Tsai, Yu-Shuen; Aguan, Kripamoy; Pal, Nikhil R.; Chung, I-Fang
2011-01-01
Informative genes from microarray data can be used to construct prediction model and investigate biological mechanisms. Differentially expressed genes, the main targets of most gene selection methods, can be classified as single- and multiple-class specific signature genes. Here, we present a novel gene selection algorithm based on a Group Marker Index (GMI), which is intuitive, of low-computational complexity, and efficient in identification of both types of genes. Most gene selection methods identify only single-class specific signature genes and cannot identify multiple-class specific signature genes easily. Our algorithm can detect de novo certain conditions of multiple-class specificity of a gene and makes use of a novel non-parametric indicator to assess the discrimination ability between classes. Our method is effective even when the sample size is small as well as when the class sizes are significantly different. To compare the effectiveness and robustness we formulate an intuitive template-based method and use four well-known datasets. We demonstrate that our algorithm outperforms the template-based method in difficult cases with unbalanced distribution. Moreover, the multiple-class specific genes are good biomarkers and play important roles in biological pathways. Our literature survey supports that the proposed method identifies unique multiple-class specific marker genes (not reported earlier to be related to cancer) in the Central Nervous System data. It also discovers unique biomarkers indicating the intrinsic difference between subtypes of lung cancer. We also associate the pathway information with the multiple-class specific signature genes and cross-reference to published studies. We find that the identified genes participate in the pathways directly involved in cancer development in leukemia data. Our method gives a promising way to find genes that can involve in pathways of multiple diseases and hence opens up the possibility of using an existing drug on other diseases as well as designing a single drug for multiple diseases. PMID:21909426
Modise, David M.; Gemeildien, Junaid; Ndimba, Bongani K.; Christoffels, Alan
2018-01-01
Background Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations. Methods In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO), Trait Ontology (TO), Plant Ontology (PO), Growth Ontology (GRO) and Environment Ontology (EO) were used to semantically integrate drought related information. Results Target genes linked to Quantitative Trait Loci (QTLs) controlling yield and stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%), salt (32%), cold (20%), heat (8%) and oxidative stress (25%) were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs associated with different traits that are responsive to multiple stresses. Ontology mapping was used to validate the identified genes, while reconstruction of the phylogenetic tree was instrumental to infer the evolutionary relationship of the sorghum orthologs. The results also show specific genes responsible for various interrelated components of drought response mechanism such as drought tolerance, drought avoidance and drought escape. Conclusions We submit that this approach is novel and to our knowledge, has not been used previously in any other research; it enables us to perform cross-species queries for genes that are likely to be associated with multiple stress tolerance, as a means to identify novel targets for engineering stress resistance in sorghum and possibly, in other crop species. PMID:29590108
GeneNetFinder2: Improved Inference of Dynamic Gene Regulatory Relations with Multiple Regulators.
Han, Kyungsook; Lee, Jeonghoon
2016-01-01
A gene involved in complex regulatory interactions may have multiple regulators since gene expression in such interactions is often controlled by more than one gene. Another thing that makes gene regulatory interactions complicated is that regulatory interactions are not static, but change over time during the cell cycle. Most research so far has focused on identifying gene regulatory relations between individual genes in a particular stage of the cell cycle. In this study we developed a method for identifying dynamic gene regulations of several types from the time-series gene expression data. The method can find gene regulations with multiple regulators that work in combination or individually as well as those with single regulators. The method has been implemented as the second version of GeneNetFinder (hereafter called GeneNetFinder2) and tested on several gene expression datasets. Experimental results with gene expression data revealed the existence of genes that are not regulated by individual genes but rather by a combination of several genes. Such gene regulatory relations cannot be found by conventional methods. Our method finds such regulatory relations as well as those with multiple, independent regulators or single regulators, and represents gene regulatory relations as a dynamic network in which different gene regulatory relations are shown in different stages of the cell cycle. GeneNetFinder2 is available at http://bclab.inha.ac.kr/GeneNetFinder and will be useful for modeling dynamic gene regulations with multiple regulators.
Chen, Junhui; Meng, Yuhuan; Zhou, Jinghui; Zhuo, Min; Ling, Fei; Zhang, Yu; Du, Hongli; Wang, Xiaoning
2013-01-01
Type 2 Diabetes Mellitus (T2DM) and obesity have become increasingly prevalent in recent years. Recent studies have focused on identifying causal variations or candidate genes for obesity and T2DM via analysis of expression quantitative trait loci (eQTL) within a single tissue. T2DM and obesity are affected by comprehensive sets of genes in multiple tissues. In the current study, gene expression levels in multiple human tissues from GEO datasets were analyzed, and 21 candidate genes displaying high percentages of differential expression were filtered out. Specifically, DENND1B, LYN, MRPL30, POC1B, PRKCB, RP4-655J12.3, HIBADH, and TMBIM4 were identified from the T2DM-control study, and BCAT1, BMP2K, CSRNP2, MYNN, NCKAP5L, SAP30BP, SLC35B4, SP1, BAP1, GRB14, HSP90AB1, ITGA5, and TOMM5 were identified from the obesity-control study. The majority of these genes are known to be involved in T2DM and obesity. Therefore, analysis of gene expression in various tissues using GEO datasets may be an effective and feasible method to determine novel or causal genes associated with T2DM and obesity.
Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan
2007-09-11
Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.
Taguchi, Y-H
2018-05-08
Even though coexistence of multiple phenotypes sharing the same genomic background is interesting, it remains incompletely understood. Epigenomic profiles may represent key factors, with unknown contributions to the development of multiple phenotypes, and social-insect castes are a good model for elucidation of the underlying mechanisms. Nonetheless, previous studies have failed to identify genes associated with aberrant gene expression and methylation profiles because of the lack of suitable methodology that can address this problem properly. A recently proposed principal component analysis (PCA)-based and tensor decomposition (TD)-based unsupervised feature extraction (FE) can solve this problem because these two approaches can deal with gene expression and methylation profiles even when a small number of samples is available. PCA-based and TD-based unsupervised FE methods were applied to the analysis of gene expression and methylation profiles in the brains of two social insects, Polistes canadensis and Dinoponera quadriceps. Genes associated with differential expression and methylation between castes were identified, and analysis of enrichment of Gene Ontology terms confirmed reliability of the obtained sets of genes from the biological standpoint. Biologically relevant genes, shown to be associated with significant differential gene expression and methylation between castes, were identified here for the first time. The identification of these genes may help understand the mechanisms underlying epigenetic control of development of multiple phenotypes under the same genomic conditions.
Kassambara, Alboukadel; Hose, Dirk; Moreaux, Jérôme; Walker, Brian A.; Protopopov, Alexei; Reme, Thierry; Pellestor, Franck; Pantesco, Véronique; Jauch, Anna; Morgan, Gareth; Goldschmidt, Hartmut; Klein, Bernard
2012-01-01
Background Genetic abnormalities are common in patients with multiple myeloma, and may deregulate gene products involved in tumor survival, proliferation, metabolism and drug resistance. In particular, translocations may result in a high expression of targeted genes (termed spike expression) in tumor cells. We identified spike genes in multiple myeloma cells of patients with newly-diagnosed myeloma and investigated their prognostic value. Design and Methods Genes with a spike expression in multiple myeloma cells were picked up using box plot probe set signal distribution and two selection filters. Results In a cohort of 206 newly diagnosed patients with multiple myeloma, 2587 genes/expressed sequence tags with a spike expression were identified. Some spike genes were associated with some transcription factors such as MAF or MMSET and with known recurrent translocations as expected. Spike genes were not associated with increased DNA copy number and for a majority of them, involved unknown mechanisms. Of spiked genes, 36.7% clustered significantly in 149 out of 862 documented chromosome (sub)bands, of which 53 had prognostic value (35 bad, 18 good). Their prognostic value was summarized with a spike band score that delineated 23.8% of patients with a poor median overall survival (27.4 months versus not reached, P<0.001) using the training cohort of 206 patients. The spike band score was independent of other gene expression profiling-based risk scores, t(4;14), or del17p in an independent validation cohort of 345 patients. Conclusions We present a new approach to identify spike genes and their relationship to patients’ survival. PMID:22102711
Tong, Pan; Coombes, Kevin R
2012-11-15
Identifying genes altered in cancer plays a crucial role in both understanding the mechanism of carcinogenesis and developing novel therapeutics. It is known that there are various mechanisms of regulation that can lead to gene dysfunction, including copy number change, methylation, abnormal expression, mutation and so on. Nowadays, all these types of alterations can be simultaneously interrogated by different types of assays. Although many methods have been proposed to identify altered genes from a single assay, there is no method that can deal with multiple assays accounting for different alteration types systematically. In this article, we propose a novel method, integration using item response theory (integIRTy), to identify altered genes by using item response theory that allows integrated analysis of multiple high-throughput assays. When applied to a single assay, the proposed method is more robust and reliable than conventional methods such as Student's t-test or the Wilcoxon rank-sum test. When used to integrate multiple assays, integIRTy can identify novel-altered genes that cannot be found by looking at individual assay separately. We applied integIRTy to three public cancer datasets (ovarian carcinoma, breast cancer, glioblastoma) for cross-assay type integration which all show encouraging results. The R package integIRTy is available at the web site http://bioinformatics.mdanderson.org/main/OOMPA:Overview. kcoombes@mdanderson.org. Supplementary data are available at Bioinformatics online.
Ji, S C; Pan, Y T; Lu, Q Y; Sun, Z Y; Liu, Y Z
2014-03-17
The purpose of this study was to identify critical genes associated with septic multiple trauma by comparing peripheral whole blood samples from multiple trauma patients with and without sepsis. A microarray data set was downloaded from the Gene Expression Omnibus (GEO) database. This data set included 70 samples, 36 from multiple trauma patients with sepsis and 34 from multiple trauma patients without sepsis (as a control set). The data were preprocessed, and differentially expressed genes (DEGs) were then screened for using packages of the R language. Functional analysis of DEGs was performed with DAVID. Interaction networks were then established for the most up- and down-regulated genes using HitPredict. Pathway-enrichment analysis was conducted for genes in the networks using WebGestalt. Fifty-eight DEGs were identified. The expression levels of PLAU (down-regulated) and MMP8 (up-regulated) presented the largest fold-changes, and interaction networks were established for these genes. Further analysis revealed that PLAT (plasminogen activator, tissue) and SERPINF2 (serpin peptidase inhibitor, clade F, member 2), which interact with PLAU, play important roles in the pathway of the component and coagulation cascade. We hypothesize that PLAU is a major regulator of the component and coagulation cascade, and down-regulation of PLAU results in dysfunction of the pathway, causing sepsis.
Circadian Enhancers Coordinate Multiple Phases of Rhythmic Gene Transcription In Vivo
Fang, Bin; Everett, Logan J.; Jager, Jennifer; Briggs, Erika; Armour, Sean M.; Feng, Dan; Roy, Ankur; Gerhart-Hines, Zachary; Sun, Zheng; Lazar, Mitchell A.
2014-01-01
SUMMARY Mammalian transcriptomes display complex circadian rhythms with multiple phases of gene expression that cannot be accounted for by current models of the molecular clock. We have determined the underlying mechanisms by measuring nascent RNA transcription around the clock in mouse liver. Unbiased examination of eRNAs that cluster in specific circadian phases identified functional enhancers driven by distinct transcription factors (TFs). We further identify on a global scale the components of the TF cistromes that function to orchestrate circadian gene expression. Integrated genomic analyses also revealed novel mechanisms by which a single circadian factor controls opposing transcriptional phases. These findings shed new light on the diversity and specificity of TF function in the generation of multiple phases of circadian gene transcription in a mammalian organ. PMID:25416951
Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo.
Fang, Bin; Everett, Logan J; Jager, Jennifer; Briggs, Erika; Armour, Sean M; Feng, Dan; Roy, Ankur; Gerhart-Hines, Zachary; Sun, Zheng; Lazar, Mitchell A
2014-11-20
Mammalian transcriptomes display complex circadian rhythms with multiple phases of gene expression that cannot be accounted for by current models of the molecular clock. We have determined the underlying mechanisms by measuring nascent RNA transcription around the clock in mouse liver. Unbiased examination of enhancer RNAs (eRNAs) that cluster in specific circadian phases identified functional enhancers driven by distinct transcription factors (TFs). We further identify on a global scale the components of the TF cistromes that function to orchestrate circadian gene expression. Integrated genomic analyses also revealed mechanisms by which a single circadian factor controls opposing transcriptional phases. These findings shed light on the diversity and specificity of TF function in the generation of multiple phases of circadian gene transcription in a mammalian organ.
2013-01-01
Background Colorectal cancer is the third leading cause of cancer deaths in the United States. The initial assessment of colorectal cancer involves clinical staging that takes into account the extent of primary tumor invasion, determining the number of lymph nodes with metastatic cancer and the identification of metastatic sites in other organs. Advanced clinical stage indicates metastatic cancer, either in regional lymph nodes or in distant organs. While the genomic and genetic basis of colorectal cancer has been elucidated to some degree, less is known about the identity of specific cancer genes that are associated with advanced clinical stage and metastasis. Methods We compiled multiple genomic data types (mutations, copy number alterations, gene expression and methylation status) as well as clinical meta-data from The Cancer Genome Atlas (TCGA). We used an elastic-net regularized regression method on the combined genomic data to identify genetic aberrations and their associated cancer genes that are indicators of clinical stage. We ranked candidate genes by their regression coefficient and level of support from multiple assay modalities. Results A fit of the elastic-net regularized regression to 197 samples and integrated analysis of four genomic platforms identified the set of top gene predictors of advanced clinical stage, including: WRN, SYK, DDX5 and ADRA2C. These genetic features were identified robustly in bootstrap resampling analysis. Conclusions We conducted an analysis integrating multiple genomic features including mutations, copy number alterations, gene expression and methylation. This integrated approach in which one considers all of these genomic features performs better than any individual genomic assay. We identified multiple genes that robustly delineate advanced clinical stage, suggesting their possible role in colorectal cancer metastatic progression. PMID:24308539
Yang, Ze-Hui; Zheng, Rui; Gao, Yuan; Zhang, Qiang
2016-09-01
With the widespread application of high-throughput technology, numerous meta-analysis methods have been proposed for differential expression profiling across multiple studies. We identified the suitable differentially expressed (DE) genes that contributed to lung adenocarcinoma (ADC) clustering based on seven popular multiple meta-analysis methods. Seven microarray expression profiles of ADC and normal controls were extracted from the ArrayExpress database. The Bioconductor was used to perform the data preliminary preprocessing. Then, DE genes across multiple studies were identified. Hierarchical clustering was applied to compare the classification performance for microarray data samples. The classification efficiency was compared based on accuracy, sensitivity and specificity. Across seven datasets, 573 ADC cases and 222 normal controls were collected. After filtering out unexpressed and noninformative genes, 3688 genes were remained for further analysis. The classification efficiency analysis showed that DE genes identified by sum of ranks method separated ADC from normal controls with the best accuracy, sensitivity and specificity of 0.953, 0.969 and 0.932, respectively. The gene set with the highest classification accuracy mainly participated in the regulation of response to external stimulus (P = 7.97E-04), cyclic nucleotide-mediated signaling (P = 0.01), regulation of cell morphogenesis (P = 0.01) and regulation of cell proliferation (P = 0.01). Evaluation of DE genes identified by different meta-analysis methods in classification efficiency provided a new perspective to the choice of the suitable method in a given application. Varying meta-analysis methods always present varying abilities, so synthetic consideration should be taken when providing meta-analysis methods for particular research. © 2015 John Wiley & Sons Ltd.
Integrative Analysis of Prognosis Data on Multiple Cancer Subtypes
Liu, Jin; Huang, Jian; Zhang, Yawei; Lan, Qing; Rothman, Nathaniel; Zheng, Tongzhang; Ma, Shuangge
2014-01-01
Summary In cancer research, profiling studies have been extensively conducted, searching for genes/SNPs associated with prognosis. Cancer is diverse. Examining the similarity and difference in the genetic basis of multiple subtypes of the same cancer can lead to a better understanding of their connections and distinctions. Classic meta-analysis methods analyze each subtype separately and then compare analysis results across subtypes. Integrative analysis methods, in contrast, analyze the raw data on multiple subtypes simultaneously and can outperform meta-analysis methods. In this study, prognosis data on multiple subtypes of the same cancer are analyzed. An AFT (accelerated failure time) model is adopted to describe survival. The genetic basis of multiple subtypes is described using the heterogeneity model, which allows a gene/SNP to be associated with prognosis of some subtypes but not others. A compound penalization method is developed to identify genes that contain important SNPs associated with prognosis. The proposed method has an intuitive formulation and is realized using an iterative algorithm. Asymptotic properties are rigorously established. Simulation shows that the proposed method has satisfactory performance and outperforms a penalization-based meta-analysis method and a regularized thresholding method. An NHL (non-Hodgkin lymphoma) prognosis study with SNP measurements is analyzed. Genes associated with the three major subtypes, namely DLBCL, FL, and CLL/SLL, are identified. The proposed method identifies genes that are different from alternatives and have important implications and satisfactory prediction performance. PMID:24766212
Microarray gene expression profiling analysis combined with bioinformatics in multiple sclerosis.
Liu, Mingyuan; Hou, Xiaojun; Zhang, Ping; Hao, Yong; Yang, Yiting; Wu, Xiongfeng; Zhu, Desheng; Guan, Yangtai
2013-05-01
Multiple sclerosis (MS) is the most prevalent demyelinating disease and the principal cause of neurological disability in young adults. Recent microarray gene expression profiling studies have identified several genetic variants contributing to the complex pathogenesis of MS, however, expressional and functional studies are still required to further understand its molecular mechanism. The present study aimed to analyze the molecular mechanism of MS using microarray analysis combined with bioinformatics techniques. We downloaded the gene expression profile of MS from Gene Expression Omnibus (GEO) and analysed the microarray data using the differentially coexpressed genes (DCGs) and links package in R and Database for Annotation, Visualization and Integrated Discovery. The regulatory impact factor (RIF) algorithm was used to measure the impact factor of transcription factor. A total of 1,297 DCGs between MS patients and healthy controls were identified. Functional annotation indicated that these DCGs were associated with immune and neurological functions. Furthermore, the RIF result suggested that IKZF1, BACH1, CEBPB, EGR1, FOS may play central regulatory roles in controlling gene expression in the pathogenesis of MS. Our findings confirm the presence of multiple molecular alterations in MS and indicate the possibility for identifying prognostic factors associated with MS pathogenesis.
Plevova, Karla; Francova, Hana Skuhrova; Burckova, Katerina; Brychtova, Yvona; Doubek, Michael; Pavlova, Sarka; Malcikova, Jitka; Mayer, Jiri; Tichy, Boris; Pospisilova, Sarka
2014-01-01
In chronic lymphocytic leukemia, usually a monoclonal disease, multiple productive immunoglobulin heavy chain gene rearrangements are identified sporadically. Prognostication of such cases based on immunoglobulin heavy variable gene mutational status can be problematic, especially if the different rearrangements have discordant mutational status. To gain insight into the possible biological mechanisms underlying the origin of the multiple rearrangements, we performed a comprehensive immunogenetic and immunophenotypic characterization of 31 cases with the multiple rearrangements identified in a cohort of 1147 patients with chronic lymphocytic leukemia. For the majority of cases (25/31), we provide evidence of the co-existence of at least two B lymphocyte clones with a chronic lymphocytic leukemia phenotype. We also identified clonal drifts in serial samples, likely driven by selection forces. More specifically, higher immunoglobulin variable gene identity to germline and longer complementarity determining region 3 were preferred in persistent or newly appearing clones, a phenomenon more pronounced in patients with stereotyped B-cell receptors. Finally, we report that other factors, such as TP53 gene defects and therapy administration, influence clonal selection. Our findings are relevant to clonal evolution in the context of antigen stimulation and transition of monoclonal B-cell lymphocytosis to chronic lymphocytic leukemia. PMID:24038023
Doi, Ayano; Ichinohe, Risa; Ikuyo, Yoriko; Takahashi, Teruyoshi; Marui, Shigetaka; Yasuhara, Koji; Nakamura, Tetsuro; Sugita, Shintaro; Sakamoto, Hiromi; Yoshida, Teruhiko; Hasegawa, Tadashi
2014-01-01
The diagnosis and treatment of soft tissue sarcomas (STS) have been difficult. Of the diverse histological subtypes, undifferentiated pleomorphic sarcoma (UPS) is particularly difficult to diagnose accurately, and its classification per se is still controversial. Recent advances in genomic technologies provide an excellent way to address such problems. However, it is often difficult, if not impossible, to identify definitive disease-associated genes using genome-wide analysis alone, primarily because of multiple testing problems. In the present study, we analyzed microarray data from 88 STS patients using a combination method that used knowledge-based filtering and a simulation based on the integration of multiple statistics to reduce multiple testing problems. We identified 25 genes, including hypoxia-related genes (e.g., MIF, SCD1, P4HA1, ENO1, and STAT1) and cell cycle- and DNA repair-related genes (e.g., TACC3, PRDX1, PRKDC, and H2AFY). These genes showed significant differential expression among histological subtypes, including UPS, and showed associations with overall survival. STAT1 showed a strong association with overall survival in UPS patients (logrank p = 1.84×10−6 and adjusted p value 2.99×10−3 after the permutation test). According to the literature, the 25 genes selected are useful not only as markers of differential diagnosis but also as prognostic/predictive markers and/or therapeutic targets for STS. Our combination method can identify genes that are potential prognostic/predictive factors and/or therapeutic targets in STS and possibly in other cancers. These disease-associated genes deserve further preclinical and clinical validation. PMID:25188299
Jia, Peilin; Wang, Lily; Fanous, Ayman H.; Pato, Carlos N.; Edwards, Todd L.; Zhao, Zhongming
2012-01-01
With the recent success of genome-wide association studies (GWAS), a wealth of association data has been accomplished for more than 200 complex diseases/traits, proposing a strong demand for data integration and interpretation. A combinatory analysis of multiple GWAS datasets, or an integrative analysis of GWAS data and other high-throughput data, has been particularly promising. In this study, we proposed an integrative analysis framework of multiple GWAS datasets by overlaying association signals onto the protein-protein interaction network, and demonstrated it using schizophrenia datasets. Building on a dense module search algorithm, we first searched for significantly enriched subnetworks for schizophrenia in each single GWAS dataset and then implemented a discovery-evaluation strategy to identify module genes with consistent association signals. We validated the module genes in an independent dataset, and also examined them through meta-analysis of the related SNPs using multiple GWAS datasets. As a result, we identified 205 module genes with a joint effect significantly associated with schizophrenia; these module genes included a number of well-studied candidate genes such as DISC1, GNA12, GNA13, GNAI1, GPR17, and GRIN2B. Further functional analysis suggested these genes are involved in neuronal related processes. Additionally, meta-analysis found that 18 SNPs in 9 module genes had P meta<1×10−4, including the gene HLA-DQA1 located in the MHC region on chromosome 6, which was reported in previous studies using the largest cohort of schizophrenia patients to date. These results demonstrated our bi-directional network-based strategy is efficient for identifying disease-associated genes with modest signals in GWAS datasets. This approach can be applied to any other complex diseases/traits where multiple GWAS datasets are available. PMID:22792057
Pediatric Multiple Sclerosis: Genes, Environment, and a Comprehensive Therapeutic Approach.
Cappa, Ryan; Theroux, Liana; Brenton, J Nicholas
2017-10-01
Pediatric multiple sclerosis is an increasingly recognized and studied disorder that accounts for 3% to 10% of all patients with multiple sclerosis. The risk for pediatric multiple sclerosis is thought to reflect a complex interplay between environmental and genetic risk factors. Environmental exposures, including sunlight (ultraviolet radiation, vitamin D levels), infections (Epstein-Barr virus), passive smoking, and obesity, have been identified as potential risk factors in youth. Genetic predisposition contributes to the risk of multiple sclerosis, and the major histocompatibility complex on chromosome 6 makes the single largest contribution to susceptibility to multiple sclerosis. With the use of large-scale genome-wide association studies, other non-major histocompatibility complex alleles have been identified as independent risk factors for the disease. The bridge between environment and genes likely lies in the study of epigenetic processes, which are environmentally-influenced mechanisms through which gene expression may be modified. This article will review these topics to provide a framework for discussion of a comprehensive approach to counseling and ultimately treating the pediatric patient with multiple sclerosis. Copyright © 2017 Elsevier Inc. All rights reserved.
Gene panel testing for hereditary breast cancer.
Winship, Ingrid; Southey, Melissa C
2016-03-21
Inherited predisposition to breast cancer is explained only in part by mutations in the BRCA1 and BRCA2 genes. Most families with an apparent familial clustering of breast cancer who are investigated through Australia's network of genetic services and familial cancer centres do not have mutations in either of these genes. More recently, additional breast cancer predisposition genes, such as PALB2, have been identified. New genetic technology allows a panel of multiple genes to be tested for mutations in a single test. This enables more women and their families to have risk assessment and risk management, in a preventive approach to predictable breast cancer. Predictive testing for a known family-specific mutation in a breast cancer predisposition gene provides personalised risk assessment and evidence-based risk management. Breast cancer predisposition gene panel tests have a greater diagnostic yield than conventional testing of only the BRCA1 and BRCA2 genes. The clinical validity and utility of some of the putative breast cancer predisposition genes is not yet clear. Ethical issues warrant consideration, as multiple gene panel testing has the potential to identify secondary findings not originally sought by the test requested. Multiple gene panel tests may provide an affordable and effective way to investigate the heritability of breast cancer.
Examination of association to autism of common genetic variationin genes related to dopamine.
Anderson, B M; Schnetz-Boutaud, N; Bartlett, J; Wright, H H; Abramson, R K; Cuccaro, M L; Gilbert, J R; Pericak-Vance, M A; Haines, J L
2008-12-01
Autism is a severe neurodevelopmental disorder characterized by a triad of complications. Autistic individuals display significant disturbances in language and reciprocal social interactions, combined with repetitive and stereotypic behaviors. Prevalence studies suggest that autism is more common than originally believed, with recent estimates citing a rate of one in 150. Although multiple genetic linkage and association studies have yielded multiple suggestive genes or chromosomal regions, a specific risk locus has yet to be identified and widely confirmed. Because many etiologies have been suggested for this complex syndrome, we hypothesize that one of the difficulties in identifying autism genes is that multiple genetic variants may be required to significantly increase the risk of developing autism. Thus, we took the alternative approach of examining 14 prominent dopamine pathway candidate genes for detailed study by genotyping 28 single nucleotide polymorphisms. Although we did observe a nominally significant association for rs2239535 (P=0.008) on chromosome 20, single-locus analysis did not reveal any results as significant after correction for multiple comparisons. No significant interaction was identified when Multifactor Dimensionality Reduction was employed to test specifically for multilocus effects. Although genome-wide linkage scans in autism have provided support for linkage to various loci along the dopamine pathway, our study does not provide strong evidence of linkage or association to any specific gene or combination of genes within the pathway. These results demonstrate that common genetic variation within the tested genes located within this pathway at most play a minor to moderate role in overall autism pathogenesis.
Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N
2016-01-01
The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust fungus. Upregulation of gene expression in haustoria and evidence for diversifying selection are two useful parameters to identify candidate Avr genes. Recently, we have also applied machine learning approaches to agnostically predict candidate effectors. Here, we review progress in stem rust pathogenomics and approaches currently underway to identify Avr genes recognized by wheat Sr genes.
Anti-inflammatory genes associated with multiple sclerosis: a gene expression study.
Perga, S; Montarolo, F; Martire, S; Berchialla, P; Malucchi, S; Bertolotto, A
2015-02-15
Multiple sclerosis (MS) is an autoimmune inflammatory disease of the central nervous system caused by a complex interaction between multiple genes and environmental factors. HLA region is the strongest susceptibility locus, but recent huge genome-wide association studies identified new susceptibility genes. Among these, BACH2, PTGER4, RGS1 and ZFP36L1 were highlighted. Here, a gene expression analysis revealed that three of them, namely BACH2, PTGER4 and ZFP36L1, are down-regulated in MS patients' blood cells compared to healthy subjects. Interestingly, all these genes are involved in the immune system regulation with predominant anti-inflammatory role and their reduction could predispose to MS development. Copyright © 2015 Elsevier B.V. All rights reserved.
Safari-Alighiarloo, Nahid; Taghizadeh, Mohammad; Tabatabaei, Seyyed Mohammad; Namaki, Saeed
2016-01-01
Background The involvement of multiple genes and missing heritability, which are dominant in complex diseases such as multiple sclerosis (MS), entail using network biology to better elucidate their molecular basis and genetic factors. We therefore aimed to integrate interactome (protein–protein interaction (PPI)) and transcriptomes data to construct and analyze PPI networks for MS disease. Methods Gene expression profiles in paired cerebrospinal fluid (CSF) and peripheral blood mononuclear cells (PBMCs) samples from MS patients, sampled in relapse or remission and controls, were analyzed. Differentially expressed genes which determined only in CSF (MS vs. control) and PBMCs (relapse vs. remission) separately integrated with PPI data to construct the Query-Query PPI (QQPPI) networks. The networks were further analyzed to investigate more central genes, functional modules and complexes involved in MS progression. Results The networks were analyzed and high centrality genes were identified. Exploration of functional modules and complexes showed that the majority of high centrality genes incorporated in biological pathways driving MS pathogenesis. Proteasome and spliceosome were also noticeable in enriched pathways in PBMCs (relapse vs. remission) which were identified by both modularity and clique analyses. Finally, STK4, RB1, CDKN1A, CDK1, RAC1, EZH2, SDCBP genes in CSF (MS vs. control) and CDC37, MAP3K3, MYC genes in PBMCs (relapse vs. remission) were identified as potential candidate genes for MS, which were the more central genes involved in biological pathways. Discussion This study showed that network-based analysis could explicate the complex interplay between biological processes underlying MS. Furthermore, an experimental validation of candidate genes can lead to identification of potential therapeutic targets. PMID:28028462
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.
Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less
Law, Sheran Hiu Wan; Redelings, Benjamin David; Kullman, Seth William
2012-01-15
The availability of multiple teleost (bony fish) genomes is providing unprecedented opportunities to understand the diversity and function of gene duplication events using comparative genomics. Here we examine multiple paralogous genes of γ-glutamyl transferase (GGT) in several distantly related teleost species including medaka, stickleback, green spotted pufferfish, fugu, and zebrafish. Through mining genome databases, we have identified multiple GGT orthologs. Duplicate (paralogous) GGT sequences for GGT1 (GGT1 a and b), GGTL1 (GGTL1 a and b), and GGTL3 (GGTL3 a and b) were identified for each species. Phylogenetic analysis suggests that GGTs are ancient proteins conserved across most metazoan phyla and those paralogous GGTs in teleosts likely arose from the serial 3R genome duplication events. A third GGTL1 gene (GGTL1c) was found in green spotted pufferfish; however, this gene is not present in medaka, stickleback, or fugu. Similarly, one or both paralogs of GGTL3 appear to have been lost in green spotted pufferfish, fugu, and zebrafish. Syntenic relationships were highly maintained between duplicated teleost chromosomes, among teleosts and across ray-finned (Actinopterygii) and lobe-finned (Sarcopterygii) species. To assess subfunction partitioning, six medaka GGT genes were cloned and assessed for developmental and tissue-specific expression. On the basis of these data, we propose a modification of the "duplication-degeneration-complementation" model of subfunction partitioning where quantitative differences rather than absolute differences in gene expression are observed between gene paralogs. Our results demonstrate that multiple GGT genes have been retained within teleost genomes. Questions remain, however, regarding the functional roles of multiple GGTs in these species. Copyright © 2011 Wiley Periodicals, Inc., A Wiley Company.
Comprehensive Characterization of Cancer Driver Genes and Mutations.
Bailey, Matthew H; Tokheim, Collin; Porta-Pardo, Eduard; Sengupta, Sohini; Bertrand, Denis; Weerasinghe, Amila; Colaprico, Antonio; Wendl, Michael C; Kim, Jaegil; Reardon, Brendan; Ng, Patrick Kwok-Shing; Jeong, Kang Jin; Cao, Song; Wang, Zixing; Gao, Jianjiong; Gao, Qingsong; Wang, Fang; Liu, Eric Minwei; Mularoni, Loris; Rubio-Perez, Carlota; Nagarajan, Niranjan; Cortés-Ciriano, Isidro; Zhou, Daniel Cui; Liang, Wen-Wei; Hess, Julian M; Yellapantula, Venkata D; Tamborero, David; Gonzalez-Perez, Abel; Suphavilai, Chayaporn; Ko, Jia Yu; Khurana, Ekta; Park, Peter J; Van Allen, Eliezer M; Liang, Han; Lawrence, Michael S; Godzik, Adam; Lopez-Bigas, Nuria; Stuart, Josh; Wheeler, David; Getz, Gad; Chen, Ken; Lazar, Alexander J; Mills, Gordon B; Karchin, Rachel; Ding, Li
2018-04-05
Identifying molecular cancer drivers is critical for precision oncology. Multiple advanced algorithms to identify drivers now exist, but systematic attempts to combine and optimize them on large datasets are few. We report a PanCancer and PanSoftware analysis spanning 9,423 tumor exomes (comprising all 33 of The Cancer Genome Atlas projects) and using 26 computational tools to catalog driver genes and mutations. We identify 299 driver genes with implications regarding their anatomical sites and cancer/cell types. Sequence- and structure-based analyses identified >3,400 putative missense driver mutations supported by multiple lines of evidence. Experimental validation confirmed 60%-85% of predicted mutations as likely drivers. We found that >300 MSI tumors are associated with high PD-1/PD-L1, and 57% of tumors analyzed harbor putative clinically actionable events. Our study represents the most comprehensive discovery of cancer genes and mutations to date and will serve as a blueprint for future biological and clinical endeavors. Published by Elsevier Inc.
Paisitkriangkrai, Sakrapee; Quek, Kelly; Nievergall, Eva; Jabbour, Anissa; Zannettino, Andrew; Kok, Chung Hoow
2018-06-07
Recurrent oncogenic fusion genes play a critical role in the development of various cancers and diseases and provide, in some cases, excellent therapeutic targets. To date, analysis tools that can identify and compare recurrent fusion genes across multiple samples have not been available to researchers. To address this deficiency, we developed Co-occurrence Fusion (Co-fuse), a new and easy to use software tool that enables biologists to merge RNA-seq information, allowing them to identify recurrent fusion genes, without the need for exhaustive data processing. Notably, Co-fuse is based on pattern mining and statistical analysis which enables the identification of hidden patterns of recurrent fusion genes. In this report, we show that Co-fuse can be used to identify 2 distinct groups within a set of 49 leukemic cell lines based on their recurrent fusion genes: a multiple myeloma (MM) samples-enriched cluster and an acute myeloid leukemia (AML) samples-enriched cluster. Our experimental results further demonstrate that Co-fuse can identify known driver fusion genes (e.g., IGH-MYC, IGH-WHSC1) in MM, when compared to AML samples, indicating the potential of Co-fuse to aid the discovery of yet unknown driver fusion genes through cohort comparisons. Additionally, using a 272 primary glioma sample RNA-seq dataset, Co-fuse was able to validate recurrent fusion genes, further demonstrating the power of this analysis tool to identify recurrent fusion genes. Taken together, Co-fuse is a powerful new analysis tool that can be readily applied to large RNA-seq datasets, and may lead to the discovery of new disease subgroups and potentially new driver genes, for which, targeted therapies could be developed. The Co-fuse R source code is publicly available at https://github.com/sakrapee/co-fuse .
Wang, Zhishi; Craven, Mark; Newton, Michael A.; Ahlquist, Paul
2013-01-01
Systematic, genome-wide RNA interference (RNAi) analysis is a powerful approach to identify gene functions that support or modulate selected biological processes. An emerging challenge shared with some other genome-wide approaches is that independent RNAi studies often show limited agreement in their lists of implicated genes. To better understand this, we analyzed four genome-wide RNAi studies that identified host genes involved in influenza virus replication. These studies collectively identified and validated the roles of 614 cell genes, but pair-wise overlap among the four gene lists was only 3% to 15% (average 6.7%). However, a number of functional categories were overrepresented in multiple studies. The pair-wise overlap of these enriched-category lists was high, ∼19%, implying more agreement among studies than apparent at the gene level. Probing this further, we found that the gene lists implicated by independent studies were highly connected in interacting networks by independent functional measures such as protein-protein interactions, at rates significantly higher than predicted by chance. We also developed a general, model-based approach to gauge the effects of false-positive and false-negative factors and to estimate, from a limited number of studies, the total number of genes involved in a process. For influenza virus replication, this novel statistical approach estimates the total number of cell genes involved to be ∼2,800. This and multiple other aspects of our experimental and computational results imply that, when following good quality control practices, the low overlap between studies is primarily due to false negatives rather than false-positive gene identifications. These results and methods have implications for and applications to multiple forms of genome-wide analysis. PMID:24068911
Rare Variant Association Test with Multiple Phenotypes
Lee, Selyeong; Won, Sungho; Kim, Young Jin; Kim, Yongkang; Kim, Bong-Jo; Park, Taesung
2016-01-01
Although genome-wide association studies (GWAS) have now discovered thousands of genetic variants associated with common traits, such variants cannot explain the large degree of “missing heritability,” likely due to rare variants. The advent of next generation sequencing technology has allowed rare variant detection and association with common traits, often by investigating specific genomic regions for rare variant effects on a trait. Although multiply correlated phenotypes are often concurrently observed in GWAS, most studies analyze only single phenotypes, which may lessen statistical power. To increase power, multivariate analyses, which consider correlations between multiple phenotypes, can be used. However, few existing multi-variant analyses can identify rare variants for assessing multiple phenotypes. Here, we propose Multivariate Association Analysis using Score Statistics (MAAUSS), to identify rare variants associated with multiple phenotypes, based on the widely used Sequence Kernel Association Test (SKAT) for a single phenotype. We applied MAAUSS to Whole Exome Sequencing (WES) data from a Korean population of 1,058 subjects, to discover genes associated with multiple traits of liver function. We then assessed validation of those genes by a replication study, using an independent dataset of 3,445 individuals. Notably, we detected the gene ZNF620 among five significant genes. We then performed a simulation study to compare MAAUSS's performance with existing methods. Overall, MAAUSS successfully conserved type 1 error rates and in many cases, had a higher power than the existing methods. This study illustrates a feasible and straightforward approach for identifying rare variants correlated with multiple phenotypes, with likely relevance to missing heritability. PMID:28039885
Xia, Wei; Wu, Jian; Deng, Fei-Yan; Wu, Long-Fei; Zhang, Yong-Hong; Guo, Yu-Fan; Lei, Shu-Feng
2017-02-01
Rheumatoid arthritis (RA) is a systemic autoimmune disease. So far, it is unclear whether there exist common RA-related genes shared in different tissues/cells. In this study, we conducted an integrative analysis on multiple datasets to identify potential shared genes that are significant in multiple tissues/cells for RA. Seven microarray gene expression datasets representing various RA-related tissues/cells were downloaded from the Gene Expression Omnibus (GEO). Statistical analyses, testing both marginal and joint effects, were conducted to identify significant genes shared in various samples. Followed-up analyses were conducted on functional annotation clustering analysis, protein-protein interaction (PPI) analysis, gene-based association analysis, and ELISA validation analysis in in-house samples. We identified 18 shared significant genes, which were mainly involved in the immune response and chemokine signaling pathway. Among the 18 genes, eight genes (PPBP, PF4, HLA-F, S100A8, RNASEH2A, P2RY6, JAG2, and PCBP1) interact with known RA genes. Two genes (HLA-F and PCBP1) are significant in gene-based association analysis (P = 1.03E-31, P = 1.30E-2, respectively). Additionally, PCBP1 also showed differential protein expression levels in in-house case-control plasma samples (P = 2.60E-2). This study represented the first effort to identify shared RA markers from different functional cells or tissues. The results suggested that one of the shared genes, i.e., PCBP1, is a promising biomarker for RA.
A fast and high performance multiple data integration algorithm for identifying human disease genes
2015-01-01
Background Integrating multiple data sources is indispensable in improving disease gene identification. It is not only due to the fact that disease genes associated with similar genetic diseases tend to lie close with each other in various biological networks, but also due to the fact that gene-disease associations are complex. Although various algorithms have been proposed to identify disease genes, their prediction performances and the computational time still should be further improved. Results In this study, we propose a fast and high performance multiple data integration algorithm for identifying human disease genes. A posterior probability of each candidate gene associated with individual diseases is calculated by using a Bayesian analysis method and a binary logistic regression model. Two prior probability estimation strategies and two feature vector construction methods are developed to test the performance of the proposed algorithm. Conclusions The proposed algorithm is not only generated predictions with high AUC scores, but also runs very fast. When only a single PPI network is employed, the AUC score is 0.769 by using F2 as feature vectors. The average running time for each leave-one-out experiment is only around 1.5 seconds. When three biological networks are integrated, the AUC score using F3 as feature vectors increases to 0.830, and the average running time for each leave-one-out experiment takes only about 12.54 seconds. It is better than many existing algorithms. PMID:26399620
Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish
2014-01-01
MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095
Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija
2012-04-01
Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.
High-throughput discovery of novel developmental phenotypes
Dickinson, Mary E.; Flenniken, Ann M.; Ji, Xiao; Teboul, Lydia; Wong, Michael D.; White, Jacqueline K.; Meehan, Terrence F.; Weninger, Wolfgang J.; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N.; Bower, Lynette; Brown, James M.; Caddle, L. Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J.; Denegre, James M.; Doe, Brendan; Dolan, Mary E.; Edie, Sarah M.; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R.; Hsu, Chih-wei; Johnson, Sara J.; Kalaga, Sowmya; Keith, Lance C.; Lanoue, Louise; Lawson, Thomas N.; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L.; Newbigging, Susan; Nutter, Lauryl M.J.; Peterson, Kevin A.; Ramirez-Solis, Ramiro; Rowland, Douglas J.; Ryder, Edward; Samocha, Kaitlin E.; Seavitt, John R.; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B.; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G.; Tocchini-Valentini, Glauco P.; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C.; Justice, Monica J.; Parkinson, Helen E.; Moore, Mark; Wells, Sara; Braun, Robert E.; Svenson, Karen L.; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R. Mark; Brown, Steve D.M.; Adams, David J.; Lloyd, K.C. Kent; McKerlie, Colin; Beaudet, Arthur L.; Bucan, Maja; Murray, Stephen A.
2016-01-01
Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 lethal genes during the production of the first 1751 unique gene knockouts. Using a standardised phenotyping platform that incorporates high-resolution 3D imaging, we identified novel phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes identified in our screen, thus providing a novel dataset that facilitates prioritization and validation of mutations identified in clinical sequencing efforts. PMID:27626380
GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature.
Ye, Ning; Yin, Hengfu; Liu, Jingjing; Dai, Xiaogang; Yin, Tongming
2015-01-01
The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI) toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.
Silver, Nicholas; Cotroneo, Emanuele; Proctor, Gordon; Osailan, Samira; Paterson, Katherine L; Carpenter, Guy H
2008-01-01
Background Real-time PCR is a reliable tool with which to measure mRNA transcripts, and provides valuable information on gene expression profiles. Endogenous controls such as housekeeping genes are used to normalise mRNA levels between samples for sensitive comparisons of mRNA transcription. Selection of the most stable control gene(s) is therefore critical for the reliable interpretation of gene expression data. For the purpose of this study, 7 commonly used housekeeping genes were investigated in salivary submandibular glands under normal, inflamed, atrophic and regenerative states. Results The program NormFinder identified the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative states, and GAPDH in the atrophic state. For normalisation to multiple housekeeping genes, for each individual state, the optimal number of housekeeping genes as given by geNorm was: ACTB/UBC in the normal, ACTB/YWHAZ in the inflamed, ACTB/HPRT in the atrophic and ACTB/GAPDH in the regenerative state. The most stable housekeeping gene identified between states (compared to normal) was UBC. However, ACTB, identified as one of the most stably expressed genes within states, was found to be one of the most variable between states. Furthermore we demonstrated that normalising between states to ACTB, rather than UBC, introduced an approximately 3 fold magnitude of error. Conclusion Using NormFinder, our studies demonstrated the suitability of HPRT to use as a single gene for normalisation within the normal, inflamed and regenerative groups and GAPDH in the atrophic group. However, if normalising to multiple housekeeping genes, we recommend normalising to those identified by geNorm. For normalisation across the physiological states, we recommend the use of UBC. PMID:18637167
Dynamic regulation of genetic pathways and targets during aging in Caenorhabditis elegans.
He, Kan; Zhou, Tao; Shao, Jiaofang; Ren, Xiaoliang; Zhao, Zhongying; Liu, Dahai
2014-03-01
Numerous genetic targets and some individual pathways associated with aging have been identified using the worm model. However, less is known about the genetic mechanisms of aging in genome wide, particularly at the level of multiple pathways as well as the regulatory networks during aging. Here, we employed the gene expression datasets of three time points during aging in Caenorhabditis elegans (C. elegans) and performed the approach of gene set enrichment analysis (GSEA) on each dataset between adjacent stages. As a result, multiple genetic pathways and targets were identified as significantly down- or up-regulated. Among them, 5 truly aging-dependent signaling pathways including MAPK signaling pathway, mTOR signaling pathway, Wnt signaling pathway, TGF-beta signaling pathway and ErbB signaling pathway as well as 12 significantly associated genes were identified with dynamic expression pattern during aging. On the other hand, the continued declines in the regulation of several metabolic pathways have been demonstrated to display age-related changes. Furthermore, the reconstructed regulatory networks based on three of aging related Chromatin immunoprecipitation experiments followed by sequencing (ChIP-seq) datasets and the expression matrices of 154 involved genes in above signaling pathways provide new insights into aging at the multiple pathways level. The combination of multiple genetic pathways and targets needs to be taken into consideration in future studies of aging, in which the dynamic regulation would be uncovered.
Molecular study on some antibiotic resistant genes in Salmonella spp. isolates
NASA Astrophysics Data System (ADS)
Nabi, Ari Q.
2017-09-01
Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.
Özgür, Arzucan; Hur, Junguk; He, Yongqun
2016-01-01
The Interaction Network Ontology (INO) logically represents biological interactions, pathways, and networks. INO has been demonstrated to be valuable in providing a set of structured ontological terms and associated keywords to support literature mining of gene-gene interactions from biomedical literature. However, previous work using INO focused on single keyword matching, while many interactions are represented with two or more interaction keywords used in combination. This paper reports our extension of INO to include combinatory patterns of two or more literature mining keywords co-existing in one sentence to represent specific INO interaction classes. Such keyword combinations and related INO interaction type information could be automatically obtained via SPARQL queries, formatted in Excel format, and used in an INO-supported SciMiner, an in-house literature mining program. We studied the gene interaction sentences from the commonly used benchmark Learning Logic in Language (LLL) dataset and one internally generated vaccine-related dataset to identify and analyze interaction types containing multiple keywords. Patterns obtained from the dependency parse trees of the sentences were used to identify the interaction keywords that are related to each other and collectively represent an interaction type. The INO ontology currently has 575 terms including 202 terms under the interaction branch. The relations between the INO interaction types and associated keywords are represented using the INO annotation relations: 'has literature mining keywords' and 'has keyword dependency pattern'. The keyword dependency patterns were generated via running the Stanford Parser to obtain dependency relation types. Out of the 107 interactions in the LLL dataset represented with two-keyword interaction types, 86 were identified by using the direct dependency relations. The LLL dataset contained 34 gene regulation interaction types, each of which associated with multiple keywords. A hierarchical display of these 34 interaction types and their ancestor terms in INO resulted in the identification of specific gene-gene interaction patterns from the LLL dataset. The phenomenon of having multi-keyword interaction types was also frequently observed in the vaccine dataset. By modeling and representing multiple textual keywords for interaction types, the extended INO enabled the identification of complex biological gene-gene interactions represented with multiple keywords.
Shi, Chang-Xin; Kortüm, K Martin; Zhu, Yuan Xiao; Bruins, Laura A; Jedlowski, Patrick; Votruba, Patrick G; Luo, Moulun; Stewart, Robert A; Ahmann, Jonathan; Braggio, Esteban; Stewart, A Keith
2017-12-01
Bortezomib is highly effective in the treatment of multiple myeloma; however, emergent drug resistance is common. Consequently, we employed CRISPR targeting 19,052 human genes to identify unbiased targets that contribute to bortezomib resistance. Specifically, we engineered an RPMI8226 multiple myeloma cell line to express Cas9 infected by lentiviral vector CRISPR library and cultured derived cells in doses of bortezomib lethal to parental cells. Sequencing was performed on surviving cells to identify inactivated genes responsible for drug resistance. From two independent whole-genome screens, we selected 31 candidate genes and constructed a second CRISPR sgRNA library, specifically targeting each of these 31 genes with four sgRNAs. After secondary screening for bortezomib resistance, the top 20 "resistance" genes were selected for individual validation. Of these 20 targets, the proteasome regulatory subunit PSMC6 was the only gene validated to reproducibly confer bortezomib resistance. We confirmed that inhibition of chymotrypsin-like proteasome activity by bortezomib was significantly reduced in cells lacking PSMC6. We individually investigated other members of the PSMC group (PSMC1 to 5) and found that deficiency in each of those subunits also imparts bortezomib resistance. We found 36 mutations in 19S proteasome subunits out of 895 patients in the IA10 release of the CoMMpass study (https://themmrf.org). Our findings demonstrate that the PSMC6 subunit is the most prominent target required for bortezomib sensitivity in multiple myeloma cells and should be examined in drug-refractory populations. Mol Cancer Ther; 16(12); 2862-70. ©2017 AACR . ©2017 American Association for Cancer Research.
2013-01-01
Background Genetic engineering of industrial microorganisms often suffers from undesirable side effects on essential functions. Reverse engineering is an alternative strategy to improve multifactorial traits like low glycerol/high ethanol yield in yeast fermentation. Previous rational engineering of this trait always affected essential functions like growth and stress tolerance. We have screened Saccharomyces cerevisiae biodiversity for specific alleles causing lower glycerol/higher ethanol yield, assuming higher compatibility with normal cellular functionality. Previous work identified ssk1E330N…K356N as causative allele in strain CBS6412, which displayed the lowest glycerol/ethanol ratio. Results We have now identified a unique segregant, 26B, that shows similar low glycerol/high ethanol production as the superior parent, but lacks the ssk1E330N…K356N allele. Using segregants from the backcross of 26B with the inferior parent strain, we applied pooled-segregant whole-genome sequence analysis and identified three minor quantitative trait loci (QTLs) linked to low glycerol/high ethanol production. Within these QTLs, we identified three novel alleles of known regulatory and structural genes of glycerol metabolism, smp1R110Q,P269Q, hot1P107S,H274Y and gpd1L164P as causative genes. All three genes separately caused a significant drop in the glycerol/ethanol production ratio, while gpd1L164P appeared to be epistatically suppressed by other alleles in the superior parent. The order of potency in reducing the glycerol/ethanol ratio of the three alleles was: gpd1L164P > hot1P107S,H274Y ≥ smp1R110Q,P269Q. Conclusions Our results show that natural yeast strains harbor multiple specific alleles of genes controlling essential functions, that are apparently compatible with survival in the natural environment. These newly identified alleles can be used as gene tools for engineering industrial yeast strains with multiple subtle changes, minimizing the risk of negatively affecting other essential functions. The gene tools act at the transcriptional, regulatory or structural gene level, distributing the impact over multiple targets and thus further minimizing possible side-effects. In addition, the results suggest polygenic analysis of complex traits as a promising new avenue to identify novel components involved in cellular functions, including those important in industrial applications. PMID:23759206
Zhou, Xue; Liu, Zhiyong; Ji, Ruiqin; Feng, Hui
2017-10-01
We studied the underlying causes of multiple-allele-inherited male sterility in Chinese cabbage (Brassica campestris L. ssp. pekinensis) by identifying differentially expressed genes (DEGs) related to pollen sterility between fertile and sterile flower buds. In this work, we verified the stages of sterility microscopically and then performed transcriptome analysis of mRNA isolated from fertile and sterile buds using Illumina HiSeq 2000 platform sequencing. Approximately 80% of ~229 million high-quality paired-end reads were uniquely mapped to the reference genome. In sterile buds, 699 genes were significantly up-regulated and 4096 genes were down-regulated. Among the DEGs, 28 pollen cell wall-related genes, 54 transcription factor genes, 45 phytohormone-related genes, 20 anther and pollen-related genes, 212 specifically expressed transcripts, and 417 DEGs located on linkage group A07 were identified. Six transcription factor genes BrAMS, BrMS1, BrbHLH089, BrbHLH091, BrAtMYB103, and BrANAC025 were identified as putative sterility-related genes. The weak auxin signal that is regulated by BrABP1 may be one of the key factors causing pollen sterility observed here. Moreover, several significantly enriched GO terms such as "cell wall organization or biogenesis" (GO:0071554), "intrinsic to membrane" (GO:0031224), "integral to membrane" (GO:0016021), "hydrolase activity, acting on ester bonds" (GO:0016788), and one significantly enriched pathway "starch and sucrose metabolism" (ath00500) were identified in this work. qRT-PCR, PCR, and in situ hybridization experiments validated our RNA-seq transcriptome analysis as accurate and reliable. This study will lay the foundation for elucidating the molecular mechanism(s) that underly sterility and provide valuable information for studying multiple-allele-inherited male sterility in the Chinese cabbage line 'AB01'.
Deng, Wenping; Zhang, Kui; Liu, Sanzhen; Zhao, Patrick; Xu, Shizhong; Wei, Hairong
2018-04-30
Joint reconstruction of multiple gene regulatory networks (GRNs) using gene expression data from multiple tissues/conditions is very important for understanding common and tissue/condition-specific regulation. However, there are currently no computational models and methods available for directly constructing such multiple GRNs that not only share some common hub genes but also possess tissue/condition-specific regulatory edges. In this paper, we proposed a new graphic Gaussian model for joint reconstruction of multiple gene regulatory networks (JRmGRN), which highlighted hub genes, using gene expression data from several tissues/conditions. Under the framework of Gaussian graphical model, JRmGRN method constructs the GRNs through maximizing a penalized log likelihood function. We formulated it as a convex optimization problem, and then solved it with an alternating direction method of multipliers (ADMM) algorithm. The performance of JRmGRN was first evaluated with synthetic data and the results showed that JRmGRN outperformed several other methods for reconstruction of GRNs. We also applied our method to real Arabidopsis thaliana RNA-seq data from two light regime conditions in comparison with other methods, and both common hub genes and some conditions-specific hub genes were identified with higher accuracy and precision. JRmGRN is available as a R program from: https://github.com/wenpingd. hairong@mtu.edu. Proof of theorem, derivation of algorithm and supplementary data are available at Bioinformatics online.
iGC-an integrated analysis package of gene expression and copy number alteration.
Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y
2017-01-14
With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .
Severgnini, Marco; Bicciato, Silvio; Mangano, Eleonora; Scarlatti, Francesca; Mezzelani, Alessandra; Mattioli, Michela; Ghidoni, Riccardo; Peano, Clelia; Bonnal, Raoul; Viti, Federica; Milanesi, Luciano; De Bellis, Gianluca; Battaglia, Cristina
2006-06-01
Meta-analysis of microarray data is increasingly important, considering both the availability of multiple platforms using disparate technologies and the accumulation in public repositories of data sets from different laboratories. We addressed the issue of comparing gene expression profiles from two microarray platforms by devising a standardized investigative strategy. We tested this procedure by studying MDA-MB-231 cells, which undergo apoptosis on treatment with resveratrol. Gene expression profiles were obtained using high-density, short-oligonucleotide, single-color microarray platforms: GeneChip (Affymetrix) and CodeLink (Amersham). Interplatform analyses were carried out on 8414 common transcripts represented on both platforms, as identified by LocusLink ID, representing 70.8% and 88.6% of annotated GeneChip and CodeLink features, respectively. We identified 105 differentially expressed genes (DEGs) on CodeLink and 42 DEGs on GeneChip. Among them, only 9 DEGs were commonly identified by both platforms. Multiple analyses (BLAST alignment of probes with target sequences, gene ontology, literature mining, and quantitative real-time PCR) permitted us to investigate the factors contributing to the generation of platform-dependent results in single-color microarray experiments. An effective approach to cross-platform comparison involves microarrays of similar technologies, samples prepared by identical methods, and a standardized battery of bioinformatic and statistical analyses.
Parkin, Derek B; Archer, Linda L; Childress, April L; Wellehan, James F X
2009-07-01
Bearded dragons (Pogona vitticeps) are popular pets in the United States. Agamid Adenovirus 1 (AgAdV1) is an important infectious agent of bearded dragons. The only AgAdV1 sequences available to date are from a highly conserved region of the DNA polymerase gene. Degenerate primers were designed to amplify a variable region of the AgAdV1 hexon gene for sequencing. Genetic differences were identified within the hexon gene of 17 bearded dragons from 4 collections. Much less diversity was present in the polymerase gene. Bayesian analysis of the hexon nucleotide alignment identified two larger groups and two isolates that did not tightly cluster with these two groups. Multiple genotypes were identified within collections, and individual genotypes were seen in different collections. Three bearded dragons appeared to be infected by multiple strains. These findings show that this hexon region is useful for AgAdV1 genotyping, which can be used epidemiologically as well as in future investigations of AgAdV1 evolution and clinical implications of strain differences.
Taguchi, Y-h
2015-01-01
Transgenerational epigenetics (TGE) are currently considered important in disease, but the mechanisms involved are not yet fully understood. TGE abnormalities expected to cause disease are likely to be initiated during development and to be mediated by aberrant gene expression associated with aberrant promoter methylation that is heritable between generations. However, because methylation is removed and then re-established during development, it is not easy to identify promoter methylation abnormalities by comparing normal lineages with those expected to exhibit TGE abnormalities. This study applied the recently proposed principal component analysis (PCA)-based unsupervised feature extraction to previously reported and publically available gene expression/promoter methylation profiles of rat primordial germ cells, between E13 and E16 of the F3 generation vinclozolin lineage that are expected to exhibit TGE abnormalities, to identify multiple genes that exhibited aberrant gene expression/promoter methylation during development. The biological feasibility of the identified genes were tested via enrichment analyses of various biological concepts including pathway analysis, gene ontology terms and protein-protein interactions. All validations suggested superiority of the proposed method over three conventional and popular supervised methods that employed t test, limma and significance analysis of microarrays, respectively. The identified genes were globally related to tumors, the prostate, kidney, testis and the immune system and were previously reported to be related to various diseases caused by TGE. Among the genes reported by PCA-based unsupervised feature extraction, we propose that chemokine signaling pathways and leucine rich repeat proteins are key factors that initiate transgenerational epigenetic-mediated diseases, because multiple genes included in these two categories were identified in this study.
