. We highlight emerging solutions and concurrently discuss novel therapeutic RNAi-based concepts. The current rapid advances create realistic optimism that the establishment of RNAi as a new and potent clinical modality in humans is near. PMID:18060021
Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T
2015-12-01
The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
RNAi technologies in agricultural biotechnology: The Toxicology Forum 40th Annual Summer Meeting.
Sherman, James H; Munyikwa, Tichafa; Chan, Stephen Y; Petrick, Jay S; Witwer, Kenneth W; Choudhuri, Supratim
2015-11-01
During the 40th Annual Meeting of The Toxicology Forum, the current and potential future science, regulations, and politics of agricultural biotechnology were presented and discussed. The meeting session described herein focused on the technology of RNA interference (RNAi) in agriculture. The general process by which RNAi works, currently registered RNAi-based plant traits, example RNAi-based traits in development, potential use of double stranded RNA (dsRNA) as topically applied pesticide active ingredients, research related to the safety of RNAi, biological barriers to ingested dsRNA, recent regulatory RNAi science reviews, and regulatory considerations related to the use of RNAi in agriculture were discussed. Participants generally agreed that the current regulatory framework is robust and appropriate for evaluating the safety of RNAi employed in agricultural biotechnology and were also supportive of the use of RNAi to develop improved crop traits. However, as with any emerging technology, the potential range of future products, potential future regulatory frameworks, and public acceptance of the technology will continue to evolve. As such, continuing dialogue was encouraged to promote education of consumers and science-based regulations. Copyright © 2015 Elsevier Inc. All rights reserved.
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
False negative rates in Drosophila cell-based RNAi screens: a case study
2011-01-01
Background High-throughput screening using RNAi is a powerful gene discovery method but is often complicated by false positive and false negative results. Whereas false positive results associated with RNAi reagents has been a matter of extensive study, the issue of false negatives has received less attention. Results We performed a meta-analysis of several genome-wide, cell-based Drosophila RNAi screens, together with a more focused RNAi screen, and conclude that the rate of false negative results is at least 8%. Further, we demonstrate how knowledge of the cell transcriptome can be used to resolve ambiguous results and how the number of false negative results can be reduced by using multiple, independently-tested RNAi reagents per gene. Conclusions RNAi reagents that target the same gene do not always yield consistent results due to false positives and weak or ineffective reagents. False positive results can be partially minimized by filtering with transcriptome data. RNAi libraries with multiple reagents per gene also reduce false positive and false negative outcomes when inconsistent results are disambiguated carefully. PMID:21251254
Li-Byarlay, Hongmei; Li, Yang; Stroud, Hume; Feng, Suhua; Newman, Thomas C.; Kaneda, Megan; Hou, Kirk K.; Worley, Kim C.; Elsik, Christine G.; Wickline, Samuel A.; Jacobsen, Steven E.; Ma, Jian; Robinson, Gene E.
2013-01-01
Studies of DNA methylation from fungi, plants, and animals indicate that gene body methylation is ancient and highly conserved in eukaryotic genomes, but its role has not been clearly defined. It has been postulated that regulation of alternative splicing of transcripts was an original function of DNA methylation, but a direct experimental test of the effect of methylation on alternative slicing at the whole genome level has never been performed. To do this, we developed a unique method to administer RNA interference (RNAi) in a high-throughput and noninvasive manner and then used it to knock down the expression of DNA methyl-transferase 3 (dnmt3), which is required for de novo DNA methylation. We chose the honey bee (Apis mellifera) for this test because it has recently emerged as an important model organism for studying the effects of DNA methylation on development and social behavior, and DNA methylation in honey bees is predominantly on gene bodies. Here we show that dnmt3 RNAi decreased global genomic methylation level as expected and in addition caused widespread and diverse changes in alternative splicing in fat tissue. Four different types of splicing events were affected by dnmt3 gene knockdown, and change in two types, exon skipping and intron retention, was directly related to decreased methylation. These results demonstrate that one function of gene body DNA methylation is to regulate alternative splicing. PMID:23852726
Differential effects of RNAi treatments on field populations of the western corn rootworm.
Chu, Chia-Ching; Sun, Weilin; Spencer, Joseph L; Pittendrigh, Barry R; Seufferheld, Manfredo J
2014-03-01
RNA interference (RNAi) mediated crop protection against insect pests is a technology that is greatly anticipated by the academic and industrial pest control communities. Prior to commercialization, factors influencing the potential for evolution of insect resistance to RNAi should be evaluated. While mutations in genes encoding the RNAi machinery or the sequences targeted for interference may serve as a prominent mechanism of resistance evolution, differential effects of RNAi on target pests may also facilitate such evolution. However, to date, little is known about how variation of field insect populations could influence the effectiveness of RNAi treatments. To approach this question, we evaluated the effects of RNAi treatments on adults of three western corn rootworm (WCR; Diabrotica virgifera virgifera LeConte) populations exhibiting different levels of gut cysteine protease activity, tolerance of soybean herbivory, and immune gene expression; two populations were collected from crop rotation-resistant (RR) problem areas and one from a location where RR was not observed (wild type; WT). Our results demonstrated that RNAi targeting DvRS5 (a highly expressed cysteine protease gene) reduced gut cysteine protease activity in all three WCR populations. However, the proportion of the cysteine protease activity that was inhibited varied across populations. When WCR adults were treated with double-stranded RNA of an immune gene att1, different changes in survival among WT and RR populations on soybean diets occurred. Notably, for both genes, the sequences targeted for RNAi were the same across all populations examined. These findings indicate that the effectiveness of RNAi treatments could vary among field populations depending on their physiological and genetic backgrounds and that the consistency of an RNAi trait's effectiveness on phenotypically different populations should be considered or tested prior to wide deployment. Also, genes that are potentially subjected
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
DNA replication machinery is required for development in Drosophila.
Kohzaki, Hidetsugu; Asano, Maki; Murakami, Yota
2018-01-01
In Drosophila , some factors involved in chromosome replication seem to be involved in gene amplification and endoreplication, which are actively utilized in particular tissue development, but direct evidence has not been shown. Therefore, we examined the effect of depletion of replication factors on these processes. First, we confirmed RNAi knockdown can be used for the depletion of replication factors by comparing the phenotypes of RNAi knockdown and deletion or point mutants of the components of DNA licensing factor, MCM2, MCM4 and Cdt1. Next, we found that tissue-specific RNAi knockdown of replication factors caused tissue-specific defects, probably due to defects in DNA replication. In particular, we found that depletion inhibited gene amplification of the chorion gene in follicle cells and endoreplication in salivary glands, showing that chromosomal DNA replication factors are required for these processes. Finally, using RNAi, we screened the genes for chromosomal DNA replication that affected tissue development. Interestingly, wing specific knockdown of Mcm10 induced wing formation defects. These results suggest that some components of chromosomal replication machinery are directly involved in tissue development.
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
RNAi Technique in Stem Cell Research: Current Status and Future Perspectives.
Zou, Gang-Ming
2017-01-01
RNAi is a mechanism displayed by most eukaryotic cells to rid themselves of foreign double-strand RNA molecules. In the 18 years since the initial report, RNAi has now been demonstrated to function in mammalian cells to alter gene expression and has been used as a means for genetic discovery as well as a possible strategy for genetic correction and genetic therapy in cancer and other disease. The aim of this review is to provide a general overview of how RNAi suppresses gene expression and to examine some published RNAi approaches that have resulted in changes in stem cell function and suggest the possible clinical relevance of this work in cancer therapy through targeting cancer stem cells.
Towards the elements of successful insect Ribonucleic acid interference (RNAi)
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...
Gotoh, Hiroki; Zinna, Robert A; Warren, Ian; DeNieu, Michael; Niimi, Teruyuki; Dworkin, Ian; Emlen, Douglas J; Miura, Toru; Lavine, Laura C
2016-03-22
Genes in the sex determination pathway are important regulators of sexually dimorphic animal traits, including the elaborate and exaggerated male ornaments and weapons of sexual selection. In this study, we identified and functionally analyzed members of the sex determination gene family in the golden metallic stag beetle Cyclommatus metallifer, which exhibits extreme differences in mandible size between males and females. We constructed a C. metallifer transcriptomic database from larval and prepupal developmental stages and tissues of both males and females. Using Roche 454 pyrosequencing, we generated a de novo assembled database from a total of 1,223,516 raw reads, which resulted in 14,565 isotigs (putative transcript isoforms) contained in 10,794 isogroups (putative identified genes). We queried this database for C. metallifer conserved sex determination genes and identified 14 candidate sex determination pathway genes. We then characterized the roles of several of these genes in development of extreme sexual dimorphic traits in this species. We performed molecular expression analyses with RT-PCR and functional analyses using RNAi on three C. metallifer candidate genes--Sex-lethal (CmSxl), transformer-2 (Cmtra2), and intersex (Cmix). No differences in expression pattern were found between the sexes for any of these three genes. In the RNAi gene-knockdown experiments, we found that only the Cmix had any effect on sexually dimorphic morphology, and these mimicked the effects of Cmdsx knockdown in females. Knockdown of CmSxl had no measurable effects on stag beetle phenotype, while knockdown of Cmtra2 resulted in complete lethality at the prepupal period. These results indicate that the roles of CmSxl and Cmtra2 in the sex determination cascade are likely to have diverged in stag beetles when compared to Drosophila. Our results also suggest that Cmix has a conserved role in this pathway. In addition to those three genes, we also performed a more complete
Phylogenetic Origin and Diversification of RNAi Pathway Genes in Insects.
Dowling, Daniel; Pauli, Thomas; Donath, Alexander; Meusemann, Karen; Podsiadlowski, Lars; Petersen, Malte; Peters, Ralph S; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Niehuis, Oliver
2016-12-01
RNA interference (RNAi) refers to the set of molecular processes found in eukaryotic organisms in which small RNA molecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect Transcriptome Evolution) project as well as other resources such as i5K (5000 Insect Genome Project). Specifically, we traced the origin of the double stranded RNA binding protein R2D2 to the last common ancestor of winged insects (Pterygota), the loss of Sid-1/Tag-130 orthologs in Antliophora (fleas, flies and relatives, and scorpionflies in a broad sense), and confirm previous evidence for the splitting of the Argonaute proteins Aubergine and Piwi in Brachyceran flies (Diptera, Brachycera). Our study offers new reference points for future experimental research on RNAi-related pathway genes in insects. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
RNAi control of aflatoxins in peanut plants, a multifactorial system
USDA-ARS?s Scientific Manuscript database
RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...
Nir, Oaz; Bakal, Chris; Perrimon, Norbert; Berger, Bonnie
2010-03-01
Biological networks are highly complex systems, consisting largely of enzymes that act as molecular switches to activate/inhibit downstream targets via post-translational modification. Computational techniques have been developed to perform signaling network inference using some high-throughput data sources, such as those generated from transcriptional and proteomic studies, but comparable methods have not been developed to use high-content morphological data, which are emerging principally from large-scale RNAi screens, to these ends. Here, we describe a systematic computational framework based on a classification model for identifying genetic interactions using high-dimensional single-cell morphological data from genetic screens, apply it to RhoGAP/GTPase regulation in Drosophila, and evaluate its efficacy. Augmented by knowledge of the basic structure of RhoGAP/GTPase signaling, namely, that GAPs act directly upstream of GTPases, we apply our framework for identifying genetic interactions to predict signaling relationships between these proteins. We find that our method makes mediocre predictions using only RhoGAP single-knockdown morphological data, yet achieves vastly improved accuracy by including original data from a double-knockdown RhoGAP genetic screen, which likely reflects the redundant network structure of RhoGAP/GTPase signaling. We consider other possible methods for inference and show that our primary model outperforms the alternatives. This work demonstrates the fundamental fact that high-throughput morphological data can be used in a systematic, successful fashion to identify genetic interactions and, using additional elementary knowledge of network structure, to infer signaling relations.
Cen, Yan-Hui; Guo, Wen-Wen; Luo, Bin; Lin, Yong-Da; Zhang, Qing-Mei; Zhou, Su-Fang; Luo, Guo-Rong; Xiao, Shao-Wen; Xie, Xiao-Xun
2012-10-01
OY-TES-1 is a member of the CTA (cancer-testis antigen) group expressed in a variety of cancer and restrictedly expressed in adult normal tissues, except for testis. To determine whether MSCs (mesenchymal stem cells) express OY-TES-1 and its possible roles on MSCs, OY-TES-1 expression in MSCs isolated from human bone marrow was tested with RT (reverse transcription)-PCR, immunocytochemistry and Western blot. Using RNAi (RNA interference) technology, OY-TES-1 expression was knocked down followed by analysing cell viability, cell cycle, apoptosis and migration ability. MSCs expressed OY-TES-1 at both mRNA and protein levels. The down-regulation of OY-TES-1 expression in these MSCs caused cell growth inhibition, cell cycle arrest, apoptosis induction and migration ability attenuation. Through these primary results it was suggested that OY-TES-1 may influence the biological behaviour of MSCs.
Zhang, Wen; Li, Shaojun; Zhao, Yunlong; Guo, Nannan; Li, Yingjie
2016-12-01
Objective To observe the expression of the neural precursor cell expressed, developmentally down-regulated 9 (NEDD9) in esophageal cancer, to investigate the impact of decreased expression of NEDD9 on invasion and migration, and to explicit the function of NEDD9 in EC109 human esophageal cancer cell line. Methods Immunohistochemical staining was used to detect the expression of NEDD9 in human esophageal cancer tissues and paracancerous normal tissues. RNA interfering (RNAi) was used to knockdown NEDD9 in EC109 cells. The interference efficiency was detected by reverse transcription PCR (RT-PCR) and Western blot analysis. Cell proliferation was determined by MTT assay and the invasion and migration abilities of EC109 cells were monitored by Transwell TM assay. The protein levels of proliferating cell nuclear antigen (PCNA), Bax and Bcl-2 were tested by Western blotting. Results The positive expression rate of NEDD9 in esophageal carcinoma tissues was significantly higher compared with that in the paracancerous tissues. After NEDD9 expression was successfully downregulated in EC109 cells by siRNA, the proliferation, invasion and migration rates in transfection group were significantly lower than those in control group; meanwhile, the expression of Bcl-2 was reduced and Bax expression was enhanced. Conclusion The protein expression level of NEDD9 is higher in esophageal carcinoma tissues than that in adjacent normal tissues. Knockdown of NEDD9 expression can restrain the proliferation, invasion and migration of EC109 cells.
RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella
Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.
2004-01-01
Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231
Freeley, Michael; Derrick, Emily; Dempsey, Eugene; Hoff, Antje; Davies, Anthony; Leake, Devin; Vermeulen, Annaleen; Kelleher, Dermot; Long, Aideen
2015-09-01
Screening of RNA interference (RNAi) libraries in primary T cells is labor-intensive and technically challenging because these cells are hard to transfect. Chemically modified, self-delivering small interfering RNAs (siRNAs) offer a solution to this problem, because they enter hard-to-transfect cell types without needing a delivery reagent and are available in library format for RNAi screening. In this study, we have screened a library of chemically modified, self-delivering siRNAs targeting the expression of 72 distinct genes in conjunction with an image-based high-content-analysis platform as a proof-of-principle strategy to identify genes involved in lymphocyte function-associated antigen-1 (LFA-1)-mediated migration in primary human T cells. Our library-screening strategy identified the small GTPase RhoA as being crucial for T cell polarization and migration in response to LFA-1 stimulation and other migratory ligands. We also demonstrate that multiple downstream assays can be performed within an individual RNAi screen and have used the remainder of the cells for additional assays, including cell viability and adhesion to ICAM-1 (the physiological ligand for LFA-1) in the absence or presence of the chemokine SDF-1α. This study therefore demonstrates the ease and benefits of conducting siRNA library screens in primary human T cells using self-delivering, chemically modified siRNAs, and it emphasizes the feasibility and potential of this approach for elucidating the signaling pathways that regulate T cell function. © 2015 Society for Laboratory Automation and Screening.
RNAi mediated, stable resistance to Triticum mosaic virus in wheat
USDA-ARS?s Scientific Manuscript database
Triticum mosaic virus (TriMV), discovered in 2006, affects wheat production systems in the Great Plains of the United States. There are no available TriMV resistant commercial varieties. RNA interference (RNAi) was evaluated as an alternative strategy to generate resistance to TriMV. An RNAi pANDA...
Calhoun, Colonya C; Lu, Ying-Chun; Song, Jun; Chiu, Robert
2009-01-01
Cyclophilin A (CypA) was originally identified as a cytosolic protein possessing peptidyl-prolyl isomerase activity. CypA has been shown to play a pivotal role in the immune response, but little is known about other molecular mechanisms of CypA-mediated biologic events. In our present study, we demonstrate that knockdown CypA expression using RNAi in U2OS cells resulted in disruption of the F-actin structure, as well as decreased anchorage-independent growth, proliferation, and migration. Wild-type U2OS cells treated with cyclosporine A (CsA), a peptidyl-prolyl isomerase inhibitor, displayed the same phenotype as knockdown CypA cells, suggesting that the isomerase activity of CypA is required to maintain a normal phenotype. In vitro and in vivo binding assays revealed that CypA binds to N-WASP, which functions in the nucleation of actin via the Arp2/3 complex. Pulse-chase labeling study indicated an enhanced degradation of N-WASP in cell lacking CypA, suggesting that CypA is required for stabilizing N-WASP to form a N-WASP/Arp2/3 complex for the nucleation/initiation of F-actin polymerization.
Lee, Myon-Hee; Yoon, Dong Suk
2017-01-01
Stem cells have the ability to self-renew and to generate differentiated cell types. A regulatory network that controls this balance is critical for stem cell homeostasis and normal animal development. Particularly, Ras-ERK/MAPK signaling pathway is critical for stem cell self-renewal and differentiation in mammals, including humans. Aberrant regulation of Ras-ERK/MAPK signaling pathway results in either stem cell or overproliferation. Therefore, the identification of Ras-ERK/MAPK signaling pathway-associated regulators is critical to understand the mechanism of stem cell (possibly cancer stem cell) control. In this report, using the nematode C. elegans mutants, we developed a methodology for a phenotype-based RNAi screening that identifies stem cell regulator genes associated with Ras-ERK/MAPK signaling within the context of a whole organism. Importantly, this phenotype-based RNAi screening can be applied for other stem cell-associated signaling pathways such as Wnt/β-catenin and Notch using the C. elegans.
Potential and development of inhaled RNAi therapeutics for the treatment of pulmonary tuberculosis.
Man, Dede K W; Chow, Michael Y T; Casettari, Luca; Gonzalez-Juarrero, Mercedes; Lam, Jenny K W
2016-07-01
Tuberculosis (TB), caused by the infection of Mycobacterium tuberculosis (Mtb), continues to pose a serious threat to public health, and the situation is worsening with the rapid emergence of multidrug resistant (MDR) TB. Current TB regimens require long duration of treatment, and their toxic side effects often lead to poor adherence and low success rates. There is an urgent need for shorter and more effective treatment for TB. In recent years, RNA interference (RNAi) has become a powerful tool for studying gene function by silencing the target genes. The survival of Mtb in host macrophages involves the attenuation of the antimicrobial responses mounted by the host cells. RNAi technology has helped to improve our understanding of how these bacilli interferes with the bactericidal effect and host immunity during TB infection. It has been suggested that the host-directed intervention by modulation of host pathways can be employed as a novel and effective therapy against TB. This therapeutic approach could be achieved by RNAi, which holds enormous potential beyond a laboratory to the clinic. RNAi therapy targeting TB is being investigated for enhancing host antibacterial capacity or improving drug efficacy on drug resistance strains while minimizing the associated adverse effects. One of the key challenges of RNAi therapeutics arises from the delivery of the RNAi molecules into the target cells, and inhalation could serve as a direct administration route for the treatment of pulmonary TB in a non-invasive manner. However, there are still major obstacles that need to be overcome. This review focuses on the RNAi candidates that are currently explored for the treatment of TB and discusses the major barriers of pulmonary RNAi delivery. From this, we hope to stimulate further studies of local RNAi therapeutics for pulmonary TB treatment. Copyright © 2016 Elsevier B.V. All rights reserved.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans
Avgousti, Daphne C; Palani, Santhosh; Sherman, Yekaterina; Grishok, Alla
2012-01-01
Endogenous small interfering RNAs (endo-siRNAs) have been discovered in many organisms, including mammals. In C. elegans, depletion of germline-enriched endo-siRNAs found in complex with the CSR-1 Argonaute protein causes sterility and defects in chromosome segregation in early embryos. We discovered that knockdown of either csr-1, the RNA-dependent RNA polymerase (RdRP) ego-1, or the dicer-related helicase drh-3, leads to defects in histone mRNA processing, resulting in severe depletion of core histone proteins. The maturation of replication-dependent histone mRNAs, unlike that of other mRNAs, requires processing of their 3′UTRs through an endonucleolytic cleavage guided by the U7 snRNA, which is lacking in C. elegans. We found that CSR-1-bound antisense endo-siRNAs match histone mRNAs and mRNA precursors. Consistently, we demonstrate that CSR-1 directly binds to histone mRNA in an ego-1-dependent manner using biotinylated 2′-O-methyl RNA oligonucleotides. Moreover, we demonstrate that increasing the dosage of histone genes rescues the lethality associated with depletion of CSR-1 and EGO-1. These results support a positive and direct effect of RNAi on histone gene expression. PMID:22863779
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
Avgousti, Daphne C; Palani, Santhosh; Sherman, Yekaterina; Grishok, Alla
2012-10-03
Endogenous small interfering RNAs (endo-siRNAs) have been discovered in many organisms, including mammals. In C. elegans, depletion of germline-enriched endo-siRNAs found in complex with the CSR-1 Argonaute protein causes sterility and defects in chromosome segregation in early embryos. We discovered that knockdown of either csr-1, the RNA-dependent RNA polymerase (RdRP) ego-1, or the dicer-related helicase drh-3, leads to defects in histone mRNA processing, resulting in severe depletion of core histone proteins. The maturation of replication-dependent histone mRNAs, unlike that of other mRNAs, requires processing of their 3'UTRs through an endonucleolytic cleavage guided by the U7 snRNA, which is lacking in C. elegans. We found that CSR-1-bound antisense endo-siRNAs match histone mRNAs and mRNA precursors. Consistently, we demonstrate that CSR-1 directly binds to histone mRNA in an ego-1-dependent manner using biotinylated 2'-O-methyl RNA oligonucleotides. Moreover, we demonstrate that increasing the dosage of histone genes rescues the lethality associated with depletion of CSR-1 and EGO-1. These results support a positive and direct effect of RNAi on histone gene expression.
[Expression analysis of a transformer gene in Daphnia pulex after RNAi].
Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L
2016-01-01
In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.
The Transgenic RNAi Project at Harvard Medical School: Resources and Validation.
Perkins, Lizabeth A; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert
2015-11-01
To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT-qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT-qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). Copyright © 2015 by the Genetics Society of America.
The Transgenic RNAi Project at Harvard Medical School: Resources and Validation
Perkins, Lizabeth A.; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J.; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E.; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert
2015-01-01
To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT–qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT–qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). PMID:26320097
"Caenorhabditis Elegans" as an Undergraduate Educational Tool for Teaching RNAi
ERIC Educational Resources Information Center
Andersen, Janet; Krichevsky, Alexander; Leheste, Joerg R.; Moloney, Daniel J.
2008-01-01
Discovery of RNA-mediated interference (RNAi) is widely recognized as one of the most significant molecular biology breakthroughs in the past 10 years. There is a need for science educators to develop teaching tools and laboratory activities that demonstrate the power of this new technology and help students to better understand the RNAi process.…
Transcriptional silencing of a transgene by RNAi in the soma of C. elegans.
Grishok, Alla; Sinskey, Jina L; Sharp, Phillip A
2005-03-15
The silencing of transgene expression at the level of transcription in the soma of Caenorhabditis elegans through an RNAi-dependent pathway has not been previously characterized. Most gene silencing due to RNAi in C. elegans occurs at the post-transcriptional level. We observed transcriptional silencing when worms containing the elt-2::gfp/LacZ transgene were fed RNA produced from the commonly used L4440 vector. The transgene and the vector share plasmid backbone sequences. This transgene silencing depends on multiple RNAi pathway genes, including dcr-1, rde-1, rde-4, and rrf-1. Unlike post-transcriptional gene silencing in worms, elt-2::gfp/LacZ silencing is dependent on the PAZ-PIWI protein Alg-1 and on the HP1 homolog Hpl-2. The latter is a chromatin silencing factor, and expression of the transgene is inhibited at the level of intron-containing precursor mRNA. This inhibition is accompanied by a decrease in the acetylation of histones associated with the transgene. This transcriptional silencing in the soma can be distinguished from transgene silencing in the germline by its inability to be transmitted across generations and its dependence on the rde-1 gene. We therefore define this type of silencing as RNAi-induced Transcriptional Gene Silencing (RNAi-TGS). Additional chromatin-modifying components affecting RNAi-TGS were identified in a candidate RNAi screen.
Conditional knockdown of BCL2A1 reveals rate-limiting roles in BCR-dependent B-cell survival
Sochalska, M; Ottina, E; Tuzlak, S; Herzog, S; Herold, M; Villunger, A
2016-01-01
Bcl2 family proteins control mitochondrial apoptosis and its members exert critical cell type and differentiation stage-specific functions, acting as barriers against autoimmunity or transformation. Anti-apoptotic Bcl2a1/Bfl1/A1 is frequently deregulated in different types of blood cancers in humans but its physiological role is poorly understood as quadruplication of the Bcl2a1 gene locus in mice hampers conventional gene targeting strategies. Transgenic overexpression of A1, deletion of the A1-a paralogue or constitutive knockdown in the hematopoietic compartment of mice by RNAi suggested rate-limiting roles in lymphocyte development, granulopoiesis and mast cell activation. Here we report on the consequences of conditional knockdown of A1 protein expression using a reverse transactivator (rtTA)-driven approach that highlights a critical role for this Bcl2 family member in the maintenance of mature B-cell homeostasis. Furthermore, we define the A1/Bim (Bcl-2 interacting mediator of cell death) axis as a target of key kinases mediating B-cell receptor (BCR)-dependent survival signals, such as, spleen tyrosine kinase (Syk) and Brutons tyrosine kinase (Btk). As such, A1 represents a putative target for the treatment of B-cell-related pathologies depending on hyperactivation of BCR-emanating survival signals and loss of A1 expression accounts, in part, for the pro-apoptotic effects of Syk- or Btk inhibitors that rely on the ‘BH3-only' protein Bim for cell killing. PMID:26450454
Bhinder, Bhavneet; Antczak, Christophe; Shum, David; Radu, Constantin; Mahida, Jeni P.; Liu-Sullivan, Nancy; Ibáñez, Glorymar; Raja, Balajee Somalinga; Calder, Paul A.; Djaballah, Hakim
2014-01-01
Memorial Sloan-Kettering Cancer Center (MSKCC) has implemented the creation of a full service state-of-the-art High-throughput Screening Core Facility (HTSCF) equipped with modern robotics and custom-built screening data management resources to rapidly store and query chemical and RNAi screening data outputs. The mission of the facility is to provide oncology clinicians and researchers alike with access to cost-effective HTS solutions for both chemical and RNAi screening, with an ultimate goal of novel target identification and drug discovery. HTSCF was established in 2003 to support the institution’s commitment to growth in molecular pharmacology and in the realm of therapeutic agents to fight chronic diseases such as cancer. This endeavor required broad range of expertise in technology development to establish robust and innovative assays, large collections of diverse chemical and RNAi duplexes to probe specific cellular events, sophisticated compound and data handling capabilities, and a profound knowledge in assay development, hit validation, and characterization. Our goal has been to strive for constant innovation, and we strongly believe in shifting the paradigm from traditional drug discovery towards translational research now, making allowance for unmet clinical needs in patients. Our efforts towards repurposing FDA-approved drugs fructified when digoxin, identified through primary HTS, was administered in the clinic for treatment of stage Vb retinoblastoma. In summary, the overall aim of our facility is to identify novel chemical probes, to study cellular processes relevant to investigator’s research interest in chemical biology and functional genomics, and to be instrumental in accelerating the process of drug discovery in academia. PMID:24661215
C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.
Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua
2009-08-07
The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.
Barnard, Annette-Christi; Nijhof, Ard M.; Fick, Wilma; Stutzer, Christian; Maritz-Olivier, Christine
2012-01-01
The availability of genome sequencing data in combination with knowledge of expressed genes via transcriptome and proteome data has greatly advanced our understanding of arthropod vectors of disease. Not only have we gained insight into vector biology, but also into their respective vector-pathogen interactions. By combining the strengths of postgenomic databases and reverse genetic approaches such as RNAi, the numbers of available drug and vaccine targets, as well as number of transgenes for subsequent transgenic or paratransgenic approaches, have expanded. These are now paving the way for in-field control strategies of vectors and their pathogens. Basic scientific questions, such as understanding the basic components of the vector RNAi machinery, is vital, as this allows for the transfer of basic RNAi machinery components into RNAi-deficient vectors, thereby expanding the genetic toolbox of these RNAi-deficient vectors and pathogens. In this review, we focus on the current knowledge of arthropod vector RNAi machinery and the impact of RNAi on understanding vector biology and vector-pathogen interactions for which vector genomic data is available on VectorBase. PMID:24705082
RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.
Rytlewski, Julie A; Beronja, Slobodan
2015-01-01
The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.
Biotechnological uses of RNAi in plants: risk assessment considerations.
Casacuberta, Josep M; Devos, Yann; du Jardin, Patrick; Ramon, Matthew; Vaucheret, Hervé; Nogué, Fabien
2015-03-01
RNAi offers opportunities to generate new traits in genetically modified (GM) plants. Instead of expressing novel proteins, RNAi-based GM plants reduce target gene expression. Silencing of off-target genes may trigger unintended effects, and identifying these genes would facilitate risk assessment. However, using bioinformatics alone is not reliable, due to the lack of genomic data and insufficient knowledge of mechanisms governing mRNA-small (s)RNA interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Next-generation transgenic cotton: pyramiding RNAi and Bt counters insect resistance.
Ni, Mi; Ma, Wei; Wang, Xiaofang; Gao, Meijing; Dai, Yan; Wei, Xiaoli; Zhang, Lei; Peng, Yonggang; Chen, Shuyuan; Ding, Lingyun; Tian, Yue; Li, Jie; Wang, Haiping; Wang, Xiaolin; Xu, Guowang; Guo, Wangzhen; Yang, Yihua; Wu, Yidong; Heuberger, Shannon; Tabashnik, Bruce E; Zhang, Tianzhen; Zhu, Zhen
2017-09-01
Transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are extensively cultivated worldwide. To counter rapidly increasing pest resistance to crops that produce single Bt toxins, transgenic plant 'pyramids' producing two or more Bt toxins that kill the same pest have been widely adopted. However, cross-resistance and antagonism between Bt toxins limit the sustainability of this approach. Here we describe development and testing of the first pyramids of cotton combining protection from a Bt toxin and RNA interference (RNAi). We developed two types of transgenic cotton plants producing double-stranded RNA (dsRNA) from the global lepidopteran pest Helicoverpa armigera designed to interfere with its metabolism of juvenile hormone (JH). We focused on suppression of JH acid methyltransferase (JHAMT), which is crucial for JH synthesis, and JH-binding protein (JHBP), which transports JH to organs. In 2015 and 2016, we tested larvae from a Bt-resistant strain and a related susceptible strain of H. armigera on seven types of cotton: two controls, Bt cotton, two types of RNAi cotton (targeting JHAMT or JHBP) and two pyramids (Bt cotton plus each type of RNAi). Both types of RNAi cotton were effective against Bt-resistant insects. Bt cotton and RNAi acted independently against the susceptible strain. In computer simulations of conditions in northern China, where millions of farmers grow Bt cotton as well as abundant non-transgenic host plants of H. armigera, pyramided cotton combining a Bt toxin and RNAi substantially delayed resistance relative to using Bt cotton alone. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...
Tulpule, Asmin; Lensch, M William; Miller, Justine D; Austin, Karyn; D'Andrea, Alan; Schlaeger, Thorsten M; Shimamura, Akiko; Daley, George Q
2010-04-29
Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNA interference (RNAi) strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicate that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Knockdown and replacement therapy mediated by artificial mirtrons in spinocerebellar ataxia 7
Curtis, Helen J.; Wood, Matthew J.A.
2017-01-01
Abstract We evaluate a knockdown-replacement strategy mediated by mirtrons as an alternative to allele-specific silencing using spinocerebellar ataxia 7 (SCA7) as a model. Mirtrons are introns that form pre-microRNA hairpins after splicing, producing RNAi effectors not processed by Drosha. Mirtron mimics may therefore avoid saturation of the canonical processing pathway. This method combines gene silencing mediated by an artificial mirtron with delivery of a functional copy of the gene such that both elements of the therapy are always expressed concurrently, minimizing the potential for undesirable effects and preserving wild-type function. This mutation- and single nucleotide polymorphism-independent method could be crucial in dominant diseases that feature both gain- and loss-of-function pathologies or have a heterogeneous genetic background. Here we develop mirtrons against ataxin 7 with silencing efficacy comparable to shRNAs, and introduce silent mutations into an ataxin 7 transgene such that it is resistant to their effect. We successfully express the transgene and one mirtron together from a single construct. Hence, we show that this method can be used to silence the endogenous allele of ataxin 7 and replace it with an exogenous copy of the gene, highlighting the efficacy and transferability across patient genotypes of this approach. PMID:28575281
Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin
2016-01-01
ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for
RNCR3 knockdown inhibits diabetes mellitus-induced retinal reactive gliosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Chang; Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai; The Fourth School of Clinical Medicine, Nanjing Medical University, Nanjing
Retinal reactive gliosis is an important pathological feature of diabetic retinopathy. Identifying the underlying mechanisms causing reactive gliosis will be important for developing new therapeutic strategies for treating diabetic retinopathy. Herein, we show that long noncoding RNA-RNCR3 knockdown significantly inhibits retinal reactive gliosis. RNCR3 knockdown leads to a marked reduction in the release of several cytokines. RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration, as shown by less apoptotic retinal cells and ameliorative visual function. RNCR3 knockdown could also decrease Müller glial cell viability and proliferation, and reduce the expression of glial reactivity-related genes including GFAP and vimentin in vitro. Collectively, thismore » study shows that RNCR3 knockdown may be a promising strategy for the prevention of diabetes mellitus-induced retinal neurodegeneration. - Highlights: • RNCR3 knockdown inhibits retinal reactive gliosis. • RNCR3 knockdown causes a significant change in cytokine profile. • RNCR3 knockdown alleviates diabetes mellitus-induced retinal neurodegeneration. • RNCR3 knockdown affects Müller glial cell function in vitro.« less
RNAiFold2T: Constraint Programming design of thermo-IRES switches.