2015-01-01
Background Transgenerational epigenetics (TGE) are currently considered important in disease, but the mechanisms involved are not yet fully understood. TGE abnormalities expected to cause disease are likely to be initiated during development and to be mediated by aberrant gene expression associated with aberrant promoter methylation that is heritable between generations. However, because methylation is removed and then re-established during development, it is not easy to identify promoter methylation abnormalities by comparing normal lineages with those expected to exhibit TGE abnormalities. Methods This study applied the recently proposed principal component analysis (PCA)-based unsupervised feature extraction to previously reported and publically available gene expression/promoter methylation profiles of rat primordial germ cells, between E13 and E16 of the F3 generation vinclozolin lineage that are expected to exhibit TGE abnormalities, to identify multiple genes that exhibited aberrant gene expression/promoter methylation during development. Results The biological feasibility of the identified genes were tested via enrichment analyses of various biological concepts including pathway analysis, gene ontology terms and protein-protein interactions. All validations suggested superiority of the proposed method over three conventional and popular supervised methods that employed t test, limma and significance analysis of microarrays, respectively. The identified genes were globally related to tumors, the prostate, kidney, testis and the immune system and were previously reported to be related to various diseases caused by TGE. Conclusions Among the genes reported by PCA-based unsupervised feature extraction, we propose that chemokine signaling pathways and leucine rich repeat proteins are key factors that initiate transgenerational epigenetic-mediated diseases, because multiple genes included in these two categories were identified in this study. PMID:26677731
Bioinformatics approaches to predict target genes from transcription factor binding data.
Essebier, Alexandra; Lamprecht, Marnie; Piper, Michael; Bodén, Mikael
2017-12-01
Transcription factors regulate gene expression and play an essential role in development by maintaining proliferative states, driving cellular differentiation and determining cell fate. Transcription factors are capable of regulating multiple genes over potentially long distances making target gene identification challenging. Currently available experimental approaches to detect distal interactions have multiple weaknesses that have motivated the development of computational approaches. Although an improvement over experimental approaches, existing computational approaches are still limited in their application, with different weaknesses depending on the approach. Here, we review computational approaches with a focus on data dependency, cell type specificity and usability. With the aim of identifying transcription factor target genes, we apply available approaches to typical transcription factor experimental datasets. We show that approaches are not always capable of annotating all transcription factor binding sites; binding sites should be treated disparately; and a combination of approaches can increase the biological relevance of the set of genes identified as targets. Copyright © 2017 Elsevier Inc. All rights reserved.
Youssef, Noha H; Blainey, Paul C; Quake, Stephen R; Elshahed, Mostafa S
2011-11-01
Members of candidate division OP11 are widely distributed in terrestrial and marine ecosystems, yet little information regarding their metabolic capabilities and ecological role within such habitats is currently available. Here, we report on the microfluidic isolation, multiple-displacement-amplification, pyrosequencing, and genomic analysis of a single cell (ZG1) belonging to candidate division OP11. Genome analysis of the ∼270-kb partial genome assembly obtained showed that it had no particular similarity to a specific phylum. Four hundred twenty-three open reading frames were identified, 46% of which had no function prediction. In-depth analysis revealed a heterotrophic lifestyle, with genes encoding endoglucanase, amylopullulanase, and laccase enzymes, suggesting a capacity for utilization of cellulose, starch, and, potentially, lignin, respectively. Genes encoding several glycolysis enzymes as well as formate utilization were identified, but no evidence for an electron transport chain was found. The presence of genes encoding various components of lipopolysaccharide biosynthesis indicates a Gram-negative bacterial cell wall. The partial genome also provides evidence for antibiotic resistance (β-lactamase, aminoglycoside phosphotransferase), as well as antibiotic production (bacteriocin) and extracellular bactericidal peptidases. Multiple mechanisms for stress response were identified, as were elements of type I and type IV secretion systems. Finally, housekeeping genes identified within the partial genome were used to demonstrate the OP11 affiliation of multiple hitherto unclassified genomic fragments from multiple database-deposited metagenomic data sets. These results provide the first glimpse into the lifestyle of a member of a ubiquitous, yet poorly understood bacterial candidate division.
Examination of Association to Autism of Common Genetic Variation in Genes Related to Dopamine
Anderson, B.M.; Schnetz-Boutaud, N.; Bartlett, J.; Wright, H.H.; Abramson, R.K.; Cuccaro, M.L.; Gilbert, J.R.; Pericak-Vance, M.A.; Haines, J.L.
2010-01-01
Autism is a severe neurodevelopmental disorder characterized by a triad of complications. Autistic individuals display significant disturbances in language and reciprocal social interactions, combined with repetitive and stereotypic behaviors. Prevalence studies suggest that autism is more common than originally believed, with recent estimates citing a rate of one in 150. Although this genomic approach has yielded multiple suggestive regions, a specific risk locus has yet to be identified and widely confirmed. Because many etiologies have been suggested for this complex syndrome, we hypothesize that one of the difficulties in identifying autism genes is that multiple genetic variants may be required to significantly increase the risk of developing autism. Thus we took the alternative approach of examining 14 prominent dopamine pathway candidate genes for detailed study by genotyping 28 SNPs. Although we did observe a nominally significant association for rs2239535 (p=.008) on chromosome 20, single locus analysis did not reveal any results as significant after correction for multiple comparisons. No significant interaction was identified when Multifactor Dimensionality Reduction (MDR) was employed to test specifically for multilocus effects. Although genome-wide linkage scans in autism have provided support for linkage to various loci along the dopamine pathway, our study does not provide strong evidence of linkage or association to any specific gene or combination of genes within the pathway. These results demonstrate that common genetic variation within the tested genes located within this pathway at most play a minor to moderate role in overall autism pathogenesis. PMID:19360691
EnRICH: Extraction and Ranking using Integration and Criteria Heuristics.
Zhang, Xia; Greenlee, M Heather West; Serb, Jeanne M
2013-01-15
High throughput screening technologies enable biologists to generate candidate genes at a rate that, due to time and cost constraints, cannot be studied by experimental approaches in the laboratory. Thus, it has become increasingly important to prioritize candidate genes for experiments. To accomplish this, researchers need to apply selection requirements based on their knowledge, which necessitates qualitative integration of heterogeneous data sources and filtration using multiple criteria. A similar approach can also be applied to putative candidate gene relationships. While automation can assist in this routine and imperative procedure, flexibility of data sources and criteria must not be sacrificed. A tool that can optimize the trade-off between automation and flexibility to simultaneously filter and qualitatively integrate data is needed to prioritize candidate genes and generate composite networks from heterogeneous data sources. We developed the java application, EnRICH (Extraction and Ranking using Integration and Criteria Heuristics), in order to alleviate this need. Here we present a case study in which we used EnRICH to integrate and filter multiple candidate gene lists in order to identify potential retinal disease genes. As a result of this procedure, a candidate pool of several hundred genes was narrowed down to five candidate genes, of which four are confirmed retinal disease genes and one is associated with a retinal disease state. We developed a platform-independent tool that is able to qualitatively integrate multiple heterogeneous datasets and use different selection criteria to filter each of them, provided the datasets are tables that have distinct identifiers (required) and attributes (optional). With the flexibility to specify data sources and filtering criteria, EnRICH automatically prioritizes candidate genes or gene relationships for biologists based on their specific requirements. Here, we also demonstrate that this tool can be effectively and easily used to apply highly specific user-defined criteria and can efficiently identify high quality candidate genes from relatively sparse datasets.
SZDB: A Database for Schizophrenia Genetic Research
Wu, Yong; Yao, Yong-Gang
2017-01-01
Abstract Schizophrenia (SZ) is a debilitating brain disorder with a complex genetic architecture. Genetic studies, especially recent genome-wide association studies (GWAS), have identified multiple variants (loci) conferring risk to SZ. However, how to efficiently extract meaningful biological information from bulk genetic findings of SZ remains a major challenge. There is a pressing need to integrate multiple layers of data from various sources, eg, genetic findings from GWAS, copy number variations (CNVs), association and linkage studies, gene expression, protein–protein interaction (PPI), co-expression, expression quantitative trait loci (eQTL), and Encyclopedia of DNA Elements (ENCODE) data, to provide a comprehensive resource to facilitate the translation of genetic findings into SZ molecular diagnosis and mechanism study. Here we developed the SZDB database (http://www.szdb.org/), a comprehensive resource for SZ research. SZ genetic data, gene expression data, network-based data, brain eQTL data, and SNP function annotation information were systematically extracted, curated and deposited in SZDB. In-depth analyses and systematic integration were performed to identify top prioritized SZ genes and enriched pathways. Multiple types of data from various layers of SZ research were systematically integrated and deposited in SZDB. In-depth data analyses and integration identified top prioritized SZ genes and enriched pathways. We further showed that genes implicated in SZ are highly co-expressed in human brain and proteins encoded by the prioritized SZ risk genes are significantly interacted. The user-friendly SZDB provides high-confidence candidate variants and genes for further functional characterization. More important, SZDB provides convenient online tools for data search and browse, data integration, and customized data analyses. PMID:27451428
Nicoletti, Paola; Bansal, Mukesh; Lefebvre, Celine; Guarnieri, Paolo; Shen, Yufeng; Pe'er, Itsik; Califano, Andrea; Floratos, Aris
2015-01-01
Stevens-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN) represent rare but serious adverse drug reactions (ADRs). Both are characterized by distinctive blistering lesions and significant mortality rates. While there is evidence for strong drug-specific genetic predisposition related to HLA alleles, recent genome wide association studies (GWAS) on European and Asian populations have failed to identify genetic susceptibility alleles that are common across multiple drugs. We hypothesize that this is a consequence of the low to moderate effect size of individual genetic risk factors. To test this hypothesis we developed Pointer, a new algorithm that assesses the aggregate effect of multiple low risk variants on a pathway using a gene set enrichment approach. A key advantage of our method is the capability to associate SNPs with genes by exploiting physical proximity as well as by using expression quantitative trait loci (eQTLs) that capture information about both cis- and trans-acting regulatory effects. We control for known bias-inducing aspects of enrichment based analyses, such as: 1) gene length, 2) gene set size, 3) presence of biologically related genes within the same linkage disequilibrium (LD) region, and, 4) genes shared among multiple gene sets. We applied this approach to publicly available SJS/TEN genome-wide genotype data and identified the ABC transporter and Proteasome pathways as potentially implicated in the genetic susceptibility of non-drug-specific SJS/TEN. We demonstrated that the innovative SNP-to-gene mapping phase of the method was essential in detecting the significant enrichment for those pathways. Analysis of an independent gene expression dataset provides supportive functional evidence for the involvement of Proteasome pathways in SJS/TEN cutaneous lesions. These results suggest that Pointer provides a useful framework for the integrative analysis of pharmacogenetic GWAS data, by increasing the power to detect aggregate effects of multiple low risk variants. The software is available for download at https://sourceforge.net/projects/pointergsa/.
Identifying metabolic enzymes with multiple types of association evidence
Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M
2006-01-01
Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130
OrthoMCL: Identification of Ortholog Groups for Eukaryotic Genomes
Li, Li; Stoeckert, Christian J.; Roos, David S.
2003-01-01
The identification of orthologous groups is useful for genome annotation, studies on gene/protein evolution, comparative genomics, and the identification of taxonomically restricted sequences. Methods successfully exploited for prokaryotic genome analysis have proved difficult to apply to eukaryotes, however, as larger genomes may contain multiple paralogous genes, and sequence information is often incomplete. OrthoMCL provides a scalable method for constructing orthologous groups across multiple eukaryotic taxa, using a Markov Cluster algorithm to group (putative) orthologs and paralogs. This method performs similarly to the INPARANOID algorithm when applied to two genomes, but can be extended to cluster orthologs from multiple species. OrthoMCL clusters are coherent with groups identified by EGO, but improved recognition of “recent” paralogs permits overlapping EGO groups representing the same gene to be merged. Comparison with previously assigned EC annotations suggests a high degree of reliability, implying utility for automated eukaryotic genome annotation. OrthoMCL has been applied to the proteome data set from seven publicly available genomes (human, fly, worm, yeast, Arabidopsis, the malaria parasite Plasmodium falciparum, and Escherichia coli). A Web interface allows queries based on individual genes or user-defined phylogenetic patterns (http://www.cbil.upenn.edu/gene-family). Analysis of clusters incorporating P. falciparum genes identifies numerous enzymes that were incompletely annotated in first-pass annotation of the parasite genome. PMID:12952885
Genes uniquely expressed in human growth plate chondrocytes uncover a distinct regulatory network.
Li, Bing; Balasubramanian, Karthika; Krakow, Deborah; Cohn, Daniel H
2017-12-20
Chondrogenesis is the earliest stage of skeletal development and is a highly dynamic process, integrating the activities and functions of transcription factors, cell signaling molecules and extracellular matrix proteins. The molecular mechanisms underlying chondrogenesis have been extensively studied and multiple key regulators of this process have been identified. However, a genome-wide overview of the gene regulatory network in chondrogenesis has not been achieved. In this study, employing RNA sequencing, we identified 332 protein coding genes and 34 long non-coding RNA (lncRNA) genes that are highly selectively expressed in human fetal growth plate chondrocytes. Among the protein coding genes, 32 genes were associated with 62 distinct human skeletal disorders and 153 genes were associated with skeletal defects in knockout mice, confirming their essential roles in skeletal formation. These gene products formed a comprehensive physical interaction network and participated in multiple cellular processes regulating skeletal development. The data also revealed 34 transcription factors and 11,334 distal enhancers that were uniquely active in chondrocytes, functioning as transcriptional regulators for the cartilage-selective genes. Our findings revealed a complex gene regulatory network controlling skeletal development whereby transcription factors, enhancers and lncRNAs participate in chondrogenesis by transcriptional regulation of key genes. Additionally, the cartilage-selective genes represent candidate genes for unsolved human skeletal disorders.
Xie, Xin-Ping; Xie, Yu-Feng; Wang, Hong-Qiang
2017-08-23
Large-scale accumulation of omics data poses a pressing challenge of integrative analysis of multiple data sets in bioinformatics. An open question of such integrative analysis is how to pinpoint consistent but subtle gene activity patterns across studies. Study heterogeneity needs to be addressed carefully for this goal. This paper proposes a regulation probability model-based meta-analysis, jGRP, for identifying differentially expressed genes (DEGs). The method integrates multiple transcriptomics data sets in a gene regulatory space instead of in a gene expression space, which makes it easy to capture and manage data heterogeneity across studies from different laboratories or platforms. Specifically, we transform gene expression profiles into a united gene regulation profile across studies by mathematically defining two gene regulation events between two conditions and estimating their occurring probabilities in a sample. Finally, a novel differential expression statistic is established based on the gene regulation profiles, realizing accurate and flexible identification of DEGs in gene regulation space. We evaluated the proposed method on simulation data and real-world cancer datasets and showed the effectiveness and efficiency of jGRP in identifying DEGs identification in the context of meta-analysis. Data heterogeneity largely influences the performance of meta-analysis of DEGs identification. Existing different meta-analysis methods were revealed to exhibit very different degrees of sensitivity to study heterogeneity. The proposed method, jGRP, can be a standalone tool due to its united framework and controllable way to deal with study heterogeneity.
Emergence of antibiotic-resistant extremophiles (AREs).
Gabani, Prashant; Prakash, Dhan; Singh, Om V
2012-09-01
Excessive use of antibiotics in recent years has produced bacteria that are resistant to a wide array of antibiotics. Several genetic and non-genetic elements allow microorganisms to adapt and thrive under harsh environmental conditions such as lethal doses of antibiotics. We attempt to classify these microorganisms as antibiotic-resistant extremophiles (AREs). AREs develop strategies to gain greater resistance to antibiotics via accumulation of multiple genes or plasmids that harbor genes for multiple drug resistance (MDR). In addition to their altered expression of multiple genes, AREs also survive by producing enzymes such as penicillinase that inactivate antibiotics. It is of interest to identify the underlying molecular mechanisms by which the AREs are able to survive in the presence of wide arrays of high-dosage antibiotics. Technologically, "omics"-based approaches such as genomics have revealed a wide array of genes differentially expressed in AREs. Proteomics studies with 2DE, MALDI-TOF, and MS/MS have identified specific proteins, enzymes, and pumps that function in the adaptation mechanisms of AREs. This article discusses the molecular mechanisms by which microorganisms develop into AREs and how "omics" approaches can identify the genetic elements of these adaptation mechanisms. These objectives will assist the development of strategies and potential therapeutics to treat outbreaks of pathogenic microorganisms in the future.
Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E; Fonseca, Nuno A; Reboiro-Jato, David; Reboiro-Jato, Miguel; Fdez-Riverola, Florentino; Raspé, Olivier; Vieira, Cristina P
2013-05-01
S-RNase-based gametophytic self-incompatibility evolved once before the split of the Asteridae and Rosidae. In Prunus (tribe Amygdaloideae of Rosaceae), the self-incompatibility S-pollen is a single F-box gene that presents the expected evolutionary signatures. In Malus and Pyrus (subtribe Pyrinae of Rosaceae), however, clusters of F-box genes (called SFBBs) have been described that are expressed in pollen only and are linked to the S-RNase gene. Although polymorphic, SFBB genes present levels of diversity lower than those of the S-RNase gene. They have been suggested as putative S-pollen genes, in a system of non-self recognition by multiple factors. Subsets of allelic products of the different SFBB genes interact with non-self S-RNases, marking them for degradation, and allowing compatible pollinations. This study performed a detailed characterization of SFBB genes in Sorbus aucuparia (Pyrinae) to address three predictions of the non-self recognition by multiple factors model. As predicted, the number of SFBB genes was large to account for the many S-RNase specificities. Secondly, like the S-RNase gene, the SFBB genes were old. Thirdly, amino acids under positive selection-those that could be involved in specificity determination-were identified when intra-haplotype SFBB genes were analysed using codon models. Overall, the findings reported here support the non-self recognition by multiple factors model.
Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S
2016-01-01
Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers.
Dimitrova, Irina K.; Richer, Jennifer K.; Rudolph, Michael C.; Spoelstra, Nicole S.; Reno, Elaine M.; Medina, Theresa M.; Bradford, Andrew P.
2009-01-01
Objective To identify differentially expressed genes between fibroid and adjacent normal myometrium in an identical hormonal and genetic background. Design Array analysis of 3 leiomyomata and matched adjacent normal myometrium in a single patient. Setting University of Colorado Hospital. Patient(s) A single female undergoing medically indicated hysterectomy for symptomatic fibroids. Interventions(s) mRNA isolation and microarray analysis, reverse-transcriptase polymerase chain reaction, western blotting and immunohistochemistry. Main Outcome Measure(s) Changes in mRNA and protein levels in leiomyomata and matched normal myometrium. Result(s) Expression of 197 genes was increased and 619 decreased, significantly by at least 2 fold, in leiomyomata relative to normal myometrium. Expression profiles between tumors were similar and normal myometrial samples showed minimal variation. Changes in, and variation of, expression of selected genes were confirmed in additional normal and leiomyoma samples from multiple patients. Conclusion(s) Analysis of multiple tumors from a single patient confirmed changes in expression of genes described in previous, apparently disparate, studies and identified novel targets. Gene expression profiles in leiomyomata are consistent with increased activation of mitogenic pathways and inhibition of apoptosis. Down-regulation of genes implicated in invasion and metastasis, of cancers, was observed in fibroids. This expression pattern may underlie the benign nature of uterine leiomyomata and may aid in the differential diagnosis of leiomyosarcoma. PMID:18672237
Pritchard, Antonia L; Johansson, Peter A; Nathan, Vaishnavi; Howlie, Madeleine; Symmons, Judith; Palmer, Jane M; Hayward, Nicholas K
2018-01-01
While a number of autosomal dominant and autosomal recessive cancer syndromes have an associated spectrum of cancers, the prevalence and variety of cancer predisposition mutations in patients with multiple primary cancers have not been extensively investigated. An understanding of the variants predisposing to more than one cancer type could improve patient care, including screening and genetic counselling, as well as advancing the understanding of tumour development. A cohort of 57 patients ascertained due to their cutaneous melanoma (CM) diagnosis and with a history of two or more additional non-cutaneous independent primary cancer types were recruited for this study. Patient blood samples were assessed by whole exome or whole genome sequencing. We focussed on variants in 525 pre-selected genes, including 65 autosomal dominant and 31 autosomal recessive cancer predisposition genes, 116 genes involved in the DNA repair pathway, and 313 commonly somatically mutated in cancer. The same genes were analysed in exome sequence data from 1358 control individuals collected as part of non-cancer studies (UK10K). The identified variants were classified for pathogenicity using online databases, literature and in silico prediction tools. No known pathogenic autosomal dominant or previously described compound heterozygous mutations in autosomal recessive genes were observed in the multiple cancer cohort. Variants typically found somatically in haematological malignancies (in JAK1, JAK2, SF3B1, SRSF2, TET2 and TYK2) were present in lymphocyte DNA of patients with multiple primary cancers, all of whom had a history of haematological malignancy and cutaneous melanoma, as well as colorectal cancer and/or prostate cancer. Other potentially pathogenic variants were discovered in BUB1B, POLE2, ROS1 and DNMT3A. Compared to controls, multiple cancer cases had significantly more likely damaging mutations (nonsense, frameshift ins/del) in tumour suppressor and tyrosine kinase genes and higher overall burden of mutations in all cancer genes. We identified several pathogenic variants that likely predispose to at least one of the tumours in patients with multiple cancers. We additionally present evidence that there may be a higher burden of variants of unknown significance in 'cancer genes' in patients with multiple cancer types. Further screens of this nature need to be carried out to build evidence to show if the cancers observed in these patients form part of a cancer spectrum associated with single germline variants in these genes, whether multiple layers of susceptibility exist (oligogenic or polygenic), or if the occurrence of multiple different cancers is due to random chance.
Wang, W; Huang, S; Hou, W; Liu, Y; Fan, Q; He, A; Wen, Y; Hao, J; Guo, X; Zhang, F
2017-10-01
Several genome-wide association studies (GWAS) of bone mineral density (BMD) have successfully identified multiple susceptibility genes, yet isolated susceptibility genes are often difficult to interpret biologically. The aim of this study was to unravel the genetic background of BMD at pathway level, by integrating BMD GWAS data with genome-wide expression quantitative trait loci (eQTLs) and methylation quantitative trait loci (meQTLs) data METHOD: We employed the GWAS datasets of BMD from the Genetic Factors for Osteoporosis Consortium (GEFOS), analysing patients' BMD. The areas studied included 32 735 femoral necks, 28 498 lumbar spines, and 8143 forearms. Genome-wide eQTLs (containing 923 021 eQTLs) and meQTLs (containing 683 152 unique methylation sites with local meQTLs) data sets were collected from recently published studies. Gene scores were first calculated by summary data-based Mendelian randomisation (SMR) software and meQTL-aligned GWAS results. Gene set enrichment analysis (GSEA) was then applied to identify BMD-associated gene sets with a predefined significance level of 0.05. We identified multiple gene sets associated with BMD in one or more regions, including relevant known biological gene sets such as the Reactome Circadian Clock (GSEA p-value = 1.0 × 10 -4 for LS and 2.7 × 10 -2 for femoral necks BMD in eQTLs-based GSEA) and insulin-like growth factor receptor binding (GSEA p-value = 5.0 × 10 -4 for femoral necks and 2.6 × 10 -2 for lumbar spines BMD in meQTLs-based GSEA). Our results provided novel clues for subsequent functional analysis of bone metabolism, and illustrated the benefit of integrating eQTLs and meQTLs data into pathway association analysis for genetic studies of complex human diseases. Cite this article : W. Wang, S. Huang, W. Hou, Y. Liu, Q. Fan, A. He, Y. Wen, J. Hao, X. Guo, F. Zhang. Integrative analysis of GWAS, eQTLs and meQTLs data suggests that multiple gene sets are associated with bone mineral density. Bone Joint Res 2017;6:572-576. © 2017 Wang et al.
High-throughput discovery of novel developmental phenotypes.
Dickinson, Mary E; Flenniken, Ann M; Ji, Xiao; Teboul, Lydia; Wong, Michael D; White, Jacqueline K; Meehan, Terrence F; Weninger, Wolfgang J; Westerberg, Henrik; Adissu, Hibret; Baker, Candice N; Bower, Lynette; Brown, James M; Caddle, L Brianna; Chiani, Francesco; Clary, Dave; Cleak, James; Daly, Mark J; Denegre, James M; Doe, Brendan; Dolan, Mary E; Edie, Sarah M; Fuchs, Helmut; Gailus-Durner, Valerie; Galli, Antonella; Gambadoro, Alessia; Gallegos, Juan; Guo, Shiying; Horner, Neil R; Hsu, Chih-Wei; Johnson, Sara J; Kalaga, Sowmya; Keith, Lance C; Lanoue, Louise; Lawson, Thomas N; Lek, Monkol; Mark, Manuel; Marschall, Susan; Mason, Jeremy; McElwee, Melissa L; Newbigging, Susan; Nutter, Lauryl M J; Peterson, Kevin A; Ramirez-Solis, Ramiro; Rowland, Douglas J; Ryder, Edward; Samocha, Kaitlin E; Seavitt, John R; Selloum, Mohammed; Szoke-Kovacs, Zsombor; Tamura, Masaru; Trainor, Amanda G; Tudose, Ilinca; Wakana, Shigeharu; Warren, Jonathan; Wendling, Olivia; West, David B; Wong, Leeyean; Yoshiki, Atsushi; MacArthur, Daniel G; Tocchini-Valentini, Glauco P; Gao, Xiang; Flicek, Paul; Bradley, Allan; Skarnes, William C; Justice, Monica J; Parkinson, Helen E; Moore, Mark; Wells, Sara; Braun, Robert E; Svenson, Karen L; de Angelis, Martin Hrabe; Herault, Yann; Mohun, Tim; Mallon, Ann-Marie; Henkelman, R Mark; Brown, Steve D M; Adams, David J; Lloyd, K C Kent; McKerlie, Colin; Beaudet, Arthur L; Bućan, Maja; Murray, Stephen A
2016-09-22
Approximately one-third of all mammalian genes are essential for life. Phenotypes resulting from knockouts of these genes in mice have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5,000 knockout mouse lines, here we identify 410 lethal genes during the production of the first 1,751 unique gene knockouts. Using a standardized phenotyping platform that incorporates high-resolution 3D imaging, we identify phenotypes at multiple time points for previously uncharacterized genes and additional phenotypes for genes with previously reported mutant phenotypes. Unexpectedly, our analysis reveals that incomplete penetrance and variable expressivity are common even on a defined genetic background. In addition, we show that human disease genes are enriched for essential genes, thus providing a dataset that facilitates the prioritization and validation of mutations identified in clinical sequencing efforts.
Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
Taylor, Louis J; Strebel, Klaus
2017-01-07
Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.
Ray, Sumanta; Maulik, Ujjwal
2016-12-20
Detecting perturbation in modular structure during HIV-1 disease progression is an important step to understand stage specific infection pattern of HIV-1 virus in human cell. In this article, we proposed a novel methodology on integration of multiple biological information to identify such disruption in human gene module during different stages of HIV-1 infection. We integrate three different biological information: gene expression information, protein-protein interaction information and gene ontology information in single gene meta-module, through non negative matrix factorization (NMF). As the identified metamodules inherit those information so, detecting perturbation of these, reflects the changes in expression pattern, in PPI structure and in functional similarity of genes during the infection progression. To integrate modules of different data sources into strong meta-modules, NMF based clustering is utilized here. Perturbation in meta-modular structure is identified by investigating the topological and intramodular properties and putting rank to those meta-modules using a rank aggregation algorithm. We have also analyzed the preservation structure of significant GO terms in which the human proteins of the meta-modules participate. Moreover, we have performed an analysis to show the change of coregulation pattern of identified transcription factors (TFs) over the HIV progression stages.
Integrating Multiple Data Sources for Combinatorial Marker Discovery: A Study in Tumorigenesis.
Bandyopadhyay, Sanghamitra; Mallik, Saurav
2018-01-01
Identification of combinatorial markers from multiple data sources is a challenging task in bioinformatics. Here, we propose a novel computational framework for identifying significant combinatorial markers ( s) using both gene expression and methylation data. The gene expression and methylation data are integrated into a single continuous data as well as a (post-discretized) boolean data based on their intrinsic (i.e., inverse) relationship. A novel combined score of methylation and expression data (viz., ) is introduced which is computed on the integrated continuous data for identifying initial non-redundant set of genes. Thereafter, (maximal) frequent closed homogeneous genesets are identified using a well-known biclustering algorithm applied on the integrated boolean data of the determined non-redundant set of genes. A novel sample-based weighted support ( ) is then proposed that is consecutively calculated on the integrated boolean data of the determined non-redundant set of genes in order to identify the non-redundant significant genesets. The top few resulting genesets are identified as potential s. Since our proposed method generates a smaller number of significant non-redundant genesets than those by other popular methods, the method is much faster than the others. Application of the proposed technique on an expression and a methylation data for Uterine tumor or Prostate Carcinoma produces a set of significant combination of markers. We expect that such a combination of markers will produce lower false positives than individual markers.
Williams, Justin S; Der, Joshua P; dePamphilis, Claude W; Kao, Teh-Hui
2014-07-01
Petunia possesses self-incompatibility, by which pistils reject self-pollen but accept non-self-pollen for fertilization. Self-/non-self-recognition between pollen and pistil is regulated by the pistil-specific S-RNase gene and by multiple pollen-specific S-locus F-box (SLF) genes. To date, 10 SLF genes have been identified by various methods, and seven have been shown to be involved in pollen specificity. For a given S-haplotype, each SLF interacts with a subset of its non-self S-RNases, and an as yet unknown number of SLFs are thought to collectively mediate ubiquitination and degradation of all non-self S-RNases to allow cross-compatible pollination. To identify a complete suite of SLF genes of P. inflata, we used a de novo RNA-seq approach to analyze the pollen transcriptomes of S2-haplotype and S3-haplotype, as well as the leaf transcriptome of the S3S3 genotype. We searched for genes that fit several criteria established from the properties of the known SLF genes and identified the same seven new SLF genes in S2-haplotype and S3-haplotype, suggesting that a total of 17 SLF genes constitute pollen specificity in each S-haplotype. This finding lays the foundation for understanding how multiple SLF genes evolved and the biochemical basis for differential interactions between SLF proteins and S-RNases. © 2014 American Society of Plant Biologists. All rights reserved.
DNA methylome signature in rheumatoid arthritis.
Nakano, Kazuhisa; Whitaker, John W; Boyle, David L; Wang, Wei; Firestein, Gary S
2013-01-01
Epigenetics can influence disease susceptibility and severity. While DNA methylation of individual genes has been explored in autoimmunity, no unbiased systematic analyses have been reported. Therefore, a genome-wide evaluation of DNA methylation loci in fibroblast-like synoviocytes (FLS) isolated from the site of disease in rheumatoid arthritis (RA) was performed. Genomic DNA was isolated from six RA and five osteoarthritis (OA) FLS lines and evaluated using the Illumina HumanMethylation450 chip. Cluster analysis of data was performed and corrected using Benjamini-Hochberg adjustment for multiple comparisons. Methylation was confirmed by pyrosequencing and gene expression was determined by qPCR. Pathway analysis was performed using the Kyoto Encyclopedia of Genes and Genomes. RA and control FLS segregated based on DNA methylation, with 1859 differentially methylated loci. Hypomethylated loci were identified in key genes relevant to RA, such as CHI3L1, CASP1, STAT3, MAP3K5, MEFV and WISP3. Hypermethylation was also observed, including TGFBR2 and FOXO1. Hypomethylation of individual genes was associated with increased gene expression. Grouped analysis identified 207 hypermethylated or hypomethylated genes with multiple differentially methylated loci, including COL1A1, MEFV and TNF. Hypomethylation was increased in multiple pathways related to cell migration, including focal adhesion, cell adhesion, transendothelial migration and extracellular matrix interactions. Confirmatory studies with OA and normal FLS also demonstrated segregation of RA from control FLS based on methylation pattern. Differentially methylated genes could alter FLS gene expression and contribute to the pathogenesis of RA. DNA methylation of critical genes suggests that RA FLS are imprinted and implicate epigenetic contributions to inflammatory arthritis.
Datta, K; Baisakh, N; Thet, K Maung; Tu, J; Datta, S K
2002-12-01
Here we describe the development of transgene-pyramided stable elite rice lines resistant to disease and insect pests by conventional crossing of two transgenic parental lines transformed independently with different genes. The Xa21 gene (resistance to bacterial blight), the Bt fusion gene (for insect resistance) and the chitinase gene (for tolerance of sheath blight) were combined in a single rice line by reciprocal crossing of two transgenic homozygous IR72 lines. F4 plant lines carrying all the genes of interest stably were identified using molecular methods. The identified lines, when exposed to infection caused by Xanthomonas oryzae pv oryzae, showed resistance to bacterial blight. Neonate larval mortality rates of yellow stem borer ( Scirpophaga incertulas) in an insect bioassay of the same identified lines were 100%. The identified line pyramided with different genes to protect against yield loss showed high tolerance of sheath blight disease caused by Rhizoctonia solani.
Liu, Guiyou; Zhang, Fang; Jiang, Yongshuai; Hu, Yang; Gong, Zhongying; Liu, Shoufeng; Chen, Xiuju; Jiang, Qinghua; Hao, Junwei
2017-02-01
Much effort has been expended on identifying the genetic determinants of multiple sclerosis (MS). Existing large-scale genome-wide association study (GWAS) datasets provide strong support for using pathway and network-based analysis methods to investigate the mechanisms underlying MS. However, no shared genetic pathways have been identified to date. We hypothesize that shared genetic pathways may indeed exist in different MS-GWAS datasets. Here, we report results from a three-stage analysis of GWAS and expression datasets. In stage 1, we conducted multiple pathway analyses of two MS-GWAS datasets. In stage 2, we performed a candidate pathway analysis of the large-scale MS-GWAS dataset. In stage 3, we performed a pathway analysis using the dysregulated MS gene list from seven human MS case-control expression datasets. In stage 1, we identified 15 shared pathways. In stage 2, we successfully replicated 14 of these 15 significant pathways. In stage 3, we found that dysregulated MS genes were significantly enriched in 10 of 15 MS risk pathways identified in stages 1 and 2. We report shared genetic pathways in different MS-GWAS datasets and highlight some new MS risk pathways. Our findings provide new insights on the genetic determinants of MS.
Identification of novel mutational drivers reveals oncogene dependencies in multiple myeloma.
Walker, Brian A; Mavrommatis, Konstantinos; Wardell, Christopher P; Ashby, T Cody; Bauer, Michael; Davies, Faith E; Rosenthal, Adam; Wang, Hongwei; Qu, Pingping; Hoering, Antje; Samur, Mehmet; Towfic, Fadi; Ortiz, Maria; Flynt, Erin; Yu, Zhinuan; Yang, Zhihong; Rozelle, Dan; Obenauer, John; Trotter, Matthew; Auclair, Daniel; Keats, Jonathan; Bolli, Niccolo; Fulciniti, Mariateresa; Szalat, Raphael; Moreau, Philippe; Durie, Brian; Stewart, A Keith; Goldschmidt, Hartmut; Raab, Marc S; Einsele, Hermann; Sonneveld, Pieter; San Miguel, Jesus; Lonial, Sagar; Jackson, Graham H; Anderson, Kenneth C; Avet-Loiseau, Herve; Munshi, Nikhil; Thakurta, Anjan; Morgan, Gareth J
2018-06-08
Understanding the profile of oncogene and tumor suppressor gene mutations with their interactions and impact on the prognosis of multiple myeloma (MM) can improve the definition of disease subsets and identify pathways important in disease pathobiology. Using integrated genomics of 1,273 newly diagnosed patients with multiple myeloma we identify 63 driver genes, some of which are novel including IDH1 , IDH2 , HUWE1 , KLHL6 , and PTPN11 Oncogene mutations are significantly more clonal than tumor suppressor mutations, indicating they may exert a bigger selective pressure. Patients with more mutations in driver genes are associated with a worse outcome, as are those with identified mechanisms of genomic instability. Oncogenic dependencies were identified between mutations in driver genes, common regions of copy number change, and primary translocation and hyperdiploidy events. These dependencies included associations with t(4;14) and mutations in FGFR3 , DIS3 and PRKD2 ; t(11;14) with mutations in CCND1 and IRF4 ; t(14;16) with mutations in MAF , BRAF , DIS3 and ATM ; and hyperdiploidy with gain 11q, mutations in FAM46C and MYC rearrangements. These associations indicate that the genomic landscape of myeloma is pre-determined by the primary events upon which further dependencies are built, giving rise to a non-random accumulation of genetic hits. Understanding these dependencies may elucidate potential evolutionary patterns and lead to better treatment regimens. Copyright © 2018 American Society of Hematology.
Haplotype Analysis in Multiple Crosses to Identify a QTL Gene
Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly
2004-01-01
Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P ≤ 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene. PMID:15310659
Haplotype analysis in multiple crosses to identify a QTL gene.
Wang, Xiaosong; Korstanje, Ron; Higgins, David; Paigen, Beverly
2004-09-01
Identifying quantitative trait locus (QTL) genes is a challenging task. Herein, we report using a two-step process to identify Apoa2 as the gene underlying Hdlq5, a QTL for plasma high-density lipoprotein cholesterol (HDL) levels on mouse chromosome 1. First, we performed a sequence analysis of the Apoa2 coding region in 46 genetically diverse mouse strains and found five different APOA2 protein variants, which we named APOA2a to APOA2e. Second, we conducted a haplotype analysis of the strains in 21 crosses that have so far detected HDL QTLs; we found that Hdlq5 was detected only in the nine crosses where one parent had the APOA2b protein variant characterized by an Ala61-to-Val61 substitution. We then found that strains with the APOA2b variant had significantly higher (P < or = 0.002) plasma HDL levels than those with either the APOA2a or the APOA2c variant. These findings support Apoa2 as the underlying Hdlq5 gene and suggest the Apoa2 polymorphisms responsible for the Hdlq5 phenotype. Therefore, haplotype analysis in multiple crosses can be used to support a candidate QTL gene.
van der Vaart, Andrew D.; Wolstenholme, Jennifer T.; Smith, Maren L.; Harris, Guy M.; Lopez, Marcelo F.; Wolen, Aaron R.; Becker, Howard C.; Williams, Robert W.; Miles, Michael F.
2016-01-01
The transition from acute to chronic ethanol exposure leads to lasting behavioral and physiological changes such as increased consumption, dependence, and withdrawal. Changes in brain gene expression are hypothesized to underlie these adaptive responses to ethanol. Previous studies on acute ethanol identified genetic variation in brain gene expression networks and behavioral responses to ethanol across the BXD panel of recombinant inbred mice. In this work, we have performed the first joint genetic and genomic analysis of transcriptome shifts in response to chronic intermittent ethanol (CIE) by vapor chamber exposure in a BXD cohort. CIE treatment is known to produce significant and sustained changes in ethanol consumption with repeated cycles of ethanol vapor. Using Affymetrix microarray analysis of prefrontal cortex (PFC) and nucleus accumbens (NAC) RNA, we compared CIE expression responses to those seen following acute ethanol treatment, and to voluntary ethanol consumption. Gene expression changes in PFC and NAC after CIE overlapped significantly across brain regions and with previously published expression following acute ethanol. Genes highly modulated by CIE were enriched for specific biological processes including synaptic transmission, neuron ensheathment, intracellular signaling, and neuronal projection development. Expression quantitative trait locus (eQTL) analyses identified genomic loci associated with ethanol-induced transcriptional changes with largely distinct loci identified between brain regions. Correlating CIE-regulated genes to ethanol consumption data identified specific genes highly associated with variation in the increase in drinking seen with repeated cycles of CIE. In particular, multiple myelin-related genes were identified. Furthermore, genetic variance in or near dynamin3 (Dnm3) on Chr1 at ~164 Mb may have a major regulatory role in CIE-responsive gene expression. Dnm3 expression correlates significantly with ethanol consumption, is contained in a highly ranked functional group of CIE-regulated genes in the NAC, and has a cis-eQTL within a genomic region linked with multiple CIE-responsive genes. PMID:27838001
Novel genomic findings in multiple myeloma identified through routine diagnostic sequencing.
Ryland, Georgina L; Jones, Kate; Chin, Melody; Markham, John; Aydogan, Elle; Kankanige, Yamuna; Caruso, Marisa; Guinto, Jerick; Dickinson, Michael; Prince, H Miles; Yong, Kwee; Blombery, Piers
2018-05-14
Multiple myeloma is a genomically complex haematological malignancy with many genomic alterations recognised as important in diagnosis, prognosis and therapeutic decision making. Here, we provide a summary of genomic findings identified through routine diagnostic next-generation sequencing at our centre. A cohort of 86 patients with multiple myeloma underwent diagnostic sequencing using a custom hybridisation-based panel targeting 104 genes. Sequence variants, genome-wide copy number changes and structural rearrangements were detected using an inhouse-developed bioinformatics pipeline. At least one mutation was found in 69 (80%) patients. Frequently mutated genes included TP53 (36%), KRAS (22.1%), NRAS (15.1%), FAM46C/DIS3 (8.1%) and TET2/FGFR3 (5.8%), including multiple mutations not previously described in myeloma. Importantly we observed TP53 mutations in the absence of a 17 p deletion in 8% of the cohort, highlighting the need for sequencing-based assessment in addition to cytogenetics to identify these high-risk patients. Multiple novel copy number changes and immunoglobulin heavy chain translocations are also discussed. Our results demonstrate that many clinically relevant genomic findings remain in multiple myeloma which have not yet been identified through large-scale sequencing efforts, and provide important mechanistic insights into plasma cell pathobiology. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
TimeXNet Web: Identifying cellular response networks from diverse omics time-course data.
Tan, Phit Ling; López, Yosvany; Nakai, Kenta; Patil, Ashwini
2018-05-14
Condition-specific time-course omics profiles are frequently used to study cellular response to stimuli and identify associated signaling pathways. However, few online tools allow users to analyze multiple types of high-throughput time-course data. TimeXNet Web is a web server that extracts a time-dependent gene/protein response network from time-course transcriptomic, proteomic or phospho-proteomic data, and an input interaction network. It classifies the given genes/proteins into time-dependent groups based on the time of their highest activity and identifies the most probable paths connecting genes/proteins in consecutive groups. The response sub-network is enriched in activated genes/proteins and contains novel regulators that do not show any observable change in the input data. Users can view the resultant response network and analyze it for functional enrichment. TimeXNet Web supports the analysis of high-throughput data from multiple species by providing high quality, weighted protein-protein interaction networks for 12 model organisms. http://txnet.hgc.jp/. ashwini@hgc.jp. Supplementary data are available at Bioinformatics online.
Lamba, Jatinder K; Crews, Kristine R; Pounds, Stanley B; Cao, Xueyuan; Gandhi, Varsha; Plunkett, William; Razzouk, Bassem I; Lamba, Vishal; Baker, Sharyn D; Raimondi, Susana C; Campana, Dario; Pui, Ching-Hon; Downing, James R; Rubnitz, Jeffrey E; Ribeiro, Raul C
2011-01-01
Aim To identify gene-expression signatures predicting cytarabine response by an integrative analysis of multiple clinical and pharmacological end points in acute myeloid leukemia (AML) patients. Materials & methods We performed an integrated analysis to associate the gene expression of diagnostic bone marrow blasts from acute myeloid leukemia (AML) patients treated in the discovery set (AML97; n = 42) and in the independent validation set (AML02; n = 46) with multiple clinical and pharmacological end points. Based on prior biological knowledge, we defined a gene to show a therapeutically beneficial (detrimental) pattern of association of its expression positively (negatively) correlated with favorable phenotypes such as intracellular cytarabine 5´-triphosphate levels, morphological response and event-free survival, and negatively (positively) correlated with unfavorable end points such as post-cytarabine DNA synthesis levels, minimal residual disease and cytarabine LC50. Results We identified 240 probe sets predicting a therapeutically beneficial pattern and 97 predicting detrimental pattern (p ≤ 0.005) in the discovery set. Of these, 60 were confirmed in the independent validation set. The validated probe sets correspond to genes involved in PIK3/PTEN/AKT/mTOR signaling, G-protein-coupled receptor signaling and leukemogenesis. This suggests that targeting these pathways as potential pharmacogenomic and therapeutic candidates could be useful for improving treatment outcomes in AML. Conclusion This study illustrates the power of integrated data analysis of genomic data as well as multiple clinical and pharmacologic end points in the identification of genes and pathways of biological relevance. PMID:21449673
Aguiar, Bruno; Vieira, Jorge; Cunha, Ana E.; Fonseca, Nuno A.; Reboiro-Jato, David; Reboiro-Jato, Miguel; Fdez-Riverola, Florentino; Raspé, Olivier; Vieira, Cristina P.
2013-01-01
S-RNase-based gametophytic self-incompatibility evolved once before the split of the Asteridae and Rosidae. In Prunus (tribe Amygdaloideae of Rosaceae), the self-incompatibility S-pollen is a single F-box gene that presents the expected evolutionary signatures. In Malus and Pyrus (subtribe Pyrinae of Rosaceae), however, clusters of F-box genes (called SFBBs) have been described that are expressed in pollen only and are linked to the S-RNase gene. Although polymorphic, SFBB genes present levels of diversity lower than those of the S-RNase gene. They have been suggested as putative S-pollen genes, in a system of non-self recognition by multiple factors. Subsets of allelic products of the different SFBB genes interact with non-self S-RNases, marking them for degradation, and allowing compatible pollinations. This study performed a detailed characterization of SFBB genes in Sorbus aucuparia (Pyrinae) to address three predictions of the non-self recognition by multiple factors model. As predicted, the number of SFBB genes was large to account for the many S-RNase specificities. Secondly, like the S-RNase gene, the SFBB genes were old. Thirdly, amino acids under positive selection—those that could be involved in specificity determination—were identified when intra-haplotype SFBB genes were analysed using codon models. Overall, the findings reported here support the non-self recognition by multiple factors model. PMID:23606363
Gene expression allelic imbalance in ovine brown adipose tissue impacts energy homeostasis
Ghazanfar, Shila; Vuocolo, Tony; Morrison, Janna L.; Nicholas, Lisa M.; McMillen, Isabella C.; Yang, Jean Y. H.; Buckley, Michael J.
2017-01-01
Heritable trait variation within a population of organisms is largely governed by DNA variations that impact gene transcription and protein function. Identifying genetic variants that affect complex functional traits is a primary aim of population genetics studies, especially in the context of human disease and agricultural production traits. The identification of alleles directly altering mRNA expression and thereby biological function is challenging due to difficulty in isolating direct effects of cis-acting genetic variations from indirect trans-acting genetic effects. Allele specific gene expression or allelic imbalance in gene expression (AI) occurring at heterozygous loci provides an opportunity to identify genes directly impacted by cis-acting genetic variants as indirect trans-acting effects equally impact the expression of both alleles. However, the identification of genes showing AI in the context of the expression of all genes remains a challenge due to a variety of technical and statistical issues. The current study focuses on the discovery of genes showing AI using single nucleotide polymorphisms as allelic reporters. By developing a computational and statistical process that addressed multiple analytical challenges, we ranked 5,809 genes for evidence of AI using RNA-Seq data derived from brown adipose tissue samples from a cohort of late gestation fetal lambs and then identified a conservative subgroup of 1,293 genes. Thus, AI was extensive, representing approximately 25% of the tested genes. Genes associated with AI were enriched for multiple Gene Ontology (GO) terms relating to lipid metabolism, mitochondrial function and the extracellular matrix. These functions suggest that cis-acting genetic variations causing AI in the population are preferentially impacting genes involved in energy homeostasis and tissue remodelling. These functions may contribute to production traits likely to be under genetic selection in the population. PMID:28665992
Genetic changes associated with testicular cancer susceptibility.
Pyle, Louise C; Nathanson, Katherine L
2016-10-01
Testicular germ cell tumor (TGCT) is a highly heritable cancer primarily affecting young white men. Genome-wide association studies (GWAS) have been particularly effective in identifying multiple common variants with strong contribution to TGCT risk. These loci identified through association studies have implicated multiple genes as associated with TGCT predisposition, many of which are unique among cancer types, and regulate processes such as pluripotency, sex specification, and microtubule assembly. Together these biologically plausible genes converge on pathways involved in male germ cell development and maturation, and suggest that perturbation of them confers susceptibility to TGCT, as a developmental defect of germ cell differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.
Jones, Kaylie D; Wheaton, Dianna K; Bowne, Sara J; Sullivan, Lori S; Birch, David G; Chen, Rui; Daiger, Stephen P
2017-01-01
With recent availability of next-generation sequencing (NGS), it is becoming more common to pursue disease-targeted panel testing rather than traditional sequential gene-by-gene dideoxy sequencing. In this report, we describe using NGS to identify multiple disease-causing mutations that contribute concurrently or independently to retinal dystrophy in three relatively small families. Family members underwent comprehensive visual function evaluations, and genetic counseling including a detailed family history. A preliminary genetic inheritance pattern was assigned and updated as additional family members were tested. Family 1 (FAM1) and Family 2 (FAM2) were clinically diagnosed with retinitis pigmentosa (RP) and had a suspected autosomal dominant pedigree with non-penetrance (n.p.). Family 3 (FAM3) consisted of a large family with a diagnosis of RP and an overall dominant pedigree, but the proband had phenotypically cone-rod dystrophy. Initial genetic analysis was performed on one family member with traditional Sanger single gene sequencing and/or panel-based testing, and ultimately, retinal gene-targeted NGS was required to identify the underlying cause of disease for individuals within the three families. Results obtained in these families necessitated further genetic and clinical testing of additional family members to determine the complex genetic and phenotypic etiology of each family. Genetic testing of FAM1 (n = 4 affected; 1 n.p.) identified a dominant mutation in RP1 (p.Arg677Ter) that was present for two of the four affected individuals but absent in the proband and the presumed non-penetrant individual. Retinal gene-targeted NGS in the fourth affected family member revealed compound heterozygous mutations in USH2A (p. Cys419Phe, p.Glu767Serfs*21). Genetic testing of FAM2 (n = 3 affected; 1 n.p.) identified three retinal dystrophy genes ( PRPH2 , PRPF8 , and USH2A ) with disease-causing mutations in varying combinations among the affected family members. Genetic testing of FAM3 (n = 7 affected) identified a mutation in PRPH2 (p.Pro216Leu) tracking with disease in six of the seven affected individuals. Additional retinal gene-targeted NGS testing determined that the proband also harbored a multiple exon deletion in the CRX gene likely accounting for her cone-rod phenotype; her son harbored only the mutation in CRX , not the familial mutation in PRPH2 . Multiple genes contributing to the retinal dystrophy genotypes within a family were discovered using retinal gene-targeted NGS. Families with noted examples of phenotypic variation or apparent non-penetrant individuals may offer a clue to suspect complex inheritance. Furthermore, this finding underscores that caution should be taken when attributing a single gene disease-causing mutation (or inheritance pattern) to a family as a whole. Identification of a disease-causing mutation in a proband, even with a clear inheritance pattern in hand, may not be sufficient for targeted, known mutation analysis in other family members.
Slattery, Martha L; Herrick, Jennifer S; Stevens, John R; Wolff, Roger K; Mullany, Lila E
2017-01-01
Determination of functional pathways regulated by microRNAs (miRNAs), while an essential step in developing therapeutics, is challenging. Some miRNAs have been studied extensively; others have limited information. In this study, we focus on 254 miRNAs previously identified as being associated with colorectal cancer and their database-identified validated target genes. We use RNA-Seq data to evaluate messenger RNA (mRNA) expression for 157 subjects who also had miRNA expression data. In the replication phase of the study, we replicated associations between 254 miRNAs associated with colorectal cancer and mRNA expression of database-identified target genes in normal colonic mucosa. In the discovery phase of the study, we evaluated expression of 18 miR-NAs (those with 20 or fewer database-identified target genes along with miR-21-5p, miR-215-5p, and miR-124-3p which have more than 500 database-identified target genes) with expression of 17 434 mRNAs to identify new targets in colon tissue. Seed region matches between miRNA and newly identified targeted mRNA were used to help determine direct miRNA-mRNA associations. From the replication of the 121 miRNAs that had at least 1 database-identified target gene using mRNA expression methods, 97.9% were expressed in normal colonic mucosa. Of the 8622 target miRNA-mRNA associations identified in the database, 2658 (30.2%) were associated with gene expression in normal colonic mucosa after adjusting for multiple comparisons. Of the 133 miRNAs with database-identified target genes by non-mRNA expression methods, 97.2% were expressed in normal colonic mucosa. After adjustment for multiple comparisons, 2416 miRNA-mRNA associations remained significant (19.8%). Results from the discovery phase based on detailed examination of 18 miRNAs identified more than 80 000 miRNA-mRNA associations that had not previously linked to the miRNA. Of these miRNA-mRNA associations, 15.6% and 14.8% had seed matches for CRCh38 and CRCh37, respectively. Our data suggest that miRNA target gene databases are incomplete; pathways derived from these databases have similar deficiencies. Although we know a lot about several miRNAs, little is known about other miRNAs in terms of their targeted genes. We encourage others to use their data to continue to further identify and validate miRNA-targeted genes.
dbCPG: A web resource for cancer predisposition genes.
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-06-21
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.
A Network of Genes Antagonistic to the LIN-35 Retinoblastoma Protein of Caenorhabditis elegans
Polley, Stanley R. G.; Fay, David S.
2012-01-01
The Caenorhabditis elegans pRb ortholog, LIN-35, functions in a wide range of cellular and developmental processes. This includes a role of LIN-35 in nutrient utilization by the intestine, which it carries out redundantly with SLR-2, a zinc-finger protein. This and other redundant functions of LIN-35 were identified in genetic screens for mutations that display synthetic phenotypes in conjunction with loss of lin-35. To explore the intestinal role of LIN-35, we conducted a genome-wide RNA-interference-feeding screen for suppressors of lin-35; slr-2 early larval arrest. Of the 26 suppressors identified, 17 fall into three functional classes: (1) ribosome biogenesis genes, (2) mitochondrial prohibitins, and (3) chromatin regulators. Further characterization indicates that different categories of suppressors act through distinct molecular mechanisms. We also tested lin-35; slr-2 suppressors, as well as suppressors of the synthetic multivulval phenotype, to determine the spectrum of lin-35-synthetic phenotypes that could be suppressed following inhibition of these genes. We identified 19 genes, most of which are evolutionarily conserved, that can suppress multiple unrelated lin-35-synthetic phenotypes. Our study reveals a network of genes broadly antagonistic to LIN-35 as well as genes specific to the role of LIN-35 in intestinal and vulval development. Suppressors of multiple lin-35 phenotypes may be candidate targets for anticancer therapies. Moreover, screening for suppressors of phenotypically distinct synthetic interactions, which share a common altered gene, may prove to be a novel and effective approach for identifying genes whose activities are most directly relevant to the core functions of the shared gene. PMID:22542970
Liu, Jian; Cheng, Yuhu; Wang, Xuesong; Zhang, Lin; Liu, Hui
2017-08-17
It is urgent to diagnose colorectal cancer in the early stage. Some feature genes which are important to colorectal cancer development have been identified. However, for the early stage of colorectal cancer, less is known about the identity of specific cancer genes that are associated with advanced clinical stage. In this paper, we conducted a feature extraction method named Optimal Mean based Block Robust Feature Extraction method (OMBRFE) to identify feature genes associated with advanced colorectal cancer in clinical stage by using the integrated colorectal cancer data. Firstly, based on the optimal mean and L 2,1 -norm, a novel feature extraction method called Optimal Mean based Robust Feature Extraction method (OMRFE) is proposed to identify feature genes. Then the OMBRFE method which introduces the block ideology into OMRFE method is put forward to process the colorectal cancer integrated data which includes multiple genomic data: copy number alterations, somatic mutations, methylation expression alteration, as well as gene expression changes. Experimental results demonstrate that the OMBRFE is more effective than previous methods in identifying the feature genes. Moreover, genes identified by OMBRFE are verified to be closely associated with advanced colorectal cancer in clinical stage.
Evangelista, Cláudia Carolina Silva; Guidelli, Giovanna Vieira; Borges, Gustavo; Araujo, Thais Fenz; de Souza, Tiago Alves Jorge; Neves, Ubiraci Pereira da Costa; Tunnacliffe, Alan; Pereira, Tiago Campos
2017-01-01
Abstract The molecular basis of anhydrobiosis, the state of suspended animation entered by some species during extreme desiccation, is still poorly understood despite a number of transcriptome and proteome studies. We therefore conducted functional screening by RNA interference (RNAi) for genes involved in anhydrobiosis in the holo-anhydrobiotic nematode Panagrolaimus superbus. A new method of survival analysis, based on staining, and proof-of-principle RNAi experiments confirmed a role for genes involved in oxidative stress tolerance, while a novel medium-scale RNAi workflow identified a further 40 anhydrobiosis-associated genes, including several involved in proteostasis, DNA repair and signal transduction pathways. This suggests that multiple genes contribute to anhydrobiosis in P. superbus. PMID:29111563
Gunasekara, Chathura; Zhang, Kui; Deng, Wenping; Brown, Laura
2018-01-01
Abstract Despite their important roles, the regulators for most metabolic pathways and biological processes remain elusive. Presently, the methods for identifying metabolic pathway and biological process regulators are intensively sought after. We developed a novel algorithm called triple-gene mutual interaction (TGMI) for identifying these regulators using high-throughput gene expression data. It first calculated the regulatory interactions among triple gene blocks (two pathway genes and one transcription factor (TF)), using conditional mutual information, and then identifies significantly interacted triple genes using a newly identified novel mutual interaction measure (MIM), which was substantiated to reflect strengths of regulatory interactions within each triple gene block. The TGMI calculated the MIM for each triple gene block and then examined its statistical significance using bootstrap. Finally, the frequencies of all TFs present in all significantly interacted triple gene blocks were calculated and ranked. We showed that the TFs with higher frequencies were usually genuine pathway regulators upon evaluating multiple pathways in plants, animals and yeast. Comparison of TGMI with several other algorithms demonstrated its higher accuracy. Therefore, TGMI will be a valuable tool that can help biologists to identify regulators of metabolic pathways and biological processes from the exploded high-throughput gene expression data in public repositories. PMID:29579312
Marchi, Emmanuela; Lodi, Tiziana; Donnini, Claudia
2007-08-01
The original purpose of the experiments described in this article was to identify, in the biotechnologically important yeast Kluyveromyces lactis, gene(s) that are potentially involved in oxidative protein folding within the endoplasmic reticulum (ER), which often represents a bottleneck for heterologous protein production. Because treatment with the membrane-permeable reducing agent dithiothreitol inhibits disulfide bond formation and mimics the reducing effect that the normal transit of folding proteins has in the ER environment, the strategy was to search for genes that conferred higher levels of resistance to dithiothreitol when present in multiple copies. We identified a gene (KNQ1) encoding a drug efflux permease for several toxic compounds that in multiple copies conferred increased dithiothreitol resistance. However, the KNQ1 product is not involved in the excretion of dithiothreitol or in recombinant protein secretion. We generated a knq1 null mutant, and showed that both overexpression and deletion of the KNQ1 gene resulted in increased resistance to dithiothreitol. KNQ1 amplification and deletion resulted in enhanced transcription of iron transport genes, suggesting, for the membrane-associated protein Knq1p, a new, unexpected role in iron homeostasis on which dithiothreitol tolerance may depend.