Garcia-Martin, Juan Antonio; Dotu, Ivan; Fernandez-Chamorro, Javier; Lozano, Gloria; Ramajo, Jorge; Martinez-Salas, Encarnacion; Clote, Peter
2016-06-15
RNA thermometers (RNATs) are cis-regulatory elements that change secondary structure upon temperature shift. Often involved in the regulation of heat shock, cold shock and virulence genes, RNATs constitute an interesting potential resource in synthetic biology, where engineered RNATs could prove to be useful tools in biosensors and conditional gene regulation. Solving the 2-temperature inverse folding problem is critical for RNAT engineering. Here we introduce RNAiFold2T, the first Constraint Programming (CP) and Large Neighborhood Search (LNS) algorithms to solve this problem. Benchmarking tests of RNAiFold2T against existent programs (adaptive walk and genetic algorithm) inverse folding show that our software generates two orders of magnitude more solutions, thus allowing ample exploration of the space of solutions. Subsequently, solutions can be prioritized by computing various measures, including probability of target structure in the ensemble, melting temperature, etc. Using this strategy, we rationally designed two thermosensor internal ribosome entry site (thermo-IRES) elements, whose normalized cap-independent translation efficiency is approximately 50% greater at 42 °C than 30 °C, when tested in reticulocyte lysates. Translation efficiency is lower than that of the wild-type IRES element, which on the other hand is fully resistant to temperature shift-up. This appears to be the first purely computational design of functional RNA thermoswitches, and certainly the first purely computational design of functional thermo-IRES elements. RNAiFold2T is publicly available as part of the new release RNAiFold3.0 at https://github.com/clotelab/RNAiFold and http://bioinformatics.bc.edu/clotelab/RNAiFold, which latter has a web server as well. The software is written in C ++ and uses OR-Tools CP search engine. clote@bc.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Zhang, Chi; Montgomery, Taiowa A; Fischer, Sylvia E J; Garcia, Susana M D A; Riedel, Christian G; Fahlgren, Noah; Sullivan, Christopher M; Carrington, James C; Ruvkun, Gary
2012-05-22
In nematodes, plants, and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary small interfering RNAs (siRNAs) and the target messenger RNA (mRNA) leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10, and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, and other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage but sensitive to high dosage of double-stranded RNAs. We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6, and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zhang, Chi; Montgomery, Taiowa A.; Fischer, Sylvia E. J.; Garcia, Susana M. D. A.; Riedel, Christian G.; Fahlgren, Noah; Sullivan, Christopher M.; Carrington, James C.; Ruvkun, Gary
2012-01-01
SUMMARY Background In nematodes, plants and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary siRNAs and the target mRNA leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. Results From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10 and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, as well as other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage, but sensitive to high dosage of double-stranded RNAs (dsRNAs). We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6 and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. Conclusions The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. PMID:22542102
Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano
2015-03-25
RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicolas, Francisco E.; Vila, Ana; Moxon, Simon
Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M
Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...
2015-03-25
Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M
iScreen: Image-Based High-Content RNAi Screening Analysis Tools.
Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua
2015-09-01
High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.
Single-cell analysis of population context advances RNAi screening at multiple levels
Snijder, Berend; Sacher, Raphael; Rämö, Pauli; Liberali, Prisca; Mench, Karin; Wolfrum, Nina; Burleigh, Laura; Scott, Cameron C; Verheije, Monique H; Mercer, Jason; Moese, Stefan; Heger, Thomas; Theusner, Kristina; Jurgeit, Andreas; Lamparter, David; Balistreri, Giuseppe; Schelhaas, Mario; De Haan, Cornelis A M; Marjomäki, Varpu; Hyypiä, Timo; Rottier, Peter J M; Sodeik, Beate; Marsh, Mark; Gruenberg, Jean; Amara, Ali; Greber, Urs; Helenius, Ari; Pelkmans, Lucas
2012-01-01
Isogenic cells in culture show strong variability, which arises from dynamic adaptations to the microenvironment of individual cells. Here we study the influence of the cell population context, which determines a single cell's microenvironment, in image-based RNAi screens. We developed a comprehensive computational approach that employs Bayesian and multivariate methods at the single-cell level. We applied these methods to 45 RNA interference screens of various sizes, including 7 druggable genome and 2 genome-wide screens, analysing 17 different mammalian virus infections and four related cell physiological processes. Analysing cell-based screens at this depth reveals widespread RNAi-induced changes in the population context of individual cells leading to indirect RNAi effects, as well as perturbations of cell-to-cell variability regulators. We find that accounting for indirect effects improves the consistency between siRNAs targeted against the same gene, and between replicate RNAi screens performed in different cell lines, in different labs, and with different siRNA libraries. In an era where large-scale RNAi screens are increasingly performed to reach a systems-level understanding of cellular processes, we show that this is often improved by analyses that account for and incorporate the single-cell microenvironment. PMID:22531119
de Paiva, Rita Marcia Cardoso; Grazielle-Silva, Viviane; Cardoso, Mariana Santos; Nakagaki, Brenda Naemi; Mendonça-Neto, Rondon Pessoa; Canavaci, Adriana Monte Cassiano; Souza Melo, Normanda; Martinelli, Patrícia Massara; Fernandes, Ana Paula; daRocha, Wanderson Duarte; Teixeira, Santuza M R
2015-12-01
Leishmaniasis, a human parasitic disease with manifestations ranging from cutaneous ulcerations to fatal visceral infection, is caused by several Leishmania species. These protozoan parasites replicate as extracellular, flagellated promastigotes in the gut of a sandfly vector and as amastigotes inside the parasitophorous vacuole of vertebrate host macrophages. Amastins are surface glycoproteins encoded by large gene families present in the genomes of several trypanosomatids and highly expressed in the intracellular amastigote stages of Trypanosoma cruzi and Leishmania spp. Here, we showed that the genome of L. braziliensis contains 52 amastin genes belonging to all four previously described amastin subfamilies and that the expression of members of all subfamilies is upregulated in L. braziliensis amastigotes. Although primary sequence alignments showed no homology to any known protein sequence, homology searches based on secondary structure predictions indicate that amastins are related to claudins, a group of proteins that are components of eukaryotic tight junction complexes. By knocking-down the expression of δ-amastins in L. braziliensis, their essential role during infection became evident. δ-amastin knockdown parasites showed impaired growth after in vitro infection of mouse macrophages and completely failed to produce infection when inoculated in BALB/c mice, an attenuated phenotype that was reverted by the re-expression of an RNAi-resistant amastin gene. Further highlighting their essential role in host-parasite interactions, electron microscopy analyses of macrophages infected with amastin knockdown parasites showed significant alterations in the tight contact that is normally observed between the surface of wild type amastigotes and the membrane of the parasitophorous vacuole.
RNAi of COL1A1 in mesenchymal progenitor cells.
Millington-Ward, Sophia; McMahon, Helena P; Allen, Danny; Tuohy, Gearóid; Kiang, Anna-Sophia; Palfi, Arpad; Kenna, Paul F; Humphries, Peter; Farrar, G Jane
2004-10-01
Given that mutant COL1A1 is known to cause Osteogenesis Imperfecta (OI), tools to modulate COL1A1 expression are likely to be of significant therapeutic value. In this context, we have evaluated RNA interference (RNAi) as a means to downregulate COL1A1 expression in Cos-7 cells and in human mesenchymal progenitor stem cells (MPCs), the latter cells giving rise to bone and therefore representing a target cell type for collagen-related disorders. In addition, allele-specificity, a key factor to the success of RNAi-based suppression, was explored with a view to developing a mutation-independent RNAi-based therapeutic for OI by targeting an intragenic SNP within transcripts derived from the COL1A1 gene. Preferential suppression of individual polymorphic alleles that differed by a single nucleotide was observed.
The insect ecdysone receptor is a good potential target for RNAi-based pest control.
Yu, Rong; Xu, Xinping; Liang, Yongkang; Tian, Honggang; Pan, Zhanqing; Jin, Shouheng; Wang, Na; Zhang, Wenqing
2014-01-01
RNA interference (RNAi) has great potential for use in insect pest control. However, some significant challenges must be overcome before RNAi-based pest control can become a reality. One challenge is the proper selection of a good target gene for RNAi. Here, we report that the insect ecdysone receptor (EcR) is a good potential target for RNAi-based pest control in the brown planthopper Nilaparvata lugens, a serious insect pest of rice plants. We demonstrated that the use of a 360 bp fragment (NlEcR-c) that is common between NlEcR-A and NlEcR-B for feeding RNAi experiments significantly decreased the relative mRNA expression levels of NlEcR compared with those in the dsGFP control. Feeding RNAi also resulted in a significant reduction in the number of offspring per pair of N. lugens. Consequently, a transgenic rice line expressing NlEcR dsRNA was constructed by Agrobacterium- mediated transformation. The results of qRT-PCR showed that the total copy number of the target gene in all transgenic rice lines was 2. Northern blot analysis showed that the small RNA of the hairpin dsNlEcR-c was successfully expressed in the transgenic rice lines. After newly hatched nymphs of N. lugens fed on the transgenic rice lines, effective RNAi was observed. The NlEcR expression levels in all lines examined were decreased significantly compared with the control. In all lines, the survival rate of the nymphs was nearly 90%, and the average number of offspring per pair in the treated groups was significantly less than that observed in the control, with a decrease of 44.18-66.27%. These findings support an RNAi-based pest control strategy and are also important for the management of rice insect pests.
Taylor, Jessica; Woodcock, Simon
2015-09-01
For more than a decade, RNA interference (RNAi) has brought about an entirely new approach to functional genomics screening. Enabling high-throughput loss-of-function (LOF) screens against the human genome, identifying new drug targets, and significantly advancing experimental biology, RNAi is a fast, flexible technology that is compatible with existing high-throughput systems and processes; however, the recent advent of clustered regularly interspaced palindromic repeats (CRISPR)-Cas, a powerful new precise genome-editing (PGE) technology, has opened up vast possibilities for functional genomics. CRISPR-Cas is novel in its simplicity: one piece of easily engineered guide RNA (gRNA) is used to target a gene sequence, and Cas9 expression is required in the cells. The targeted double-strand break introduced by the gRNA-Cas9 complex is highly effective at removing gene expression compared to RNAi. Together with the reduced cost and complexity of CRISPR-Cas, there is the realistic opportunity to use PGE to screen for phenotypic effects in a total gene knockout background. This review summarizes the exciting development of CRISPR-Cas as a high-throughput screening tool, comparing its future potential to that of well-established RNAi screening techniques, and highlighting future challenges and opportunities within these disciplines. We conclude that the two technologies actually complement rather than compete with each other, enabling greater understanding of the genome in relation to drug discovery. © 2015 Society for Laboratory Automation and Screening.
Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.
Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F
2015-01-01
Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.
van Haaften, Gijs; Romeijn, Ron; Pothof, Joris; Koole, Wouter; Mullenders, Leon H F; Pastink, Albert; Plasterk, Ronald H A; Tijsterman, Marcel
2006-07-11
Ionizing radiation is extremely harmful for human cells, and DNA double-strand breaks (DSBs) are considered to be the main cytotoxic lesions induced. Improper processing of DSBs contributes to tumorigenesis, and mutations in DSB response genes underlie several inherited disorders characterized by cancer predisposition. Here, we performed a comprehensive screen for genes that protect animal cells against ionizing radiation. A total of 45 C. elegans genes were identified in a genome-wide RNA interference screen for increased sensitivity to ionizing radiation in germ cells. These genes include orthologs of well-known human cancer predisposition genes as well as novel genes, including human disease genes not previously linked to defective DNA-damage responses. Knockdown of eleven genes also impaired radiation-induced cell-cycle arrest, and seven genes were essential for apoptosis upon exposure to irradiation. The gene set was further clustered on the basis of increased sensitivity to DNA-damaging cancer drugs cisplatin and camptothecin. Almost all genes are conserved across animal phylogeny, and their relevance for humans was directly demonstrated by showing that their knockdown in human cells results in radiation sensitivity, indicating that this set of genes is important for future cancer profiling and drug development.
Time-controllable Nkcc1 knockdown replicates reversible hearing loss in postnatal mice.
Watabe, Takahisa; Xu, Ming; Watanabe, Miho; Nabekura, Junichi; Higuchi, Taiga; Hori, Karin; Sato, Mitsuo P; Nin, Fumiaki; Hibino, Hiroshi; Ogawa, Kaoru; Masuda, Masatsugu; Tanaka, Kenji F
2017-10-19
Identification of the causal effects of specific proteins on recurrent and partially reversible hearing loss has been difficult because of the lack of an animal model that provides reversible gene knockdown. We have developed the transgenic mouse line Actin-tTS::Nkcc1 tetO/tetO for manipulatable expression of the cochlear K + circulation protein, NKCC1. Nkcc1 transcription was blocked by the binding of a tetracycline-dependent transcriptional silencer to the tetracycline operator sequences inserted upstream of the Nkcc1 translation initiation site. Administration of the tetracycline derivative doxycycline reversibly regulated Nkcc1 knockdown. Progeny from pregnant/lactating mothers fed doxycycline-free chow from embryonic day 0 showed strong suppression of Nkcc1 expression (~90% downregulation) and Nkcc1 null phenotypes at postnatal day 35 (P35). P35 transgenic mice from mothers fed doxycycline-free chow starting at P0 (delivery) showed weaker suppression of Nkcc1 expression (~70% downregulation) and less hearing loss with mild cochlear structural changes. Treatment of these mice at P35 with doxycycline for 2 weeks reactivated Nkcc1 transcription to control levels and improved hearing level at high frequency; i.e., these doxycycline-treated mice exhibited partially reversible hearing loss. Thus, development of the Actin-tTS::Nkcc1 tetO/tetO transgenic mouse line provides a mouse model for the study of variable hearing loss through reversible knockdown of Nkcc1.
RNAi-based GM plants: food for thought for risk assessors.
Ramon, Matthew; Devos, Yann; Lanzoni, Anna; Liu, Yi; Gomes, Ana; Gennaro, Andrea; Waigmann, Elisabeth
2014-12-01
RNA interference (RNAi) is an emerging technology that offers new opportunities for the generation of new traits in genetically modified (GM) plants. Potential risks associated with RNAi-based GM plants and issues specific to their risk assessment were discussed during an international scientific workshop (June 2014) organized by the European Food Safety Authority (EFSA). Selected key outcomes of the workshop are reported here. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences
Robert, Valérie J.P.; Sijen, Titia; van Wolfswinkel, Josien; Plasterk, Ronald H.A.
2005-01-01
Protection of genomes against invasion by repetitive sequences, such as transposons, viruses, and repetitive transgenes, involves strong and selective silencing of these sequences. During silencing of repetitive transgenes, a trans effect (“cosuppression”) occurs that results in silencing of cognate endogenous genes. Here we report RNA interference (RNAi) screens performed to catalog genes required for cosuppression in the Caenorhabditis elegans germline. We find factors with a putative role in chromatin remodeling and factors involved in RNAi. Together with molecular data also presented in this study, these results suggest that in C. elegans repetitive sequences trigger transcriptional gene silencing using RNAi and chromatin factors. PMID:15774721
RNAi-mediated resistance to viruses in genetically engineered plants.
Ibrahim, Abdulrazak B; Aragão, Francisco J L
2015-01-01
RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.
Du, Yiwei; He, Wei; Deng, Changwang; Chen, Xi; Gou, Lanming; Zhu, Fugui; Guo, Wei; Zhang, Jianfu; Wang, Tao
2016-01-01
Flowering time is a critical trait for crops cultivated under various temperature/photoperiod conditions around the world. To understand better the flowering time of rice, we used the vector pTCK303 to produce several lines of RNAi knockdown transgenic rice and investigated their flowering times and other agronomic traits. Among them, the heading date of FRRP1-RNAi knockdown transgenic rice was 23-26 days earlier than that of wild-type plants. FRRP1 is a novel rice gene that encodes a C3HC4-type Really Interesting Novel Gene (RING) finger domain protein. In addition to the early flowering time, FRRP1-RNAi knockdown transgenic rice caused changes on an array of agronomic traits, including plant height, panicle length and grain length. We analyzed the expression of some key genes associated with the flowering time and other agronomic traits in the FRRP1-RNAi knockdown lines and compared with that in wild-type lines. The expression of Hd3a increased significantly, which was the key factor in the early flowering time. Further experiments showed that the level of histone H2B monoubiquitination (H2Bub1) was noticeably reduced in the FRRP1-RNAi knockdown transgenic rice lines compared with wild-type plants and MBP-FRRP1-F1 was capable of self-ubiquitination. The results indicate that Flowering Related RING Protein 1 (FRRP1) is involved in histone H2B monoubiquitination and suggest that FRRP1 functions as an E3 ligase in vivo and in vitro. In conclusion, FRRP1 probably regulates flowering time and yield potential in rice by affecting histone H2B monoubiquitination, which leads to changes in gene expression in multiple processes.
Deng, Changwang; Chen, Xi; Gou, Lanming; Zhu, Fugui; Guo, Wei; Zhang, Jianfu; Wang, Tao
2016-01-01
Flowering time is a critical trait for crops cultivated under various temperature/photoperiod conditions around the world. To understand better the flowering time of rice, we used the vector pTCK303 to produce several lines of RNAi knockdown transgenic rice and investigated their flowering times and other agronomic traits. Among them, the heading date of FRRP1-RNAi knockdown transgenic rice was 23–26 days earlier than that of wild-type plants. FRRP1 is a novel rice gene that encodes a C3HC4-type Really Interesting Novel Gene (RING) finger domain protein. In addition to the early flowering time, FRRP1-RNAi knockdown transgenic rice caused changes on an array of agronomic traits, including plant height, panicle length and grain length. We analyzed the expression of some key genes associated with the flowering time and other agronomic traits in the FRRP1-RNAi knockdown lines and compared with that in wild-type lines. The expression of Hd3a increased significantly, which was the key factor in the early flowering time. Further experiments showed that the level of histone H2B monoubiquitination (H2Bub1) was noticeably reduced in the FRRP1-RNAi knockdown transgenic rice lines compared with wild-type plants and MBP-FRRP1-F1 was capable of self-ubiquitination. The results indicate that Flowering Related RING Protein 1 (FRRP1) is involved in histone H2B monoubiquitination and suggest that FRRP1 functions as an E3 ligase in vivo and in vitro. In conclusion, FRRP1 probably regulates flowering time and yield potential in rice by affecting histone H2B monoubiquitination, which leads to changes in gene expression in multiple processes. PMID:26934377
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin
2017-07-18
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin
2017-01-01
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023
Li, Xiaoou; Xie, Lili; He, Bing; Huang, Wei
2018-01-01
Objective To study the role of a disintegrin and metalloproteinase10 (ADAM10) in shedding neural cadherin (N-cadherin) and develop an approach to interfere the process of ventricular remodeling in adriamycin-induced cardiomyopathy (ACM) rats. Methods In a rat model of ACM, the effects of intraperitoneal injection of the lentiviral RNAi vector of ADAM10 on the morphology of cardiomyocytes and contractile function were observed by HE staining and color Doppler echocardiography. The expressions of N-cadherin and C-terminal fragment 1 (CTF1) were detected by Western blotting and immunohistochemistry. Results In the in vivo experiment, a large amount of fluorescence was seen in the isolated primary cardiomyocytes, which indicated that the transfection in the rat model was successful. In the treatment group, the morphology of cardiomyocytes and function of the heart were evidently improved, N-cadherin protein expression was remarkably up-regulated and CTF1 protein was obviously down-regulated compared with the model group. Conclusion Knock-down of ADAM10 increases N-cadherin expression and decreases CTF1 expression, thus improves cardiac function in the rat model of ACM.
Shum, David; Bhinder, Bhavneet; Djaballah, Hakim
2013-01-01
MicroRNAs (miRNAs) are small endogenous and conserved non-coding RNA molecules that regulate gene expression. Although the first miRNA was discovered well over sixteen years ago, little is known about their biogenesis and it is only recently that we have begun to understand their scope and diversity. For this purpose, we performed an RNAi screen aimed at identifying genes involved in their biogenesis pathway with a potential use as biomarkers. Using a previously developed miRNA 21 (miR-21) EGFP-based biosensor cell based assay monitoring green fluorescence enhancements, we performed an arrayed short hairpin RNA (shRNA) screen against a lentiviral particle ready TRC1 library covering 16,039 genes in 384-well plate format, and interrogating the genome one gene at a time building a panoramic view of endogenous miRNA activity. Using the BDA method for RNAi data analysis, we nominate 497 gene candidates the knockdown of which increased the EGFP fluorescence and yielding an initial hit rate of 3.09%; of which only 22, with reported validated clones, are deemed high-confidence gene candidates. An unexpected and surprising result was that only DROSHA was identified as a hit out of the seven core essential miRNA biogenesis genes; suggesting that perhaps intracellular shRNA processing into the correct duplex may be cell dependent and with differential outcome. Biological classification revealed several major control junctions among them genes involved in transport and vesicular trafficking. In summary, we report on 22 high confidence gene candidate regulators of miRNA biogenesis with potential use in drug and biomarker discovery. PMID:23977983
Dash, Manoranjan; Dutta, Tushar K; Phani, Victor; Papolu, Pradeep K; Shivakumara, Tagginahalli N; Rao, Uma
2017-08-26
Owing to the current deficiencies in chemical control options and unavailability of novel management strategies, root-knot nematode (M. incognita) infections remain widespread with significant socio-economic impacts. Helminth nervous systems are peptide-rich and appear to be putative drug targets that could be exploited by antihelmintic chemotherapy. Herein, to characterize the novel peptidergic neurotransmitters, in silico mining of M. incognita genomic and transciptomic datasets revealed the presence of 16 neuropeptide-like protein (nlp) genes with structural hallmarks of neuropeptide preproproteins; among which 13 nlps were PCR-amplified and sequenced. Two key nlp genes (Mi-nlp-3 and Mi-nlp-12) were localized to the basal bulb and tail region of nematode body via in situ hybridization assay. Mi-nlp-3 and Mi-nlp-12 were greatly expressed (in qRT-PCR assay) in the pre-parasitic juveniles and adult females, suggesting the association of these genes in host recognition, development and reproduction of M. incognita. In vitro knockdown of Mi-nlp-3 and Mi-nlp-12 via RNAi demonstrated the significant reduction in attraction and penetration of M. incognita in tomato root in Pluronic gel medium. A pronounced perturbation in development and reproduction of NLP-silenced worms was also documented in adzuki beans in CYG growth pouches. The deleterious phenotypes obtained due to NLP knockdown suggests that transgenic plants engineered to express RNA constructs targeting nlp genes may emerge as an environmentally viable option to manage nematode problems in crop plants. Copyright © 2017 Elsevier Inc. All rights reserved.
Optical imaging of RNAi-mediated silencing of cancer
NASA Astrophysics Data System (ADS)
Ochiya, Takahiro; Honma, Kimi; Takeshita, Fumitaka; Nagahara, Shunji
2008-02-01
RNAi has rapidly become a powerful tool for drug target discovery and validation in an in vitro culture system and, consequently, interest is rapidly growing for extension of its application to in vivo systems, such as animal disease models and human therapeutics. Cancer is one obvious application for RNAi therapeutics, because abnormal gene expression is thought to contribute to the pathogenesis and maintenance of the malignant phenotype of cancer and thereby many oncogenes and cell-signaling molecules present enticing drug target possibilities. RNAi, potent and specific, could silence tumor-related genes and would appear to be a rational approach to inhibit tumor growth. In subsequent in vivo studies, the appropriate cancer model must be developed for an evaluation of siRNA effects on tumors. How to evaluate the effect of siRNA in an in vivo therapeutic model is also important. Accelerating the analyses of these models and improving their predictive value through whole animal imaging methods, which provide cancer inhibition in real time and are sensitive to subtle changes, are crucial for rapid advancement of these approaches. Bioluminescent imaging is one of these optically based imaging methods that enable rapid in vivo analyses of a variety of cellular and molecular events with extreme sensitivity.
Affinity approaches in RNAi-based therapeutics purification.
Pereira, Patrícia; Queiroz, João A; Figueiras, Ana; Sousa, Fani
2016-05-15
The recent investigation on RNA interference (RNAi) related mechanisms and applications led to an increased awareness of the importance of RNA in biology. Nowadays, RNAi-based technology has emerged as a potentially powerful tool for silencing gene expression, being exploited to develop new therapeutics for treating a vast number of human disease conditions, as it is expected that this technology can be translated onto clinical applications in a near future. This approach makes use of a large number of small (namely short interfering RNAs, microRNAs and PIWI-interacting RNAs) and long non-coding RNAs (ncRNAs), which are likely to have a crucial role as the next generation therapeutics. The commercial and biomedical interest in these RNAi-based therapy applications have fostered the need to develop innovative procedures to easily and efficiently purify RNA, aiming to obtain the final product with high purity degree, good quality and biological activity. Recently, affinity chromatography has been applied to ncRNAs purification, in view of the high specificity. Therefore, this article intends to review the biogenesis pathways of regulatory ncRNAs and also to discuss the most significant and recent developments as well as applications of affinity chromatography in the challenging task of purifying ncRNAs. In addition, the importance of affinity chromatography in ncRNAs purification is addressed and prospects for what is forthcoming are presented. Copyright © 2016 Elsevier B.V. All rights reserved.
Zotti, M J; Smagghe, G
2015-06-01
The time has passed for us to wonder whether RNA interference (RNAi) effectively controls pest insects or protects beneficial insects from diseases. The RNAi era in insect science began with studies of gene function and genetics that paved the way for the development of novel and highly specific approaches for the management of pest insects and, more recently, for the treatment and prevention of diseases in beneficial insects. The slight differences in components of RNAi pathways are sufficient to provide a high degree of variation in responsiveness among insects. The current framework to assess the negative effects of genetically modified (GM) plants on human health is adequate for RNAi-based GM plants. Because of the mode of action of RNAi and the lack of genomic data for most exposed non-target organisms, it becomes difficult to determine the environmental risks posed by RNAi-based technologies and the benefits provided for the protection of crops. A better understanding of the mechanisms that determine the variability in the sensitivity of insects would accelerate the worldwide release of commercial RNAi-based approaches.
Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity
Bayne, Elizabeth H.; White, Sharon A.; Kagansky, Alexander; Bijos, Dominika A.; Sanchez-Pulido, Luis; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Ponting, Chris P.; Rappsilber, Juri; Allshire, Robin C.
2010-01-01
Summary In fission yeast, RNAi directs heterochromatin formation at centromeres, telomeres, and the mating type locus. Noncoding RNAs transcribed from repeat elements generate siRNAs that are incorporated into the Argonaute-containing RITS complex and direct it to nascent homologous transcripts. This leads to recruitment of the CLRC complex, including the histone methyltransferase Clr4, promoting H3K9 methylation and heterochromatin formation. A key question is what mediates the recruitment of Clr4/CLRC to transcript-bound RITS. We have identified a LIM domain protein, Stc1, that is required for centromeric heterochromatin integrity. Our analyses show that Stc1 is specifically required to establish H3K9 methylation via RNAi, and interacts both with the RNAi effector Ago1, and with the chromatin-modifying CLRC complex. Moreover, tethering Stc1 to a euchromatic locus is sufficient to induce silencing and heterochromatin formation independently of RNAi. We conclude that Stc1 associates with RITS on centromeric transcripts and recruits CLRC, thereby coupling RNAi to chromatin modification. PMID:20211136
Seo, Gil Ju; Kincaid, Rodney P.; Phanaksri, Teva; Burke, James M.; Pare, Justin M.; Cox, Jennifer E.; Hsiang, Tien-Ying; Krug, Robert M.; Sullivan, Christopher S.
2013-01-01
SUMMARY RNA interference (RNAi) is an established antiviral defense mechanism in plants and invertebrates. Whether RNAi serves a similar function in mammalian cells remains unresolved. We find that in some cell types, mammalian RNAi activity is reduced shortly after viral infection via poly ADP-ribosylation of the RNA induced silencing complex (RISC), a core component of RNAi. Well-established antiviral signaling pathways, including RIG-I/MAVS and RNAseL, contribute to inhibition of RISC. In the absence of virus infection, microRNAs repress interferon-stimulated genes (ISGs) associated with cell death and proliferation, thus maintaining homeostasis. Upon detection of intracellular pathogen-associated molecular patterns, RISC activity decreases, contributing to increased expression of ISGs. Our results suggest that unlike in lower eukaryotes, mammalian RISC is not antiviral in some contexts, but rather, RISC has been co-opted to negatively regulate toxic host antiviral effectors via microRNAs. PMID:24075860
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
The Sheffield RNAi Screening Facility (SRSF): portfolio growth and technology development.
Brown, Stephen
2014-05-01
The Sheffield RNAi Screening Facility (SRSF) (www.rnai.group.shef.ac.uk) was established in 2008 with Wellcome Trust and University of Sheffield funding, with the task to provide the first UK RNAi screening resource for academic groups interested in identifying genes required in a diverse range of biological processes using Drosophila cell culture. The SRSF has carried out a wide range of screens varying in sizes from bespoke small-scale libraries, targeting a few hundred genes, to high-throughput, genome-wide studies. The SRSF has grown and improved with a dedicated partnership of its academic customers based mainly in the UK. We are part of the UK Academics Functional Genomics Network, participating in organizing an annual meeting in London and are part of the University of Sheffield's D3N (www.d3n.org.uk), connecting academics, biotech and pharmaceutical companies with a multidisciplinary network in Drug Discovery and Development. Recently, the SRSF has been funded by the Yorkshire Cancer Research Fund to perform genome-wide RNAi screens using human cells as part of a core facility for regional Yorkshire Universities and screens are now underway. Overall the SRSF has carried out more than 40 screens from Drosophila and human cell culture experiments.
The unique GGA clathrin adaptor of Drosophila melanogaster is not essential.
Luan, Shan; Ilvarsonn, Anne M; Eissenberg, Joel C
2012-01-01
The Golgi-localized, γ-ear-containing, ARF binding proteins (GGAs) are a highly conserved family of monomeric clathrin adaptor proteins implicated in clathrin-mediated protein sorting between the trans-Golgi network and endosomes. GGA RNAi knockdowns in Drosophila have resulted in conflicting data concerning whether the Drosophila GGA (dGGA) is essential. The goal of this study was to define the null phenotype for the unique Drosophila GGA. We describe two independently derived dGGA mutations. Neither allele expresses detectable dGGA protein. Homozygous and hemizygous flies with each allele are viable and fertile. In contrast to a previous report using RNAi knockdown, GGA mutant flies show no evidence of age-dependent retinal degeneration or cathepsin missorting. Our results demonstrate that several of the previous RNAi knockdown phenotypes were the result of off-target effects. However, GGA null flies are hypersensitive to dietary chloroquine and to starvation, implicating GGA in lysosomal function and autophagy.
Inducing Cold-Sensitivity in the Frigophilic Fly Drosophila montana by RNAi
Cook, Nicola; Tournière, Océane; Sneddon, Tanya; Ritchie, Michael G.
2016-01-01
Cold acclimation is a critical physiological adaptation for coping with seasonal cold. By increasing their cold tolerance individuals can remain active for longer at the onset of winter and can recover more quickly from a cold shock. In insects, despite many physiological studies, little is known about the genetic basis of cold acclimation. Recently, transcriptomic analyses in Drosophila virilis and D. montana revealed candidate genes for cold acclimation by identifying genes upregulated during exposure to cold. Here, we test the role of myo-inositol-1-phosphate synthase (Inos), in cold tolerance in D. montana using an RNAi approach. D. montana has a circumpolar distribution and overwinters as an adult in northern latitudes with extreme cold. We assessed cold tolerance of dsRNA knock-down flies using two metrics: chill-coma recovery time (CCRT) and mortality rate after cold acclimation. Injection of dsRNAInos did not alter CCRT, either overall or in interaction with the cold treatment, however it did induced cold-specific mortality, with high levels of mortality observed in injected flies acclimated at 5°C but not at 19°C. Overall, injection with dsRNAInos induced a temperature-sensitive mortality rate of over 60% in this normally cold-tolerant species. qPCR analysis confirmed that dsRNA injection successfully reduced gene expression of Inos. Thus, our results demonstrate the involvement of Inos in increasing cold tolerance in D. montana. The potential mechanisms involved by which Inos increases cold tolerance are also discussed. PMID:27832122
Novel Methods for Mosquito Control using RNAi.
USDA-ARS?s Scientific Manuscript database
The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...
Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.
Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F
2018-04-03
High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.
Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran
2009-11-01
Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.
Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar
2016-05-25
Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of trans-cinnamic acid in the plant due to AaC4H knockdown was accompanied with the reduction of p-coumaric acid, total phenolics, anthocyanin, cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL) activities but increase in salicylic acid (SA) and artemisinin. Interestingly, feeding trans-cinnamic acid to the RNAi line increased the level of artemisinin along with benzoic (BA) and SA with no effect on the downstream metabolites p-coumaric acid, coniferylaldehyde and sinapaldehyde, whereas p-coumaric acid feeding increased the content of downstream coniferylaldehyde and sinapaldehyde with no effect on BA, SA, trans-cinnamic acid or artemisinin. SA is reported earlier to be inducing the artemisinin yield. This report demonstrates the link between the phenylpropanoid/lignin pathway with artemisinin pathway through SA, triggered by accumulation of trans-cinnamic acid because of the blockage at C4H.
Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar
2016-01-01
Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of trans-cinnamic acid in the plant due to AaC4H knockdown was accompanied with the reduction of p-coumaric acid, total phenolics, anthocyanin, cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL) activities but increase in salicylic acid (SA) and artemisinin. Interestingly, feeding trans-cinnamic acid to the RNAi line increased the level of artemisinin along with benzoic (BA) and SA with no effect on the downstream metabolites p-coumaric acid, coniferylaldehyde and sinapaldehyde, whereas p-coumaric acid feeding increased the content of downstream coniferylaldehyde and sinapaldehyde with no effect on BA, SA, trans-cinnamic acid or artemisinin. SA is reported earlier to be inducing the artemisinin yield. This report demonstrates the link between the phenylpropanoid/lignin pathway with artemisinin pathway through SA, triggered by accumulation of trans-cinnamic acid because of the blockage at C4H. PMID:27220407
Luo, Jiangnan; Lushchak, Oleh V; Goergen, Philip; Williams, Michael J; Nässel, Dick R
2014-01-01
A set of 14 insulin-producing cells (IPCs) in the Drosophila brain produces three insulin-like peptides (DILP2, 3 and 5). Activity in IPCs and release of DILPs is nutrient dependent and controlled by multiple factors such as fat body-derived proteins, neurotransmitters, and neuropeptides. Two monoamine receptors, the octopamine receptor OAMB and the serotonin receptor 5-HT1A, are expressed by the IPCs. These receptors may act antagonistically on adenylate cyclase. Here we investigate the action of the two receptors on activity in and output from the IPCs. Knockdown of OAMB by targeted RNAi led to elevated Dilp3 transcript levels in the brain, whereas 5-HT1A knockdown resulted in increases of Dilp2 and 5. OAMB-RNAi in IPCs leads to extended survival of starved flies and increased food intake, whereas 5-HT1A-RNAi produces the opposite phenotypes. However, knockdown of either OAMB or 5-HT1A in IPCs both lead to increased resistance to oxidative stress. In assays of carbohydrate levels we found that 5-HT1A knockdown in IPCs resulted in elevated hemolymph glucose, body glycogen and body trehalose levels, while no effects were seen after OAMB knockdown. We also found that manipulations of the two receptors in IPCs affected male aggressive behavior in different ways and 5-HT1A-RNAi reduced courtship latency. Our observations suggest that activation of 5-HT1A and OAMB signaling in IPCs generates differential effects on Dilp transcription, fly physiology, metabolism and social interactions. However the findings do not support an antagonistic action of the two monoamines and their receptors in this particular system.
Kaur, Punit; Nagaraja, Ganachari M; Asea, Alexzander
2011-01-01
Elevated heat shock protein 27 (Hsp27) expression has been found in a number of tumors, including breast, prostate, gastric, uterine, ovarian, head and neck, and tumor arising from the nervous system and urinary system, and determined to be a predictor of poor clinical outcome. Although the mechanism of action of Hsp27 has been well documented, there are currently no available inhibitors of Hsp27 in clinical trials. RNA interference (RNAi) has the potential to offer more specificity and flexibility than traditional drugs to silence gene expression. Not surprisingly, RNAi has become a major focus for biotechnology and pharmaceutical companies, which are now in the early stages of developing RNAi therapeutics, mostly based on short interfering RNA (siRNAs), to target viral infection, cancer, hypercholesterolemia, cardiovascular disease, macular degeneration, and neurodegenerative diseases. However, the critical issues associated with RNAi as a therapeutic are delivery, specificity, and stability of the RNAi reagents. To date, the delivery is currently considered the biggest hurdle, as the introduction of siRNAs systemically into body fluids can result in their degradation, off-target effects, and immune detection. In this chapter, we discuss a method of combined lentiviral and RNAi-based technology for the delivery and permanent silencing of the hsp25 gene.
Logic integration of mRNA signals by an RNAi-based molecular computer.
Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov
2010-05-01
Synthetic in vivo molecular 'computers' could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that 'transduce' mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi 'computational' module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting.
Logic integration of mRNA signals by an RNAi-based molecular computer
Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov
2010-01-01
Synthetic in vivo molecular ‘computers’ could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that ‘transduce’ mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi ‘computational’ module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting. PMID:20194121
RNAiFold: a web server for RNA inverse folding and molecular design.
Garcia-Martin, Juan Antonio; Clote, Peter; Dotu, Ivan
2013-07-01
Synthetic biology and nanotechnology are poised to make revolutionary contributions to the 21st century. In this article, we describe a new web server to support in silico RNA molecular design. Given an input target RNA secondary structure, together with optional constraints, such as requiring GC-content to lie within a certain range, requiring the number of strong (GC), weak (AU) and wobble (GU) base pairs to lie in a certain range, the RNAiFold web server determines one or more RNA sequences, whose minimum free-energy secondary structure is the target structure. RNAiFold provides access to two servers: RNA-CPdesign, which applies constraint programming, and RNA-LNSdesign, which applies the large neighborhood search heuristic; hence, it is suitable for larger input structures. Both servers can also solve the RNA inverse hybridization problem, i.e. given a representation of the desired hybridization structure, RNAiFold returns two sequences, whose minimum free-energy hybridization is the input target structure. The web server is publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold, which provides access to two specialized servers: RNA-CPdesign and RNA-LNSdesign. Source code for the underlying algorithms, implemented in COMET and supported on linux, can be downloaded at the server website.
Grimm, Dirk
2011-10-26
For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.
Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.
2010-01-01
RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369
A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia
Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric
2014-01-01
In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163
Key enzymes and proteins of crop insects as candidate for RNAi based gene silencing
Kola, Vijaya Sudhakara Rao; Renuka, P.; Madhav, Maganti Sheshu; Mangrauthia, Satendra K.
2015-01-01
RNA interference (RNAi) is a mechanism of homology dependent gene silencing present in plants and animals. It operates through 21–24 nucleotides small RNAs which are processed through a set of core enzymatic machinery that involves Dicer and Argonaute proteins. In recent past, the technology has been well appreciated toward the control of plant pathogens and insects through suppression of key genes/proteins of infecting organisms. The genes encoding key enzymes/proteins with the great potential for developing an effective insect control by RNAi approach are actylcholinesterase, cytochrome P450 enzymes, amino peptidase N, allatostatin, allatotropin, tryptophan oxygenase, arginine kinase, vacuolar ATPase, chitin synthase, glutathione-S-transferase, catalase, trehalose phosphate synthase, vitellogenin, hydroxy-3-methylglutaryl coenzyme A reductase, and hormone receptor genes. Through various studies, it is demonstrated that RNAi is a reliable molecular tool which offers great promises in meeting the challenges imposed by crop insects with careful selection of key enzymes/proteins. Utilization of RNAi tool to target some of these key proteins of crop insects through various approaches is described here. The major challenges of RNAi based insect control such as identifying potential targets, delivery methods of silencing trigger, off target effects, and complexity of insect biology are very well illustrated. Further, required efforts to address these challenges are also discussed. PMID:25954206
Fassnacht, Christina; Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos; Stadler, Michael B; Ciosk, Rafal
2018-03-01
Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition.
Ribonucleic acid interference (RNAi) and control of citrus pests
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...
Soaking RNAi in Bombyx mori BmN4-SID1 Cells Arrests Cell Cycle Progression
Mon, Hiroaki; Li, Zhiqing; Kobayashi, Isao; Tomita, Shuichiro; Lee, JaeMan; Sezutsu, Hideki; Tamura, Toshiki; Kusakabe, Takahiro
2013-01-01
RNA interference (RNAi) is an evolutionarily conserved mechanism for sequence-specific gene silencing. Previously, the BmN4-SID1 cell expressing Caenorhabditis ele gans SID-1 was established, in which soaking RNAi could induce effective gene silencing. To establish its utility, 6 cell cycle progression related cDNAs, CDK1, MYC, MYB, RNRS, CDT1, and GEMININ, were isolated from the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), and their expressions were further silenced by soaking RNAi in the BmN4-SID1 cells. The cell cycle progression analysis using flow cytometer demonstrated that the small amount of double stranded RNA was enough to arrest cell cycle progression at the specific cell phases. These data suggest that RNAi in the BmN4-SID1 cells can be used as a powerful tool for loss-of-function analysis of B. mori genes. PMID:24773378
Knockdown of Lmo7 inhibits chick myogenesis.
Possidonio, Ana C B; Soares, Carolina P; Fontenele, Marcio; Morris, Eduardo R; Mouly, Vincent; Costa, Manoel L; Mermelstein, Claudia
2016-02-01
The multifunctional protein Lmo7 has been implicated in some aspects of myogenesis in mammals. Here we studied the distribution and expression of Lmo7 and the effects of Lmo7 knockdown in primary cultures of chick skeletal muscle cells. Lmo7 was localized within the nuclei of myoblasts and at the perinuclear region of myotubes. Knockdown of Lmo7 using siRNA specific to chick reduces the number and width of myotubes and the number of MyoD positive-myoblasts. Both Wnt3a enriched medium and Bio, activators of the Wnt/beta-catenin pathway, could rescue the effects of the Lmo7 knockdown suggesting a crosstalk between the Wnt/beta-catenin and Lmo7-mediated signaling pathways. Our data shows a role of Lmo7 during the initial events of chick skeletal myogenesis, particularly in myoblast survival. © 2016 Federation of European Biochemical Societies.
Benzon, C R; Johnson, S B; McCue, D L; Li, D; Green, T A; Hommel, J D
2014-01-31
Neuromedin U (NMU) is a highly conserved neuropeptide which regulates food intake and body weight. Transgenic mice lacking NMU are hyperphagic and obese, making NMU a novel target for understanding and treating obesity. Neuromedin U receptor 2 (NMUR2) is a high-affinity receptor for NMU found in discrete regions of the central nervous system, in particular the paraventricular nucleus of the hypothalamus (PVN), where it may be responsible for mediating the anorectic effects of NMU. We hypothesized that selective knock down of NMUR2 in the PVN of rats would increase their sensitivity to the reinforcing properties of food resulting in increased intake and preference for high-fat obesogenic food. To this end, we used viral-mediated RNAi to selectively knock down NMUR2 gene expression in the PVN. In rats fed a standard chow, NMUR2 knockdown produced no significant effect on food intake or body weight. However, when the same rats were fed a high-fat diet (45% fat), they consumed significantly more food, gained more body weight, and had increased feed efficiency relative to controls. Furthermore, NMUR2 knockdown rats demonstrated significantly greater binge-type food consumption of the high-fat diet and showed a greater preference for higher-fat food. These results demonstrate that NMUR2 signaling in the PVN regulates consumption and preference for high-fat foods without disrupting feeding behavior associated with non-obesogenic standard chow. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation.
Nakama, Mina; Kawakami, Kei; Kajitani, Takuya; Urano, Takeshi; Murakami, Yota
2012-03-01
Certain noncoding RNAs (ncRNAs) implicated in the regulation of chromatin structure associate with chromatin. During the formation of RNAi-directed heterochromatin in fission yeast, ncRNAs transcribed from heterochromatin are thought to recruit the RNAi machinery to chromatin for the formation of heterochromatin; however, the molecular details of this association are not clear. Here, using RNA immunoprecipitation assay, we showed that the heterochromatic ncRNA was associated with chromatin via the formation of a DNA-RNA hybrid and bound to the RNA-induced transcriptional silencing (RITS) complex. The presence of DNA-RNA hybrid in the cell was also confirmed by immunofluorescence analysis using anti-DNA-RNA hybrid antibody. Over-expression and depletion of RNase H in vivo decreased and increased the amount of DNA-RNA hybrid formed, respectively, and both disturbed heterochromatin. Moreover, DNA-RNA hybrid was formed on, and over-expression of RNase H inhibited the formation of, artificial heterochromatin induced by tethering of RITS to mRNA. These results indicate that heterochromatic ncRNAs are retained on chromatin via the formation of DNA-RNA hybrids and provide a platform for the RNAi-directed heterochromatin assembly and suggest that DNA-RNA hybrid formation plays a role in chromatic ncRNA function. © 2012 The Authors. Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen
2018-05-04
Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Lew, Carolyn Ritterson; Tolan, Dean R.
2012-01-01
In cancer, glucose uptake and glycolysis are increased regardless of the oxygen concentration in the cell, a phenomenon known as the Warburg effect. Several (but not all) glycolytic enzymes have been investigated as potential therapeutic targets for cancer treatment using RNAi. Here, four previously untargeted glycolytic enzymes, aldolase A, glyceraldehyde 3-phosphate dehydrogenase, triose phosphate isomerase, and enolase 1, are targeted using RNAi in Ras-transformed NIH-3T3 cells. Of these enzymes, knockdown of aldolase causes the greatest effect, inhibiting cell proliferation by 90%. This defect is rescued by expression of exogenous aldolase. However, aldolase knockdown does not affect glycolytic flux or intracellular ATP concentration, indicating a non-metabolic cause for the cell proliferation defect. Furthermore, this defect could be rescued with an enzymatically dead aldolase variant that retains the known F-actin binding ability of aldolase. One possible model for how aldolase knockdown may inhibit transformed cell proliferation is through its disruption of actin-cytoskeleton dynamics in cell division. Consistent with this hypothesis, aldolase knockdown cells show increased multinucleation. These results are compared with other studies targeting glycolytic enzymes with RNAi in the context of cancer cell proliferation and suggest that aldolase may be a useful target in the treatment of cancer. PMID:23093405
Liu, Xiaoxuan; Liu, Cheng; Catapano, Carlo V; Peng, Ling; Zhou, Jiehua; Rocchi, Palma
2014-01-01
RNAi-based nucleic acid molecules have attracted considerable attention as compelling therapeutics providing safe and competent delivery systems are available. Dendrimers are emerging as appealing nanocarriers for nucleic acid delivery thanks to their unique well-defined architecture and the resulting cooperativity and multivalency confined within a nanostructure. The present review offers a brief overview of the structurally flexible triethanolamine-core poly(amidoamine) (PAMAM) dendrimers developed in our group as nanovectors for the delivery of RNAi therapeutics. Their excellent activity for delivering different RNAi therapeutics in various disease models in vitro and in vivo will be highlighted here. © 2013.
RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules.
Garcia-Martin, Juan Antonio; Dotu, Ivan; Clote, Peter
2015-07-01
Several algorithms for RNA inverse folding have been used to design synthetic riboswitches, ribozymes and thermoswitches, whose activity has been experimentally validated. The RNAiFold software is unique among approaches for inverse folding in that (exhaustive) constraint programming is used instead of heuristic methods. For that reason, RNAiFold can generate all sequences that fold into the target structure or determine that there is no solution. RNAiFold 2.0 is a complete overhaul of RNAiFold 1.0, rewritten from the now defunct COMET language to C++. The new code properly extends the capabilities of its predecessor by providing a user-friendly pipeline to design synthetic constructs having the functionality of given Rfam families. In addition, the new software supports amino acid constraints, even for proteins translated in different reading frames from overlapping coding sequences; moreover, structure compatibility/incompatibility constraints have been expanded. With these features, RNAiFold 2.0 allows the user to design single RNA molecules as well as hybridization complexes of two RNA molecules. the web server, source code and linux binaries are publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold2.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos
2018-01-01
Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition. PMID:29579041
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Argonaute2 is the catalytic engine of mammalian RNAi.
Liu, Jidong; Carmell, Michelle A; Rivas, Fabiola V; Marsden, Carolyn G; Thomson, J Michael; Song, Ji-Joon; Hammond, Scott M; Joshua-Tor, Leemor; Hannon, Gregory J
2004-09-03
Gene silencing through RNA interference (RNAi) is carried out by RISC, the RNA-induced silencing complex. RISC contains two signature components, small interfering RNAs (siRNAs) and Argonaute family proteins. Here, we show that the multiple Argonaute proteins present in mammals are both biologically and biochemically distinct, with a single mammalian family member, Argonaute2, being responsible for messenger RNA cleavage activity. This protein is essential for mouse development, and cells lacking Argonaute2 are unable to mount an experimental response to siRNAs. Mutations within a cryptic ribonuclease H domain within Argonaute2, as identified by comparison with the structure of an archeal Argonaute protein, inactivate RISC. Thus, our evidence supports a model in which Argonaute contributes "Slicer" activity to RISC, providing the catalytic engine for RNAi.
RNAi: a potential new class of therapeutic for human genetic disease.
Seyhan, Attila A
2011-11-01
Dominant negative genetic disorders, in which a mutant allele of a gene causes disease in the presence of a second, normal copy, have been challenging since there is no cure and treatments are only to alleviate the symptoms. Current therapies involving pharmacological and biological drugs are not suitable to target mutant genes selectively due to structural indifference of the normal variant of their targets from the disease-causing mutant ones. In instances when the target contains single nucleotide polymorphism (SNP), whether it is an enzyme or structural or receptor protein are not ideal for treatment using conventional drugs due to their lack of selectivity. Therefore, there is a need to develop new approaches to accelerate targeting these previously inaccessible targets by classical therapeutics. Although there is a cooling trend by the pharmaceutical industry for the potential of RNA interference (RNAi), RNAi and other RNA targeting drugs (antisense, ribozyme, etc.) still hold their promise as the only drugs that provide an opportunity to target genes with SNP mutations found in dominant negative disorders, genes specific to pathogenic tumor cells, and genes that are critical for mediating the pathology of various other diseases. Because of its exquisite specificity and potency, RNAi has attracted a considerable interest as a new class of therapeutic for genetic diseases including amyotrophic lateral sclerosis, Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), spinocerebellar ataxia, dominant muscular dystrophies, and cancer. In this review, progress and challenges in developing RNAi therapeutics for genetic diseases will be discussed.
Blood-brain barrier transport of non-viral gene and RNAi therapeutics.
Boado, Ruben J
2007-09-01
The development of gene- and RNA interference (RNAi)-based therapeutics represents a challenge for the drug delivery field. The global brain distribution of DNA genes, as well as the targeting of specific regions of the brain, is even more complicated because conventional delivery systems, i.e. viruses, have poor diffusion in brain when injected in situ and do not cross the blood-brain barrier (BBB), which is only permeable to lipophilic molecules of less than 400 Da. Recent advances in the "Trojan Horse Liposome" (THL) technology applied to the transvascular non-viral gene therapy of brain disorders presents a promising solution to the DNA/RNAi delivery obstacle. The THL is comprised of immunoliposomes carrying either a gene for protein replacement or small hairpin RNA (shRNA) expression plasmids for RNAi effect, respectively. The THL is engineered with known lipids containing polyethyleneglycol (PEG), which stabilizes its structure in vivo in circulation. The tissue target specificity of THL is given by conjugation of approximately 1% of the PEG residues to peptidomimetic monoclonal antibodies (MAb) that bind to specific endogenous receptors (i.e. insulin and transferrin receptors) located on both the BBB and the brain cellular membranes, respectively. These MAbs mediate (a) receptor-mediated transcytosis of the THL complex through the BBB, (b) endocytosis into brain cells and (c) transport to the brain cell nuclear compartment. The present review presents an overview of the THL technology and its current application to gene therapy and RNAi, including experimental models of Parkinson's disease and brain tumors.
An interactive web-based application for Comprehensive Analysis of RNAi-screen Data.
Dutta, Bhaskar; Azhir, Alaleh; Merino, Louis-Henri; Guo, Yongjian; Revanur, Swetha; Madhamshettiwar, Piyush B; Germain, Ronald N; Smith, Jennifer A; Simpson, Kaylene J; Martin, Scott E; Buehler, Eugen; Beuhler, Eugen; Fraser, Iain D C
2016-02-23
RNAi screens are widely used in functional genomics. Although the screen data can be susceptible to a number of experimental biases, many of these can be corrected by computational analysis. For this purpose, here we have developed a web-based platform for integrated analysis and visualization of RNAi screen data named CARD (for Comprehensive Analysis of RNAi Data; available at https://card.niaid.nih.gov). CARD allows the user to seamlessly carry out sequential steps in a rigorous data analysis workflow, including normalization, off-target analysis, integration of gene expression data, optimal thresholds for hit selection and network/pathway analysis. To evaluate the utility of CARD, we describe analysis of three genome-scale siRNA screens and demonstrate: (i) a significant increase both in selection of subsequently validated hits and in rejection of false positives, (ii) an increased overlap of hits from independent screens of the same biology and (iii) insight to microRNA (miRNA) activity based on siRNA seed enrichment.
An interactive web-based application for Comprehensive Analysis of RNAi-screen Data
Dutta, Bhaskar; Azhir, Alaleh; Merino, Louis-Henri; Guo, Yongjian; Revanur, Swetha; Madhamshettiwar, Piyush B.; Germain, Ronald N.; Smith, Jennifer A.; Simpson, Kaylene J.; Martin, Scott E.; Beuhler, Eugen; Fraser, Iain D. C.
2016-01-01
RNAi screens are widely used in functional genomics. Although the screen data can be susceptible to a number of experimental biases, many of these can be corrected by computational analysis. For this purpose, here we have developed a web-based platform for integrated analysis and visualization of RNAi screen data named CARD (for Comprehensive Analysis of RNAi Data; available at https://card.niaid.nih.gov). CARD allows the user to seamlessly carry out sequential steps in a rigorous data analysis workflow, including normalization, off-target analysis, integration of gene expression data, optimal thresholds for hit selection and network/pathway analysis. To evaluate the utility of CARD, we describe analysis of three genome-scale siRNA screens and demonstrate: (i) a significant increase both in selection of subsequently validated hits and in rejection of false positives, (ii) an increased overlap of hits from independent screens of the same biology and (iii) insight to microRNA (miRNA) activity based on siRNA seed enrichment. PMID:26902267
Schmitz, Michael H. A.; Held, Michael; Janssens, Veerle; Hutchins, James R. A.; Hudecz, Otto; Ivanova, Elitsa; Goris, Jozef; Trinkle-Mulcahy, Laura; Lamond, Angus I.; Poser, Ina; Hyman, Anthony A.; Mechtler, Karl; Peters, Jan-Michael; Gerlich, Daniel W.
2013-01-01
When vertebrate cells exit mitosis various cellular structures are re-organized to build functional interphase cells1. This depends on Cdk1 (cyclin dependent kinase 1) inactivation and subsequent dephosphorylation of its substrates2–4. Members of the protein phosphatase 1 and 2A (PP1 and PP2A) families can dephosphorylate Cdk1 substrates in biochemical extracts during mitotic exit5,6, but how this relates to postmitotic reassembly of interphase structures in intact cells is not known. Here, we use a live-cell imaging assay and RNAi knockdown to screen a genome-wide library of protein phosphatases for mitotic exit functions in human cells. We identify a trimeric PP2A–B55α complex as a key factor in mitotic spindle breakdown and postmitotic reassembly of the nuclear envelope, Golgi apparatus and decondensed chromatin. Using a chemically induced mitotic exit assay, we find that PP2A–B55α functions downstream of Cdk1 inactivation. PP2A–B55α isolated from mitotic cells had reduced phosphatase activity towards the Cdk1 substrate, histone H1, and was hyper-phosphorylated on all subunits. Mitotic PP2A complexes co-purified with the nuclear transport factor importin-β1, and RNAi depletion of importin-β1 delayed mitotic exit synergistically with PP2A–B55α. This demonstrates that PP2A–B55α and importin-β1 cooperate in the regulation of postmitotic assembly mechanisms in human cells. PMID:20711181
Silencing of ATP11B by RNAi-Induced Changes in Neural Stem Cell Morphology.
Wang, Jiao; Wang, Qian; Zhou, Fangfang; Wang, Dong; Wen, Tieqiao
2017-01-01
RNA interference (RNAi) technology is one of the main research tools in many studies of neural stem cells. This study describes effects of ATP11B on the morphology change of neural stem cells by using RNAi. ATP11B belongs to P4-ATPases family, which is preferential translocate phosphatidylserine of cell membrane. Although it exists in neural stem cells, its physiological function is poorly understood. By using RNAi technology to downregulate expression of ATP11B, we found distinct morphological changes in neural stem cells. More important, psiRNA-ATP11B-transfected cells displayed short neurite outgrowth compared to the control cells. These data strongly suggest that ATP11B plays a key role in the morphological change of neural stem cells.
Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.
2015-01-01
Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849
Ruiz-Vázquez, Rosa M; Nicolás, Francisco E; Torres-Martínez, Santiago; Garre, Victoriano
2015-01-01
The basal fungus Mucor circinelloides has become, in recent years, a valuable model to study RNA-mediated gene silencing or RNA interference (RNAi). Serendipitously discovered in the late 1900s, the gene silencing in M. circinelloides is a landscape of consensus and dissents. Although similar to other classical fungal models in the basic design of the essential machinery that is responsible for silencing of gene expression, the existence of small RNA molecules of different sizes generated during this process and the presence of a mechanism that amplifies the silencing signal, give it a unique identity. In addition, M. circinelloides combines the components of RNAi machinery to carry out functions that not only limit themselves to the defense against foreign genetic material, but it uses some of these elements to regulate the expression of its own genes. Thus, different combinations of RNAi elements produce distinct classes of endogenous small RNAs (esRNAs) that regulate different physiological and developmental processes in response to environmental signals. The recent discovery of a new RNAi pathway involved in the specific degradation of endogenous mRNAs, using a novel RNase protein, adds one more element to the exciting puzzle of the gene silencing in M. circinelloides, in addition to providing hints about the evolutionary origin of the RNAi mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.
Cheng, Han; Koning, Katie; O'Hearn, Aileen; Wang, Minxiu; Rumschlag-Booms, Emily; Varhegyi, Elizabeth; Rong, Lijun
2015-11-24
Genome-wide RNAi screening has been widely used to identify host proteins involved in replication and infection of different viruses, and numerous host factors are implicated in the replication cycles of these viruses, demonstrating the power of this approach. However, discrepancies on target identification of the same viruses by different groups suggest that high throughput RNAi screening strategies need to be carefully designed, developed and optimized prior to the large scale screening. Two genome-wide RNAi screens were performed in parallel against the entry of pseudotyped Marburg viruses and avian influenza virus H5N1 utilizing an HIV-1 based surrogate system, to identify host factors which are important for virus entry. A comparative analysis approach was employed in data analysis, which alleviated systematic positional effects and reduced the false positive number of virus-specific hits. The parallel nature of the strategy allows us to easily identify the host factors for a specific virus with a greatly reduced number of false positives in the initial screen, which is one of the major problems with high throughput screening. The power of this strategy is illustrated by a genome-wide RNAi screen for identifying the host factors important for Marburg virus and/or avian influenza virus H5N1 as described in this study. This strategy is particularly useful for highly pathogenic viruses since pseudotyping allows us to perform high throughput screens in the biosafety level 2 (BSL-2) containment instead of the BSL-3 or BSL-4 for the infectious viruses, with alleviated safety concerns. The screening strategy together with the unique comparative analysis approach makes the data more suitable for hit selection and enables us to identify virus-specific hits with a much lower false positive rate.
RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.
Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu
2017-04-01
Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.
Jang, Mihue; Han, Hee Dong; Ahn, Hyung Jun
2016-01-01
Incorporating multiple copies of two RNAi molecules into a single nanostructure in a precisely controlled manner can provide an efficient delivery tool to regulate multiple gene pathways in the relation of mutual dependence. Here, we show a RNA nanotechnology platform for a two-in-one RNAi delivery system to contain polymeric two RNAi molecules within the same RNA nanoparticles, without the aid of polyelectrolyte condensation reagents. As our RNA nanoparticles lead to the simultaneous silencing of two targeted mRNAs, of which biological functions are highly interdependent, combination therapy for multi-drug resistance cancer cells, which was studied as a specific application of our two-in-one RNAi delivery system, demonstrates the efficient synergistic effects for cancer therapy. Therefore, this RNA nanoparticles approach has an efficient tool for a simultaneous co-delivery of RNAi molecules in the RNAi-based biomedical applications, and our current studies present an efficient strategy to overcome multi-drug resistance caused by malfunction of genes in chemotherapy. PMID:27562435
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
Wang, Zhishi; Craven, Mark; Newton, Michael A.; Ahlquist, Paul
2013-01-01
Systematic, genome-wide RNA interference (RNAi) analysis is a powerful approach to identify gene functions that support or modulate selected biological processes. An emerging challenge shared with some other genome-wide approaches is that independent RNAi studies often show limited agreement in their lists of implicated genes. To better understand this, we analyzed four genome-wide RNAi studies that identified host genes involved in influenza virus replication. These studies collectively identified and validated the roles of 614 cell genes, but pair-wise overlap among the four gene lists was only 3% to 15% (average 6.7%). However, a number of functional categories were overrepresented in multiple studies. The pair-wise overlap of these enriched-category lists was high, ∼19%, implying more agreement among studies than apparent at the gene level. Probing this further, we found that the gene lists implicated by independent studies were highly connected in interacting networks by independent functional measures such as protein-protein interactions, at rates significantly higher than predicted by chance. We also developed a general, model-based approach to gauge the effects of false-positive and false-negative factors and to estimate, from a limited number of studies, the total number of genes involved in a process. For influenza virus replication, this novel statistical approach estimates the total number of cell genes involved to be ∼2,800. This and multiple other aspects of our experimental and computational results imply that, when following good quality control practices, the low overlap between studies is primarily due to false negatives rather than false-positive gene identifications. These results and methods have implications for and applications to multiple forms of genome-wide analysis. PMID:24068911
Biosafety research for non-target organism risk assessment of RNAi-based GE plants
Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo
2015-01-01
RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220
Choosing the Right Tool for the Job: RNAi, TALEN or CRISPR
Boettcher, Michael; McManus, Michael T.
2015-01-01
The most widely used approach for defining a genes’ function is to reduce or completely disrupt its normal expression. For over a decade, RNAi has ruled the lab, offering a magic bullet to disrupt gene expression in many organisms. However, new biotechnological tools - specifically CRISPR-based technologies - have become available and are squeezing out RNAi dominance in mammalian cell studies. These seemingly competing technologies leave research investigators with the question: ‘Which technology should I use in my experiment?’ This review offers a practical resource to compare and contrast these technologies, guiding the investigator when and where to use this fantastic array of powerful tools. PMID:26000843
Sifuentes-Romero, Itzel; Merchant-Larios, Horacio; Milton, Sarah L; Moreno-Mendoza, Norma; Díaz-Hernández, Verónica; García-Gasca, Alejandra
2013-06-07
The autosomal Sry-related gene, Sox9, encodes a transcription factor, which performs an important role in testis differentiation in mammals. In several reptiles, Sox9 is differentially expressed in gonads, showing a significant upregulation during the thermo-sensitive period (TSP) at the male-promoting temperature, consistent with the idea that SOX9 plays a central role in the male pathway. However, in spite of numerous studies, it remains unclear how SOX9 functions during this event. In the present work, we developed an RNAi-based method for silencing Sox9 in an in vitro gonad culture system for the sea turtle, Lepidochelys olivacea. Gonads were dissected as soon as the embryos entered the TSP and were maintained in organ culture. Transfection of siRNA resulted in the decrease of both Sox9 mRNA and protein. Furthermore, we found coordinated expression patterns for Sox9 and the anti-Müllerian hormone gene, Amh, suggesting that SOX9 could directly or indirectly regulate Amh expression, as it occurs in mammals. These results demonstrate an in vitro method to knockdown endogenous genes in gonads from a sea turtle, which represents a novel approach to investigate the roles of important genes involved in sex determination or differentiation pathways in species with temperature-dependent sex determination.
RNAi-mediated male sterility of tobacco by silencing TA29.
Nawaz-ul-Rehman, Muhammad Shah; Mansoor, Shahid; Khan, Asif Ali; Zafar, Yusuf; Briddon, Rob W
2007-06-01
The superior performance of F1 hybrids has a significant impact on agricultural productivity. For commercial application, the availability of an efficient system for obtaining male-sterile lines of crops is an essential prerequisite. Here we have investigated the use of RNA interference (RNAi) technology to silence a male-specific gene in the model host tobacco. TA29 is expressed exclusively in anthers at the time of microspore development. About 10 out of 13 tobacco lines transformed with a hairpin RNAi construct containing TA29 sequences were male sterile. Transgenic plants were phenotypically indistinguishable from non-transgenic plants. At the anthesis stage, pollen grains from transgenic, male-sterile plants were aborted and lysed in comparison to the round and fully developed pollen in non-transgenic plants. Microscopic analysis of anthers showed selective degradation of tapetum in transgenic plants with no microspore development. One week after self-pollination, the ovules of non-transgenic plants were double the size of those in transgenic plants, due to successful self-fertilization. Male sterile transgenic plants set seed normally, when cross-pollinated with pollen from non-transgenic plants, confirming no adverse effect on the female parts of the flower. These results show that silencing of male-specific genes by RNAi is potentially a useful tool for generating male-sterile lines for producing hybrid seed.
Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria
Adler, Carolyn E; Seidel, Chris W; McKinney, Sean A; Sánchez Alvarado, Alejandro
2014-01-01
Planarian flatworms regenerate every organ after amputation. Adult pluripotent stem cells drive this ability, but how injury activates and directs stem cells into the appropriate lineages is unclear. Here we describe a single-organ regeneration assay in which ejection of the planarian pharynx is selectively induced by brief exposure of animals to sodium azide. To identify genes required for pharynx regeneration, we performed an RNAi screen of 356 genes upregulated after amputation, using successful feeding as a proxy for regeneration. We found that knockdown of 20 genes caused a wide range of regeneration phenotypes and that RNAi of the forkhead transcription factor FoxA, which is expressed in a subpopulation of stem cells, specifically inhibited regrowth of the pharynx. Selective amputation of the pharynx therefore permits the identification of genes required for organ-specific regeneration and suggests an ancient function for FoxA-dependent transcriptional programs in driving regeneration. DOI: http://dx.doi.org/10.7554/eLife.02238.001 PMID:24737865
Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.; ...
2015-06-19
The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cass, Cynthia L.; Peraldi, Antoine; Dowd, Patrick F.
The phenylpropanoid pathway in plants synthesizes a variety of structural and defence compounds, and is an important target in efforts to reduce cell wall lignin for improved biomass conversion to biofuels. Little is known concerning the trade-offs in grasses when perturbing the function of the first gene family in the pathway, PHENYLALANINE AMMONIA LYASE ( PAL). Therefore, PAL isoforms in the model grass Brachypodium distachyon were targeted, by RNA interference (RNAi), and large reductions (up to 85%) in stem tissue transcript abundance for two of the eight putative BdPAL genes were identified. The cell walls of stems of BdPAL-knockdown plantsmore » had reductions of 43% in lignin and 57% in cell wall-bound ferulate, and a nearly 2-fold increase in the amounts of polysaccharide-derived carbohydrates released by thermochemical and hydrolytic enzymic partial digestion. PAL-knockdown plants exhibited delayed development and reduced root growth, along with increased susceptibilities to the fungal pathogens Fusarium culmorum and Magnaporthe oryzae. Surprisingly, these plants generally had wild-type (WT) resistances to caterpillar herbivory, drought, and ultraviolet light. RNA sequencing analyses revealed that the expression of genes associated with stress responses including ethylene biosynthesis and signalling were significantly altered in PAL knocked-down plants under non-challenging conditions. These data reveal that, although an attenuation of the phenylpropanoid pathway increases carbohydrate availability for biofuel, it can adversely affect plant growth and disease resistance to fungal pathogens. Lastly, the data identify notable differences between the stress responses of these monocot pal mutants versus Arabidopsis (a dicot) pal mutants and provide insights into the challenges that may arise when deploying phenylpropanoid pathway-altered bioenergy crops.« less
New insights into siRNA amplification and RNAi
Zhang, Chi; Ruvkun, Gary
2012-01-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
Non-transgenic RNAi technology to control insects on citrus
USDA-ARS?s Scientific Manuscript database
This research demonstrated a non-transgenic delivery method for ribonucleic acid interference, RNAi, that reduced fitness as measured in increased mortality over time, of two insect pests of citrus, ie. psyllids and leafhoppers. The Asian citrus psyllid transmits a deadly plant-infecting bacterium o...
G-protein-coupled receptors participate in cytokinesis
Zhang, Xin; Bedigian, Anne V.; Wang, Wenchao; Eggert, Ulrike S.
2014-01-01
Cytokinesis, the last step during cell division, is a highly coordinated process that involves the relay of signals from both the outside and inside of the cell. We have a basic understanding of how cells regulate internal events, but how cells respond to extracellular cues is less explored. In a systematic RNAi screen of G-protein-coupled receptors (GPCRs) and their effectors, we found that some GPCRs are involved in cytokinesis. RNAi knockdown of these GPCRs caused increased binucleated cell formation, and live cell imaging showed that most formed midbodies but failed at the abscission stage. OR2A4 localized to cytokinetic structures in cells and its knockdown caused cytokinesis failure at an earlier stage, likely due to effects on the actin cytoskeleton. Identifying the downstream components that transmit GPCR signals during cytokinesis will be the next step and we show that GIPC1, an adaptor protein for GPCRs, may play a part. RNAi knockdown of GIPC1 significantly increased binucleated cell formation. Understanding the molecular details of GPCRs and their interaction proteins in cytokinesis regulation will give us important clues about GPCRs signaling as well as how cells communicate with their environment during division. PMID:22888021
The Role of Folate Transport in Antifolate Drug Action in Trypanosoma brucei*
Dewar, Simon; Sienkiewicz, Natasha; Ong, Han B.; Wall, Richard J.; Horn, David
2016-01-01
The aim of this study was to identify and characterize mechanisms of resistance to antifolate drugs in African trypanosomes. Genome-wide RNAi library screens were undertaken in bloodstream form Trypanosoma brucei exposed to the antifolates methotrexate and raltitrexed. In conjunction with drug susceptibility and folate transport studies, RNAi knockdown was used to validate the functions of the putative folate transporters. The transport kinetics of folate and methotrexate were further characterized in whole cells. RNA interference target sequencing experiments identified a tandem array of genes encoding a folate transporter family, TbFT1–3, as major contributors to antifolate drug uptake. RNAi knockdown of TbFT1–3 substantially reduced folate transport into trypanosomes and reduced the parasite's susceptibly to the classical antifolates methotrexate and raltitrexed. In contrast, knockdown of TbFT1–3 increased susceptibly to the non-classical antifolates pyrimethamine and nolatrexed. Both folate and methotrexate transport were inhibited by classical antifolates but not by non-classical antifolates or biopterin. Thus, TbFT1–3 mediates the uptake of folate and classical antifolates in trypanosomes, and TbFT1–3 loss-of-function is a mechanism of antifolate drug resistance. PMID:27703008
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Knockdown of Fruit Flies by Imidacloprid Nanoaerosol.
Morozov, Victor N; Kanev, Igor L
2015-10-20
This report describes the effects of nanoaerosol particles (NAPs) from imidacloprid (IMI) on fruit flies. NAPs were produced using a newly developed generator which employs electro-hydrodynamic atomization of IMI solution in ethanol. Exposure of Drosophila melanogaster to the IMI NAPs at a concentration of C = 2.7 ± 0.1 ng/cm(3) caused knockdown in half of the flies in T50 = 88 ± 14 min at 22 °C and in T50 = 36 ± 2 min at 33 °C. A number of special experiments precluded IMI volatilization and contact or oral action of IMI upon exposure to the NAPs. It was shown that only the fraction of NAPs in the size range of 7-300 nm is responsible for the knockdown and that dependence of T50 on the NAPs' fraction mass follows Haber's rule, C × T50 = const. Comparison with the oral doses obtained when flies were fed an IMI-sucrose mixture revealed that the inhaled doses that caused knockdown were 2 orders of magnitude lower than the oral ones. This new technology may be used to quickly eliminate insects with nanoaerosols of nonvolatile insecticides in greenhouses and other closed environments.
RNAi and heterochromatin repress centromeric meiotic recombination
Ellermeier, Chad; Higuchi, Emily C.; Phadnis, Naina; Holm, Laerke; Geelhood, Jennifer L.; Thon, Genevieve; Smith, Gerald R.
2010-01-01
During meiosis, the formation of viable haploid gametes from diploid precursors requires that each homologous chromosome pair be properly segregated to produce an exact haploid set of chromosomes. Genetic recombination, which provides a physical connection between homologous chromosomes, is essential in most species for proper homologue segregation. Nevertheless, recombination is repressed specifically in and around the centromeres of chromosomes, apparently because rare centromeric (or pericentromeric) recombination events, when they do occur, can disrupt proper segregation and lead to genetic disabilities, including birth defects. The basis by which centromeric meiotic recombination is repressed has been largely unknown. We report here that, in fission yeast, RNAi functions and Clr4-Rik1 (histone H3 lysine 9 methyltransferase) are required for repression of centromeric recombination. Surprisingly, one mutant derepressed for recombination in the heterochromatic mating-type region during meiosis and several mutants derepressed for centromeric gene expression during mitotic growth are not derepressed for centromeric recombination during meiosis. These results reveal a complex relation between types of repression by heterochromatin. Our results also reveal a previously undemonstrated role for RNAi and heterochromatin in the repression of meiotic centromeric recombination and, potentially, in the prevention of birth defects by maintenance of proper chromosome segregation during meiosis. PMID:20421495
PTEN knockdown alters dendritic spine/protrusion morphology, not density
Haws, Michael E.; Jaramillo, Thomas C.; Espinosa-Becerra, Felipe; Widman, Allie; Stuber, Garret D.; Sparta, Dennis R.; Tye, Kay M.; Russo, Scott J.; Parada, Luis F.; Kaplitt, Michael; Bonci, Antonello; Powell, Craig M.
2014-01-01
Mutations in phosphatase and tensin homolog deleted on chromosome ten (PTEN) are implicated in neuropsychiatric disorders including autism. Previous studies report that PTEN knockdown in neurons in vivo leads to increased spine density and synaptic activity. To better characterize synaptic changes in neurons lacking PTEN, we examined the effects of shRNA knockdown of PTEN in basolateral amygdala neurons on synaptic spine density and morphology using fluorescent dye confocal imaging. Contrary to previous studies in dentate gyrus, we find that knockdown of PTEN in basolateral amygdala leads to a significant decrease in total spine density in distal dendrites. Curiously, this decreased spine density is associated with increased miniature excitatory post-synaptic current frequency and amplitude, suggesting an increase in number and function of mature spines. These seemingly contradictory findings were reconciled by spine morphology analysis demonstrating increased mushroom spine density and size with correspondingly decreased thin protrusion density at more distal segments. The same analysis of PTEN conditional deletion in dentate gyrus demonstrated that loss of PTEN does not significantly alter total density of dendritic protrusions in the dentate gyrus, but does decrease thin protrusion density and increases density of more mature mushroom spines. These findings suggest that, contrary to previous reports, PTEN knockdown may not induce de novo spinogenesis, but instead may increase synaptic activity by inducing morphological and functional maturation of spines. Furthermore, behavioral analysis of basolateral amygdala PTEN knockdown suggests that these changes limited only to the basolateral amygdala complex may not be sufficient to induce increased anxiety-related behaviors. PMID:24264880
Koch, Aline; Kogel, Karl-Heinz
2014-09-01
RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Byun, Mi Young; Cui, Li Hua; Kim, Woo Taek
2015-12-25
The Ku70-Ku80 heterodimer plays a critical role in the maintenance of genomic stability in humans and yeasts. In this report, we identified and characterized OsKu80 in rice, a model monocot crop. OsKu80 forms a heterodimer with OsKu70 in yeast and plant cells, as demonstrated by yeast two-hybrid, in vivo co-immunoprecipitation, and bimolecular fluorescence complementation assays. RNAi-mediated knock-down T3 transgenic rice plants (Ubi:RNAi-OsKu80) displayed a retarded growth phenotype at the post-germination stage. In addition, the Ubi:RNAi-OsKu80 knock-down progeny exhibited noticeably increased telomere length as compared to wild-type rice. These results are discussed with the idea that OsKu80 plays a role in developmental growth and telomere length regulation in rice plants. Copyright © 2015 Elsevier Inc. All rights reserved.
Ciaudo, Constance; Jay, Florence; Okamoto, Ikuhiro; Chen, Chong-Jian; Sarazin, Alexis; Servant, Nicolas; Barillot, Emmanuel; Heard, Edith; Voinnet, Olivier
2013-01-01
In most mouse tissues, long-interspersed elements-1 (L1s) are silenced via methylation of their 5′-untranslated regions (5′-UTR). A gradual loss-of-methylation in pre-implantation embryos coincides with L1 retrotransposition in blastocysts, generating potentially harmful mutations. Here, we show that Dicer- and Ago2-dependent RNAi restricts L1 accumulation and retrotransposition in undifferentiated mouse embryonic stem cells (mESCs), derived from blastocysts. RNAi correlates with production of Dicer-dependent 22-nt small RNAs mapping to overlapping sense/antisense transcripts produced from the L1 5′-UTR. However, RNA-surveillance pathways simultaneously degrade these transcripts and, consequently, confound the anti-L1 RNAi response. In Dicer−/− mESC complementation experiments involving ectopic Dicer expression, L1 silencing was rescued in cells in which microRNAs remained strongly depleted. Furthermore, these cells proliferated and differentiated normally, unlike their non-complemented counterparts. These results shed new light on L1 biology, uncover defensive, in addition to regulatory roles for RNAi, and raise questions on the differentiation defects of Dicer−/− mESCs. PMID:24244175
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
Development of functional ectopic compound eyes in scarabaeid beetles by knockdown of orthodenticle.
Zattara, Eduardo E; Macagno, Anna L M; Busey, Hannah A; Moczek, Armin P
2017-11-07
Complex traits like limbs, brains, or eyes form through coordinated integration of diverse cell fates across developmental space and time, yet understanding how complexity and integration emerge from uniform, undifferentiated precursor tissues remains limited. Here, we use ectopic eye formation as a paradigm to investigate the emergence and integration of novel complex structures following massive ontogenetic perturbation. We show that down-regulation via RNAi of a single head patterning gene- orthodenticle -induces ectopic structures externally resembling compound eyes at the middorsal adult head of both basal and derived scarabaeid beetle species (Onthophagini and Oniticellini). Scanning electron microscopy documents ommatidial organization of these induced structures, while immunohistochemistry reveals the presence of rudimentary ommatidial lenses, crystalline cones, and associated neural-like tissue within them. Further, RNA-sequencing experiments show that after orthodenticle down-regulation, the transcriptional signature of the middorsal head-the location of ectopic eye induction-converges onto that of regular compound eyes, including up-regulation of several retina-specific genes. Finally, a light-aversion behavioral assay to assess functionality reveals that ectopic compound eyes can rescue the ability to respond to visual stimuli when wild-type eyes are surgically removed. Combined, our results show that knockdown of a single gene is sufficient for the middorsal head to acquire the competence to ectopically generate a functional compound eye-like structure. These findings highlight the buffering capacity of developmental systems, allowing massive genetic perturbations to be channeled toward orderly and functional developmental outcomes, and render ectopic eye formation a widely accessible paradigm to study the evolution of complex systems. Published under the PNAS license.
RNAi-mediated gene silencing as a principle of action of venoms and poisons.
Pereira, Tiago Campos; Lopes-Cendes, Iscia
2008-01-01
RNA interference (RNAi) is a natural phenomenon in which double-stranded RNA molecules (dsRNAs) promote silencing of genes with similar sequence. It is noteworthy that in some instances the effects of gene silencing are similar to those caused by venoms and natural poisons (e.g., hemorrhage and low blood pressure). This observation raises the possibility that venomous/poisonous species in fact produce dsRNAs in their venoms/poisons and leading to the deleterious effects in the victim by RNAi-mediated gene silencing. Two approaches could be used to test this hypothesis, first, the neutralization of the dsRNAs and comparing to a non-treated venom sample; and second, to identify the dsRNA present in the venom and attempt to artificially reproduce its effects in the laboratory. In addition, we present three innovative treatment strategies for accidental interactions with venomous or poisonous species. RNAi has several roles in biological systems: gene regulation, antiviral defense, transposon silencing and heterochromatin formation. The hypothesis presented here provides a new role: a natural attack mechanism.
RNAi at work: Targeting invertebrate pests and beneficial organisms' diseases
USDA-ARS?s Scientific Manuscript database
Invertebrates present two types of large scale RNAi application opportunities: pest control and beneficial insect health. The former involves the introduction of sustainable applications to keep pest populations low, and the latter represents the challenge of keeping beneficial organisms healthy. RN...
RNAi and Antiviral Defense in the Honey Bee.
Brutscher, Laura M; Flenniken, Michelle L
2015-01-01
Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans.
RNAi and Antiviral Defense in the Honey Bee
Brutscher, Laura M.; Flenniken, Michelle L.
2015-01-01
Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans. PMID:26798663
Sindhu, Anoop S; Maier, Tom R; Mitchum, Melissa G; Hussey, Richard S; Davis, Eric L; Baum, Thomas J
2009-01-01
Cyst nematodes are highly evolved sedentary plant endoparasites that use parasitism proteins injected through the stylet into host tissues to successfully parasitize plants. These secretory proteins likely are essential for parasitism as they are involved in a variety of parasitic events leading to the establishment of specialized feeding cells required by the nematode to obtain nourishment. With the advent of RNA interference (RNAi) technology and the demonstration of host-induced gene silencing in parasites, a new strategy to control pests and pathogens has become available, particularly in root-knot nematodes. Plant host-induced silencing of cyst nematode genes so far has had only limited success but similarly should disrupt the parasitic cycle and render the host plant resistant. Additional in planta RNAi data for cyst nematodes are being provided by targeting four parasitism genes through host-induced RNAi gene silencing in transgenic Arabidopsis thaliana, which is a host for the sugar beet cyst nematode Heterodera schachtii. Here it is reported that mRNA abundances of targeted nematode genes were specifically reduced in nematodes feeding on plants expressing corresponding RNAi constructs. Furthermore, this host-induced RNAi of all four nematode parasitism genes led to a reduction in the number of mature nematode females. Although no complete resistance was observed, the reduction of developing females ranged from 23% to 64% in different RNAi lines. These observations demonstrate the relevance of the targeted parasitism genes during the nematode life cycle and, potentially more importantly, suggest that a viable level of resistance in crop plants may be accomplished in the future using this technology against cyst nematodes.
A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae
Morris, Robert; Wilson, Leonie; Warnock, Neil D.; Maule, Aaron G.
2017-01-01
Entomopathogenic nematodes (EPNs) employ a sophisticated chemosensory apparatus to detect potential hosts. Understanding the molecular basis of relevant host-finding behaviours could facilitate improved EPN biocontrol approaches, and could lend insight to similar behaviours in economically important mammalian parasites. FMRFamide-like peptides are enriched and conserved across the Phylum Nematoda, and have been linked with motor and sensory function, including dispersal and aggregating behaviours in the free living nematode Caenorhabditis elegans. The RNA interference (RNAi) pathway of Steinernema carpocapsae was characterised in silico, and employed to knockdown the expression of the FMRFamide-like peptide 21 (GLGPRPLRFamide) gene (flp-21) in S. carpocapsae infective juveniles; a first instance of RNAi in this genus, and a first in an infective juvenile of any EPN species. Our data show that 5 mg/ml dsRNA and 50 mM serotonin triggers statistically significant flp-21 knockdown (-84%***) over a 48 h timecourse, which inhibits host-finding (chemosensory), dispersal, hyperactive nictation and jumping behaviours. However, whilst 1 mg/ml dsRNA and 50 mM serotonin also triggers statistically significant flp-21 knockdown (-51%**) over a 48 h timecourse, it does not trigger the null sensory phenotypes; statistically significant target knockdown can still lead to false negative results, necessitating appropriate experimental design. SPME GC-MS volatile profiles of two EPN hosts, Galleria mellonella and Tenebrio molitor reveal an array of shared and unique compounds; these differences had no impact on null flp-21 RNAi phenotypes for the behaviours assayed. Localisation of flp-21 / FLP-21 to paired anterior neurons by whole mount in situ hybridisation and immunocytochemistry corroborates the RNAi data, further suggesting a role in sensory modulation. These data can underpin efforts to study these behaviours in other economically important parasites, and could facilitate
Morris, Robert; Wilson, Leonie; Sturrock, Matthew; Warnock, Neil D; Carrizo, Daniel; Cox, Deborah; Maule, Aaron G; Dalzell, Johnathan J
2017-03-01
Entomopathogenic nematodes (EPNs) employ a sophisticated chemosensory apparatus to detect potential hosts. Understanding the molecular basis of relevant host-finding behaviours could facilitate improved EPN biocontrol approaches, and could lend insight to similar behaviours in economically important mammalian parasites. FMRFamide-like peptides are enriched and conserved across the Phylum Nematoda, and have been linked with motor and sensory function, including dispersal and aggregating behaviours in the free living nematode Caenorhabditis elegans. The RNA interference (RNAi) pathway of Steinernema carpocapsae was characterised in silico, and employed to knockdown the expression of the FMRFamide-like peptide 21 (GLGPRPLRFamide) gene (flp-21) in S. carpocapsae infective juveniles; a first instance of RNAi in this genus, and a first in an infective juvenile of any EPN species. Our data show that 5 mg/ml dsRNA and 50 mM serotonin triggers statistically significant flp-21 knockdown (-84%***) over a 48 h timecourse, which inhibits host-finding (chemosensory), dispersal, hyperactive nictation and jumping behaviours. However, whilst 1 mg/ml dsRNA and 50 mM serotonin also triggers statistically significant flp-21 knockdown (-51%**) over a 48 h timecourse, it does not trigger the null sensory phenotypes; statistically significant target knockdown can still lead to false negative results, necessitating appropriate experimental design. SPME GC-MS volatile profiles of two EPN hosts, Galleria mellonella and Tenebrio molitor reveal an array of shared and unique compounds; these differences had no impact on null flp-21 RNAi phenotypes for the behaviours assayed. Localisation of flp-21 / FLP-21 to paired anterior neurons by whole mount in situ hybridisation and immunocytochemistry corroborates the RNAi data, further suggesting a role in sensory modulation. These data can underpin efforts to study these behaviours in other economically important parasites, and could facilitate
Smith, Ian; Greenside, Peyton G; Natoli, Ted; Lahr, David L; Wadden, David; Tirosh, Itay; Narayan, Rajiv; Root, David E; Golub, Todd R; Subramanian, Aravind; Doench, John G
2017-11-01
The application of RNA interference (RNAi) to mammalian cells has provided the means to perform phenotypic screens to determine the functions of genes. Although RNAi has revolutionized loss-of-function genetic experiments, it has been difficult to systematically assess the prevalence and consequences of off-target effects. The Connectivity Map (CMAP) represents an unprecedented resource to study the gene expression consequences of expressing short hairpin RNAs (shRNAs). Analysis of signatures for over 13,000 shRNAs applied in 9 cell lines revealed that microRNA (miRNA)-like off-target effects of RNAi are far stronger and more pervasive than generally appreciated. We show that mitigating off-target effects is feasible in these datasets via computational methodologies to produce a consensus gene signature (CGS). In addition, we compared RNAi technology to clustered regularly interspaced short palindromic repeat (CRISPR)-based knockout by analysis of 373 single guide RNAs (sgRNAs) in 6 cells lines and show that the on-target efficacies are comparable, but CRISPR technology is far less susceptible to systematic off-target effects. These results will help guide the proper use and analysis of loss-of-function reagents for the determination of gene function.
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway
2012-01-01
Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893
Identification of a novel mitochondrial complex I assembly factor ACDH-12 in Caenorhabditis elegans.
Chuaijit, Sirithip; Boonyatistan, Worawit; Boonchuay, Pichsinee; Metheetrairut, Chanatip; Suthammarak, Wichit
2018-03-11
Assembly of complex I of the mitochondrial respiratory chain (MRC) requires not only structural subunits for electron transport, but also assembly factors. In the nematode Caenorhabditis elegans, NUAF-1 and NUAF-3 are the only two assembly factors that have been characterized. In this study, we identify ACDH-12 as an assembly factor of the respiratory complex I. We demonstrate for the first time that a deficiency of ACDH-12 affects the formation and function of complex I. RNAi knockdown of acdh-12 also shortens lifespan and decreases fecundity. Although ACDH-12 has long been recognized as a very long-chain acyl-CoA dehydrogenase (VLCAD), the knockdown nematodes did not exhibit any change in body fat content. We suggested that in Caenorhabditis elegans, ACDH-12 is required for the assembly of the respiratory complex I, but may not be crucial to fatty acid oxidation. Interestingly, sequence analysis shows high homology between ACDH-12 and the human ACAD9, a protein that has initially been identified as a VLCAD, but later found to also be involved in the assembly of complex I in human. Copyright © 2018 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hau; Florens, Laurence; Mak, Ho Yi
2012-01-01
The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans. PMID:22508728
Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi
2012-04-15
The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.
Koutsogiannouli, Evangelia A.; Hader, Christiane; Pinkerneil, Maria; Hoffmann, Michèle J.; Schulz, Wolfgang A.
2017-01-01
Disturbances in histone acetyltransferases (HATs) are common in cancers. In urothelial carcinoma (UC), p300 and CBP are often mutated, whereas the GNAT family HATs GCN5 and PCAF (General Control Nonderepressible 5, p300/CBP-Associated Factor) are often upregulated. Here, we explored the effects of specific siRNA-mediated knockdown of GCN5, PCAF or both in four UC cell lines (UCCs). Expression of various HATs and marker proteins was measured by qRT-PCR and western blot. Cellular effects of knockdowns were analyzed by flow cytometry and ATP-, caspase-, and colony forming-assays. GCN5 was regularly upregulated in UCCs, whereas PCAF was variable. Knockdown of GCN5 or both GNATs, but not of PCAF alone, diminished viability and inhibited clonogenic growth in 2/4 UCCs, inducing cell cycle changes and caspase-3/7 activity. PCAF knockdown elicited GCN5 mRNA upregulation. Double knockdown increased c-MYC and MDM2 (Mouse Double Minute 2) in most cell lines. In conclusion, GCN5 upregulation is especially common in UCCs. GCN5 knockdown impeded growth of specific UCCs, whereas PCAF knockdown elicited minor effects. The limited sensitivity towards GNAT knockdown and its variation between the cell lines might be due to compensatory effects including HAT, c-MYC and MDM2 upregulation. Our results predict that developing drugs targeting individual HATs for UC treatment may be challenging. PMID:28678170
Gillet, François-Xavier; Garcia, Rayssa A.; Macedo, Leonardo L. P.; Albuquerque, Erika V. S.; Silva, Maria C. M.; Grossi-de-Sa, Maria F.
2017-01-01
Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil (Anthonomus grandis), we showed that the chimeric protein PTD-DRBD (peptide transduction domain—dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests. PMID:28503153
Gillet, François-Xavier; Garcia, Rayssa A; Macedo, Leonardo L P; Albuquerque, Erika V S; Silva, Maria C M; Grossi-de-Sa, Maria F
2017-01-01
Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil ( Anthonomus grandis ), we showed that the chimeric protein PTD-DRBD (peptide transduction domain-dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests.
Transmission bottlenecks and RNAi collectively influence tick-borne flavivirus evolution.
Grubaugh, Nathan D; Rückert, Claudia; Armstrong, Philip M; Bransfield, Angela; Anderson, John F; Ebel, Gregory D; Brackney, Doug E
2016-07-01
Arthropod-borne RNA viruses exist within hosts as heterogeneous populations of viral variants and, as a result, possess great genetic plasticity. Understanding the micro-evolutionary forces shaping these viruses can provide insights into how they emerge, adapt, and persist in new and changing ecological niches. While considerable attention has been directed toward studying the population dynamics of mosquito-borne viruses, little is known about tick-borne virus populations. Therefore, using a mouse and Ixodes scapularis tick transmission model, we examined Powassan virus (POWV; Flaviviridae, Flavivirus ) populations in and between both the vertebrate host and arthropod vector. We found that genetic bottlenecks, RNAi-mediated diversification, and selective constraints collectively influence POWV evolution. Together, our data provide a mechanistic explanation for the slow, long-term evolutionary trends of POWV, and suggest that all arthropod-borne viruses encounter similar selective pressures at the molecular level (i.e. RNAi), yet evolve much differently due to their unique rates and modes of transmission.
Gene Silencing in Insect Cells Using RNAi.
Wu, Hsuan-Chen; March, John C; Bentley, William E
2016-01-01
A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.
RNAi-mediated down-regulation of SHATTERPROOF gene in transgenic oilseed rape.
Kord, Hadis; Shakib, Ali Mohammad; Daneshvar, Mohammad Hossein; Azadi, Pejman; Bayat, Vahid; Mashayekhi, Mohsen; Zarea, Mahboobeh; Seifi, Alireza; Ahmad-Raji, Mana
2015-06-01
Oilseed rape is one of the important oil plants. Pod shattering is one of the problems in oilseed rape production especially in regions with dry conditions. One of the important genes in Brassica pod opening is SHATTERPROOF1 (SHP1). Down-regulation of BnSHP1 expression by RNAi can increase resistance to pod shattering. A 470 bp of the BnSHP1 cDNA sequence constructed in an RNAi-silencing vector was transferred to oilseed rape cv. SLM046. Molecular analysis of T2 transgenic plants by RT-PCR and Real-time PCR showed that expression of the BnSHP alleles was highly decreased in comparison with control plants. Morphologically, transgenic plants were normal and produced seeds at greenhouse conditions. At ripening, stage pods failed to shatter, and a finger pressure was needed for pod opening.
Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A
2016-08-01
Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less
Kir, Gokhan; Ye, Huaxun; Nelissen, Hilde; Neelakandan, Anjanasree K.; Kusnandar, Andree S.; Luo, Anding; Inzé, Dirk; Sylvester, Anne W.; Yin, Yanhai; Becraft, Philip W.
2015-01-01
Brassinosteroids (BRs) are plant hormones involved in various growth and developmental processes. The BR signaling system is well established in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) but poorly understood in maize (Zea mays). BRASSINOSTEROID INSENSITIVE1 (BRI1) is a BR receptor, and database searches and additional genomic sequencing identified five maize homologs including duplicate copies of BRI1 itself. RNA interference (RNAi) using the extracellular coding region of a maize zmbri1 complementary DNA knocked down the expression of all five homologs. Decreased response to exogenously applied brassinolide and altered BR marker gene expression demonstrate that zmbri1-RNAi transgenic lines have compromised BR signaling. zmbri1-RNAi plants showed dwarf stature due to shortened internodes, with upper internodes most strongly affected. Leaves of zmbri1-RNAi plants are dark green, upright, and twisted, with decreased auricle formation. Kinematic analysis showed that decreased cell division and cell elongation both contributed to the shortened leaves. A BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1-yellow fluorescent protein (BES1-YFP) transgenic line was developed that showed BR-inducible BES1-YFP accumulation in the nucleus, which was decreased in zmbri1-RNAi. Expression of the BES1-YFP reporter was strong in the auricle region of developing leaves, suggesting that localized BR signaling is involved in promoting auricle development, consistent with the zmbri1-RNAi phenotype. The blade-sheath boundary disruption, shorter ligule, and disrupted auricle morphology of RNAi lines resemble KNOTTED1-LIKE HOMEOBOX (KNOX) mutants, consistent with a mechanistic connection between KNOX genes and BR signaling. PMID:26162429
Genome-wide RNAi screen reveals ALK1 mediates LDL uptake and transcytosis in endothelial cells
Kraehling, Jan R.; Chidlow, John H.; Rajagopal, Chitra; Sugiyama, Michael G.; Fowler, Joseph W.; Lee, Monica Y.; Zhang, Xinbo; Ramírez, Cristina M.; Park, Eon Joo; Tao, Bo; Chen, Keyang; Kuruvilla, Leena; Larriveé, Bruno; Folta-Stogniew, Ewa; Ola, Roxana; Rotllan, Noemi; Zhou, Wenping; Nagle, Michael W.; Herz, Joachim; Williams, Kevin Jon; Eichmann, Anne; Lee, Warren L.; Fernández-Hernando, Carlos; Sessa, William C.
2016-01-01
In humans and animals lacking functional LDL receptor (LDLR), LDL from plasma still readily traverses the endothelium. To identify the pathways of LDL uptake, a genome-wide RNAi screen was performed in endothelial cells and cross-referenced with GWAS-data sets. Here we show that the activin-like kinase 1 (ALK1) mediates LDL uptake into endothelial cells. ALK1 binds LDL with lower affinity than LDLR and saturates only at hypercholesterolemic concentrations. ALK1 mediates uptake of LDL into endothelial cells via an unusual endocytic pathway that diverts the ligand from lysosomal degradation and promotes LDL transcytosis. The endothelium-specific genetic ablation of Alk1 in Ldlr-KO animals leads to less LDL uptake into the aortic endothelium, showing its physiological role in endothelial lipoprotein metabolism. In summary, identification of pathways mediating LDLR-independent uptake of LDL may provide unique opportunities to block the initiation of LDL accumulation in the vessel wall or augment hepatic LDLR-dependent clearance of LDL. PMID:27869117
Genome-wide RNAi screen reveals ALK1 mediates LDL uptake and transcytosis in endothelial cells.
Kraehling, Jan R; Chidlow, John H; Rajagopal, Chitra; Sugiyama, Michael G; Fowler, Joseph W; Lee, Monica Y; Zhang, Xinbo; Ramírez, Cristina M; Park, Eon Joo; Tao, Bo; Chen, Keyang; Kuruvilla, Leena; Larriveé, Bruno; Folta-Stogniew, Ewa; Ola, Roxana; Rotllan, Noemi; Zhou, Wenping; Nagle, Michael W; Herz, Joachim; Williams, Kevin Jon; Eichmann, Anne; Lee, Warren L; Fernández-Hernando, Carlos; Sessa, William C
2016-11-21
In humans and animals lacking functional LDL receptor (LDLR), LDL from plasma still readily traverses the endothelium. To identify the pathways of LDL uptake, a genome-wide RNAi screen was performed in endothelial cells and cross-referenced with GWAS-data sets. Here we show that the activin-like kinase 1 (ALK1) mediates LDL uptake into endothelial cells. ALK1 binds LDL with lower affinity than LDLR and saturates only at hypercholesterolemic concentrations. ALK1 mediates uptake of LDL into endothelial cells via an unusual endocytic pathway that diverts the ligand from lysosomal degradation and promotes LDL transcytosis. The endothelium-specific genetic ablation of Alk1 in Ldlr-KO animals leads to less LDL uptake into the aortic endothelium, showing its physiological role in endothelial lipoprotein metabolism. In summary, identification of pathways mediating LDLR-independent uptake of LDL may provide unique opportunities to block the initiation of LDL accumulation in the vessel wall or augment hepatic LDLR-dependent clearance of LDL.
Kurscheid, Sebastian; Lew-Tabor, Ala E; Rodriguez Valle, Manuel; Bruyeres, Anthea G; Doogan, Vivienne J; Munderloh, Ulrike G; Guerrero, Felix D; Barrero, Roberto A; Bellgard, Matthew I
2009-01-01
Background The Arthropods are a diverse group of organisms including Chelicerata (ticks, mites, spiders), Crustacea (crabs, shrimps), and Insecta (flies, mosquitoes, beetles, silkworm). The cattle tick, Rhipicephalus (Boophilus) microplus, is an economically significant ectoparasite of cattle affecting cattle industries world wide. With the availability of sequence reads from the first Chelicerate genome project (the Ixodes scapularis tick) and extensive R. microplus ESTs, we investigated evidence for putative RNAi proteins and studied RNA interference in tick cell cultures and adult female ticks targeting Drosophila homologues with known cell viability phenotype. Results We screened 13,643 R. microplus ESTs and I. scapularis genome reads to identify RNAi related proteins in ticks. Our analysis identified 31 RNAi proteins including a putative tick Dicer, RISC associated (Ago-2 and FMRp), RNA dependent RNA polymerase (EGO-1) and 23 homologues implicated in dsRNA uptake and processing. We selected 10 R. microplus ESTs with >80% similarity to D. melanogaster proteins associated with cell viability for RNAi functional screens in both BME26 R. microplus embryonic cells and female ticks in vivo. Only genes associated with proteasomes had an effect on cell viability in vitro. In vivo RNAi showed that 9 genes had significant effects either causing lethality or impairing egg laying. Conclusion We have identified key RNAi-related proteins in ticks and along with our loss-of-function studies support a functional RNAi pathway in R. microplus. Our preliminary studies indicate that tick RNAi pathways may differ from that of other Arthropods such as insects. PMID:19323841
Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....
Pareek, Manish; Rajam, Manchikatla Venkat
2017-09-01
Fusarium oxysporum is a soil-borne plant fungal pathogen, and causes colossal losses in several crop plants including tomato. Effective control measures include the use of harmful fungicides and resistant cultivars, but these methods have shown limited success. Conventional methods to validate fungal pathogenic genes are labour intensive. Therefore, an alternative strategy is required to efficiently characterize unknown pathogenic genes. RNA interference (RNAi) has emerged as a potential tool to functionally characterize novel fungal pathogenic genes and also to control fungal diseases. Here, we report an efficient method to produce stable RNAi transformants of F. oxysporum using Agrobacterium-mediated transformation (AMT). We have transformed F. oxysporum spores using RNAi constructs of Fmk1, Hog1, and Pbs2 MAP kinase signalling genes. Fmk1 RNAi fungal transformants showed loss of surface hydrophobicity, reduced invasive growth on tomato fruits and hypo-virulence on tomato seedlings. Hog1 and Pbs2 RNAi transformants showed altered conidial size, and reduced invasive growth and pathogenesis. These results showed that AMT using RNAi constructs is an effective approach for dissecting the role of genes involved in pathogenesis in F. oxysporum and this could be extended for other fungal systems. The obtained knowledge can be easily translated for developing fungal resistant crops by RNAi. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION
LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.
2012-01-01
Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and
Automatic Segmentation of High-Throughput RNAi Fluorescent Cellular Images
Yan, Pingkum; Zhou, Xiaobo; Shah, Mubarak; Wong, Stephen T. C.
2010-01-01
High-throughput genome-wide RNA interference (RNAi) screening is emerging as an essential tool to assist biologists in understanding complex cellular processes. The large number of images produced in each study make manual analysis intractable; hence, automatic cellular image analysis becomes an urgent need, where segmentation is the first and one of the most important steps. In this paper, a fully automatic method for segmentation of cells from genome-wide RNAi screening images is proposed. Nuclei are first extracted from the DNA channel by using a modified watershed algorithm. Cells are then extracted by modeling the interaction between them as well as combining both gradient and region information in the Actin and Rac channels. A new energy functional is formulated based on a novel interaction model for segmenting tightly clustered cells with significant intensity variance and specific phenotypes. The energy functional is minimized by using a multiphase level set method, which leads to a highly effective cell segmentation method. Promising experimental results demonstrate that automatic segmentation of high-throughput genome-wide multichannel screening can be achieved by using the proposed method, which may also be extended to other multichannel image segmentation problems. PMID:18270043
Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F
2009-02-01
RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.
Riechmann, Veit
2017-01-01
In vivo RNAi in Drosophila facilitates simple and rapid analysis of gene functions in a cell- or tissue-specific manner. The versatility of the UAS-GAL4 system allows to control exactly where and when during development the function of a gene is depleted. The epithelium of the ovary is a particularly good model to study in a living animal how stem cells are maintained and how their descendants proliferate and differentiate. Here I provide basic information about the publicly available reagents for in vivo RNAi, and I describe how the oogenesis system can be applied to analyze stem cells and epithelial development at a histological level. Moreover, I give helpful hints to optimize the use of the UAS-GAL4 system for RNAi induction in the follicular epithelium. Finally, I provide detailed step-by-step protocols for ovary dissection, antibody stainings, and ovary mounting for microscopic analysis.
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Chen, C; Li, H; Zhou, X; Wong, S T C
2008-05-01
Image-based, high throughput genome-wide RNA interference (RNAi) experiments are increasingly carried out to facilitate the understanding of gene functions in intricate biological processes. Automated screening of such experiments generates a large number of images with great variations in image quality, which makes manual analysis unreasonably time-consuming. Therefore, effective techniques for automatic image analysis are urgently needed, in which segmentation is one of the most important steps. This paper proposes a fully automatic method for cells segmentation in genome-wide RNAi screening images. The method consists of two steps: nuclei and cytoplasm segmentation. Nuclei are extracted and labelled to initialize cytoplasm segmentation. Since the quality of RNAi image is rather poor, a novel scale-adaptive steerable filter is designed to enhance the image in order to extract long and thin protrusions on the spiky cells. Then, constraint factor GCBAC method and morphological algorithms are combined to be an integrated method to segment tight clustered cells. Compared with the results obtained by using seeded watershed and the ground truth, that is, manual labelling results by experts in RNAi screening data, our method achieves higher accuracy. Compared with active contour methods, our method consumes much less time. The positive results indicate that the proposed method can be applied in automatic image analysis of multi-channel image screening data.
[Knock-down of ZEB1 inhibits the proliferation, invasion and migration of gastric cancer cells].
Chen, Dengyu; Chu, Yifan; Zheng, Qingwei; Xu, Zhiben; Zhou, Ping; Li, Sheng
2017-08-01
Objective To down-regulate the expression of zinc-finger E-box binding homeobox 1 (ZEB1) gene by shRNA, and investigate its effect on invasion, migration and proliferation, as well as the related gene expressions of lncRNA HOTAIR and E-cadherin in human gastric cancer BGC823 cells. Methods RNA interfering (RNAi) was used to knock down ZEB1 in gastric cancer BGC823 cells. The recombinant plasmid shZEB1 was constructed and transfected into the gastric cancer BGC823 cells by Lipofectamine TM 2000, and the stably transfected cells were isolated by G418 selection and limited dilution. The expression of ZEB1 mRNA and protein was detected by real-time quantitative PCR and Western blot analysis. Cell proliferation was determined by MTT assay, and the invasion and migration abilities of BGC823 cells were monitored by Transwell TM invasion assay and wound healing assay, respectively. The expressions of lncRNA HOTAIR and E-cadherin mRNA were detected by real-time quantitative PCR. Results After ZEB1 expression was successfully down-regulated in BGC823 cells by siRNA, the proliferation, invasion and migration rates in shZEB1 transfection group were significantly lower than those in control group; meanwhile, the expression of lncRNA HOTAIR was reduced and E-cadherin expression was enhanced. Conclusion Knock-down of ZEB1 expression by RNA interference can decease lncRNA HOTAIR expression and restrain cell proliferation, invasion and migration in gastric cancer BGC823 cells.
Natural and Unanticipated Modifiers of RNAi Activity in Caenorhabditis elegans
Asad, Nadeem; Aw, Wen Yih; Timmons, Lisa
2012-01-01
Organisms used as model genomics systems are maintained as isogenic strains, yet evidence of sequence differences between independently maintained wild-type stocks has been substantiated by whole-genome resequencing data and strain-specific phenotypes. Sequence differences may arise from replication errors, transposon mobilization, meiotic gene conversion, or environmental or chemical assault on the genome. Low frequency alleles or mutations with modest effects on phenotypes can contribute to natural variation, and it has proven possible for such sequences to become fixed by adapted evolutionary enrichment and identified by resequencing. Our objective was to identify and analyze single locus genetic defects leading to RNAi resistance in isogenic strains of Caenorhabditis elegans. In so doing, we uncovered a mutation that arose de novo in an existing strain, which initially frustrated our phenotypic analysis. We also report experimental, environmental, and genetic conditions that can complicate phenotypic analysis of RNAi pathway defects. These observations highlight the potential for unanticipated mutations, coupled with genetic and environmental phenomena, to enhance or suppress the effects of known mutations and cause variation between wild-type strains. PMID:23209671
The impact of HIV-1 genetic diversity on the efficacy of a combinatorial RNAi-based gene therapy.