Adamczuk, Marcin; Dziewit, Lukasz
2017-01-01
The draft genome of multidrug-resistant Aeromonas sp. ARM81 isolated from a wastewater treatment plant in Warsaw (Poland) was obtained. Sequence analysis revealed multiple genes conferring resistance to aminoglycosides, β-lactams or tetracycline. Three different β-lactamase genes were identified, including an extended-spectrum β-lactamase gene bla PER-1 . The antibiotic susceptibility was experimentally tested. Genome sequencing also allowed us to investigate the plasmidome and transposable mobilome of ARM81. Four plasmids, of which two carry phenotypic modules (i.e., genes encoding a zinc transporter ZitB and a putative glucosyltransferase), and 28 putative transposase genes were identified. The mobility of three insertion sequences (isoforms of previously identified elements ISAs12, ISKpn9 and ISAs26) was confirmed using trap plasmids.
Identification of the Core Set of Carbon-Associated Genes in a Bioenergy Grassland Soil
Howe, Adina; Yang, Fan; Williams, Ryan J.; ...
2016-11-17
Despite the central role of soil microbial communities in global carbon (C) cycling, little is known about soil microbial community structure and even less about their metabolic pathways. Efforts to characterize soil communities often focus on identifying differences in gene content across environmental gradients, but an alternative question is what genes are similar in soils. These genes may indicate critical species or potential functions that are required in all soils. Here we identified the “core” set of C cycling sequences widely present in multiple soil metagenomes from a fertilized prairie (FP). Of 226,887 sequences associated with known enzymes involved inmore » the synthesis, metabolism, and transport of carbohydrates, 843 were identified to be consistently prevalent across four replicate soil metagenomes. This core metagenome was functionally and taxonomically diverse, representing five enzyme classes and 99 enzyme families within the CAZy database. Though it only comprised 0.4% of all CAZy-associated genes identified in FP metagenomes, the core was found to be comprised of functions similar to those within cumulative soils. The FP CAZy-associated core sequences were present in multiple publicly available soil metagenomes and most similar to soils sharing geographic proximity. As a result, in soil ecosystems, where high diversity remains a key challenge for metagenomic investigations, these core genes represent a subset of critical functions necessary for carbohydrate metabolism, which can be targeted to evaluate important C fluxes in these and other similar soils.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Howe, Adina; Yang, Fan; Williams, Ryan J.
Despite the central role of soil microbial communities in global carbon (C) cycling, little is known about soil microbial community structure and even less about their metabolic pathways. Efforts to characterize soil communities often focus on identifying differences in gene content across environmental gradients, but an alternative question is what genes are similar in soils. These genes may indicate critical species or potential functions that are required in all soils. Here we identified the “core” set of C cycling sequences widely present in multiple soil metagenomes from a fertilized prairie (FP). Of 226,887 sequences associated with known enzymes involved inmore » the synthesis, metabolism, and transport of carbohydrates, 843 were identified to be consistently prevalent across four replicate soil metagenomes. This core metagenome was functionally and taxonomically diverse, representing five enzyme classes and 99 enzyme families within the CAZy database. Though it only comprised 0.4% of all CAZy-associated genes identified in FP metagenomes, the core was found to be comprised of functions similar to those within cumulative soils. The FP CAZy-associated core sequences were present in multiple publicly available soil metagenomes and most similar to soils sharing geographic proximity. As a result, in soil ecosystems, where high diversity remains a key challenge for metagenomic investigations, these core genes represent a subset of critical functions necessary for carbohydrate metabolism, which can be targeted to evaluate important C fluxes in these and other similar soils.« less
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
Shimoni, Yishai
2018-02-01
One of the goals of cancer research is to identify a set of genes that cause or control disease progression. However, although multiple such gene sets were published, these are usually in very poor agreement with each other, and very few of the genes proved to be functional therapeutic targets. Furthermore, recent findings from a breast cancer gene-expression cohort showed that sets of genes selected randomly can be used to predict survival with a much higher probability than expected. These results imply that many of the genes identified in breast cancer gene expression analysis may not be causal of cancer progression, even though they can still be highly predictive of prognosis. We performed a similar analysis on all the cancer types available in the cancer genome atlas (TCGA), namely, estimating the predictive power of random gene sets for survival. Our work shows that most cancer types exhibit the property that random selections of genes are more predictive of survival than expected. In contrast to previous work, this property is not removed by using a proliferation signature, which implies that proliferation may not always be the confounder that drives this property. We suggest one possible solution in the form of data-driven sub-classification to reduce this property significantly. Our results suggest that the predictive power of random gene sets may be used to identify the existence of sub-classes in the data, and thus may allow better understanding of patient stratification. Furthermore, by reducing the observed bias this may allow more direct identification of biologically relevant, and potentially causal, genes.
2018-01-01
One of the goals of cancer research is to identify a set of genes that cause or control disease progression. However, although multiple such gene sets were published, these are usually in very poor agreement with each other, and very few of the genes proved to be functional therapeutic targets. Furthermore, recent findings from a breast cancer gene-expression cohort showed that sets of genes selected randomly can be used to predict survival with a much higher probability than expected. These results imply that many of the genes identified in breast cancer gene expression analysis may not be causal of cancer progression, even though they can still be highly predictive of prognosis. We performed a similar analysis on all the cancer types available in the cancer genome atlas (TCGA), namely, estimating the predictive power of random gene sets for survival. Our work shows that most cancer types exhibit the property that random selections of genes are more predictive of survival than expected. In contrast to previous work, this property is not removed by using a proliferation signature, which implies that proliferation may not always be the confounder that drives this property. We suggest one possible solution in the form of data-driven sub-classification to reduce this property significantly. Our results suggest that the predictive power of random gene sets may be used to identify the existence of sub-classes in the data, and thus may allow better understanding of patient stratification. Furthermore, by reducing the observed bias this may allow more direct identification of biologically relevant, and potentially causal, genes. PMID:29470520
Complete genomic screen in Parkinson disease: evidence for multiple genes.
Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Slotterbeck, B; Booze, M W; Ribble, R C; Rampersaud, E; West, S G; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Vance, J M; Pericak-Vance, M A
2001-11-14
The relative contribution of genes vs environment in idiopathic Parkinson disease (PD) is controversial. Although genetic studies have identified 2 genes in which mutations cause rare single-gene variants of PD and observational studies have suggested a genetic component, twin studies have suggested that little genetic contribution exists in the common forms of PD. To identify genetic risk factors for idiopathic PD. Genetic linkage study conducted 1995-2000 in which a complete genomic screen (n = 344 markers) was performed in 174 families with multiple individuals diagnosed as having idiopathic PD, identified through probands in 13 clinic populations in the continental United States and Australia. A total of 870 family members were studied: 378 diagnosed as having PD, 379 unaffected by PD, and 113 with unclear status. Logarithm of odds (lod) scores generated from parametric and nonparametric genetic linkage analysis. Two-point parametric maximum parametric lod score (MLOD) and multipoint nonparametric lod score (LOD) linkage analysis detected significant evidence for linkage to 5 distinct chromosomal regions: chromosome 6 in the parkin gene (MLOD = 5.07; LOD = 5.47) in families with at least 1 individual with PD onset at younger than 40 years, chromosomes 17q (MLOD = 2.28; LOD = 2.62), 8p (MLOD = 2.01; LOD = 2.22), and 5q (MLOD = 2.39; LOD = 1.50) overall and in families with late-onset PD, and chromosome 9q (MLOD = 1.52; LOD = 2.59) in families with both levodopa-responsive and levodopa-nonresponsive patients. Our data suggest that the parkin gene is important in early-onset PD and that multiple genetic factors may be important in the development of idiopathic late-onset PD.
Ecotoxicogenomics is research that identifies patterns of gene expression in wildlife and predicts effects of environmental stressors. We are developing a multiple stressor, multiple life stage exposure model using the fathead minnow (Pimephales promelas), initially studying fou...
2014-01-01
Background Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. Methods We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Results Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients’ clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Conclusions Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology. PMID:24885126
Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan
2014-05-15
Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.
Gupta, Mayetri; Cheung, Ching-Lung; Hsu, Yi-Hsiang; Demissie, Serkalem; Cupples, L Adrienne; Kiel, Douglas P; Karasik, David
2011-06-01
Genome-wide association studies (GWAS) using high-density genotyping platforms offer an unbiased strategy to identify new candidate genes for osteoporosis. It is imperative to be able to clearly distinguish signal from noise by focusing on the best phenotype in a genetic study. We performed GWAS of multiple phenotypes associated with fractures [bone mineral density (BMD), bone quantitative ultrasound (QUS), bone geometry, and muscle mass] with approximately 433,000 single-nucleotide polymorphisms (SNPs) and created a database of resulting associations. We performed analysis of GWAS data from 23 phenotypes by a novel modification of a block clustering algorithm followed by gene-set enrichment analysis. A data matrix of standardized regression coefficients was partitioned along both axes--SNPs and phenotypes. Each partition represents a distinct cluster of SNPs that have similar effects over a particular set of phenotypes. Application of this method to our data shows several SNP-phenotype connections. We found a strong cluster of association coefficients of high magnitude for 10 traits (BMD at several skeletal sites, ultrasound measures, cross-sectional bone area, and section modulus of femoral neck and shaft). These clustered traits were highly genetically correlated. Gene-set enrichment analyses indicated the augmentation of genes that cluster with the 10 osteoporosis-related traits in pathways such as aldosterone signaling in epithelial cells, role of osteoblasts, osteoclasts, and chondrocytes in rheumatoid arthritis, and Parkinson signaling. In addition to several known candidate genes, we also identified PRKCH and SCNN1B as potential candidate genes for multiple bone traits. In conclusion, our mining of GWAS results revealed the similarity of association results between bone strength phenotypes that may be attributed to pleiotropic effects of genes. This knowledge may prove helpful in identifying novel genes and pathways that underlie several correlated phenotypes, as well as in deciphering genetic and phenotypic modularity underlying osteoporosis risk. Copyright © 2011 American Society for Bone and Mineral Research.
Martin, Maureen V; Rollins, Brandi; Sequeira, P Adolfo; Mesén, Andrea; Byerley, William; Stein, Richard; Moon, Emily A; Akil, Huda; Jones, Edward G; Watson, Stanley J; Barchas, Jack; DeLisi, Lynn E; Myers, Richard M; Schatzberg, Alan; Bunney, William E; Vawter, Marquis P
2009-01-01
Background The purpose of this study was to examine the effects of glucose reduction stress on lymphoblastic cell line (LCL) gene expression in subjects with schizophrenia compared to non-psychotic relatives. Methods LCLs were grown under two glucose conditions to measure the effects of glucose reduction stress on exon expression in subjects with schizophrenia compared to unaffected family member controls. A second aim of this project was to identify cis-regulated transcripts associated with diagnosis. Results There were a total of 122 transcripts with significant diagnosis by probeset interaction effects and 328 transcripts with glucose deprivation by probeset interaction probeset effects after corrections for multiple comparisons. There were 8 transcripts with expression significantly affected by the interaction between diagnosis and glucose deprivation and probeset after correction for multiple comparisons. The overall validation rate by qPCR of 13 diagnosis effect genes identified through microarray was 62%, and all genes tested by qPCR showed concordant up- or down-regulation by qPCR and microarray. We assessed brain gene expression of five genes found to be altered by diagnosis and glucose deprivation in LCLs and found a significant decrease in expression of one gene, glutaminase, in the dorsolateral prefrontal cortex (DLPFC). One SNP with previously identified regulation by a 3' UTR SNP was found to influence IRF5 expression in both brain and lymphocytes. The relationship between the 3' UTR rs10954213 genotype and IRF5 expression was significant in LCLs (p = 0.0001), DLPFC (p = 0.007), and anterior cingulate cortex (p = 0.002). Conclusion Experimental manipulation of cells lines from subjects with schizophrenia may be a useful approach to explore stress related gene expression alterations in schizophrenia and to identify SNP variants associated with gene expression. PMID:19772658
Construct and Compare Gene Coexpression Networks with DAPfinder and DAPview.
Skinner, Jeff; Kotliarov, Yuri; Varma, Sudhir; Mine, Karina L; Yambartsev, Anatoly; Simon, Richard; Huyen, Yentram; Morgun, Andrey
2011-07-14
DAPfinder and DAPview are novel BRB-ArrayTools plug-ins to construct gene coexpression networks and identify significant differences in pairwise gene-gene coexpression between two phenotypes. Each significant difference in gene-gene association represents a Differentially Associated Pair (DAP). Our tools include several choices of filtering methods, gene-gene association metrics, statistical testing methods and multiple comparison adjustments. Network results are easily displayed in Cytoscape. Analyses of glioma experiments and microarray simulations demonstrate the utility of these tools. DAPfinder is a new friendly-user tool for reconstruction and comparison of biological networks.
Lochlainn, Seosamh Ó; Amoah, Stephen; Graham, Neil S; Alamer, Khalid; Rios, Juan J; Kurup, Smita; Stoute, Andrew; Hammond, John P; Østergaard, Lars; King, Graham J; White, Phillip J; Broadley, Martin R
2011-12-08
Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service.
2011-01-01
Background Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. Results We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Conclusions Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service. PMID:22152063
Geographically multifarious phenotypic divergence during speciation
Gompert, Zachariah; Lucas, Lauren K; Nice, Chris C; Fordyce, James A; Alex Buerkle, C; Forister, Matthew L
2013-01-01
Speciation is an important evolutionary process that occurs when barriers to gene flow evolve between previously panmictic populations. Although individual barriers to gene flow have been studied extensively, we know relatively little regarding the number of barriers that isolate species or whether these barriers are polymorphic within species. Herein, we use a series of field and lab experiments to quantify phenotypic divergence and identify possible barriers to gene flow between the butterfly species Lycaeides idas and Lycaeides melissa. We found evidence that L. idas and L. melissa have diverged along multiple phenotypic axes. Specifically, we identified major phenotypic differences in female oviposition preference and diapause initiation, and more moderate divergence in mate preference. Multiple phenotypic differences might operate as barriers to gene flow, as shown by correlations between genetic distance and phenotypic divergence and patterns of phenotypic variation in admixed Lycaeides populations. Although some of these traits differed primarily between species (e.g., diapause initiation), several traits also varied among conspecific populations (e.g., male mate preference and oviposition preference). PMID:23532669
Identification of rare genetic variation of NLRP1 gene in familial multiple sclerosis.
Maver, Ales; Lavtar, Polona; Ristić, Smiljana; Stopinšek, Sanja; Simčič, Saša; Hočevar, Keli; Sepčić, Juraj; Drulović, Jelena; Pekmezović, Tatjana; Novaković, Ivana; Alenka, Hodžić; Rudolf, Gorazd; Šega, Saša; Starčević-Čizmarević, Nada; Palandačić, Anja; Zamolo, Gordana; Kapović, Miljenko; Likar, Tina; Peterlin, Borut
2017-06-16
The genetic etiology and the contribution of rare genetic variation in multiple sclerosis (MS) has not yet been elucidated. Although familial forms of MS have been described, no convincing rare and penetrant variants have been reported to date. We aimed to characterize the contribution of rare genetic variation in familial and sporadic MS and have identified a family with two sibs affected by concomitant MS and malignant melanoma (MM). We performed whole exome sequencing in this primary family and 38 multiplex MS families and 44 sporadic MS cases and performed transcriptional and immunologic assessment of the identified variants. We identified a potentially causative homozygous missense variant in NLRP1 gene (Gly587Ser) in the primary family. Further possibly pathogenic NLRP1 variants were identified in the expanded cohort of patients. Stimulation of peripheral blood mononuclear cells from MS patients with putatively pathogenic NLRP1 variants showed an increase in IL-1B gene expression and active cytokine IL-1β production, as well as global activation of NLRP1-driven immunologic pathways. We report a novel familial association of MS and MM, and propose a possible underlying genetic basis in NLRP1 gene. Furthermore, we provide initial evidence of the broader implications of NLRP1-related pathway dysfunction in MS.
Tully, Douglas B; Bao, Wenjun; Goetz, Amber K; Blystone, Chad R; Ren, Hongzu; Schmid, Judith E; Strader, Lillian F; Wood, Carmen R; Best, Deborah S; Narotsky, Michael G; Wolf, Douglas C; Rockett, John C; Dix, David J
2006-09-15
Four triazole fungicides were studied using toxicogenomic techniques to identify potential mechanisms of action. Adult male Sprague-Dawley rats were dosed for 14 days by gavage with fluconazole, myclobutanil, propiconazole, or triadimefon. Following exposure, serum was collected for hormone measurements, and liver and testes were collected for histology, enzyme biochemistry, or gene expression profiling. Body and testis weights were unaffected, but liver weights were significantly increased by all four triazoles, and hepatocytes exhibited centrilobular hypertrophy. Myclobutanil exposure increased serum testosterone and decreased sperm motility, but no treatment-related testis histopathology was observed. We hypothesized that gene expression profiles would identify potential mechanisms of toxicity and used DNA microarrays and quantitative real-time PCR (qPCR) to generate profiles. Triazole fungicides are designed to inhibit fungal cytochrome P450 (CYP) 51 enzyme but can also modulate the expression and function of mammalian CYP genes and enzymes. Triazoles affected the expression of numerous CYP genes in rat liver and testis, including multiple Cyp2c and Cyp3a isoforms as well as other xenobiotic metabolizing enzyme (XME) and transporter genes. For some genes, such as Ces2 and Udpgtr2, all four triazoles had similar effects on expression, suggesting possible common mechanisms of action. Many of these CYP, XME and transporter genes are regulated by xeno-sensing nuclear receptors, and hierarchical clustering of CAR/PXR-regulated genes demonstrated the similarities of toxicogenomic responses in liver between all four triazoles and in testis between myclobutanil and triadimefon. Triazoles also affected expression of multiple genes involved in steroid hormone metabolism in the two tissues. Thus, gene expression profiles helped identify possible toxicological mechanisms of the triazole fungicides.
GOEAST: a web-based software toolkit for Gene Ontology enrichment analysis.
Zheng, Qi; Wang, Xiu-Jie
2008-07-01
Gene Ontology (GO) analysis has become a commonly used approach for functional studies of large-scale genomic or transcriptomic data. Although there have been a lot of software with GO-related analysis functions, new tools are still needed to meet the requirements for data generated by newly developed technologies or for advanced analysis purpose. Here, we present a Gene Ontology Enrichment Analysis Software Toolkit (GOEAST), an easy-to-use web-based toolkit that identifies statistically overrepresented GO terms within given gene sets. Compared with available GO analysis tools, GOEAST has the following improved features: (i) GOEAST displays enriched GO terms in graphical format according to their relationships in the hierarchical tree of each GO category (biological process, molecular function and cellular component), therefore, provides better understanding of the correlations among enriched GO terms; (ii) GOEAST supports analysis for data from various sources (probe or probe set IDs of Affymetrix, Illumina, Agilent or customized microarrays, as well as different gene identifiers) and multiple species (about 60 prokaryote and eukaryote species); (iii) One unique feature of GOEAST is to allow cross comparison of the GO enrichment status of multiple experiments to identify functional correlations among them. GOEAST also provides rigorous statistical tests to enhance the reliability of analysis results. GOEAST is freely accessible at http://omicslab.genetics.ac.cn/GOEAST/
Population- and individual-specific regulatory variation in Sardinia.
Pala, Mauro; Zappala, Zachary; Marongiu, Mara; Li, Xin; Davis, Joe R; Cusano, Roberto; Crobu, Francesca; Kukurba, Kimberly R; Gloudemans, Michael J; Reinier, Frederic; Berutti, Riccardo; Piras, Maria G; Mulas, Antonella; Zoledziewska, Magdalena; Marongiu, Michele; Sorokin, Elena P; Hess, Gaelen T; Smith, Kevin S; Busonero, Fabio; Maschio, Andrea; Steri, Maristella; Sidore, Carlo; Sanna, Serena; Fiorillo, Edoardo; Bassik, Michael C; Sawcer, Stephen J; Battle, Alexis; Novembre, John; Jones, Chris; Angius, Andrea; Abecasis, Gonçalo R; Schlessinger, David; Cucca, Francesco; Montgomery, Stephen B
2017-05-01
Genetic studies of complex traits have mainly identified associations with noncoding variants. To further determine the contribution of regulatory variation, we combined whole-genome and transcriptome data for 624 individuals from Sardinia to identify common and rare variants that influence gene expression and splicing. We identified 21,183 expression quantitative trait loci (eQTLs) and 6,768 splicing quantitative trait loci (sQTLs), including 619 new QTLs. We identified high-frequency QTLs and found evidence of selection near genes involved in malarial resistance and increased multiple sclerosis risk, reflecting the epidemiological history of Sardinia. Using family relationships, we identified 809 segregating expression outliers (median z score of 2.97), averaging 13.3 genes per individual. Outlier genes were enriched for proximal rare variants, providing a new approach to study large-effect regulatory variants and their relevance to traits. Our results provide insight into the effects of regulatory variants and their relationship to population history and individual genetic risk.
SEA: a super-enhancer archive.
Wei, Yanjun; Zhang, Shumei; Shang, Shipeng; Zhang, Bin; Li, Song; Wang, Xinyu; Wang, Fang; Su, Jianzhong; Wu, Qiong; Liu, Hongbo; Zhang, Yan
2016-01-04
Super-enhancers are large clusters of transcriptional enhancers regarded as having essential roles in driving the expression of genes that control cell identity during development and tumorigenesis. The construction of a genome-wide super-enhancer database is urgently needed to better understand super-enhancer-directed gene expression regulation for a given biology process. Here, we present a specifically designed web-accessible database, Super-Enhancer Archive (SEA, http://sea.edbc.org). SEA focuses on integrating super-enhancers in multiple species and annotating their potential roles in the regulation of cell identity gene expression. The current release of SEA incorporates 83 996 super-enhancers computationally or experimentally identified in 134 cell types/tissues/diseases, including human (75 439, three of which were experimentally identified), mouse (5879, five of which were experimentally identified), Drosophila melanogaster (1774) and Caenorhabditis elegans (904). To facilitate data extraction, SEA supports multiple search options, including species, genome location, gene name, cell type/tissue and super-enhancer name. The response provides detailed (epi)genetic information, incorporating cell type specificity, nearby genes, transcriptional factor binding sites, CRISPR/Cas9 target sites, evolutionary conservation, SNPs, H3K27ac, DNA methylation, gene expression and TF ChIP-seq data. Moreover, analytical tools and a genome browser were developed for users to explore super-enhancers and their roles in defining cell identity and disease processes in depth. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke
2001-01-01
Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950
A genome-scale map of expression for a mouse brain section obtained using voxelation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chin, Mark H.; Geng, Alex B.; Khan, Arshad H.
Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological diseases. We have reconstructed 2- dimensional images of gene expression for 20,000 genes in a coronal slice of the mouse brain at the level of the striatum by using microarrays in combination with voxelation at a resolution of 1 mm3. Good reliability of the microarray results were confirmed using multiple replicates, subsequent quantitative RT-PCR voxelation, mass spectrometry voxelation and publicly available in situ hybridization data. Known and novel genes were identified with expression patterns localized to defined substructures within the brain. In addition, genesmore » with unexpected patterns were identified and cluster analysis identified a set of genes with a gradient of dorsal/ventral expression not restricted to known anatomical boundaries. The genome-scale maps of gene expression obtained using voxelation will be a valuable tool for the neuroscience community.« less
2014-01-01
Background In complex large-scale experiments, in addition to simultaneously considering a large number of features, multiple hypotheses are often being tested for each feature. This leads to a problem of multi-dimensional multiple testing. For example, in gene expression studies over ordered categories (such as time-course or dose-response experiments), interest is often in testing differential expression across several categories for each gene. In this paper, we consider a framework for testing multiple sets of hypothesis, which can be applied to a wide range of problems. Results We adopt the concept of the overall false discovery rate (OFDR) for controlling false discoveries on the hypothesis set level. Based on an existing procedure for identifying differentially expressed gene sets, we discuss a general two-step hierarchical hypothesis set testing procedure, which controls the overall false discovery rate under independence across hypothesis sets. In addition, we discuss the concept of the mixed-directional false discovery rate (mdFDR), and extend the general procedure to enable directional decisions for two-sided alternatives. We applied the framework to the case of microarray time-course/dose-response experiments, and proposed three procedures for testing differential expression and making multiple directional decisions for each gene. Simulation studies confirm the control of the OFDR and mdFDR by the proposed procedures under independence and positive correlations across genes. Simulation results also show that two of our new procedures achieve higher power than previous methods. Finally, the proposed methodology is applied to a microarray dose-response study, to identify 17 β-estradiol sensitive genes in breast cancer cells that are induced at low concentrations. Conclusions The framework we discuss provides a platform for multiple testing procedures covering situations involving two (or potentially more) sources of multiplicity. The framework is easy to use and adaptable to various practical settings that frequently occur in large-scale experiments. Procedures generated from the framework are shown to maintain control of the OFDR and mdFDR, quantities that are especially relevant in the case of multiple hypothesis set testing. The procedures work well in both simulations and real datasets, and are shown to have better power than existing methods. PMID:24731138
Visscher, Anne M.; Belfield, Eric J.; Vlad, Daniela; Irani, Niloufer; Moore, Ian; Harberd, Nicholas P.
2015-01-01
A subset of genes in Arabidopsis thaliana is known to be up-regulated in response to a wide range of different environmental stress factors. However, not all of these genes are characterized as yet with respect to their functions. In this study, we used transgenic knockout, overexpression and reporter gene approaches to try to elucidate the biological roles of five unknown multiple-stress responsive genes in Arabidopsis. The selected genes have the following locus identifiers: At1g18740, At1g74450, At4g27652, At4g29780 and At5g12010. Firstly, T-DNA insertion knockout lines were identified for each locus and screened for altered phenotypes. None of the lines were found to be visually different from wildtype Col-0. Secondly, 35S-driven overexpression lines were generated for each open reading frame. Analysis of these transgenic lines showed altered phenotypes for lines overexpressing the At1g74450 ORF. Plants overexpressing the multiple-stress responsive gene At1g74450 are stunted in height and have reduced male fertility. Alexander staining of anthers from flowers at developmental stage 12–13 showed either an absence or a reduction in viable pollen compared to wildtype Col-0 and At1g74450 knockout lines. Interestingly, the effects of stress on crop productivity are most severe at developmental stages such as male gametophyte development. However, the molecular factors and regulatory networks underlying environmental stress-induced male gametophytic alterations are still largely unknown. Our results indicate that the At1g74450 gene provides a potential link between multiple environmental stresses, plant height and pollen development. In addition, ruthenium red staining analysis showed that At1g74450 may affect the composition of the inner seed coat mucilage layer. Finally, C-terminal GFP fusion proteins for At1g74450 were shown to localise to the cytosol. PMID:26485022
Identifying a gene expression signature of cluster headache in blood
Eising, Else; Pelzer, Nadine; Vijfhuizen, Lisanne S.; Vries, Boukje de; Ferrari, Michel D.; ‘t Hoen, Peter A. C.; Terwindt, Gisela M.; van den Maagdenberg, Arn M. J. M.
2017-01-01
Cluster headache is a relatively rare headache disorder, typically characterized by multiple daily, short-lasting attacks of excruciating, unilateral (peri-)orbital or temporal pain associated with autonomic symptoms and restlessness. To better understand the pathophysiology of cluster headache, we used RNA sequencing to identify differentially expressed genes and pathways in whole blood of patients with episodic (n = 19) or chronic (n = 20) cluster headache in comparison with headache-free controls (n = 20). Gene expression data were analysed by gene and by module of co-expressed genes with particular attention to previously implicated disease pathways including hypocretin dysregulation. Only moderate gene expression differences were identified and no associations were found with previously reported pathogenic mechanisms. At the level of functional gene sets, associations were observed for genes involved in several brain-related mechanisms such as GABA receptor function and voltage-gated channels. In addition, genes and modules of co-expressed genes showed a role for intracellular signalling cascades, mitochondria and inflammation. Although larger study samples may be required to identify the full range of involved pathways, these results indicate a role for mitochondria, intracellular signalling and inflammation in cluster headache. PMID:28074859
Dong, Tao; He, Jing; Wang, Shiqing; Wang, Lianzhang; Cheng, Yuqi; Zhong, Yi
2016-01-01
The etiology of autism is so complicated because it involves the effects of variants of several hundred risk genes along with the contribution of environmental factors. Therefore, it has been challenging to identify the causal paths that lead to the core autistic symptoms such as social deficit, repetitive behaviors, and behavioral inflexibility. As an alternative approach, extensive efforts have been devoted to identifying the convergence of the targets and functions of the autism-risk genes to facilitate mapping out causal paths. In this study, we used a reversal-learning task to measure behavioral flexibility in Drosophila and determined the effects of loss-of-function mutations in multiple autism-risk gene homologs in flies. Mutations of five autism-risk genes with diversified molecular functions all led to a similar phenotype of behavioral inflexibility indicated by impaired reversal-learning. These reversal-learning defects resulted from the inability to forget or rather, specifically, to activate Rac1 (Ras-related C3 botulinum toxin substrate 1)-dependent forgetting. Thus, behavior-evoked activation of Rac1-dependent forgetting has a converging function for autism-risk genes. PMID:27335463
Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.
Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole
2017-08-01
Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.
Genetic association of impulsivity in young adults: a multivariate study
Khadka, S; Narayanan, B; Meda, S A; Gelernter, J; Han, S; Sawyer, B; Aslanzadeh, F; Stevens, M C; Hawkins, K A; Anticevic, A; Potenza, M N; Pearlson, G D
2014-01-01
Impulsivity is a heritable, multifaceted construct with clinically relevant links to multiple psychopathologies. We assessed impulsivity in young adult (N~2100) participants in a longitudinal study, using self-report questionnaires and computer-based behavioral tasks. Analysis was restricted to the subset (N=426) who underwent genotyping. Multivariate association between impulsivity measures and single-nucleotide polymorphism data was implemented using parallel independent component analysis (Para-ICA). Pathways associated with multiple genes in components that correlated significantly with impulsivity phenotypes were then identified using a pathway enrichment analysis. Para-ICA revealed two significantly correlated genotype–phenotype component pairs. One impulsivity component included the reward responsiveness subscale and behavioral inhibition scale of the Behavioral-Inhibition System/Behavioral-Activation System scale, and the second impulsivity component included the non-planning subscale of the Barratt Impulsiveness Scale and the Experiential Discounting Task. Pathway analysis identified processes related to neurogenesis, nervous system signal generation/amplification, neurotransmission and immune response. We identified various genes and gene regulatory pathways associated with empirically derived impulsivity components. Our study suggests that gene networks implicated previously in brain development, neurotransmission and immune response are related to impulsive tendencies and behaviors. PMID:25268255
dbCPG: A web resource for cancer predisposition genes
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-01-01
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119
MVisAGe Identifies Concordant and Discordant Genomic Alterations of Driver Genes in Squamous Tumors.
Walter, Vonn; Du, Ying; Danilova, Ludmila; Hayward, Michele C; Hayes, D Neil
2018-06-15
Integrated analyses of multiple genomic datatypes are now common in cancer profiling studies. Such data present opportunities for numerous computational experiments, yet analytic pipelines are limited. Tools such as the cBioPortal and Regulome Explorer, although useful, are not easy to access programmatically or to implement locally. Here, we introduce the MVisAGe R package, which allows users to quantify gene-level associations between two genomic datatypes to investigate the effect of genomic alterations (e.g., DNA copy number changes on gene expression). Visualizing Pearson/Spearman correlation coefficients according to the genomic positions of the underlying genes provides a powerful yet novel tool for conducting exploratory analyses. We demonstrate its utility by analyzing three publicly available cancer datasets. Our approach highlights canonical oncogenes in chr11q13 that displayed the strongest associations between expression and copy number, including CCND1 and CTTN , genes not identified by copy number analysis in the primary reports. We demonstrate highly concordant usage of shared oncogenes on chr3q, yet strikingly diverse oncogene usage on chr11q as a function of HPV infection status. Regions of chr19 that display remarkable associations between methylation and gene expression were identified, as were previously unreported miRNA-gene expression associations that may contribute to the epithelial-to-mesenchymal transition. Significance: This study presents an important bioinformatics tool that will enable integrated analyses of multiple genomic datatypes. Cancer Res; 78(12); 3375-85. ©2018 AACR . ©2018 American Association for Cancer Research.
Transposon mutagenesis identifies genes that cooperate with mutant Pten in breast cancer progression
Rangel, Roberto; Lee, Song-Choon; Hon-Kim Ban, Kenneth; Guzman-Rojas, Liliana; Mann, Michael B.; Newberg, Justin Y.; McNoe, Leslie A.; Selvanesan, Luxmanan; Ward, Jerrold M.; Rust, Alistair G.; Chin, Kuan-Yew; Black, Michael A.; Jenkins, Nancy A.; Copeland, Neal G.
2016-01-01
Triple-negative breast cancer (TNBC) has the worst prognosis of any breast cancer subtype. To better understand the genetic forces driving TNBC, we performed a transposon mutagenesis screen in a phosphatase and tensin homolog (Pten) mutant mice and identified 12 candidate trunk drivers and a much larger number of progression genes. Validation studies identified eight TNBC tumor suppressor genes, including the GATA-like transcriptional repressor TRPS1. Down-regulation of TRPS1 in TNBC cells promoted epithelial-to-mesenchymal transition (EMT) by deregulating multiple EMT pathway genes, in addition to increasing the expression of SERPINE1 and SERPINB2 and the subsequent migration, invasion, and metastasis of tumor cells. Transposon mutagenesis has thus provided a better understanding of the genetic forces driving TNBC and discovered genes with potential clinical importance in TNBC. PMID:27849608
For patients with solid tumors, the primary cause of illness and death is metastasis, a complex process involving multiple steps and cooperation between cancerous and normal cells. Many genes must be involved, but few have been found and characterized.
Deng, Peng; Wang, Xiaoqiang; Baird, Sonya M; Showmaker, Kurt C; Smith, Leif; Peterson, Daniel G; Lu, Shien
2016-06-01
Burkholderia contaminans MS14 shows significant antimicrobial activities against plant and animal pathogenic fungi and bacteria. The antifungal agent occidiofungin produced by MS14 has great potential for development of biopesticides and pharmaceutical drugs. However, the use of Burkholderia species as biocontrol agent in agriculture is restricted due to the difficulties in distinguishing between plant growth-promoting bacteria and the pathogenic bacteria. The complete MS14 genome was sequenced and analyzed to find what beneficial and virulence-related genes it harbors. The phylogenetic relatedness of B. contaminans MS14 and other 17 Burkholderia species was also analyzed. To research MS14's potential virulence, the gene regions related to the antibiotic production, antibiotic resistance, and virulence were compared between MS14 and other Burkholderia genomes. The genome of B. contaminans MS14 was sequenced and annotated. The genomic analyses reveal the presence of multiple gene sets for antimicrobial biosynthesis, which contribute to its antimicrobial activities. BLAST results indicate that the MS14 genome harbors a large number of unique regions. MS14 is closely related to another plant growth-promoting Burkholderia strain B. lata 383 according to the average nucleotide identity data. Moreover, according to the phylogenetic analysis, plant growth-promoting species isolated from soils and mammalian pathogenic species are clustered together, respectively. MS14 has multiple antimicrobial activity-related genes identified from the genome, but it lacks key virulence-related gene loci found in the pathogenic strains. Additionally, plant growth-promoting Burkholderia species have one or more antimicrobial biosynthesis genes in their genomes as compared with nonplant growth-promoting soil-isolated Burkholderia species. On the other hand, pathogenic species harbor multiple virulence-associated gene loci that are not present in nonpathogenic Burkholderia species. The MS14 genome as well as Burkholderia species genome show considerable diversity. Multiple antimicrobial agent biosynthesis genes were identified in the genome of plant growth-promoting species of Burkholderia. In addition, by comparing to nonpathogenic Burkholderia species, pathogenic Burkholderia species have more characterized homologs of the gene loci known to contribute to pathogenicity and virulence to plant and animals. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Identifying mechanistic indicators of childhood asthma from blood gene expression
Asthmatic individuals have been identified as a susceptible subpopulation for air pollutants. However, asthma represents a syndrome with multiple probable etiologies, and the identification of these asthma endotypes is critical to accurately define the most susceptible subpopula...
Li, Fei-Feng; Wang, Xu-Dong; Zhu, Min-Wei; Lou, Zhi-Hong; Zhang, Qiong; Zhu, Chun-Yu; Feng, Hong-Lin; Lin, Zhi-Guo; Liu, Shu-Lin
2015-12-01
Microcephalic osteodysplastic primordial dwarfism type II (MOPD II) is a highly detrimental human autosomal inherited recessive disorder. The hallmark characteristics of this disease are intrauterine and postnatal growth restrictions, with some patients also having cerebrovascular problems such as cerebral aneurysms. The genomic basis behind most clinical features of MOPD II remains largely unclear. The aim of this work was to identify the genetic defects in a Chinese family with MOPD II associated with multiple intracranial aneurysms. The patient had typical MOPD II syndrome, with subarachnoid hemorrhage and multiple intracranial aneurysms. We identified three novel mutations in the PCNT gene, including one single base alteration (9842A>C in exon 45) and two deletions (Del-C in exon 30 and Del-16 in exon 41). The deletions were co-segregated with the affected individual in the family and were not present in the control population. Computer modeling demonstrated that the deletions may cause drastic changes on the secondary and tertiary structures, affecting the hydrophilicity and hydrophobicity of the mutant proteins. In conclusion, we identified two novel mutations in the PCNT gene associated with MOPD II and intracranial aneurysms, and the mutations were expected to alter the stability and functioning of the protein by computer modeling.
Bhavanandan, V P; Gupta, D; Woitach, J; Guo, X; Jiang, W
1999-06-01
Secreted epithelial mucins are large macromolecules which exhibit extreme polydispersity, the molecular basis of which is not fully understood. We have obtained partial sequences of two genes (BSM1 and BSM2) coding for two distinct molecules. This is the first time that such closely-related genes have been identified for any mucin from an animal. We propose that a combination of multiple homologous genes, alternative splicing, differential glycosylation, and additional post-translational processing all contribute to the extreme polydispersity of mucins. The multiple domain structure and non-identical tandem repeats are also very important for the generation of the saccharide diversities of mucins.
Zhang, Zhengrong; Yuan, Li; Liu, Xin; Chen, Xuesen; Wang, Xiaoyun
2018-01-10
As a family of transcription factors, DNA binding with one figure (Dof) proteins play important roles in various biological processes in plants. Here, a total of 60 putative apple (Malus domestica) Dof genes (MdDof) were identified and mapped to different chromosomes. Chromosomal distribution and synteny analysis indicated that the expansion of the MdDof genes came primarily from segmental and duplication events, and from whole genome duplication, which lead to more Dof members in apples than in other plants. All 60 MdDof genes were classified into thirteen groups, according to multiple sequence alignment and the phylogenetic tree constructed of Dof genes from apple, peach (Prunus persica), Arabidopsis and rice. Within each group, the members shared a similar exon/intron and motif compositions, although the sizes of the MdDof genes and encoding proteins were quite different. Several Dof genes from the apple and peach were identified to be homologues based on their close synteny relationship, which suggested that these genes bear similar functions. Half of the MdDof genes were randomly selected to determine their responses to different stresses. The majority of MdDof genes were quite sensitive to PEG, NaCl, cold and exogenous ABA treatment. Our results suggested that MdDof family members may play important roles in plant tolerance to abiotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.
Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K.; Li, Changwei; Schwander, Karen; Richard, Melissa A.; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M.; Bielak, Lawrence F.; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P.; Horimoto, Andrea R. V. R.; Lohman, Kurt K.; Manning, Alisa K.; Rankinen, Tuomo; Smith, Albert V.; Wojczynski, Mary K.; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Harris, Sarah E.; He, Meian; Hsu, Fang-Chi; Jackson, Anne U.; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Nolte, Ilja M.; Padmanabhan, Sandosh; Robino, Antonietta; Scott, Robert A.; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O.; Varga, Tibor V.; Vitart, Veronique; Wang, Yajuan; Warren, Helen R.; Wen, Wanqing; Yanek, Lisa R.; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Arking, Dan E.; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L.; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M.; Correa, Adolfo; de las Fuentes, Lisa; de Mutsert, Renée; de Silva, H. Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B.; Ehret, Georg; Eppinga, Ruben N.; Faul, Jessica D.; Felix, Stephan B.; Forouhi, Nita G.; Forrester, Terrence; Franco, Oscar H.; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C. Charles; Gu, Dongfeng; Hagenaars, Saskia P.; Hallmans, Göran; Harris, Tamara B.; He, Jiang; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V.; Ikram, M. Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O.; Koh, Woon-Puay; Krieger, José E.; Kritchevsky, Stephen B.; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A.; Langefeld, Carl D.; Langenberg, Claudia; Launer, Lenore J.; Lehne, Benjamin; Lewis, Cora E.; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A.; Meitinger, Thomas; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L.; Momozawa, Yukihide; Nalls, Mike A.; Nelson, Christopher P.; Sotoodehnia, Nona; Norris, Jill M.; O'Connell, Jeff R.; Palmer, Nicholette D.; Perls, Thomas; Pedersen, Nancy L.; Peters, Annette; Peyser, Patricia A.; Poulter, Neil; Raffel, Leslie J.; Raitakari, Olli T.; Roll, Kathryn; Rose, Lynda M.; Rosendaal, Frits R.; Rotter, Jerome I.; Schmidt, Carsten O.; Schreiner, Pamela J.; Schupf, Nicole; Scott, William R.; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M.; Smith, Jennifer A.; Snieder, Harold; Starr, John M.; Strauch, Konstantin; Stringham, Heather M.; Tan, Nicholas Y. Q.; Tang, Hua; Taylor, Kent D.; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T.; Uitterlinden, André G.; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B.; Becker, Diane M.; Boehnke, Michael; Bowden, Donald W.; Chambers, John C.; Deary, Ian J.; Esko, Tõnu; Farrall, Martin; Franks, Paul W.; Freedman, Barry I.; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S.; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C.; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K. E.; Oldehinkel, Albertine J.; Penninx, Brenda W. J. H.; Polasek, Ozren; Porteous, David J.; Rauramaa, Rainer; Samani, Nilesh J.; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E.; Watkins, Hugh; Weir, David R.; Wickremasinghe, Ananda R.; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K.; Gudnason, Vilmundur; Horta, Bernardo L.; Kardia, Sharon L. R.; Liu, Yongmei; Pereira, Alexandre C.; Psaty, Bruce M.; Ridker, Paul M.; van Dam, Rob M.; Gauderman, W. James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O.; Fornage, Myriam; Rotimi, Charles N.; Cupples, L. Adrienne; Kelly, Tanika N.; Fox, Ervin R.; Hayward, Caroline; van Duijn, Cornelia M.; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Morrison, Alanna C.; Caulfield, Mark J.; Munroe, Patricia B.; Rao, Dabeeru C.; Province, Michael A.; Levy, Daniel
2018-01-01
Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10−5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10−8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10−8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension. PMID:29912962
Feitosa, Mary F; Kraja, Aldi T; Chasman, Daniel I; Sung, Yun J; Winkler, Thomas W; Ntalla, Ioanna; Guo, Xiuqing; Franceschini, Nora; Cheng, Ching-Yu; Sim, Xueling; Vojinovic, Dina; Marten, Jonathan; Musani, Solomon K; Li, Changwei; Bentley, Amy R; Brown, Michael R; Schwander, Karen; Richard, Melissa A; Noordam, Raymond; Aschard, Hugues; Bartz, Traci M; Bielak, Lawrence F; Dorajoo, Rajkumar; Fisher, Virginia; Hartwig, Fernando P; Horimoto, Andrea R V R; Lohman, Kurt K; Manning, Alisa K; Rankinen, Tuomo; Smith, Albert V; Tajuddin, Salman M; Wojczynski, Mary K; Alver, Maris; Boissel, Mathilde; Cai, Qiuyin; Campbell, Archie; Chai, Jin Fang; Chen, Xu; Divers, Jasmin; Gao, Chuan; Goel, Anuj; Hagemeijer, Yanick; Harris, Sarah E; He, Meian; Hsu, Fang-Chi; Jackson, Anne U; Kähönen, Mika; Kasturiratne, Anuradhani; Komulainen, Pirjo; Kühnel, Brigitte; Laguzzi, Federica; Luan, Jian'an; Matoba, Nana; Nolte, Ilja M; Padmanabhan, Sandosh; Riaz, Muhammad; Rueedi, Rico; Robino, Antonietta; Said, M Abdullah; Scott, Robert A; Sofer, Tamar; Stančáková, Alena; Takeuchi, Fumihiko; Tayo, Bamidele O; van der Most, Peter J; Varga, Tibor V; Vitart, Veronique; Wang, Yajuan; Ware, Erin B; Warren, Helen R; Weiss, Stefan; Wen, Wanqing; Yanek, Lisa R; Zhang, Weihua; Zhao, Jing Hua; Afaq, Saima; Amin, Najaf; Amini, Marzyeh; Arking, Dan E; Aung, Tin; Boerwinkle, Eric; Borecki, Ingrid; Broeckel, Ulrich; Brown, Morris; Brumat, Marco; Burke, Gregory L; Canouil, Mickaël; Chakravarti, Aravinda; Charumathi, Sabanayagam; Ida Chen, Yii-Der; Connell, John M; Correa, Adolfo; de Las Fuentes, Lisa; de Mutsert, Renée; de Silva, H Janaka; Deng, Xuan; Ding, Jingzhong; Duan, Qing; Eaton, Charles B; Ehret, Georg; Eppinga, Ruben N; Evangelou, Evangelos; Faul, Jessica D; Felix, Stephan B; Forouhi, Nita G; Forrester, Terrence; Franco, Oscar H; Friedlander, Yechiel; Gandin, Ilaria; Gao, He; Ghanbari, Mohsen; Gigante, Bruna; Gu, C Charles; Gu, Dongfeng; Hagenaars, Saskia P; Hallmans, Göran; Harris, Tamara B; He, Jiang; Heikkinen, Sami; Heng, Chew-Kiat; Hirata, Makoto; Howard, Barbara V; Ikram, M Arfan; John, Ulrich; Katsuya, Tomohiro; Khor, Chiea Chuen; Kilpeläinen, Tuomas O; Koh, Woon-Puay; Krieger, José E; Kritchevsky, Stephen B; Kubo, Michiaki; Kuusisto, Johanna; Lakka, Timo A; Langefeld, Carl D; Langenberg, Claudia; Launer, Lenore J; Lehne, Benjamin; Lewis, Cora E; Li, Yize; Lin, Shiow; Liu, Jianjun; Liu, Jingmin; Loh, Marie; Louie, Tin; Mägi, Reedik; McKenzie, Colin A; Meitinger, Thomas; Metspalu, Andres; Milaneschi, Yuri; Milani, Lili; Mohlke, Karen L; Momozawa, Yukihide; Nalls, Mike A; Nelson, Christopher P; Sotoodehnia, Nona; Norris, Jill M; O'Connell, Jeff R; Palmer, Nicholette D; Perls, Thomas; Pedersen, Nancy L; Peters, Annette; Peyser, Patricia A; Poulter, Neil; Raffel, Leslie J; Raitakari, Olli T; Roll, Kathryn; Rose, Lynda M; Rosendaal, Frits R; Rotter, Jerome I; Schmidt, Carsten O; Schreiner, Pamela J; Schupf, Nicole; Scott, William R; Sever, Peter S; Shi, Yuan; Sidney, Stephen; Sims, Mario; Sitlani, Colleen M; Smith, Jennifer A; Snieder, Harold; Starr, John M; Strauch, Konstantin; Stringham, Heather M; Tan, Nicholas Y Q; Tang, Hua; Taylor, Kent D; Teo, Yik Ying; Tham, Yih Chung; Turner, Stephen T; Uitterlinden, André G; Vollenweider, Peter; Waldenberger, Melanie; Wang, Lihua; Wang, Ya Xing; Wei, Wen Bin; Williams, Christine; Yao, Jie; Yu, Caizheng; Yuan, Jian-Min; Zhao, Wei; Zonderman, Alan B; Becker, Diane M; Boehnke, Michael; Bowden, Donald W; Chambers, John C; Deary, Ian J; Esko, Tõnu; Farrall, Martin; Franks, Paul W; Freedman, Barry I; Froguel, Philippe; Gasparini, Paolo; Gieger, Christian; Jonas, Jost Bruno; Kamatani, Yoichiro; Kato, Norihiro; Kooner, Jaspal S; Kutalik, Zoltán; Laakso, Markku; Laurie, Cathy C; Leander, Karin; Lehtimäki, Terho; Study, Lifelines Cohort; Magnusson, Patrik K E; Oldehinkel, Albertine J; Penninx, Brenda W J H; Polasek, Ozren; Porteous, David J; Rauramaa, Rainer; Samani, Nilesh J; Scott, James; Shu, Xiao-Ou; van der Harst, Pim; Wagenknecht, Lynne E; Wareham, Nicholas J; Watkins, Hugh; Weir, David R; Wickremasinghe, Ananda R; Wu, Tangchun; Zheng, Wei; Bouchard, Claude; Christensen, Kaare; Evans, Michele K; Gudnason, Vilmundur; Horta, Bernardo L; Kardia, Sharon L R; Liu, Yongmei; Pereira, Alexandre C; Psaty, Bruce M; Ridker, Paul M; van Dam, Rob M; Gauderman, W James; Zhu, Xiaofeng; Mook-Kanamori, Dennis O; Fornage, Myriam; Rotimi, Charles N; Cupples, L Adrienne; Kelly, Tanika N; Fox, Ervin R; Hayward, Caroline; van Duijn, Cornelia M; Tai, E Shyong; Wong, Tien Yin; Kooperberg, Charles; Palmas, Walter; Rice, Kenneth; Morrison, Alanna C; Elliott, Paul; Caulfield, Mark J; Munroe, Patricia B; Rao, Dabeeru C; Province, Michael A; Levy, Daniel
2018-01-01
Heavy alcohol consumption is an established risk factor for hypertension; the mechanism by which alcohol consumption impact blood pressure (BP) regulation remains unknown. We hypothesized that a genome-wide association study accounting for gene-alcohol consumption interaction for BP might identify additional BP loci and contribute to the understanding of alcohol-related BP regulation. We conducted a large two-stage investigation incorporating joint testing of main genetic effects and single nucleotide variant (SNV)-alcohol consumption interactions. In Stage 1, genome-wide discovery meta-analyses in ≈131K individuals across several ancestry groups yielded 3,514 SNVs (245 loci) with suggestive evidence of association (P < 1.0 x 10-5). In Stage 2, these SNVs were tested for independent external replication in ≈440K individuals across multiple ancestries. We identified and replicated (at Bonferroni correction threshold) five novel BP loci (380 SNVs in 21 genes) and 49 previously reported BP loci (2,159 SNVs in 109 genes) in European ancestry, and in multi-ancestry meta-analyses (P < 5.0 x 10-8). For African ancestry samples, we detected 18 potentially novel BP loci (P < 5.0 x 10-8) in Stage 1 that warrant further replication. Additionally, correlated meta-analysis identified eight novel BP loci (11 genes). Several genes in these loci (e.g., PINX1, GATA4, BLK, FTO and GABBR2) have been previously reported to be associated with alcohol consumption. These findings provide insights into the role of alcohol consumption in the genetic architecture of hypertension.
Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.
Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik
2010-04-01
To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.
Taylor, Robert W; Pyle, Angela; Griffin, Helen; Blakely, Emma L; Duff, Jennifer; He, Langping; Smertenko, Tania; Alston, Charlotte L; Neeve, Vivienne C; Best, Andrew; Yarham, John W; Kirschner, Janbernd; Schara, Ulrike; Talim, Beril; Topaloglu, Haluk; Baric, Ivo; Holinski-Feder, Elke; Abicht, Angela; Czermin, Birgit; Kleinle, Stephanie; Morris, Andrew A M; Vassallo, Grace; Gorman, Grainne S; Ramesh, Venkateswaran; Turnbull, Douglass M; Santibanez-Koref, Mauro; McFarland, Robert; Horvath, Rita; Chinnery, Patrick F
2014-07-02
Mitochondrial disorders have emerged as a common cause of inherited disease, but their diagnosis remains challenging. Multiple respiratory chain complex defects are particularly difficult to diagnose at the molecular level because of the massive number of nuclear genes potentially involved in intramitochondrial protein synthesis, with many not yet linked to human disease. To determine the molecular basis of multiple respiratory chain complex deficiencies. We studied 53 patients referred to 2 national centers in the United Kingdom and Germany between 2005 and 2012. All had biochemical evidence of multiple respiratory chain complex defects but no primary pathogenic mitochondrial DNA mutation. Whole-exome sequencing was performed using 62-Mb exome enrichment, followed by variant prioritization using bioinformatic prediction tools, variant validation by Sanger sequencing, and segregation of the variant with the disease phenotype in the family. Presumptive causal variants were identified in 28 patients (53%; 95% CI, 39%-67%) and possible causal variants were identified in 4 (8%; 95% CI, 2%-18%). Together these accounted for 32 patients (60% 95% CI, 46%-74%) and involved 18 different genes. These included recurrent mutations in RMND1, AARS2, and MTO1, each on a haplotype background consistent with a shared founder allele, and potential novel mutations in 4 possible mitochondrial disease genes (VARS2, GARS, FLAD1, and PTCD1). Distinguishing clinical features included deafness and renal involvement associated with RMND1 and cardiomyopathy with AARS2 and MTO1. However, atypical clinical features were present in some patients, including normal liver function and Leigh syndrome (subacute necrotizing encephalomyelopathy) seen in association with TRMU mutations and no cardiomyopathy with founder SCO2 mutations. It was not possible to confidently identify the underlying genetic basis in 21 patients (40%; 95% CI, 26%-54%). Exome sequencing enhances the ability to identify potential nuclear gene mutations in patients with biochemically defined defects affecting multiple mitochondrial respiratory chain complexes. Additional study is required in independent patient populations to determine the utility of this approach in comparison with traditional diagnostic methods.
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.
2017-01-01
Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405
USDA-ARS?s Scientific Manuscript database
Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...
USDA-ARS?s Scientific Manuscript database
Drought tolerance is a complex trait that is governed by multiple genes. To identify the potential candidate genes, comparative analysis of drought stress-responsive transcriptome between drought-tolerant (Triticum aestivum Cv. C306) and drought-sensitive (Triticum aestivum Cv. WL711) genotypes was ...
USDA-ARS?s Scientific Manuscript database
To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...
Rajamani, Deepa; Bhasin, Manoj K
2016-05-03
Pancreatic cancer is an aggressive cancer with dismal prognosis, urgently necessitating better biomarkers to improve therapeutic options and early diagnosis. Traditional approaches of biomarker detection that consider only one aspect of the biological continuum like gene expression alone are limited in their scope and lack robustness in identifying the key regulators of the disease. We have adopted a multidimensional approach involving the cross-talk between the omics spaces to identify key regulators of disease progression. Multidimensional domain-specific disease signatures were obtained using rank-based meta-analysis of individual omics profiles (mRNA, miRNA, DNA methylation) related to pancreatic ductal adenocarcinoma (PDAC). These domain-specific PDAC signatures were integrated to identify genes that were affected across multiple dimensions of omics space in PDAC (genes under multiple regulatory controls, GMCs). To further pin down the regulators of PDAC pathophysiology, a systems-level network was generated from knowledge-based interaction information applied to the above identified GMCs. Key regulators were identified from the GMC network based on network statistics and their functional importance was validated using gene set enrichment analysis and survival analysis. Rank-based meta-analysis identified 5391 genes, 109 miRNAs and 2081 methylation-sites significantly differentially expressed in PDAC (false discovery rate ≤ 0.05). Bimodal integration of meta-analysis signatures revealed 1150 and 715 genes regulated by miRNAs and methylation, respectively. Further analysis identified 189 altered genes that are commonly regulated by miRNA and methylation, hence considered GMCs. Systems-level analysis of the scale-free GMCs network identified eight potential key regulator hubs, namely E2F3, HMGA2, RASA1, IRS1, NUAK1, ACTN1, SKI and DLL1, associated with important pathways driving cancer progression. Survival analysis on individual key regulators revealed that higher expression of IRS1 and DLL1 and lower expression of HMGA2, ACTN1 and SKI were associated with better survival probabilities. It is evident from the results that our hierarchical systems-level multidimensional analysis approach has been successful in isolating the converging regulatory modules and associated key regulatory molecules that are potential biomarkers for pancreatic cancer progression.