Herrera-Carrillo, E; Berkhout, B
2015-06-01
A hurdle for human immunodeficiency virus (HIV-1) therapy is the genomic diversity of circulating viruses and the possibility that drug-resistant virus variants are selected. Although RNA interference (RNAi) is a powerful tool to stably inhibit HIV-1 replication by the expression of antiviral short hairpin RNAs (shRNAs) in transduced T cells, this approach is also vulnerable to pre-existing genetic variation and the development of viral resistance through mutation. To prevent viral escape, we proposed to combine multiple shRNAs against important regions of the HIV-1 RNA genome, which should ideally be conserved in all HIV-1 subtypes. The vulnerability of RNAi therapy to viral escape has been studied for a single subtype B strain, but it is unclear whether the antiviral shRNAs can inhibit diverse virus isolates and subtypes, including drug-resistant variants that could be present in treated patients. To determine the breadth of the RNAi gene therapy approach, we studied the susceptibility of HIV-1 subtypes A-E and drug-resistant variants. In addition, we monitored the evolution of HIV-1 escape variants. We demonstrate that the combinatorial RNAi therapy is highly effective against most isolates, supporting the future testing of this gene therapy in appropriate in vivo models.
Wallace, Lindsay M; Saad, Nizar Y; Pyne, Nettie K; Fowler, Allison M; Eidahl, Jocelyn O; Domire, Jacqueline S; Griffin, Danielle A; Herman, Adam C; Sahenk, Zarife; Rodino-Klapac, Louise R; Harper, Scott Q
2018-03-16
RNAi emerged as a prospective molecular therapy nearly 15 years ago. Since then, two major RNAi platforms have been under development: oligonucleotides and gene therapy. Oligonucleotide-based approaches have seen more advancement, with some promising therapies that may soon reach market. In contrast, vector-based approaches for RNAi therapy have remained largely in the pre-clinical realm, with limited clinical safety and efficacy data to date. We are developing a gene therapy approach to treat the autosomal-dominant disorder facioscapulohumeral muscular dystrophy. Our strategy involves silencing the myotoxic gene DUX4 using adeno-associated viral vectors to deliver targeted microRNA expression cassettes (miDUX4s). We previously demonstrated proof of concept for this approach in mice, and we are now taking additional steps here to assess safety issues related to miDUX4 overexpression and sequence-specific off-target silencing. In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not. This study provides important data to help advance our goal of translating RNAi gene therapy for facioscapulohumeral muscular dystrophy.
Chen, Qing; Rehman, S; Smant, G; Jones, John T
2005-07-01
RNA interference (RNAi) has been used widely as a tool for examining gene function and a method that allows its use with plant-parasitic nematodes recently has been described. Here, we use a modified method to analyze the function of secreted beta-1,4, endoglucanases of the potato cyst nematode Globodera rostochiensis, the first in vivo functional analysis of a pathogenicity protein of a plant-parasitic nematode. Knockout of the beta-1,4, endoglucanases reduced the ability of the nematodes to invade roots. We also use RNAi to show that gr-ams-1, a secreted protein of the main sense organs (the amphids), is essential for host location.
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.
2015-01-01
Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102
DISE: A Seed-Dependent RNAi Off-Target Effect That Kills Cancer Cells.
Putzbach, William; Gao, Quan Q; Patel, Monal; Haluck-Kangas, Ashley; Murmann, Andrea E; Peter, Marcus E
2018-01-01
Off-target effects (OTEs) represent a significant caveat for RNAi caused by substantial complementarity between siRNAs and unintended mRNAs. We now discuss the existence of three types of seed-dependent OTEs (sOTEs). Type I involves unintended targeting through the guide strand seed of an siRNA. Type II is caused by the activity of the seed on the designated siRNA passenger strand when loaded into the RNA-induced silencing complex (RISC). Both type I and II sOTEs will elicit unpredictable cellular responses. By contrast, in sOTE type III the guide strand seed preferentially targets essential survival genes resulting in death induced by survival gene elimination (DISE). In this Opinion article, we discuss DISE as a consequence of RNAi that may preferentially affect cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Suppression of RND3 activity by AES downregulation promotes cancer cell proliferation and invasion.
Xia, Hongwei; Li, Mingxing; Chen, Liang; Leng, Weibing; Yuan, Dandan; Pang, Xiaohui; Chen, Liu; Li, Ronghui; Tang, Qiulin; Bi, Feng
2013-05-01
Amino-terminal enhancer of split (AES) is a member of the Groucho/TLE family. Although it has no DNA-binding site, AES can regulate transcriptional activity by interacting with transcriptional factors. Emerging evidence indicates that AES may play an important role in tumor metastasis, but the molecular mechanism is still poorly understood. In this study, we found that knockdown of AES by RNA interference (RNAi) downregulated RND3 expression at the mRNA and protein levels in MDA-MB-231 and HepG2, two cancer cell lines. Furthermore, luciferase assays showed that overexpression of AES significantly enhanced RND3 promoter activity. Moreover, inhibition of AES both in MDA-MB-231 and HepG2 cells by RNAi significantly promoted cell proliferation, cell cycle progression and invasion, consistent with the effects of RNAi-mediated RND3 knockdown in these cells. For the first time, data are presented showing that alteration of the malignant behavior of cancer cells by AES is related to RND3 regulation, and these findings also provide new insights into the mechanism of AES action in regulating tumor malignancy.
Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube
USDA-ARS?s Scientific Manuscript database
RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....
Musiyenko, Alla; Bitko, Vira; Barik, Sailen
2007-07-01
Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.
Kondylis, Vangelis; Tang, Yang; Fuchs, Florian; Boutros, Michael; Rabouille, Catherine
2011-02-23
In Drosophila, the early secretory apparatus comprises discrete paired Golgi stacks in close proximity to exit sites from the endoplasmic reticulum (tER sites), thus forming tER-Golgi units. Although many components involved in secretion have been identified, the structural components sustaining its organisation are less known. Here we set out to identify novel ER resident proteins involved in the of tER-Golgi unit organisation. To do so, we designed a novel screening strategy combining a bioinformatics pre-selection with an RNAi screen. We first selected 156 proteins exhibiting known or related ER retention/retrieval signals from a list of proteins predicted to have a signal sequence. We then performed a microscopy-based primary and confirmation RNAi screen in Drosophila S2 cells directly scoring the organisation of the tER-Golgi units. We identified 49 hits, most of which leading to an increased number of smaller tER-Golgi units (MG for "more and smaller Golgi") upon depletion. 16 of them were validated and characterised, showing that this phenotype was not due to an inhibition in secretion, a block in G2, or ER stress. Interestingly, the MG phenotype was often accompanied by an increase in the cell volume. Out of 6 proteins, 4 were localised to the ER. This work has identified novel proteins involved in the organisation of the Drosophila early secretory pathway. It contributes to the effort of assigning protein functions to gene annotation in the secretory pathway, and analysis of the MG hits revealed an enrichment of ER proteins. These results suggest a link between ER localisation, aspects of cell metabolism and tER-Golgi structural organisation.
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Singh, Anand K; Lakhotia, Subhash C
2016-01-01
A delayed organismic lethality was reported in Drosophila following heat shock when developmentally active and stress-inducible noncoding hsrω-n transcripts were down-regulated during heat shock through hs-GAL4-driven expression of the hsrω-RNAi transgene, despite the characteristic elevation of all heat shock proteins (Hsp), including Hsp70. Here, we show that hsrω-RNAi transgene expression prior to heat shock singularly prevents accumulation of Hsp70 in all larval tissues without affecting transcriptional induction of hsp70 genes and stability of their transcripts. Absence of the stress-induced Hsp70 accumulation was not due to higher levels of Hsc70 in hsrω-RNAi transgene-expressing tissues. Inhibition of proteasomal activity during heat shock restored high levels of the induced Hsp70, suggesting very rapid degradation of the Hsp70 even during the stress when hsrω-RNAi transgene was expressed ahead of heat shock. Unexpectedly, while complete absence of hsrω transcripts in hsrω (66) homozygotes (hsrω-null) did not prevent high accumulation of heat shock-induced Hsp70, hsrω-RNAi transgene expression in hsrω-null background blocked Hsp70 accumulation. Nonspecific RNAi transgene expression did not affect Hsp70 induction. These observations reveal that, under certain conditions, the stress-induced Hsp70 can be selectively and rapidly targeted for proteasomal degradation even during heat shock. In the present case, the selective degradation of Hsp70 does not appear to be due to down-regulation of the hsrω-n transcripts per se; rather, this may be an indirect effect of the expression of hsrω-RNAi transgene whose RNA products may titrate away some RNA-binding proteins which may also be essential for stability of the induced Hsp70.
Turner, Alice M; Stolk, Jan; Bals, Robert; Lickliter, Jason D; Hamilton, James; Christianson, Dawn R; Given, Bruce D; Burdon, Jonathan G; Loomba, Rohit; Stoller, James K; Teckman, Jeffery H
2018-03-21
Alpha-1 antitrypsin deficiency (AATD) is a genetic disorder causing pulmonary and liver disease. The PiZ mutation in AAT (SERPINA1) results in mis-folded AAT protein (Z-AAT) accumulating in hepatocytes, leading to fibrosis and cirrhosis. RNAi-based therapeutics silencing production of hepatic Z-AAT might benefit patients with AATD-associated liver disease. This study evaluated an RNAi therapeutic to silence production of AAT. Part A of this double-blind first-in-human study randomized 54 healthy volunteers (HVs) into single dose cohorts (two placebo: four active), receiving escalating doses of the investigational agent ARC-AAT from 0.38 to 8.0 mg/kg or placebo. Part B randomized 11 patients with PiZZ (homozygous for Z-AAT) genotype AATD, who received up to 4.0 mg/kg of ARC-AAT or placebo. Patients with baseline FibroScan® >11 kPa or forced expiratory volume in one second (FEV1) <60% were excluded. Assessments included safety, pharmacokinetics, and change in serum AAT concentrations. A total of 36 HVs received ARC-AAT and 18 received placebo (part A). Seven PiZZ individuals received ARC-AAT and four received placebo (part B). A dose response in serum AAT reduction was observed at doses ≥4 mg/kg with similar relative reductions in PiZZ patients and HVs at 4 mg/kg and a maximum reduction of 76.1% (HVs) vs. 78.8% (PiZZ) at this dose. The time it took for serum AAT to return to baseline was similar for HV and PiZZ. There were no notable differences between HV and PiZZ safety parameters. The study was terminated early because of toxicity findings related to the delivery vehicle (ARC-EX1) seen in a non-human primate study. PiZZ patients and HVs responded similarly to ARC-AAT. Deep and durable knockdown of hepatic AAT production based on observed reduction in serum AAT concentrations was demonstrated. Accumulation of abnormal proteins in the livers of patients with alpha-1 antitrypsin deficiency may lead to decreased liver function and potentially liver
Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei
2016-01-01
RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA. PMID:27306325
Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei
2016-06-16
RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA.
USDA-ARS?s Scientific Manuscript database
Male ejaculate proteins, including both sperm and seminal fluid proteins, play an important role in mediating reproductive biology. The function of ejaculate proteins can include enabling sperm-egg interactions, enhancing sperm storage, mediating female attractiveness, and even regulating female lif...
Kennedy, Lisa M; Grishok, Alla
2014-05-01
Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning.
Kennedy, Lisa M.; Grishok, Alla
2014-01-01
Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning. PMID:24558261
Mandal, Kamal; Sarkar, Rajesh K; Sen Sharma, Souvik; Jain, Ayushi; Majumdar, Subeer S
2018-01-30
Globally, there is an alarming decline in sperm count. Very often hormonal supplementation fails to restore normal sperm count. Sertoli cells (Sc) present within seminiferous tubules provide appropriate niche and factors required for the differentiation of germ cells (Gc) into mature sperm (spermatogenesis). Functionally compromised Sc may be one of the reasons for failure of hormones to facilitate normal spermatogenesis. Although role of secretory proteins and signaling molecules of Sc has been studied well, role of transcription factors regulating sperm count has not been addressed appropriately. Retinoic acid receptor-related orphan receptor (ROR)-alpha is one of such transcription factors reported in testis but its role in testicular function is not yet known. In a separate study, we found abundant ROR-alpha binding sites on promoter regions of several genes upregulated in pubertal rat Sc as compared to infant Sc. Immunostaining studies also revealed presence of ROR alpha in nucleus of pubertal Sc. We generated a transgenic knockdown rat model expressing shRNA targeted to ROR-alpha under Sc specific promoter, which is transcriptionally active only at and after puberty. ROR-alpha knockdown animals were found to have abnormal association of Sc and Gc, including Gc sloughing and restricted release of sperm. The knockdown animals displayed compromised spermatogenesis leading to significant reduction in sperm count. This is the first report describing the Sc specific role of ROR-alpha in maintaining quantitatively normal sperm output. Identification of various such molecules can generate avenues to limit or reverse an alarmingly declining sperm count witnessed globally in men. Copyright © 2017 Elsevier B.V. All rights reserved.
RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.
Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj
2017-01-01
Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.
RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea
Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L.; Mukherjee, Sunil Kumar
2017-01-01
Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea. PMID:29077738
Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.
Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian
2009-03-01
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.
Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice
Judge, Adam D.; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian
2009-01-01
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target’s biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics. PMID:19229107
Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.
Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P
2016-04-27
Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing
Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams
Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.
2016-01-01
Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-01-01
SUMMARY The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used human Ago2 minimal RISC system to purify Sjögren’s syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. PMID:22055194
Gonsalves, Foster C.; Klein, Keren; Carson, Brittany B.; Katz, Shauna; Ekas, Laura A.; Evans, Steve; Nagourney, Robert; Cardozo, Timothy; Brown, Anthony M. C.; DasGupta, Ramanuj
2011-01-01
Misregulated β-catenin responsive transcription (CRT) has been implicated in the genesis of various malignancies, including colorectal carcinomas, and it is a key therapeutic target in combating various cancers. Despite significant effort, successful clinical implementation of CRT inhibitory therapeutics remains a challenging goal. This is, in part, because of the challenge of identifying inhibitory compounds that specifically modulate the nuclear transcriptional activity of β-catenin while not affecting its cytoskeletal function in stabilizing adherens junctions at the cell membrane. Here, we report an RNAi-based modifier screening strategy for the identification of CRT inhibitors. Our data provide support for the specificity of these inhibitory compounds in antagonizing the transcriptional function of nuclear β-catenin. We show that these inhibitors efficiently block Wnt/β-catenin–induced target genes and phenotypes in various mammalian and cancer cell lines. Importantly, these Wnt inhibitors are specifically cytotoxic to human colon tumor biopsy cultures as well as colon cancer cell lines that exhibit deregulated Wnt signaling. PMID:21393571
Stanislaus, Anthony; Bakhtiar, Athirah; Salleh, Diyana; Tiash, Snigdha; Fatemian, Tahereh; Hossain, Sharif; Akaike, Toshihiro; Chowdhury, Ezharul Hoque
2012-06-18
RNA interference (RNAi) is a powerful approach in functional genomics to selectively silence messenger mRNA (mRNA) expression and can be employed to rapidly develop potential novel drugs against a complex disease like cancer. However, naked siRNA being anionic is unable to cross the anionic cell membrane through passive diffusion and therefore, delivery of siRNA remains a major hurdle to overcome before the potential of siRNA technology can fully be exploited in cancer. pH-sensitive carbonate apatite has recently been developed as an efficient tool to deliver siRNA into the mammalian cells by virtue of its high affinity interaction with the siRNA and the desirable size distribution of the resulting siRNA-apatite complex for effective cellular endocytosis. Moreover, internalized siRNA was found to escape from the endosomes in a time-dependent manner and efficiently silence gene expression. Here we show that carbonate apatite-mediated delivery of siRNA against PLC-gamma-2 (PLCG2) and calmodulin 1 (CALM1) genes has led to the sensitization of a human cervical cancer cell line to doxorubicin- and paclitaxel depending on the dosage of the individual drug whereas no such enhancement in cell death was observed with cisplatin irrespective of the dosage following intracellular delivery of the siRNAs. Thus, PLCG2 and CALM1 genes are two potential targets for gene knockdown in doxorubicin and paclitaxel-based chemotherapy of cervical cancer.
Fatty acids increase neuronal hypertrophy of Pten knockdown neurons
Fricano, Catherine J.; DeSpenza, Tyrone; Frazel, Paul W.; Li, Meijie; O'Malley, A. James; Westbrook, Gary L.; Luikart, Bryan W.
2014-01-01
Phosphatase and tensin homolog (Pten) catalyzes the reverse reaction of PI3K by dephosphorylating PIP3 to PIP2. This negatively regulates downstream Akt/mTOR/S6 signaling resulting in decreased cellular growth and proliferation. Co-injection of a lentivirus knocking Pten down with a control lentivirus allows us to compare the effects of Pten knockdown between individual neurons within the same animal. We find that knockdown of Pten results in neuronal hypertrophy by 21 days post-injection. This neuronal hypertrophy is correlated with increased p-S6 and p-mTOR in individual neurons. We used this system to test whether an environmental factor that has been implicated in cellular hypertrophy could influence the severity of the Pten knockdown-induced hypertrophy. Implantation of mini-osmotic pumps delivering fatty acids results in increased neuronal hypertrophy and p-S6/p-mTOR staining. These hypertrophic effects were reversed in response to rapamycin treatment. However, we did not observe a similar increase in hypertrophy in response to dietary manipulations of fatty acids. Thus, we conclude that by driving growth signaling with fatty acids and knocking down a critical regulator of growth, Pten, we are able to observe an additive morphological phenotype of increased soma size mediated by the mTOR pathway. PMID:24795563
Kondylis, Vangelis; Tang, Yang; Fuchs, Florian; Boutros, Michael; Rabouille, Catherine
2011-01-01
Background In Drosophila, the early secretory apparatus comprises discrete paired Golgi stacks in close proximity to exit sites from the endoplasmic reticulum (tER sites), thus forming tER-Golgi units. Although many components involved in secretion have been identified, the structural components sustaining its organisation are less known. Here we set out to identify novel ER resident proteins involved in the of tER-Golgi unit organisation. Results To do so, we designed a novel screening strategy combining a bioinformatics pre-selection with an RNAi screen. We first selected 156 proteins exhibiting known or related ER retention/retrieval signals from a list of proteins predicted to have a signal sequence. We then performed a microscopy-based primary and confirmation RNAi screen in Drosophila S2 cells directly scoring the organisation of the tER-Golgi units. We identified 49 hits, most of which leading to an increased number of smaller tER-Golgi units (MG for “more and smaller Golgi”) upon depletion. 16 of them were validated and characterised, showing that this phenotype was not due to an inhibition in secretion, a block in G2, or ER stress. Interestingly, the MG phenotype was often accompanied by an increase in the cell volume. Out of 6 proteins, 4 were localised to the ER. Conclusions This work has identified novel proteins involved in the organisation of the Drosophila early secretory pathway. It contributes to the effort of assigning protein functions to gene annotation in the secretory pathway, and analysis of the MG hits revealed an enrichment of ER proteins. These results suggest a link between ER localisation, aspects of cell metabolism and tER-Golgi structural organisation. PMID:21383842
Hu, Meiying; Chen, Shaohua; Muhammad, Rizwan-ul-Haq; Dong, Xiaolin; Gong, Liang
2013-01-01
Deregulated reactive oxygen species (ROS) production can lead to the disruption of structural and functional integrity of cells as a consequence of reactive interaction between ROS and various biological components. Catalase (CAT) is a common enzyme existing in nearly all organisms exposed to oxygen, which decomposes harmful hydrogen peroxide, into water and oxygen. In this study, the full length sequence that encodes CAT-like protein from Spodoptera litura named siltCAT (GenBank accession number: JQ_663444) was cloned and characterized. Amino acid sequence alignment showed siltCAT shared relatively high conservation with other insect, especially the conserved residues which defined heme and NADPH orientation. Expression pattern analysis showed that siltCAT mRNA was mainly expressed in the fat body, midgut, cuticle and malpighian tube, and as well as over last instar larvae, pupa and adult stages. RNA interference was used to silence CAT gene in SL-1 cells and the fourth-instar stage of S. litura larvae respectively. Our results provided evidence that CAT knockdown induced ROS generation, cell cycle arrest and apoptosis in SL-1 cells. It also confirmed the decrease in survival rate because of increased ROS production in experimental groups injected with double-stranded RNA of CAT (dsCAT). This study implied that ROS scavenging by CAT is important for S. litura survival. PMID:23555693
Endogenous RNAi Pathways Are Required in Neurons for Dauer Formation in Caenorhabditis elegans.
Bharadwaj, Pallavi S; Hall, Sarah E
2017-04-01
Animals can adapt to unfavorable environments through changes in physiology or behavior. In the nematode, Caenorhabditis elegans , environmental conditions perceived early in development determine whether the animal enters either the reproductive cycle, or enters into an alternative diapause stage named dauer. Here, we show that endogenous RNAi pathways play a role in dauer formation in crowding (high pheromone), starvation, and high temperature conditions. Disruption of the Mutator proteins or the nuclear Argonaute CSR-1 result in differential dauer-deficient phenotypes that are dependent upon the experienced environmental stress. We provide evidence that the RNAi pathways function in chemosensory neurons for dauer formation, upstream of the TGF-β and insulin signaling pathways. In addition, we show that Mutator MUT-16 expression in a subset of individual pheromone-sensing neurons is sufficient for dauer formation in high pheromone conditions, but not in starvation or high temperature conditions. Furthermore, we also show that MUT-16 and CSR-1 are required for expression of a subset of G proteins with functions in the detection of pheromone components. Together, our data suggest a model where Mutator -amplified siRNAs that associate with the CSR-1 pathway promote expression of genes required for the detection and signaling of environmental conditions to regulate development and behavior in C. elegans This study highlights a mechanism whereby RNAi pathways mediate the link between environmental stress and adaptive phenotypic plasticity in animals. Copyright © 2017 by the Genetics Society of America.
He, Quan; Harris, Nicole; Ren, Jun; Han, Xianlin
2014-01-01
Tafazzin, a mitochondrial acyltransferase, plays an important role in cardiolipin side chain remodeling. Previous studies have shown that dysfunction of tafazzin reduces cardiolipin content, impairs mitochondrial function, and causes dilated cardiomyopathy in Barth syndrome. Reactive oxygen species (ROS) have been implicated in the development of cardiomyopathy and are also the obligated byproducts of mitochondria. We hypothesized that tafazzin knockdown increases ROS production from mitochondria, and a mitochondria-targeted antioxidant prevents tafazzin knockdown induced mitochondrial and cardiac dysfunction. We employed cardiac myocytes transduced with an adenovirus containing tafazzin shRNA as a model to investigate the effects of the mitochondrial antioxidant, mito-Tempo. Knocking down tafazzin decreased steady state levels of cardiolipin and increased mitochondrial ROS. Treatment of cardiac myocytes with mito-Tempo normalized tafazzin knockdown enhanced mitochondrial ROS production and cellular ATP decline. Mito-Tempo also significantly abrogated tafazzin knockdown induced cardiac hypertrophy, contractile dysfunction, and cell death. We conclude that mitochondria-targeted antioxidant prevents cardiac dysfunction induced by tafazzin gene knockdown in cardiac myocytes and suggest mito-Tempo as a potential therapeutic for Barth syndrome and other dilated cardiomyopathies resulting from mitochondrial oxidative stress. PMID:25247053
Gene therapy knockdown of VEGFR2 in retinal endothelial cells to treat retinopathy.
Simmons, Aaron B; Bretz, Colin A; Wang, Haibo; Kunz, Eric; Hajj, Kassem; Kennedy, Carson; Yang, Zhihong; Suwanmanee, Thipparat; Kafri, Tal; Hartnett, M Elizabeth
2018-05-05
Inhibition of vascular endothelial growth factor (VEGF) in retinopathy of prematurity (ROP) raises concerns for premature infants because VEGF is essential for retinovascular development as well as neuronal and glial health. This study tested the hypothesis that endothelial cell-specific knockdown of VEGF receptor 2 (VEGFR2), or downstream STAT3, would inhibit VEGF-induced retinopathy without delaying physiologic retinal vascular development. We developed an endothelial cell-specific lentiviral vector that delivered shRNAs to VEGFR2 or STAT3 and a green fluorescent protein reporter under control of the VE-cadherin promoter. The specificity and efficacy of the lentiviral vector-driven shRNAs were validated in vitro and in vivo. In the rat oxygen-induced retinopathy model highly representative of human ROP, the effects of endothelial cell knockdown of VEGFR2 or STAT3 were determined on intravitreal neovascularization (IVNV), physiologic retinal vascular development [assessed as area of peripheral avascular/total retina (AVA)], retinal structure, and retinal function. Targeted knockdown of VEGFR2 or STAT3 specifically in retinal endothelial cells by subretinal injection of lentiviral vectors into postnatal day 8 rat pup eyes efficiently inhibited IVNV, and knockdown of VEGFR2 also reduced AVA and increased retinal thickness without altering retinal function. Taken together, our results support specific knockdown of VEGFR2 in retinal endothelial cells as a novel therapeutic method to treat retinopathy.
Dcdc2 knockout mice display exacerbated developmental disruptions following knockdown of Dcx
Wang, Yu; Yin, Xiuyin; Rosen, Glenn; Gabel, Lisa; Guadiana, Sarah M.; Sarkisian, Matthew R; Galaburda, Albert M.; LoTurco, Joseph J.
2011-01-01
The dyslexia-associated gene DCDC2 is a member of the DCX family of genes known to play roles in neurogenesis, neuronal migration and differentiation. Here we report the first phenotypic analysis of a Dcdc2 knockout mouse. Comparisons between Dcdc2 knockout mice and wild type littermates revealed no significant differences in neuronal migration, neocortical lamination, neuronal cilliogenesis or dendritic differentiation. Considering previous studies showing genetic interactions and potential functional redundancy among members of the DCX family, we tested whether decreasing Dcx expression by RNAi would differentially impair neurodevelopment in Dcdc2 knockouts and wild type mice. Consistent with this hypothesis, we found that deficits in neuronal migration, and dendritic growth caused by RNAi of Dcx were more severe in Dcdc2 knockouts than in wild type mice with the same transfection. These results indicate that Dcdc2 is not required for neurogenesis, neuronal migration or differentiation in mice, but may have partial functional redundancy with Dcx. PMID:21689730
Enhanced toxic cloud knockdown spray system for decontamination applications
Betty, Rita G [Rio Rancho, NM; Tucker, Mark D [Albuquerque, NM; Brockmann, John E [Albuquerque, NM; Lucero, Daniel A [Albuquerque, NM; Levin, Bruce L [Tijeras, NM; Leonard, Jonathan [Albuquerque, NM
2011-09-06
Methods and systems for knockdown and neutralization of toxic clouds of aerosolized chemical or biological warfare (CBW) agents and toxic industrial chemicals using a non-toxic, non-corrosive aqueous decontamination formulation.
Chin, Wei-Xin; Ang, Swee Kim; Chu, Justin Jang Hann
2017-01-01
In invertebrate eukaryotes and prokaryotes, respectively, the RNAi and clustered regularly interspaced short palindromic repeats-CRISPR-associated (CRISPR-Cas) pathways are highly specific and efficient RNA and DNA interference systems, and are well characterised as potent antiviral systems. It has become possible to recruit or reconstitute these pathways in mammalian cells, where they can be directed against desired host or viral targets. The RNAi and CRISPR-Cas systems can therefore yield ideal antiviral therapeutics, capable of specific and efficient viral inhibition with minimal off-target effects, but development of such therapeutics can be slow. This review covers recent advances made towards developing RNAi or CRISPR-Cas strategies for clinical use. These studies address the delivery, toxicity or target design issues that typically plague the in vivo or clinical use of these technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Anti-tumor effect of estrogen-related receptor alpha knockdown on uterine endometrial cancer
Matsushima, Hiroshi; Mori, Taisuke; Ito, Fumitake; Yamamoto, Takuro; Akiyama, Makoto; Kokabu, Tetsuya; Yoriki, Kaori; Umemura, Shiori; Akashi, Kyoko; Kitawaki, Jo
2016-01-01
Estrogen-related receptor (ERR)α presents structural similarities with estrogen receptor (ER)α. However, it is an orphan receptor not binding to naturally occurring estrogens. This study was designed to investigate the role of ERRα in endometrial cancer progression. Immunohistochemistry analysis on 50 specimens from patients with endometrial cancer showed that ERRα was expressed in all examined tissues and the elevated expression levels of ERRα were associated with advanced clinical stages and serous histological type (p < 0.01 for each). ERRα knockdown with siRNA suppressed angiogenesis via VEGF and cell proliferation in vitro (p < 0.01). Cell cycle and apoptosis assays using flow cytometry and western blot revealed that ERRα knockdown induced cell cycle arrest during the mitotic phase followed by apoptosis initiated by caspase-3. Additionally, ERRα knockdown sensitized cells to paclitaxel. A significant reduction of tumor growth and angiogenesis was also observed in ERRα knockdown xenografts (p < 0.01). These findings indicate that ERRα may serve as a novel molecular target for the treatment of endometrial cancer. PMID:27153547
Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall
2015-06-01
4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4
Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-11-04
The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.
Wagner, Nicholas; Mroczka, Andrew; Roberts, Peter D; Schreckengost, William; Voelker, Toni
2011-09-01
Suppression of the microsomal ω6 oleate desaturase during the seed development of soybean (Glycine max) with the 420-bp soybean FAD2-1A intron as RNAi trigger shifts the conventional fatty acid composition of soybean oil from 20% oleic and 60% polyunsaturates to one containing greater than 80% oleic acid and less than 10% polyunsaturates. To determine whether RNAi could be attenuated by reducing the trigger fragment length, transgenic plants were generated to express successively shorter 5' or 3' deletion derivatives of the FAD2-1A intron. We observed a gradual reduction in transcript suppression with shorter trigger fragments. Fatty acid composition was less affected with shorter triggers, and triggers less than 60 bp had no phenotypic effect. No trigger sequences conferring significantly higher or lower suppression efficiencies were found, and the primary determinant of suppression effect was sequence length. The observed relationship of transcript suppression with the induced fatty acid phenotype indicates that RNAi is a saturation process and not a step change between suppressed and nonsuppressed states and intermediate suppression states can be achieved. © 2010 Monsanto. Plant Biotechnology Journal © 2010 Society for Experimental Biology and Blackwell Publishing Ltd.
Brain-Targeted (Pro)Renin Receptor Knockdown attenuates Angiotensin II-Dependent Hypertension
Li, Wencheng; Peng, Hua; Cao, Theresa; Sato, Ryosuke; McDaniels, Sarah. J.; Kobori, Hiroyuki; Navar, L. Gabriel; Feng, Yumei
2012-01-01
The (pro)renin receptor is a newly discovered member of the brain renin-angiotensin system. To investigate the role of brain (pro)renin receptor in hypertension, adeno-associated virus-mediated (pro)renin receptor shRNA was used to knockdown (pro)renin receptor expression in the brain of non-transgenic normotensive and human renin-angiotensinogen double transgenic hypertensive mice. Blood pressure was monitored using implanted telemetric probes in conscious animals. Real-time PCR and immunostaining were performed to determine (pro)renin receptor, angiotensin II type 1 receptor and vasopressin mRNA levels. Plasma vasopressin levels were determined by Enzyme-Linked Immuno Sorbent Assay. Double transgenic mice exhibited higher blood pressure, elevated cardiac and vascular sympathetic tone, and impaired spontaneous baroreflex sensitivity. Intracerebroventricular delivery of (pro)renin receptor shRNA significantly reduced blood pressure, cardiac and vasomotor sympathetic tone, and improved baroreflex sensitivity compared to the control virus treatment in double transgenic mice. (Pro)renin receptor knockdown significantly reduced angiotensin II type 1 receptor and vasopressin levels in double transgenic mice. These data indicate that (pro)renin receptor knockdown in the brain attenuates angiotensin II-dependent hypertension and is associated with a decrease insympathetic tone and an improvement of the baroreflex sensitivity. In addition, brain-targeted (pro)renin receptor knockdown is associated with down-regulation of angiotensin II type 1 receptor and vasopressin levels. We conclude that central (pro)renin receptor contributes to the pathogenesis of hypertension in human renin-angiotensinogen transgenic mice. PMID:22526255
Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame
2014-04-20
A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.
Matsushima, Yuichi; Adán, Cristina; Garesse, Rafael; Kaguni, Laurie S
2005-04-29
We report the cloning and molecular analysis of Drosophila mitochondrial transcription factor (d-mtTF) B1. An RNA interference (RNAi) construct was designed that reduces expression of d-mtTFB1 to 5% of its normal level in Schneider cells. In striking contrast with our previous study on d-mtTFB2, we found that RNAi knock-down of d-mtTFB1 does not change the abundance of specific mitochondrial RNA transcripts, nor does it affect the copy number of mitochondrial DNA. In a corollary manner, overexpression of d-mtTFB1 did not increase either the abundance of mitochondrial RNA transcripts or mitochondrial DNA copy number. Our data suggest that, unlike d-mtTFB2, d-mtTFB1 does not have a critical role in either transcription or regulation of the copy number of mitochondrial DNA. Instead, because we found that RNAi knockdown of d-mtTFB1 reduces mitochondrial protein synthesis, we propose that it serves its primary role in modulating translation. Our work represents the first study to document the role of mtTFB1 in vivo and establishes clearly functional differences between mtTFB1 and mtTFB2.
Vieira, Paulo; Eves-van den Akker, Sebastian; Verma, Ruchi; Wantoch, Sarah; Eisenback, Jonathan D.; Kamo, Kathryn
2015-01-01
The root lesion nematode Pratylenchus penetrans is considered one of the most economically important species within the genus. Host range studies have shown that nearly 400 plant species can be parasitized by this species. To obtain insight into the transcriptome of this migratory plant-parasitic nematode, we used Illumina mRNA sequencing analysis of a mixed population, as well as nematode reads detected in infected soybean roots 3 and 7 days after nematode infection. Over 140 million paired end reads were obtained for this species, and de novo assembly resulted in a total of 23,715 transcripts. Homology searches showed significant hit matches to 58% of the total number of transcripts using different protein and EST databases. In general, the transcriptome of P. penetrans follows common features reported for other root lesion nematode species. We also explored the efficacy of RNAi, delivered from the host, as a strategy to control P. penetrans, by targeted knock-down of selected nematode genes. Different comparisons were performed to identify putative nematode genes with a role in parasitism, resulting in the identification of transcripts with similarities to other nematode parasitism genes. Focusing on the predicted nematode secreted proteins found in this transcriptome, we observed specific members to be up-regulated at the early time points of infection. In the present study, we observed an enrichment of predicted secreted proteins along the early time points of parasitism by this species, with a significant number being pioneer candidate genes. A representative set of genes examined using RT-PCR confirms their expression during the host infection. The expression patterns of the different candidate genes raise the possibility that they might be involved in critical steps of P. penetrans parasitism. This analysis sheds light on the transcriptional changes that accompany plant infection by P. penetrans, and will aid in identifying potential gene targets for
Baranski, Thomas J; Kraja, Aldi T; Fink, Jill L; Feitosa, Mary; Lenzini, Petra A; Borecki, Ingrid B; Liu, Ching-Ti; Cupples, L Adrienne; North, Kari E; Province, Michael A
2018-04-01
Human GWAS of obesity have been successful in identifying loci associated with adiposity, but for the most part, these are non-coding SNPs whose function, or even whose gene of action, is unknown. To help identify the genes on which these human BMI loci may be operating, we conducted a high throughput screen in Drosophila melanogaster. Starting with 78 BMI loci from two recently published GWAS meta-analyses, we identified fly orthologs of all nearby genes (± 250KB). We crossed RNAi knockdown lines of each gene with flies containing tissue-specific drivers to knock down (KD) the expression of the genes only in the brain and the fat body. We then raised the flies on a control diet and compared the amount of fat/triglyceride in the tissue-specific KD group compared to the driver-only control flies. 16 of the 78 BMI GWAS loci could not be screened with this approach, as no gene in the 500-kb region had a fly ortholog. Of the remaining 62 GWAS loci testable in the fly, we found a significant fat phenotype in the KD flies for at least one gene for 26 loci (42%) even after correcting for multiple comparisons. By contrast, the rate of significant fat phenotypes in RNAi KD found in a recent genome-wide Drosophila screen (Pospisilik et al. (2010) is ~5%. More interestingly, for 10 of the 26 positive regions, we found that the nearest gene was not the one that showed a significant phenotype in the fly. Specifically, our screen suggests that for the 10 human BMI SNPs rs11057405, rs205262, rs9925964, rs9914578, rs2287019, rs11688816, rs13107325, rs7164727, rs17724992, and rs299412, the functional genes may NOT be the nearest ones (CLIP1, C6orf106, KAT8, SMG6, QPCTL, EHBP1, SLC39A8, ADPGK /ADPGK-AS1, PGPEP1, KCTD15, respectively), but instead, the specific nearby cis genes are the functional target (namely: ZCCHC8, VPS33A, RSRC2; SPDEF, NUDT3; PAGR1; SETD1, VKORC1; SGSM2, SRR; VASP, SIX5; OTX1; BANK1; ARIH1; ELL; CHST8, respectively). The study also suggests further functional
Michalko, Jaroslav; Glanc, Matouš; Perrot-Rechenmann, Catherine; Friml, Jiří
2016-01-01
The Auxin Binding Protein 1 (ABP1) is one of the most studied proteins in plants. Since decades ago, it has been the prime receptor candidate for the plant hormone auxin with a plethora of described functions in auxin signaling and development. The developmental importance of ABP1 has recently been questioned by identification of Arabidopsis thaliana abp1 knock-out alleles that show no obvious phenotypes under normal growth conditions. In this study, we examined the contradiction between the normal growth and development of the abp1 knock-outs and the strong morphological defects observed in three different ethanol-inducible abp1 knock-down mutants ( abp1-AS, SS12K, SS12S). By analyzing segregating populations of abp1 knock-out vs. abp1 knock-down crosses we show that the strong morphological defects that were believed to be the result of conditional down-regulation of ABP1 can be reproduced also in the absence of the functional ABP1 protein. This data suggests that the phenotypes in abp1 knock-down lines are due to the off-target effects and asks for further reflections on the biological function of ABP1 or alternative explanations for the missing phenotypic defects in the abp1 loss-of-function alleles.