Du, Qingzhang; Tian, Jiaxing; Yang, Xiaohui; Pan, Wei; Xu, Baohua; Li, Bailian; Ingvarsson, Pär K.; Zhang, Deqiang
2015-01-01
Economically important traits in many species generally show polygenic, quantitative inheritance. The components of genetic variation (additive, dominant and epistatic effects) of these traits conferred by multiple genes in shared biological pathways remain to be defined. Here, we investigated 11 full-length genes in cellulose biosynthesis, on 10 growth and wood-property traits, within a population of 460 unrelated Populus tomentosa individuals, via multi-gene association. To validate positive associations, we conducted single-marker analysis in a linkage population of 1,200 individuals. We identified 118, 121, and 43 associations (P< 0.01) corresponding to additive, dominant, and epistatic effects, respectively, with low to moderate proportions of phenotypic variance (R2). Epistatic interaction models uncovered a combination of three non-synonymous sites from three unique genes, representing a significant epistasis for diameter at breast height and stem volume. Single-marker analysis validated 61 associations (false discovery rate, Q ≤ 0.10), representing 38 SNPs from nine genes, and its average effect (R2 = 3.8%) nearly 2-fold higher than that identified with multi-gene association, suggesting that multi-gene association can capture smaller individual variants. Moreover, a structural gene–gene network based on tissue-specific transcript abundances provides a better understanding of the multi-gene pathway affecting tree growth and lignocellulose biosynthesis. Our study highlights the importance of pathway-based multiple gene associations to uncover the nature of genetic variance for quantitative traits and may drive novel progress in molecular breeding. PMID:25428896
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Cha, Kihoon; Hwang, Taeho; Oh, Kimin; Yi, Gwan-Su
2015-01-01
It has been reported that several brain diseases can be treated as transnosological manner implicating possible common molecular basis under those diseases. However, molecular level commonality among those brain diseases has been largely unexplored. Gene expression analyses of human brain have been used to find genes associated with brain diseases but most of those studies were restricted either to an individual disease or to a couple of diseases. In addition, identifying significant genes in such brain diseases mostly failed when it used typical methods depending on differentially expressed genes. In this study, we used a correlation-based biclustering approach to find coexpressed gene sets in five neurodegenerative diseases and three psychiatric disorders. By using biclustering analysis, we could efficiently and fairly identified various gene sets expressed specifically in both single and multiple brain diseases. We could find 4,307 gene sets correlatively expressed in multiple brain diseases and 3,409 gene sets exclusively specified in individual brain diseases. The function enrichment analysis of those gene sets showed many new possible functional bases as well as neurological processes that are common or specific for those eight diseases. This study introduces possible common molecular bases for several brain diseases, which open the opportunity to clarify the transnosological perspective assumed in brain diseases. It also showed the advantages of correlation-based biclustering analysis and accompanying function enrichment analysis for gene expression data in this type of investigation.
2015-01-01
Background It has been reported that several brain diseases can be treated as transnosological manner implicating possible common molecular basis under those diseases. However, molecular level commonality among those brain diseases has been largely unexplored. Gene expression analyses of human brain have been used to find genes associated with brain diseases but most of those studies were restricted either to an individual disease or to a couple of diseases. In addition, identifying significant genes in such brain diseases mostly failed when it used typical methods depending on differentially expressed genes. Results In this study, we used a correlation-based biclustering approach to find coexpressed gene sets in five neurodegenerative diseases and three psychiatric disorders. By using biclustering analysis, we could efficiently and fairly identified various gene sets expressed specifically in both single and multiple brain diseases. We could find 4,307 gene sets correlatively expressed in multiple brain diseases and 3,409 gene sets exclusively specified in individual brain diseases. The function enrichment analysis of those gene sets showed many new possible functional bases as well as neurological processes that are common or specific for those eight diseases. Conclusions This study introduces possible common molecular bases for several brain diseases, which open the opportunity to clarify the transnosological perspective assumed in brain diseases. It also showed the advantages of correlation-based biclustering analysis and accompanying function enrichment analysis for gene expression data in this type of investigation. PMID:26043779
The Genetics of Deafness in Domestic Animals
Strain, George M.
2015-01-01
Although deafness can be acquired throughout an animal’s life from a variety of causes, hereditary deafness, especially congenital hereditary deafness, is a significant problem in several species. Extensive reviews exist of the genetics of deafness in humans and mice, but not for deafness in domestic animals. Hereditary deafness in many species and breeds is associated with loci for white pigmentation, where the cochlear pathology is cochleo-saccular. In other cases, there is no pigmentation association and the cochlear pathology is neuroepithelial. Late onset hereditary deafness has recently been identified in dogs and may be present but not yet recognized in other species. Few genes responsible for deafness have been identified in animals, but progress has been made for identifying genes responsible for the associated pigmentation phenotypes. Across species, the genes identified with deafness or white pigmentation patterns include MITF, PMEL, KIT, EDNRB, CDH23, TYR, and TRPM1 in dog, cat, horse, cow, pig, sheep, ferret, mink, camelid, and rabbit. Multiple causative genes are present in some species. Significant work remains in many cases to identify specific chromosomal deafness genes so that DNA testing can be used to identify carriers of the mutated genes and thereby reduce deafness prevalence. PMID:26664958
Systematic analysis of molecular mechanisms for HCC metastasis via text mining approach.
Zhen, Cheng; Zhu, Caizhong; Chen, Haoyang; Xiong, Yiru; Tan, Junyuan; Chen, Dong; Li, Jin
2017-02-21
To systematically explore the molecular mechanism for hepatocellular carcinoma (HCC) metastasis and identify regulatory genes with text mining methods. Genes with highest frequencies and significant pathways related to HCC metastasis were listed. A handful of proteins such as EGFR, MDM2, TP53 and APP, were identified as hub nodes in PPI (protein-protein interaction) network. Compared with unique genes for HBV-HCCs, genes particular to HCV-HCCs were less, but may participate in more extensive signaling processes. VEGFA, PI3KCA, MAPK1, MMP9 and other genes may play important roles in multiple phenotypes of metastasis. Genes in abstracts of HCC-metastasis literatures were identified. Word frequency analysis, KEGG pathway and PPI network analysis were performed. Then co-occurrence analysis between genes and metastasis-related phenotypes were carried out. Text mining is effective for revealing potential regulators or pathways, but the purpose of it should be specific, and the combination of various methods will be more useful.
Integrative approaches for large-scale transcriptome-wide association studies
Gusev, Alexander; Ko, Arthur; Shi, Huwenbo; Bhatia, Gaurav; Chung, Wonil; Penninx, Brenda W J H; Jansen, Rick; de Geus, Eco JC; Boomsma, Dorret I; Wright, Fred A; Sullivan, Patrick F; Nikkola, Elina; Alvarez, Marcus; Civelek, Mete; Lusis, Aldons J.; Lehtimäki, Terho; Raitoharju, Emma; Kähönen, Mika; Seppälä, Ilkka; Raitakari, Olli T.; Kuusisto, Johanna; Laakso, Markku; Price, Alkes L.; Pajukanta, Päivi; Pasaniuc, Bogdan
2016-01-01
Many genetic variants influence complex traits by modulating gene expression, thus altering the abundance levels of one or multiple proteins. Here, we introduce a powerful strategy that integrates gene expression measurements with summary association statistics from large-scale genome-wide association studies (GWAS) to identify genes whose cis-regulated expression is associated to complex traits. We leverage expression imputation to perform a transcriptome wide association scan (TWAS) to identify significant expression-trait associations. We applied our approaches to expression data from blood and adipose tissue measured in ~3,000 individuals overall. We imputed gene expression into GWAS data from over 900,000 phenotype measurements to identify 69 novel genes significantly associated to obesity-related traits (BMI, lipids, and height). Many of the novel genes are associated with relevant phenotypes in the Hybrid Mouse Diversity Panel. Our results showcase the power of integrating genotype, gene expression and phenotype to gain insights into the genetic basis of complex traits. PMID:26854917
Putnam, Christopher D.; Srivatsan, Anjana; Nene, Rahul V.; Martinez, Sandra L.; Clotfelter, Sarah P.; Bell, Sara N.; Somach, Steven B.; E.S. de Souza, Jorge; Fonseca, André F.; de Souza, Sandro J.; Kolodner, Richard D.
2016-01-01
Gross chromosomal rearrangements (GCRs) play an important role in human diseases, including cancer. The identity of all Genome Instability Suppressing (GIS) genes is not currently known. Here multiple Saccharomyces cerevisiae GCR assays and query mutations were crossed into arrays of mutants to identify progeny with increased GCR rates. One hundred eighty two GIS genes were identified that suppressed GCR formation. Another 438 cooperatively acting GIS genes were identified that were not GIS genes, but suppressed the increased genome instability caused by individual query mutations. Analysis of TCGA data using the human genes predicted to act in GIS pathways revealed that a minimum of 93% of ovarian and 66% of colorectal cancer cases had defects affecting one or more predicted GIS gene. These defects included loss-of-function mutations, copy-number changes associated with reduced expression, and silencing. In contrast, acute myeloid leukaemia cases did not appear to have defects affecting the predicted GIS genes. PMID:27071721
Allman, Elizabeth S; Degnan, James H; Rhodes, John A
2011-06-01
Gene trees are evolutionary trees representing the ancestry of genes sampled from multiple populations. Species trees represent populations of individuals-each with many genes-splitting into new populations or species. The coalescent process, which models ancestry of gene copies within populations, is often used to model the probability distribution of gene trees given a fixed species tree. This multispecies coalescent model provides a framework for phylogeneticists to infer species trees from gene trees using maximum likelihood or Bayesian approaches. Because the coalescent models a branching process over time, all trees are typically assumed to be rooted in this setting. Often, however, gene trees inferred by traditional phylogenetic methods are unrooted. We investigate probabilities of unrooted gene trees under the multispecies coalescent model. We show that when there are four species with one gene sampled per species, the distribution of unrooted gene tree topologies identifies the unrooted species tree topology and some, but not all, information in the species tree edges (branch lengths). The location of the root on the species tree is not identifiable in this situation. However, for 5 or more species with one gene sampled per species, we show that the distribution of unrooted gene tree topologies identifies the rooted species tree topology and all its internal branch lengths. The length of any pendant branch leading to a leaf of the species tree is also identifiable for any species from which more than one gene is sampled.
Carrigan, Matthew A.; Uryasev, Oleg; Davis, Ross P.; Zhai, LanMin; Hurley, Thomas D.; Benner, Steven A.
2012-01-01
Background Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s), where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs) and hominoids. Methodology/Principal Findings To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines). Database mining then identified novel ADH1 paralogs in both macaque (an OWM) and marmoset (a NWM). These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding) sequences and intronic sequences. Conclusions/Significance We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels). The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs) and catarrhines (OWMs and hominoids) having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates, followed by the loss of an ADH1 paralog in the human lineage. PMID:22859968
Lai, Yinglei; Zhang, Fanni; Nayak, Tapan K; Modarres, Reza; Lee, Norman H; McCaffrey, Timothy A
2014-01-01
Gene set enrichment analysis (GSEA) is an important approach to the analysis of coordinate expression changes at a pathway level. Although many statistical and computational methods have been proposed for GSEA, the issue of a concordant integrative GSEA of multiple expression data sets has not been well addressed. Among different related data sets collected for the same or similar study purposes, it is important to identify pathways or gene sets with concordant enrichment. We categorize the underlying true states of differential expression into three representative categories: no change, positive change and negative change. Due to data noise, what we observe from experiments may not indicate the underlying truth. Although these categories are not observed in practice, they can be considered in a mixture model framework. Then, we define the mathematical concept of concordant gene set enrichment and calculate its related probability based on a three-component multivariate normal mixture model. The related false discovery rate can be calculated and used to rank different gene sets. We used three published lung cancer microarray gene expression data sets to illustrate our proposed method. One analysis based on the first two data sets was conducted to compare our result with a previous published result based on a GSEA conducted separately for each individual data set. This comparison illustrates the advantage of our proposed concordant integrative gene set enrichment analysis. Then, with a relatively new and larger pathway collection, we used our method to conduct an integrative analysis of the first two data sets and also all three data sets. Both results showed that many gene sets could be identified with low false discovery rates. A consistency between both results was also observed. A further exploration based on the KEGG cancer pathway collection showed that a majority of these pathways could be identified by our proposed method. This study illustrates that we can improve detection power and discovery consistency through a concordant integrative analysis of multiple large-scale two-sample gene expression data sets.
Srivastava, Mousami; Khurana, Pankaj; Sugadev, Ragumani
2012-11-02
The tissue-specific Unigene Sets derived from more than one million expressed sequence tags (ESTs) in the NCBI, GenBank database offers a platform for identifying significantly and differentially expressed tissue-specific genes by in-silico methods. Digital differential display (DDD) rapidly creates transcription profiles based on EST comparisons and numerically calculates, as a fraction of the pool of ESTs, the relative sequence abundance of known and novel genes. However, the process of identifying the most likely tissue for a specific disease in which to search for candidate genes from the pool of differentially expressed genes remains difficult. Therefore, we have used 'Gene Ontology semantic similarity score' to measure the GO similarity between gene products of lung tissue-specific candidate genes from control (normal) and disease (cancer) sets. This semantic similarity score matrix based on hierarchical clustering represents in the form of a dendrogram. The dendrogram cluster stability was assessed by multiple bootstrapping. Multiple bootstrapping also computes a p-value for each cluster and corrects the bias of the bootstrap probability. Subsequent hierarchical clustering by the multiple bootstrapping method (α = 0.95) identified seven clusters. The comparative, as well as subtractive, approach revealed a set of 38 biomarkers comprising four distinct lung cancer signature biomarker clusters (panel 1-4). Further gene enrichment analysis of the four panels revealed that each panel represents a set of lung cancer linked metastasis diagnostic biomarkers (panel 1), chemotherapy/drug resistance biomarkers (panel 2), hypoxia regulated biomarkers (panel 3) and lung extra cellular matrix biomarkers (panel 4). Expression analysis reveals that hypoxia induced lung cancer related biomarkers (panel 3), HIF and its modulating proteins (TGM2, CSNK1A1, CTNNA1, NAMPT/Visfatin, TNFRSF1A, ETS1, SRC-1, FN1, APLP2, DMBT1/SAG, AIB1 and AZIN1) are significantly down regulated. All down regulated genes in this panel were highly up regulated in most other types of cancers. These panels of proteins may represent signature biomarkers for lung cancer and will aid in lung cancer diagnosis and disease monitoring as well as in the prediction of responses to therapeutics.
Zhao, Zheng; Bai, Jing; Wu, Aiwei; Wang, Yuan; Zhang, Jinwen; Wang, Zishan; Li, Yongsheng; Xu, Juan; Li, Xia
2015-01-01
Long non-coding RNAs (lncRNAs) are emerging as key regulators of diverse biological processes and diseases. However, the combinatorial effects of these molecules in a specific biological function are poorly understood. Identifying co-expressed protein-coding genes of lncRNAs would provide ample insight into lncRNA functions. To facilitate such an effort, we have developed Co-LncRNA, which is a web-based computational tool that allows users to identify GO annotations and KEGG pathways that may be affected by co-expressed protein-coding genes of a single or multiple lncRNAs. LncRNA co-expressed protein-coding genes were first identified in publicly available human RNA-Seq datasets, including 241 datasets across 6560 total individuals representing 28 tissue types/cell lines. Then, the lncRNA combinatorial effects in a given GO annotations or KEGG pathways are taken into account by the simultaneous analysis of multiple lncRNAs in user-selected individual or multiple datasets, which is realized by enrichment analysis. In addition, this software provides a graphical overview of pathways that are modulated by lncRNAs, as well as a specific tool to display the relevant networks between lncRNAs and their co-expressed protein-coding genes. Co-LncRNA also supports users in uploading their own lncRNA and protein-coding gene expression profiles to investigate the lncRNA combinatorial effects. It will be continuously updated with more human RNA-Seq datasets on an annual basis. Taken together, Co-LncRNA provides a web-based application for investigating lncRNA combinatorial effects, which could shed light on their biological roles and could be a valuable resource for this community. Database URL: http://www.bio-bigdata.com/Co-LncRNA/ PMID:26363020
Mollah, Mohammad Manir Hossain; Jamal, Rahman; Mokhtar, Norfilza Mohd; Harun, Roslan; Mollah, Md. Nurul Haque
2015-01-01
Background Identifying genes that are differentially expressed (DE) between two or more conditions with multiple patterns of expression is one of the primary objectives of gene expression data analysis. Several statistical approaches, including one-way analysis of variance (ANOVA), are used to identify DE genes. However, most of these methods provide misleading results for two or more conditions with multiple patterns of expression in the presence of outlying genes. In this paper, an attempt is made to develop a hybrid one-way ANOVA approach that unifies the robustness and efficiency of estimation using the minimum β-divergence method to overcome some problems that arise in the existing robust methods for both small- and large-sample cases with multiple patterns of expression. Results The proposed method relies on a β-weight function, which produces values between 0 and 1. The β-weight function with β = 0.2 is used as a measure of outlier detection. It assigns smaller weights (≥ 0) to outlying expressions and larger weights (≤ 1) to typical expressions. The distribution of the β-weights is used to calculate the cut-off point, which is compared to the observed β-weight of an expression to determine whether that gene expression is an outlier. This weight function plays a key role in unifying the robustness and efficiency of estimation in one-way ANOVA. Conclusion Analyses of simulated gene expression profiles revealed that all eight methods (ANOVA, SAM, LIMMA, EBarrays, eLNN, KW, robust BetaEB and proposed) perform almost identically for m = 2 conditions in the absence of outliers. However, the robust BetaEB method and the proposed method exhibited considerably better performance than the other six methods in the presence of outliers. In this case, the BetaEB method exhibited slightly better performance than the proposed method for the small-sample cases, but the the proposed method exhibited much better performance than the BetaEB method for both the small- and large-sample cases in the presence of more than 50% outlying genes. The proposed method also exhibited better performance than the other methods for m > 2 conditions with multiple patterns of expression, where the BetaEB was not extended for this condition. Therefore, the proposed approach would be more suitable and reliable on average for the identification of DE genes between two or more conditions with multiple patterns of expression. PMID:26413858
Disease-specific molecular events in cortical multiple sclerosis lesions
Wimmer, Isabella; Höftberger, Romana; Gerlach, Susanna; Haider, Lukas; Zrzavy, Tobias; Hametner, Simon; Mahad, Don; Binder, Christoph J.; Krumbholz, Markus; Bauer, Jan; Bradl, Monika
2013-01-01
Cortical lesions constitute an important part of multiple sclerosis pathology. Although inflammation appears to play a role in their formation, the mechanisms leading to demyelination and neurodegeneration are poorly understood. We aimed to identify some of these mechanisms by combining gene expression studies with neuropathological analysis. In our study, we showed that the combination of inflammation, plaque-like primary demyelination and neurodegeneration in the cortex is specific for multiple sclerosis and is not seen in other chronic inflammatory diseases mediated by CD8-positive T cells (Rasmussen’s encephalitis), B cells (B cell lymphoma) or complex chronic inflammation (tuberculous meningitis, luetic meningitis or chronic purulent meningitis). In addition, we performed genome-wide microarray analysis comparing micro-dissected active cortical multiple sclerosis lesions with those of tuberculous meningitis (inflammatory control), Alzheimer’s disease (neurodegenerative control) and with cortices of age-matched controls. More than 80% of the identified multiple sclerosis-specific genes were related to T cell-mediated inflammation, microglia activation, oxidative injury, DNA damage and repair, remyelination and regenerative processes. Finally, we confirmed by immunohistochemistry that oxidative damage in cortical multiple sclerosis lesions is associated with oligodendrocyte and neuronal injury, the latter also affecting axons and dendrites. Our study provides new insights into the complex mechanisms of neurodegeneration and regeneration in the cortex of patients with multiple sclerosis. PMID:23687122
DEIVA: a web application for interactive visual analysis of differential gene expression profiles.
Harshbarger, Jayson; Kratz, Anton; Carninci, Piero
2017-01-07
Differential gene expression (DGE) analysis is a technique to identify statistically significant differences in RNA abundance for genes or arbitrary features between different biological states. The result of a DGE test is typically further analyzed using statistical software, spreadsheets or custom ad hoc algorithms. We identified a need for a web-based system to share DGE statistical test results, and locate and identify genes in DGE statistical test results with a very low barrier of entry. We have developed DEIVA, a free and open source, browser-based single page application (SPA) with a strong emphasis on being user friendly that enables locating and identifying single or multiple genes in an immediate, interactive, and intuitive manner. By design, DEIVA scales with very large numbers of users and datasets. Compared to existing software, DEIVA offers a unique combination of design decisions that enable inspection and analysis of DGE statistical test results with an emphasis on ease of use.
In Silico Gene Prioritization by Integrating Multiple Data Sources
Zhou, Yingyao; Shields, Robert; Chanda, Sumit K.; Elston, Robert C.; Li, Jing
2011-01-01
Identifying disease genes is crucial to the understanding of disease pathogenesis, and to the improvement of disease diagnosis and treatment. In recent years, many researchers have proposed approaches to prioritize candidate genes by considering the relationship of candidate genes and existing known disease genes, reflected in other data sources. In this paper, we propose an expandable framework for gene prioritization that can integrate multiple heterogeneous data sources by taking advantage of a unified graphic representation. Gene-gene relationships and gene-disease relationships are then defined based on the overall topology of each network using a diffusion kernel measure. These relationship measures are in turn normalized to derive an overall measure across all networks, which is utilized to rank all candidate genes. Based on the informativeness of available data sources with respect to each specific disease, we also propose an adaptive threshold score to select a small subset of candidate genes for further validation studies. We performed large scale cross-validation analysis on 110 disease families using three data sources. Results have shown that our approach consistently outperforms other two state of the art programs. A case study using Parkinson disease (PD) has identified four candidate genes (UBB, SEPT5, GPR37 and TH) that ranked higher than our adaptive threshold, all of which are involved in the PD pathway. In particular, a very recent study has observed a deletion of TH in a patient with PD, which supports the importance of the TH gene in PD pathogenesis. A web tool has been implemented to assist scientists in their genetic studies. PMID:21731658
Brahe, Lena K; Ängquist, Lars; Larsen, Lesli H; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Hlavaty, Petr; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild I A; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M
2013-09-14
Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile after weight loss and in response to a given diet, among overweight European adults participating in the Diet Obesity and Genes study. By multiple linear regressions, 240 SNPs in twenty-four candidate genes were investigated for SNP main and SNP-diet interaction effects on total cholesterol, LDL-cholesterol, HDL-cholesterol and TAG after an 8-week low-energy diet (only main effect) ,and a 6-month ad libitum weight maintenance diet, with different contents of dietary protein or glycaemic index. After adjusting for multiple testing, a SNP-dietary protein interaction effect on TAG was identified for lipin 1 (LPIN1) rs4315495, with a decrease in TAG of 20.26 mmol/l per A-allele/protein unit (95% CI 20.38, 20.14, P=0.000043). In conclusion, we investigated SNP-diet interactions for blood lipid profiles for 240 SNPs in twenty-four candidate genes, selected for their involvement in lipid metabolism pathways, and identified one significant interaction between LPIN1 rs4315495 and dietary protein for TAG concentration.
Bush, W S; McCauley, J L; DeJager, P L; Dudek, S M; Hafler, D A; Gibson, R A; Matthews, P M; Kappos, L; Naegelin, Y; Polman, C H; Hauser, S L; Oksenberg, J; Haines, J L; Ritchie, M D
2011-07-01
Gene-gene interactions are proposed as an important component of the genetic architecture of complex diseases, and are just beginning to be evaluated in the context of genome-wide association studies (GWAS). In addition to detecting epistasis, a benefit to interaction analysis is that it also increases power to detect weak main effects. We conducted a knowledge-driven interaction analysis of a GWAS of 931 multiple sclerosis (MS) trios to discover gene-gene interactions within established biological contexts. We identify heterogeneous signals, including a gene-gene interaction between CHRM3 (muscarinic cholinergic receptor 3) and MYLK (myosin light-chain kinase) (joint P=0.0002), an interaction between two phospholipase C-β isoforms, PLCβ1 and PLCβ4 (joint P=0.0098), and a modest interaction between ACTN1 (actinin alpha 1) and MYH9 (myosin heavy chain 9) (joint P=0.0326), all localized to calcium-signaled cytoskeletal regulation. Furthermore, we discover a main effect (joint P=5.2E-5) previously unidentified by single-locus analysis within another related gene, SCIN (scinderin), a calcium-binding cytoskeleton regulatory protein. This work illustrates that knowledge-driven interaction analysis of GWAS data is a feasible approach to identify new genetic effects. The results of this study are among the first gene-gene interactions and non-immune susceptibility loci for MS. Further, the implicated genes cluster within inter-related biological mechanisms that suggest a neurodegenerative component to MS.
Genetic control and comparative genomic analysis of flowering time in Setaria (Poaceae).
Mauro-Herrera, Margarita; Wang, Xuewen; Barbier, Hugues; Brutnell, Thomas P; Devos, Katrien M; Doust, Andrew N
2013-02-01
We report the first study on the genetic control of flowering in Setaria, a panicoid grass closely related to switchgrass, and in the same subfamily as maize and sorghum. A recombinant inbred line mapping population derived from a cross between domesticated Setaria italica (foxtail millet) and its wild relative Setaria viridis (green millet), was grown in eight trials with varying environmental conditions to identify a small number of quantitative trait loci (QTL) that control differences in flowering time. Many of the QTL across trials colocalize, suggesting that the genetic control of flowering in Setaria is robust across a range of photoperiod and other environmental factors. A detailed comparison of QTL for flowering in Setaria, sorghum, and maize indicates that several of the major QTL regions identified in maize and sorghum are syntenic orthologs with Setaria QTL, although the maize large effect QTL on chromosome 10 is not. Several Setaria QTL intervals had multiple LOD peaks and were composed of multiple syntenic blocks, suggesting that observed QTL represent multiple tightly linked loci. Candidate genes from flowering time pathways identified in rice and Arabidopsis were identified in Setaria QTL intervals, including those involved in the CONSTANS photoperiod pathway. However, only three of the approximately seven genes cloned for flowering time in maize colocalized with Setaria QTL. This suggests that variation in flowering time in separate grass lineages is controlled by a combination of conserved and lineage specific genes.
Genetic Control and Comparative Genomic Analysis of Flowering Time in Setaria (Poaceae)
Mauro-Herrera, Margarita; Wang, Xuewen; Barbier, Hugues; Brutnell, Thomas P.; Devos, Katrien M.; Doust, Andrew N.
2013-01-01
We report the first study on the genetic control of flowering in Setaria, a panicoid grass closely related to switchgrass, and in the same subfamily as maize and sorghum. A recombinant inbred line mapping population derived from a cross between domesticated Setaria italica (foxtail millet) and its wild relative Setaria viridis (green millet), was grown in eight trials with varying environmental conditions to identify a small number of quantitative trait loci (QTL) that control differences in flowering time. Many of the QTL across trials colocalize, suggesting that the genetic control of flowering in Setaria is robust across a range of photoperiod and other environmental factors. A detailed comparison of QTL for flowering in Setaria, sorghum, and maize indicates that several of the major QTL regions identified in maize and sorghum are syntenic orthologs with Setaria QTL, although the maize large effect QTL on chromosome 10 is not. Several Setaria QTL intervals had multiple LOD peaks and were composed of multiple syntenic blocks, suggesting that observed QTL represent multiple tightly linked loci. Candidate genes from flowering time pathways identified in rice and Arabidopsis were identified in Setaria QTL intervals, including those involved in the CONSTANS photoperiod pathway. However, only three of the approximately seven genes cloned for flowering time in maize colocalized with Setaria QTL. This suggests that variation in flowering time in separate grass lineages is controlled by a combination of conserved and lineage specific genes. PMID:23390604
Accurate and fast multiple-testing correction in eQTL studies.
Sul, Jae Hoon; Raj, Towfique; de Jong, Simone; de Bakker, Paul I W; Raychaudhuri, Soumya; Ophoff, Roel A; Stranger, Barbara E; Eskin, Eleazar; Han, Buhm
2015-06-04
In studies of expression quantitative trait loci (eQTLs), it is of increasing interest to identify eGenes, the genes whose expression levels are associated with variation at a particular genetic variant. Detecting eGenes is important for follow-up analyses and prioritization because genes are the main entities in biological processes. To detect eGenes, one typically focuses on the genetic variant with the minimum p value among all variants in cis with a gene and corrects for multiple testing to obtain a gene-level p value. For performing multiple-testing correction, a permutation test is widely used. Because of growing sample sizes of eQTL studies, however, the permutation test has become a computational bottleneck in eQTL studies. In this paper, we propose an efficient approach for correcting for multiple testing and assess eGene p values by utilizing a multivariate normal distribution. Our approach properly takes into account the linkage-disequilibrium structure among variants, and its time complexity is independent of sample size. By applying our small-sample correction techniques, our method achieves high accuracy in both small and large studies. We have shown that our method consistently produces extremely accurate p values (accuracy > 98%) for three human eQTL datasets with different sample sizes and SNP densities: the Genotype-Tissue Expression pilot dataset, the multi-region brain dataset, and the HapMap 3 dataset. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
A vector space model approach to identify genetically related diseases.
Sarkar, Indra Neil
2012-01-01
The relationship between diseases and their causative genes can be complex, especially in the case of polygenic diseases. Further exacerbating the challenges in their study is that many genes may be causally related to multiple diseases. This study explored the relationship between diseases through the adaptation of an approach pioneered in the context of information retrieval: vector space models. A vector space model approach was developed that bridges gene disease knowledge inferred across three knowledge bases: Online Mendelian Inheritance in Man, GenBank, and Medline. The approach was then used to identify potentially related diseases for two target diseases: Alzheimer disease and Prader-Willi Syndrome. In the case of both Alzheimer Disease and Prader-Willi Syndrome, a set of plausible diseases were identified that may warrant further exploration. This study furthers seminal work by Swanson, et al. that demonstrated the potential for mining literature for putative correlations. Using a vector space modeling approach, information from both biomedical literature and genomic resources (like GenBank) can be combined towards identification of putative correlations of interest. To this end, the relevance of the predicted diseases of interest in this study using the vector space modeling approach were validated based on supporting literature. The results of this study suggest that a vector space model approach may be a useful means to identify potential relationships between complex diseases, and thereby enable the coordination of gene-based findings across multiple complex diseases.
Quillé, Marie-Lise; Hirchaud, Edouard; Baron, Daniel; Benech, Caroline; Guihot, Jeanne; Placet, Morgane; Mignen, Olivier; Férec, Claude; Houlgatte, Rémi; Friocourt, Gaëlle
2011-01-01
Genetic investigations of X-linked intellectual disabilities have implicated the ARX (Aristaless-related homeobox) gene in a wide spectrum of disorders extending from phenotypes characterised by severe neuronal migration defects such as lissencephaly, to mild or moderate forms of mental retardation without apparent brain abnormalities but with associated features of dystonia and epilepsy. Analysis of Arx spatio-temporal localisation profile in mouse revealed expression in telencephalic structures, mainly restricted to populations of GABAergic neurons at all stages of development. Furthermore, studies of the effects of ARX loss of function in humans and animal models revealed varying defects, suggesting multiple roles of this gene during brain development. However, to date, little is known about how ARX functions as a transcription factor and the nature of its targets. To better understand its role, we combined chromatin immunoprecipitation and mRNA expression with microarray analysis and identified a total of 1006 gene promoters bound by Arx in transfected neuroblastoma (N2a) cells and in mouse embryonic brain. Approximately 24% of Arx-bound genes were found to show expression changes following Arx overexpression or knock-down. Several of the Arx target genes we identified are known to be important for a variety of functions in brain development and some of them suggest new functions for Arx. Overall, these results identified multiple new candidate targets for Arx and should help to better understand the pathophysiological mechanisms of intellectual disability and epilepsy associated with ARX mutations. PMID:21966449
Abdeltawab, Nourtan F.; Aziz, Ramy K.; Kansal, Rita; Rowe, Sarah L.; Su, Yin; Gardner, Lidia; Brannen, Charity; Nooh, Mohammed M.; Attia, Ramy R.; Abdelsamed, Hossam A.; Taylor, William L.; Lu, Lu; Williams, Robert W.; Kotb, Malak
2008-01-01
Striking individual differences in severity of group A streptococcal (GAS) sepsis have been noted, even among patients infected with the same bacterial strain. We had provided evidence that HLA class II allelic variation contributes significantly to differences in systemic disease severity by modulating host responses to streptococcal superantigens. Inasmuch as the bacteria produce additional virulence factors that participate in the pathogenesis of this complex disease, we sought to identify additional gene networks modulating GAS sepsis. Accordingly, we applied a systems genetics approach using a panel of advanced recombinant inbred mice. By analyzing disease phenotypes in the context of mice genotypes we identified a highly significant quantitative trait locus (QTL) on Chromosome 2 between 22 and 34 Mb that strongly predicts disease severity, accounting for 25%–30% of variance. This QTL harbors several polymorphic genes known to regulate immune responses to bacterial infections. We evaluated candidate genes within this QTL using multiple parameters that included linkage, gene ontology, variation in gene expression, cocitation networks, and biological relevance, and identified interleukin1 alpha and prostaglandin E synthases pathways as key networks involved in modulating GAS sepsis severity. The association of GAS sepsis with multiple pathways underscores the complexity of traits modulating GAS sepsis and provides a powerful approach for analyzing interactive traits affecting outcomes of other infectious diseases. PMID:18421376
Update on Novel CCM Gene Mutations in Patients with Cerebral Cavernous Malformations.
Scimone, Concetta; Bramanti, Placido; Alafaci, Concetta; Granata, Francesca; Piva, Francesco; Rinaldi, Carmela; Donato, Luigi; Greco, Federica; Sidoti, Antonina; D'Angelo, Rosalia
2017-02-01
Cerebral cavernous malformations (CCMs) are lesions affecting brain microvessels. The pathogenesis is not clearly understood. Conventional classification criterion is based on genetics, and thus, familial and sporadic forms can be distinguished; however, classification of sporadic cases with multiple lesions still remains uncertain. To date, three CCM causative genes have been identified: CCM1/KRIT1, CCM2/MGC4607 and CCM3/PDCD10. In our previous mutation screening, performed in a cohort of 95 Italian patients, with both sporadic and familial cases, we identified several mutations in CCM genes. This study represents further molecular screening in a cohort of 19 Italian patients enrolled by us in the few last years and classified into familial, sporadic and sporadic with multiple lesions cases. Direct sequencing and multiplex ligation-dependent probe amplification (MLPA) analysis were performed to detect point mutations and large genomic rearrangements, respectively. Effects of detected mutations and single-nucleotide polymorphisms (SNPs) were evaluated by an in silico approach and by western blot analysis. A novel nonsense mutation in CCM1 and a novel missense mutation in CCM2 were detected; moreover, several CCM2 gene polymorphisms in sporadic CCM patients were reported. We believe that these data enrich the mutation spectrum of CCM genes, which is useful for genetic counselling to identify both familial and sporadic CCM cases, as early as possible.
Pigard, Nadine; Elovaara, Irina; Kuusisto, Hanna; Paalavuo, Raija; Dastidar, Prasun; Zimmermann, Klaus; Schwarz, Hans-Peter; Reipert, Birgit
2009-04-30
The objective of this study was to identify genes that are differentially expressed in peripheral T cells of patients with MS exacerbation receiving treatment with IVIG. Using microarray analysis, we identified 360 genes that were at least two-fold up- or down-regulated. The expression of four representative genes (PTGER4, CXCL5, IL11 and CASP2) was confirmed by quantitative PCR. Four of the differentially expressed genes encode chemokines (CXCL3, CXCL5, CCL13 and XCL2) that are involved in directing leukocyte migration. We suggest that the modulation of chemokine expression in peripheral T cells contributes to the beneficial activity of IVIG in patients with MS exacerbation.
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the genes that contribute to cellulose content in cereal culms and to a greater understanding of the interactions between them. PMID:26154104
A Prototype System for Retrieval of Gene Functional Information
Folk, Lillian C.; Patrick, Timothy B.; Pattison, James S.; Wolfinger, Russell D.; Mitchell, Joyce A.
2003-01-01
Microarrays allow researchers to gather data about the expression patterns of thousands of genes simultaneously. Statistical analysis can reveal which genes show statistically significant results. Making biological sense of those results requires the retrieval of functional information about the genes thus identified, typically a manual gene-by-gene retrieval of information from various on-line databases. For experiments generating thousands of genes of interest, retrieval of functional information can become a significant bottleneck. To address this issue, we are currently developing a prototype system to automate the process of retrieval of functional information from multiple on-line sources. PMID:14728346
Gene discovery by chemical mutagenesis and whole-genome sequencing in Dictyostelium.
Li, Cheng-Lin Frank; Santhanam, Balaji; Webb, Amanda Nicole; Zupan, Blaž; Shaulsky, Gad
2016-09-01
Whole-genome sequencing is a useful approach for identification of chemical-induced lesions, but previous applications involved tedious genetic mapping to pinpoint the causative mutations. We propose that saturation mutagenesis under low mutagenic loads, followed by whole-genome sequencing, should allow direct implication of genes by identifying multiple independent alleles of each relevant gene. We tested the hypothesis by performing three genetic screens with chemical mutagenesis in the social soil amoeba Dictyostelium discoideum Through genome sequencing, we successfully identified mutant genes with multiple alleles in near-saturation screens, including resistance to intense illumination and strong suppressors of defects in an allorecognition pathway. We tested the causality of the mutations by comparison to published data and by direct complementation tests, finding both dominant and recessive causative mutations. Therefore, our strategy provides a cost- and time-efficient approach to gene discovery by integrating chemical mutagenesis and whole-genome sequencing. The method should be applicable to many microbial systems, and it is expected to revolutionize the field of functional genomics in Dictyostelium by greatly expanding the mutation spectrum relative to other common mutagenesis methods. © 2016 Li et al.; Published by Cold Spring Harbor Laboratory Press.
Singh, Ravi P; Hodson, David P; Jin, Yue; Lagudah, Evans S; Ayliffe, Michael A; Bhavani, Sridhar; Rouse, Matthew N; Pretorius, Zacharias A; Szabo, Les J; Huerta-Espino, Julio; Basnet, Bhoja R; Lan, Caixia; Hovmøller, Mogens S
2015-07-01
Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best stem rust management strategy.
Saunders, Edward J; Dadaev, Tokhir; Leongamornlert, Daniel A; Al Olama, Ali Amin; Benlloch, Sara; Giles, Graham G; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A; Schleutker, Johanna; Nordestgaard, Borge G; Travis, Ruth C; Neal, David; Pasayan, Nora; Khaw, Kay-Tee; Stanford, Janet L; Blot, William J; Thibodeau, Stephen N; Maier, Christiane; Kibel, Adam S; Cybulski, Cezary; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y; Kaneva, Radka; Batra, Jyotsna; Teixeira, Manuel R; Pandha, Hardev; Govindasami, Koveela; Muir, Ken; Easton, Douglas F; Eeles, Rosalind A; Kote-Jarai, Zsofia
2016-04-12
Germline mutations within DNA-repair genes are implicated in susceptibility to multiple forms of cancer. For prostate cancer (PrCa), rare mutations in BRCA2 and BRCA1 give rise to moderately elevated risk, whereas two of B100 common, low-penetrance PrCa susceptibility variants identified so far by genome-wide association studies implicate RAD51B and RAD23B. Genotype data from the iCOGS array were imputed to the 1000 genomes phase 3 reference panel for 21 780 PrCa cases and 21 727 controls from the Prostate Cancer Association Group to Investigate Cancer Associated Alterations in the Genome (PRACTICAL) consortium. We subsequently performed single variant, gene and pathway-level analyses using 81 303 SNPs within 20 Kb of a panel of 179 DNA-repair genes. Single SNP analyses identified only the previously reported association with RAD51B. Gene-level analyses using the SKAT-C test from the SNP-set (Sequence) Kernel Association Test (SKAT) identified a significant association with PrCa for MSH5. Pathway-level analyses suggested a possible role for the translesion synthesis pathway in PrCa risk and Homologous recombination/Fanconi Anaemia pathway for PrCa aggressiveness, even though after adjustment for multiple testing these did not remain significant. MSH5 is a novel candidate gene warranting additional follow-up as a prospective PrCa-risk locus. MSH5 has previously been reported as a pleiotropic susceptibility locus for lung, colorectal and serous ovarian cancers.
Chan, Kei Hang K; Huang, Yen-Tsung; Meng, Qingying; Wu, Chunyuan; Reiner, Alexander; Sobel, Eric M; Tinker, Lesley; Lusis, Aldons J; Yang, Xia; Liu, Simin
2014-12-01
Although cardiovascular disease (CVD) and type 2 diabetes mellitus (T2D) share many common risk factors, potential molecular mechanisms that may also be shared for these 2 disorders remain unknown. Using an integrative pathway and network analysis, we performed genome-wide association studies in 8155 blacks, 3494 Hispanic American, and 3697 Caucasian American women who participated in the national Women's Health Initiative single-nucleotide polymorphism (SNP) Health Association Resource and the Genomics and Randomized Trials Network. Eight top pathways and gene networks related to cardiomyopathy, calcium signaling, axon guidance, cell adhesion, and extracellular matrix seemed to be commonly shared between CVD and T2D across all 3 ethnic groups. We also identified ethnicity-specific pathways, such as cell cycle (specific for Hispanic American and Caucasian American) and tight junction (CVD and combined CVD and T2D in Hispanic American). In network analysis of gene-gene or protein-protein interactions, we identified key drivers that included COL1A1, COL3A1, and ELN in the shared pathways for both CVD and T2D. These key driver genes were cross-validated in multiple mouse models of diabetes mellitus and atherosclerosis. Our integrative analysis of American women of 3 ethnicities identified multiple shared biological pathways and key regulatory genes for the development of CVD and T2D. These prospective findings also support the notion that ethnicity-specific susceptibility genes and process are involved in the pathogenesis of CVD and T2D. © 2014 American Heart Association, Inc.
Sass, Andrea; Marchbank, Angela; Tullis, Elizabeth; Lipuma, John J; Mahenthiralingam, Eshwar
2011-07-22
Burkholderia cenocepacia is a member of the Burkholderia cepacia complex group of bacteria that cause infections in individuals with cystic fibrosis. B. cenocepacia isolate J2315 has been genome sequenced and is representative of a virulent, epidemic CF strain (ET12). Its genome encodes multiple antimicrobial resistance pathways and it is not known which of these is important for intrinsic or spontaneous resistance. To map these pathways, transcriptomic analysis was performed on: (i) strain J2315 exposed to sub-inhibitory concentrations of antibiotics and the antibiotic potentiator chlorpromazine, and (ii) on spontaneous mutants derived from J2315 and with increased resistance to the antibiotics amikacin, meropenem and trimethoprim-sulfamethoxazole. Two pan-resistant ET12 outbreak isolates recovered two decades after J2315 were also compared to identify naturally evolved gene expression changes. Spontaneous resistance in B. cenocepacia involved more gene expression changes and different subsets of genes than those provoked by exposure to sub inhibitory concentrations of each antibiotic. The phenotype and altered gene expression in the resistant mutants was also stable irrespective of the presence of the priming antibiotic. Both known and novel genes involved in efflux, antibiotic degradation/modification, membrane function, regulation and unknown functions were mapped. A novel role for the phenylacetic acid (PA) degradation pathway genes was identified in relation to spontaneous resistance to meropenem and glucose was found to repress their expression. Subsequently, 20 mM glucose was found to produce greater that 2-fold reductions in the MIC of multiple antibiotics against B. cenocepacia J2315. Mutation of an RND multidrug efflux pump locus (BCAM0925-27) and squalene-hopene cyclase gene (BCAS0167), both upregulated after chlorpromazine exposure, confirmed their role in resistance. The recently isolated outbreak isolates had altered the expression of multiple genes which mirrored changes seen in the antibiotic resistant mutants, corroborating the strategy used to model resistance. Mutation of an ABC transporter gene (BCAS0081) upregulated in both outbreak strains, confirmed its role in B. cenocepacia resistance. Global mapping of the genetic pathways which mediate antibiotic resistance in B. cenocepacia has revealed that they are multifactorial, identified potential therapeutic targets and also demonstrated that putative catabolite repression of genes by glucose can improve antibiotic efficacy.
Edenberg, Howard J; Foroud, Tatiana
2014-01-01
Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...
Network Analysis of Rodent Transcriptomes in Spaceflight
NASA Technical Reports Server (NTRS)
Ramachandran, Maya; Fogle, Homer; Costes, Sylvain
2017-01-01
Network analysis methods leverage prior knowledge of cellular systems and the statistical and conceptual relationships between analyte measurements to determine gene connectivity. Correlation and conditional metrics are used to infer a network topology and provide a systems-level context for cellular responses. Integration across multiple experimental conditions and omics domains can reveal the regulatory mechanisms that underlie gene expression. GeneLab has assembled rich multi-omic (transcriptomics, proteomics, epigenomics, and epitranscriptomics) datasets for multiple murine tissues from the Rodent Research 1 (RR-1) experiment. RR-1 assesses the impact of 37 days of spaceflight on gene expression across a variety of tissue types, such as adrenal glands, quadriceps, gastrocnemius, tibalius anterior, extensor digitorum longus, soleus, eye, and kidney. Network analysis is particularly useful for RR-1 -omics datasets because it reinforces subtle relationships that may be overlooked in isolated analyses and subdues confounding factors. Our objective is to use network analysis to determine potential target nodes for therapeutic intervention and identify similarities with existing disease models. Multiple network algorithms are used for a higher confidence consensus.
Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou
2016-12-23
Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.
Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, V. Shane; Haralambieva, Iana H.; Vierkant, Robert A.; Poland, Gregory A.
2014-01-01
The role that genetics plays in response to infection or disease is becoming increasingly clear as we learn more about immunogenetics and host-pathogen interactions. Here we report a genome-wide analysis of the effects of host genetic variation on cytokine responses to vaccinia virus stimulation in smallpox vaccine recipients. Our data show that vaccinia stimulation of immune individuals results in secretion of inflammatory and Th1 cytokines. We identified multiple SNPs significantly associated with variations in cytokine secretion. These SNPs are found in genes with known immune function, as well as in genes encoding for proteins involved in signal transduction, cytoskeleton, membrane channels and ion transport, as well as others with no previously identified connection to immune responses. The large number of significant SNP associations implies that cytokine secretion in response to vaccinia virus is a complex process controlled by multiple genes and gene families. Follow-up studies to replicate these findings and then pursue mechanistic studies will provide a greater understanding of how genetic variation influences vaccine responses. PMID:22610502
A novel approach to identify genes that determine grain protein deviation in cereals.
Mosleth, Ellen F; Wan, Yongfang; Lysenko, Artem; Chope, Gemma A; Penson, Simon P; Shewry, Peter R; Hawkesford, Malcolm J
2015-06-01
Grain yield and protein content were determined for six wheat cultivars grown over 3 years at multiple sites and at multiple nitrogen (N) fertilizer inputs. Although grain protein content was negatively correlated with yield, some grain samples had higher protein contents than expected based on their yields, a trait referred to as grain protein deviation (GPD). We used novel statistical approaches to identify gene transcripts significantly related to GPD across environments. The yield and protein content were initially adjusted for nitrogen fertilizer inputs and then adjusted for yield (to remove the negative correlation with protein content), resulting in a parameter termed corrected GPD. Significant genetic variation in corrected GPD was observed for six cultivars grown over a range of environmental conditions (a total of 584 samples). Gene transcript profiles were determined in a subset of 161 samples of developing grain to identify transcripts contributing to GPD. Principal component analysis (PCA), analysis of variance (ANOVA) and means of scores regression (MSR) were used to identify individual principal components (PCs) correlating with GPD alone. Scores of the selected PCs, which were significantly related to GPD and protein content but not to the yield and significantly affected by cultivar, were identified as reflecting a multivariate pattern of gene expression related to genetic variation in GPD. Transcripts with consistent variation along the selected PCs were identified by an approach hereby called one-block means of scores regression (one-block MSR). © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
PSAT: A web tool to compare genomic neighborhoods of multiple prokaryotic genomes
Fong, Christine; Rohmer, Laurence; Radey, Matthew; Wasnick, Michael; Brittnacher, Mitchell J
2008-01-01
Background The conservation of gene order among prokaryotic genomes can provide valuable insight into gene function, protein interactions, or events by which genomes have evolved. Although some tools are available for visualizing and comparing the order of genes between genomes of study, few support an efficient and organized analysis between large numbers of genomes. The Prokaryotic Sequence homology Analysis Tool (PSAT) is a web tool for comparing gene neighborhoods among multiple prokaryotic genomes. Results PSAT utilizes a database that is preloaded with gene annotation, BLAST hit results, and gene-clustering scores designed to help identify regions of conserved gene order. Researchers use the PSAT web interface to find a gene of interest in a reference genome and efficiently retrieve the sequence homologs found in other bacterial genomes. The tool generates a graphic of the genomic neighborhood surrounding the selected gene and the corresponding regions for its homologs in each comparison genome. Homologs in each region are color coded to assist users with analyzing gene order among various genomes. In contrast to common comparative analysis methods that filter sequence homolog data based on alignment score cutoffs, PSAT leverages gene context information for homologs, including those with weak alignment scores, enabling a more sensitive analysis. Features for constraining or ordering results are designed to help researchers browse results from large numbers of comparison genomes in an organized manner. PSAT has been demonstrated to be useful for helping to identify gene orthologs and potential functional gene clusters, and detecting genome modifications that may result in loss of function. Conclusion PSAT allows researchers to investigate the order of genes within local genomic neighborhoods of multiple genomes. A PSAT web server for public use is available for performing analyses on a growing set of reference genomes through any web browser with no client side software setup or installation required. Source code is freely available to researchers interested in setting up a local version of PSAT for analysis of genomes not available through the public server. Access to the public web server and instructions for obtaining source code can be found at . PMID:18366802
Rogic, Sanja; Wong, Albertina; Pavlidis, Paul
2017-01-01
Background Prenatal alcohol exposure (PAE) can result in an array of morphological, behavioural and neurobiological deficits that can range in their severity. Despite extensive research in the field and a significant progress made, especially in understanding the range of possible malformations and neurobehavioral abnormalities, the molecular mechanisms of alcohol responses in development are still not well understood. There have been multiple transcriptomic studies looking at the changes in gene expression after PAE in animal models, however there is a limited apparent consensus among the reported findings. In an effort to address this issue, we performed a comprehensive re-analysis and meta-analysis of all suitable, publically available expression data sets. Methods We assembled ten microarray data sets of gene expression after PAE in mouse and rat models consisting of samples from a total of 63 ethanol-exposed and 80 control animals. We re-analyzed each data set for differential expression and then used the results to perform meta-analyses considering all data sets together or grouping them by time or duration of exposure (pre- and post-natal, acute and chronic, respectively). We performed network and Gene Ontology enrichment analysis to further characterize the identified signatures. Results For each sub-analysis we identified signatures of differential expressed genes that show support from multiple studies. Overall, the changes in gene expression were more extensive after acute ethanol treatment during prenatal development than in other models. Considering the analysis of all the data together, we identified a robust core signature of 104 genes down-regulated after PAE, with no up-regulated genes. Functional analysis reveals over-representation of genes involved in protein synthesis, mRNA splicing and chromatin organization. Conclusions Our meta-analysis shows that existing studies, despite superficial dissimilarity in findings, share features that allow us to identify a common core signature set of transcriptome changes in PAE. This is an important step to identifying the biological processes that underlie the etiology of FASD. PMID:26996386
Unity in defence: honeybee workers exhibit conserved molecular responses to diverse pathogens.
Doublet, Vincent; Poeschl, Yvonne; Gogol-Döring, Andreas; Alaux, Cédric; Annoscia, Desiderato; Aurori, Christian; Barribeau, Seth M; Bedoya-Reina, Oscar C; Brown, Mark J F; Bull, James C; Flenniken, Michelle L; Galbraith, David A; Genersch, Elke; Gisder, Sebastian; Grosse, Ivo; Holt, Holly L; Hultmark, Dan; Lattorff, H Michael G; Le Conte, Yves; Manfredini, Fabio; McMahon, Dino P; Moritz, Robin F A; Nazzi, Francesco; Niño, Elina L; Nowick, Katja; van Rij, Ronald P; Paxton, Robert J; Grozinger, Christina M
2017-03-02
Organisms typically face infection by diverse pathogens, and hosts are thought to have developed specific responses to each type of pathogen they encounter. The advent of transcriptomics now makes it possible to test this hypothesis and compare host gene expression responses to multiple pathogens at a genome-wide scale. Here, we performed a meta-analysis of multiple published and new transcriptomes using a newly developed bioinformatics approach that filters genes based on their expression profile across datasets. Thereby, we identified common and unique molecular responses of a model host species, the honey bee (Apis mellifera), to its major pathogens and parasites: the Microsporidia Nosema apis and Nosema ceranae, RNA viruses, and the ectoparasitic mite Varroa destructor, which transmits viruses. We identified a common suite of genes and conserved molecular pathways that respond to all investigated pathogens, a result that suggests a commonality in response mechanisms to diverse pathogens. We found that genes differentially expressed after infection exhibit a higher evolutionary rate than non-differentially expressed genes. Using our new bioinformatics approach, we unveiled additional pathogen-specific responses of honey bees; we found that apoptosis appeared to be an important response following microsporidian infection, while genes from the immune signalling pathways, Toll and Imd, were differentially expressed after Varroa/virus infection. Finally, we applied our bioinformatics approach and generated a gene co-expression network to identify highly connected (hub) genes that may represent important mediators and regulators of anti-pathogen responses. Our meta-analysis generated a comprehensive overview of the host metabolic and other biological processes that mediate interactions between insects and their pathogens. We identified key host genes and pathways that respond to phylogenetically diverse pathogens, representing an important source for future functional studies as well as offering new routes to identify or generate pathogen resilient honey bee stocks. The statistical and bioinformatics approaches that were developed for this study are broadly applicable to synthesize information across transcriptomic datasets. These approaches will likely have utility in addressing a variety of biological questions.
Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian
2010-01-01
Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000
Multiple levels of redundant processes inhibit Caenorhabditis elegans vulval cell fates.
Andersen, Erik C; Saffer, Adam M; Horvitz, H Robert
2008-08-01
Many mutations cause obvious abnormalities only when combined with other mutations. Such synthetic interactions can be the result of redundant gene functions. In Caenorhabditis elegans, the synthetic multivulva (synMuv) genes have been grouped into multiple classes that redundantly inhibit vulval cell fates. Animals with one or more mutations of the same class undergo wild-type vulval development, whereas animals with mutations of any two classes have a multivulva phenotype. By varying temperature and genetic background, we determined that mutations in most synMuv genes within a single synMuv class enhance each other. However, in a few cases no enhancement was observed. For example, mutations that affect an Mi2 homolog and a histone methyltransferase are of the same class and do not show enhancement. We suggest that such sets of genes function together in vivo and in at least some cases encode proteins that interact physically. The approach of genetic enhancement can be applied more broadly to identify potential protein complexes as well as redundant processes or pathways. Many synMuv genes are evolutionarily conserved, and the genetic relationships we have identified might define the functions not only of synMuv genes in C. elegans but also of their homologs in other organisms.
Multiple Levels of Redundant Processes Inhibit Caenorhabditis elegans Vulval Cell Fates
Andersen, Erik C.; Saffer, Adam M.; Horvitz, H. Robert
2008-01-01
Many mutations cause obvious abnormalities only when combined with other mutations. Such synthetic interactions can be the result of redundant gene functions. In Caenorhabditis elegans, the synthetic multivulva (synMuv) genes have been grouped into multiple classes that redundantly inhibit vulval cell fates. Animals with one or more mutations of the same class undergo wild-type vulval development, whereas animals with mutations of any two classes have a multivulva phenotype. By varying temperature and genetic background, we determined that mutations in most synMuv genes within a single synMuv class enhance each other. However, in a few cases no enhancement was observed. For example, mutations that affect an Mi2 homolog and a histone methyltransferase are of the same class and do not show enhancement. We suggest that such sets of genes function together in vivo and in at least some cases encode proteins that interact physically. The approach of genetic enhancement can be applied more broadly to identify potential protein complexes as well as redundant processes or pathways. Many synMuv genes are evolutionarily conserved, and the genetic relationships we have identified might define the functions not only of synMuv genes in C. elegans but also of their homologs in other organisms. PMID:18689876
Zhou, Cheng; Wen, Guang-Dong; Soe, Lwin Myint; Xu, Hong-Jun; Du, Juan; Zhang, Jian-Zhong
2016-01-01
Background: Acne inversa (AI), also called hidradenitis suppurativa, is a chronic, inflammatory, recurrent skin disease of the hair follicle. Familial AI shows autosomal-dominant inheritance caused by mutations in the γ-secretase genes. This study was aimed to identify the specific mutations in the γ-secretase genes in two Chinese families with AI. Methods: In this study, two Chinese families with AI were investigated. All the affected individuals in the two families mainly manifested with multiple comedones, pitted scars, and a few inflammatory nodules on their face, neck, trunk, axilla, buttocks, upper arms, and thighs. Reticulate pigmentation in the flexures areas resembled Dowling-Degos disease clinically and pathologically. In addition, one of the affected individuals developed anal canal squamous cell carcinoma. Molecular mutation analysis of γ-secretase genes including PSENEN, PSEN1, and NCSTN was performed by polymerase chain reaction and direct DNA sequencing. Results: Two novel mutations of PSENEN gene were identified, including a heterozygous missense mutation c.194T>G (p.L65R) and a splice site mutation c.167-2A>G. Conclusions: The identification of the two mutations could expand the spectrum of mutations in the γ-secretase genes underlying AI and provide valuable information for further study of genotype-phenotype correlations. PMID:27900998
Luan, Jun-Bo; Chen, Wenbo; Hasegawa, Daniel K; Simmons, Alvin M; Wintermantel, William M; Ling, Kai-Shu; Fei, Zhangjun; Liu, Shu-Sheng; Douglas, Angela E
2015-09-15
Genomic decay is a common feature of intracellular bacteria that have entered into symbiosis with plant sap-feeding insects. This study of the whitefly Bemisia tabaci and two bacteria (Portiera aleyrodidarum and Hamiltonella defensa) cohoused in each host cell investigated whether the decay of Portiera metabolism genes is complemented by host and Hamiltonella genes, and compared the metabolic traits of the whitefly symbiosis with other sap-feeding insects (aphids, psyllids, and mealybugs). Parallel genomic and transcriptomic analysis revealed that the host genome contributes multiple metabolic reactions that complement or duplicate Portiera function, and that Hamiltonella may contribute multiple cofactors and one essential amino acid, lysine. Homologs of the Bemisia metabolism genes of insect origin have also been implicated in essential amino acid synthesis in other sap-feeding insect hosts, indicative of parallel coevolution of shared metabolic pathways across multiple symbioses. Further metabolism genes coded in the Bemisia genome are of bacterial origin, but phylogenetically distinct from Portiera, Hamiltonella and horizontally transferred genes identified in other sap-feeding insects. Overall, 75% of the metabolism genes of bacterial origin are functionally unique to one symbiosis, indicating that the evolutionary history of metabolic integration in these symbioses is strongly contingent on the pattern of horizontally acquired genes. Our analysis, further, shows that bacteria with genomic decay enable host acquisition of complex metabolic pathways by multiple independent horizontal gene transfers from exogenous bacteria. Specifically, each horizontally acquired gene can function with other genes in the pathway coded by the symbiont, while facilitating the decay of the symbiont gene coding the same reaction. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Origins of extrinsic variability in eukaryotic gene expression
NASA Astrophysics Data System (ADS)
Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff
2006-02-01
Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes simultaneously, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modelling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous lower limit for expression variability. A second source, which is modelled as originating from a common upstream transcription factor, exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.