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-09-03
Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management.
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-01-01
Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management. PMID:26333918
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi
Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.
2015-01-01
SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455
Role of LRV1 and RNAi in the Pathogenesis of Leishmania.
Patterson, Jean L
2017-02-01
The recent paper by Brettmann et al. provides insight as to how an RNA virus can persistently coexist in a protozoan with RNAi activity and how these two entities work to maintain balance. The authors were also able to successfully remove the virus and examine the role of the virus in parasitemia and the pathogenesis of leishmaniasis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Nonionic surfactant vesicles for delivery of RNAi therapeutics
Paecharoenchai, Orapan; Teng, Lesheng; Yung, Bryant C; Teng, Lirong; Opanasopit, Praneet; Lee, Robert J
2014-01-01
RNAi is a promising potential therapeutic approach for many diseases. A major barrier to its clinical translation is the lack of efficient delivery systems for siRNA. Among nonviral vectors, nonionic surfactant vesicles (niosomes) have shown a great deal of promise in terms of their efficacy and toxicity profiles. Nonionic surfactants have been shown to be a superior alternative to phospholipids in several studies. There is a large selection of surfactants with various properties that have been incorporated into niosomes. Therefore, there is great potential for innovation in terms of nisome composition. This article summarizes recent advancements in niosome technology for the delivery of siRNA. PMID:24156490
Pompey, Justine M; Foda, Bardees; Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
Montes-Cobos, Elena; Li, Xiao; Fischer, Henrike J; Sasse, André; Kügler, Sebastian; Didié, Michael; Toischer, Karl; Fassnacht, Martin; Dressel, Ralf; Reichardt, Holger M
2015-01-01
Mineralocorticoid receptor (MR) inactivation in mice results in early postnatal lethality. Therefore we generated mice in which MR expression can be silenced during adulthood by administration of doxycycline (Dox). Using a lentiviral approach, we obtained two lines of transgenic mice harboring a construct that allows for regulatable MR inactivation by RNAi and concomitant expression of eGFP. MR mRNA levels in heart and kidney of inducible MR knock-down mice were unaltered in the absence of Dox, confirming the tightness of the system. In contrast, two weeks after Dox administration MR expression was significantly diminished in a variety of tissues. In the kidney, this resulted in lower mRNA levels of selected target genes, which was accompanied by strongly increased serum aldosterone and plasma renin levels as well as by elevated sodium excretion. In the healthy heart, gene expression and the amount of collagen were unchanged despite MR levels being significantly reduced. After transverse aortic constriction, however, cardiac hypertrophy and progressive heart failure were attenuated by MR silencing, fibrosis was unaffected and mRNA levels of a subset of genes reduced. Taken together, we believe that this mouse model is a useful tool to investigate the role of the MR in pathophysiological processes.
Calo, Silvia; Nicolás, Francisco E; Lee, Soo Chan; Vila, Ana; Cervantes, Maria; Torres-Martinez, Santiago; Ruiz-Vazquez, Rosa M; Cardenas, Maria E; Heitman, Joseph
2017-03-01
Mucorales are a group of basal fungi that includes the casual agents of the human emerging disease mucormycosis. Recent studies revealed that these pathogens activate an RNAi-based pathway to rapidly generate drug-resistant epimutant strains when exposed to stressful compounds such as the antifungal drug FK506. To elucidate the molecular mechanism of this epimutation pathway, we performed a genetic analysis in Mucor circinelloides that revealed an inhibitory role for the non-canonical RdRP-dependent Dicer-independent silencing pathway, which is an RNAi-based mechanism involved in mRNA degradation that was recently identified. Thus, mutations that specifically block the mRNA degradation pathway, such as those in the genes r3b2 and rdrp3, enhance the production of drug resistant epimutants, similar to the phenotype previously described for mutation of the gene rdrp1. Our genetic analysis also revealed two new specific components of the epimutation pathway related to the quelling induced protein (qip) and a Sad-3-like helicase (rnhA), as mutations in these genes prevented formation of drug-resistant epimutants. Remarkably, drug-resistant epimutant production was notably increased in M. circinelloides f. circinelloides isolates from humans or other animal hosts. The host-pathogen interaction could be a stressful environment in which the phenotypic plasticity provided by the epimutant pathway might provide an advantage for these strains. These results evoke a model whereby balanced regulation of two different RNAi pathways is determined by the activation of the RNAi-dependent epimutant pathway under stress conditions, or its repression when the regular maintenance of the mRNA degradation pathway operates under non-stress conditions.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Jannot, Guillaume; Boisvert, Marie-Eve L; Banville, Isabelle H; Simard, Martin J
2008-05-01
In Caenorhabditis elegans, specific Argonaute proteins are dedicated to the RNAi and microRNA pathways. To uncover how the precise Argonaute selection occurs, we designed dsRNA triggers containing both miRNA and siRNA sequences. While dsRNA carrying nucleotides mismatches can only enter the miRNA pathway, a fully complementary dsRNA successfully rescues let-7 miRNA function and initiates silencing by RNAi. We demonstrated that RDE-1 is essential for RNAi induced by the perfectly paired trigger, yet is not required for silencing by the let-7 miRNA. In contrast, ALG-1/ALG-2 are required for the miRNA function, but not for the siRNA-directed gene silencing. Finally, a dsRNA containing a bulged miRNA and a perfectly paired siRNA can enter both pathways suggesting that the sorting of small RNAs occurs after that the dsRNA trigger has been processed by Dicer. Thus, our data suggest that the selection of Argonaute proteins is affected by two molecular features: (1) the structure of the small RNA duplex; and (2) the Argonautes specific characteristics.
Withaferin A inhibits in vivo growth of breast cancer cells accelerated by Notch2 knockdown.
Kim, Su-Hyeong; Hahm, Eun-Ryeong; Arlotti, Julie A; Samanta, Suman K; Moura, Michelle B; Thorne, Stephen H; Shuai, Yongli; Anderson, Carolyn J; White, Alexander G; Lokshin, Anna; Lee, Joomin; Singh, Shivendra V
2016-05-01
The present study offers novel insights into the molecular circuitry of accelerated in vivo tumor growth by Notch2 knockdown in triple-negative breast cancer (TNBC) cells. Therapeutic vulnerability of Notch2-altered growth to a small molecule (withaferin A, WA) is also demonstrated. MDA-MB-231 and SUM159 cells were used for the xenograft studies. A variety of technologies were deployed to elucidate the mechanisms underlying tumor growth augmentation by Notch2 knockdown and its reversal by WA, including Fluorescence Molecular Tomography for measurement of tumor angiogenesis in live mice, Seahorse Flux analyzer for ex vivo measurement of tumor metabolism, proteomics, and Luminex-based cytokine profiling. Stable knockdown of Notch2 resulted in accelerated in vivo tumor growth in both cells reflected by tumor volume and/or latency. For example, the wet tumor weight from mice bearing Notch2 knockdown MDA-MB-231 cells was about 7.1-fold higher compared with control (P < 0.0001). Accelerated tumor growth by Notch2 knockdown was highly sensitive to inhibition by a promising steroidal lactone (WA) derived from a medicinal plant. Molecular underpinnings for tumor growth intensification by Notch2 knockdown included compensatory increase in Notch1 activation, increased cellular proliferation and/or angiogenesis, and increased plasma or tumor levels of growth stimulatory cytokines. WA administration reversed many of these effects providing explanation for its remarkable anti-cancer efficacy. Notch2 functions as a tumor growth suppressor in TNBC and WA offers a novel therapeutic strategy for restoring this function.
Roles for the VCP co-factors Npl4 and Ufd1 in neuronal function in Drosophila melanogaster.
Byrne, Dwayne J; Harmon, Mark J; Simpson, Jeremy C; Blackstone, Craig; O'Sullivan, Niamh C
2017-10-20
The VCP-Ufd1-Npl4 complex regulates proteasomal processing within cells by delivering ubiquitinated proteins to the proteasome for degradation. Mutations in VCP are associated with two neurodegenerative diseases, amyotrophic lateral sclerosis (ALS) and inclusion body myopathy with Paget's disease of the bone and frontotemporal dementia (IBMPFD), and extensive study has revealed crucial functions of VCP within neurons. By contrast, little is known about the functions of Npl4 or Ufd1 in vivo. Using neuronal-specific knockdown of Npl4 or Ufd1 in Drosophila melanogaster, we infer that Npl4 contributes to microtubule organization within developing motor neurons. Moreover, Npl4 RNAi flies present with neurodegenerative phenotypes including progressive locomotor deficits, reduced lifespan and increased accumulation of TAR DNA-binding protein-43 homolog (TBPH). Knockdown, but not overexpression, of TBPH also exacerbates Npl4 RNAi-associated adult-onset neurodegenerative phenotypes. In contrast, we find that neuronal knockdown of Ufd1 has little effect on neuromuscular junction (NMJ) organization, TBPH accumulation or adult behaviour. These findings suggest the differing neuronal functions of Npl4 and Ufd1 in vivo. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Effects of Shell-Buckling Knockdown Factors in Large Cylindrical Shells
NASA Technical Reports Server (NTRS)
Hrinda, Glenn A.
2012-01-01
Shell-buckling knockdown factors (SBKF) have been used in large cylindrical shell structures to account for uncertainty in buckling loads. As the diameter of the cylinder increases, achieving the manufacturing tolerances becomes increasingly more difficult. Knockdown factors account for manufacturing imperfections in the shell geometry by decreasing the allowable buckling load of the cylinder. In this paper, large-diameter (33 ft) cylinders are investigated by using various SBKF's. An investigation that is based on finite-element analysis (FEA) is used to develop design sensitivity relationships. Different manufacturing imperfections are modeled into a perfect cylinder to investigate the effects of these imperfections on buckling. The analysis results may be applicable to large- diameter rockets, cylindrical tower structures, bulk storage tanks, and silos.
Knockdown of miR-210 decreases hypoxic glioma stem cells stemness and radioresistance.
Yang, Wei; Wei, Jing; Guo, Tiantian; Shen, Yueming; Liu, Fenju
2014-08-01
Glioma contains abundant hypoxic regions which provide niches to promote the maintenance and expansion of glioma stem cells (GSCs), which are resistant to conventional therapies and responsible for recurrence. Given the fact that miR-210 plays a vital role in cellular adaption to hypoxia and in stem cell survival and stemness maintenance, strategies correcting the aberrantly expressed miR-210 might open up a new therapeutic avenue to hypoxia GSCs. In the present study, to explore the possibility of miR-210 as an effective therapeutic target to hypoxic GSCs, we employed a lentiviral-mediated anti-sense miR-210 gene transfer technique to knockdown miR-210 expression and analyze phenotypic changes in hypoxic U87s and SHG44s cells. We found that hypoxia led to an increased HIF-2α mRNA expression and miR-210 expression in GSCs. Knockdown of miR-210 decreased neurosphere formation capacity, stem cell marker expression and cell viability, and induced differentiation and G0/G1 arrest in hypoxic GSCs by partially rescued Myc antagonist (MNT) protein expression. Knockdown of MNT could reverse the gene expression changes and the growth inhibition resulting from knockdown of miR-210 in hypoxic GSCs. Moreover, knockdown of miR-210 led to increased apoptotic rate and Caspase-3/7 activity and decreased invasive capacity, reactive oxygen species (ROS) and lactate production and radioresistance in hypoxic GSCs. These findings suggest that miR-210 might be a potential therapeutic target to eliminate GSCs located in hypoxic niches. Copyright © 2014 Elsevier Inc. All rights reserved.
Knockdown of HDAC1 expression suppresses invasion and induces apoptosis in glioma cells.
Wang, Xiao-Qiang; Bai, Hong-Min; Li, Shi-Ting; Sun, Hui; Min, Ling-Zhao; Tao, Bang-Bao; Zhong, Jun; Li, Bin
2017-07-18
Glioma is the most common malignant tumor of the central nervous system, with a low survival rate of five years worldwide. Although high expression and prognostic value of histone deacetylase 1 (HDAC1) have been recently reported in various types of human tumors, the molecular mechanism underlying the biological function of HDAC1 in glioma is still unclear. We found that HDAC1 was elevated in glioma tissues and cell lines. HDAC1 expression was closely related with pathological grade and overall survival of patients with gliomas. Downregulation of HDAC1 inhibited cell proliferation, prevented invasion of glioma cell lines, and induced cell apoptosis. The expression of apoptosis and metastasis related molecules were detected by RT-PCR and Western blot, respectively, in U251 and T98G cells with HDAC1 knockdown. We found that HDAC1 knockdown upregulated expression of BIM, BAX, cleaved CASPASE3 and E-CADHERIN, and decreased expression of TWIST1, SNAIL and MMP9 in U251 and T98G cells with HDAC1 knockdown. In vivo data showed that knockdown of HDAC1 inhibited tumor growth in nude mice. In summary, HDAC1 may therefore be considered an unfavorable progression indicator for glioma patients, and may also serve as a potential therapeutic target.
Camuglia, Jaclyn M; Mandigo, Torrey R; Moschella, Richard; Mark, Jenna; Hudson, Christine H; Sheen, Derek; Folker, Eric S
2018-04-06
A strength of Drosophila as a model system is its utility as a tool to screen for novel regulators of various functional and developmental processes. However, the utility of Drosophila as a screening tool is dependent on the speed and simplicity of the assay used. Here, we use larval locomotion as an assay to identify novel regulators of skeletal muscle function. We combined this assay with muscle-specific depletion of 82 genes to identify genes that impact muscle function by their expression in muscle cells. The data from the screen were supported with characterization of the muscle pattern in embryos and larvae that had disrupted expression of the strongest hit from the screen. With this assay, we showed that 12/82 tested genes regulate muscle function. Intriguingly, the disruption of five genes caused an increase in muscle function, illustrating that mechanisms that reduce muscle function exist and that the larval locomotion assay is sufficiently quantitative to identify conditions that both increase and decrease muscle function. We extended the data from this screen and tested the mechanism by which the strongest hit, fascin, impacted muscle function. Compared to controls, animals in which fascin expression was disrupted with either a mutant allele or muscle-specific expression of RNAi had fewer muscles, smaller muscles, muscles with fewer nuclei, and muscles with disrupted myotendinous junctions. However, expression of RNAi against fascin only after the muscle had finished embryonic development did not recapitulate any of these phenotypes. These data suggest that muscle function is reduced due to impaired myoblast fusion, muscle growth, and muscle attachment. Together, these data demonstrate the utility of Drosophila larval locomotion as an assay for the identification of novel regulators of muscle development and implicate fascin as necessary for embryonic muscle development.
Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C
2002-06-28
Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L
2018-02-01
Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.
Suppressing tawny crazy ant (Nylanderia fulva) by RNAi technology.
Meng, Jia; Lei, Jiaxin; Davitt, Andrew; Holt, Jocelyn R; Huang, Jian; Gold, Roger; Vargo, Edward L; Tarone, Aaron M; Zhu-Salzman, Keyan
2018-05-22
The tawny crazy ant (Nylanderia fulva) is a new invasive pest in the United States. At present, its management mainly relies on the use of synthetic insecticides, which are generally ineffective at producing lasting control of the pest, necessitating alternative environmentally friendly measures. In this study, we evaluated the feasibility of gene silencing to control this ant species. Six housekeeping genes encoding actin (NfActin), coatomer subunit β (NfCOPβ), arginine kinase (NfArgK), and V-type proton ATPase subunits A (NfvATPaseA), B (NfvATPaseB) and E (NfvATPaseE) were cloned. Phylogenetic analysis revealed high sequence similarity to homologs from other ant species, particularly the Florida carpenter ant (Camponotus floridanus). To silence these genes, vector L4440 was used to generate 6 specific RNAi constructs for bacterial expression. Heat-inactivated, dsRNA-expressing Escherichia coli were incorporated into artificial diet. Worker ants exhibited reduced endogenous gene expression after feeding on such diet for 9 days. However, only ingestion of dsRNAs of NfCOPβ (a gene involved in protein trafficking) and NfArgK (a cellular energy reserve regulatory gene in invertebrates) caused modest but significantly higher ant mortality than the control. These results suggest that bacterially expressed dsRNA can be orally delivered to ant cells as a mean to target its vulnerabilities. Improved efficacy is necessary for the RNAi-based approach to be useful in tawny crazy ant management. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Tchurikov, Nickolai A; Fedoseeva, Daria M; Gashnikova, Natalya M; Sosin, Dmitri V; Gorbacheva, Maria A; Alembekov, Ildar R; Chechetkin, Vladimir R; Kravatsky, Yuri V; Kretova, Olga V
2016-05-25
Highly active antiretroviral therapy has greatly reduced the morbidity and mortality of AIDS. However, many of the antiretroviral drugs are toxic with long-term use, and all currently used anti-HIV agents generate drug-resistant mutants. Therefore, there is a great need for new approaches to AIDS therapy. RNAi is a powerful means of inhibiting HIV-1 production in human cells. We propose to use RNAi for gene therapy of HIV/AIDS. Previously we identified a number of new biologically active siRNAs targeting several moderately conserved regions in HIV-1 transcripts. Here we analyze the heterogeneity of nucleotide sequences in three RNAi targets in sequences encoding the reverse transcriptase and integrase domains of current isolates of HIV-1 subtype A in Russia. These data were used to generate genetic constructs expressing short hairpin RNAs 28-30-bp in length that could be processed in cells into siRNAs. After transfection of the constructs we observed siRNAs that efficiently attacked the selected targets. We expect that targeting several viral genes important for HIV-1 reproduction will help overcome the problem of viral adaptation and will prevent the appearance of RNAi escape mutants in current virus strains, an important feature of gene therapy of HIV/AIDS. Copyright © 2016 Elsevier B.V. All rights reserved.
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
RNAi pathways in Mucor: A tale of proteins, small RNAs and functional diversity.
Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M
2016-05-01
The existence of an RNA-mediated silencing mechanism in the opportunistic fungal pathogen Mucor circinelloides was first described in the early 2000. Since then, Mucor has reached an outstanding position within the fungal kingdom as a model system to achieve a deeper understanding of regulation of endogenous functions by the RNA interference (RNAi) machinery. M. circinelloides combines diverse components of its RNAi machinery to carry out functions not only limited to the defense against invasive nucleic acids, but also to regulate expression of its own genes by producing different classes of endogenous small RNA molecules (esRNAs). The recent discovery of a novel RNase that participates in a new RNA degradation pathway adds more elements to the gene silencing-mediated regulation. This review focuses on esRNAs in M. circinelloides, the different pathways involved in their biogenesis, and their roles in regulating specific physiological and developmental processes in response to environmental signals, highlighting the complexity of silencing-mediated regulation in fungi. Copyright © 2015 Elsevier Inc. All rights reserved.
Castanotto, Daniela; Sakurai, Kumi; Lingeman, Robert; Li, Haitang; Shively, Louise; Aagaard, Lars; Soifer, Harris; Gatignol, Anne; Riggs, Arthur; Rossi, John J.
2007-01-01
Despite the great potential of RNAi, ectopic expression of shRNA or siRNAs holds the inherent risk of competition for critical RNAi components, thus altering the regulatory functions of some cellular microRNAs. In addition, specific siRNA sequences can potentially hinder incorporation of other siRNAs when used in a combinatorial approach. We show that both synthetic siRNAs and expressed shRNAs compete against each other and with the endogenous microRNAs for transport and for incorporation into the RNA induced silencing complex (RISC). The same siRNA sequences do not display competition when expressed from a microRNA backbone. We also show that TAR RNA binding protein (TRBP) is one of the sensors for selection and incorporation of the guide sequence of interfering RNAs. These findings reveal that combinatorial siRNA approaches can be problematic and have important implications for the methodology of expression and use of therapeutic interfering RNAs. PMID:17660190
Poerschke, Robyn L.; Moos, Philip J.
2010-01-01
Thioredoxin reductase (TR1) is a selenoprotein that is involved in cellular redox status control and deoxyribonucleotide biosynthesis. Many cancers, including lung, overexpress TR1, making it a potential cancer therapy target. Previous work has shown that TR1 knockdown enhances the sensitivity of cancer cells to anticancer treatments, as well as certain selenocompounds. However, it is unknown if TR1 knockdown produces similar effect on the sensitivity of human lung cancer cells. To further elucidate the role of TR1 in the mechanism of selenocompounds in lung cancer, a lentiviral microRNA delivery system to knockdown TR1 expression in A549 human lung adenocarcinoma cells was utilized. Cell viability was assessed after 48 hr treatment with the selenocysteine prodrug selenazolidines 2-butylselenazolidine-4(R)-carboxylic acid (BSCA) and 2-cyclohexylselenazolidine-4-(R)-carboxylic acid (ChSCA), selenocystine (SECY), methylseleninic acid (MSA), 1,4-phenylenebis(methylene)selenocyanate (p-XSC), and selenomethionine (SEM). TR1 knockdown increased the cytotoxicity of BSCA, ChSCA, and SECY but did not sensitize cells to MSA, SEM, or p-XSC. GSH and TR1 depletion together decreased cell viability, while no change was observed with GSH depletion alone. Reactive oxygen species generation was induced only in TR1 knockdown cells treated with the selenazolidines or SECY. These three compounds also decreased total intracellular glutathione levels and oxidized thioredoxin, but in a TR1 independent manner. TR1 knockdown increased selenazolidine and SECY-induced mitochondrial membrane depolarization, as well as DNA strand breaks and AIF translocation from the mitochondria. These results indicate the ability of TR1 to modulate the cytotoxic effects of BSCA, ChSCA and SECY in human lung cancer cells through mitochondrial dysfunction. PMID:20920480
The flipflop orphan genes are required for limb bud eversion in the Tribolium embryo.
Thümecke, Susanne; Beermann, Anke; Klingler, Martin; Schröder, Reinhard
2017-01-01
Unlike Drosophila but similar to other arthropod and vertebrate embryos, the flour beetle Tribolium castaneum develops everted limb buds during embryogenesis. However, the molecular processes directing the evagination of epithelia are only poorly understood. Here we show that the newly discovered genes Tc-flipflop1 and Tc-flipflop2 are involved in regulating the directional budding of appendages. RNAi-knockdown of Tc-flipflop results in a variety of phenotypic traits. Most prominently, embryonic limb buds frequently grow inwards rather than out, leading to the development of inverted appendages inside the larval body. Moreover, affected embryos display dorsal closure defects. The Tc-flipflop genes are evolutionarily non-conserved, and their molecular function is not evident. We further found that Tc-RhoGEF2 , a highly-conserved gene known to be involved in actomyosin-dependent cell movement and cell shape changes, shows a Tc-flipflop -like RNAi-phenotype. The similarity of the inverted appendage phenotype in both the flipflop - and the RhoGEF2 RNAi gene knockdown led us to conclude that the Tc-flipflop orphan genes act in a Rho-dependent pathway that is essential for the early morphogenesis of polarised epithelial movements. Our work describes one of the few examples of an orphan gene playing a crucial role in an important developmental process.
Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.
2016-01-01
Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a
Identification and functional characterization of the TAB2 gene from Litopenaeus vannamei.
Wang, Sheng; Li, Haoyang; Qian, Zhe; Song, Xuan; Zhang, Zijian; Zuo, Hongliang; Xu, Xiaopeng; Weng, Shaoping; He, Jianguo; Li, Chaozheng
2015-10-01
In Drosophila, TAB2, an important intermediate in the IMD signaling pathway, plays critical roles in the innate immune response in response to bacterial and viral infection. However, the role of TAB-related proteins in the immune response of shrimp has not yet been established. Here, we reported the identification of a TAB2-like gene in Litopenaeus vannamei designated as LvTAB2. The full-length cDNA of LvTAB2 was 2160 bp with an open reading frame of 1827 bp, which encoded a putative protein of 608 amino acids including a ubiquitin binding domain (CUE) at the N-terminal and a Zinc Finger domain (ZnF) at the C-terminus. Real-time RT-PCR analysis showed that LvTAB2 was expressed in all tested tissues and the expression levels of LvTAB2 in gills and hemocytes were positively induced in response to LPS, Vibrio parahemolyticus and White Spot Syndrome Virus (WSSV) challenges. Dual luciferase reporter assays demonstrated that LvTAB2 was able to induce the expression of antimicrobial peptide (AMP) genes, including Drosophila Attacin A and shrimp Penaeidins. Interestingly, over-expression of LvTAB2 could up-regulate the promoter activities of L. vannamei Vago1, Vago3 and Vago4 genes in S2 cells. To our knowledge, it was the first report that TAB2 participated in innate immune signaling to regulate the expression of Vago genes in invertebrates. Moreover, RNAi-mediated knockdown of LvTAB2 enhanced sensitivity of L. vannamei to Vibrio parahaemolyticus infection and caused elevated virus loads after WSSV infection. We suggested that the LvTAB2 may play important roles in the shrimp innate immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jung, Je Hyeong; Kannan, Baskaran; Dermawan, Hugo; Moxley, Geoffrey W; Altpeter, Fredy
2016-11-01
Sugarcane (Saccharum spp. hybrids) is a major feedstock for commercial bioethanol production. The recent integration of conversion technologies that utilize lignocellulosic sugarcane residues as well as sucrose from stem internodes has elevated bioethanol yields. RNAi suppression of lignin biosynthetic enzymes is a successful strategy to improve the saccharification of lignocellulosic biomass. 4-coumarate:coenzyme A ligase (4CL) is a key enzyme in the biosynthesis of phenylpropanoid metabolites, such as lignin and flavonoids. Identifying a major 4CL involved in lignin biosynthesis among multiple isoforms with functional divergence is key to manipulate lignin biosynthesis. In this study, two full length 4CL genes (Sh4CL1 and Sh4CL2) were isolated and characterized in sugarcane. Phylogenetic, expression and RNA interference (RNAi) analysis confirmed that Sh4CL1 is a major lignin biosynthetic gene. An intragenic precision breeding strategy may facilitate the regulatory approval of the genetically improved events and was used for RNAi suppression of Sh4CL1. Both, the RNAi inducing cassette and the expression cassette for the mutated ALS selection marker consisted entirely of DNA sequences from sugarcane or the sexually compatible species Sorghum bicolor. Field grown sugarcane with intragenic RNAi suppression of Sh4CL1 resulted in reduction of the total lignin content by up to 16.5 % along with altered monolignol ratios without reduction in biomass yield. Mature, field grown, intragenic sugarcane events displayed 52-76 % improved saccharification efficiency of lignocellulosic biomass compared to wild type (WT) controls. This demonstrates for the first time that an intragenic approach can add significant value to lignocellulosic feedstocks for biofuel and biochemical production.
Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei
2018-01-01
Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog ( Ihh ) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes.
USDA-ARS?s Scientific Manuscript database
Modern molecular biological techniques allow for the design of molecules of ribonucleic acid capable of disrupting key biological processes of pests and diseases. A major requirement for the practical application of ribonucleic acid interference (RNAi) against insect pests is an efficient entry path...
Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes
Kim, Kevin; Lee, Young Sik; Carthew, Richard W.
2007-01-01
In the Drosophila RNA interference (RNAi) pathway, small interfering RNAs (siRNAs) direct Argonaute2 (Ago2), an endonuclease, within the RNA-induced silencing complex (RISC) to cleave complementary mRNA targets. In vitro studies have shown that, for each siRNA duplex, RISC retains only one strand, the guide, and releases the other, the passenger, to form a holo-RISC complex. Here, we have isolated a new Ago2 mutant allele and provide, for the first time, in vivo evidence that endogenous Ago2 slicer activity is important to mount an RNAi response in Drosophila. We demonstrate in vivo that efficient removal of the passenger strand from RISC requires the cleavage activity of Ago2. We have also identified a new intermediate complex in the RISC assembly pathway, pre-RISC, in which Ago2 is stably bound to double-stranded siRNA. PMID:17123955
MacDonald, Michael J.; Brown, Laura J.; Longacre, Melissa J.; Stoker, Scott W.; Kendrick, Mindy A.; Hasan, Noaman M.
2013-01-01
Background There are three isocitrate dehydrogenases (IDHs) in the pancreatic insulin cell; IDH1 (cytosolic) and IDH2 (mitochondrial) use NADP(H). IDH3 is mitochondrial, uses NAD(H) and was believed to be the IDH that supports the citric acid cycle. Methods With shRNAs targeting mRNAs for these enzymes we generated cell lines from INS-1 832/13 cells with severe (80%–90%) knockdown of the mitochondrial IDHs separately and together in the same cell line. Results With knockdown of both mitochondrial IDH’s mRNA, enzyme activity and protein level, but not with knockdown of one mitochondrial IDH, glucose- and BCH (an allosteric activator of glutamate dehydrogenase)-plus-glutamine-stimulated insulin release were inhibited. Cellular levels of citrate, α-ketoglutarate, malate and ATP were altered in patterns consistent with blockage at the mitochondrial IDH reactions. We were able to generate only 50% knockdown of Idh1 mRNA in multiple cell lines (without inhibition of insulin release) possibly because greater knockdown of IDH1 was not compatible with cell line survival. Conclusions The mitochondrial IDHs are redundant for insulin secretion. When both enzymes are severely knocked down, their low activities (possibly assisted by transport of IDH products and other metabolic intermediates from the cytosol into mitochondria) are sufficient for cell growth, but inadequate for insulin secretion when the requirement for intermediates is certainly more rapid. The results also indicate that IDH2 can support the citric acid cycle. General Significance As almost all mammalian cells possess substantial amounts of all three IDH enzymes, the biological principles suggested by these results are probably extrapolatable to many tissues. PMID:23876293
Hou, Qiu-Li; Chen, Er-Hu; Jiang, Hong-Bo; Wei, Dan-Dan; Gui, Shun-Hua; Wang, Jin-Jun; Smagghe, Guy
2017-11-01
Energy homeostasis requires continuous compensation for fluctuations in energy expenditure and availability of food resources. In insects, energy mobilization is under control of the adipokinetic hormone (AKH) where it is regulating the nutritional status by supporting the mobilization of lipids. In this study, we characterized the gene coding for the AKH receptor (AKHR) and investigated its function in the oriental fruit fly (Bactrocera dorsalis) that is economically one of the most important pest insects of tropical and subtropical fruit. Bacdo-AKHR is a typical G protein-coupled receptor (GPCR) and phylogenetic analysis confirmed that Bacdo-AKHR is closely related to insect AKHRs from other species. When expressed in Chinese hamster ovary (CHO) cells, Bacdo-AKHR exhibited a high sensitivity and selectivity for AKH peptide (EC 50 = 19.3 nM). Using qPCR, the developmental stage and tissue-specific expression profiles demonstrated that Bacdo-AKHR was highly expressed in both the larval and adult stages, and also specifically in the fat body and midgut of the adult with no difference in sex. To investigate the role of AKHR in B. dorsalis, RNAi assays were performed with dsRNA against Bacdo-AKHR in adult flies of both sexes and under starvation and feeding condition. As major results, the knockdown of this gene resulted in triacylglycerol (TAG) accumulation. With RNAi-males, we observed a severe decrease in their sexual courtship activity when starved, but there was a partial rescue in copulation when refed. Also in RNAi-males, the tethered-flight duration declined compared with the control group when starved, which is confirming the dependency on energy metabolism. In RNAi-females, the sexual behavior was not affected, but their fecundity was decreased. Our findings indicate an interesting role of AKHR in the sexual behavior of males specifically. The effects are associated with TAG accumulation, and we also reported that the conserved role of AKH
Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei
2018-03-01
Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.
Alaaeldin, Eman; Abu Lila, Amr S; Ando, Hidenori; Fukushima, Masakazu; Huang, Cheng-Long; Wada, Hiromi; Sarhan, Hatem A; Khaled, Khaled A; Ishida, Tatsuhiro
2017-06-10
Many therapeutic strategies have been applied in efforts to conquer the development and/or progression of cancer. The combination of chemotherapy and an RNAi-based approach has proven to be an efficient anticancer therapy. However, the feasibility of such a therapeutic strategy has been substantially restricted either by the failure to achieve the efficient delivery of RNAi molecules to tumor tissue or by the immunostimulatory response triggered by RNAi molecules. In this study, therefore, we intended to investigate the efficacy of using liposomal oxaliplatin (liposomal l-OHP) to guarantee the efficient delivery of RNAi molecules, namely shRNA against thymidylate synthase (TS shRNA) complexed with cationic liposome (TS shRNA-lipoplex), to solid tumors, and to suppress the immunostimulatory effect of RNAi molecules, TS shRNA, following intravenous administration. Herein, we describe how liposomal l-OHP enhanced the intra-tumor accumulation of TS shRNA-lipoplex and significantly reduced the immunostimulatory response triggered by TS shRNA. Consequently, such enhanced accumulation of TS shRNA-lipoplex along with the cytotoxic effect of liposomal l-OHP led to a remarkable tumor growth suppression (compared to mono-therapy) following systemic administration. Our results, therefore, may have important implications for the provision of a safer and more applicable combination therapy of RNAi molecules and anti-cancer agents that can produce a more reliable anti-tumor effect. Copyright © 2017 Elsevier B.V. All rights reserved.
Andralojc, Karolina M.; Kelly, Ashley L.; Tanner, Paige C.
2017-01-01
Germ cells contain non-membrane bound cytoplasmic organelles that help maintain germline integrity. In C. elegans they are called P granules; without them, the germline undergoes partial masculinization and aberrant differentiation. One key P-granule component is the Argonaute CSR-1, a small-RNA binding protein that antagonizes accumulation of sperm-specific transcripts in developing oocytes and fine-tunes expression of proteins critical to early embryogenesis. Loss of CSR-1 complex components results in a very specific, enlarged P-granule phenotype. In a forward screen to identify mutants with abnormal P granules, ten alleles were recovered with a csr-1 P-granule phenotype, eight of which contain mutations in known components of the CSR-1 complex (csr-1, ego-1, ekl-1, and drh-3). The remaining two alleles are in a novel gene now called elli-1 (enlarged germline granules). ELLI-1 is first expressed in primordial germ cells during mid-embryogenesis, and continues to be expressed in the adult germline. While ELLI-1 forms cytoplasmic aggregates, they occasionally dock, but do not co-localize with P granules. Instead, the majority of ELLI-1 aggregates accumulate in the shared germline cytoplasm. In elli-1 mutants, several genes that promote RNAi and P-granule accumulation are upregulated, and embryonic lethality, sterility, and RNAi resistance in a hypomorphic drh-3 allele is enhanced, suggesting that ELLI-1 functions with CSR-1 to modulate RNAi activity, P-granule accumulation, and post-transcriptional expression in the germline. PMID:28182654
The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans
Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P.; Mak, Ho Yi
2014-01-01
Summary RNA interference (RNAi) is a potent mechanism for down-regulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi and other eukaryotes [1–3]. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary siRNAs [4–6]. Exogenous double stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis [7, 8]. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear if the sub-cellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively [9–11]. We report that RDE-12, a conserved FG domain containing DEAD-box helicase, localizes in P-granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA targeted mRNA in distinct cytoplasmic compartments. PMID:24684930
The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans.
Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P; Mak, Ho Yi
2014-04-14
RNAi is a potent mechanism for downregulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi, and other eukaryotes. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary small interfering RNAs (siRNAs). Exogenous double-stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA-dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear whether the subcellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively. We report that RDE-12, a conserved phenylalanine-glycine (FG) domain-containing DEAD box helicase, localizes in P granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA-targeted mRNA in distinct cytoplasmic compartments. Copyright © 2014 Elsevier Ltd. All rights reserved.
Barad, Shiri; Sela, Noa; Dubey, Amit K; Kumar, Dilip; Luria, Neta; Ment, Dana; Cohen, Shahar; Schaffer, Arthur A; Prusky, Dov
2017-08-04
The destructive phytopathogen Colletotrichum gloeosporioides causes anthracnose disease in fruit. During host colonization, it secretes ammonia, which modulates environmental pH and regulates gene expression, contributing to pathogenicity. However, the effect of host pH environment on pathogen colonization has never been evaluated. Development of an isogenic tomato line with reduced expression of the gene for acidity, SlPH (Solyc10g074790.1.1), enabled this analysis. Total RNA from C. gloeosporioides colonizing wild-type (WT) and RNAi-SlPH tomato lines was sequenced and gene-expression patterns were compared. C. gloeosporioides inoculation of the RNAi-SlPH line with pH 5.96 compared to the WT line with pH 4.2 showed 30% higher colonization and reduced ammonia accumulation. Large-scale comparative transcriptome analysis of the colonized RNAi-SlPH and WT lines revealed their different mechanisms of colonization-pattern activation: whereas the WT tomato upregulated 13-LOX (lipoxygenase), jasmonic acid and glutamate biosynthesis pathways, it downregulated processes related to chlorogenic acid biosynthesis II, phenylpropanoid biosynthesis and hydroxycinnamic acid tyramine amide biosynthesis; the RNAi-SlPH line upregulated UDP-D-galacturonate biosynthesis I and free phenylpropanoid acid biosynthesis, but mainly downregulated pathways related to sugar metabolism, such as the glyoxylate cycle and L-arabinose degradation II. Comparison of C. gloeosporioides gene expression during colonization of the WT and RNAi-SlPH lines showed that the fungus upregulates ammonia and nitrogen transport and the gamma-aminobutyric acid metabolic process during colonization of the WT, while on the RNAi-SlPH tomato, it mainly upregulates the nitrate metabolic process. Modulation of tomato acidity and pH had significant phenotypic effects on C. gloeosporioides development. The fungus showed increased colonization on the neutral RNAi-SlPH fruit, and limited colonization on the WT acidic fruit
Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L
2014-01-01
Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C
2014-04-14
Argonaute (AGO) proteins are key nuclease effectors of RNAi. Although purified AGOs can mediate a single round of target RNA cleavage in vitro, accessory factors are required for small interfering RNA (siRNA) loading and to achieve multiple-target turnover. To identify AGO cofactors, we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi, including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 colocalizes with WAGO-1 in germline P granules and in cytoplasmic and perinuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1), where it promotes small RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pten Knockdown in vivo Increases Excitatory Drive onto Dentate Granule Cells
Luikart, Bryan W.; Schnell, Eric; Washburn, Eric K.; Bensen, AeSoon L.; Tovar, Kenneth R.; Westbrook, Gary L.
2011-01-01
Some cases of autism spectrum disorder (ASD) have mutations in the lipid phosphatase, Pten (phosphatase and tensin homolog on chromosome 10). Tissue specific deletion of Pten in the hippocampus and cortex of mice causes anatomical and behavioral abnormalities similar to human autism. However, the impact of reductions in Pten on synaptic and circuit function remains unexplored. We used in vivo stereotaxic injections of lentivirus expressing an shRNA to knockdown Pten in mouse neonatal and young adult dentate granule cells. We then assessed the morphology and synaptic physiology between two weeks and four months later. Confocal imaging of the hippocampus revealed a marked increase in granule cell size and an increase in dendritic spine density. The onset of morphological changes occurred earlier in neonatal mice than in young adults. We used whole-cell recordings from granule cells in acute slices to assess synaptic function following Pten knockdown. Consistent with the increase in dendritic spines, the frequency of excitatory miniature and spontaneous postsynaptic currents increased. However, there was little or no effect on inhibitory postsynaptic currents. Thus Pten knockdown results in an imbalance between excitatory and inhibitory synaptic activity. Because reductions in Pten affected mature granule cells as well as developing granule cells, we suggest that the disruption of circuit function by Pten hypofunction may be ongoing well beyond early development. PMID:21411674
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Liu, Tao; Sims, David; Baum, Buzz
2009-01-01
In recent years RNAi screening has proven a powerful tool for dissecting gene functions in animal cells in culture. However, to date, most RNAi screens have been performed in a single cell line, and results then extrapolated across cell types and systems. Here, to dissect generic and cell type-specific mechanisms underlying cell morphology, we have performed identical kinome RNAi screens in six different Drosophila cell lines, derived from two distinct tissues of origin. This analysis identified a core set of kinases required for normal cell morphology in all lines tested, together with a number of kinases with cell type-specific functions. Most significantly, the screen identified a role for minibrain (mnb/DYRK1A), a kinase associated with Down's syndrome, in the regulation of actin-based protrusions in CNS-derived cell lines. This cell type-specific requirement was not due to the peculiarities in the morphology of CNS-derived cells and could not be attributed to differences in mnb expression. Instead, it likely reflects differences in gene expression that constitute the cell type-specific functional context in which mnb/DYRK1A acts. Using parallel RNAi screens and gene expression analyses across cell types we have identified generic and cell type-specific regulators of cell morphology, which include mnb/DYRK1A in the regulation of protrusion morphology in CNS-derived cell lines. This analysis reveals the importance of using different cell types to gain a thorough understanding of gene function across the genome and, in the case of kinases, the difficulties of using the differential gene expression to predict function.
FUN-L: gene prioritization for RNAi screens.
Lees, Jonathan G; Hériché, Jean-Karim; Morilla, Ian; Fernández, José M; Adler, Priit; Krallinger, Martin; Vilo, Jaak; Valencia, Alfonso; Ellenberg, Jan; Ranea, Juan A; Orengo, Christine
2015-06-15
Most biological processes remain only partially characterized with many components still to be identified. Given that a whole genome can usually not be tested in a functional assay, identifying the genes most likely to be of interest is of critical importance to avoid wasting resources. Given a set of known functionally related genes and using a state-of-the-art approach to data integration and mining, our Functional Lists (FUN-L) method provides a ranked list of candidate genes for testing. Validation of predictions from FUN-L with independent RNAi screens confirms that FUN-L-produced lists are enriched in genes with the expected phenotypes. In this article, we describe a website front end to FUN-L. The website is freely available to use at http://funl.org © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system
Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng
2018-01-01
Background Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). Results In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. Conclusion This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes. PMID:29440889
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M; Berger, Martin R
2014-07-30
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-reg-ulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic le-sions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant de-creases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions.
Kovacheva, Marineta; Zepp, Michael; Berger, Stefan M.; Berger, Martin R.
2014-01-01
Increased bone sialoprotein (BSP) serum levels are related to breast cancer skeletal metastasis, but their relevance is unknown. We elucidated novel intracellular BSP functions by a conditional knockdown of BSP. Conditional MDA-MB-231 subclones were equipped with a novel gene expression cassette containing a tet-regulated miRNA providing knockdown of BSP production. These clones were used to assess the effect of BSP on morphology, proliferation, migration, colony formation and gene expression in vitro, and on soft tissue and osteolytic lesions in a xenograft model by three imaging methods. BSP knockdown caused significant anti-proliferative, anti-migratory and anti-clonogenic effects in vitro (p<0.001). In vivo, significant decreases of soft tissue and osteolytic lesions (p<0.03) were recorded after 3 weeks of miRNA treatment, leading to complete remission within 6 weeks. Microarray data revealed that 0.3% of genes were modulated in response to BSP knockdown. Upregulated genes included the endoplasmic reticulum stress genes ATF3 and DDIT3, the tumor suppressor gene EGR1, ID2 (related to breast epithelial differentiation), c-FOS and SERPINB2, whereas the metastasis associated genes CD44 and IL11 were downregulated. Also, activation of apoptotic pathways was demonstrated. These results implicate that intracellular BSP is essential for breast cancer skeletal metastasis and a target for treating these lesions. PMID:24980816
Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan
2013-01-01
Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.
RNA therapeutics: RNAi and antisense mechanisms and clinical applications.
Chery, Jessica
2016-07-01
RNA therapeutics refers to the use of oligonucleotides to target primarily ribonucleic acids (RNA) for therapeutic efforts or in research studies to elucidate functions of genes. Oligonucleotides are distinct from other pharmacological modalities, such as small molecules and antibodies that target mainly proteins, due to their mechanisms of action and chemical properties. Nucleic acids come in two forms: deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). Although DNA is more stable, RNA offers more structural variety ranging from messenger RNA (mRNA) that codes for protein to non-coding RNAs, microRNA (miRNA), transfer RNA (tRNA), short interfering RNAs (siRNAs), ribosomal RNA (rRNA), and long-noncoding RNAs (lncRNAs). As our understanding of the wide variety of RNAs deepens, researchers have sought to target RNA since >80% of the genome is estimated to be transcribed. These transcripts include non-coding RNAs such as miRNAs and siRNAs that function in gene regulation by playing key roles in the transfer of genetic information from DNA to protein, the final product of the central dogma in biology 1 . Currently there are two main approaches used to target RNA: double stranded RNA-mediated interference (RNAi) and antisense oligonucleotides (ASO). Both approaches are currently in clinical trials for targeting of RNAs involved in various diseases, such as cancer and neurodegeneration. In fact, ASOs targeting spinal muscular atrophy and amyotrophic lateral sclerosis have shown positive results in clinical trials 2 . Advantages of ASOs include higher affinity due to the development of chemical modifications that increase affinity, selectivity while decreasing toxicity due to off-target effects. This review will highlight the major therapeutic approaches of RNA medicine currently being applied with a focus on RNAi and ASOs.
Gao, Yan Ru; Huang, Wen Ling; Tang, Chun Lian; Liu, Rong; Zhao, Qin Ping; Ming, Zhen Ping; Dong, Hui Fen
2018-01-18
Schistosomiasis caused by Schistosoma japonicum is among the most serious endemic zoonoses in China. To study interactions between schistosomula, the pre-adult juvenile stage, and hosts, it is important to study the functions of key genes involved in schistosomula growth and development. Programmed cell death protein 10 (pcdp10) is an important apoptosis-related gene with various biological functions. This study described the molecular characterization of S. japonicum PCDP10 (SjPCDP10) and evaluated its functions in schistosomula. Real-time quantitative polymerase chain reaction (qPCR) and western blot were used to detect Sjpcdp10 mRNA and protein levels, respectively, at different developmental stages. Immunolocalization was performed to determine SjPCDP10 expression in the parasite. RNA interference (RNAi) experiments were used to assess gene functions associated with SjPCDP10 in schistosomula growth and development. Real-time qPCR revealed that Sjpcdp10 was expressed during all investigated developmental stages and upregulated during schistosomula growth and development. Histochemical localization showed that SjPCDP10 was mainly distributed in the teguments of schistosomula in all investigated stages and part of the parenchymal area of 14-, 18-, and 21-day-old schistosomula. Following Sjpcdp10 knockdown by RNAi, the lengths, widths, areas, and volumes of schistosomula were significantly lower than those in the control group. Scanning electron microscopy showed that the body surfaces of schistosomula subjected to RNAi were seriously damaged, with few tegumental spines and sensory papillae. Transmission electron microscopy indicated that the teguments of Sjpcdp10-knockdown schistosomula were incomplete, the number of layers was reduced, and the thickness decreased significantly as compared with those in the control group. Furthermore, terminal deoxynucleotidyl transferase dUTP nick-end labelling results showed that the rate of apoptosis in Sjpcdp10-knockdown
NASA Astrophysics Data System (ADS)
Yang, Chengbin; Panwar, Nishtha; Wang, Yucheng; Zhang, Butian; Liu, Maixian; Toh, Huiting; Yoon, Ho Sup; Tjin, Swee Chuan; Chong, Peter Han Joo; Law, Wing-Cheung; Chen, Chih-Kuang; Yong, Ken-Tye
2016-04-01
First-line therapy of chronic myelogenous leukemia (CML) has always involved the use of BCR-ABL tyrosine-kinase inhibitors which is associated with an abnormal chromosome called Philadelphia chromosome. Although the overall survival rate has been improved by the current therapeutic regime, the presence of resistance has resulted in limited efficacy. In this study, an RNA interference (RNAi)-based therapeutic regime is proposed with the aim to knockdown the BCR-ABL hybrid oncogene using small interfering RNA (siRNA). The siRNA transfection rates have usually been limited due to the declining contact probability among polyplexes and the non-adherent nature of leukemic cells. Our work aims at addressing this limitation by using a biodegradable charged polyester-based vector (BCPV) as a nanocarrier for the delivery of BCR-ABL-specific siRNA to the suspension culture of a K562 CML cell line. BCR-ABL siRNAs were encapsulated in the BCPVs by electrostatic force. Cell internalization was facilitated by the BCPV and assessed by confocal microscopy and flow cytometry. The regulation of the BCR-ABL level in K562 cells as a result of RNAi was analyzed by real-time polymerase chain reaction (RT-PCR). We observed that BCPV was able to form stable nanoplexes with siRNA molecules, even in the presence of fetal bovine serum (FBS), and successfully assisted in vitro siRNA transfection in the non-adherent K562 cells. As a consequence of downregulation of BCR-ABL, BCPV-siRNA nanoplexes inhibited cell proliferation and promoted cell apoptosis. All results were compared with a commercial transfection reagent, Lipofectamine2000™, which served as a positive control. More importantly, this class of non-viral vector exhibits biodegradable features and negligible cytotoxicity, thus providing a versatile platform to deliver siRNA to non-adherent leukemia cells with high transfection efficiency by effectively overcoming extra- and intra-cellular barriers. Due to the excellent in vitro
Azorsa, David O; Gonzales, Irma M; Basu, Gargi D; Choudhary, Ashish; Arora, Shilpi; Bisanz, Kristen M; Kiefer, Jeffrey A; Henderson, Meredith C; Trent, Jeffrey M; Von Hoff, Daniel D; Mousses, Spyro
2009-01-01
Background Pancreatic cancer retains a poor prognosis among the gastrointestinal cancers. It affects 230,000 individuals worldwide, has a very high mortality rate, and remains one of the most challenging malignancies to treat successfully. Treatment with gemcitabine, the most widely used chemotherapeutic against pancreatic cancer, is not curative and resistance may occur. Combinations of gemcitabine with other chemotherapeutic drugs or biological agents have resulted in limited improvement. Methods In order to improve gemcitabine response in pancreatic cancer cells, we utilized a synthetic lethal RNAi screen targeting 572 known kinases to identify genes that when silenced would sensitize pancreatic cancer cells to gemcitabine. Results Results from the RNAi screens identified several genes that, when silenced, potentiated the growth inhibitory effects of gemcitabine in pancreatic cancer cells. The greatest potentiation was shown by siRNA targeting checkpoint kinase 1 (CHK1). Validation of the screening results was performed in MIA PaCa-2 and BxPC3 pancreatic cancer cells by examining the dose response of gemcitabine treatment in the presence of either CHK1 or CHK2 siRNA. These results showed a three to ten-fold decrease in the EC50 for CHK1 siRNA-treated cells versus control siRNA-treated cells while treatment with CHK2 siRNA resulted in no change compared to controls. CHK1 was further targeted with specific small molecule inhibitors SB 218078 and PD 407824 in combination with gemcitabine. Results showed that treatment of MIA PaCa-2 cells with either of the CHK1 inhibitors SB 218078 or PD 407824 led to sensitization of the pancreatic cancer cells to gemcitabine. Conclusion These findings demonstrate the effectiveness of synthetic lethal RNAi screening as a tool for identifying sensitizing targets to chemotherapeutic agents. These results also indicate that CHK1 could serve as a putative therapeutic target for sensitizing pancreatic cancer cells to gemcitabine. PMID
Tai, Kuo-Feng; Wang, Chien-Hsing
2013-12-01
The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the
RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).
Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed
2014-07-01
Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.
LSD1 knockdown reveals novel histone lysine methylation in human breast cancer MCF-7 cells.
Jin, Yue; Huo, Bo; Fu, Xueqi; Cheng, Zhongyi; Zhu, Jun; Zhang, Yu; Hao, Tian; Hu, Xin
2017-08-01
Histone lysine methylation, which plays an important role in the regulation of gene expression, genome stability, chromosome conformation and cell differentiation, is a dynamic process that is collaboratively regulated by lysine methyltransferases (KMTs) and lysine demethylases (KDMs). LSD1, the first identified KDMs, catalyzes the demethylation of mono- and di-methylated H3K4 and H3K9. Here, we systematically investigated the effects of LSD1 knockdown on histone methylations. Surprisingly, in addition to H3K4 and H3K9, the methylation level on other histone lysines, such as H3K27, H3K36 and H3K79, are also increased. The expression of SOX2, E-cadherin and FoxA2 are increased upon LSD1 knockdown, and the methylation level of H3K4, H3K27 and H3K36 in the promoter region of these genes are all changed after LSD1 knockdown. Our results show that LSD1 knockdown has a broad effect on histone lysine methylation, which indicates that LSD1 regulates histone lysine methylation in collaboration with other KMTs and KDMs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Gene expression profiling of selenophosphate synthetase 2 knockdown in Drosophila melanogaster.
Li, Gaopeng; Liu, Liying; Li, Ping; Chen, Luonan; Song, Haiyun; Zhang, Yan
2016-03-01
Selenium (Se) is an important trace element for many organisms and is incorporated into selenoproteins as selenocysteine (Sec). In eukaryotes, selenophosphate synthetase SPS2 is essential for Sec biosynthesis. In recent years, genetic disruptions of both Sec biosynthesis genes and selenoprotein genes have been investigated in different animal models, which provide important clues for understanding the Se metabolism and function in these organisms. However, a systematic study on the knockdown of SPS2 has not been performed in vivo. Herein, we conducted microarray experiments to study the transcriptome of fruit flies with knockdown of SPS2 in larval and adult stages. Several hundred differentially expressed genes were identified in each stage. In spite that the expression levels of other Sec biosynthesis genes and selenoprotein genes were not significantly changed, it is possible that selenoprotein translation might be reduced without impacting the mRNA level. Functional enrichment and network-based analyses revealed that although different sets of differentially expressed genes were obtained in each stage, they were both significantly enriched in the carbohydrate metabolism and redox processes. Furthermore, protein-protein interaction (PPI)-based network clustering analysis implied that several hub genes detected in the top modules, such as Nimrod C1 and regucalcin, could be considered as key regulators that are responsible for the complex responses caused by SPS2 knockdown. Overall, our data provide new insights into the relationship between Se utilization and several fundamental cellular processes as well as diseases.
Lin, Qiaoya; Jin, Cheng S; Huang, Huang; Ding, Lili; Zhang, Zhihong; Chen, Juan; Zheng, Gang
2014-08-13
The abilities to deliver siRNA to its intended action site and assess the delivery efficiency are challenges for current RNAi therapy, where effective siRNA delivery will join force with patient genetic profiling to achieve optimal treatment outcome. Imaging could become a critical enabler to maximize RNAi efficacy in the context of tracking siRNA delivery, rational dosimetry and treatment planning. Several imaging modalities have been used to visualize nanoparticle-based siRNA delivery but rarely did they guide treatment planning. We report a multimodal theranostic lipid-nanoparticle, HPPS(NIR)-chol-siRNA, which has a near-infrared (NIR) fluorescent core, enveloped by phospholipid monolayer, intercalated with siRNA payloads, and constrained by apoA-I mimetic peptides to give ultra-small particle size (<30 nm). Using fluorescence imaging, we demonstrated its cytosolic delivery capability for both NIR-core and dye-labeled siRNAs and its structural integrity in mice through intravenous administration, validating the usefulness of NIR-core as imaging surrogate for non-labeled therapeutic siRNAs. Next, we validated the targeting specificity of HPPS(NIR)-chol-siRNA to orthotopic tumor using sequential four-steps (in vivo, in situ, ex vivo and frozen-tissue) fluorescence imaging. The image co-registration of computed tomography and fluorescence molecular tomography enabled non-invasive assessment and treatment planning of siRNA delivery into the orthotopic tumor, achieving efficacious RNAi therapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Powell, Michelle E; Bradish, Hannah M; Gatehouse, John A; Fitches, Elaine C
2017-01-01
Aethina tumida is a serious pest of the European honey bee (Apis mellifera) in North America and Australia. Here we investigate whether Laccase 2, the phenoloxidase gene essential for cuticle sclerotisation and pigmentation in many insects, and vacuolar-ATPase V-type subunit A, vital for the generation of proton gradients used to drive a range of transport processes, could be potential targets for RNAi-mediated control of A. tumida. Injection of V-ATPase subunit A (5 ng) and Laccase 2 (12.5 ng) dsRNAs resulted in 100% larval mortality, and qPCR confirmed significant decreases and enhanced suppression of transcript levels over time. Oral delivery of V-ATPase subunit A dsRNA in solutions resulted in 50% mortality; however, gene suppression could not be verified. We suggest that the inconsistent RNAi effect was a consequence of dsRNA degradation within the gut owing to the presence of extracellular nucleases. Target specificity was confirmed by a lack of effect on survival or gene expression in honey bees injected with A. tumida dsRNAs. This is the first study to show evidence for systemic RNAi in A. tumida in response to injected dsRNA, but further research is required to develop methods to induce RNAi effects via ingestion. © 2016 Crown copyright. Pest Management Science © 2016 Society of Chemical Industry. © 2016 Crown copyright. Pest Management Science © 2016 Society of Chemical Industry.
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.
2014-01-01
Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931
Raman, Pravrutha; Zaghab, Soriayah M.; Traver, Edward C.
2017-01-01
Abstract Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. PMID:28541563
Hu, Lifang; Su, Peihong; Li, Runzhi; Yan, Kun; Chen, Zhihao; Shang, Peng; Qian, Airong
2015-01-01
Microtubule actin crosslinking factor 1 (MACF1), a widely expressed cytoskeletal linker, plays important roles in various cells by regulating cytoskeleton dynamics. However, its role in osteoblastic cells is not well understood. Based on our previous findings that the association of MACF1 with F-actin and microtubules in osteoblast-like cells was altered under magnetic force conditions, here, by adopting a stable MACF1-knockdown MC3T3-E1 osteoblastic cell line, we found that MACF1 knockdown induced large cells with a binuclear/multinuclear structure. Further, immunofluorescence staining showed disorganization of F-actin and microtubules in MACF1-knockdown cells. Cell counting revealed significant decrease of cell proliferation and cell cycle analysis showed an S phase cell cycle arrest in MACF1-knockdown cells. Moreover and interestingly, MACF1 knockdown showed a potential effect on cellular MTT reduction activity and mitochondrial content, suggesting an impact on cellular metabolic activity. These results together indicate an important role of MACF1 in regulating osteoblastic cell morphology and function. [BMB Reports 2015; 48(10): 583-588] PMID:26277981
Hu, Lifang; Su, Peihong; Li, Runzhi; Yan, Kun; Chen, Zhihao; Shang, Peng; Qian, Airong
2015-10-01
Microtubule actin crosslinking factor 1 (MACF1), a widely expressed cytoskeletal linker, plays important roles in various cells by regulating cytoskeleton dynamics. However, its role in osteoblastic cells is not well understood. Based on our previous findings that the association of MACF1 with F-actin and microtubules in osteoblast-like cells was altered under magnetic force conditions, here, by adopting a stable MACF1-knockdown MC3T3-E1 osteoblastic cell line, we found that MACF1 knockdown induced large cells with a binuclear/multinuclear structure. Further, immunofluorescence staining showed disorganization of F-actin and microtubules in MACF1-knockdown cells. Cell counting revealed significant decrease of cell proliferation and cell cycle analysis showed an S phase cell cycle arrest in MACF1-knockdown cells. Moreover and interestingly, MACF1 knockdown showed a potential effect on cellular MTT reduction activity and mitochondrial content, suggesting an impact on cellular metabolic activity. These results together indicate an important role of MACF1 in regulating osteoblastic cell morphology and function.
2010-01-01
Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH) prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs) enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA) protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi) to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the expression profiles of members
RNAi-mediated gene silencing of WsSGTL1 in W.somnifera affects growth and glycosylation pattern
Saema, Syed; Rahman, Laiq ur; Niranjan, Abhishek; Ahmad, Iffat Zareen; Misra, Pratibha
2015-01-01
Sterol glycosyltransferases (SGTs) belong to family 1 of glycosyltransferases (GTs) and are enzymes responsible for synthesis of sterol–glucosides (SGs) in many organisms. WsSGTL1 is a SGT of Withania somnifera that has been found associated with plasma membranes. However its biological function in W.somnifera is largely unknown. In the present study, we have demonstrated through RNAi silencing of WsSGTL1 gene that it performs glycosylation of withanolides and sterols resulting in glycowithanolides and glycosylated sterols respectively, and affects the growth and development of transgenic W.somnifera. For this, RNAi construct (pFGC1008-WsSGTL1) was made and genetic transformation was done by Agrobacterium tumefaciens. HPLC analysis depicts the reduction of withanoside V (the glycowithanolide of W.somnifera) and a large increase of withanolides (majorly withaferin A) content. Also, a significant decrease in level of glycosylated sterols has been observed. Hence, the obtained data provides an insight into the biological function of WsSGTL1 gene in W.somnifera. PMID:26357855
RNAi-independent role for Argonaute2 in CTCF/CP190 chromatin insulator function
Moshkovich, Nellie; Nisha, Parul; Boyle, Patrick J.; Thompson, Brandi A.; Dale, Ryan K.; Lei, Elissa P.
2011-01-01
A major role of the RNAi pathway in Schizosaccharomyces pombe is to nucleate heterochromatin, but it remains unclear whether this mechanism is conserved. To address this question in Drosophila, we performed genome-wide localization of Argonaute2 (AGO2) by chromatin immunoprecipitation (ChIP)-seq in two different embryonic cell lines and found that AGO2 localizes to euchromatin but not heterochromatin. This localization pattern is further supported by immunofluorescence staining of polytene chromosomes and cell lines, and these studies also indicate that a substantial fraction of AGO2 resides in the nucleus. Intriguingly, AGO2 colocalizes extensively with CTCF/CP190 chromatin insulators but not with genomic regions corresponding to endogenous siRNA production. Moreover, AGO2, but not its catalytic activity or Dicer-2, is required for CTCF/CP190-dependent Fab-8 insulator function. AGO2 interacts physically with CTCF and CP190, and depletion of either CTCF or CP190 results in genome-wide loss of AGO2 chromatin association. Finally, mutation of CTCF, CP190, or AGO2 leads to reduction of chromosomal looping interactions, thereby altering gene expression. We propose that RNAi-independent recruitment of AGO2 to chromatin by insulator proteins promotes the definition of transcriptional domains throughout the genome. PMID:21852534
Ibrahim, Abdulrazak B; Monteiro, Tatiane R; Cabral, Glaucia B; Aragão, Francisco J L
2017-10-01
RNA interference (RNAi)-based transgenic technologies have evolved as potent biochemical tools for silencing specific genes of plant pathogens and pests. The approach has been demonstrated to be useful in silencing genes in insect species. Here, we report on the successful construction of RNAi-based plasmid containing an interfering cassette designed to generate dsRNAs that target a novel v-ATPase transcript in whitefly (Bemisia tabaci), an important agricultural pest in tropical and sub-tropical regions. The presence of the transgene was confirmed in T 0 and T 1 generations of transgenic lettuce lines, segregating in a Mendelian fashion. Seven lines were infested with whiteflies and monitored over a period of 32 days. Analysis of mortality showed that within five days of feeding, insects on transgenic plants showed a mortality rate of 83.8-98.1%. In addition, a reduced number of eggs (95 fold less) was observed in flies feeding on transgenic lettuce plants than insects on control lines. Quantitative reverse transcription PCR showed decreased expression level of endogenous v-ATPase gene in whiteflies feeding on transgenic plants. This technology is a foundation for the production of whitefly-resistant commercial crops, improving agricultural sustainability and food security, reducing the use of more environmentally aggressive methods of pest control.
Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A
2013-08-01
Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
NHR-23 dependent collagen and hedgehog-related genes required for molting.
Kouns, Nathaniel A; Nakielna, Johana; Behensky, Frantisek; Krause, Michael W; Kostrouch, Zdenek; Kostrouchova, Marta
2011-10-07
NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparative expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa. Copyright © 2011 Elsevier Inc. All rights reserved.
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Dual knockdown of N-ras and epiregulin synergistically suppressed the growth of human hepatoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Meng; He, Hong-wei; Sun, Huan-xing
2009-09-18
Hepatocellular carcinoma (HCC) is a major challenge because of its resistance to conventional cytotoxic chemotherapy and radiotherapy. Multi-targeted therapy might be a new option for HCC treatment. Our previous study showed that N-ras gene was activated in HCC and was inhibited by RNA interference. In the present study, we investigated the alternation of gene expression by microarray in N-Ras-siRNA-treated HepG2 cells. The results revealed that the EREG gene, encoding epiregulin, was dramatically up-regulated in response to silence of N-ras. We speculated that the up-regulation of epiregulin was involved in the compensatory mechanism of N-ras knockdown for cell growth. Therefore, wemore » evaluated whether dual silence of N-ras and epiregulin display a greater suppression of cell growth. The results confirmed that dual knockdown of N-ras and epiregulin synergistically inhibited cell growth. Our results also showed that dual knockdown of N-ras and epiregulin significantly induced cell arrest at G0/G1 phase. Furthermore, Western blot assay showed that dual knockdown of N-ras and epiregulin markedly reduced the phosphorylations of ERK1/2, Akt and Rb, and inhibited the expression of cyclin D1. Our findings imply that multi-targeted silence of oncogenes might be an effective treatment for HCC.« less
Nagy, Peter D.
2017-01-01
Reconstituted antiviral defense pathway in surrogate host yeast is used as an intracellular probe to further our understanding of virus-host interactions and the role of co-opted host factors in formation of membrane-bound viral replicase complexes in protection of the viral RNA against ribonucleases. The inhibitory effect of the RNA interference (RNAi) machinery of S. castellii, which only consists of the two-component DCR1 and AGO1 genes, was measured against tomato bushy stunt virus (TBSV) in wild type and mutant yeasts. We show that deletion of the co-opted ESCRT-I (endosomal sorting complexes required for transport I) or ESCRT-III factors makes TBSV replication more sensitive to the RNAi machinery in yeast. Moreover, the lack of these pro-viral cellular factors in cell-free extracts (CFEs) used for in vitro assembly of the TBSV replicase results in destruction of dsRNA replication intermediate by a ribonuclease at the 60 min time point when the CFE from wt yeast has provided protection for dsRNA. In addition, we demonstrate that co-opted oxysterol-binding proteins and membrane contact sites, which are involved in enrichment of sterols within the tombusvirus replication compartment, are required for protection of viral dsRNA. We also show that phosphatidylethanolamine level influences the formation of RNAi-resistant replication compartment. In the absence of peroxisomes in pex3Δ yeast, TBSV subverts the ER membranes, which provide as good protection for TBSV dsRNA against RNAi or ribonucleases as the peroxisomal membranes in wt yeast. Altogether, these results demonstrate that co-opted protein factors and usurped lipids are exploited by tombusviruses to build protective subcellular environment against the RNAi machinery and possibly other cellular ribonucleases. PMID:28759634
Li, Xinxin; Zhang, Yonggen; Hannoufa, Abdelali; Yu, Peiqiang
2015-11-04
Lignin, a phenylpropanoid polymer present in secondary cell walls, has a negative impact on feed digestibility. TT8 and HB12 genes were shown to have low expression levels in low-lignin tissues of alfalfa, but to date, there has been no study on the effect of down-regulation of these two genes in alfalfa on nutrient chemical profiles and availability in ruminant livestock systems. The objectives of this study were to investigate the effect of transformation of alfalfa with TT8 and HB12 RNAi constructs on carbohydrate (CHO) structure and CHO nutritive value in ruminant livestock systems. The results showed that transformation with TT8 and HB12 RNAi constructs reduced rumen, rapidly degraded CHO fractions (RDCA4, P = 0.06; RDCB1, P < 0.01) and totally degraded CHO fraction (TRDCHO, P = 0.08). Both HB12 and TT8 populations had significantly higher in vitro digestibility of neutral detergent fiber (NDF) at 30 h of incubation (ivNDF30) compared to the control (P < 0.01). The TT8 populations had highest ivDM30 and ivNDF240. Transformation of alfalfa with TT8 and HB12 RNAi constructs induced molecular structure changes. Different CHO functional groups had different sensitivities and different responses to the transformation. The CHO molecular structure changes induced by the transformation were associated with predicted CHO availability. Compared with HB12 RNAi, transformation with TT8 RNAi could improve forage quality by increasing the availability of both NDF and DM. Further study is needed on the relationship between the transformation-induced structure changes at a molecular level and nutrient utilization in ruminant livestock systems when lignification is much higher.
Knockdown of ferroportin accelerates erastin-induced ferroptosis in neuroblastoma cells.
Geng, N; Shi, B-J; Li, S-L; Zhong, Z-Y; Li, Y-C; Xua, W-L; Zhou, H; Cai, J-H
2018-06-01
Ferroptosis is a new-found iron-dependent form of non-apoptotic regulated cell death (RCD), which is activated on therapy with several antitumor agents, but the potential mechanism remains unclear. Erastin, exhibiting selectivity for RAS-mutated cancer cells, induces ferroptosis by increasing iron and lipid reactive oxygen species (ROS) levels in cell. Ferroportin (Fpn), the sole iron export protein, participates in the regulation of intracellular iron concentration. In this study, we investigated the role of Fpn on ferroptosis induced by erastin in SH-SY5Y cells. The cell viability was determined by CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay kit. The activity of caspase-3 was measured by ELISA kit. qRT-PCR was performed to examine the mRNA expression of Fpn. Western blot assay was conducted to examine the expression level of marker proteins. Specific commercial kits were used to examine the levels of MDA, ROS and iron in cells, respectively. Ferroptosis was evaluated by intracellular lipid ROS level and iron concentration. Hepcidin could prevent erastin-induced ferroptosis by degrading Fpn. Erastin (5 μg/mL) was observed to induce ferroptosis in neuroblastoma cells at 6 hours, which was promoted by knockdown of Fpn. The expression of Fpn gene and protein was decreased in SH-SY5Y cells treated with erastin. After treatment with erastin, Fpn siRNA transfection in SH-SY5Y cells was able to accelerate ferroptosis-associated phenotypic changes. Fpn acted as a negative regulator of ferroptosis by reducing intracellular iron concentration. Knockdown of Fpn enhanced anticancer activity of erastin. These results suggested that knockdown of Fpn accelerated erastin-induced ferroptosis by increasing iron-dependent lipid ROS accumulation, highlighting Fpn as a potential therapeutic target site for neuroblastoma. Thus, Fpn inhibitors may provide new access for chemosensitization of neuroblastoma.