Origins of extrinsic variability in eukaryotic gene expression
NASA Astrophysics Data System (ADS)
Volfson, Dmitri; Marciniak, Jennifer; Blake, William J.; Ostroff, Natalie; Tsimring, Lev S.; Hasty, Jeff
2006-03-01
Variable gene expression within a clonal population of cells has been implicated in a number of important processes including mutation and evolution, determination of cell fates and the development of genetic disease. Recent studies have demonstrated that a significant component of expression variability arises from extrinsic factors thought to influence multiple genes in concert, yet the biological origins of this extrinsic variability have received little attention. Here we combine computational modeling with fluorescence data generated from multiple promoter-gene inserts in Saccharomyces cerevisiae to identify two major sources of extrinsic variability. One unavoidable source arising from the coupling of gene expression with population dynamics leads to a ubiquitous noise floor in expression variability. A second source which is modeled as originating from a common upstream transcription factor exemplifies how regulatory networks can convert noise in upstream regulator expression into extrinsic noise at the output of a target gene. Our results highlight the importance of the interplay of gene regulatory networks with population heterogeneity for understanding the origins of cellular diversity.
YY1 Regulates Melanocyte Development and Function by Cooperating with MITF
Bell, Robert J. A.; Tran, Thanh-Nga T.; Haq, Rizwan; Liu, Huifei; Love, Kevin T.; Langer, Robert; Anderson, Daniel G.; Larue, Lionel; Fisher, David E.
2012-01-01
Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP–seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1) gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF)—a general mechanism which may confer tissue-specific gene expression in multiple lineages. PMID:22570637
Freytag, Virginie; Probst, Sabine; Hadziselimovic, Nils; Boglari, Csaba; Hauser, Yannick; Peter, Fabian; Gabor Fenyves, Bank; Milnik, Annette; Demougin, Philippe; Vukojevic, Vanja; de Quervain, Dominique J-F; Papassotiropoulos, Andreas; Stetak, Attila
2017-07-12
The identification of genes related to encoding, storage, and retrieval of memories is a major interest in neuroscience. In the current study, we analyzed the temporal gene expression changes in a neuronal mRNA pool during an olfactory long-term associative memory (LTAM) in Caenorhabditis elegans hermaphrodites. Here, we identified a core set of 712 (538 upregulated and 174 downregulated) genes that follows three distinct temporal peaks demonstrating multiple gene regulation waves in LTAM. Compared with the previously published positive LTAM gene set (Lakhina et al., 2015), 50% of the identified upregulated genes here overlap with the previous dataset, possibly representing stimulus-independent memory-related genes. On the other hand, the remaining genes were not previously identified in positive associative memory and may specifically regulate aversive LTAM. Our results suggest a multistep gene activation process during the formation and retrieval of long-term memory and define general memory-implicated genes as well as conditioning-type-dependent gene sets. SIGNIFICANCE STATEMENT The identification of genes regulating different steps of memory is of major interest in neuroscience. Identification of common memory genes across different learning paradigms and the temporal activation of the genes are poorly studied. Here, we investigated the temporal aspects of Caenorhabditis elegans gene expression changes using aversive olfactory associative long-term memory (LTAM) and identified three major gene activation waves. Like in previous studies, aversive LTAM is also CREB dependent, and CREB activity is necessary immediately after training. Finally, we define a list of memory paradigm-independent core gene sets as well as conditioning-dependent genes. Copyright © 2017 the authors 0270-6474/17/376661-12$15.00/0.
Pritchard, Victoria L; Mäkinen, Hannu; Vähä, Juha-Pekka; Erkinaro, Jaakko; Orell, Panu; Primmer, Craig R
2018-06-01
Elucidating the genetic basis of adaptation to the local environment can improve our understanding of how the diversity of life has evolved. In this study, we used a dense SNP array to identify candidate loci potentially underlying fine-scale local adaptation within a large Atlantic salmon (Salmo salar) population. By combining outlier, gene-environment association and haplotype homozygosity analyses, we identified multiple regions of the genome with strong evidence for diversifying selection. Several of these candidate regions had previously been identified in other studies, demonstrating that the same loci could be adaptively important in Atlantic salmon at subdrainage, regional and continental scales. Notably, we identified signals consistent with local selection around genes associated with variation in sexual maturation, energy homeostasis and immune defence. These included the large-effect age-at-maturity gene vgll3, the known obesity gene mc4r, and major histocompatibility complex II. Most strikingly, we confirmed a genomic region on Ssa09 that was extremely differentiated among subpopulations and that is also a candidate for local selection over the global range of Atlantic salmon. This region colocalized with a haplotype strongly associated with spawning ecotype in sockeye salmon (Oncorhynchus nerka), with circumstantial evidence that the same gene (six6) may be the selective target in both cases. The phenotypic effect of this region in Atlantic salmon remains cryptic, although allelic variation is related to upstream catchment area and covaries with timing of the return spawning migration. Our results further inform management of Atlantic salmon and open multiple avenues for future research. © 2018 John Wiley & Sons Ltd.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Reliable pre-eclampsia pathways based on multiple independent microarray data sets.
Kawasaki, Kaoru; Kondoh, Eiji; Chigusa, Yoshitsugu; Ujita, Mari; Murakami, Ryusuke; Mogami, Haruta; Brown, J B; Okuno, Yasushi; Konishi, Ikuo
2015-02-01
Pre-eclampsia is a multifactorial disorder characterized by heterogeneous clinical manifestations. Gene expression profiling of preeclamptic placenta have provided different and even opposite results, partly due to data compromised by various experimental artefacts. Here we aimed to identify reliable pre-eclampsia-specific pathways using multiple independent microarray data sets. Gene expression data of control and preeclamptic placentas were obtained from Gene Expression Omnibus. Single-sample gene-set enrichment analysis was performed to generate gene-set activation scores of 9707 pathways obtained from the Molecular Signatures Database. Candidate pathways were identified by t-test-based screening using data sets, GSE10588, GSE14722 and GSE25906. Additionally, recursive feature elimination was applied to arrive at a further reduced set of pathways. To assess the validity of the pre-eclampsia pathways, a statistically-validated protocol was executed using five data sets including two independent other validation data sets, GSE30186, GSE44711. Quantitative real-time PCR was performed for genes in a panel of potential pre-eclampsia pathways using placentas of 20 women with normal or severe preeclamptic singleton pregnancies (n = 10, respectively). A panel of ten pathways were found to discriminate women with pre-eclampsia from controls with high accuracy. Among these were pathways not previously associated with pre-eclampsia, such as the GABA receptor pathway, as well as pathways that have already been linked to pre-eclampsia, such as the glutathione and CDKN1C pathways. mRNA expression of GABRA3 (GABA receptor pathway), GCLC and GCLM (glutathione metabolic pathway), and CDKN1C was significantly reduced in the preeclamptic placentas. In conclusion, ten accurate and reliable pre-eclampsia pathways were identified based on multiple independent microarray data sets. A pathway-based classification may be a worthwhile approach to elucidate the pathogenesis of pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Foronjy, Robert F; Feronjy, Robert; Spira, Avrum; Schadt, Eric E; Powell, Charles A; Zhu, Jun
2015-01-01
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a 'causal' role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology.
Hohman, Timothy J; Bush, William S; Jiang, Lan; Brown-Gentry, Kristin D; Torstenson, Eric S; Dudek, Scott M; Mukherjee, Shubhabrata; Naj, Adam; Kunkle, Brian W; Ritchie, Marylyn D; Martin, Eden R; Schellenberg, Gerard D; Mayeux, Richard; Farrer, Lindsay A; Pericak-Vance, Margaret A; Haines, Jonathan L; Thornton-Wells, Tricia A
2016-02-01
Late-onset Alzheimer disease (AD) has a complex genetic etiology, involving locus heterogeneity, polygenic inheritance, and gene-gene interactions; however, the investigation of interactions in recent genome-wide association studies has been limited. We used a biological knowledge-driven approach to evaluate gene-gene interactions for consistency across 13 data sets from the Alzheimer Disease Genetics Consortium. Fifteen single nucleotide polymorphism (SNP)-SNP pairs within 3 gene-gene combinations were identified: SIRT1 × ABCB1, PSAP × PEBP4, and GRIN2B × ADRA1A. In addition, we extend a previously identified interaction from an endophenotype analysis between RYR3 × CACNA1C. Finally, post hoc gene expression analyses of the implicated SNPs further implicate SIRT1 and ABCB1, and implicate CDH23 which was most recently identified as an AD risk locus in an epigenetic analysis of AD. The observed interactions in this article highlight ways in which genotypic variation related to disease may depend on the genetic context in which it occurs. Further, our results highlight the utility of evaluating genetic interactions to explain additional variance in AD risk and identify novel molecular mechanisms of AD pathogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.
Fyn-Dependent Gene Networks in Acute Ethanol Sensitivity
Farris, Sean P.; Miles, Michael F.
2013-01-01
Studies in humans and animal models document that acute behavioral responses to ethanol are predisposing factor for the risk of long-term drinking behavior. Prior microarray data from our laboratory document strain- and brain region-specific variation in gene expression profile responses to acute ethanol that may be underlying regulators of ethanol behavioral phenotypes. The non-receptor tyrosine kinase Fyn has previously been mechanistically implicated in the sedative-hypnotic response to acute ethanol. To further understand how Fyn may modulate ethanol behaviors, we used whole-genome expression profiling. We characterized basal and acute ethanol-evoked (3 g/kg) gene expression patterns in nucleus accumbens (NAC), prefrontal cortex (PFC), and ventral midbrain (VMB) of control and Fyn knockout mice. Bioinformatics analysis identified a set of Fyn-related gene networks differently regulated by acute ethanol across the three brain regions. In particular, our analysis suggested a coordinate basal decrease in myelin-associated gene expression within NAC and PFC as an underlying factor in sensitivity of Fyn null animals to ethanol sedation. An in silico analysis across the BXD recombinant inbred (RI) strains of mice identified a significant correlation between Fyn expression and a previously published ethanol loss-of-righting-reflex (LORR) phenotype. By combining PFC gene expression correlates to Fyn and LORR across multiple genomic datasets, we identified robust Fyn-centric gene networks related to LORR. Our results thus suggest that multiple system-wide changes exist within specific brain regions of Fyn knockout mice, and that distinct Fyn-dependent expression networks within PFC may be important determinates of the LORR due to acute ethanol. These results add to the interpretation of acute ethanol behavioral sensitivity in Fyn kinase null animals, and identify Fyn-centric gene networks influencing variance in ethanol LORR. Such networks may also inform future design of pharmacotherapies for the treatment and prevention of alcohol use disorders. PMID:24312422
Sowpati, Divya Tej; Srivastava, Surabhi; Dhawan, Jyotsna; Mishra, Rakesh K
2017-09-13
Comparative epigenomic analysis across multiple genes presents a bottleneck for bench biologists working with NGS data. Despite the development of standardized peak analysis algorithms, the identification of novel epigenetic patterns and their visualization across gene subsets remains a challenge. We developed a fast and interactive web app, C-State (Chromatin-State), to query and plot chromatin landscapes across multiple loci and cell types. C-State has an interactive, JavaScript-based graphical user interface and runs locally in modern web browsers that are pre-installed on all computers, thus eliminating the need for cumbersome data transfer, pre-processing and prior programming knowledge. C-State is unique in its ability to extract and analyze multi-gene epigenetic information. It allows for powerful GUI-based pattern searching and visualization. We include a case study to demonstrate its potential for identifying user-defined epigenetic trends in context of gene expression profiles.
Avcı, Mine; Özden Tuncer, Banu
2017-07-06
The purpose of this study was to determine the antimicrobial activity and occurrence of bacteriocin structural genes in Enterococcus spp. isolated from different cheeses and also investigate some of their virulence factors. Enterococcus strains were isolated from 33 different cheeses. Enterococcus faecium (6 strains) and Enterococcus faecalis (5 strains) enterocin-producing strains were identified by 16S rDNA analyses. Structural genes entA, entB, entP and entX were detected in some isolates. Multiple enterocin structural genes were found in 7 strains. None of the tested enterococci demonstrated anyβ-haemolytic activity and only one strain had gelatinase activity. Six strains showed multiple antibiotic resistance patterns and in addition, vanA and several virulence genes were detected in many strains. Only E. faecalis MBE1-9 showed tyrosine decarboxylase activity and tdc gene was detected only in this strain.
Inferring Gene Family Histories in Yeast Identifies Lineage Specific Expansions
Ames, Ryan M.; Money, Daniel; Lovell, Simon C.
2014-01-01
The complement of genes found in the genome is a balance between gene gain and gene loss. Knowledge of the specific genes that are gained and lost over evolutionary time allows an understanding of the evolution of biological functions. Here we use new evolutionary models to infer gene family histories across complete yeast genomes; these models allow us to estimate the relative genome-wide rates of gene birth, death, innovation and extinction (loss of an entire family) for the first time. We show that the rates of gene family evolution vary both between gene families and between species. We are also able to identify those families that have experienced rapid lineage specific expansion/contraction and show that these families are enriched for specific functions. Moreover, we find that families with specific functions are repeatedly expanded in multiple species, suggesting the presence of common adaptations and that these family expansions/contractions are not random. Additionally, we identify potential specialisations, unique to specific species, in the functions of lineage specific expanded families. These results suggest that an important mechanism in the evolution of genome content is the presence of lineage-specific gene family changes. PMID:24921666
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xia, Jing; Rocke, David M.; Perry, George
In late-onset Alzheimer’s disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with lowmore » topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases.« less
Xia, Jing; Rocke, David M.; Perry, George; ...
2014-01-01
In late-onset Alzheimer’s disease (AD), multiple brain regions are not affected simultaneously. Comparing the gene expression of the affected regions to identify the differences in the biological processes perturbed can lead to greater insight into AD pathogenesis and early characteristics. We identified differentially expressed (DE) genes from single cell microarray data of four AD affected brain regions: entorhinal cortex (EC), hippocampus (HIP), posterior cingulate cortex (PCC), and middle temporal gyrus (MTG). We organized the DE genes in the four brain regions into region-specific gene coexpression networks. Differential neighborhood analyses in the coexpression networks were performed to identify genes with lowmore » topological overlap (TO) of their direct neighbors. The low TO genes were used to characterize the biological differences between two regions. Our analyses show that increased oxidative stress, along with alterations in lipid metabolism in neurons, may be some of the very early events occurring in AD pathology. Cellular defense mechanisms try to intervene but fail, finally resulting in AD pathology as the disease progresses. Furthermore, disease annotation of the low TO genes in two independent protein interaction networks has resulted in association between cancer, diabetes, renal diseases, and cardiovascular diseases.« less
The genetics of alcoholism: identifying specific genes through family studies.
Edenberg, Howard J; Foroud, Tatiana
2006-09-01
Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.
Takeda, Kojiro; Mori, Ayaka; Yanagida, Mitsuhiro
2011-01-01
Bortezomib/PS-341/Velcade, a proteasome inhibitor, is widely used to treat multiple myeloma. While several mechanisms of the cytotoxicity of the drug were proposed, the actual mechanism remains elusive. We aimed to identify genes affecting the cytotoxicity of Bortezomib in the fission yeast S.pombe as the drug inhibits this organism's cell division cycle like proteasome mutants. Among the 2815 genes screened (covering 56% of total ORFs), 19 genes, whose deletions induce strong synthetic lethality with Bortezomib, were identified. The products of the 19 genes included four ubiquitin enzymes and one nuclear proteasome factor, and 13 of them are conserved in humans. Our results will provide useful information for understanding the actions of Bortezomib within cells. PMID:21760946
Uchiyama, Ikuo
2008-10-31
Identifying the set of intrinsically conserved genes, or the genomic core, among related genomes is crucial for understanding prokaryotic genomes where horizontal gene transfers are common. Although core genome identification appears to be obvious among very closely related genomes, it becomes more difficult when more distantly related genomes are compared. Here, we consider the core structure as a set of sufficiently long segments in which gene orders are conserved so that they are likely to have been inherited mainly through vertical transfer, and developed a method for identifying the core structure by finding the order of pre-identified orthologous groups (OGs) that maximally retains the conserved gene orders. The method was applied to genome comparisons of two well-characterized families, Bacillaceae and Enterobacteriaceae, and identified their core structures comprising 1438 and 2125 OGs, respectively. The core sets contained most of the essential genes and their related genes, which were primarily included in the intersection of the two core sets comprising around 700 OGs. The definition of the genomic core based on gene order conservation was demonstrated to be more robust than the simpler approach based only on gene conservation. We also investigated the core structures in terms of G+C content homogeneity and phylogenetic congruence, and found that the core genes primarily exhibited the expected characteristic, i.e., being indigenous and sharing the same history, more than the non-core genes. The results demonstrate that our strategy of genome alignment based on gene order conservation can provide an effective approach to identify the genomic core among moderately related microbial genomes.
Combining Evidence of Preferential Gene-Tissue Relationships from Multiple Sources
Guo, Jing; Hammar, Mårten; Öberg, Lisa; Padmanabhuni, Shanmukha S.; Bjäreland, Marcus; Dalevi, Daniel
2013-01-01
An important challenge in drug discovery and disease prognosis is to predict genes that are preferentially expressed in one or a few tissues, i.e. showing a considerably higher expression in one tissue(s) compared to the others. Although several data sources and methods have been published explicitly for this purpose, they often disagree and it is not evident how to retrieve these genes and how to distinguish true biological findings from those that are due to choice-of-method and/or experimental settings. In this work we have developed a computational approach that combines results from multiple methods and datasets with the aim to eliminate method/study-specific biases and to improve the predictability of preferentially expressed human genes. A rule-based score is used to merge and assign support to the results. Five sets of genes with known tissue specificity were used for parameter pruning and cross-validation. In total we identify 3434 tissue-specific genes. We compare the genes of highest scores with the public databases: PaGenBase (microarray), TiGER (EST) and HPA (protein expression data). The results have 85% overlap to PaGenBase, 71% to TiGER and only 28% to HPA. 99% of our predictions have support from at least one of these databases. Our approach also performs better than any of the databases on identifying drug targets and biomarkers with known tissue-specificity. PMID:23950964
Derived variants at six genes explain nearly half of size reduction in dog breeds.
Rimbault, Maud; Beale, Holly C; Schoenebeck, Jeffrey J; Hoopes, Barbara C; Allen, Jeremy J; Kilroy-Glynn, Paul; Wayne, Robert K; Sutter, Nathan B; Ostrander, Elaine A
2013-12-01
Selective breeding of dogs by humans has generated extraordinary diversity in body size. A number of multibreed analyses have been undertaken to identify the genetic basis of this diversity. We analyzed four loci discovered in a previous genome-wide association study that used 60,968 SNPs to identify size-associated genomic intervals, which were too large to assign causative roles to genes. First, we performed fine-mapping to define critical intervals that included the candidate genes GHR, HMGA2, SMAD2, and STC2, identifying five highly associated markers at the four loci. We hypothesize that three of the variants are likely to be causative. We then genotyped each marker, together with previously reported size-associated variants in the IGF1 and IGF1R genes, on a panel of 500 domestic dogs from 93 breeds, and identified the ancestral allele by genotyping the same markers on 30 wild canids. We observed that the derived alleles at all markers correlated with reduced body size, and smaller dogs are more likely to carry derived alleles at multiple markers. However, breeds are not generally fixed at all markers; multiple combinations of genotypes are found within most breeds. Finally, we show that 46%-52.5% of the variance in body size of dog breeds can be explained by seven markers in proximity to exceptional candidate genes. Among breeds with standard weights <41 kg (90 lb), the genotypes accounted for 64.3% of variance in weight. This work advances our understanding of mammalian growth by describing genetic contributions to canine size determination in non-giant dog breeds.
The Association of CD81 Polymorphisms with Alloimmunization in Sickle Cell Disease
Tatari-Calderone, Zohreh; Tamouza, Ryad; Le Bouder, Gama P.; Dewan, Ramita; Luban, Naomi L. C.; Lasserre, Jacqueline; Maury, Jacqueline; Lionnet, François; Krishnamoorthy, Rajagopal; Girot, Robert
2013-01-01
The goal of the present work was to identify the candidate genetic markers predictive of alloimmunization in sickle cell disease (SCD). Red blood cell (RBC) transfusion is indicated for acute treatment, prevention, and abrogation of some complications of SCD. A well-known consequence of multiple RBC transfusions is alloimmunization. Given that a subset of SCD patients develop multiple RBC allo-/autoantibodies, while others do not in a similar multiple transfusional setting, we investigated a possible genetic basis for alloimmunization. Biomarker(s) which predicts (predict) susceptibility to alloimmunization could identify patients at risk before the onset of a transfusion program and thus may have important implications for clinical management. In addition, such markers could shed light on the mechanism(s) underlying alloimmunization. We genotyped 27 single nucleotide polymorphisms (SNPs) in the CD81, CHRNA10, and ARHG genes in two groups of SCD patients. One group (35) of patients developed alloantibodies, and another (40) had no alloantibodies despite having received multiple transfusions. Two SNPs in the CD81 gene, that encodes molecule involved in the signal modulation of B lymphocytes, show a strong association with alloimmunization. If confirmed in prospective studies with larger cohorts, the two SNPs identified in this retrospective study could serve as predictive biomarkers for alloimmunization. PMID:23762099
Lal, Ashish; Thomas, Marshall P; Altschuler, Gabriel; Navarro, Francisco; O'Day, Elizabeth; Li, Xiao Ling; Concepcion, Carla; Han, Yoon-Chi; Thiery, Jerome; Rajani, Danielle K; Deutsch, Aaron; Hofmann, Oliver; Ventura, Andrea; Hide, Winston; Lieberman, Judy
2011-11-01
A simple biochemical method to isolate mRNAs pulled down with a transfected, biotinylated microRNA was used to identify direct target genes of miR-34a, a tumor suppressor gene. The method reidentified most of the known miR-34a regulated genes expressed in K562 and HCT116 cancer cell lines. Transcripts for 982 genes were enriched in the pull-down with miR-34a in both cell lines. Despite this large number, validation experiments suggested that ~90% of the genes identified in both cell lines can be directly regulated by miR-34a. Thus miR-34a is capable of regulating hundreds of genes. The transcripts pulled down with miR-34a were highly enriched for their roles in growth factor signaling and cell cycle progression. These genes form a dense network of interacting gene products that regulate multiple signal transduction pathways that orchestrate the proliferative response to external growth stimuli. Multiple candidate miR-34a-regulated genes participate in RAS-RAF-MAPK signaling. Ectopic miR-34a expression reduced basal ERK and AKT phosphorylation and enhanced sensitivity to serum growth factor withdrawal, while cells genetically deficient in miR-34a were less sensitive. Fourteen new direct targets of miR-34a were experimentally validated, including genes that participate in growth factor signaling (ARAF and PIK3R2) as well as genes that regulate cell cycle progression at various phases of the cell cycle (cyclins D3 and G2, MCM2 and MCM5, PLK1 and SMAD4). Thus miR-34a tempers the proliferative and pro-survival effect of growth factor stimulation by interfering with growth factor signal transduction and downstream pathways required for cell division.
Lobel, Lior; Herskovits, Anat A.
2016-01-01
Bacteria sense and respond to many environmental cues, rewiring their regulatory network to facilitate adaptation to new conditions/niches. Global transcription factors that co-regulate multiple pathways simultaneously are essential to this regulatory rewiring. CodY is one such global regulator, controlling expression of both metabolic and virulence genes in Gram-positive bacteria. Branch chained amino acids (BCAAs) serve as a ligand for CodY and modulate its activity. Classically, CodY was considered to function primarily as a repressor under rich growth conditions. However, our previous studies of the bacterial pathogen Listeria monocytogenes revealed that CodY is active also when the bacteria are starved for BCAAs. Under these conditions, CodY loses the ability to repress genes (e.g., metabolic genes) and functions as a direct activator of the master virulence regulator gene, prfA. This observation raised the possibility that CodY possesses multiple functions that allow it to coordinate gene expression across a wide spectrum of metabolic growth conditions, and thus better adapt bacteria to the mammalian niche. To gain a deeper understanding of CodY’s regulatory repertoire and identify direct target genes, we performed a genome wide analysis of the CodY regulon and DNA binding under both rich and minimal growth conditions, using RNA-Seq and ChIP-Seq techniques. We demonstrate here that CodY is indeed active (i.e., binds DNA) under both conditions, serving as a repressor and activator of different genes. Further, we identified new genes and pathways that are directly regulated by CodY (e.g., sigB, arg, his, actA, glpF, gadG, gdhA, poxB, glnR and fla genes), integrating metabolism, stress responses, motility and virulence in L. monocytogenes. This study establishes CodY as a multifaceted factor regulating L. monocytogenes physiology in a highly versatile manner. PMID:26895237
McDonald, Jacqueline U.; Kaforou, Myrsini; Clare, Simon; Hale, Christine; Ivanova, Maria; Huntley, Derek; Dorner, Marcus; Wright, Victoria J.; Levin, Michael; Martinon-Torres, Federico; Herberg, Jethro A.
2016-01-01
ABSTRACT Greater understanding of the functions of host gene products in response to infection is required. While many of these genes enable pathogen clearance, some enhance pathogen growth or contribute to disease symptoms. Many studies have profiled transcriptomic and proteomic responses to infection, generating large data sets, but selecting targets for further study is challenging. Here we propose a novel data-mining approach combining multiple heterogeneous data sets to prioritize genes for further study by using respiratory syncytial virus (RSV) infection as a model pathogen with a significant health care impact. The assumption was that the more frequently a gene is detected across multiple studies, the more important its role is. A literature search was performed to find data sets of genes and proteins that change after RSV infection. The data sets were standardized, collated into a single database, and then panned to determine which genes occurred in multiple data sets, generating a candidate gene list. This candidate gene list was validated by using both a clinical cohort and in vitro screening. We identified several genes that were frequently expressed following RSV infection with no assigned function in RSV control, including IFI27, IFIT3, IFI44L, GBP1, OAS3, IFI44, and IRF7. Drilling down into the function of these genes, we demonstrate a role in disease for the gene for interferon regulatory factor 7, which was highly ranked on the list, but not for IRF1, which was not. Thus, we have developed and validated an approach for collating published data sets into a manageable list of candidates, identifying novel targets for future analysis. IMPORTANCE Making the most of “big data” is one of the core challenges of current biology. There is a large array of heterogeneous data sets of host gene responses to infection, but these data sets do not inform us about gene function and require specialized skill sets and training for their utilization. Here we describe an approach that combines and simplifies these data sets, distilling this information into a single list of genes commonly upregulated in response to infection with RSV as a model pathogen. Many of the genes on the list have unknown functions in RSV disease. We validated the gene list with new clinical, in vitro, and in vivo data. This approach allows the rapid selection of genes of interest for further, more-detailed studies, thus reducing time and costs. Furthermore, the approach is simple to use and widely applicable to a range of diseases. PMID:27822537
Recurrent R-spondin fusions in colon cancer.
Seshagiri, Somasekar; Stawiski, Eric W; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E; Conboy, Caitlin B; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J P; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A; Degenhardt, Jeremiah D; Haverty, Peter M; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K; Zhang, Zemin; Largaespada, David A; Wu, Thomas D; de Sauvage, Frederic J
2012-08-30
Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer.
Recurrent R-spondin fusions in colon cancer
Seshagiri, Somasekar; Stawiski, Eric W.; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E.; Conboy, Caitlin B.; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S.; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J. P.; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A.; Degenhardt, Jeremiah D.; Haverty, Peter M.; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K.; Zhang, Zemin; Largaespada, David A.; Wu, Thomas D.; de Sauvage, Frederic J
2013-01-01
Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics1. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer. PMID:22895193
Large-scale gene-centric meta-analysis across 32 studies identifies multiple lipid loci
USDA-ARS?s Scientific Manuscript database
Genome-wide association studies (GWASs) have identified many SNPs underlying variations in plasma-lipid levels. We explore whether additional loci associated with plasma-lipid phenotypes, such as high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholest...
Simultaneous Identification of Multiple Driver Pathways in Cancer
Leiserson, Mark D. M.; Blokh, Dima
2013-01-01
Distinguishing the somatic mutations responsible for cancer (driver mutations) from random, passenger mutations is a key challenge in cancer genomics. Driver mutations generally target cellular signaling and regulatory pathways consisting of multiple genes. This heterogeneity complicates the identification of driver mutations by their recurrence across samples, as different combinations of mutations in driver pathways are observed in different samples. We introduce the Multi-Dendrix algorithm for the simultaneous identification of multiple driver pathways de novo in somatic mutation data from a cohort of cancer samples. The algorithm relies on two combinatorial properties of mutations in a driver pathway: high coverage and mutual exclusivity. We derive an integer linear program that finds set of mutations exhibiting these properties. We apply Multi-Dendrix to somatic mutations from glioblastoma, breast cancer, and lung cancer samples. Multi-Dendrix identifies sets of mutations in genes that overlap with known pathways – including Rb, p53, PI(3)K, and cell cycle pathways – and also novel sets of mutually exclusive mutations, including mutations in several transcription factors or other genes involved in transcriptional regulation. These sets are discovered directly from mutation data with no prior knowledge of pathways or gene interactions. We show that Multi-Dendrix outperforms other algorithms for identifying combinations of mutations and is also orders of magnitude faster on genome-scale data. Software available at: http://compbio.cs.brown.edu/software. PMID:23717195
Keel, Brittney N; Zarek, Christina M; Keele, John W; Kuehn, Larry A; Snelling, Warren M; Oliver, William T; Freetly, Harvey C; Lindholm-Perry, Amanda K
2018-06-04
Feed intake and body weight gain are economically important inputs and outputs of beef production systems. The purpose of this study was to discover differentially expressed genes that will be robust for feed intake and gain across a large segment of the cattle industry. Transcriptomic studies often suffer from issues with reproducibility and cross-validation. One way to improve reproducibility is by integrating multiple datasets via meta-analysis. RNA sequencing (RNA-Seq) was performed on longissimus dorsi muscle from 80 steers (5 cohorts, each with 16 animals) selected from the outside fringe of a bivariate gain and feed intake distribution to understand the genes and pathways involved in feed efficiency. In each cohort, 16 steers were selected from one of four gain and feed intake phenotypes (n = 4 per phenotype) in a 2 × 2 factorial arrangement with gain and feed intake as main effect variables. Each cohort was analyzed as a single experiment using a generalized linear model and results from the 5 cohort analyses were combined in a meta-analysis to identify differentially expressed genes (DEG) across the cohorts. A total of 51 genes were differentially expressed for the main effect of gain, 109 genes for the intake main effect, and 11 genes for the gain x intake interaction (P corrected < 0.05). A jackknife sensitivity analysis showed that, in general, the meta-analysis produced robust DEGs for the two main effects and their interaction. Pathways identified from over-represented genes included mitochondrial energy production and oxidative stress pathways for the main effect of gain due to DEG including GPD1, NDUFA6, UQCRQ, ACTC1, and MGST3. For intake, metabolic pathways including amino acid biosynthesis and degradation were identified, and for the interaction analysis the pathways identified included GADD45, pyridoxal 5'phosphate salvage, and caveolar mediated endocytosis signaling. Variation among DEG identified by cohort suggests that environment and breed may play large roles in the expression of genes associated with feed efficiency in the muscle of beef cattle. Meta-analyses of transcriptome data from groups of animals over multiple cohorts may be necessary to elucidate the genetics contributing these types of biological phenotypes.
Shi, Xingjie; Zhao, Qing; Huang, Jian; Xie, Yang; Ma, Shuangge
2015-01-01
Motivation: Both gene expression levels (GEs) and copy number alterations (CNAs) have important biological implications. GEs are partly regulated by CNAs, and much effort has been devoted to understanding their relations. The regulation analysis is challenging with one gene expression possibly regulated by multiple CNAs and one CNA potentially regulating the expressions of multiple genes. The correlations among GEs and among CNAs make the analysis even more complicated. The existing methods have limitations and cannot comprehensively describe the regulation. Results: A sparse double Laplacian shrinkage method is developed. It jointly models the effects of multiple CNAs on multiple GEs. Penalization is adopted to achieve sparsity and identify the regulation relationships. Network adjacency is computed to describe the interconnections among GEs and among CNAs. Two Laplacian shrinkage penalties are imposed to accommodate the network adjacency measures. Simulation shows that the proposed method outperforms the competing alternatives with more accurate marker identification. The Cancer Genome Atlas data are analysed to further demonstrate advantages of the proposed method. Availability and implementation: R code is available at http://works.bepress.com/shuangge/49/ Contact: shuangge.ma@yale.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26342102
Evidence for the importance of personalized molecular profiling in pancreatic cancer.
Lili, Loukia N; Matyunina, Lilya V; Walker, L DeEtte; Daneker, George W; McDonald, John F
2014-03-01
There is a growing body of evidence that targeted gene therapy holds great promise for the future treatment of cancer. A crucial step in this therapy is the accurate identification of appropriate candidate genes/pathways for targeted treatment. One approach is to identify variant genes/pathways that are significantly enriched in groups of afflicted individuals relative to control subjects. However, if there are multiple molecular pathways to the same cancer, the molecular determinants of the disease may be heterogeneous among individuals and possibly go undetected by group analyses. In an effort to explore this question in pancreatic cancer, we compared the most significantly differentially expressed genes/pathways between cancer and control patient samples as determined by group versus personalized analyses. We found little to no overlap between genes/pathways identified by gene expression profiling using group analyses relative to those identified by personalized analyses. Our results indicate that personalized and not group molecular profiling is the most appropriate approach for the identification of putative candidates for targeted gene therapy of pancreatic and perhaps other cancers with heterogeneous molecular etiology.
USDA-ARS?s Scientific Manuscript database
Phytophthora capsici is responsible for multiple disease syndromes of Capsicum annuum but the resistance mechanism is still unknown. Evaluating gene expression during foliar blight can be used to identify expression patterns associated with resistance in Capsicum species. This study reports a direct...
USDA-ARS?s Scientific Manuscript database
Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by multiple ESTs derived only from the oocyte c...
Pseudomonas sax genes overcome aliphatic isothiocyanate-mediated non-host resistance in Arabidopsis
Jun Fan; Casey Crooks; Gary Creissen; Lionel Hill; Shirley Fairhurst; Peter Doerner; Chris Lamb
2011-01-01
Most plant-microbe interactions do not result in disease; natural products restrict non-host pathogens. We found that sulforaphane (4-methylsulfinylbutyl isothiocyanate), a natural product derived from aliphatic glucosinolates, inhibits growth in Arabidopsis of non-host Pseudomonas bacteria in planta. Multiple sax genes (saxCAB/F/D/G) were identified in Pseudomonas...
Kote-Jarai, Zsofia; Saunders, Edward J.; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Jugurnauth-Little, Sarah; Ross-Adams, Helen; Al Olama, Ali Amin; Benlloch, Sara; Halim, Silvia; Russel, Roslin; Dunning, Alison M.; Luccarini, Craig; Dennis, Joe; Neal, David E.; Hamdy, Freddie C.; Donovan, Jenny L.; Muir, Ken; Giles, Graham G.; Severi, Gianluca; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schumacher, Fredrick; Henderson, Brian E.; Le Marchand, Loic; Lindstrom, Sara; Kraft, Peter; Hunter, David J.; Gapstur, Susan; Chanock, Stephen; Berndt, Sonja I.; Albanes, Demetrius; Andriole, Gerald; Schleutker, Johanna; Weischer, Maren; Canzian, Federico; Riboli, Elio; Key, Tim J.; Travis, Ruth C.; Campa, Daniele; Ingles, Sue A.; John, Esther M.; Hayes, Richard B.; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Ostrander, Elaine A.; Signorello, Lisa B.; Thibodeau, Stephen N.; Schaid, Dan; Maier, Christiane; Vogel, Walther; Kibel, Adam S.; Cybulski, Cezary; Lubinski, Jan; Cannon-Albright, Lisa; Brenner, Hermann; Park, Jong Y.; Kaneva, Radka; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Dicks, Ed; Baynes, Caroline; Conroy, Don; Bojesen, Stig E.; Kaaks, Rudolf; Vincent, Daniel; Bacot, François; Tessier, Daniel C.; Easton, Douglas F.; Eeles, Rosalind A.
2013-01-01
Associations between single nucleotide polymorphisms (SNPs) at 5p15 and multiple cancer types have been reported. We have previously shown evidence for a strong association between prostate cancer (PrCa) risk and rs2242652 at 5p15, intronic in the telomerase reverse transcriptase (TERT) gene that encodes TERT. To comprehensively evaluate the association between genetic variation across this region and PrCa, we performed a fine-mapping analysis by genotyping 134 SNPs using a custom Illumina iSelect array or Sequenom MassArray iPlex, followed by imputation of 1094 SNPs in 22 301 PrCa cases and 22 320 controls in The PRACTICAL consortium. Multiple stepwise logistic regression analysis identified four signals in the promoter or intronic regions of TERT that independently associated with PrCa risk. Gene expression analysis of normal prostate tissue showed evidence that SNPs within one of these regions also associated with TERT expression, providing a potential mechanism for predisposition to disease. PMID:23535824
He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei
2016-01-01
WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions, indicating tandem duplicate WRKYs in the adaptive responses to environmental stimuli during the evolution process. Our results provide a framework for future studies regarding the function of WRKY genes in response to stress in B. napus. PMID:27322342
He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei
2016-01-01
WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions, indicating tandem duplicate WRKYs in the adaptive responses to environmental stimuli during the evolution process. Our results provide a framework for future studies regarding the function of WRKY genes in response to stress in B. napus.
Genetics and Genomics of Social Behavior in a Chicken Model.
Johnsson, Martin; Henriksen, Rie; Fogelholm, Jesper; Höglund, Andrey; Jensen, Per; Wright, Dominic
2018-05-01
The identification of genes affecting sociality can give insights into the maintenance and development of sociality and personality. In this study, we used the combination of an advanced intercross between wild and domestic chickens with a combined QTL and eQTL genetical genomics approach to identify genes for social reinstatement, a social and anxiety-related behavior. A total of 24 social reinstatement QTL were identified and overlaid with over 600 eQTL obtained from the same birds using hypothalamic tissue. Correlations between overlapping QTL and eQTL indicated five strong candidate genes, with the gene TTRAP being strongly significantly correlated with multiple aspects of social reinstatement behavior, as well as possessing a highly significant eQTL. Copyright © 2018 by the Genetics Society of America.
Analysis of bHLH coding genes using gene co-expression network approach.
Srivastava, Swati; Sanchita; Singh, Garima; Singh, Noopur; Srivastava, Gaurava; Sharma, Ashok
2016-07-01
Network analysis provides a powerful framework for the interpretation of data. It uses novel reference network-based metrices for module evolution. These could be used to identify module of highly connected genes showing variation in co-expression network. In this study, a co-expression network-based approach was used for analyzing the genes from microarray data. Our approach consists of a simple but robust rank-based network construction. The publicly available gene expression data of Solanum tuberosum under cold and heat stresses were considered to create and analyze a gene co-expression network. The analysis provide highly co-expressed module of bHLH coding genes based on correlation values. Our approach was to analyze the variation of genes expression, according to the time period of stress through co-expression network approach. As the result, the seed genes were identified showing multiple connections with other genes in the same cluster. Seed genes were found to be vary in different time periods of stress. These analyzed seed genes may be utilized further as marker genes for developing the stress tolerant plant species.
Evidence of IgY subclass diversification in snakes: evolutionary implications.
Wang, Tao; Sun, Yi; Shao, Wenwei; Cheng, Gang; Li, Lingxiao; Cao, Zubing; Yang, Zhi; Zou, Huiying; Zhang, Wei; Han, Binyue; Hu, Yang; Ren, Liming; Hu, Xiaoxiang; Guo, Ying; Fei, Jing; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-01
Mammalian IgG and IgE are thought to have evolved from IgY of nonmammalian tetrapods; however, no diversification of IgY subclasses has been reported in reptiles or birds, which are phylogenetically close to mammals. To our knowledge, we report the first evidence of the presence of multiple IgY-encoding (υ) genes in snakes. Two υ genes were identified in the snake Elaphe taeniura, and three υ genes were identified in the Burmese python (Python molurus bivittatus). Although four of the υ genes displayed a conventional four-H chain C region exon structure, one of the υ genes in the Burmese python lacked the H chain C region 2 exon, thus exhibiting a structure similar to that of the mammalian γ genes. We developed mouse mAbs specific for the IgY1 and IgY2 of E. taeniura and showed that both were expressed in serum; each had two isoforms: one full-length and one truncated at the C terminus. The truncation was not caused by alternative splicing or transcriptional termination. We also identified the μ and δ genes, but no α gene, in both snakes. This study provides valuable clues for our understanding of Ig gene evolution in tetrapods.
Hendrickx, Debbie A. E.; van Scheppingen, Jackelien; van der Poel, Marlijn; Bossers, Koen; Schuurman, Karianne G.; van Eden, Corbert G.; Hol, Elly M.; Hamann, Jörg; Huitinga, Inge
2017-01-01
In multiple sclerosis (MS), activated microglia and infiltrating macrophages phagocytose myelin focally in (chronic) active lesions. These demyelinating sites expand in time, but at some point turn inactive into a sclerotic scar. To identify molecular mechanisms underlying lesion activity and halt, we analyzed genome-wide gene expression in rim and peri-lesional regions of chronic active and inactive MS lesions, as well as in control tissue. Gene clustering revealed patterns of gene expression specifically associated with MS and with the presumed, subsequent stages of lesion development. Next to genes involved in immune functions, we found regulation of novel genes in and around the rim of chronic active lesions, such as NPY, KANK4, NCAN, TKTL1, and ANO4. Of note, the presence of many foamy macrophages in active rims was accompanied by a congruent upregulation of genes related to lipid binding, such as MSR1, CD68, CXCL16, and OLR1, and lipid uptake, such as CHIT1, GPNMB, and CCL18. Except CCL18, these genes were already upregulated in regions around active MS lesions, showing that such lesions are indeed expanding. In vitro downregulation of the scavenger receptors MSR1 and CXCL16 reduced myelin uptake. In conclusion, this study provides the gene expression profile of different aspects of MS pathology and indicates that early demyelination, mediated by scavenger receptors, is already present in regions around active MS lesions. Genes involved in early demyelination events in regions surrounding chronic active MS lesions might be promising therapeutic targets to stop lesion expansion. PMID:29312322
Hendrickx, Debbie A E; van Scheppingen, Jackelien; van der Poel, Marlijn; Bossers, Koen; Schuurman, Karianne G; van Eden, Corbert G; Hol, Elly M; Hamann, Jörg; Huitinga, Inge
2017-01-01
In multiple sclerosis (MS), activated microglia and infiltrating macrophages phagocytose myelin focally in (chronic) active lesions. These demyelinating sites expand in time, but at some point turn inactive into a sclerotic scar. To identify molecular mechanisms underlying lesion activity and halt, we analyzed genome-wide gene expression in rim and peri-lesional regions of chronic active and inactive MS lesions, as well as in control tissue. Gene clustering revealed patterns of gene expression specifically associated with MS and with the presumed, subsequent stages of lesion development. Next to genes involved in immune functions, we found regulation of novel genes in and around the rim of chronic active lesions, such as NPY, KANK4, NCAN, TKTL1 , and ANO4 . Of note, the presence of many foamy macrophages in active rims was accompanied by a congruent upregulation of genes related to lipid binding, such as MSR1, CD68, CXCL16 , and OLR1 , and lipid uptake, such as CHIT1, GPNMB , and CCL18 . Except CCL18 , these genes were already upregulated in regions around active MS lesions, showing that such lesions are indeed expanding. In vitro downregulation of the scavenger receptors MSR1 and CXCL16 reduced myelin uptake. In conclusion, this study provides the gene expression profile of different aspects of MS pathology and indicates that early demyelination, mediated by scavenger receptors, is already present in regions around active MS lesions. Genes involved in early demyelination events in regions surrounding chronic active MS lesions might be promising therapeutic targets to stop lesion expansion.
Brito, Jose L.R.; Walker, Brian; Jenner, Matthew; Dickens, Nicholas J.; Brown, Nicola J.M.; Ross, Fiona M.; Avramidou, Athanasia; Irving, Julie A.E.; Gonzalez, David; Davies, Faith E.; Morgan, Gareth J.
2009-01-01
Background The recurrent immunoglobulin translocation, t(4;14)(p16;q32) occurs in 15% of multiple myeloma patients and is associated with poor prognosis, through an unknown mechanism. The t(4;14) up-regulates fibroblast growth factor receptor 3 (FGFR3) and multiple myeloma SET domain (MMSET) genes. The involvement of MMSET in the pathogenesis of t(4;14) multiple myeloma and the mechanism or genes deregulated by MMSET upregulation are still unclear. Design and Methods The expression of MMSET was analyzed using a novel antibody. The involvement of MMSET in t(4;14) myelomagenesis was assessed by small interfering RNA mediated knockdown combined with several biological assays. In addition, the differential gene expression of MMSET-induced knockdown was analyzed with expression microarrays. MMSET gene targets in primary patient material was analyzed by expression microarrays. Results We found that MMSET isoforms are expressed in multiple myeloma cell lines, being exclusively up-regulated in t(4;14)-positive cells. Suppression of MMSET expression affected cell proliferation by both decreasing cell viability and cell cycle progression of cells with the t(4;14) translocation. These findings were associated with reduced expression of genes involved in the regulation of cell cycle progression (e.g. CCND2, CCNG1, BRCA1, AURKA and CHEK1), apoptosis (CASP1, CASP4 and FOXO3A) and cell adhesion (ADAM9 and DSG2). Furthermore, we identified genes involved in the latter processes that were differentially expressed in t(4;14) multiple myeloma patient samples. Conclusions In conclusion, dysregulation of MMSET affects the expression of several genes involved in the regulation of cell cycle progression, cell adhesion and survival. PMID:19059936
Wang, Rong-Kai; Zhang, Rui-Fen; Hao, Yu-Jin
2013-01-01
The MYB proteins comprise one of the largest families of transcription factors (TFs) in plants. Although several MYB genes have been characterized to play roles in secondary metabolism, the MYB family has not yet been identified in apple. In this study, 229 apple MYB genes were identified through a genome-wide analysis and divided into 45 subgroups. A computational analysis was conducted using the apple genomic database to yield a complete overview of the MYB family, including the intron-exon organizations, the sequence features of the MYB DNA-binding domains, the carboxy-terminal motifs, and the chromosomal locations. Subsequently, the expression of 18 MYB genes, including 12 were chosen from stress-related subgroups, while another 6 ones from other subgroups, in response to various abiotic stresses was examined. It was found that several of these MYB genes, particularly MdoMYB121, were induced by multiple stresses. The MdoMYB121 was then further functionally characterized. Its predicted protein was found to be localized in the nucleus. A transgenic analysis indicated that the overexpression of the MdoMYB121 gene remarkably enhanced the tolerance to high salinity, drought, and cold stresses in transgenic tomato and apple plants. Our results indicate that the MYB genes are highly conserved in plant species and that MdoMYB121 can be used as a target gene in genetic engineering approaches to improve the tolerance of plants to multiple abiotic stresses. PMID:23950843
Curtis, Ross E; Kim, Seyoung; Woolford, John L; Xu, Wenjie; Xing, Eric P
2013-03-21
Association analysis using genome-wide expression quantitative trait locus (eQTL) data investigates the effect that genetic variation has on cellular pathways and leads to the discovery of candidate regulators. Traditional analysis of eQTL data via pairwise statistical significance tests or linear regression does not leverage the availability of the structural information of the transcriptome, such as presence of gene networks that reveal correlation and potentially regulatory relationships among the study genes. We employ a new eQTL mapping algorithm, GFlasso, which we have previously developed for sparse structured regression, to reanalyze a genome-wide yeast dataset. GFlasso fully takes into account the dependencies among expression traits to suppress false positives and to enhance the signal/noise ratio. Thus, GFlasso leverages the gene-interaction network to discover the pleiotropic effects of genetic loci that perturb the expression level of multiple (rather than individual) genes, which enables us to gain more power in detecting previously neglected signals that are marginally weak but pleiotropically significant. While eQTL hotspots in yeast have been reported previously as genomic regions controlling multiple genes, our analysis reveals additional novel eQTL hotspots and, more interestingly, uncovers groups of multiple contributing eQTL hotspots that affect the expression level of functional gene modules. To our knowledge, our study is the first to report this type of gene regulation stemming from multiple eQTL hotspots. Additionally, we report the results from in-depth bioinformatics analysis for three groups of these eQTL hotspots: ribosome biogenesis, telomere silencing, and retrotransposon biology. We suggest candidate regulators for the functional gene modules that map to each group of hotspots. Not only do we find that many of these candidate regulators contain mutations in the promoter and coding regions of the genes, in the case of the Ribi group, we provide experimental evidence suggesting that the identified candidates do regulate the target genes predicted by GFlasso. Thus, this structured association analysis of a yeast eQTL dataset via GFlasso, coupled with extensive bioinformatics analysis, discovers a novel regulation pattern between multiple eQTL hotspots and functional gene modules. Furthermore, this analysis demonstrates the potential of GFlasso as a powerful computational tool for eQTL studies that exploit the rich structural information among expression traits due to correlation, regulation, or other forms of biological dependencies.
Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai
2009-02-22
The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.
Multi-variant study of obesity risk genes in African Americans: The Jackson Heart Study.
Liu, Shijian; Wilson, James G; Jiang, Fan; Griswold, Michael; Correa, Adolfo; Mei, Hao
2016-11-30
Genome-wide association study (GWAS) has been successful in identifying obesity risk genes by single-variant association analysis. For this study, we designed steps of analysis strategy and aimed to identify multi-variant effects on obesity risk among candidate genes. Our analyses were focused on 2137 African American participants with body mass index measured in the Jackson Heart Study and 657 common single nucleotide polymorphisms (SNPs) genotyped at 8 GWAS-identified obesity risk genes. Single-variant association test showed that no SNPs reached significance after multiple testing adjustment. The following gene-gene interaction analysis, which was focused on SNPs with unadjusted p-value<0.10, identified 6 significant multi-variant associations. Logistic regression showed that SNPs in these associations did not have significant linear interactions; examination of genetic risk score evidenced that 4 multi-variant associations had significant additive effects of risk SNPs; and haplotype association test presented that all multi-variant associations contained one or several combinations of particular alleles or haplotypes, associated with increased obesity risk. Our study evidenced that obesity risk genes generated multi-variant effects, which can be additive or non-linear interactions, and multi-variant study is an important supplement to existing GWAS for understanding genetic effects of obesity risk genes. Copyright © 2016 Elsevier B.V. All rights reserved.
Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong
2018-03-01
Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.
Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong
2016-10-01
Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.
Mapping cis- and trans-regulatory effects across multiple tissues in twins
Grundberg, Elin; Small, Kerrin S.; Hedman, Åsa K.; Nica, Alexandra C.; Buil, Alfonso; Keildson, Sarah; Bell, Jordana T.; Yang, Tsun-Po; Meduri, Eshwar; Barrett, Amy; Nisbett, James; Sekowska, Magdalena; Wilk, Alicja; Shin, So-Youn; Glass, Daniel; Travers, Mary; Min, Josine L.; Ring, Sue; Ho, Karen; Thorleifsson, Gudmar; Kong, Augustine; Thorsteindottir, Unnur; Ainali, Chrysanthi; Dimas, Antigone S.; Hassanali, Neelam; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lowe, Christopher E.; Di Meglio, Paola; Montgomery, Stephen B.; Parts, Leopold; Potter, Simon; Surdulescu, Gabriela; Tsaprouni, Loukia; Tsoka, Sophia; Bataille, Veronique; Durbin, Richard; Nestle, Frank O.; O’Rahilly, Stephen; Soranzo, Nicole; Lindgren, Cecilia M.; Zondervan, Krina T.; Ahmadi, Kourosh R.; Schadt, Eric E.; Stefansson, Kari; Smith, George Davey; McCarthy, Mark I.; Deloukas, Panos; Dermitzakis, Emmanouil T.; Spector, Tim D.
2013-01-01
Sequence-based variation in gene expression is a key driver of disease risk. Common variants regulating expression in cis have been mapped in many eQTL studies typically in single tissues from unrelated individuals. Here, we present a comprehensive analysis of gene expression across multiple tissues conducted in a large set of mono- and dizygotic twins that allows systematic dissection of genetic (cis and trans) and non-genetic effects on gene expression. Using identity-by-descent estimates, we show that at least 40% of the total heritable cis-effect on expression cannot be accounted for by common cis-variants, a finding which exposes the contribution of low frequency and rare regulatory variants with respect to both transcriptional regulation and complex trait susceptibility. We show that a substantial proportion of gene expression heritability is trans to the structural gene and identify several replicating trans-variants which act predominantly in a tissue-restricted manner and may regulate the transcription of many genes. PMID:22941192
Lee, Sanghyeob; Choi, Doil
2013-09-01
Global transcriptome analysis revealed common regulons for biotic/abiotic stresses, and some of these regulons encoding signaling components in both stresses were newly identified in this study. In this study, we aimed to identify plant responses to multiple stress conditions and discover the common regulons activated under a variety of stress conditions. Global transcriptome analysis revealed that salicylic acid (SA) may affect the activation of abiotic stress-responsive genes in pepper. Our data indicate that methyl jasmonate (MeJA) and ethylene (ET)-responsive genes were primarily activated by biotic stress, while abscisic acid (ABA)-responsive genes were activated under both types of stresses. We also identified differentially expressed gene (DEG) responses to specific stress conditions. Biotic stress induces more DEGs than those induced by abiotic and hormone applications. The clustering analysis using DEGs indicates that there are common regulons for biotic or abiotic stress conditions. Although SA and MeJA have an antagonistic effect on gene expression levels, SA and MeJA show a largely common regulation as compared to the regulation at the DEG expression level induced by other hormones. We also monitored the expression profiles of DEG encoding signaling components. Twenty-two percent of these were commonly expressed in both stress conditions. The importance of this study is that several genes commonly regulated by both stress conditions may have future applications for creating broadly stress-tolerant pepper plants. This study revealed that there are complex regulons in pepper plant to both biotic and abiotic stress conditions.
Meta-analysis identifies gene-by-environment interactions as demonstrated in a study of 4,965 mice.
Kang, Eun Yong; Han, Buhm; Furlotte, Nicholas; Joo, Jong Wha J; Shih, Diana; Davis, Richard C; Lusis, Aldons J; Eskin, Eleazar
2014-01-01
Identifying environmentally-specific genetic effects is a key challenge in understanding the structure of complex traits. Model organisms play a crucial role in the identification of such gene-by-environment interactions, as a result of the unique ability to observe genetically similar individuals across multiple distinct environments. Many model organism studies examine the same traits but under varying environmental conditions. For example, knock-out or diet-controlled studies are often used to examine cholesterol in mice. These studies, when examined in aggregate, provide an opportunity to identify genomic loci exhibiting environmentally-dependent effects. However, the straightforward application of traditional methodologies to aggregate separate studies suffers from several problems. First, environmental conditions are often variable and do not fit the standard univariate model for interactions. Additionally, applying a multivariate model results in increased degrees of freedom and low statistical power. In this paper, we jointly analyze multiple studies with varying environmental conditions using a meta-analytic approach based on a random effects model to identify loci involved in gene-by-environment interactions. Our approach is motivated by the observation that methods for discovering gene-by-environment interactions are closely related to random effects models for meta-analysis. We show that interactions can be interpreted as heterogeneity and can be detected without utilizing the traditional uni- or multi-variate approaches for discovery of gene-by-environment interactions. We apply our new method to combine 17 mouse studies containing in aggregate 4,965 distinct animals. We identify 26 significant loci involved in High-density lipoprotein (HDL) cholesterol, many of which are consistent with previous findings. Several of these loci show significant evidence of involvement in gene-by-environment interactions. An additional advantage of our meta-analysis approach is that our combined study has significantly higher power and improved resolution compared to any single study thus explaining the large number of loci discovered in the combined study.
Meta-Analysis Identifies Gene-by-Environment Interactions as Demonstrated in a Study of 4,965 Mice
Joo, Jong Wha J.; Shih, Diana; Davis, Richard C.; Lusis, Aldons J.; Eskin, Eleazar
2014-01-01
Identifying environmentally-specific genetic effects is a key challenge in understanding the structure of complex traits. Model organisms play a crucial role in the identification of such gene-by-environment interactions, as a result of the unique ability to observe genetically similar individuals across multiple distinct environments. Many model organism studies examine the same traits but under varying environmental conditions. For example, knock-out or diet-controlled studies are often used to examine cholesterol in mice. These studies, when examined in aggregate, provide an opportunity to identify genomic loci exhibiting environmentally-dependent effects. However, the straightforward application of traditional methodologies to aggregate separate studies suffers from several problems. First, environmental conditions are often variable and do not fit the standard univariate model for interactions. Additionally, applying a multivariate model results in increased degrees of freedom and low statistical power. In this paper, we jointly analyze multiple studies with varying environmental conditions using a meta-analytic approach based on a random effects model to identify loci involved in gene-by-environment interactions. Our approach is motivated by the observation that methods for discovering gene-by-environment interactions are closely related to random effects models for meta-analysis. We show that interactions can be interpreted as heterogeneity and can be detected without utilizing the traditional uni- or multi-variate approaches for discovery of gene-by-environment interactions. We apply our new method to combine 17 mouse studies containing in aggregate 4,965 distinct animals. We identify 26 significant loci involved in High-density lipoprotein (HDL) cholesterol, many of which are consistent with previous findings. Several of these loci show significant evidence of involvement in gene-by-environment interactions. An additional advantage of our meta-analysis approach is that our combined study has significantly higher power and improved resolution compared to any single study thus explaining the large number of loci discovered in the combined study. PMID:24415945
Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Gonzalo, Victoria; Lozano, Juan José; Muñoz, Jenifer; Balaguer, Francesc; Pellisé, Maria; Rodríguez de Miguel, Cristina; Andreu, Montserrat; Jover, Rodrigo; Llor, Xavier; Giráldez, M Dolores; Ocaña, Teresa; Serradesanferm, Anna; Alonso-Espinaco, Virginia; Jimeno, Mireya; Cuatrecasas, Miriam; Sendino, Oriol; Castellví-Bel, Sergi; Castells, Antoni
2010-01-19
Colorectal cancer (CRC) multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals) and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2), RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008) and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047) as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006). Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17), SFRP1 (r = 0.83, 0.06), HPP1 (r = 0.64, p = 0.17), 3OST2 (r = 0.83, p = 0.06) and GATA4 (r = 0.6, p = 0.24). Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant difference in any evaluated gene. These results provide a proof-of-concept that gene promoter methylation is associated with tumor multiplicity. This underlying epigenetic defect may have noteworthy implications in the prevention of patients with sporadic CRC.
Larson, Nicholas B; McDonnell, Shannon K; Fogarty, Zach; Larson, Melissa C; Cheville, John; Riska, Shaun; Baheti, Saurabh; Weber, Alexandra M; Nair, Asha A; Wang, Liang; O'Brien, Daniel; Davila, Jaime; Schaid, Daniel J; Thibodeau, Stephen N
2017-10-17
Large-scale genome-wide association studies have identified multiple single-nucleotide polymorphisms associated with risk of prostate cancer. Many of these genetic variants are presumed to be regulatory in nature; however, follow-up expression quantitative trait loci (eQTL) association studies have to-date been restricted largely to cis -acting associations due to study limitations. While trans -eQTL scans suffer from high testing dimensionality, recent evidence indicates most trans -eQTL associations are mediated by cis -regulated genes, such as transcription factors. Leveraging a data-driven gene co-expression network, we conducted a comprehensive cis -mediator analysis using RNA-Seq data from 471 normal prostate tissue samples to identify downstream regulatory associations of previously identified prostate cancer risk variants. We discovered multiple trans -eQTL associations that were significantly mediated by cis -regulated transcripts, four of which involved risk locus 17q12, proximal transcription factor HNF1B , and target trans -genes with known HNF response elements ( MIA2 , SRC , SEMA6A , KIF12 ). We additionally identified evidence of cis -acting down-regulation of MSMB via rs10993994 corresponding to reduced co-expression of NDRG1 . The majority of these cis -mediator relationships demonstrated trans -eQTL replicability in 87 prostate tissue samples from the Gene-Tissue Expression Project. These findings provide further biological context to known risk loci and outline new hypotheses for investigation into the etiology of prostate cancer.
NASA Astrophysics Data System (ADS)
Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.
2018-03-01
Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.
Molecular defects identified by whole exome sequencing in a child with Fanconi anemia.
Zheng, Zhaojing; Geng, Juan; Yao, Ru-En; Li, Caihua; Ying, Daming; Shen, Yongnian; Ying, Lei; Yu, Yongguo; Fu, Qihua
2013-11-10
Fanconi anemia is a rare genetic disease characterized by bone marrow failure, multiple congenital malformations, and an increased susceptibility to malignancy. At least 15 genes have been identified that are involved in the pathogenesis of Fanconi anemia. However, it is still a challenge to assign the complementation group and to characterize the molecular defects in patients with Fanconi anemia. In the current study, whole exome sequencing was used to identify the affected gene(s) in a boy with Fanconi anemia. A recurring, non-synonymous mutation was found (c.3971C>T, p.P1324L) as well as a novel frameshift mutation (c.989_995del, p.H330LfsX2) in FANCA gene. Our results indicate that whole exome sequencing may be useful in clinical settings for rapid identification of disease-causing mutations in rare genetic disorders such as Fanconi anemia. © 2013 Elsevier B.V. All rights reserved.
Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.
Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung
2009-12-15
The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.
Kneidinger, Doris; Ibrišimović, Mirza; Lion, Thomas; Klein, Reinhard
2012-06-01
Human adenoviruses are a common threat to immunocompromised patients, e.g., HIV-positive individuals or solid-organ and, in particular, allogeneic stem cell transplant recipients. Antiviral drugs have a limited effect on adenoviruses, and existing treatment modalities often fail to prevent fatal outcome. Silencing of viral genes by short interfering RNAs (siRNAs) holds a great promise in the treatment of viral infections. The aim of the present study was to identify adenoviral candidate targets for RNA interference-mediated inhibition of adenoviral replication. We investigated the impact of silencing of a set of early, middle, and late viral genes on the replication of adenovirus 5 in vitro. Adenovirus replication was inhibited by siRNAs directed against the adenoviral E1A, DNA polymerase, preterminal protein (pTP), IVa2, hexon, and protease genes. Silencing of early and middle genes was more effective in inhibiting adenovirus multiplication than was silencing of late genes. A siRNA directed against the viral DNA polymerase mRNA decreased viral genome copy numbers and infectious virus progeny by several orders of magnitude. Since silencing of any of the early genes directly or indirectly affected viral DNA synthesis, our data suggest that reducing viral genome copy numbers is a more promising strategy for the treatment of adenoviral infections than is reducing the numbers of proteins necessary for capsid generation. Thus, adenoviral DNA replication was identified as a key target for RNAi-mediated inhibition of adenovirus multiplication. In addition, the E1A transcripts emerged as a second important target, because its knockdown markedly improved the viability of cells at late stages of infection. Copyright © 2012 Elsevier B.V. All rights reserved.
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Integrative radiogenomic analysis for multicentric radiophenotype in glioblastoma
Kong, Doo-Sik; Kim, Jinkuk; Lee, In-Hee; Kim, Sung Tae; Seol, Ho Jun; Lee, Jung-Il; Park, Woong-Yang; Ryu, Gyuha; Wang, Zichen; Ma'ayan, Avi; Nam, Do-Hyun
2016-01-01
We postulated that multicentric glioblastoma (GBM) represents more invasiveness form than solitary GBM and has their own genomic characteristics. From May 2004 to June 2010 we retrospectively identified 51 treatment-naïve GBM patients with available clinical information from the Samsung Medical Center data registry. Multicentricity of the tumor was defined as the presence of multiple foci on the T1 contrast enhancement of MR images or having high signal for multiple lesions without contiguity of each other on the FLAIR image. Kaplan-Meier survival analysis demonstrated that multicentric GBM had worse prognosis than solitary GBM (median, 16.03 vs. 20.57 months, p < 0.05). Copy number variation (CNV) analysis revealed there was an increase in 11 regions, and a decrease in 17 regions, in the multicentric GBM. Gene expression profiling identified 738 genes to be increased and 623 genes to be decreased in the multicentric radiophenotype (p < 0.001). Integration of the CNV and expression datasets identified twelve representative genes: CPM, LANCL2, LAMP1, GAS6, DCUN1D2, CDK4, AGAP2, TSPAN33, PDLIM1, CLDN12, and GTPBP10 having high correlation across CNV, gene expression and patient outcome. Network and enrichment analyses showed that the multicentric tumor had elevated fibrotic signaling pathways compared with a more proliferative and mitogenic signal in the solitary tumors. Noninvasive radiological imaging together with integrative radiogenomic analysis can provide an important tool in helping to advance personalized therapy for the more clinically aggressive subset of GBM. PMID:26863628
Abu-Jamous, Basel; Fa, Rui; Roberts, David J; Nandi, Asoke K
2015-06-04
Collective analysis of the increasingly emerging gene expression datasets are required. The recently proposed binarisation of consensus partition matrices (Bi-CoPaM) method can combine clustering results from multiple datasets to identify the subsets of genes which are consistently co-expressed in all of the provided datasets in a tuneable manner. However, results validation and parameter setting are issues that complicate the design of such methods. Moreover, although it is a common practice to test methods by application to synthetic datasets, the mathematical models used to synthesise such datasets are usually based on approximations which may not always be sufficiently representative of real datasets. Here, we propose an unsupervised method for the unification of clustering results from multiple datasets using external specifications (UNCLES). This method has the ability to identify the subsets of genes consistently co-expressed in a subset of datasets while being poorly co-expressed in another subset of datasets, and to identify the subsets of genes consistently co-expressed in all given datasets. We also propose the M-N scatter plots validation technique and adopt it to set the parameters of UNCLES, such as the number of clusters, automatically. Additionally, we propose an approach for the synthesis of gene expression datasets using real data profiles in a way which combines the ground-truth-knowledge of synthetic data and the realistic expression values of real data, and therefore overcomes the problem of faithfulness of synthetic expression data modelling. By application to those datasets, we validate UNCLES while comparing it with other conventional clustering methods, and of particular relevance, biclustering methods. We further validate UNCLES by application to a set of 14 real genome-wide yeast datasets as it produces focused clusters that conform well to known biological facts. Furthermore, in-silico-based hypotheses regarding the function of a few previously unknown genes in those focused clusters are drawn. The UNCLES method, the M-N scatter plots technique, and the expression data synthesis approach will have wide application for the comprehensive analysis of genomic and other sources of multiple complex biological datasets. Moreover, the derived in-silico-based biological hypotheses represent subjects for future functional studies.
Tong, Pin; Monahan, Jack; Prendergast, James G D
2017-03-01
Large-scale gene expression datasets are providing an increasing understanding of the location of cis-eQTLs in the human genome and their role in disease. However, little is currently known regarding the extent of regulatory site-sharing between genes. This is despite it having potentially wide-ranging implications, from the determination of the way in which genetic variants may shape multiple phenotypes to the understanding of the evolution of human gene order. By first identifying the location of non-redundant cis-eQTLs, we show that regulatory site-sharing is a relatively common phenomenon in the human genome, with over 10% of non-redundant regulatory variants linked to the expression of multiple nearby genes. We show that these shared, local regulatory sites are linked to high levels of chromatin looping between the regulatory sites and their associated genes. In addition, these co-regulated gene modules are found to be strongly conserved across mammalian species, suggesting that shared regulatory sites have played an important role in shaping human gene order. The association of these shared cis-eQTLs with multiple genes means they also appear to be unusually important in understanding the genetics of human phenotypes and pleiotropy, with shared regulatory sites more often linked to multiple human phenotypes than other regulatory variants. This study shows that regulatory site-sharing is likely an underappreciated aspect of gene regulation and has important implications for the understanding of various biological phenomena, including how the two and three dimensional structures of the genome have been shaped and the potential causes of disease pleiotropy outside coding regions.
Blatti, Charles; Sinha, Saurabh
2016-07-15
Analysis of co-expressed gene sets typically involves testing for enrichment of different annotations or 'properties' such as biological processes, pathways, transcription factor binding sites, etc., one property at a time. This common approach ignores any known relationships among the properties or the genes themselves. It is believed that known biological relationships among genes and their many properties may be exploited to more accurately reveal commonalities of a gene set. Previous work has sought to achieve this by building biological networks that combine multiple types of gene-gene or gene-property relationships, and performing network analysis to identify other genes and properties most relevant to a given gene set. Most existing network-based approaches for recognizing genes or annotations relevant to a given gene set collapse information about different properties to simplify (homogenize) the networks. We present a network-based method for ranking genes or properties related to a given gene set. Such related genes or properties are identified from among the nodes of a large, heterogeneous network of biological information. Our method involves a random walk with restarts, performed on an initial network with multiple node and edge types that preserve more of the original, specific property information than current methods that operate on homogeneous networks. In this first stage of our algorithm, we find the properties that are the most relevant to the given gene set and extract a subnetwork of the original network, comprising only these relevant properties. We then re-rank genes by their similarity to the given gene set, based on a second random walk with restarts, performed on the above subnetwork. We demonstrate the effectiveness of this algorithm for ranking genes related to Drosophila embryonic development and aggressive responses in the brains of social animals. DRaWR was implemented as an R package available at veda.cs.illinois.edu/DRaWR. blatti@illinois.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Feronjy, Robert; Spira, Avrum; Schadt, Eric E.; Powell, Charles A.; Zhu, Jun
2015-01-01
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a ‘causal’ role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology. PMID:25569234
A new fast method for inferring multiple consensus trees using k-medoids.
Tahiri, Nadia; Willems, Matthieu; Makarenkov, Vladimir
2018-04-05
Gene trees carry important information about specific evolutionary patterns which characterize the evolution of the corresponding gene families. However, a reliable species consensus tree cannot be inferred from a multiple sequence alignment of a single gene family or from the concatenation of alignments corresponding to gene families having different evolutionary histories. These evolutionary histories can be quite different due to horizontal transfer events or to ancient gene duplications which cause the emergence of paralogs within a genome. Many methods have been proposed to infer a single consensus tree from a collection of gene trees. Still, the application of these tree merging methods can lead to the loss of specific evolutionary patterns which characterize some gene families or some groups of gene families. Thus, the problem of inferring multiple consensus trees from a given set of gene trees becomes relevant. We describe a new fast method for inferring multiple consensus trees from a given set of phylogenetic trees (i.e. additive trees or X-trees) defined on the same set of species (i.e. objects or taxa). The traditional consensus approach yields a single consensus tree. We use the popular k-medoids partitioning algorithm to divide a given set of trees into several clusters of trees. We propose novel versions of the well-known Silhouette and Caliński-Harabasz cluster validity indices that are adapted for tree clustering with k-medoids. The efficiency of the new method was assessed using both synthetic and real data, such as a well-known phylogenetic dataset consisting of 47 gene trees inferred for 14 archaeal organisms. The method described here allows inference of multiple consensus trees from a given set of gene trees. It can be used to identify groups of gene trees having similar intragroup and different intergroup evolutionary histories. The main advantage of our method is that it is much faster than the existing tree clustering approaches, while providing similar or better clustering results in most cases. This makes it particularly well suited for the analysis of large genomic and phylogenetic datasets.
Liu, Miaomiao; Zhu, Jinhang; Wu, Shengbing; Wang, Chenkai; Guo, Xingyi; Wu, Jiawen; Zhou, Meiqi
2018-04-11
Artemisia argyi Lev. et Vant. (A. argyi) is widely utilized for moxibustion in Chinese medicine, and the mechanism underlying terpenoid biosynthesis in its leaves is suggested to play an important role in its medicinal use. However, the A. argyi transcriptome has not been sequenced. Herein, we performed RNA sequencing for A. argyi leaf, root and stem tissues to identify as many as possible of the transcribed genes. In total, 99,807 unigenes were assembled by analysing the expression profiles generated from the three tissue types, and 67,446 of those unigenes were annotated in public databases. We further performed differential gene expression analysis to compare leaf tissue with the other two tissue types and identified numerous genes that were specifically expressed or up-regulated in leaf tissue. Specifically, we identified multiple genes encoding significant enzymes or transcription factors related to terpenoid synthesis. This study serves as a valuable resource for transcriptome information, as many transcribed genes related to terpenoid biosynthesis were identified in the A. argyi transcriptome, providing a functional genomic basis for additional studies on molecular mechanisms underlying the medicinal use of A. argyi.
Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma | Office of Cancer Genomics
In a recent Nature article, Morin et al. uncovered a novel role for chromatin modification in driving the progression of two non-Hodgkin lymphomas (NHLs), follicular lymphoma and diffuse large B-cell lymphoma. Through DNA and RNA sequencing of 117 tumor samples and 10 assorted cell lines, the authors identified and validated 109 genes with multiple mutations in these B-cell NHLs. Of the 109 genes, several genes not previously linked to lymphoma demonstrated positive selection for mutation including two genes involved in histone modification, MLL2 and MEF2B.
Karanja, Bernard Kinuthia; Fan, Lianxue; Xu, Liang; Wang, Yan; Zhu, Xianwen; Tang, Mingjia; Wang, Ronghua; Zhang, Fei; Muleke, Everlyne M'mbone; Liu, Liwang
2017-11-01
The radish WRKY gene family was genome-widely identified and played critical roles in response to multiple abiotic stresses. The WRKY is among the largest transcription factors (TFs) associated with multiple biological activities for plant survival, including control response mechanisms against abiotic stresses such as heat, salinity, and heavy metals. Radish is an important root vegetable crop and therefore characterization and expression pattern investigation of WRKY transcription factors in radish is imperative. In the present study, 126 putative WRKY genes were retrieved from radish genome database. Protein sequence and annotation scrutiny confirmed that RsWRKY proteins possessed highly conserved domains and zinc finger motif. Based on phylogenetic analysis results, RsWRKYs candidate genes were divided into three groups (Group I, II and III) with the number 31, 74, and 20, respectively. Additionally, gene structure analysis revealed that intron-exon patterns of the WRKY genes are highly conserved in radish. Linkage map analysis indicated that RsWRKY genes were distributed with varying densities over nine linkage groups. Further, RT-qPCR analysis illustrated the significant variation of 36 RsWRKY genes under one or more abiotic stress treatments, implicating that they might be stress-responsive genes. In total, 126 WRKY TFs were identified from the R. sativus genome wherein, 35 of them showed abiotic stress-induced expression patterns. These results provide a genome-wide characterization of RsWRKY TFs and baseline for further functional dissection and molecular evolution investigation, specifically for improving abiotic stress resistances with an ultimate goal of increasing yield and quality of radish.
Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S.
2016-01-01
Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites. PMID:27588023
Pathania, Shivalika; Bagler, Ganesh; Ahuja, Paramvir S
2016-01-01
Comparative co-expression analysis of multiple species using high-throughput data is an integrative approach to determine the uniformity as well as diversification in biological processes. Rauvolfia serpentina and Catharanthus roseus, both members of Apocyanacae family, are reported to have remedial properties against multiple diseases. Despite of sharing upstream of terpenoid indole alkaloid pathway, there is significant diversity in tissue-specific synthesis and accumulation of specialized metabolites in these plants. This led us to implement comparative co-expression network analysis to investigate the modules and genes responsible for differential tissue-specific expression as well as species-specific synthesis of metabolites. Toward these goals differential network analysis was implemented to identify candidate genes responsible for diversification of metabolites profile. Three genes were identified with significant difference in connectivity leading to differential regulatory behavior between these plants. These genes may be responsible for diversification of secondary metabolism, and thereby for species-specific metabolite synthesis. The network robustness of R. serpentina, determined based on topological properties, was also complemented by comparison of gene-metabolite networks of both plants, and may have evolved to have complex metabolic mechanisms as compared to C. roseus under the influence of various stimuli. This study reveals evolution of complexity in secondary metabolism of R. serpentina, and key genes that contribute toward diversification of specific metabolites.
Regularized rare variant enrichment analysis for case-control exome sequencing data.
Larson, Nicholas B; Schaid, Daniel J
2014-02-01
Rare variants have recently garnered an immense amount of attention in genetic association analysis. However, unlike methods traditionally used for single marker analysis in GWAS, rare variant analysis often requires some method of aggregation, since single marker approaches are poorly powered for typical sequencing study sample sizes. Advancements in sequencing technologies have rendered next-generation sequencing platforms a realistic alternative to traditional genotyping arrays. Exome sequencing in particular not only provides base-level resolution of genetic coding regions, but also a natural paradigm for aggregation via genes and exons. Here, we propose the use of penalized regression in combination with variant aggregation measures to identify rare variant enrichment in exome sequencing data. In contrast to marginal gene-level testing, we simultaneously evaluate the effects of rare variants in multiple genes, focusing on gene-based least absolute shrinkage and selection operator (LASSO) and exon-based sparse group LASSO models. By using gene membership as a grouping variable, the sparse group LASSO can be used as a gene-centric analysis of rare variants while also providing a penalized approach toward identifying specific regions of interest. We apply extensive simulations to evaluate the performance of these approaches with respect to specificity and sensitivity, comparing these results to multiple competing marginal testing methods. Finally, we discuss our findings and outline future research. © 2013 WILEY PERIODICALS, INC.
Senthivel, Vivek Raj; Sturrock, Marc; Piedrafita, Gabriel; Isalan, Mark
2016-12-16
Nonlinear responses to signals are widespread natural phenomena that affect various cellular processes. Nonlinearity can be a desirable characteristic for engineering living organisms because it can lead to more switch-like responses, similar to those underlying the wiring in electronics. Steeper functions are described as ultrasensitive, and can be applied in synthetic biology by using various techniques including receptor decoys, multiple co-operative binding sites, and sequential positive feedbacks. Here, we explore the inherent non-linearity of a biological signaling system to identify functions that can potentially be exploited using cell genome engineering. For this, we performed genome-wide transcription profiling to identify genes with ultrasensitive response functions to Hepatocyte Growth Factor (HGF). We identified 3,527 genes that react to increasing concentrations of HGF, in Madin-Darby canine kidney (MDCK) cells, grown as cysts in 3D collagen cell culture. By fitting a generic Hill function to the dose-responses of these genes we obtained a measure of the ultrasensitivity of HGF-responsive genes, identifying a subset with higher apparent Hill coefficients (e.g. MMP1, TIMP1, SNORD75, SNORD86 and ERRFI1). The regulatory regions of these genes are potential candidates for future engineering of synthetic mammalian gene circuits requiring nonlinear responses to HGF signalling.
Genome-wide association analysis of seedling root development in maize (Zea mays L.).
Pace, Jordon; Gardner, Candice; Romay, Cinta; Ganapathysubramanian, Baskar; Lübberstedt, Thomas
2015-02-05
Plants rely on the root system for anchorage to the ground and the acquisition and absorption of nutrients critical to sustaining productivity. A genome wide association analysis enables one to analyze allelic diversity of complex traits and identify superior alleles. 384 inbred lines from the Ames panel were genotyped with 681,257 single nucleotide polymorphism markers using Genotyping-by-Sequencing technology and 22 seedling root architecture traits were phenotyped. Utilizing both a general linear model and mixed linear model, a GWAS study was conducted identifying 268 marker trait associations (p ≤ 5.3×10(-7)). Analysis of significant SNP markers for multiple traits showed that several were located within gene models with some SNP markers localized within regions of previously identified root quantitative trait loci. Gene model GRMZM2G153722 located on chromosome 4 contained nine significant markers. This predicted gene is expressed in roots and shoots. This study identifies putatively associated SNP markers associated with root traits at the seedling stage. Some SNPs were located within or near (<1 kb) gene models. These gene models identify possible candidate genes involved in root development at the seedling stage. These and respective linked or functional markers could be targets for breeders for marker assisted selection of seedling root traits.
Kassir, Yona
2017-01-01
Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.
Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.
Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D
2006-04-01
A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.
USDA-ARS?s Scientific Manuscript database
The filamentous fungus Aspergillus flavus is an agriculturally important opportunistic plant pathogen that produces potent carcinogenic compounds called aflatoxins. We identified the A. flavus rtfA gene, the ortholog of rtf1 in S. cerevisiae and rtfA in A. nidulans. Interestingly, rtfA has multiple ...
Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G
2006-07-01
Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.
Estimating differential expression from multiple indicators
Ilmjärv, Sten; Hundahl, Christian Ansgar; Reimets, Riin; Niitsoo, Margus; Kolde, Raivo; Vilo, Jaak; Vasar, Eero; Luuk, Hendrik
2014-01-01
Regardless of the advent of high-throughput sequencing, microarrays remain central in current biomedical research. Conventional microarray analysis pipelines apply data reduction before the estimation of differential expression, which is likely to render the estimates susceptible to noise from signal summarization and reduce statistical power. We present a probe-level framework, which capitalizes on the high number of concurrent measurements to provide more robust differential expression estimates. The framework naturally extends to various experimental designs and target categories (e.g. transcripts, genes, genomic regions) as well as small sample sizes. Benchmarking in relation to popular microarray and RNA-sequencing data-analysis pipelines indicated high and stable performance on the Microarray Quality Control dataset and in a cell-culture model of hypoxia. Experimental-data-exhibiting long-range epigenetic silencing of gene expression was used to demonstrate the efficacy of detecting differential expression of genomic regions, a level of analysis not embraced by conventional workflows. Finally, we designed and conducted an experiment to identify hypothermia-responsive genes in terms of monotonic time-response. As a novel insight, hypothermia-dependent up-regulation of multiple genes of two major antioxidant pathways was identified and verified by quantitative real-time PCR. PMID:24586062
van Dongen, Stijn; Haluck-Kangas, Ashley; Sarshad, Aishe A; Bartom, Elizabeth T; Kim, Kwang-Youn A; Scholtens, Denise M; Hafner, Markus; Zhao, Jonathan C; Murmann, Andrea E
2017-01-01
Over 80% of multiple-tested siRNAs and shRNAs targeting CD95 or CD95 ligand (CD95L) induce a form of cell death characterized by simultaneous activation of multiple cell death pathways preferentially killing transformed and cancer stem cells. We now show these si/shRNAs kill cancer cells through canonical RNAi by targeting the 3’UTR of critical survival genes in a unique form of off-target effect we call DISE (death induced by survival gene elimination). Drosha and Dicer-deficient cells, devoid of most miRNAs, are hypersensitive to DISE, suggesting cellular miRNAs protect cells from this form of cell death. By testing 4666 shRNAs derived from the CD95 and CD95L mRNA sequences and an unrelated control gene, Venus, we have identified many toxic sequences - most of them located in the open reading frame of CD95L. We propose that specific toxic RNAi-active sequences present in the genome can kill cancer cells. PMID:29063830
Derived variants at six genes explain nearly half of size reduction in dog breeds
Rimbault, Maud; Beale, Holly C.; Schoenebeck, Jeffrey J.; Hoopes, Barbara C.; Allen, Jeremy J.; Kilroy-Glynn, Paul; Wayne, Robert K.; Sutter, Nathan B.; Ostrander, Elaine A.
2013-01-01
Selective breeding of dogs by humans has generated extraordinary diversity in body size. A number of multibreed analyses have been undertaken to identify the genetic basis of this diversity. We analyzed four loci discovered in a previous genome-wide association study that used 60,968 SNPs to identify size-associated genomic intervals, which were too large to assign causative roles to genes. First, we performed fine-mapping to define critical intervals that included the candidate genes GHR, HMGA2, SMAD2, and STC2, identifying five highly associated markers at the four loci. We hypothesize that three of the variants are likely to be causative. We then genotyped each marker, together with previously reported size-associated variants in the IGF1 and IGF1R genes, on a panel of 500 domestic dogs from 93 breeds, and identified the ancestral allele by genotyping the same markers on 30 wild canids. We observed that the derived alleles at all markers correlated with reduced body size, and smaller dogs are more likely to carry derived alleles at multiple markers. However, breeds are not generally fixed at all markers; multiple combinations of genotypes are found within most breeds. Finally, we show that 46%–52.5% of the variance in body size of dog breeds can be explained by seven markers in proximity to exceptional candidate genes. Among breeds with standard weights <41 kg (90 lb), the genotypes accounted for 64.3% of variance in weight. This work advances our understanding of mammalian growth by describing genetic contributions to canine size determination in non-giant dog breeds. PMID:24026177
Kang, Hye-Min; Lee, Jin-Sol; Kim, Min-Sub; Lee, Young Hwan; Jung, Jee-Hyun; Hagiwara, Atsushi; Zhou, Bingsheng; Lee, Jae-Seong; Jeong, Chang-Bum
2018-05-30
Autophagy originated from the common ancestor of all life forms, and its function is highly conserved from yeast to humans. Autophagy plays a key role in various fundamental biological processes including defense, and has developed through serial interactions of multiple gene sets referred to as autophagy-related (Atg) genes. Despite their significance in metazoan life and evolution, few studies have been conducted to identify these genes in aquatic invertebrates. In this study, we identified whole Atg genes in four Brachionus rotifer spp., namely B. calyciflorus, B. koreanus, B. plicatilis, and B. rotundiformis, through searches of their entire genomes; and we annotated them according to the yeast nomenclature. Twenty-four genes orthologous to yeast genes were present in all of the Brachionus spp. while three additional gene duplicates were identified in the genome of B. koreanus, indicating that these genes had diversified during the speciation. Also, their transcriptional responses to cadmium exposure indicated regulation by cadmium-induced oxidative-stress-related signaling pathways. This study provides valuable information on 99 conserved Atg genes involved in autophagosome formation in Brachionus spp., with transcriptional modulation in response to cadmium, in the context of the role of autophagy in the damage response. Copyright © 2018 Elsevier B.V. All rights reserved.
Angelastro, James M.; Klimaschewski, Lars; Tang, Song; Vitolo, Ottavio V.; Weissman, Tamily A.; Donlin, Laura T.; Shelanski, Michael L.; Greene, Lloyd A.
2000-01-01
Neurotrophic factors such as nerve growth factor (NGF) promote a wide variety of responses in neurons, including differentiation, survival, plasticity, and repair. Such actions often require changes in gene expression. To identify the regulated genes and thereby to more fully understand the NGF mechanism, we carried out serial analysis of gene expression (SAGE) profiling of transcripts derived from rat PC12 cells before and after NGF-promoted neuronal differentiation. Multiple criteria supported the reliability of the profile. Approximately 157,000 SAGE tags were analyzed, representing at least 21,000 unique transcripts. Of these, nearly 800 were regulated by 6-fold or more in response to NGF. Approximately 150 of the regulated transcripts have been matched to named genes, the majority of which were not previously known to be NGF-responsive. Functional categorization of the regulated genes provides insight into the complex, integrated mechanism by which NGF promotes its multiple actions. It is anticipated that as genomic sequence information accrues the data derived here will continue to provide information about neurotrophic factor mechanisms. PMID:10984536
Fan, Qianrui; Wang, Wenyu; Hao, Jingcan; He, Awen; Wen, Yan; Guo, Xiong; Wu, Cuiyan; Ning, Yujie; Wang, Xi; Wang, Sen; Zhang, Feng
2017-08-01
Neuroticism is a fundamental personality trait with significant genetic determinant. To identify novel susceptibility genes for neuroticism, we conducted an integrative analysis of genomic and transcriptomic data of genome wide association study (GWAS) and expression quantitative trait locus (eQTL) study. GWAS summary data was driven from published studies of neuroticism, totally involving 170,906 subjects. eQTL dataset containing 927,753 eQTLs were obtained from an eQTL meta-analysis of 5311 samples. Integrative analysis of GWAS and eQTL data was conducted by summary data-based Mendelian randomization (SMR) analysis software. To identify neuroticism associated gene sets, the SMR analysis results were further subjected to gene set enrichment analysis (GSEA). The gene set annotation dataset (containing 13,311 annotated gene sets) of GSEA Molecular Signatures Database was used. SMR single gene analysis identified 6 significant genes for neuroticism, including MSRA (p value=2.27×10 -10 ), MGC57346 (p value=6.92×10 -7 ), BLK (p value=1.01×10 -6 ), XKR6 (p value=1.11×10 -6 ), C17ORF69 (p value=1.12×10 -6 ) and KIAA1267 (p value=4.00×10 -6 ). Gene set enrichment analysis observed significant association for Chr8p23 gene set (false discovery rate=0.033). Our results provide novel clues for the genetic mechanism studies of neuroticism. Copyright © 2017. Published by Elsevier Inc.
Poole, William; Leinonen, Kalle; Shmulevich, Ilya
2017-01-01
Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C. PMID:28170390
Poole, William; Leinonen, Kalle; Shmulevich, Ilya; Knijnenburg, Theo A; Bernard, Brady
2017-02-01
Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C.
Identification of cancer genes that are independent of dominant proliferation and lineage programs
Selfors, Laura M.; Stover, Daniel G.; Harris, Isaac S.; Brugge, Joan S.; Coloff, Jonathan L.
2017-01-01
Large, multidimensional cancer datasets provide a resource that can be mined to identify candidate therapeutic targets for specific subgroups of tumors. Here, we analyzed human breast cancer data to identify transcriptional programs associated with tumors bearing specific genetic driver alterations. Using an unbiased approach, we identified thousands of genes whose expression was enriched in tumors with specific genetic alterations. However, expression of the vast majority of these genes was not enriched if associations were analyzed within individual breast tumor molecular subtypes, across multiple tumor types, or after gene expression was normalized to account for differences in proliferation or tumor lineage. Together with linear modeling results, these findings suggest that most transcriptional programs associated with specific genetic alterations in oncogenes and tumor suppressors are highly context-dependent and are predominantly linked to differences in proliferation programs between distinct breast cancer subtypes. We demonstrate that such proliferation-dependent gene expression dominates tumor transcriptional programs relative to matched normal tissues. However, we also identified a relatively small group of cancer-associated genes that are both proliferation- and lineage-independent. A subset of these genes are attractive candidate targets for combination therapy because they are essential in breast cancer cell lines, druggable, enriched in stem-like breast cancer cells, and resistant to chemotherapy-induced down-regulation. PMID:29229826
Mackeh, Rafah; Boughorbel, Sabri; Chaussabel, Damien; Kino, Tomoshige
2017-01-01
The collection of large-scale datasets available in public repositories is rapidly growing and providing opportunities to identify and fill gaps in different fields of biomedical research. However, users of these datasets should be able to selectively browse datasets related to their field of interest. Here we made available a collection of transcriptome datasets related to human follicular cells from normal individuals or patients with polycystic ovary syndrome, in the process of their development, during in vitro fertilization. After RNA-seq dataset exclusion and careful selection based on study description and sample information, 12 datasets, encompassing a total of 85 unique transcriptome profiles, were identified in NCBI Gene Expression Omnibus and uploaded to the Gene Expression Browser (GXB), a web application specifically designed for interactive query and visualization of integrated large-scale data. Once annotated in GXB, multiple sample grouping has been made in order to create rank lists to allow easy data interpretation and comparison. The GXB tool also allows the users to browse a single gene across multiple projects to evaluate its expression profiles in multiple biological systems/conditions in a web-based customized graphical views. The curated dataset is accessible at the following link: http://ivf.gxbsidra.org/dm3/landing.gsp.
Mackeh, Rafah; Boughorbel, Sabri; Chaussabel, Damien; Kino, Tomoshige
2017-01-01
The collection of large-scale datasets available in public repositories is rapidly growing and providing opportunities to identify and fill gaps in different fields of biomedical research. However, users of these datasets should be able to selectively browse datasets related to their field of interest. Here we made available a collection of transcriptome datasets related to human follicular cells from normal individuals or patients with polycystic ovary syndrome, in the process of their development, during in vitro fertilization. After RNA-seq dataset exclusion and careful selection based on study description and sample information, 12 datasets, encompassing a total of 85 unique transcriptome profiles, were identified in NCBI Gene Expression Omnibus and uploaded to the Gene Expression Browser (GXB), a web application specifically designed for interactive query and visualization of integrated large-scale data. Once annotated in GXB, multiple sample grouping has been made in order to create rank lists to allow easy data interpretation and comparison. The GXB tool also allows the users to browse a single gene across multiple projects to evaluate its expression profiles in multiple biological systems/conditions in a web-based customized graphical views. The curated dataset is accessible at the following link: http://ivf.gxbsidra.org/dm3/landing.gsp. PMID:28413616
Fang, Peng; Lu, Rongfei; Sun, Feng; Lan, Ying; Shen, Wenbiao; Du, Linlin; Zhou, Yijun; Zhou, Tong
2015-10-24
Stably expressed reference gene(s) normalization is important for the understanding of gene expression patterns by quantitative Real-time PCR (RT-qPCR), particularly for Rice stripe virus (RSV) and Rice black streaked dwarf virus (RBSDV) that caused seriously damage on rice plants in China and Southeast Asia. The expression of fourteen common used reference genes of Oryza sativa L. were evaluated by RT-qPCR in RSV and RBSDV infected rice plants. Suitable normalization reference gene(s) were identified by geNorm and NormFinder algorithms. UBQ 10 + GAPDH and UBC + Actin1 were identified as suitable reference genes for RT-qPCR normalization under RSV and RBSDV infection, respectively. When using multiple reference genes, the expression patterns of OsPRIb and OsWRKY, two virus resistance genes, were approximately similar with that reported previously. Comparatively, by using single reference gene (TIP41-Like), a weaker inducible response was observed. We proposed that the combination of two reference genes could obtain more accurate and reliable normalization of RT-qPCR results in RSV- and RBSDV-infected plants. This work therefore sheds light on establishing a standardized RT-qPCR procedure in RSV- and RBSDV-infected rice plants, and might serve as an important point for discovering complex regulatory networks and identifying genes relevant to biological processes or implicated in virus.
Zhao, Zheng; Bai, Jing; Wu, Aiwei; Wang, Yuan; Zhang, Jinwen; Wang, Zishan; Li, Yongsheng; Xu, Juan; Li, Xia
2015-01-01
Long non-coding RNAs (lncRNAs) are emerging as key regulators of diverse biological processes and diseases. However, the combinatorial effects of these molecules in a specific biological function are poorly understood. Identifying co-expressed protein-coding genes of lncRNAs would provide ample insight into lncRNA functions. To facilitate such an effort, we have developed Co-LncRNA, which is a web-based computational tool that allows users to identify GO annotations and KEGG pathways that may be affected by co-expressed protein-coding genes of a single or multiple lncRNAs. LncRNA co-expressed protein-coding genes were first identified in publicly available human RNA-Seq datasets, including 241 datasets across 6560 total individuals representing 28 tissue types/cell lines. Then, the lncRNA combinatorial effects in a given GO annotations or KEGG pathways are taken into account by the simultaneous analysis of multiple lncRNAs in user-selected individual or multiple datasets, which is realized by enrichment analysis. In addition, this software provides a graphical overview of pathways that are modulated by lncRNAs, as well as a specific tool to display the relevant networks between lncRNAs and their co-expressed protein-coding genes. Co-LncRNA also supports users in uploading their own lncRNA and protein-coding gene expression profiles to investigate the lncRNA combinatorial effects. It will be continuously updated with more human RNA-Seq datasets on an annual basis. Taken together, Co-LncRNA provides a web-based application for investigating lncRNA combinatorial effects, which could shed light on their biological roles and could be a valuable resource for this community. Database URL: http://www.bio-bigdata.com/Co-LncRNA/. © The Author(s) 2015. Published by Oxford University Press.
Identification of prostate cancer modifier pathways using parental strain expression mapping
Xu, Qing; Majumder, Pradip K.; Ross, Kenneth; Shim, Yeonju; Golub, Todd R.; Loda, Massimo; Sellers, William R.
2007-01-01
Inherited genetic risk factors play an important role in cancer. However, other than the Mendelian fashion cancer susceptibility genes found in familial cancer syndromes, little is known about risk modifiers that control individual susceptibility. Here we developed a strategy, parental strain expression mapping, that utilizes the homogeneity of inbred mice and genome-wide mRNA expression analyses to directly identify candidate germ-line modifier genes and pathways underlying phenotypic differences among murine strains exposed to transgenic activation of AKT1. We identified multiple candidate modifier pathways and, specifically, the glycolysis pathway as a candidate negative modulator of AKT1-induced proliferation. In keeping with the findings in the murine models, in multiple human prostate expression data set, we found that enrichment of glycolysis pathways in normal tissues was associated with decreased rates of cancer recurrence after prostatectomy. Together, these data suggest that parental strain expression mapping can directly identify germ-line modifier pathways of relevance to human disease. PMID:17978178
Liu, June; Cattadori, Isabella M.; Sim, Derek G.; Eden, John-Sebastian; Read, Andrew F.
2017-01-01
ABSTRACT The coevolution of myxoma virus (MYXV) and wild European rabbits in Australia and Europe is a paradigm for the evolution of a pathogen in a new host species. Genomic analyses have identified the mutations that have characterized this evolutionary process, but defining causal mutations in the pathways from virulence to attenuation and back to virulence has not been possible. Using reverse genetics, we examined the roles of six selected mutations found in Australian field isolates of MYXV that fall in known or potential virulence genes. Several of these mutations occurred in genes previously identified as virulence genes in whole-gene knockout studies. Strikingly, no single or double mutation among the mutations tested had an appreciable impact on virulence. This suggests either that virulence evolution was defined by amino acid changes other than those analyzed here or that combinations of multiple mutations, possibly involving epistatic interactions or noncoding sequences, have been critical in the ongoing evolution of MYXV virulence. In sum, our results show that single-gene knockout studies of a progenitor virus can have little power to predict the impact of individual mutations seen in the field. The genetic determinants responsible for this canonical case of virulence evolution remain to be determined. IMPORTANCE The species jump of myxoma virus (MYXV) from the South American tapeti to the European rabbit populations of Australia and Europe is a canonical example of host-pathogen coevolution. Detailed molecular studies have identified multiple genes in MYXV that are critical for virulence, and genome sequencing has revealed the evolutionary history of MYXV in Australia and Europe. However, it has not been possible to categorically identify the key mutations responsible for the attenuation of or reversion to virulence during this evolutionary process. Here we use reverse genetics to examine the role of mutations in viruses isolated early and late in the Australian radiation of MYXV. Surprisingly, none of the candidate mutations that we identified as likely having roles in attenuation proved to be important for virulence. This indicates that considerable caution is warranted when interpreting the possible role of individual mutations during virulence evolution. PMID:28768866
Gene flow in complex landscapes: Testing multiple hypotheses with causal modeling
Samuel A. Cushman; Kevin S. McKelvey; Jim Hayden; Michael K. Schwartz
2006-01-01
Predicting population-level effects of landscape change depends on identifying factors that influence population connectivity in complex landscapes. However, most putative movement corridors and barriers have not been based on empirical data. In this study, we identify factors that influence connectivity by comparing patterns of genetic similarity among 146 black bears...
Genome complexity in the coelacanth is reflected in its adaptive immune system
Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.
2014-01-01
We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.
Toulouse, Jacynthe L; Edens, Thaddeus J; Alejaldre, Lorea; Manges, Amee R; Pelletier, Joelle N
2017-05-01
Whole-genome sequencing of trimethoprim-resistant Escherichia coli clinical isolates identified a member of the trimethoprim-resistant type II dihydrofolate reductase gene family ( dfrB ). The dfrB4 gene was located within a class I integron flanked by multiple resistance genes. This arrangement was previously reported in a 130.6-kb multiresistance plasmid. The DfrB4 protein conferred a >2,000-fold increased trimethoprim resistance on overexpression in E. coli Our results are consistent with the finding that dfrB4 contributes to clinical trimethoprim resistance. Copyright © 2017 American Society for Microbiology.
The α‐synuclein gene in multiple system atrophy
Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W
2006-01-01
Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523
TargetCompare: A web interface to compare simultaneous miRNAs targets
Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-dos-Santos, André M; dos Santos, Ândrea Ribeiro
2014-01-01
MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. Availability http://lghm.ufpa.br/targetcompare PMID:25352731
TargetCompare: A web interface to compare simultaneous miRNAs targets.
Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-Dos-Santos, André M; Dos Santos, Andrea Ribeiro
2014-01-01
MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. http://lghm.ufpa.br/targetcompare.
Determination of the core promoter regions of the Saccharomyces cerevisiae RPS3 gene.
Joo, Yoo Jin; Kim, Jin-Ha; Baek, Joung Hee; Seong, Ki Moon; Lee, Jae Yung; Kim, Joon
2009-01-01
Ribosomal protein genes (RPG), which are scattered throughout the genomes of all eukaryotes, are subjected to coordinated expression. In yeast, the expression of RPGs is highly regulated, mainly at the transcriptional level. Recent research has found that many ribosomal proteins (RPs) function in multiple processes in addition to protein synthesis. Therefore, detailed knowledge of promoter architecture as well as gene regulation is important in understanding the multiple cellular processes mediated by RPGs. In this study, we investigated the functional architecture of the yeast RPS3 promoter and identified many putative cis-elements. Using beta-galactosidase reporter analysis and EMSA, the core promoter of RPS3 containing UASrpg and T-rich regions was corroborated. Moreover, the promoter occupancy of RPS3 by three transcription factors was confirmed. Taken together, our results further the current understanding of the promoter architecture and trans-elements of the Saccharomyces cerevisiae RPS3 gene.
Sharma, Amitabh; Gulbahce, Natali; Pevzner, Samuel J.; Menche, Jörg; Ladenvall, Claes; Folkersen, Lasse; Eriksson, Per; Orho-Melander, Marju; Barabási, Albert-László
2013-01-01
Genome wide association studies (GWAS) identify susceptibility loci for complex traits, but do not identify particular genes of interest. Integration of functional and network information may help in overcoming this limitation and identifying new susceptibility loci. Using GWAS and comorbidity data, we present a network-based approach to predict candidate genes for lipid and lipoprotein traits. We apply a prediction pipeline incorporating interactome, co-expression, and comorbidity data to Global Lipids Genetics Consortium (GLGC) GWAS for four traits of interest, identifying phenotypically coherent modules. These modules provide insights regarding gene involvement in complex phenotypes with multiple susceptibility alleles and low effect sizes. To experimentally test our predictions, we selected four candidate genes and genotyped representative SNPs in the Malmö Diet and Cancer Cardiovascular Cohort. We found significant associations with LDL-C and total-cholesterol levels for a synonymous SNP (rs234706) in the cystathionine beta-synthase (CBS) gene (p = 1 × 10−5 and adjusted-p = 0.013, respectively). Further, liver samples taken from 206 patients revealed that patients with the minor allele of rs234706 had significant dysregulation of CBS (p = 0.04). Despite the known biological role of CBS in lipid metabolism, SNPs within the locus have not yet been identified in GWAS of lipoprotein traits. Thus, the GWAS-based Comorbidity Module (GCM) approach identifies candidate genes missed by GWAS studies, serving as a broadly applicable tool for the investigation of other complex disease phenotypes. PMID:23882023
Evaluation of genome-wide association study results through development of ontology fingerprints
Tsoi, Lam C.; Boehnke, Michael; Klein, Richard L.; Zheng, W. Jim
2009-01-01
Motivation: Genome-wide association (GWA) studies may identify multiple variants that are associated with a disease or trait. To narrow down candidates for further validation, quantitatively assessing how identified genes relate to a phenotype of interest is important. Results: We describe an approach to characterize genes or biological concepts (phenotypes, pathways, diseases, etc.) by ontology fingerprint—the set of Gene Ontology (GO) terms that are overrepresented among the PubMed abstracts discussing the gene or biological concept together with the enrichment p-value of these terms generated from a hypergeometric enrichment test. We then quantify the relevance of genes to the trait from a GWA study by calculating similarity scores between their ontology fingerprints using enrichment p-values. We validate this approach by correctly identifying corresponding genes for biological pathways with a 90% average area under the ROC curve (AUC). We applied this approach to rank genes identified through a GWA study that are associated with the lipid concentrations in plasma as well as to prioritize genes within linkage disequilibrium (LD) block. We found that the genes with highest scores were: ABCA1, lipoprotein lipase (LPL) and cholesterol ester transfer protein, plasma for high-density lipoprotein; low-density lipoprotein receptor, APOE and APOB for low-density lipoprotein; and LPL, APOA1 and APOB for triglyceride. In addition, we identified genes relevant to lipid metabolism from the literature even in cases where such knowledge was not reflected in current annotation of these genes. These results demonstrate that ontology fingerprints can be used effectively to prioritize genes from GWA studies for experimental validation. Contact: zhengw@musc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19349285
GeneMachine: gene prediction and sequence annotation.
Makalowska, I; Ryan, J F; Baxevanis, A D
2001-09-01
A number of free-standing programs have been developed in order to help researchers find potential coding regions and deduce gene structure for long stretches of what is essentially 'anonymous DNA'. As these programs apply inherently different criteria to the question of what is and is not a coding region, multiple algorithms should be used in the course of positional cloning and positional candidate projects to assure that all potential coding regions within a previously-identified critical region are identified. We have developed a gene identification tool called GeneMachine which allows users to query multiple exon and gene prediction programs in an automated fashion. BLAST searches are also performed in order to see whether a previously-characterized coding region corresponds to a region in the query sequence. A suite of Perl programs and modules are used to run MZEF, GENSCAN, GRAIL 2, FGENES, RepeatMasker, Sputnik, and BLAST. The results of these runs are then parsed and written into ASN.1 format. Output files can be opened using NCBI Sequin, in essence using Sequin as both a workbench and as a graphical viewer. The main feature of GeneMachine is that the process is fully automated; the user is only required to launch GeneMachine and then open the resulting file with Sequin. Annotations can then be made to these results prior to submission to GenBank, thereby increasing the intrinsic value of these data. GeneMachine is freely-available for download at http://genome.nhgri.nih.gov/genemachine. A public Web interface to the GeneMachine server for academic and not-for-profit users is available at http://genemachine.nhgri.nih.gov. The Web supplement to this paper may be found at http://genome.nhgri.nih.gov/genemachine/supplement/.
Carroll, Ronan K; Weiss, Andy; Broach, William H; Wiemels, Richard E; Mogen, Austin B; Rice, Kelly C; Shaw, Lindsey N
2016-02-09
In Staphylococcus aureus, hundreds of small regulatory or small RNAs (sRNAs) have been identified, yet this class of molecule remains poorly understood and severely understudied. sRNA genes are typically absent from genome annotation files, and as a consequence, their existence is often overlooked, particularly in global transcriptomic studies. To facilitate improved detection and analysis of sRNAs in S. aureus, we generated updated GenBank files for three commonly used S. aureus strains (MRSA252, NCTC 8325, and USA300), in which we added annotations for >260 previously identified sRNAs. These files, the first to include genome-wide annotation of sRNAs in S. aureus, were then used as a foundation to identify novel sRNAs in the community-associated methicillin-resistant strain USA300. This analysis led to the discovery of 39 previously unidentified sRNAs. Investigating the genomic loci of the newly identified sRNAs revealed a surprising degree of inconsistency in genome annotation in S. aureus, which may be hindering the analysis and functional exploration of these elements. Finally, using our newly created annotation files as a reference, we perform a global analysis of sRNA gene expression in S. aureus and demonstrate that the newly identified tsr25 is the most highly upregulated sRNA in human serum. This study provides an invaluable resource to the S. aureus research community in the form of our newly generated annotation files, while at the same time presenting the first examination of differential sRNA expression in pathophysiologically relevant conditions. Despite a large number of studies identifying regulatory or small RNA (sRNA) genes in Staphylococcus aureus, their annotation is notably lacking in available genome files. In addition to this, there has been a considerable lack of cross-referencing in the wealth of studies identifying these elements, often leading to the same sRNA being identified multiple times and bearing multiple names. In this work, we have consolidated and curated known sRNA genes from the literature and mapped them to their position on the S. aureus genome, creating new genome annotation files. These files can now be used by the scientific community at large in experiments to search for previously undiscovered sRNA genes and to monitor sRNA gene expression by transcriptome sequencing (RNA-seq). We demonstrate this application, identifying 39 new sRNAs and studying their expression during S. aureus growth in human serum. Copyright © 2016 Carroll et al.
Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.
van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew
2009-05-01
Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.
Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J
2016-06-01
Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.
Insights into the innate immunome of actiniarians using a comparative genomic approach.
van der Burg, Chloé A; Prentis, Peter J; Surm, Joachim M; Pavasovic, Ana
2016-11-02
Innate immune genes tend to be highly conserved in metazoans, even in early divergent lineages such as Cnidaria (jellyfish, corals, hydroids and sea anemones) and Porifera (sponges). However, constant and diverse selection pressures on the immune system have driven the expansion and diversification of different immune gene families in a lineage-specific manner. To investigate how the innate immune system has evolved in a subset of sea anemone species (Order: Actiniaria), we performed a comprehensive and comparative study using 10 newly sequenced transcriptomes, as well as three publically available transcriptomes, to identify the origins, expansions and contractions of candidate and novel immune gene families. We characterised five conserved genes and gene families, as well as multiple novel innate immune genes, including the newly recognised putative pattern recognition receptor CniFL. Single copies of TLR, MyD88 and NF-κB were found in most species, and several copies of IL-1R-like, NLR and CniFL were found in almost all species. Multiple novel immune genes were identified with domain architectures including the Toll/interleukin-1 receptor (TIR) homology domain, which is well documented as functioning in protein-protein interactions and signal transduction in immune pathways. We hypothesise that these genes may interact as novel proteins in immune pathways of cnidarian species. Novelty in the actiniarian immunome is not restricted to only TIR-domain-containing proteins, as we identify a subset of NLRs which have undergone neofunctionalisation and contain 3-5 N-terminal transmembrane domains, which have so far only been identified in two anthozoan species. This research has significance in understanding the evolution and origin of the core eumetazoan gene set, including how novel innate immune genes evolve. For example, the evolution of transmembrane domain containing NLRs indicates that these NLRs may be membrane-bound, while all other metazoan and plant NLRs are exclusively cytosolic receptors. This is one example of how species without an adaptive immune system may evolve innovative solutions to detect pathogens or interact with native microbiota. Overall, these results provide an insight into the evolution of the innate immune system, and show that early divergent lineages, such as actiniarians, have a diverse repertoire of conserved and novel innate immune genes.
Botta, C; Di Martino, M T; Ciliberto, D; Cucè, M; Correale, P; Rossi, M; Tagliaferri, P; Tassone, P
2016-12-16
Multiple myeloma (MM) is closely dependent on cross-talk between malignant plasma cells and cellular components of the inflammatory/immunosuppressive bone marrow milieu, which promotes disease progression, drug resistance, neo-angiogenesis, bone destruction and immune-impairment. We investigated the relevance of inflammatory genes in predicting disease evolution and patient survival. A bioinformatics study by Ingenuity Pathway Analysis on gene expression profiling dataset of monoclonal gammopathy of undetermined significance, smoldering and symptomatic-MM, identified inflammatory and cytokine/chemokine pathways as the most progressively affected during disease evolution. We then selected 20 candidate genes involved in B-cell inflammation and we investigated their role in predicting clinical outcome, through univariate and multivariate analyses (log-rank test, logistic regression and Cox-regression model). We defined an 8-genes signature (IL8, IL10, IL17A, CCL3, CCL5, VEGFA, EBI3 and NOS2) identifying each condition (MGUS/smoldering/symptomatic-MM) with 84% accuracy. Moreover, six genes (IFNG, IL2, LTA, CCL2, VEGFA, CCL3) were found independently correlated with patients' survival. Patients whose MM cells expressed high levels of Th1 cytokines (IFNG/LTA/IL2/CCL2) and low levels of CCL3 and VEGFA, experienced the longest survival. On these six genes, we built a prognostic risk score that was validated in three additional independent datasets. In this study, we provide proof-of-concept that inflammation has a critical role in MM patient progression and survival. The inflammatory-gene prognostic signature validated in different datasets clearly indicates novel opportunities for personalized anti-MM treatment.
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene. PMID:17597519
Feng, Tao; Cao, Gui-Ling; Chu, Ming-Xing; Di, Ran; Huang, Dong-Wei; Liu, Qiu-Yue; Pan, Zhang-Yuan; Jin, Mei; Zhang, Ying-Jie; Li, Ning
2015-02-01
Litter size is a favorable economic trait for the goat industry, but remains a complex trait controlled by multiple genes in multiple organs. Several genes have been identified that may affect embryo survival, follicular development, and the health of fetuses during pregnancy. Jining Grey goats demonstrate the largest litter size among goat breeds indigenous to China. In order to better understand the genetic basis of this trait, six suppression subtractive hybridization (SSH) cDNA libraries were constructed using pooled mRNAs from hypothalamuses, pituitaries, and ovaries of sexually mature and adult polytocous Jining Grey goats, as testers, versus the pooled corresponding mRNAs of monotocous Liaoning Cashmere goats, as drivers. A total of 1,458 true-positive clones--including 955 known genes and 481 known and 22 unknown expressed sequence tags--were obtained from the SSH libraries by sequencing and alignment. The known genes were categorized into cellular processes and signaling information storage and processing, and metabolism. Three genes (FTH1, GH, and SAA) were selected to validate the SSH results by quantitative real-time PCR; all three were up-regulated in the corresponding tissues in the tester group indicating that these are candidate genes associated with the large litter size of Jining Grey goats. Several other identified genes may affect embryo survival, follicular development, and health during pregnancy. This study provides insights into the mechanistic basis by which the caprine hypothalamic-pituitary-gonadal axis affects reproductive traits and provides a theoretical basis for goat production and breeding. © 2015 Wiley Periodicals, Inc.
Single and multiple phenotype QTL analyses of downy mildew resistance in interspecific grapevines.
Divilov, Konstantin; Barba, Paola; Cadle-Davidson, Lance; Reisch, Bruce I
2018-05-01
Downy mildew resistance across days post-inoculation, experiments, and years in two interspecific grapevine F 1 families was investigated using linear mixed models and Bayesian networks, and five new QTL were identified. Breeding grapevines for downy mildew disease resistance has traditionally relied on qualitative gene resistance, which can be overcome by pathogen evolution. Analyzing two interspecific F 1 families, both having ancestry derived from Vitis vinifera and wild North American Vitis species, across 2 years and multiple experiments, we found multiple loci associated with downy mildew sporulation and hypersensitive response in both families using a single phenotype model. The loci explained between 7 and 17% of the variance for either phenotype, suggesting a complex genetic architecture for these traits in the two families studied. For two loci, we used RNA-Seq to detect differentially transcribed genes and found that the candidate genes at these loci were likely not NBS-LRR genes. Additionally, using a multiple phenotype Bayesian network analysis, we found effects between the leaf trichome density, hypersensitive response, and sporulation phenotypes. Moderate-high heritabilities were found for all three phenotypes, suggesting that selection for downy mildew resistance is an achievable goal by breeding for either physical- or non-physical-based resistance mechanisms, with the combination of the two possibly providing durable resistance.
Ko, Yi-An; Mukherjee, Bhramar; Smith, Jennifer A; Kardia, Sharon L R; Allison, Matthew; Diez Roux, Ana V
2016-11-01
There has been an increased interest in identifying gene-environment interaction (G × E) in the context of multiple environmental exposures. Most G × E studies analyze one exposure at a time, but we are exposed to multiple exposures in reality. Efficient analysis strategies for complex G × E with multiple environmental factors in a single model are still lacking. Using the data from the Multiethnic Study of Atherosclerosis, we illustrate a two-step approach for modeling G × E with multiple environmental factors. First, we utilize common clustering and classification strategies (e.g., k-means, latent class analysis, classification and regression trees, Bayesian clustering using Dirichlet Process) to define subgroups corresponding to distinct environmental exposure profiles. Second, we illustrate the use of an additive main effects and multiplicative interaction model, instead of the conventional saturated interaction model using product terms of factors, to study G × E with the data-driven exposure subgroups defined in the first step. We demonstrate useful analytical approaches to translate multiple environmental exposures into one summary class. These tools not only allow researchers to consider several environmental exposures in G × E analysis but also provide some insight into how genes modify the effect of a comprehensive exposure profile instead of examining effect modification for each exposure in isolation.
Microarray expression profiling identifies genes with altered expression in HDL-deficient mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.
2000-05-05
Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared withmore » the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.« less
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-05-26
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.
Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki
2016-01-01
Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414
2012-01-01
High-dimensional gene expression data provide a rich source of information because they capture the expression level of genes in dynamic states that reflect the biological functioning of a cell. For this reason, such data are suitable to reveal systems related properties inside a cell, e.g., in order to elucidate molecular mechanisms of complex diseases like breast or prostate cancer. However, this is not only strongly dependent on the sample size and the correlation structure of a data set, but also on the statistical hypotheses tested. Many different approaches have been developed over the years to analyze gene expression data to (I) identify changes in single genes, (II) identify changes in gene sets or pathways, and (III) identify changes in the correlation structure in pathways. In this paper, we review statistical methods for all three types of approaches, including subtypes, in the context of cancer data and provide links to software implementations and tools and address also the general problem of multiple hypotheses testing. Further, we provide recommendations for the selection of such analysis methods. Reviewers This article was reviewed by Arcady Mushegian, Byung-Soo Kim and Joel Bader. PMID:23227854
Sporulation genes associated with sporulation efficiency in natural isolates of yeast.
Tomar, Parul; Bhatia, Aatish; Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu
2013-01-01
Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes - HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast.