Martel, Cécile; Pinçon, Anthony; Bélanger, Alexandre Maxime; Luo, Xiaoyan; Gillis, Marc-Antoine; de Montgolfier, Olivia; Thorin-Trescases, Nathalie; Thorin, Éric
2018-01-01
Angiopoietin-like 2 (ANGPTL2) is an inflammatory adipokine linking obesity to insulin resistance. Intermittent fasting, on the other hand, is a lifestyle intervention able to prevent obesity and diabetes but difficult to implement and maintain. Our objectives were to characterize a link between ANGPTL2 and intermittent fasting and to investigate whether the knockdown of ANGPTL2 reproduces the benefits of intermittent fasting on weight gain and insulin responsiveness in knockdown and wild-type littermates mice. Intermittent fasting, access to food ad libitum once every other day, was initiated at the age of three months and maintained for four months. Intermittent fasting decreased by 63% (p < 0.05) gene expression of angptl2 in adipose tissue of wild-type mice. As expected, intermittent fasting improved insulin sensitivity (p < 0.05) and limited weight gain (p < 0.05) in wild-type mice. Knockdown mice fed ad libitum, however, were comparable to wild-type mice following the intermittent fasting regimen: insulin sensitivity and weight gain were identical, while intermittent fasting had no additional impact on these parameters in knockdown mice. Energy intake was similar between both wild-type fed intermittent fasting and ANGPTL2 knockdown mice fed ad libitum, suggesting that intermittent fasting and knockdown of ANGPTL2 equally lower feeding efficiency. These results suggest that the reduction of ANGPTL2 could be a useful and promising strategy to prevent obesity and insulin resistance, although further investigation of the mechanisms linking ANGPTL2 and intermittent fasting is warranted. Impact statement Intermittent fasting is an efficient diet pattern to prevent weight gain and improve insulin sensitivity. It is, however, a difficult regimen to follow and compliance is expected to be very low. In this work, we demonstrate that knockdown of ANGPTL2 in mice fed ad libitum mimics the beneficial effects of intermittent fasting on weight gain and insulin
Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K
2017-01-01
Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can
Henderson, Jordana M; Nisperos, Sean V; Weeks, Joi; Ghulam, Mahjoobah; Marín, Ignacio; Zayas, Ricardo M
2015-08-15
E3 ubiquitin ligases constitute a large family of enzymes that modify specific proteins by covalently attaching ubiquitin polypeptides. This post-translational modification can serve to regulate protein function or longevity. In spite of their importance in cell physiology, the biological roles of most ubiquitin ligases remain poorly understood. Here, we analyzed the function of the HECT domain family of E3 ubiquitin ligases in stem cell biology and tissue regeneration in planarians. Using bioinformatic searches, we identified 17 HECT E3 genes that are expressed in the Schmidtea mediterranea genome. Whole-mount in situ hybridization experiments showed that HECT genes were expressed in diverse tissues and most were expressed in the stem cell population (neoblasts) or in their progeny. To investigate the function of all HECT E3 ligases, we inhibited their expression using RNA interference (RNAi) and determined that orthologs of huwe1, wwp1, and trip12 had roles in tissue regeneration. We show that huwe1 RNAi knockdown led to a significant expansion of the neoblast population and death by lysis. Further, our experiments showed that wwp1 was necessary for both neoblast and intestinal tissue homeostasis as well as uncovered an unexpected role of trip12 in posterior tissue specification. Taken together, our data provide insights into the roles of HECT E3 ligases in tissue regeneration and demonstrate that planarians will be a useful model to evaluate the functions of E3 ubiquitin ligases in stem cell regulation. Copyright © 2015 Elsevier Inc. All rights reserved.
Protein Knockdown Technology: Application of Ubiquitin Ligase to Cancer Therapy.
Ohoka, Nobumichi; Shibata, Norihito; Hattori, Takayuki; Naito, Mikihiko
2016-01-01
Selective degradation of pathogenic proteins by small molecules in cells is a novel approach for development of therapeutic agents against various diseases, including cancer. We and others have developed a protein knockdown technology with a series of hybrid small compounds, called SNIPERs (Specific and Nongenetic IAP-dependent Protein ERasers); and peptidic chimeric molecules, called PROTACs (proteolysis-targeting chimeric molecules), which induce selective degradation of target proteins via the ubiquitin-proteasome pathway. These compounds include two different ligands connected by a linker; one is a ligand for a ubiquitin ligase and the other is a ligand for the target protein, which are expected to crosslink these proteins in cells. Theoretically, any cytosolic protein can be targeted for degradation by this technology. To date, several SNIPERs and PROTACs against various oncogenic proteins have been developed, which specifically induce polyubiquitylation and proteasomal degradation of the oncogenic proteins, resulting in cell death, growth arrest, or impaired migration of cancer cells. Thus, this protein knockdown technology has a great potential for cancer therapy.
Stable knockdown of Kif5b in MDCK cells leads to epithelial–mesenchymal transition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cui, Ju, E-mail: juzi.cui@gmail.com; Department of Biochemistry, LKS Faculty of Medicine, The University of Hong Kong, Hong Kong SAR; Jin, Guoxiang
2015-07-17
Polarization of epithelial cells requires vectorial sorting and transport of polarity proteins to apical or basolateral domains. Kif5b is the mouse homologue of the human ubiquitous Kinesin Heavy Chain (uKHC). To investigate the function of Kif5b in epithelial cells, we examined the phenotypes of Kif5b-deficient MDCK cells. Stable knockdown of Kif5b in MDCK cells resulted in reduced cell proliferation rate, profound changes in cell morphology, loss of epithelial cell marker, and gain of mesenchymal marker, as well as increased cell migration, invasion, and tumorigenesis abilities. E-cadherin and NMMIIA could interact with Kif5b in polarized MDCK cells, and their expression levelsmore » were decreased in Kif5b-deficient MDCK cells. Overexpression of E-cadherin and NMMIIA in Kif5b depleted MDCK cells could decrease mesenchymal marker expression and cell migration ability. These results indicate that stable knockdown of Kif5b in MDCK cells can lead to epithelial–mesenchymal transition, which is mediated by defective E-cadherin and NMMIIA expression. - Highlights: • Knockdown of Kif5b in MDCK cells resulted in reduced cell proliferation rate. • Kif5b deficient MDCK cells underwent epithelial–mesenchymal transition. • E-cadherin and NMMIIA could interact with Kif5b in polarized MDCK cells. • Decreased E-cadherin and NMMIIA levels mediate EMT in Kif5b deficient MDCK cells. • Overexpression of E-cadherin and NMMIIA reverse the effects of Kif5b knockdown.« less
Sigle, L T; Hillyer, J F
2018-03-09
Haemocytes respond to infection by phagocytosing pathogens, producing the enzymes that drive the phenoloxidase-based melanization cascade, secreting lytic factors, and producing other humoral proteins. A subset of haemocytes, called periostial haemocytes, aggregate on the surface of the heart of mosquitoes and kill pathogens in areas of high haemolymph flow. Periostial haemocytes are always present, but an infection induces the recruitment of additional haemocytes to these regions. Here, we tested whether members of the Nimrod gene family are involved in the periostial immune response of the African malaria mosquito, Anopheles gambiae. Using organismal manipulations, RNA interference (RNAi) and microscopy, we show that, following an infection with Escherichia coli, nimrod - the orthologue of Drosophila NimB2 - is not involved in periostial responses. At 4 h postinfection, however, RNAi-based knockdown of draper results in a marginal increase in the number of periostial haemocytes and a doubling of E. coli accumulation at the periostial regions. Finally, at 24 h postinfection, knockdown of eater decreases the number of periostial haemocytes and decreases the phagocytosis of E. coli on the surface of the heart. Phagocytosis of bacteria is more prevalent in the periostial regions of the mid abdominal segments, and knockdown of draper, nimrod or eater does not alter this distribution. Finally, knockdown of Nimrod family genes did not have a meaningful effect on the accumulation of melanin at the periostial regions. This study identifies roles for eater and draper in the functional integration of the mosquito immune and circulatory systems. © 2018 The Royal Entomological Society.
Slo1 regulates ethanol-induced scrunching in freshwater planarians
NASA Astrophysics Data System (ADS)
Cochet-Escartin, Olivier; Carter, Jason A.; Chakraverti-Wuerthwein, Milena; Sinha, Joydeb; Collins, Eva-Maria S.
2016-10-01
When freshwater planarians are exposed to a low-percentage (0.5%-1%) alcohol solution, they display a characteristic ‘drunken’ phenotype. Here we show that this drunken phenotype is a mixture of cilia-mediated gliding and scrunching, a muscular-based planarian gait which we recently demonstrated to be triggered by adverse environmental stimuli. At exogenous ethanol concentrations ≥2% (v/v), planarians become gradually immobilized and ultimately die. Using RNA interference (RNAi) for targeted gene knockdown, we elucidate the molecular basis for ethanol sensing and show that the big potassium ion channel SLO1 is necessary for ethanol sensitivity in planarians. Because slo1(RNAi) animals maintain their ability to scrunch in response to other adverse triggers, these results suggest that slo1 specifically regulates ethanol sensitivity and not the scrunching gait per se. Furthermore, this study demonstrates the ease of performing pharmacological studies in planarians. Combined with the worms’ amenability to quantitative behavioral assays and targeted gene knockdown, planarians are a valuable model organism for studying the effect of neuroactive compounds on brain function and behavior.
Slo1 regulates ethanol-induced scrunching in freshwater planarians.
Cochet-Escartin, Olivier; Carter, Jason A; Chakraverti-Wuerthwein, Milena; Sinha, Joydeb; Collins, Eva-Maria S
2016-09-09
When freshwater planarians are exposed to a low-percentage (0.5%-1%) alcohol solution, they display a characteristic 'drunken' phenotype. Here we show that this drunken phenotype is a mixture of cilia-mediated gliding and scrunching, a muscular-based planarian gait which we recently demonstrated to be triggered by adverse environmental stimuli. At exogenous ethanol concentrations ≥2% (v/v), planarians become gradually immobilized and ultimately die. Using RNA interference (RNAi) for targeted gene knockdown, we elucidate the molecular basis for ethanol sensing and show that the big potassium ion channel SLO1 is necessary for ethanol sensitivity in planarians. Because slo1(RNAi) animals maintain their ability to scrunch in response to other adverse triggers, these results suggest that slo1 specifically regulates ethanol sensitivity and not the scrunching gait per se. Furthermore, this study demonstrates the ease of performing pharmacological studies in planarians. Combined with the worms' amenability to quantitative behavioral assays and targeted gene knockdown, planarians are a valuable model organism for studying the effect of neuroactive compounds on brain function and behavior.
Kretova, Olga V; Fedoseeva, Daria M; Gorbacheva, Maria A; Gashnikova, Natalya M; Gashnikova, Maria P; Melnikova, Nataliya V; Chechetkin, Vladimir R; Kravatsky, Yuri V; Tchurikov, Nickolai A
2017-09-15
RNAi has been suggested for use in gene therapy of HIV/AIDS, but the main problem is that HIV-1 is highly variable and could escape attack from the small interfering RNAs (siRNAs) due to even single nucleotide substitutions in the potential targets. To exhaustively check the variability in selected RNA targets of HIV-1, we used ultra-deep sequencing of six regions of HIV-1 from the plasma of two independent cohorts of patients from Russia. Six RNAi targets were found that are invariable in 82%-97% of viruses in both cohorts and are located inside the domains specifying reverse transcriptase (RT), integrase, vpu, gp120, and p17. The analysis of mutation frequencies and their characteristics inside the targets suggests a likely role for APOBEC3G (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G, A3G) in G-to-A mutations and a predominant effect of RT biases in the detected variability of the virus. The lowest frequency of mutations was detected in the central part of all six targets. We also discovered that the identical RNAi targets are present in many HIV-1 strains from many countries and from all continents. The data are important for both the understanding of the patterns of HIV-1 mutability and properties of RT and for the development of gene therapy approaches using RNAi for the treatment of HIV/AIDS. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Remmele, Steffen; Ritzerfeld, Julia; Nickel, Walter; Hesser, Jürgen
2011-03-01
RNAi-based high-throughput microscopy screens have become an important tool in biological sciences in order to decrypt mostly unknown biological functions of human genes. However, manual analysis is impossible for such screens since the amount of image data sets can often be in the hundred thousands. Reliable automated tools are thus required to analyse the fluorescence microscopy image data sets usually containing two or more reaction channels. The herein presented image analysis tool is designed to analyse an RNAi screen investigating the intracellular trafficking and targeting of acylated Src kinases. In this specific screen, a data set consists of three reaction channels and the investigated cells can appear in different phenotypes. The main issue of the image processing task is an automatic cell segmentation which has to be robust and accurate for all different phenotypes and a successive phenotype classification. The cell segmentation is done in two steps by segmenting the cell nuclei first and then using a classifier-enhanced region growing on basis of the cell nuclei to segment the cells. The classification of the cells is realized by a support vector machine which has to be trained manually using supervised learning. Furthermore, the tool is brightness invariant allowing different staining quality and it provides a quality control that copes with typical defects during preparation and acquisition. A first version of the tool has already been successfully applied for an RNAi-screen containing three hundred thousand image data sets and the SVM extended version is designed for additional screens.
Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y
2013-01-01
Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi) knockdown to delineate the role of G6PD in animal physiology. Upon G6PD RNAi knockdown, G6PD activity was significantly hampered in C. elegans in parallel with increased oxidative stress and DNA oxidative damage. Phenotypically, G6PD-knockdown enhanced germ cell apoptosis (2-fold increase), reduced egg production (65% of mock), and hatching (10% of mock). To determine whether oxidative stress is associated with G6PD knockdown-induced reproduction defects, C. elegans was challenged with a short-term hydrogen peroxide (H2O2). The early phase egg production of both mock and G6PD-knockdown C. elegans were significantly affected by H2O2. However, H2O2-induced germ cell apoptosis was more dramatic in mock than that in G6PD-deficient C. elegans. To investigate the signaling pathways involved in defective oogenesis and embryogenesis caused by G6PD knockdown, mutants of p53 and mitogen-activated protein kinase (MAPK) pathways were examined. Despite the upregulation of CEP-1 (p53), cep-1 mutation did not affect egg production and hatching in G6PD-deficient C. elegans. Neither pmk-1 nor mek-1 mutation significantly affected egg production, whereas sek-1 mutation further decreased egg production in G6PD-deficient C. elegans. Intriguingly, loss of function of sek-1 or mek-1 dramatically rescued defective hatching (8.3- and 9.6-fold increase, respectively) induced by G6PD knockdown. Taken together, these findings show that G6PD knockdown reduces egg production and hatching in C. elegans
Yang, H-C; Chen, T-L; Wu, Y-H; Cheng, K-P; Lin, Y-H; Cheng, M-L; Ho, H-Y; Lo, S J; Chiu, D T-Y
2013-05-02
Glucose 6-phosphate dehydrogenase (G6PD) deficiency, known as favism, is classically manifested by hemolytic anemia in human. More recently, it has been shown that mild G6PD deficiency moderately affects cardiac function, whereas severe G6PD deficiency leads to embryonic lethality in mice. How G6PD deficiency affects organisms has not been fully elucidated due to the lack of a suitable animal model. In this study, G6PD-deficient Caenorhabditis elegans was established by RNA interference (RNAi) knockdown to delineate the role of G6PD in animal physiology. Upon G6PD RNAi knockdown, G6PD activity was significantly hampered in C. elegans in parallel with increased oxidative stress and DNA oxidative damage. Phenotypically, G6PD-knockdown enhanced germ cell apoptosis (2-fold increase), reduced egg production (65% of mock), and hatching (10% of mock). To determine whether oxidative stress is associated with G6PD knockdown-induced reproduction defects, C. elegans was challenged with a short-term hydrogen peroxide (H2O2). The early phase egg production of both mock and G6PD-knockdown C. elegans were significantly affected by H2O2. However, H2O2-induced germ cell apoptosis was more dramatic in mock than that in G6PD-deficient C. elegans. To investigate the signaling pathways involved in defective oogenesis and embryogenesis caused by G6PD knockdown, mutants of p53 and mitogen-activated protein kinase (MAPK) pathways were examined. Despite the upregulation of CEP-1 (p53), cep-1 mutation did not affect egg production and hatching in G6PD-deficient C. elegans. Neither pmk-1 nor mek-1 mutation significantly affected egg production, whereas sek-1 mutation further decreased egg production in G6PD-deficient C. elegans. Intriguingly, loss of function of sek-1 or mek-1 dramatically rescued defective hatching (8.3- and 9.6-fold increase, respectively) induced by G6PD knockdown. Taken together, these findings show that G6PD knockdown reduces egg production and hatching in C. elegans
Estrin, Michael A; Hussein, Islam T M; Puryear, Wendy B; Kuan, Anne C; Artim, Stephen C; Runstadler, Jonathan A
2018-01-01
Influenza A virus infections are important causes of morbidity and mortality worldwide, and currently available prevention and treatment methods are suboptimal. In recent years, genome-wide investigations have revealed numerous host factors that are required for influenza to successfully complete its life cycle. However, only a select, small number of influenza strains were evaluated using this platform, and there was considerable variation in the genes identified across different investigations. In an effort to develop a universally efficacious therapeutic strategy with limited potential for the emergence of resistance, this study was performed to investigate the effect of combinatorial RNA interference (RNAi) on inhibiting the replication of diverse influenza A virus subtypes and strains. Candidate genes were selected for targeting based on the results of multiple previous independent genome-wide studies. The effect of single and combinatorial RNAi on the replication of 12 diverse influenza A viruses, including three strains isolated from birds and one strain isolated from seals, was then evaluated in primary normal human bronchial epithelial cells. After excluding overly toxic siRNA, two siRNA combinations were identified that reduced mean viral replication by greater than 79 percent in all mammalian strains, and greater than 68 percent in all avian strains. Host-directed combinatorial RNAi effectively prevents growth of a broad range of influenza virus strains in vitro, and is a potential therapeutic candidate for further development and future in vivo studies.
Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M
2017-08-21
Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P < 0.001) and metacercariae (P < 0.01), resulting in a remarkable killing effect on C. sinensis adult worms (P < 0.01). Fluorescent Cy3-labeled dsRNA was mostly deposited in the uterus and vitellarium of adult worm and in the cyst wall of metacercaria. The present study is the first report of RNAi trials in C. sinensis, allowing further applications in identifying functional genes in C. sinensis.
[MACF1 knockdown in glioblastoma multiforme cells increases temozolomide-induced cytotoxicity].
Xie, Si-di; Chen, Zi-Yang; Wang, Hai; He, Min-Yi; Lu, Yun-Tao; Lei, Bing-Xi; Li, He-Zhen; Liu, Ya-Wei; Qi, Song-Tao
2017-09-20
To investigate the role of microtubule-actin crosslinking factor 1 (MACF1) in the response of glioma cells to temozolomide (TMZ). TMZ was applied to a human gliomablastoma cell line (U87) and changes in the protein expression and cellular localization were determined with Western blot, RT-PCR, and immunofluorescence. The responses of the cells with MACF1 expression knockdown by RNA interference to TMZ were assessed. TMZ-induced effects on MACF1 expression were also assessed by immunohistochemistry in a nude mouse model bearing human glioblastoma xenografts. TMZ resulted in significantly increased MACF1 expression (by about 2 folds) and changes in its localization in the gliomablastoma cells both in vitro and in vivo (P<0.01). Knockdown of MACF1 reduced the proliferation (by 45%) of human glioma cell lines treated with TMZ (P<0.01). TMZ-induced changes in MACF1 expression was accompanied by cytoskeletal rearrangement. MACF1 may be a potential therapeutic target for glioblastoma.
Ni, Julie Zhouli; Kalinava, Natallia; Chen, Esteban; Huang, Alex; Trinh, Thi; Gu, Sam Guoping
2016-01-01
Environmental stress-induced transgenerational epigenetic effects have been observed in various model organisms and human. The capacity and mechanism of such phenomena are poorly understood. In C. elegans, siRNA mediates transgenerational gene silencing through the germline nuclear RNAi pathway. This pathway is also required to maintain the germline immortality when C. elegans is under heat stress. However, the underlying molecular mechanism is unknown. In this study, we investigated the impact of heat stress on chromatin, transcription, and siRNAs at the whole-genome level, and whether any of the heat-induced effects is transgenerationally heritable in either the wild-type or the germline nuclear RNAi mutant animals. We performed 12-generation temperature-shift experiments using the wild-type C. elegans and a mutant strain that lacks the germline-specific nuclear Argonaute protein HRDE-1/WAGO-9. By examining the mRNA, small RNA, RNA polymerase II, and H3K9 trimethylation profiles at the whole-genome level, we revealed an epigenetic role of HRDE-1 in repressing heat stress-induced transcriptional activation of over 280 genes. Many of these genes are in or near LTR (long-terminal repeat) retrotransposons. Strikingly, for some of these genes, the heat stress-induced transcriptional activation in the hrde-1 mutant intensifies in the late generations under the heat stress and is heritable for at least two generations after the mutant animals are shifted back to lower temperature. hrde-1 mutation also leads to siRNA expression changes of many genes. This effect on siRNA is dependent on both the temperature and generation. Our study demonstrated that a large number of the endogenous targets of the germline nuclear RNAi pathway in C. elegans are sensitive to heat-induced transcriptional activation. This effect at certain genomic loci including LTR retrotransposons is transgenerational. Germline nuclear RNAi antagonizes this temperature effect at the transcriptional level
The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells
Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P.; Lu, Wange; Wang, Kai
2013-01-01
Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases. PMID:23710042
The functional genetic link of NLGN4X knockdown and neurodevelopment in neural stem cells.
Shi, Lingling; Chang, Xiao; Zhang, Peilin; Coba, Marcelo P; Lu, Wange; Wang, Kai
2013-09-15
Genetic mutations in NLGN4X (neuroligin 4), including point mutations and copy number variants (CNVs), have been associated with susceptibility to autism spectrum disorders (ASDs). However, it is unclear how mutations in NLGN4X result in neurodevelopmental defects. Here, we used neural stem cells (NSCs) as in vitro models to explore the impacts of NLGN4X knockdown on neurodevelopment. Using two shRNAmir-based vectors targeting NLGN4X and one control shRNAmir vector, we modulated NLGN4X expression and differentiated these NSCs into mature neurons. We monitored the neurodevelopmental process at Weeks 0, 0.5, 1, 2, 4 and 6, based on morphological analysis and whole-genome gene expression profiling. At the cellular level, in NSCs with NLGN4X knockdown, we observed increasingly delayed neuronal development and compromised neurite formation, starting from Week 2 through Week 6 post differentiation. At the molecular level, we identified multiple pathways, such as neurogenesis, neuron differentiation and muscle development, which are increasingly disturbed in cells with NLGN4X knockdown. Notably, several postsynaptic genes, including DLG4, NLGN1 and NLGN3, also have decreased expression. Based on in vitro models, NLGN4X knockdown directly impacts neurodevelopmental process during the formation of neurons and their connections. Our functional genomics study highlights the utility of NSCs models in understanding the functional roles of CNVs in affecting neurodevelopment and conferring susceptibility to neurodevelopmental diseases.
Isolating of Target Genes for NKX3.1 in Prostate Carcinogenesis
2005-03-01
stainin on e te o tesr prostate hist log .(Band - . (C a .. ( 2 (M -P) Ki6 s shows . celula pr lf rto in c( ssi Fg1.prosthate cane r progresin is enh...prostate tumorigenicity. s{ LA Finally, to assess the significance of Cyclin D1 for prostatea ,. 0 tumorigenicity, we used RNAi to knock-down its expression
Hoa, Neil T; Ge, Lisheng; Erickson, Kate L; Kruse, Carol A; Cornforth, Andrew N; Kuznetsov, Yurii; McPherson, Alex; Martini, Filippo; Jadus, Martin R
2015-01-01
Cancer cells derived from Glioblastoma multiforme possess membranous protrusions allowing these cells to infiltrate surrounding tissue, while resisting lymphocyte cytotoxicity. Microvilli and filopodia are supported by actin filaments cross-linked by fascin. Fascin-1 was genetically silenced within human U251 glioma cells; these knock-down glioma cells lost their microvilli/filopodia. The doubling time of these fascin-1 knock-down cells was doubled that of shRNA control U251 cells. Fascin-1 knock-down cells lost their transmigratory ability responding to interleukin-6 or insulin-like growth factor-1. Fascin-1 silenced U251 cells were more easily killed by cytolytic lymphocytes. Fascin-1 knock-down provides unique opportunities to augment glioma immunotherapy by simultaneously targeting several key glioma functions: like cell transmigration, cell division and resisting immune responses. PMID:25901196
Swevers, Luc; Liu, Jisheng; Huvenne, Hanneke; Smagghe, Guy
2011-01-01
RNA interference (RNAi), an RNA-dependent gene silencing process that is initiated by double-stranded RNA (dsRNA) molecules, has been applied with variable success in lepidopteran insects, in contrast to the high efficiency achieved in the coleopteran Tribolium castaneum. To gain insight into the factors that determine the efficiency of RNAi, a survey was carried out to check the expression of factors that constitute the machinery of the small interfering RNA (siRNA) and microRNA (miRNA) pathways in different tissues and stages of the silkmoth, Bombyx mori. It was found that the dsRNA-binding protein R2D2, an essential component in the siRNA pathway in Drosophila, was expressed at minimal levels in silkmoth tissues. The silkmoth-derived Bm5 cell line was also deficient in expression of mRNA encoding full-length BmTranslin, an RNA-binding factor that has been shown to stimulate the efficiency of RNAi. However, despite the lack of expression of the RNA-binding proteins, silencing of a luciferase reporter gene was observed by co-transfection of luc dsRNA using a lipophilic reagent. In contrast, gene silencing was not detected when the cells were soaked in culture medium supplemented with dsRNA. The introduction of an expression construct for Tribolium R2D2 (TcR2D2) did not influence the potency of luc dsRNA to silence the luciferase reporter. Immunostaining experiments further showed that both TcR2D2 and BmTranslin accumulated at defined locations within the cytoplasm of transfected cells. Our results offer a first evaluation of the expression of the RNAi machinery in silkmoth tissues and Bm5 cells and provide evidence for a functional RNAi response to intracellular dsRNA in the absence of R2D2 and Translin. The failure of TcR2D2 to stimulate the intracellular RNAi pathway in Bombyx cells is discussed. PMID:21637842
Knockdown of peroxiredoxin V increases glutamate‑induced apoptosis in HT22 hippocampal neuron cells.
Shen, Gui-Nan; Liu, Lei; Feng, Li; Jin, Yu; Jin, Mei-Hua; Han, Ying-Hao; Jin, Cheng-Hao; Jin, Yong-Zhe; Lee, Dong-Soek; Kwon, Tae Ho; Cui, Yu-Dong; Sun, Hu-Nan
2018-06-01
High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated the regulatory effect of Prx V on glutamate‑induced effects on viability and apoptosis in HT22 cells. Western blotting was used for protein expression analysis and Annexin V/PI staining and flow cytometry for determination of apoptosis. The results demonstrated that glutamate may ROS‑dependently increase HT22 cell apoptosis and upregulate Prx V protein levels. Furthermore, knockdown of Prx V protein expression with a lentivirus significantly enhanced HT22 cell apoptosis mediated by glutamate, which was reversed by inhibition of ROS with N‑acetyl‑L‑cysteine. Inhibiting the extracellular signal‑regulated kinase (ERK) signaling pathway with PD98059, a specific inhibitor for ERK phosphorylation, markedly decreased glutamate‑induced HT22 cell apoptosis in Prx V knockdown cells, indicating the potential involvement of ERK signaling in glutamate‑induced HT22 cell apoptosis. In addition, an increase in nuclear apoptosis‑inducing factor was observed in Prx V knockdown HT22 cells following glutamate treatment, compared with mock cells, whereas no differences in B‑cell lymphoma‑2 and cleaved‑caspase‑3 protein expression levels were observed between mock and Prx V knockdown cells. The results of the present study indicated that Prx V may have potential as a therapeutic molecular target for glutamate‑induced neuronal cell death and provide novel insight into the role of Prx V in oxidative‑stress induced neuronal cell death.
Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie
2015-01-01
Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235
Lifespan and reproduction in brain-specific miR-29-knockdown mouse.
Takeda, Toru; Tanabe, Hiroyuki
2016-03-18
The microRNA miR-29 is widely distributed and highly expressed in adult mouse brain during the mouse's lifetime. We recently created conditional mutant mice whose miR-29 was brain-specifically knocked down through overexpression of an antisense RNA transgene against miR-29. To explore a role for brain miR-29 in maximizing organismal fitness, we assessed somatic growth, reproduction, and lifespan in the miR-29-knockdown (KD) mice and their wild-type (WT) littermates. The KD mice were developmentally indistinguishable from WT mice with respect to gross morphology and physical activity. Fertility testing revealed that KD males were subfertile, whereas KD females were hyperfertile, only in terms of reproductive success, when compared to their gender-matched WT correspondents. Another phenotypic difference between KD and WT animals appeared in their lifespan data; KD males displayed an overall increasing tendency in post-reproductive survival relative to WT males. In contrast, KD females were prone to shorter lifespans than WT females. These results clarify that brain-targeted miR-29 knockdown affects both lifespan and reproduction in a gender-dependent manner, and moreover that the reciprocal responsiveness to the miR-29 knockdown between these two phenotypes in both genders closely follow life-course models based on the classical trade-off prediction wherein elaborate early-life energetic investment in reproduction entails accelerated late-life declines in survival, and vice versa. Thus, this study identified miR-29 as the first mammalian miRNA that is directly implicated in the lifetime trade-off between the two major fitness components, lifespan and reproduction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection
Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara
2014-01-01
Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726
Le, Hai Van; Kim, Jae Young
2016-06-01
Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.
Yin, Zheng; Zhou, Xiaobo; Bakal, Chris; Li, Fuhai; Sun, Youxian; Perrimon, Norbert; Wong, Stephen TC
2008-01-01
derived from a wide spectrum of experimental conditions and is suitable to adaptively process new images which are continuously added to existing datasets. Validations were carried out on different dataset, including published RNAi screening using Drosophila embryos [Additional files 1, 2], dataset for cell cycle phase identification using HeLa cells [Additional files 1, 3, 4] and synthetic dataset using polygons, our methods tackled three aforementioned tasks effectively with an accuracy range of 85%–90%. When our method is implemented in the context of a Drosophila genome-scale RNAi image-based screening of cultured cells aimed to identifying the contribution of individual genes towards the regulation of cell-shape, it efficiently discovers meaningful new phenotypes and provides novel biological insight. We also propose a two-step procedure to modify the novelty detection method based on one-class SVM, so that it can be used to online phenotype discovery. In different conditions, we compared the SVM based method with our method using various datasets and our methods consistently outperformed SVM based method in at least two of three tasks by 2% to 5%. These results demonstrate that our methods can be used to better identify novel phenotypes in image-based datasets from a wide range of conditions and organisms. Conclusion We demonstrate that our method can detect various novel phenotypes effectively in complex datasets. Experiment results also validate that our method performs consistently under different order of image input, variation of starting conditions including the number and composition of existing phenotypes, and dataset from different screens. In our findings, the proposed method is suitable for online phenotype discovery in diverse high-throughput image-based genetic and chemical screens. PMID:18534020
Shi, Shuang; Zhong, Dong; Xiao, Yao; Wang, Bing; Wang, Wentao; Zhang, Fu'an; Huang, Haoyang
2017-06-20
Recent studies have shown that increased syndecan-1 (SDC1) expression in human glioma is associated with higher tumor grades and poor prognoses, but its oncogenic functions and the underlying molecular mechanisms remain unknown. Here, we examined SDC1 expression in datasets from The Cancer Genome Atlas and the National Center for Biotechnology Information Gene Expression Omnibus. Elevated SDC1 expression in glioma was closely associated with increases in tumor progression and shorter survival. We also examined SDC1 expression and evaluated the effects of stable SDC1 knockdown in glioma cell lines. SDC1 knockdown attenuated proliferation and invasion by glioma cells and markedly decreased PCNA and MMP-9 mRNA and protein expression. In a xenograft model, SDC1 knockdown suppressed the tumorigenic effects of U87 cells in vivo. SDC1 knockdown decreased phosphorylation of the c-src/FAK complex and its downstream signaling molecules, Erk, Akt and p38 MAPK. These results suggest that SDC1 may be a novel therapeutic target in the treatment of glioma.
Tsao, Yu-Tzu; Shih, Ya-Yi; Liu, Yu-An; Liu, Yi-Shiuan; Lee, Oscar K
2017-02-21
Magnesium is essential for numerous physiological functions. Magnesium exists mostly in bone and the amount is dynamically regulated by skeletal remodeling. Accelerating bone mass loss occurs when magnesium intake is insufficient; whereas high magnesium could lead to mineralization defects. However, the underlying magnesium regulatory mechanisms remain elusive. In the present study, we investigated the effects of high extracellular magnesium concentration on osteogenic differentiation of mesenchymal stromal/stem cells (MSCs) and the role of magnesium transporter SLC41A1 in the mineralization process. Murine MSCs derived from the bone marrow of BALB/c mouse or commercially purchased human MSCs were treated with osteogenic induction medium containing 5.8 mM magnesium chloride and the osteogenic differentiation efficiency was compared with that of MSCs in normal differentiation medium containing 0.8 mM magnesium chloride by cell morphology, gene expression profile of osteogenic markers, and Alizarin Red staining. Slc41a1 gene knockdown in MSCs was performed by siRNA transfection using Lipofectamine RNAiMAX, and the differentiation efficiency of siRNA-treated MSCs was also assessed. High concentration of extracellular magnesium ion inhibited mineralization during osteogenic differentiation of MSCs. Early osteogenic marker genes including osterix, alkaline phosphatase, and type I collagen were significantly downregulated in MSCs under high concentration of magnesium, whereas late marker genes such as osteopontin, osteocalcin, and bone morphogenetic protein 2 were upregulated with statistical significance compared with those in normal differentiation medium containing 0.8 mM magnesium. siRNA treatment targeting SLC41A1 magnesium transporter, a member of the solute carrier family with a predominant Mg 2+ efflux system, accelerated the mineralization process and ameliorated the inhibition of mineralization caused by high concentration of magnesium. High concentration of
Bowerman, Bruce
2011-10-01
Molecular genetic investigation of the early Caenorhabditis elegans embryo has contributed substantially to the discovery and general understanding of the genes, pathways, and mechanisms that regulate and execute developmental and cell biological processes. Initially, worm geneticists relied exclusively on a classical genetics approach, isolating mutants with interesting phenotypes after mutagenesis and then determining the identity of the affected genes. Subsequently, the discovery of RNA interference (RNAi) led to a much greater reliance on a reverse genetics approach: reducing the function of known genes with RNAi and then observing the phenotypic consequences. Now the advent of next-generation DNA sequencing technologies and the ensuing ease and affordability of whole-genome sequencing are reviving the use of classical genetics to investigate early C. elegans embryogenesis.
Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen
2013-01-01
RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I
2015-01-01
We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.
RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).
Asad, M
2006-01-01
The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.
Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R
2017-08-07
The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.
2016-10-01
October 2016 TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION...MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012...the treatment of ovarian cancer. 4 KEYWORDS: Ovarian cancer, RNAi, targeting, pathways, novel therapeutics Research Accomplishments Major Task 1
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.
2013-01-01
Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. PMID:23941992