Sporulation Genes Associated with Sporulation Efficiency in Natural Isolates of Yeast
Ramdas, Shweta; Diao, Liyang; Bhanot, Gyan; Sinha, Himanshu
2013-01-01
Yeast sporulation efficiency is a quantitative trait and is known to vary among experimental populations and natural isolates. Some studies have uncovered the genetic basis of this variation and have identified the role of sporulation genes (IME1, RME1) and sporulation-associated genes (FKH2, PMS1, RAS2, RSF1, SWS2), as well as non-sporulation pathway genes (MKT1, TAO3) in maintaining this variation. However, these studies have been done mostly in experimental populations. Sporulation is a response to nutrient deprivation. Unlike laboratory strains, natural isolates have likely undergone multiple selections for quick adaptation to varying nutrient conditions. As a result, sporulation efficiency in natural isolates may have different genetic factors contributing to phenotypic variation. Using Saccharomyces cerevisiae strains in the genetically and environmentally diverse SGRP collection, we have identified genetic loci associated with sporulation efficiency variation in a set of sporulation and sporulation-associated genes. Using two independent methods for association mapping and correcting for population structure biases, our analysis identified two linked clusters containing 4 non-synonymous mutations in genes – HOS4, MCK1, SET3, and SPO74. Five regulatory polymorphisms in five genes such as MLS1 and CDC10 were also identified as putative candidates. Our results provide candidate genes contributing to phenotypic variation in the sporulation efficiency of natural isolates of yeast. PMID:23874994
Faucon, Frederic; Gaude, Thierry; Dusfour, Isabelle; Navratil, Vincent; Corbel, Vincent; Juntarajumnong, Waraporn; Girod, Romain; Poupardin, Rodolphe; Boyer, Frederic; Reynaud, Stephane; David, Jean-Philippe
2017-04-01
The capacity of Aedes mosquitoes to resist chemical insecticides threatens the control of major arbovirus diseases worldwide. Until alternative control tools are widely deployed, monitoring insecticide resistance levels and identifying resistance mechanisms in field mosquito populations is crucial for implementing appropriate management strategies. Metabolic resistance to pyrethroids is common in Aedes aegypti but the monitoring of the dynamics of resistant alleles is impeded by the lack of robust genomic markers. In an attempt to identify the genomic bases of metabolic resistance to deltamethrin, multiple resistant and susceptible populations originating from various continents were compared using both RNA-seq and a targeted DNA-seq approach focused on the upstream regions of detoxification genes. Multiple detoxification enzymes were over transcribed in resistant populations, frequently associated with an increase in their gene copy number. Targeted sequencing identified potential promoter variations associated with their over transcription. Non-synonymous variations affecting detoxification enzymes were also identified in resistant populations. This study not only confirmed the role of gene copy number variations as a frequent cause of the over expression of detoxification enzymes associated with insecticide resistance in Aedes aegypti but also identified novel genomic resistance markers potentially associated with their cis-regulation and modifications of their protein structure conformation. As for gene transcription data, polymorphism patterns were frequently conserved within regions but differed among continents confirming the selection of different resistance factors worldwide. Overall, this study paves the way of the identification of a comprehensive set of genomic markers for monitoring the spatio-temporal dynamics of the variety of insecticide resistance mechanisms in Aedes aegypti.
Armour, Christine M; Smith, Amanda; Hartley, Taila; Chardon, Jodi Warman; Sawyer, Sarah; Schwartzentruber, Jeremy; Hennekam, Raoul; Majewski, Jacek; Bulman, Dennis E; Suri, Mohnish; Boycott, Kym M
2016-07-01
In 1987 Fitzsimmons and Guilbert described identical male twins with progressive spastic paraplegia, brachydactyly with cone shaped epiphyses, short stature, dysarthria, and "low-normal" intelligence. In subsequent years, four other patients, including one set of female identical twins, a single female child, and a single male individual were described with the same features, and the eponym Fitzsimmons syndrome was adopted (OMIM #270710). We performed exome analysis of the patient described in 2009, and one of the original twins from 1987, the only patients available from the literature. No single genetic etiology exists that explains Fitzsimmons syndrome; however, multiple different genetic causes were identified. Specifically, the twins described by Fitzsimmons had heterozygous mutations in the SACS gene, the gene responsible for autosomal recessive spastic ataxia of Charlevoix Saguenay (ARSACS), as well as a heterozygous mutation in the TRPS1, the gene responsible in Trichorhinophalangeal syndrome type 1 (TRPS1 type 1) which includes brachydactyly as a feature. A TBL1XR1 mutation was identified in the patient described in 2009 as contributing to his cognitive impairment and autistic features with no genetic cause identified for his spasticity or brachydactyly. The findings show that these individuals have multiple different etiologies giving rise to a similar phenotype, and that "Fitzsimmons syndrome" is in fact not one single syndrome. Over time, we anticipate that continued careful phenotyping with concomitant genome-wide analysis will continue to identify the causes of many rare syndromes, but it will also highlight that previously delineated clinical entities are, in fact, not syndromes at all. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Mining microarrays for metabolic meaning: nutritional regulation of hypothalamic gene expression.
Mobbs, Charles V; Yen, Kelvin; Mastaitis, Jason; Nguyen, Ha; Watson, Elizabeth; Wurmbach, Elisa; Sealfon, Stuart C; Brooks, Andrew; Salton, Stephen R J
2004-06-01
DNA microarray analysis has been used to investigate relative changes in the level of gene expression in the CNS, including changes that are associated with disease, injury, psychiatric disorders, drug exposure or withdrawal, and memory formation. We have used oligonucleotide microarrays to identify hypothalamic genes that respond to nutritional manipulation. In addition to commonly used microarray analysis based on criteria such as fold-regulation, we have also found that simply carrying out multiple t tests then sorting by P value constitutes a highly reliable method to detect true regulation, as assessed by real-time polymerase chain reaction (PCR), even for relatively low abundance genes or relatively low magnitude of regulation. Such analyses directly suggested novel mechanisms that mediate effects of nutritional state on neuroendocrine function and are being used to identify regulated gene products that may elucidate the metabolic pathology of obese ob/ob, lean Vgf-/Vgf-, and other models with profound metabolic impairments.
NASA Technical Reports Server (NTRS)
Sundaresan, A.; Pellis, N. R.
2005-01-01
Genetic response suites in human lymphocytes in response to microgravity are important to identify and further study in order to augment human physiological adaptation to novel environments. Emerging technologies, such as DNA micro array profiling, have the potential to identify novel genes that are involved in mediating adaptation to these environments. These genes may prove to be therapeutically valuable as new targets for countermeasures, or as predictive biomarkers of response to these new environments. Human lymphocytes cultured in lg and microgravity analog culture were analyzed for their differential gene expression response. Different groups of genes related to the immune response, cardiovascular system and stress response were then analyzed. Analysis of cells from multiple donors reveals a small shared set that are likely to be essential to adaptation. These three groups focus on human adaptation to new environments. The shared set contains genes related to T cell activation, immune response and stress response to analog microgravity.
Teren, A; Kirsten, H; Beutner, F; Scholz, M; Holdt, L M; Teupser, D; Gutberlet, M; Thiery, J; Schuler, G; Eitel, I
2017-02-03
Prognostic relevant pathways of leukocyte involvement in human myocardial ischemic-reperfusion injury are largely unknown. We enrolled 136 patients with ST-elevation myocardial infarction (STEMI) after primary angioplasty within 12 h after onset of symptoms. Following reperfusion, whole blood was collected within a median time interval of 20 h (interquartile range: 15-25 h) for genome-wide gene expression analysis. Subsequent CMR scans were performed using a standard protocol to determine infarct size (IS), area at risk (AAR), myocardial salvage index (MSI) and the extent of late microvascular obstruction (lateMO). We found 398 genes associated with lateMO and two genes with IS. Neither AAR, nor MSI showed significant correlations with gene expression. Genes correlating with lateMO were strongly related to several canonical pathways, including positive regulation of T-cell activation (p = 3.44 × 10 -5 ), and regulation of inflammatory response (p = 1.86 × 10 -3 ). Network analysis of multiple gene expression alterations associated with larger lateMO identified the following functional consequences: facilitated utilisation and decreased concentration of free fatty acid, repressed cell differentiation, enhanced phagocyte movement, increased cell death, vascular disease and compensatory vasculogenesis. In conclusion, the extent of lateMO after acute, reperfused STEMI correlated with altered activation of multiple genes related to fatty acid utilisation, lymphocyte differentiation, phagocyte mobilisation, cell survival, and vascular dysfunction.
Naoumkina, Marina A.; Modolo, Luzia V.; Huhman, David V.; Urbanczyk-Wochniak, Ewa; Tang, Yuhong; Sumner, Lloyd W.; Dixon, Richard A.
2010-01-01
Saponins, an important group of bioactive plant natural products, are glycosides of triterpenoid or steroidal aglycones (sapogenins). Saponins possess many biological activities, including conferring potential health benefits for humans. However, most of the steps specific for the biosynthesis of triterpene saponins remain uncharacterized at the molecular level. Here, we use comprehensive gene expression clustering analysis to identify candidate genes involved in the elaboration, hydroxylation, and glycosylation of the triterpene skeleton in the model legume Medicago truncatula. Four candidate uridine diphosphate glycosyltransferases were expressed in Escherichia coli, one of which (UGT73F3) showed specificity for multiple sapogenins and was confirmed to glucosylate hederagenin at the C28 position. Genetic loss-of-function studies in M. truncatula confirmed the in vivo function of UGT73F3 in saponin biosynthesis. This report provides a basis for future studies to define genetically the roles of multiple cytochromes P450 and glycosyltransferases in triterpene saponin biosynthesis in Medicago. PMID:20348429
Widespread genetic heterogeneity in multiple myeloma: implications for targeted therapy
Lohr, Jens G.; Stojanov, Petar; Carter, Scott L.; Cruz-Gordillo, Peter; Lawrence, Michael S.; Auclair, Daniel; Sougnez, Carrie; Knoechel, Birgit; Gould, Joshua; Saksena, Gordon; Cibulskis, Kristian; McKenna, Aaron; Chapman, Michael A.; Straussman, Ravid; Levy, Joan; Perkins, Louise M.; Keats, Jonathan J.; Schumacher, Steven E.; Rosenberg, Mara; Getz, Gad
2014-01-01
SUMMARY We performed massively parallel sequencing of paired tumor/normal samples from 203 multiple myeloma (MM) patients and identified significantly mutated genes and copy number alterations, and discovered putative tumor suppressor genes by determining homozygous deletions and loss-of-heterozygosity. We observed frequent mutations in KRAS (particularly in previously treated patients), NRAS, BRAF, FAM46C, TP53 and DIS3 (particularly in non-hyperdiploid MM). Mutations were often present in subclonal populations, and multiple mutations within the same pathway (e.g. KRAS, NRAS and BRAF) were observed in the same patient. In vitro modeling predicts only partial treatment efficacy of targeting subclonal mutations, and even growth promotion of non-mutated subclones in some cases. These results emphasize the importance of heterogeneity analysis for treatment decisions. PMID:24434212
Widespread genetic heterogeneity in multiple myeloma: implications for targeted therapy.
Lohr, Jens G; Stojanov, Petar; Carter, Scott L; Cruz-Gordillo, Peter; Lawrence, Michael S; Auclair, Daniel; Sougnez, Carrie; Knoechel, Birgit; Gould, Joshua; Saksena, Gordon; Cibulskis, Kristian; McKenna, Aaron; Chapman, Michael A; Straussman, Ravid; Levy, Joan; Perkins, Louise M; Keats, Jonathan J; Schumacher, Steven E; Rosenberg, Mara; Getz, Gad; Golub, Todd R
2014-01-13
We performed massively parallel sequencing of paired tumor/normal samples from 203 multiple myeloma (MM) patients and identified significantly mutated genes and copy number alterations and discovered putative tumor suppressor genes by determining homozygous deletions and loss of heterozygosity. We observed frequent mutations in KRAS (particularly in previously treated patients), NRAS, BRAF, FAM46C, TP53, and DIS3 (particularly in nonhyperdiploid MM). Mutations were often present in subclonal populations, and multiple mutations within the same pathway (e.g., KRAS, NRAS, and BRAF) were observed in the same patient. In vitro modeling predicts only partial treatment efficacy of targeting subclonal mutations, and even growth promotion of nonmutated subclones in some cases. These results emphasize the importance of heterogeneity analysis for treatment decisions. Copyright © 2014 Elsevier Inc. All rights reserved.
Mapping of Gene Expression Reveals CYP27A1 as a Susceptibility Gene for Sporadic ALS
van Rheenen, Wouter; Franke, Lude; Jansen, Ritsert C.; van Es, Michael A.; van Vught, Paul W. J.; Blauw, Hylke M.; Groen, Ewout J. N.; Horvath, Steve; Estrada, Karol; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, Andre G.; Robberecht, Wim; Andersen, Peter M.; Melki, Judith; Meininger, Vincent; Hardiman, Orla; Landers, John E.; Brown, Robert H.; Shatunov, Aleksey; Shaw, Christopher E.; Leigh, P. Nigel; Al-Chalabi, Ammar; Ophoff, Roel A.
2012-01-01
Amyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls) were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls). These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls). Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27×10−51) withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible susceptibility gene for ALS. PMID:22509407
Grimplet, Jérôme; Agudelo-Romero, Patricia; Teixeira, Rita T.; Martinez-Zapater, Jose M.; Fortes, Ana M.
2016-01-01
GRAS transcription factors are involved in many processes of plant growth and development (e.g., axillary shoot meristem formation, root radial patterning, nodule morphogenesis, arbuscular development) as well as in plant disease resistance and abiotic stress responses. However, little information is available concerning this gene family in grapevine (Vitis vinifera L.), an economically important woody crop. We performed a model curation of GRAS genes identified in the latest genome annotation leading to the identification of 52 genes. Gene models were improved and three new genes were identified that could be grapevine- or woody-plant specific. Phylogenetic analysis showed that GRAS genes could be classified into 13 groups that mapped on the 19 V. vinifera chromosomes. Five new subfamilies, previously not characterized in other species, were identified. Multiple sequence alignment showed typical GRAS domain in the proteins and new motifs were also described. As observed in other species, both segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in grapevine. Expression patterns across a variety of tissues and upon abiotic and biotic conditions revealed possible divergent functions of GRAS genes in grapevine development and stress responses. By comparing the information available for tomato and grapevine GRAS genes, we identified candidate genes that might constitute conserved transcriptional regulators of both climacteric and non-climacteric fruit ripening. Altogether this study provides valuable information and robust candidate genes for future functional analysis aiming at improving the quality of fleshy fruits. PMID:27065316
Zhang, Qingrun; Long, Quan; Ott, Jurg
2014-06-01
Identifying gene-gene interaction is a hot topic in genome wide association studies. Two fundamental challenges are: (1) how to smartly identify combinations of variants that may be associated with the trait from astronomical number of all possible combinations; and (2) how to test epistatic interaction when all potential combinations are available. We developed AprioriGWAS, which brings two innovations. (1) Based on Apriori, a successful method in field of Frequent Itemset Mining (FIM) in which a pattern growth strategy is leveraged to effectively and accurately reduce search space, AprioriGWAS can efficiently identify genetically associated genotype patterns. (2) To test the hypotheses of epistasis, we adopt a new conditional permutation procedure to obtain reliable statistical inference of Pearson's chi-square test for the [Formula: see text] contingency table generated by associated variants. By applying AprioriGWAS to age-related macular degeneration (AMD) data, we found that: (1) angiopoietin 1 (ANGPT1) and four retinal genes interact with Complement Factor H (CFH). (2) GO term "glycosaminoglycan biosynthetic process" was enriched in AMD interacting genes. The epistatic interactions newly found by AprioriGWAS on AMD data are likely true interactions, since genes interacting with CFH are retinal genes, and GO term enrichment also verified that interaction between glycosaminoglycans (GAGs) and CFH plays an important role in disease pathology of AMD. By applying AprioriGWAS on Bipolar disorder in WTCCC data, we found variants without marginal effect show significant interactions. For example, multiple-SNP genotype patterns inside gene GABRB2 and GRIA1 (AMPA subunit 1 receptor gene). AMPARs are found in many parts of the brain and are the most commonly found receptor in the nervous system. The GABRB2 mediates the fastest inhibitory synaptic transmission in the central nervous system. GRIA1 and GABRB2 are relevant to mental disorders supported by multiple evidences.
Smith, Milo R; Glicksberg, Benjamin S; Li, Li; Chen, Rong; Morishita, Hirofumi; Dudley, Joel T
2018-01-01
High and increasing prevalence of neurodevelopmental disorders place enormous personal and economic burdens on society. Given the growing realization that the roots of neurodevelopmental disorders often lie in early childhood, there is an urgent need to identify childhood risk factors. Neurodevelopment is marked by periods of heightened experience-dependent neuroplasticity wherein neural circuitry is optimized by the environment. If these critical periods are disrupted, development of normal brain function can be permanently altered, leading to neurodevelopmental disorders. Here, we aim to systematically identify human variants in neuroplasticity-related genes that confer risk for neurodevelopmental disorders. Historically, this knowledge has been limited by a lack of techniques to identify genes related to neurodevelopmental plasticity in a high-throughput manner and a lack of methods to systematically identify mutations in these genes that confer risk for neurodevelopmental disorders. Using an integrative genomics approach, we determined loss-of-function (LOF) variants in putative plasticity genes, identified from transcriptional profiles of brain from mice with elevated plasticity, that were associated with neurodevelopmental disorders. From five shared differentially expressed genes found in two mouse models of juvenile-like elevated plasticity (juvenile wild-type or adult Lynx1-/- relative to adult wild-type) that were also genotyped in the Mount Sinai BioMe Biobank we identified multiple associations between LOF genes and increased risk for neurodevelopmental disorders across 10,510 patients linked to the Mount Sinai Electronic Medical Records (EMR), including epilepsy and schizophrenia. This work demonstrates a novel approach to identify neurodevelopmental risk genes and points toward a promising avenue to discover new drug targets to address the unmet therapeutic needs of neurodevelopmental disease.
The WRKY transcription factor family and senescence in switchgrass.
Rinerson, Charles I; Scully, Erin D; Palmer, Nathan A; Donze-Reiner, Teresa; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Sattler, Scott E; Rohila, Jai S; Sarath, Gautam; Rushton, Paul J
2015-11-09
Early aerial senescence in switchgrass (Panicum virgatum) can significantly limit biomass yields. WRKY transcription factors that can regulate senescence could be used to reprogram senescence and enhance biomass yields. All potential WRKY genes present in the version 1.0 of the switchgrass genome were identified and curated using manual and bioinformatic methods. Expression profiles of WRKY genes in switchgrass flag leaf RNA-Seq datasets were analyzed using clustering and network analyses tools to identify both WRKY and WRKY-associated gene co-expression networks during leaf development and senescence onset. We identified 240 switchgrass WRKY genes including members of the RW5 and RW6 families of resistance proteins. Weighted gene co-expression network analysis of the flag leaf transcriptomes across development readily separated clusters of co-expressed genes into thirteen modules. A visualization highlighted separation of modules associated with the early and senescence-onset phases of flag leaf growth. The senescence-associated module contained 3000 genes including 23 WRKYs. Putative promoter regions of senescence-associated WRKY genes contained several cis-element-like sequences suggestive of responsiveness to both senescence and stress signaling pathways. A phylogenetic comparison of senescence-associated WRKY genes from switchgrass flag leaf with senescence-associated WRKY genes from other plants revealed notable hotspots in Group I, IIb, and IIe of the phylogenetic tree. We have identified and named 240 WRKY genes in the switchgrass genome. Twenty three of these genes show elevated mRNA levels during the onset of flag leaf senescence. Eleven of the WRKY genes were found in hotspots of related senescence-associated genes from multiple species and thus represent promising targets for future switchgrass genetic improvement. Overall, individual WRKY gene expression profiles could be readily linked to developmental stages of flag leaves.
Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K
2016-04-18
Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.
A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.
Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris
2008-04-01
Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.
Jakubowska, Agata K; Peters, Sander A; Ziemnicka, Jadwiga; Vlak, Just M; van Oers, Monique M
2006-03-01
The genome sequence of a Polish isolate of Agrotis segetum nucleopolyhedrovirus (AgseNPV-A) was determined and analysed. The circular genome is composed of 147,544 bp and has a G+C content of 45.7 mol%. It contains 153 putative, non-overlapping open reading frames (ORFs) encoding predicted proteins of more than 50 aa, together making up 89.8 % of the genome. The remaining 10.2 % of the DNA constitutes non-coding regions and homologous-repeat regions. One hundred and forty-three AgseNPV-A ORFs are homologues of previously reported baculovirus gene sequences. There are ten unique ORFs and they account for 3 % of the genome in total. All 62 lepidopteran baculovirus genes, including the 29 core baculovirus genes, were found in the AgseNPV-A genome. The gene content and gene order of AgseNPV-A are most similar to those of Spodoptera exigua (Se) multiple NPV and their shared homologous genes are 100 % collinear. Three putative enhancin genes were identified in the AgseNPV-A genome. In phylogenetic analysis, the AgseNPV-A enhancins form a cluster separated from enhancins of the Mamestra species NPVs.
Naito, Junko; Kaji, Hiroshi; Sowa, Hideaki; Kitazawa, Riko; Kitazawa, Sohei; Tsukada, Toshihiko; Hendy, Geoffrey N; Sugimoto, Toshitsugu; Chihara, Kazuo
2006-06-01
In some patients with multiple endocrine neoplasia type 1 (MEN1) it is not possible to identify a germline mutation in the MEN1 gene. We sought to document the loss of expression and function of the MEN1 gene product, menin, in the tumors of such a patient. The proband is an elderly female patient with primary hyperparathyroidism, pancreatic islet tumor, and breast cancer. Her son has primary hyperparathyroidism. No germline MEN1 mutation was identified in the proband or her son. However, loss of heterozygosity at the MEN1 locus and complete lack of menin expression were demonstrated in the proband's tumor tissue. The proband's cultured parathyroid cells lacked the normal reduction in proliferation and parathyroid hormone secretion in response to transforming growth factor- beta. This assessment provided insight into the molecular pathogenesis of the patient and provides evidence for a critical requirement for menin in the antiproliferative action of transforming growth factor-beta.
Mulumba–Mfumu, Leopold K.; Achenbach, Jenna E.; Mauldin, Matthew R.; Dixon, Linda K.; Tshilenge, Curé Georges; Thiry, Etienne; Moreno, Noelia; Blanco, Esther; Saegerman, Claude; Lamien, Charles E.; Diallo, Adama
2017-01-01
African swine fever (ASF) is a devastating disease of domestic pigs. It is a socioeconomically important disease, initially described from Kenya, but subsequently reported in most Sub-Saharan countries. ASF spread to Europe, South America and the Caribbean through multiple introductions which were initially eradicated—except for Sardinia—followed by re‑introduction into Europe in 2007. In this study of ASF within the Democratic Republic of the Congo, 62 domestic pig samples, collected between 2005–2012, were examined for viral DNA and sequencing at multiple loci: C-terminus of the B646L gene (p72 protein), central hypervariable region (CVR) of the B602L gene, and the E183L gene (p54 protein). Phylogenetic analyses identified three circulating genotypes: I (64.5% of samples), IX (32.3%), and XIV (3.2%). This is the first evidence of genotypes IX and XIV within this country. Examination of the CVR revealed high levels of intra-genotypic variation, with 19 identified variants. PMID:28218698
The genetic structure of the A mating-type locus of Lentinula edodes.
Au, Chun Hang; Wong, Man Chun; Bao, Dapeng; Zhang, Meiyan; Song, Chunyan; Song, Wenhua; Law, Patrick Tik Wan; Kües, Ursula; Kwan, Hoi Shan
2014-02-10
The Shiitake mushroom, Lentinula edodes (Berk.) Pegler is a tetrapolar basidiomycete with two unlinked mating-type loci, commonly called the A and B loci. Identifying the mating-types in shiitake is important for enhancing the breeding and cultivation of this economically-important edible mushroom. Here, we identified the A mating-type locus from the first draft genome sequence of L. edodes and characterized multiple alleles from different monokaryotic strains. Two intron-length polymorphism markers were developed to facilitate rapid molecular determination of A mating-type. L. edodes sequences were compared with those of known tetrapolar and bipolar basidiomycete species. The A mating-type genes are conserved at the homeodomain region across the order Agaricales. However, we observed unique genomic organization of the locus in L. edodes which exhibits atypical gene order and multiple repetitive elements around its A locus. To our knowledge, this is the first known exception among Homobasidiomycetes, in which the mitochondrial intermediate peptidase (mip) gene is not closely linked to A locus. Copyright © 2013 Elsevier B.V. All rights reserved.
Mulumba-Mfumu, Leopold K; Achenbach, Jenna E; Mauldin, Matthew R; Dixon, Linda K; Tshilenge, Curé Georges; Thiry, Etienne; Moreno, Noelia; Blanco, Esther; Saegerman, Claude; Lamien, Charles E; Diallo, Adama
2017-02-18
African swine fever (ASF) is a devastating disease of domestic pigs. It is a socioeconomically important disease, initially described from Kenya, but subsequently reported in most Sub-Saharan countries. ASF spread to Europe, South America and the Caribbean through multiple introductions which were initially eradicated-except for Sardinia-followed by re‑introduction into Europe in 2007. In this study of ASF within the Democratic Republic of the Congo, 62 domestic pig samples, collected between 2005-2012, were examined for viral DNA and sequencing at multiple loci: C-terminus of the B646L gene (p72 protein), central hypervariable region (CVR) of the B602L gene, and the E183L gene (p54 protein). Phylogenetic analyses identified three circulating genotypes: I (64.5% of samples), IX (32.3%), and XIV (3.2%). This is the first evidence of genotypes IX and XIV within this country. Examination of the CVR revealed high levels of intra-genotypic variation, with 19 identified variants.
Turner, Leslie M; Harr, Bettina
2014-12-09
Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone.
Transcriptome analysis of trigeminal ganglia following masseter muscle inflammation in rats
Park, Jennifer; Asgar, Jamila; Ro, Jin Y.
2016-01-01
Background Chronic pain in masticatory muscles is a major medical problem. Although mechanisms underlying persistent pain in masticatory muscles are not fully understood, sensitization of nociceptive primary afferents following muscle inflammation or injury contributes to muscle hyperalgesia. It is well known that craniofacial muscle injury or inflammation induces regulation of multiple genes in trigeminal ganglia, which is associated with muscle hyperalgesia. However, overall transcriptional profiles within trigeminal ganglia following masseter inflammation have not yet been determined. In the present study, we performed RNA sequencing assay in rat trigeminal ganglia to identify transcriptome profiles of genes relevant to hyperalgesia following inflammation of the rat masseter muscle. Results Masseter inflammation differentially regulated >3500 genes in trigeminal ganglia. Predominant biological pathways were predicted to be related with activation of resident non-neuronal cells within trigeminal ganglia or recruitment of immune cells. To focus our analysis on the genes more relevant to nociceptors, we selected genes implicated in pain mechanisms, genes enriched in small- to medium-sized sensory neurons, and genes enriched in TRPV1-lineage nociceptors. Among the 2320 candidate genes, 622 genes showed differential expression following masseter inflammation. When the analysis was limited to these candidate genes, pathways related with G protein-coupled signaling and synaptic plasticity were predicted to be enriched. Inspection of individual gene expression changes confirmed the transcriptional changes of multiple nociceptor genes associated with masseter hyperalgesia (e.g., Trpv1, Trpa1, P2rx3, Tac1, and Bdnf) and also suggested a number of novel probable contributors (e.g., Piezo2, Tmem100, and Hdac9). Conclusion These findings should further advance our understanding of peripheral mechanisms involved in persistent craniofacial muscle pain conditions and provide a rational basis for identifying novel genes or sets of genes that can be potentially targeted for treating such conditions. PMID:27702909
Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert
2013-01-01
Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088
Charlesworth, Jac C; Peralta, Juan M; Drigalenko, Eugene; Göring, Harald Hh; Almasy, Laura; Dyer, Thomas D; Blangero, John
2009-12-15
Gene identification using linkage, association, or genome-wide expression is often underpowered. We propose that formal combination of information from multiple gene-identification approaches may lead to the identification of novel loci that are missed when only one form of information is available. Firstly, we analyze the Genetic Analysis Workshop 16 Framingham Heart Study Problem 2 genome-wide association data for HDL-cholesterol using a "gene-centric" approach. Then we formally combine the association test results with genome-wide transcriptional profiling data for high-density lipoprotein cholesterol (HDL-C), from the San Antonio Family Heart Study, using a Z-transform test (Stouffer's method). We identified 39 genes by the joint test at a conservative 1% false-discovery rate, including 9 from the significant gene-based association test and 23 whose expression was significantly correlated with HDL-C. Seven genes identified as significant in the joint test were not independently identified by either the association or expression tests. This combined approach has increased power and leads to the direct nomination of novel candidate genes likely to be involved in the determination of HDL-C levels. Such information can then be used as justification for a more exhaustive search for functional sequence variation within the nominated genes. We anticipate that this type of analysis will improve our speed of identification of regulatory genes causally involved in disease risk.
Farber, Charles R; van Nas, Atila; Ghazalpour, Anatole; Aten, Jason E; Doss, Sudheer; Sos, Brandon; Schadt, Eric E; Ingram-Drake, Leslie; Davis, Richard C; Horvath, Steve; Smith, Desmond J; Drake, Thomas A; Lusis, Aldons J
2009-01-01
Numerous quantitative trait loci (QTLs) affecting bone traits have been identified in the mouse; however, few of the underlying genes have been discovered. To improve the process of transitioning from QTL to gene, we describe an integrative genetics approach, which combines linkage analysis, expression QTL (eQTL) mapping, causality modeling, and genetic association in outbred mice. In C57BL/6J × C3H/HeJ (BXH) F2 mice, nine QTLs regulating femoral BMD were identified. To select candidate genes from within each QTL region, microarray gene expression profiles from individual F2 mice were used to identify 148 genes whose expression was correlated with BMD and regulated by local eQTLs. Many of the genes that were the most highly correlated with BMD have been previously shown to modulate bone mass or skeletal development. Candidates were further prioritized by determining whether their expression was predicted to underlie variation in BMD. Using network edge orienting (NEO), a causality modeling algorithm, 18 of the 148 candidates were predicted to be causally related to differences in BMD. To fine-map QTLs, markers in outbred MF1 mice were tested for association with BMD. Three chromosome 11 SNPs were identified that were associated with BMD within the Bmd11 QTL. Finally, our approach provides strong support for Wnt9a, Rasd1, or both underlying Bmd11. Integration of multiple genetic and genomic data sets can substantially improve the efficiency of QTL fine-mapping and candidate gene identification. PMID:18767929
MAGMA: Generalized Gene-Set Analysis of GWAS Data
de Leeuw, Christiaan A.; Mooij, Joris M.; Heskes, Tom; Posthuma, Danielle
2015-01-01
By aggregating data for complex traits in a biologically meaningful way, gene and gene-set analysis constitute a valuable addition to single-marker analysis. However, although various methods for gene and gene-set analysis currently exist, they generally suffer from a number of issues. Statistical power for most methods is strongly affected by linkage disequilibrium between markers, multi-marker associations are often hard to detect, and the reliance on permutation to compute p-values tends to make the analysis computationally very expensive. To address these issues we have developed MAGMA, a novel tool for gene and gene-set analysis. The gene analysis is based on a multiple regression model, to provide better statistical performance. The gene-set analysis is built as a separate layer around the gene analysis for additional flexibility. This gene-set analysis also uses a regression structure to allow generalization to analysis of continuous properties of genes and simultaneous analysis of multiple gene sets and other gene properties. Simulations and an analysis of Crohn’s Disease data are used to evaluate the performance of MAGMA and to compare it to a number of other gene and gene-set analysis tools. The results show that MAGMA has significantly more power than other tools for both the gene and the gene-set analysis, identifying more genes and gene sets associated with Crohn’s Disease while maintaining a correct type 1 error rate. Moreover, the MAGMA analysis of the Crohn’s Disease data was found to be considerably faster as well. PMID:25885710
MAGMA: generalized gene-set analysis of GWAS data.
de Leeuw, Christiaan A; Mooij, Joris M; Heskes, Tom; Posthuma, Danielle
2015-04-01
By aggregating data for complex traits in a biologically meaningful way, gene and gene-set analysis constitute a valuable addition to single-marker analysis. However, although various methods for gene and gene-set analysis currently exist, they generally suffer from a number of issues. Statistical power for most methods is strongly affected by linkage disequilibrium between markers, multi-marker associations are often hard to detect, and the reliance on permutation to compute p-values tends to make the analysis computationally very expensive. To address these issues we have developed MAGMA, a novel tool for gene and gene-set analysis. The gene analysis is based on a multiple regression model, to provide better statistical performance. The gene-set analysis is built as a separate layer around the gene analysis for additional flexibility. This gene-set analysis also uses a regression structure to allow generalization to analysis of continuous properties of genes and simultaneous analysis of multiple gene sets and other gene properties. Simulations and an analysis of Crohn's Disease data are used to evaluate the performance of MAGMA and to compare it to a number of other gene and gene-set analysis tools. The results show that MAGMA has significantly more power than other tools for both the gene and the gene-set analysis, identifying more genes and gene sets associated with Crohn's Disease while maintaining a correct type 1 error rate. Moreover, the MAGMA analysis of the Crohn's Disease data was found to be considerably faster as well.
Hodgins, Kathryn A; Bock, Dan G; Hahn, Min A; Heredia, Sylvia M; Turner, Kathryn G; Rieseberg, Loren H
2015-05-01
Asteraceae, the largest family of flowering plants, has given rise to many notorious invasive species. Using publicly available transcriptome assemblies from 35 Asteraceae, including six major invasive species, we examined evidence for micro- and macro-evolutionary genomic changes associated with invasion. To detect episodes of positive selection repeated across multiple introductions, we conducted comparisons between native and introduced genotypes from six focal species and identified genes with elevated rates of amino acid change (dN/dS). We then looked for evidence of positive selection at a broader phylogenetic scale across all taxa. As invasive species may experience founder events during colonization and spread, we also looked for evidence of increased genetic load in introduced genotypes. We rarely found evidence for parallel changes in orthologous genes in the intraspecific comparisons, but in some cases we identified changes in members of the same gene family. Using among-species comparisons, we detected positive selection in 0.003-0.69% and 2.4-7.8% of the genes using site and stochastic branch-site models, respectively. These genes had diverse putative functions, including defence response, stress response and herbicide resistance, although there was no clear pattern in the GO terms. There was no indication that introduced genotypes have a higher proportion of deleterious alleles than native genotypes in the six focal species, suggesting multiple introductions and admixture mitigated the impact of drift. Our findings provide little evidence for common genomic responses in invasive taxa of the Asteraceae and hence suggest that multiple evolutionary pathways may lead to adaptation during introduction and spread in these species. © 2014 John Wiley & Sons Ltd.
Identification of five novel modifier loci of ApcMin harbored in the BXH14 recombinant inbred strain
Siracusa, Linda D.
2012-01-01
Every year thousands of people in the USA are diagnosed with small intestine and colorectal cancers (CRC). Although environmental factors affect disease etiology, uncovering underlying genetic factors is imperative for risk assessment and developing preventative therapies. Familial adenomatous polyposis is a heritable genetic disorder in which individuals carry germ-line mutations in the adenomatous polyposis coli (APC) gene that predisposes them to CRC. The Apc Min mouse model carries a point mutation in the Apc gene and develops polyps along the intestinal tract. Inbred strain background influences polyp phenotypes in Apc Min mice. Several Modifier of Min (Mom) loci that alter tumor phenotypes associated with the Apc Min mutation have been identified to date. We screened BXH recombinant inbred (RI) strains by crossing BXH RI females with C57BL/6J (B6) Apc Min males and quantitating tumor phenotypes in backcross progeny. We found that the BXH14 RI strain harbors five modifier loci that decrease polyp multiplicity. Furthermore, we show that resistance is determined by varying combinations of these modifier loci. Gene interaction network analysis shows that there are multiple networks with proven gene–gene interactions, which contain genes from all five modifier loci. We discuss the implications of this result for studies that define susceptibility loci, namely that multiple networks may be acting concurrently to alter tumor phenotypes. Thus, the significance of this work resides not only with the modifier loci we identified but also with the combinations of loci needed to get maximal protection against polyposis and the impact of this finding on human disease studies. Abbreviations:APCadenomatous polyposis coliGWASgenome-wide association studiesQTLquantitative trait lociSNPsingle-nucleotide polymorphism. PMID:22637734
Banker, Sarah E; Wade, Elizabeth J; Simon, Chris
2017-11-01
Phylogenetic studies of multiple independently inherited nuclear genes considered in combination with patterns of inheritance of organelle DNA have provided considerable insight into the history of species evolution. In particular, investigations of cicadas in the New Zealand genus Kikihia have identified interesting cases where mitochondrial DNA (mtDNA) crosses species boundaries in some species pairs but not others. Previous phylogenetic studies focusing on mtDNA largely corroborated Kikihia species groups identified by song, morphology and ecology with the exception of a unique South Island mitochondrial haplotype clade-the Westlandica group. This newly identified group consists of diverse taxa previously classified as belonging to three different sub-generic clades. We sequenced five nuclear loci from multiple individuals from every species of Kikihia to assess the nuclear gene concordance for this newly-identified mtDNA lineage. Bayes Factor analysis of the constrained phylogeny suggests some support for the mtDNA-based hypotheses, despite the fact that neither concatenation nor multiple species tree methods resolve the Westlandica group as monophyletic. The nuclear analyses suggest a geographic distinction between clearly defined monophyletic North Island clades and unresolved South Island clades. We suggest that more extreme habitat modification on South Island during the Pliocene and Pleistocene resulted in secondary contact and hybridization between species pairs and a series of mitochondrial capture events followed by subsequent lineage evolution. Copyright © 2017 Elsevier Inc. All rights reserved.
Identifying cooperative transcriptional regulations using protein–protein interactions
Nagamine, Nobuyoshi; Kawada, Yuji; Sakakibara, Yasubumi
2005-01-01
Cooperative transcriptional activations among multiple transcription factors (TFs) are important to understand the mechanisms of complex transcriptional regulations in eukaryotes. Previous studies have attempted to find cooperative TFs based on gene expression data with gene expression profiles as a measure of similarity of gene regulations. In this paper, we use protein–protein interaction data to infer synergistic binding of cooperative TFs. Our fundamental idea is based on the assumption that genes contributing to a similar biological process are regulated under the same control mechanism. First, the protein–protein interaction networks are used to calculate the similarity of biological processes among genes. Second, we integrate this similarity and the chromatin immuno-precipitation data to identify cooperative TFs. Our computational experiments in yeast show that predictions made by our method have successfully identified eight pairs of cooperative TFs that have literature evidences but could not be identified by the previous method. Further, 12 new possible pairs have been inferred and we have examined the biological relevances for them. However, since a typical problem using protein–protein interaction data is that many false-positive data are contained, we propose a method combining various biological data to increase the prediction accuracy. PMID:16126847
Hormone-Related Pathways and Risk of Breast Cancer Subtypes in African American Women
Haddad, Stephen A.; Lunetta, Kathryn L.; Ruiz-Narváez, Edward A.; Bensen, Jeannette T.; Hong, Chi-Chen; Sucheston-Campbell, Lara E.; Yao, Song; Bandera, Elisa V.; Rosenberg, Lynn; Haiman, Christopher A.; Troester, Melissa A.; Ambrosone, Christine B.; Palmer, Julie R.
2016-01-01
Purpose We sought to investigate genetic variation in hormone pathways in relation to risk of overall and subtype-specific breast cancer in women of African ancestry (AA). Methods Genotyping and imputation yielded data on 143,934 SNPs in 308 hormone-related genes for 3663 breast cancer cases (1098 ER-, 1983 ER+, 582 ER unknown) and 4687 controls from the African American Breast Cancer Epidemiology and Risk (AMBER) Consortium. AMBER includes data from four large studies of AA women: the Carolina Breast Cancer Study, the Women's Circle of Health Study, the Black Women's Health Study, and the Multiethnic Cohort Study. Pathway- and gene-based analyses were conducted, and single SNP tests were run for the top genes. Results There were no strong associations at the pathway level. The most significantly associated genes were GHRH, CALM2, CETP, and AKR1C1 for overall breast cancer (gene-based nominal p ≤0.01); NR0B1, IGF2R, CALM2, CYP1B1, and GRB2 for ER+ breast cancer (p ≤0.02); and PGR, MAPK3, MAP3K1, and LHCGR for ER- disease (p ≤0.02). Single-SNP tests for SNPs with pairwise linkage disequilibrium r2 <0.8 in the top genes identified 12 common SNPs (in CALM2, CETP, NR0B1, IGF2R, CYP1B1, PGR, MAPK3, and MAP3K1) associated with overall or subtype-specific breast cancer after gene-level correction for multiple testing. Rs11571215 in PGR (progesterone receptor) was the SNP most strongly associated with ER- disease. Conclusion We identified eight genes in hormone pathways that contain common variants associated with breast cancer in AA women after gene-level correction for multiple testing. PMID:26458823
Lee, A Yeong; Park, Won; Kang, Tae-Wook; Cha, Min Ho; Chun, Jin Mi
2018-07-15
Yijin-Tang (YJT) is a traditional prescription for the treatment of hyperlipidaemia, atherosclerosis and other ailments related to dampness phlegm, a typical pathological symptom of abnormal body fluid metabolism in Traditional Korean Medicine. However, a holistic network pharmacology approach to understanding the therapeutic mechanisms underlying hyperlipidaemia and atherosclerosis has not been pursued. To examine the network pharmacological potential effects of YJT on hyperlipidaemia and atherosclerosis, we analysed components, performed target prediction and network analysis, and investigated interacting pathways using a network pharmacology approach. Information on compounds in herbal medicines was obtained from public databases, and oral bioavailability and drug-likeness was screened using absorption, distribution, metabolism, and excretion (ADME) criteria. Correlations between compounds and genes were linked using the STITCH database, and genes related to hyperlipidaemia and atherosclerosis were gathered using the GeneCards database. Human genes were identified and subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Network analysis identified 447 compounds in five herbal medicines that were subjected to ADME screening, and 21 compounds and 57 genes formed the main pathways linked to hyperlipidaemia and atherosclerosis. Among them, 10 compounds (naringenin, nobiletin, hesperidin, galangin, glycyrrhizin, homogentisic acid, stigmasterol, 6-gingerol, quercetin and glabridin) were linked to more than four genes, and are bioactive compounds and key chemicals. Core genes in this network were CASP3, CYP1A1, CYP1A2, MMP2 and MMP9. The compound-target gene network revealed close interactions between multiple components and multiple targets, and facilitates a better understanding of the potential therapeutic effects of YJT. Pharmacological network analysis can help to explain the potential effects of YJT for treating dampness phlegm-related diseases such as hyperlipidaemia and atherosclerosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Simms, Amy N.; Mobley, Harry L. T.
2008-01-01
Two surface organelles of uropathogenic Escherichia coli (UPEC), flagella and type 1 fimbriae, are critical for colonization of the urinary tract but mediate opposite actions. Flagella propel bacteria through urine and along mucus layers, while type 1 fimbriae allow bacteria to adhere to specific receptors present on uroepithelial cells. Constitutive expression of type 1 fimbriae leads to repression of motility and chemotaxis in UPEC strain CFT073, suggesting that UPEC may coordinately regulate motility and adherence. To identify genes involved in this regulation of motility by type 1 fimbriae, transposon mutagenesis was performed on a phase-locked type 1 fimbrial ON variant of strain CFT073 (CFT073 fim L-ON), followed by a screen for restoration of motility in soft agar. Functions of the genes identified included attachment, metabolism, transport, DNA mismatch repair, and transcriptional regulation, and a number of genes had hypothetical function. Isogenic deletion mutants of these genes were also constructed in CFT073 fim L-ON. Motility was partially restored in six of these mutants, including complementable mutations in four genes encoding known transcriptional regulators, lrhA, lrp, slyA, and papX; a mismatch repair gene, mutS; and one hypothetical gene, ydiV. Type 1 fimbrial expression in these mutants was unaltered, and the majority of these mutants expressed larger amounts of flagellin than the fim L-ON parental strain. Our results indicate that repression of motility in CFT073 fim L-ON is not solely due to the constitutive expression of type 1 fimbriae on the surfaces of the bacteria and that multiple genes may contribute to this repression. PMID:18359812
Hu, Wei; Xia, Zhiqiang; Yan, Yan; Ding, Zehong; Tie, Weiwei; Wang, Lianzhe; Zou, Meiling; Wei, Yunxie; Lu, Cheng; Hou, Xiaowan; Wang, Wenquan; Peng, Ming
2015-01-01
Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs) have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava. PMID:26579161
Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui
2011-09-01
Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6')-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6')-Ib-cr, armA, and bla(DHA-1) were all identified on these self-transferable bla(CTX-M)-carrying plasmids. The genetic environments of ISCR1 associated with armA, bla(DHA-1), and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study.
Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji
2010-07-01
We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements
Hayes, James E.; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J.
2015-01-01
Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin’s lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well. PMID:26422229
Macrodontia, shovel-shaped incisors, and multituberculism: probable Ekman-Westborg-Julin trait.
Reardon, Gayle Tieszen; Slayton, L Rebecca; Norby, Clinton; Geneser, Teresa
2012-01-01
Multiple macrodontia is a rare finding and is defined as a condition in which a tooth is significantly larger than normal. Macrodontia may occur as an isolated finding, part of a group of dental anomalies, or as a component of a syndrome with multiple oral and systemic manifestations. The purpose of this paper was to report a case of macrodontia affecting all permanent teeth and exhibiting shovel-shaped maxillary and mandibular incisors and multituberculate molars and premolars. Some or all of this patient's characteristics have been reported in both males and females, with a ratio of 5:2. No inheritance pattern has been established, as these traits have generally occurred spontaneously. As more individuals are identified and as molecular techniques continue to advance, it is probable that a gene or genes responsible for macrodontia and the associated traits will be identified.
Functional Regression Models for Epistasis Analysis of Multiple Quantitative Traits.
Zhang, Futao; Xie, Dan; Liang, Meimei; Xiong, Momiao
2016-04-01
To date, most genetic analyses of phenotypes have focused on analyzing single traits or analyzing each phenotype independently. However, joint epistasis analysis of multiple complementary traits will increase statistical power and improve our understanding of the complicated genetic structure of the complex diseases. Despite their importance in uncovering the genetic structure of complex traits, the statistical methods for identifying epistasis in multiple phenotypes remains fundamentally unexplored. To fill this gap, we formulate a test for interaction between two genes in multiple quantitative trait analysis as a multiple functional regression (MFRG) in which the genotype functions (genetic variant profiles) are defined as a function of the genomic position of the genetic variants. We use large-scale simulations to calculate Type I error rates for testing interaction between two genes with multiple phenotypes and to compare the power with multivariate pairwise interaction analysis and single trait interaction analysis by a single variate functional regression model. To further evaluate performance, the MFRG for epistasis analysis is applied to five phenotypes of exome sequence data from the NHLBI's Exome Sequencing Project (ESP) to detect pleiotropic epistasis. A total of 267 pairs of genes that formed a genetic interaction network showed significant evidence of epistasis influencing five traits. The results demonstrate that the joint interaction analysis of multiple phenotypes has a much higher power to detect interaction than the interaction analysis of a single trait and may open a new direction to fully uncovering the genetic structure of multiple phenotypes.
Ju, Jin Hyun; Crystal, Ronald G.
2017-01-01
Genome-wide expression Quantitative Trait Loci (eQTL) studies in humans have provided numerous insights into the genetics of both gene expression and complex diseases. While the majority of eQTL identified in genome-wide analyses impact a single gene, eQTL that impact many genes are particularly valuable for network modeling and disease analysis. To enable the identification of such broad impact eQTL, we introduce CONFETI: Confounding Factor Estimation Through Independent component analysis. CONFETI is designed to address two conflicting issues when searching for broad impact eQTL: the need to account for non-genetic confounding factors that can lower the power of the analysis or produce broad impact eQTL false positives, and the tendency of methods that account for confounding factors to model broad impact eQTL as non-genetic variation. The key advance of the CONFETI framework is the use of Independent Component Analysis (ICA) to identify variation likely caused by broad impact eQTL when constructing the sample covariance matrix used for the random effect in a mixed model. We show that CONFETI has better performance than other mixed model confounding factor methods when considering broad impact eQTL recovery from synthetic data. We also used the CONFETI framework and these same confounding factor methods to identify eQTL that replicate between matched twin pair datasets in the Multiple Tissue Human Expression Resource (MuTHER), the Depression Genes Networks study (DGN), the Netherlands Study of Depression and Anxiety (NESDA), and multiple tissue types in the Genotype-Tissue Expression (GTEx) consortium. These analyses identified both cis-eQTL and trans-eQTL impacting individual genes, and CONFETI had better or comparable performance to other mixed model confounding factor analysis methods when identifying such eQTL. In these analyses, we were able to identify and replicate a few broad impact eQTL although the overall number was small even when applying CONFETI. In light of these results, we discuss the broad impact eQTL that have been previously reported from the analysis of human data and suggest that considerable caution should be exercised when making biological inferences based on these reported eQTL. PMID:28505156
Ju, Jin Hyun; Shenoy, Sushila A; Crystal, Ronald G; Mezey, Jason G
2017-05-01
Genome-wide expression Quantitative Trait Loci (eQTL) studies in humans have provided numerous insights into the genetics of both gene expression and complex diseases. While the majority of eQTL identified in genome-wide analyses impact a single gene, eQTL that impact many genes are particularly valuable for network modeling and disease analysis. To enable the identification of such broad impact eQTL, we introduce CONFETI: Confounding Factor Estimation Through Independent component analysis. CONFETI is designed to address two conflicting issues when searching for broad impact eQTL: the need to account for non-genetic confounding factors that can lower the power of the analysis or produce broad impact eQTL false positives, and the tendency of methods that account for confounding factors to model broad impact eQTL as non-genetic variation. The key advance of the CONFETI framework is the use of Independent Component Analysis (ICA) to identify variation likely caused by broad impact eQTL when constructing the sample covariance matrix used for the random effect in a mixed model. We show that CONFETI has better performance than other mixed model confounding factor methods when considering broad impact eQTL recovery from synthetic data. We also used the CONFETI framework and these same confounding factor methods to identify eQTL that replicate between matched twin pair datasets in the Multiple Tissue Human Expression Resource (MuTHER), the Depression Genes Networks study (DGN), the Netherlands Study of Depression and Anxiety (NESDA), and multiple tissue types in the Genotype-Tissue Expression (GTEx) consortium. These analyses identified both cis-eQTL and trans-eQTL impacting individual genes, and CONFETI had better or comparable performance to other mixed model confounding factor analysis methods when identifying such eQTL. In these analyses, we were able to identify and replicate a few broad impact eQTL although the overall number was small even when applying CONFETI. In light of these results, we discuss the broad impact eQTL that have been previously reported from the analysis of human data and suggest that considerable caution should be exercised when making biological inferences based on these reported eQTL.
Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.
Sawcer, Stephen; Hellenthal, Garrett; Pirinen, Matti; Spencer, Chris C A; Patsopoulos, Nikolaos A; Moutsianas, Loukas; Dilthey, Alexander; Su, Zhan; Freeman, Colin; Hunt, Sarah E; Edkins, Sarah; Gray, Emma; Booth, David R; Potter, Simon C; Goris, An; Band, Gavin; Oturai, Annette Bang; Strange, Amy; Saarela, Janna; Bellenguez, Céline; Fontaine, Bertrand; Gillman, Matthew; Hemmer, Bernhard; Gwilliam, Rhian; Zipp, Frauke; Jayakumar, Alagurevathi; Martin, Roland; Leslie, Stephen; Hawkins, Stanley; Giannoulatou, Eleni; D'alfonso, Sandra; Blackburn, Hannah; Martinelli Boneschi, Filippo; Liddle, Jennifer; Harbo, Hanne F; Perez, Marc L; Spurkland, Anne; Waller, Matthew J; Mycko, Marcin P; Ricketts, Michelle; Comabella, Manuel; Hammond, Naomi; Kockum, Ingrid; McCann, Owen T; Ban, Maria; Whittaker, Pamela; Kemppinen, Anu; Weston, Paul; Hawkins, Clive; Widaa, Sara; Zajicek, John; Dronov, Serge; Robertson, Neil; Bumpstead, Suzannah J; Barcellos, Lisa F; Ravindrarajah, Rathi; Abraham, Roby; Alfredsson, Lars; Ardlie, Kristin; Aubin, Cristin; Baker, Amie; Baker, Katharine; Baranzini, Sergio E; Bergamaschi, Laura; Bergamaschi, Roberto; Bernstein, Allan; Berthele, Achim; Boggild, Mike; Bradfield, Jonathan P; Brassat, David; Broadley, Simon A; Buck, Dorothea; Butzkueven, Helmut; Capra, Ruggero; Carroll, William M; Cavalla, Paola; Celius, Elisabeth G; Cepok, Sabine; Chiavacci, Rosetta; Clerget-Darpoux, Françoise; Clysters, Katleen; Comi, Giancarlo; Cossburn, Mark; Cournu-Rebeix, Isabelle; Cox, Mathew B; Cozen, Wendy; Cree, Bruce A C; Cross, Anne H; Cusi, Daniele; Daly, Mark J; Davis, Emma; de Bakker, Paul I W; Debouverie, Marc; D'hooghe, Marie Beatrice; Dixon, Katherine; Dobosi, Rita; Dubois, Bénédicte; Ellinghaus, David; Elovaara, Irina; Esposito, Federica; Fontenille, Claire; Foote, Simon; Franke, Andre; Galimberti, Daniela; Ghezzi, Angelo; Glessner, Joseph; Gomez, Refujia; Gout, Olivier; Graham, Colin; Grant, Struan F A; Guerini, Franca Rosa; Hakonarson, Hakon; Hall, Per; Hamsten, Anders; Hartung, Hans-Peter; Heard, Rob N; Heath, Simon; Hobart, Jeremy; Hoshi, Muna; Infante-Duarte, Carmen; Ingram, Gillian; Ingram, Wendy; Islam, Talat; Jagodic, Maja; Kabesch, Michael; Kermode, Allan G; Kilpatrick, Trevor J; Kim, Cecilia; Klopp, Norman; Koivisto, Keijo; Larsson, Malin; Lathrop, Mark; Lechner-Scott, Jeannette S; Leone, Maurizio A; Leppä, Virpi; Liljedahl, Ulrika; Bomfim, Izaura Lima; Lincoln, Robin R; Link, Jenny; Liu, Jianjun; Lorentzen, Aslaug R; Lupoli, Sara; Macciardi, Fabio; Mack, Thomas; Marriott, Mark; Martinelli, Vittorio; Mason, Deborah; McCauley, Jacob L; Mentch, Frank; Mero, Inger-Lise; Mihalova, Tania; Montalban, Xavier; Mottershead, John; Myhr, Kjell-Morten; Naldi, Paola; Ollier, William; Page, Alison; Palotie, Aarno; Pelletier, Jean; Piccio, Laura; Pickersgill, Trevor; Piehl, Fredrik; Pobywajlo, Susan; Quach, Hong L; Ramsay, Patricia P; Reunanen, Mauri; Reynolds, Richard; Rioux, John D; Rodegher, Mariaemma; Roesner, Sabine; Rubio, Justin P; Rückert, Ina-Maria; Salvetti, Marco; Salvi, Erika; Santaniello, Adam; Schaefer, Catherine A; Schreiber, Stefan; Schulze, Christian; Scott, Rodney J; Sellebjerg, Finn; Selmaj, Krzysztof W; Sexton, David; Shen, Ling; Simms-Acuna, Brigid; Skidmore, Sheila; Sleiman, Patrick M A; Smestad, Cathrine; Sørensen, Per Soelberg; Søndergaard, Helle Bach; Stankovich, Jim; Strange, Richard C; Sulonen, Anna-Maija; Sundqvist, Emilie; Syvänen, Ann-Christine; Taddeo, Francesca; Taylor, Bruce; Blackwell, Jenefer M; Tienari, Pentti; Bramon, Elvira; Tourbah, Ayman; Brown, Matthew A; Tronczynska, Ewa; Casas, Juan P; Tubridy, Niall; Corvin, Aiden; Vickery, Jane; Jankowski, Janusz; Villoslada, Pablo; Markus, Hugh S; Wang, Kai; Mathew, Christopher G; Wason, James; Palmer, Colin N A; Wichmann, H-Erich; Plomin, Robert; Willoughby, Ernest; Rautanen, Anna; Winkelmann, Juliane; Wittig, Michael; Trembath, Richard C; Yaouanq, Jacqueline; Viswanathan, Ananth C; Zhang, Haitao; Wood, Nicholas W; Zuvich, Rebecca; Deloukas, Panos; Langford, Cordelia; Duncanson, Audrey; Oksenberg, Jorge R; Pericak-Vance, Margaret A; Haines, Jonathan L; Olsson, Tomas; Hillert, Jan; Ivinson, Adrian J; De Jager, Philip L; Peltonen, Leena; Stewart, Graeme J; Hafler, David A; Hauser, Stephen L; McVean, Gil; Donnelly, Peter; Compston, Alastair
2011-08-10
Multiple sclerosis is a common disease of the central nervous system in which the interplay between inflammatory and neurodegenerative processes typically results in intermittent neurological disturbance followed by progressive accumulation of disability. Epidemiological studies have shown that genetic factors are primarily responsible for the substantially increased frequency of the disease seen in the relatives of affected individuals, and systematic attempts to identify linkage in multiplex families have confirmed that variation within the major histocompatibility complex (MHC) exerts the greatest individual effect on risk. Modestly powered genome-wide association studies (GWAS) have enabled more than 20 additional risk loci to be identified and have shown that multiple variants exerting modest individual effects have a key role in disease susceptibility. Most of the genetic architecture underlying susceptibility to the disease remains to be defined and is anticipated to require the analysis of sample sizes that are beyond the numbers currently available to individual research groups. In a collaborative GWAS involving 9,772 cases of European descent collected by 23 research groups working in 15 different countries, we have replicated almost all of the previously suggested associations and identified at least a further 29 novel susceptibility loci. Within the MHC we have refined the identity of the HLA-DRB1 risk alleles and confirmed that variation in the HLA-A gene underlies the independent protective effect attributable to the class I region. Immunologically relevant genes are significantly overrepresented among those mapping close to the identified loci and particularly implicate T-helper-cell differentiation in the pathogenesis of multiple sclerosis.
Kavak, Erşen; Ünlü, Mustafa; Nistér, Monica; Koman, Ahmet
2010-01-01
Cancer is among the major causes of human death and its mechanism(s) are not fully understood. We applied a novel meta-analysis approach to multiple sets of merged serial analysis of gene expression and microarray cancer data in order to analyze transcriptome alterations in human cancer. Our methodology, which we denote ‘COgnate Gene Expression patterNing in tumours’ (COGENT), unmasked numerous genes that were differentially expressed in multiple cancers. COGENT detected well-known tumor-associated (TA) genes such as TP53, EGFR and VEGF, as well as many multi-cancer, but not-yet-tumor-associated genes. In addition, we identified 81 co-regulated regions on the human genome (RIDGEs) by using expression data from all cancers. Some RIDGEs (28%) consist of paralog genes while another subset (30%) are specifically dysregulated in tumors but not in normal tissues. Furthermore, a significant number of RIDGEs are associated with GC-rich regions on the genome. All assembled data is freely available online (www.oncoreveal.org) as a tool implementing COGENT analysis of multi-cancer genes and RIDGEs. These findings engender a deeper understanding of cancer biology by demonstrating the existence of a pool of under-studied multi-cancer genes and by highlighting the cancer-specificity of some TA-RIDGEs. PMID:20621981
Planar Cell Polarity Pathway Genes and Risk for Spina Bifida
Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E.; Shaw, Gary M.; Lammer, Edward J.; Finnell, Richard H.
2009-01-01
Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologues of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled and Scrib, two of the homologues of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologues of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted p value<0.01. In conclusion our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. PMID:20101694
Genome-Wide Detection and Analysis of Multifunctional Genes
Pritykin, Yuri; Ghersi, Dario; Singh, Mona
2015-01-01
Many genes can play a role in multiple biological processes or molecular functions. Identifying multifunctional genes at the genome-wide level and studying their properties can shed light upon the complexity of molecular events that underpin cellular functioning, thereby leading to a better understanding of the functional landscape of the cell. However, to date, genome-wide analysis of multifunctional genes (and the proteins they encode) has been limited. Here we introduce a computational approach that uses known functional annotations to extract genes playing a role in at least two distinct biological processes. We leverage functional genomics data sets for three organisms—H. sapiens, D. melanogaster, and S. cerevisiae—and show that, as compared to other annotated genes, genes involved in multiple biological processes possess distinct physicochemical properties, are more broadly expressed, tend to be more central in protein interaction networks, tend to be more evolutionarily conserved, and are more likely to be essential. We also find that multifunctional genes are significantly more likely to be involved in human disorders. These same features also hold when multifunctionality is defined with respect to molecular functions instead of biological processes. Our analysis uncovers key features about multifunctional genes, and is a step towards a better genome-wide understanding of gene multifunctionality. PMID:26436655
An omnibus test for family-based association studies with multiple SNPs and multiple phenotypes.
Lasky-Su, Jessica; Murphy, Amy; McQueen, Matthew B; Weiss, Scott; Lange, Christoph
2010-06-01
We propose an omnibus family-based association test (MFBAT) that can be applied to multiple markers and multiple phenotypes and that has only one degree of freedom. The proposed test statistic extends current FBAT methodology to incorporate multiple markers as well as multiple phenotypes. Using simulation studies, power estimates for the proposed methodology are compared with the standard methodologies. On the basis of these simulations, we find that MFBAT substantially outperforms other methods, including haplotypic approaches and doing multiple tests with single single-nucleotide polymorphisms (SNPs) and single phenotypes. The practical relevance of the approach is illustrated by an application to asthma in which SNP/phenotype combinations are identified and reach overall significance that would not have been identified using other approaches. This methodology is directly applicable to cases in which there are multiple SNPs, such as candidate gene studies, cases in which there are multiple phenotypes, such as expression data, and cases in which there are multiple phenotypes and genotypes, such as genome-wide association studies that incorporate expression profiles as phenotypes. This program is available in the PBAT analysis package.
Genomics screens for metastasis genes
Yan, Jinchun; Huang, Qihong
2014-01-01
Metastasis is responsible for most cancer mortality. The process of metastasis is complex, requiring the coordinated expression and fine regulation of many genes in multiple pathways in both the tumor and host tissues. Identification and characterization of the genetic programs that regulate metastasis is critical to understanding the metastatic process and discovering molecular targets for the prevention and treatment of metastasis. Genomic approaches and functional genomic analyses can systemically discover metastasis genes. In this review, we summarize the genetic tools and methods that have been used to identify and characterize the genes that play critical roles in metastasis. PMID:22684367
Thiopeptide antibiotics stimulate biofilm formation in Bacillus subtilis.
Bleich, Rachel; Watrous, Jeramie D; Dorrestein, Pieter C; Bowers, Albert A; Shank, Elizabeth A
2015-03-10
Bacteria have evolved the ability to produce a wide range of structurally complex natural products historically called "secondary" metabolites. Although some of these compounds have been identified as bacterial communication cues, more frequently natural products are scrutinized for antibiotic activities that are relevant to human health. However, there has been little regard for how these compounds might otherwise impact the physiology of neighboring microbes present in complex communities. Bacillus cereus secretes molecules that activate expression of biofilm genes in Bacillus subtilis. Here, we use imaging mass spectrometry to identify the thiocillins, a group of thiazolyl peptide antibiotics, as biofilm matrix-inducing compounds produced by B. cereus. We found that thiocillin increased the population of matrix-producing B. subtilis cells and that this activity could be abolished by multiple structural alterations. Importantly, a mutation that eliminated thiocillin's antibiotic activity did not affect its ability to induce biofilm gene expression in B. subtilis. We go on to show that biofilm induction appears to be a general phenomenon of multiple structurally diverse thiazolyl peptides and use this activity to confirm the presence of thiazolyl peptide gene clusters in other bacterial species. Our results indicate that the roles of secondary metabolites initially identified as antibiotics may have more complex effects--acting not only as killing agents, but also as specific modulators of microbial cellular phenotypes.
Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.
2009-01-01
Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953
Cooperation and coexpression: How coexpression networks shift in response to multiple mutualists.
Palakurty, Sathvik X; Stinchcombe, John R; Afkhami, Michelle E
2018-04-01
A mechanistic understanding of community ecology requires tackling the nonadditive effects of multispecies interactions, a challenge that necessitates integration of ecological and molecular complexity-namely moving beyond pairwise ecological interaction studies and the "gene at a time" approach to mechanism. Here, we investigate the consequences of multispecies mutualisms for the structure and function of genomewide differential coexpression networks for the first time, using the tractable and ecologically important interaction between legume Medicago truncatula, rhizobia and mycorrhizal fungi. First, we found that genes whose expression is affected nonadditively by multiple mutualists are more highly connected in gene networks than expected by chance and had 94% greater network centrality than genes showing additive effects, suggesting that nonadditive genes may be key players in the widespread transcriptomic responses to multispecies symbioses. Second, multispecies mutualisms substantially changed coexpression network structure of 18 modules of host plant genes and 22 modules of the fungal symbionts' genes, indicating that third-party mutualists can cause significant rewiring of plant and fungal molecular networks. Third, we found that 60% of the coexpressed gene sets that explained variation in plant performance had coexpression structures that were altered by interactive effects of rhizobia and fungi. Finally, an "across-symbiosis" approach identified sets of plant and mycorrhizal genes whose coexpression structure was unique to the multiple mutualist context and suggested coupled responses across the plant-mycorrhizal interaction to rhizobial mutualists. Taken together, these results show multispecies mutualisms have substantial effects on the molecular interactions in host plants, microbes and across symbiotic boundaries. © 2018 John Wiley & Sons Ltd.
Liang, Jingjing; Le, Thu H.; Edwards, Digna R. Velez; Tayo, Bamidele O.; Gaulton, Kyle J.; Lu, Yingchang; Jensen, Richard A.; Chen, Guanjie; Schwander, Karen; McKenzie, Colin A.; Fox, Ervin; Nalls, Michael A.; Young, J. Hunter; Lane, Jacqueline M.; Zhou, Jie; Tang, Hua; Fornage, Myriam; Musani, Solomon K.; Wang, Heming; Forrester, Terrence; Chu, Pei-Lun; Evans, Michele K.; Morrison, Alanna C.; Martin, Lisa W.; Wiggins, Kerri L.; Hui, Qin; Zhao, Wei; Jackson, Rebecca D.; Faul, Jessica D.; Reiner, Alex P.; Bray, Michael; Denny, Joshua C.; Mosley, Thomas H.; Palmas, Walter; Guo, Xiuqing; Polak, Joseph F.; Taylor, Ken D.; Boerwinkle, Eric; Bottinger, Erwin P.; Liu, Kiang; Risch, Neil; Hunt, Steven C.; Kooperberg, Charles; Zonderman, Alan B.; Becker, Diane M.; Cai, Jianwen; Loos, Ruth J. F.; Psaty, Bruce M.; Weir, David R.; Kardia, Sharon L. R.; Arnett, Donna K.; Won, Sungho; Edwards, Todd L.; Redline, Susan; Cooper, Richard S.; Rao, D. C.; Rotimi, Charles; Levy, Daniel; Chakravarti, Aravinda
2017-01-01
Hypertension is a leading cause of global disease, mortality, and disability. While individuals of African descent suffer a disproportionate burden of hypertension and its complications, they have been underrepresented in genetic studies. To identify novel susceptibility loci for blood pressure and hypertension in people of African ancestry, we performed both single and multiple-trait genome-wide association analyses. We analyzed 21 genome-wide association studies comprised of 31,968 individuals of African ancestry, and validated our results with additional 54,395 individuals from multi-ethnic studies. These analyses identified nine loci with eleven independent variants which reached genome-wide significance (P < 1.25×10−8) for either systolic and diastolic blood pressure, hypertension, or for combined traits. Single-trait analyses identified two loci (TARID/TCF21 and LLPH/TMBIM4) and multiple-trait analyses identified one novel locus (FRMD3) for blood pressure. At these three loci, as well as at GRP20/CDH17, associated variants had alleles common only in African-ancestry populations. Functional annotation showed enrichment for genes expressed in immune and kidney cells, as well as in heart and vascular cells/tissues. Experiments driven by these findings and using angiotensin-II induced hypertension in mice showed altered kidney mRNA expression of six genes, suggesting their potential role in hypertension. Our study provides new evidence for genes related to hypertension susceptibility, and the need to study African-ancestry populations in order to identify biologic factors contributing to hypertension. PMID:28498854
Simpson, Julie E; Hosny, Ola; Wharton, Stephen B; Heath, Paul R; Holden, Hazel; Fernando, Malee S; Matthews, Fiona; Forster, Gill; O'Brien, John T; Barber, Robert; Kalaria, Raj N; Brayne, Carol; Shaw, Pamela J; Lewis, Claire E; Ince, Paul G
2009-02-01
White matter lesions (WML) in brain aging are linked to dementia and depression. Ischemia contributes to their pathogenesis but other mechanisms may contribute. We used RNA microarray analysis with functional pathway grouping as an unbiased approach to investigate evidence for additional pathogenetic mechanisms. WML were identified by MRI and pathology in brains donated to the Medical Research Council Cognitive Function and Ageing Study Cognitive Function and Aging Study. RNA was extracted to compare WML with nonlesional white matter samples from cases with lesions (WM[L]), and from cases with no lesions (WM[C]) using RNA microarray and pathway analysis. Functional pathways were validated for selected genes by quantitative real-time polymerase chain reaction and immunocytochemistry. We identified 8 major pathways in which multiple genes showed altered RNA transcription (immune regulation, cell cycle, apoptosis, proteolysis, ion transport, cell structure, electron transport, metabolism) among 502 genes that were differentially expressed in WML compared to WM[C]. In WM[L], 409 genes were altered involving the same pathways. Genes selected to validate this microarray data all showed the expected changes in RNA levels and immunohistochemical expression of protein. WML represent areas with a complex molecular phenotype. From this and previous evidence, WML may arise through tissue ischemia but may also reflect the contribution of additional factors like blood-brain barrier dysfunction. Differential expression of genes in WM[L] compared to WM[C] indicate a "field effect" in the seemingly normal surrounding white matter.
Wu, S W; De Lencastre, H
1999-01-01
Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Riffle, Michael; Merrihew, Gennifer E; Jaschob, Daniel; Sharma, Vagisha; Davis, Trisha N; Noble, William S; MacCoss, Michael J
2015-11-01
Regulation of protein abundance is a critical aspect of cellular function, organism development, and aging. Alternative splicing may give rise to multiple possible proteoforms of gene products where the abundance of each proteoform is independently regulated. Understanding how the abundances of these distinct gene products change is essential to understanding the underlying mechanisms of many biological processes. Bottom-up proteomics mass spectrometry techniques may be used to estimate protein abundance indirectly by sequencing and quantifying peptides that are later mapped to proteins based on sequence. However, quantifying the abundance of distinct gene products is routinely confounded by peptides that map to multiple possible proteoforms. In this work, we describe a technique that may be used to help mitigate the effects of confounding ambiguous peptides and multiple proteoforms when quantifying proteins. We have applied this technique to visualize the distribution of distinct gene products for the whole proteome across 11 developmental stages of the model organism Caenorhabditis elegans. The result is a large multidimensional dataset for which web-based tools were developed for visualizing how translated gene products change during development and identifying possible proteoforms. The underlying instrument raw files and tandem mass spectra may also be downloaded. The data resource is freely available on the web at http://www.yeastrc.org/wormpes/ . Graphical Abstract ᅟ.
NASA Astrophysics Data System (ADS)
Riffle, Michael; Merrihew, Gennifer E.; Jaschob, Daniel; Sharma, Vagisha; Davis, Trisha N.; Noble, William S.; MacCoss, Michael J.
2015-11-01
Regulation of protein abundance is a critical aspect of cellular function, organism development, and aging. Alternative splicing may give rise to multiple possible proteoforms of gene products where the abundance of each proteoform is independently regulated. Understanding how the abundances of these distinct gene products change is essential to understanding the underlying mechanisms of many biological processes. Bottom-up proteomics mass spectrometry techniques may be used to estimate protein abundance indirectly by sequencing and quantifying peptides that are later mapped to proteins based on sequence. However, quantifying the abundance of distinct gene products is routinely confounded by peptides that map to multiple possible proteoforms. In this work, we describe a technique that may be used to help mitigate the effects of confounding ambiguous peptides and multiple proteoforms when quantifying proteins. We have applied this technique to visualize the distribution of distinct gene products for the whole proteome across 11 developmental stages of the model organism Caenorhabditis elegans. The result is a large multidimensional dataset for which web-based tools were developed for visualizing how translated gene products change during development and identifying possible proteoforms. The underlying instrument raw files and tandem mass spectra may also be downloaded. The data resource is freely available on the web at http://www.yeastrc.org/wormpes/.
Spatially coordinated dynamic gene transcription in living pituitary tissue
Featherstone, Karen; Hey, Kirsty; Momiji, Hiroshi; McNamara, Anne V; Patist, Amanda L; Woodburn, Joanna; Spiller, David G; Christian, Helen C; McNeilly, Alan S; Mullins, John J; Finkenstädt, Bärbel F; Rand, David A; White, Michael RH; Davis, Julian RE
2016-01-01
Transcription at individual genes in single cells is often pulsatile and stochastic. A key question emerges regarding how this behaviour contributes to tissue phenotype, but it has been a challenge to quantitatively analyse this in living cells over time, as opposed to studying snap-shots of gene expression state. We have used imaging of reporter gene expression to track transcription in living pituitary tissue. We integrated live-cell imaging data with statistical modelling for quantitative real-time estimation of the timing of switching between transcriptional states across a whole tissue. Multiple levels of transcription rate were identified, indicating that gene expression is not a simple binary ‘on-off’ process. Immature tissue displayed shorter durations of high-expressing states than the adult. In adult pituitary tissue, direct cell contacts involving gap junctions allowed local spatial coordination of prolactin gene expression. Our findings identify how heterogeneous transcriptional dynamics of single cells may contribute to overall tissue behaviour. DOI: http://dx.doi.org/10.7554/eLife.08494.001 PMID:26828110
Willsey, A. Jeremy; Sanders, Stephan J.; Li, Mingfeng; Dong, Shan; Tebbenkamp, Andrew T.; Muhle, Rebecca A.; Reilly, Steven K.; Lin, Leon; Fertuzinhos, Sofia; Miller, Jeremy A.; Murtha, Michael T.; Bichsel, Candace; Niu, Wei; Cotney, Justin; Ercan-Sencicek, A. Gulhan; Gockley, Jake; Gupta, Abha; Han, Wenqi; He, Xin; Hoffman, Ellen; Klei, Lambertus; Lei, Jing; Liu, Wenzhong; Liu, Li; Lu, Cong; Xu, Xuming; Zhu, Ying; Mane, Shrikant M.; Lein, Edward S.; Wei, Liping; Noonan, James P.; Roeder, Kathryn; Devlin, Bernie; Šestan, Nenad; State, Matthew W.
2013-01-01
SUMMARY Autism spectrum disorder (ASD) is a complex developmental syndrome of unknown etiology. Recent studies employing exome- and genome-wide sequencing have identified nine high-confidence ASD (hcASD) genes. Working from the hypothesis that ASD-associated mutations in these biologically pleiotropic genes will disrupt intersecting developmental processes to contribute to a common phenotype, we have attempted to identify time periods, brain regions, and cell types in which these genes converge. We have constructed coexpression networks based on the hcASD “seed” genes, leveraging a rich expression data set encompassing multiple human brain regions across human development and into adulthood. By assessing enrichment of an independent set of probable ASD (pASD) genes, derived from the same sequencing studies, we demonstrate a key point of convergence in midfetal layer 5/6 cortical projection neurons. This approach informs when, where, and in what cell types mutations in these specific genes may be productively studied to clarify ASD pathophysiology. PMID:24267886
Blesson, Chellakkan Selvanesan; Sahlin, Lena
2012-09-25
Estrogens play a role in the regulation of genes associated with inflammation and immunity in neutrophils. Estrogen signalling is mediated by estrogen receptor (ER)α, ERβ, and G-protein-coupled estrogen receptor-1 (GPER). The mechanisms by which estrogen regulate genes in neutrophils are poorly understood. Our aim was to identify the presence of ERs and to characterize estrogen responsive genes in terminally differentiated neutrophil like HL-60 (nHL-60) cells using estradiol and selective ER agonists. ERs were identified by Western blotting and immunocytochemistry. Microarray technique was used to screen for differentially expressed genes and the selected genes were verified by quantitative PCR. We show the presence of functional ERα, ERβ and GPER. Microarray analysis showed the presence of genes that are uniquely regulated by a single ligand and also genes that are regulated by multiple ligands. We conclude that ERs are functionally active in nHL-60 cells regulating genes involved in key physiological functions. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Johansen, Ilona; Andreassen, Rune
2014-12-23
MicroRNAs (miRNAs) are an abundant class of endogenous small RNA molecules that downregulate gene expression at the post-transcriptional level. They play important roles by regulating genes that control multiple biological processes, and recent years there has been an increased interest in studying miRNA genes and miRNA gene expression. The most common method applied to study gene expression of single genes is quantitative PCR (qPCR). However, before expression of mature miRNAs can be studied robust qPCR methods (miRNA-qPCR) must be developed. This includes identification and validation of suitable reference genes. We are particularly interested in Atlantic salmon (Salmo salar). This is an economically important aquaculture species, but no reference genes dedicated for use in miRNA-qPCR methods has been validated for this species. Our aim was, therefore, to identify suitable reference genes for miRNA-qPCR methods in Salmo salar. We used a systematic approach where we utilized similar studies in other species, some biological criteria, results from deep sequencing of small RNAs and, finally, experimental validation of candidate reference genes by qPCR to identify the most suitable reference genes. Ssa-miR-25-3p was identified as most suitable single reference gene. The best combinations of two reference genes were ssa-miR-25-3p and ssa-miR-455-5p. These two genes were constitutively and stably expressed across many different tissues. Furthermore, infectious salmon anaemia did not seem to affect their expression levels. These genes were amplified with high specificity, good efficiency and the qPCR assays showed a good linearity when applying a simple cybergreen miRNA-PCR method using miRNA gene specific forward primers. We have identified suitable reference genes for miRNA-qPCR in Atlantic salmon. These results will greatly facilitate further studies on miRNA genes in this species. The reference genes identified are conserved genes that are identical in their mature sequence in many aquaculture species. Therefore, they may also be suitable as reference genes in other teleosts. Finally, the systematic approach used in our study successfully identified suitable reference genes, suggesting that this may be a useful strategy to apply in similar validation studies in other aquaculture species.
Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J
2016-05-24
Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD.
Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J
2016-01-01
Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD. PMID:27219346
Mitochondrial genome deletions and minicircles are common in lice (Insecta: Phthiraptera)
2011-01-01
Background The gene composition, gene order and structure of the mitochondrial genome are remarkably stable across bilaterian animals. Lice (Insecta: Phthiraptera) are a major exception to this genomic stability in that the canonical single chromosome with 37 genes found in almost all other bilaterians has been lost in multiple lineages in favour of multiple, minicircular chromosomes with less than 37 genes on each chromosome. Results Minicircular mt genomes are found in six of the ten louse species examined to date and three types of minicircles were identified: heteroplasmic minicircles which coexist with full sized mt genomes (type 1); multigene chromosomes with short, simple control regions, we infer that the genome consists of several such chromosomes (type 2); and multiple, single to three gene chromosomes with large, complex control regions (type 3). Mapping minicircle types onto a phylogenetic tree of lice fails to show a pattern of their occurrence consistent with an evolutionary series of minicircle types. Analysis of the nuclear-encoded, mitochondrially-targetted genes inferred from the body louse, Pediculus, suggests that the loss of mitochondrial single-stranded binding protein (mtSSB) may be responsible for the presence of minicircles in at least species with the most derived type 3 minicircles (Pediculus, Damalinia). Conclusions Minicircular mt genomes are common in lice and appear to have arisen multiple times within the group. Life history adaptive explanations which attribute minicircular mt genomes in lice to the adoption of blood-feeding in the Anoplura are not supported by this expanded data set as minicircles are found in multiple non-blood feeding louse groups but are not found in the blood-feeding genus Heterodoxus. In contrast, a mechanist explanation based on the loss of mtSSB suggests that minicircles may be selectively favoured due to the incapacity of the mt replisome to synthesize long replicative products without mtSSB and thus the loss of this gene lead to the formation of minicircles in lice. PMID:21813020
Mitochondrial genome deletions and minicircles are common in lice (Insecta: Phthiraptera).
Cameron, Stephen L; Yoshizawa, Kazunori; Mizukoshi, Atsushi; Whiting, Michael F; Johnson, Kevin P
2011-08-04
The gene composition, gene order and structure of the mitochondrial genome are remarkably stable across bilaterian animals. Lice (Insecta: Phthiraptera) are a major exception to this genomic stability in that the canonical single chromosome with 37 genes found in almost all other bilaterians has been lost in multiple lineages in favour of multiple, minicircular chromosomes with less than 37 genes on each chromosome. Minicircular mt genomes are found in six of the ten louse species examined to date and three types of minicircles were identified: heteroplasmic minicircles which coexist with full sized mt genomes (type 1); multigene chromosomes with short, simple control regions, we infer that the genome consists of several such chromosomes (type 2); and multiple, single to three gene chromosomes with large, complex control regions (type 3). Mapping minicircle types onto a phylogenetic tree of lice fails to show a pattern of their occurrence consistent with an evolutionary series of minicircle types. Analysis of the nuclear-encoded, mitochondrially-targetted genes inferred from the body louse, Pediculus, suggests that the loss of mitochondrial single-stranded binding protein (mtSSB) may be responsible for the presence of minicircles in at least species with the most derived type 3 minicircles (Pediculus, Damalinia). Minicircular mt genomes are common in lice and appear to have arisen multiple times within the group. Life history adaptive explanations which attribute minicircular mt genomes in lice to the adoption of blood-feeding in the Anoplura are not supported by this expanded data set as minicircles are found in multiple non-blood feeding louse groups but are not found in the blood-feeding genus Heterodoxus. In contrast, a mechanist explanation based on the loss of mtSSB suggests that minicircles may be selectively favoured due to the incapacity of the mt replisome to synthesize long replicative products without mtSSB and thus the loss of this gene lead to the formation of minicircles in lice.
An indicator of cancer: downregulation of monoamine oxidase-A in multiple organs and species.
Rybaczyk, Leszek A; Bashaw, Meredith J; Pathak, Dorothy R; Huang, Kun
2008-03-20
Identifying consistent changes in cellular function that occur in multiple types of cancer could revolutionize the way cancer is treated. Previous work has produced promising results such as the identification of p53. Recently drugs that affect serotonin reuptake were shown to reduce the risk of colon cancer in man. Here, we analyze an ensemble of cancer datasets focusing on genes involved in the serotonergic pathway. Genechip datasets consisting of cancerous tissue from human, mouse, rat, or zebrafish were extracted from the GEO database. We first compared gene expression between cancerous tissues and normal tissues for each type of cancer and then identified changes that were common to a variety of cancer types. Our analysis found that significant downregulation of MAO-A, the enzyme that metabolizes serotonin, occurred in multiple tissues from humans, rodents, and fish. MAO-A expression was decreased in 95.4% of human cancer patients and 94.2% of animal cancer cases compared to the non-cancerous controls. These are the first findings that identify a single reliable change in so many different cancers. Future studies should investigate links between MAO-A suppression and the development of cancer to determine the extent that MAO-A suppression contributes to increased cancer risk.
Schopfer, Lawrence M; Lockridge, Oksana
2016-06-01
Tetrameric butyrylcholinesterase (BChE) in human plasma is the product of multiple genes, namely one BCHE gene on chromosome 3q26.1 and multiple genes that encode polyproline-rich peptides. The function of the polyproline-rich peptides is to assemble BChE into tetramers. CHO cells transfected with human BChE cDNA express BChE monomers and dimers, but only low quantities of tetramers. Our goal was to identify the polyproline-rich peptides in CHO-cell derived human BChE tetramers. CHO cell-produced human BChE tetramers were purified from serum-free culture medium. Peptides embedded in the tetramerization domain were released from BChE tetramers by boiling and identified by liquid chromatography-tandem mass spectrometry. A total of 270 proline-rich peptides were sequenced, ranging in size from 6-41 residues. The peptides originated from 60 different proteins that reside in multiple cell compartments including the nucleus, cytoplasm, and endoplasmic reticulum. No single protein was the source of the polyproline-rich peptides in CHO cell-expressed human BChE tetramers. In contrast, 70% of the tetramer-organizing peptides in plasma-derived BChE tetramers originate from lamellipodin. No protein source was identified for polyproline peptides containing up to 41 consecutive proline residues. In conclusion, the use of polyproline-rich peptides as a tetramerization motif is documented only for the cholinesterases, but is expected to serve other tetrameric proteins as well. The CHO cell data suggest that the BChE tetramer-organizing peptide can arise from a variety of proteins. Copyright © 2016 Elsevier B.V. All rights reserved.
Wang, Jinglu; Qu, Susu; Wang, Weixiao; Guo, Liyuan; Zhang, Kunlin; Chang, Suhua; Wang, Jing
2016-11-01
Numbers of gene expression profiling studies of bipolar disorder have been published. Besides different array chips and tissues, variety of the data processes in different cohorts aggravated the inconsistency of results of these genome-wide gene expression profiling studies. By searching the gene expression databases, we obtained six data sets for prefrontal cortex (PFC) of bipolar disorder with raw data and combinable platforms. We used standardized pre-processing and quality control procedures to analyze each data set separately and then combined them into a large gene expression matrix with 101 bipolar disorder subjects and 106 controls. A standard linear mixed-effects model was used to calculate the differentially expressed genes (DEGs). Multiple levels of sensitivity analyses and cross validation with genetic data were conducted. Functional and network analyses were carried out on basis of the DEGs. In the result, we identified 198 unique differentially expressed genes in the PFC of bipolar disorder and control. Among them, 115 DEGs were robust to at least three leave-one-out tests or different pre-processing methods; 51 DEGs were validated with genetic association signals. Pathway enrichment analysis showed these DEGs were related with regulation of neurological system, cell death and apoptosis, and several basic binding processes. Protein-protein interaction network further identified one key hub gene. We have contributed the most comprehensive integrated analysis of bipolar disorder expression profiling studies in PFC to date. The DEGs, especially those with multiple validations, may denote a common signature of bipolar disorder and contribute to the pathogenesis of disease. Copyright © 2016 Elsevier Ltd. All rights reserved.
Methylation and microRNA-mediated epigenetic regulation of SOCS3
Boosani, Chandra S.; Agrawal, Devendra K.
2017-01-01
Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267
Voss, Joachim G.; Dobra, Adrian; Morse, Caryn; Kovacs, Joseph A.; Danner, Robert L.; Munson, Peter J.; Logan, Carolea; Rangel, Zoila; Adelsberger, Joseph W.; McLaughlin, Mary; Adams, Larry D.; Raju, Raghavan; Dalakas, Marinos C.
2016-01-01
Purpose Human immunodeficiency virus (HIV)–related fatigue (HRF) is multicausal and potentially related to mitochondrial dysfunction caused by antiretroviral therapy with nucleoside reverse transcriptase inhibitors (NRTIs). Methodology The authors compared gene expression profiles of CD14+ cells of low versus high fatigued, NRTI-treated HIV patients to healthy controls (n = 5/group). The authors identified 32 genes predictive of low versus high fatigue and 33 genes predictive of healthy versus HIV infection. The authors constructed genetic networks to further elucidate the possible biological pathways in which these genes are involved. Relevance for nursing practice Genes including the actin cytoskeletal regulatory proteins Prokineticin 2 and Cofilin 2 along with mitochondrial inner membrane proteins are involved in multiple pathways and were predictors of fatigue status. Previously identified inflammatory and signaling genes were predictive of HIV status, clearly confirming our results and suggesting a possible further connection between mitochondrial function and HIV. Isolated CD14+ cells are easily accessible cells that could be used for further study of the connection between fatigue and mitochondrial function of HIV patients. Implication for Practice The findings from this pilot study take us one step closer to identifying biomarker targets for fatigue status and mitochondrial dysfunction. Specific biomarkers will be pertinent to the development of methodologies to diagnosis, monitor, and treat fatigue and mitochondrial dysfunction. PMID:23324479
Niu, Fangfang; Wang, Chen; Yan, Jingli; Guo, Xiaohua; Wu, Feifei; Yang, Bo; Deyholos, Michael K; Jiang, Yuan-Qing
2016-09-01
NAC transcription factors (TFs) are plant-specific and play important roles in development, responses to biotic and abiotic cues and hormone signaling. So far, only a few NAC genes have been reported to regulate cell death. In this study, we identified and characterized a NAC55 gene isolated from oilseed rape (Brassica napus L.). BnaNAC55 responds to multiple stresses, including cold, heat, abscisic acid (ABA), jasmonic acid (JA) and a necrotrophic fungal pathogen Sclerotinia sclerotiorum. BnaNAC55 has transactivation activity and is located in the nucleus. BnaNAC55 is able to form homodimers in planta. Unlike ANAC055, full-length BnaNAC55, but not either the N-terminal NAC domain or C-terminal regulatory domain, induces ROS accumulation and hypersensitive response (HR)-like cell death when expressed both in oilseed rape protoplasts and Nicotiana benthamiana. Furthermore, BnaNAC55 expression causes obvious nuclear DNA fragmentation. Moreover, quantitative reverse transcription PCR (qRT-PCR) analysis identified that the expression levels of multiple genes regulating ROS production and scavenging, defense response as well as senescence are significantly induced. Using a dual luciferase reporter assay, we further confirm that BnaNAC55 could activate the expression of a few ROS and defense-related gene expression. Taken together, our work has identified a novel NAC TF from oilseed rape that modulates ROS accumulation and cell death.
Modena, Brian D; Bleecker, Eugene R; Busse, William W; Erzurum, Serpil C; Gaston, Benjamin M; Jarjour, Nizar N; Meyers, Deborah A; Milosevic, Jadranka; Tedrow, John R; Wu, Wei; Kaminski, Naftali; Wenzel, Sally E
2017-06-01
Severe asthma (SA) is a heterogeneous disease with multiple molecular mechanisms. Gene expression studies of bronchial epithelial cells in individuals with asthma have provided biological insight and underscored possible mechanistic differences between individuals. Identify networks of genes reflective of underlying biological processes that define SA. Airway epithelial cell gene expression from 155 subjects with asthma and healthy control subjects in the Severe Asthma Research Program was analyzed by weighted gene coexpression network analysis to identify gene networks and profiles associated with SA and its specific characteristics (i.e., pulmonary function tests, quality of life scores, urgent healthcare use, and steroid use), which potentially identified underlying biological processes. A linear model analysis confirmed these findings while adjusting for potential confounders. Weighted gene coexpression network analysis constructed 64 gene network modules, including modules corresponding to T1 and T2 inflammation, neuronal function, cilia, epithelial growth, and repair mechanisms. Although no network selectively identified SA, genes in modules linked to epithelial growth and repair and neuronal function were markedly decreased in SA. Several hub genes of the epithelial growth and repair module were found located at the 17q12-21 locus, near a well-known asthma susceptibility locus. T2 genes increased with severity in those treated with corticosteroids but were also elevated in untreated, mild-to-moderate disease compared with healthy control subjects. T1 inflammation, especially when associated with increased T2 gene expression, was elevated in a subgroup of younger patients with SA. In this hypothesis-generating analysis, gene expression networks in relation to asthma severity provided potentially new insight into biological mechanisms associated with the development of SA and its phenotypes.
Modena, Brian D.; Bleecker, Eugene R.; Busse, William W.; Erzurum, Serpil C.; Gaston, Benjamin M.; Jarjour, Nizar N.; Meyers, Deborah A.; Milosevic, Jadranka; Tedrow, John R.; Wu, Wei; Kaminski, Naftali
2017-01-01
Rationale: Severe asthma (SA) is a heterogeneous disease with multiple molecular mechanisms. Gene expression studies of bronchial epithelial cells in individuals with asthma have provided biological insight and underscored possible mechanistic differences between individuals. Objectives: Identify networks of genes reflective of underlying biological processes that define SA. Methods: Airway epithelial cell gene expression from 155 subjects with asthma and healthy control subjects in the Severe Asthma Research Program was analyzed by weighted gene coexpression network analysis to identify gene networks and profiles associated with SA and its specific characteristics (i.e., pulmonary function tests, quality of life scores, urgent healthcare use, and steroid use), which potentially identified underlying biological processes. A linear model analysis confirmed these findings while adjusting for potential confounders. Measurements and Main Results: Weighted gene coexpression network analysis constructed 64 gene network modules, including modules corresponding to T1 and T2 inflammation, neuronal function, cilia, epithelial growth, and repair mechanisms. Although no network selectively identified SA, genes in modules linked to epithelial growth and repair and neuronal function were markedly decreased in SA. Several hub genes of the epithelial growth and repair module were found located at the 17q12–21 locus, near a well-known asthma susceptibility locus. T2 genes increased with severity in those treated with corticosteroids but were also elevated in untreated, mild-to-moderate disease compared with healthy control subjects. T1 inflammation, especially when associated with increased T2 gene expression, was elevated in a subgroup of younger patients with SA. Conclusions: In this hypothesis-generating analysis, gene expression networks in relation to asthma severity provided potentially new insight into biological mechanisms associated with the development of SA and its phenotypes. PMID:27984699
Pornsukarom, Suchawan; Thakur, Siddhartha
2017-10-15
The aim of this study was to characterize the plasmids carrying antimicrobial resistance (AMR) determinants in multiple Salmonella serotypes recovered from the commercial swine farm environment after manure application on land. Manure and soil samples were collected on day 0 before and after manure application on six farms in North Carolina, and sequential soil samples were recollected on days 7, 14, and 21 from the same plots. All environmental samples were processed for Salmonella , and their plasmid contents were further characterized. A total of 14 isolates including Salmonella enterica serotypes Johannesburg ( n = 2), Ohio ( n = 2), Rissen ( n = 1), Typhimurium var5- ( n = 5), Worthington ( n = 3), and 4,12:i:- ( n = 1), representing different farms, were selected for plasmid analysis. Antimicrobial susceptibility testing was done by broth microdilution against a panel of 14 antimicrobials on the 14 confirmed transconjugants after conjugation assays. The plasmids were isolated by modified alkaline lysis, and PCRs were performed on purified plasmid DNA to identify the AMR determinants and the plasmid replicon types. The plasmids were sequenced for further analysis and to compare profiles and create phylogenetic trees. A class 1 integron with an ANT(2″)-Ia- aadA2 cassette was detected in the 50-kb IncN plasmids identified in S Worthington isolates. We identified 100-kb and 90-kb IncI1 plasmids in S Johannesburg and S Rissen isolates carrying the bla CMY-2 and tet (A) genes, respectively. An identical 95-kb IncF plasmid was widely disseminated among the different serotypes and across different farms. Our study provides evidence on the importance of horizontal dissemination of resistance determinants through plasmids of multiple Salmonella serotypes distributed across commercial swine farms after manure application. IMPORTANCE The horizontal gene transfer of antimicrobial resistance (AMR) determinants located on plasmids is considered to be the main reason for the rapid proliferation and spread of drug resistance. The deposition of manure generated in swine production systems into the environment is identified as a potential source of AMR dissemination. In this study, AMR gene-carrying plasmids were detected in multiple Salmonella serotypes across different commercial swine farms in North Carolina. The plasmid profiles were characterized based on Salmonella serotype donors and incompatibility (Inc) groups. We found that different Inc plasmids showed evidence of AMR gene transfer in multiple Salmonella serotypes. We detected an identical 95-kb plasmid that was widely distributed across swine farms in North Carolina. These conjugable resistance plasmids were able to persist on land after swine manure application. Our study provides strong evidence of AMR determinant dissemination present in plasmids of multiple Salmonella serotypes in the environment after manure application. Copyright © 2017 American Society for Microbiology.
Chondrodysplasia with multiple dislocations: comprehensive study of a series of 30 cases.
Ranza, E; Huber, C; Levin, N; Baujat, G; Bole-Feysot, C; Nitschke, P; Masson, C; Alanay, Y; Al-Gazali, L; Bitoun, P; Boute, O; Campeau, P; Coubes, C; McEntagart, M; Elcioglu, N; Faivre, L; Gezdirici, A; Johnson, D; Mihci, E; Nur, B G; Perrin, L; Quelin, C; Terhal, P; Tuysuz, B; Cormier-Daire, V
2017-06-01
The group of chondrodysplasia with multiple dislocations includes several entities, characterized by short stature, dislocation of large joints, hand and/or vertebral anomalies. Other features, such as epiphyseal or metaphyseal changes, cleft palate, intellectual disability are also often part of the phenotype. In addition, several conditions with overlapping features are related to this group and broaden the spectrum. The majority of these disorders have been linked to pathogenic variants in genes encoding proteins implicated in the synthesis or sulfation of proteoglycans (PG). In a series of 30 patients with multiple dislocations, we have performed exome sequencing and subsequent targeted analysis of 15 genes, implicated in chondrodysplasia with multiple dislocations, and related conditions. We have identified causative pathogenic variants in 60% of patients (18/30); when a clinical diagnosis was suspected, this was molecularly confirmed in 53% of cases. Forty percent of patients remain without molecular etiology. Pathogenic variants in genes implicated in PG synthesis are of major importance in chondrodysplasia with multiple dislocations and related conditions. The combination of hand features, growth failure severity, radiological aspects of long bones and of vertebrae allowed discrimination among the different conditions. We propose key diagnostic clues to the clinician. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Heart morphogenesis gene regulatory networks revealed by temporal expression analysis.
Hill, Jonathon T; Demarest, Bradley; Gorsi, Bushra; Smith, Megan; Yost, H Joseph
2017-10-01
During embryogenesis the heart forms as a linear tube that then undergoes multiple simultaneous morphogenetic events to obtain its mature shape. To understand the gene regulatory networks (GRNs) driving this phase of heart development, during which many congenital heart disease malformations likely arise, we conducted an RNA-seq timecourse in zebrafish from 30 hpf to 72 hpf and identified 5861 genes with altered expression. We clustered the genes by temporal expression pattern, identified transcription factor binding motifs enriched in each cluster, and generated a model GRN for the major gene batteries in heart morphogenesis. This approach predicted hundreds of regulatory interactions and found batteries enriched in specific cell and tissue types, indicating that the approach can be used to narrow the search for novel genetic markers and regulatory interactions. Subsequent analyses confirmed the GRN using two mutants, Tbx5 and nkx2-5 , and identified sets of duplicated zebrafish genes that do not show temporal subfunctionalization. This dataset provides an essential resource for future studies on the genetic/epigenetic pathways implicated in congenital heart defects and the mechanisms of cardiac transcriptional regulation. © 2017. Published by The Company of Biologists Ltd.
Proglucagons in vertebrates: Expression and processing of multiple genes in a bony fish.
Busby, Ellen R; Mommsen, Thomas P
2016-09-01
In contrast to mammals, where a single proglucagon (PG) gene encodes three peptides: glucagon, glucagon-like peptide 1 and glucagon-like peptide 2 (GLP-1; GLP-2), many non-mammalian vertebrates carry multiple PG genes. Here, we investigate proglucagon mRNA sequences, their tissue expression and processing in a diploid bony fish. Copper rockfish (Sebastes caurinus) express two independent genes coding for distinct proglucagon sequences (PG I, PG II), with PG II lacking the GLP-2 sequence. These genes are differentially transcribed in the endocrine pancreas, the brain, and the gastrointestinal tract. Alternative splicing identified in rockfish is only one part of this complex regulation of the PG transcripts: the system has the potential to produce two glucagons, four GLP-1s and a single GLP-2, or any combination of these peptides. Mass spectrometric analysis of partially purified PG-derived peptides in endocrine pancreas confirms translation of both PG transcripts and differential processing of the resulting peptides. The complex differential regulation of the two PG genes and their continued presence in this extant teleostean fish strongly suggests unique and, as yet largely unidentified, roles for the peptide products encoded in each gene. Copyright © 2016 Elsevier Inc. All rights reserved.
Genomic approaches for the elucidation of genes and gene networks underlying cardiovascular traits.
Adriaens, M E; Bezzina, C R
2018-06-22
Genome-wide association studies have shed light on the association between natural genetic variation and cardiovascular traits. However, linking a cardiovascular trait associated locus to a candidate gene or set of candidate genes for prioritization for follow-up mechanistic studies is all but straightforward. Genomic technologies based on next-generation sequencing technology nowadays offer multiple opportunities to dissect gene regulatory networks underlying genetic cardiovascular trait associations, thereby aiding in the identification of candidate genes at unprecedented scale. RNA sequencing in particular becomes a powerful tool when combined with genotyping to identify loci that modulate transcript abundance, known as expression quantitative trait loci (eQTL), or loci modulating transcript splicing known as splicing quantitative trait loci (sQTL). Additionally, the allele-specific resolution of RNA-sequencing technology enables estimation of allelic imbalance, a state where the two alleles of a gene are expressed at a ratio differing from the expected 1:1 ratio. When multiple high-throughput approaches are combined with deep phenotyping in a single study, a comprehensive elucidation of the relationship between genotype and phenotype comes into view, an approach known as systems genetics. In this review, we cover key applications of systems genetics in the broad cardiovascular field.
Pandey, Ravi S; Saxena, Garima; Bhattacharya, Debashish; Qiu, Huan; Azad, Rajeev K
2017-02-01
Identification of horizontal gene transfers (HGTs) has primarily relied on phylogenetic tree based methods, which require a rich sampling of sequenced genomes to ensure a reliable inference. Because the success of phylogenetic approaches depends on the breadth and depth of the database, researchers usually apply stringent filters to detect only the most likely gene transfers in the genomes of interest. One such study focused on a highly conservative estimate of trans-domain gene transfers in the extremophile eukaryote, Galdieria sulphuraria (Galdieri) Merola (Rhodophyta), by applying multiple filters in their phylogenetic pipeline. This led to the identification of 75 inter-domain acquisitions from Bacteria or Archaea. Because of the evolutionary, ecological, and potential biotechnological significance of foreign genes in algae, alternative approaches and pipelines complementing phylogenetics are needed for a more comprehensive assessment of HGT. We present here a novel pipeline that uncovered 17 novel foreign genes of prokaryotic origin in G. sulphuraria, results that are supported by multiple lines of evidence including composition-based, comparative data, and phylogenetics. These genes encode a variety of potentially adaptive functions, from metabolite transport to DNA repair. © 2016 Phycological Society of America.
Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome
Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka
2013-01-01
Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202
Tamplin, Owen J; Cox, Brian J; Rossant, Janet
2011-12-15
The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.
The shaping and functional consequences of the dosage effect landscape in multiple myeloma.
Samur, Mehmet K; Shah, Parantu K; Wang, Xujun; Minvielle, Stéphane; Magrangeas, Florence; Avet-Loiseau, Hervé; Munshi, Nikhil C; Li, Cheng
2013-10-02
Multiple myeloma (MM) is a malignant proliferation of plasma B cells. Based on recurrent aneuploidy such as copy number alterations (CNAs), myeloma is divided into two subtypes with different CNA patterns and patient survival outcomes. How aneuploidy events arise, and whether they contribute to cancer cell evolution are actively studied. The large amount of transcriptomic changes resultant of CNAs (dosage effect) pose big challenges for identifying functional consequences of CNAs in myeloma in terms of specific driver genes and pathways. In this study, we hypothesize that gene-wise dosage effect varies as a result from complex regulatory networks that translate the impact of CNAs to gene expression, and studying this variation can provide insights into functional effects of CNAs. We propose gene-wise dosage effect score and genome-wide karyotype plot as tools to measure and visualize concordant copy number and expression changes across cancer samples. We find that dosage effect in myeloma is widespread yet variable, and it is correlated with gene expression level and CNA frequencies in different chromosomes. Our analysis suggests that despite the enrichment of differentially expressed genes between hyperdiploid MM and non-hyperdiploid MM in the trisomy chromosomes, the chromosomal proportion of dosage sensitive genes is higher in the non-trisomy chromosomes. Dosage-sensitive genes are enriched by genes with protein translation and localization functions, and dosage resistant genes are enriched by apoptosis genes. These results point to future studies on differential dosage sensitivity and resistance of pro- and anti-proliferation pathways and their variation across patients as therapeutic targets and prognosis markers. Our findings support the hypothesis that recurrent CNAs in myeloma are selected by their functional consequences. The novel dosage effect score defined in this work will facilitate integration of copy number and expression data for identifying driver genes in cancer genomics studies. The accompanying R code is available at http://www.canevolve.org/dosageEffect/.
Bullich, Gemma; Trujillano, Daniel; Santín, Sheila; Ossowski, Stephan; Mendizábal, Santiago; Fraga, Gloria; Madrid, Álvaro; Ariceta, Gema; Ballarín, José; Torra, Roser; Estivill, Xavier; Ars, Elisabet
2015-09-01
Genetic diagnosis of steroid-resistant nephrotic syndrome (SRNS) using Sanger sequencing is complicated by the high genetic heterogeneity and phenotypic variability of this disease. We aimed to improve the genetic diagnosis of SRNS by simultaneously sequencing 26 glomerular genes using massive parallel sequencing and to study whether mutations in multiple genes increase disease severity. High-throughput mutation analysis was performed in 50 SRNS and/or focal segmental glomerulosclerosis (FSGS) patients, a validation cohort of 25 patients with known pathogenic mutations, and a discovery cohort of 25 uncharacterized patients with probable genetic etiology. In the validation cohort, we identified the 42 previously known pathogenic mutations across NPHS1, NPHS2, WT1, TRPC6, and INF2 genes. In the discovery cohort, disease-causing mutations in SRNS/FSGS genes were found in nine patients. We detected three patients with mutations in an SRNS/FSGS gene and COL4A3. Two of them were familial cases and presented a more severe phenotype than family members with mutation in only one gene. In conclusion, our results show that massive parallel sequencing is feasible and robust for genetic diagnosis of SRNS/FSGS. Our results indicate that patients carrying mutations in an SRNS/FSGS gene and also in COL4A3 gene have increased disease severity.
Dong, Shan-Shan; Guo, Yan; Zhu, Dong-Li; Chen, Xiao-Feng; Wu, Xiao-Ming; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin
2016-01-01
OBJECTIVES With ENCODE epigenomic data and results from published genome-wide association studies (GWASs), we aimed to find regulatory signatures of obesity genes and discover novel susceptibility genes. METHODS Obesity genes were obtained from public GWASs databases and their promoters were annotated based on the regulatory elements information. Significantly enriched or depleted epigenomic elements in the promoters of obesity genes were evaluated and all human genes were then prioritized according to the existence of the selected elements to predict new candidate genes. Top ranked genes were subsequently applied to validate their associations with obesity-related traits in three independent in-house GWASs samples. RESULTS We identified RAD21 and EZH2 as over-represented, STAT2 and IRF3 as depleted transcription factors. Histone modification of H3K9me3 and chromatin state segmentation of “poised promoter” and “repressed” were overrepresented. All genes were prioritized and we selected the top five genes for validation at population level. Combined results from the three GWASs samples, rs7522101 in ESRRG remained significantly associated with BMI after multiple testing corrections (P = 7.25 × 10−5). It was also associated with β-cell function (P = 1.99 × 10−3) and fasting glucose level (P < 0.05) in the meta-analyses of glucose and insulin-related traits consortium (MAGIC) dataset. CONCLUSIONS In summary, we identified epigenomic characteristics for obesity genes and suggested ESRRG as a novel obesity susceptibility gene. PMID:27113491
Zhao, Min; Li, Zhe; Qu, Hong
2015-01-01
Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis. PMID:26486520
Identification of FGF7 as a novel susceptibility locus for chronic obstructive pulmonary disease.
Brehm, John M; Hagiwara, Koichi; Tesfaigzi, Yohannes; Bruse, Shannon; Mariani, Thomas J; Bhattacharya, Soumyaroop; Boutaoui, Nadia; Ziniti, John P; Soto-Quiros, Manuel E; Avila, Lydiana; Cho, Michael H; Himes, Blanca; Litonjua, Augusto A; Jacobson, Francine; Bakke, Per; Gulsvik, Amund; Anderson, Wayne H; Lomas, David A; Forno, Erick; Datta, Soma; Silverman, Edwin K; Celedón, Juan C
2011-12-01
Traditional genome-wide association studies (GWASs) of large cohorts of subjects with chronic obstructive pulmonary disease (COPD) have successfully identified novel candidate genes, but several other plausible loci do not meet strict criteria for genome-wide significance after correction for multiple testing. The authors hypothesise that by applying unbiased weights derived from unique populations we can identify additional COPD susceptibility loci. Methods The authors performed a homozygosity haplotype analysis on a group of subjects with and without COPD to identify regions of conserved homozygosity haplotype (RCHHs). Weights were constructed based on the frequency of these RCHHs in case versus controls, and used to adjust the p values from a large collaborative GWAS of COPD. The authors identified 2318 RCHHs, of which 576 were significantly (p<0.05) over-represented in cases. After applying the weights constructed from these regions to a collaborative GWAS of COPD, the authors identified two single nucleotide polymorphisms (SNPs) in a novel gene (fibroblast growth factor-7 (FGF7)) that gained genome-wide significance by the false discovery rate method. In a follow-up analysis, both SNPs (rs12591300 and rs4480740) were significantly associated with COPD in an independent population (combined p values of 7.9E-7 and 2.8E-6, respectively). In another independent population, increased lung tissue FGF7 expression was associated with worse measures of lung function. Weights constructed from a homozygosity haplotype analysis of an isolated population successfully identify novel genetic associations from a GWAS on a separate population. This method can be used to identify promising candidate genes that fail to meet strict correction for multiple testing.
Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi.
Ropars, Jeanne; Rodríguez de la Vega, Ricardo C; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana
2015-10-05
Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1-5]. Few studies have focused on the domestication of fungi, with notable exceptions [6-11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making-P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13-15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Adaptive Horizontal Gene Transfers between Multiple Cheese-Associated Fungi
Ropars, Jeanne; Rodríguez de la Vega, Ricardo C.; López-Villavicencio, Manuela; Gouzy, Jérôme; Sallet, Erika; Dumas, Émilie; Lacoste, Sandrine; Debuchy, Robert; Dupont, Joëlle; Branca, Antoine; Giraud, Tatiana
2015-01-01
Summary Domestication is an excellent model for studies of adaptation because it involves recent and strong selection on a few, identified traits [1–5]. Few studies have focused on the domestication of fungi, with notable exceptions [6–11], despite their importance to bioindustry [12] and to a general understanding of adaptation in eukaryotes [5]. Penicillium fungi are ubiquitous molds among which two distantly related species have been independently selected for cheese making—P. roqueforti for blue cheeses like Roquefort and P. camemberti for soft cheeses like Camembert. The selected traits include morphology, aromatic profile, lipolytic and proteolytic activities, and ability to grow at low temperatures, in a matrix containing bacterial and fungal competitors [13–15]. By comparing the genomes of ten Penicillium species, we show that adaptation to cheese was associated with multiple recent horizontal transfers of large genomic regions carrying crucial metabolic genes. We identified seven horizontally transferred regions (HTRs) spanning more than 10 kb each, flanked by specific transposable elements, and displaying nearly 100% identity between distant Penicillium species. Two HTRs carried genes with functions involved in the utilization of cheese nutrients or competition and were found nearly identical in multiple strains and species of cheese-associated Penicillium fungi, indicating recent selective sweeps; they were experimentally associated with faster growth and greater competitiveness on cheese and contained genes highly expressed in the early stage of cheese maturation. These findings have industrial and food safety implications and improve our understanding of the processes of adaptation to rapid environmental changes. PMID:26412136
Herrgård, Markus J.
2014-01-01
High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490
van der Ley, P
1988-11-01
Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.
Identification of type 2 diabetes-associated combination of SNPs using support vector machine.
Ban, Hyo-Jeong; Heo, Jee Yeon; Oh, Kyung-Soo; Park, Keun-Joon
2010-04-23
Type 2 diabetes mellitus (T2D), a metabolic disorder characterized by insulin resistance and relative insulin deficiency, is a complex disease of major public health importance. Its incidence is rapidly increasing in the developed countries. Complex diseases are caused by interactions between multiple genes and environmental factors. Most association studies aim to identify individual susceptibility single markers using a simple disease model. Recent studies are trying to estimate the effects of multiple genes and multi-locus in genome-wide association. However, estimating the effects of association is very difficult. We aim to assess the rules for classifying diseased and normal subjects by evaluating potential gene-gene interactions in the same or distinct biological pathways. We analyzed the importance of gene-gene interactions in T2D susceptibility by investigating 408 single nucleotide polymorphisms (SNPs) in 87 genes involved in major T2D-related pathways in 462 T2D patients and 456 healthy controls from the Korean cohort studies. We evaluated the support vector machine (SVM) method to differentiate between cases and controls using SNP information in a 10-fold cross-validation test. We achieved a 65.3% prediction rate with a combination of 14 SNPs in 12 genes by using the radial basis function (RBF)-kernel SVM. Similarly, we investigated subpopulation data sets of men and women and identified different SNP combinations with the prediction rates of 70.9% and 70.6%, respectively. As the high-throughput technology for genome-wide SNPs improves, it is likely that a much higher prediction rate with biologically more interesting combination of SNPs can be acquired by using this method. Support Vector Machine based feature selection method in this research found novel association between combinations of SNPs and T2D in a Korean population.
Etich, Julia; Bergmeier, Vera; Pitzler, Lena; Brachvogel, Bent
2017-03-01
Wound healing is a coordinated process to restore tissue homeostasis and reestablish the protective barrier of the skin. miRNAs may modulate the expression of target genes to contribute to repair processes, but due to the complexity of the tissue it is challenging to quantify gene expression during the distinct phases of wound repair. Here, we aimed to identify a common reference gene to quantify changes in miRNA and mRNA expression during skin wound healing. Quantitative real-time PCR and bioinformatic analysis tools were used to identify suitable reference genes during skin repair and their reliability was tested by studying the expression of mRNAs and miRNAs. Morphological assessment of wounds showed that the injury model recapitulates the distinct phases of skin repair. Non-degraded RNA could be isolated from skin and wounds and used to study the expression of non-coding small nuclear RNAs during wound healing. Among those, RNU6B was most constantly expressed during skin repair. Using this reference gene we could confirm the transient upregulation of IL-1β and PTPRC/CD45 during the early phase as well as the increased expression of collagen type I at later stages of repair and validate the differential expression of miR-204, miR-205, and miR-31 in skin wounds. In contrast to Gapdh the normalization to multiple reference genes gave a similar outcome. RNU6B is an accurate alternative normalizer to quantify mRNA and miRNA expression during the distinct phases of skin wound healing when analysis of multiple reference genes is not feasible.
2011-01-01
Background Several tools have been developed to perform global gene expression profile data analysis, to search for specific chromosomal regions whose features meet defined criteria as well as to study neighbouring gene expression. However, most of these tools are tailored for a specific use in a particular context (e.g. they are species-specific, or limited to a particular data format) and they typically accept only gene lists as input. Results TRAM (Transcriptome Mapper) is a new general tool that allows the simple generation and analysis of quantitative transcriptome maps, starting from any source listing gene expression values for a given gene set (e.g. expression microarrays), implemented as a relational database. It includes a parser able to assign univocal and updated gene symbols to gene identifiers from different data sources. Moreover, TRAM is able to perform intra-sample and inter-sample data normalization, including an original variant of quantile normalization (scaled quantile), useful to normalize data from platforms with highly different numbers of investigated genes. When in 'Map' mode, the software generates a quantitative representation of the transcriptome of a sample (or of a pool of samples) and identifies if segments of defined lengths are over/under-expressed compared to the desired threshold. When in 'Cluster' mode, the software searches for a set of over/under-expressed consecutive genes. Statistical significance for all results is calculated with respect to genes localized on the same chromosome or to all genome genes. Transcriptome maps, showing differential expression between two sample groups, relative to two different biological conditions, may be easily generated. We present the results of a biological model test, based on a meta-analysis comparison between a sample pool of human CD34+ hematopoietic progenitor cells and a sample pool of megakaryocytic cells. Biologically relevant chromosomal segments and gene clusters with differential expression during the differentiation toward megakaryocyte were identified. Conclusions TRAM is designed to create, and statistically analyze, quantitative transcriptome maps, based on gene expression data from multiple sources. The release includes FileMaker Pro database management runtime application and it is freely available at http://apollo11.isto.unibo.it/software/, along with preconfigured implementations for mapping of human, mouse and zebrafish transcriptomes. PMID:21333005
Meredith, Brian K.; Berry, Donagh P.; Kearney, Francis; Finlay, Emma K.; Fahey, Alan G.; Bradley, Daniel G.; Lynn, David J.
2013-01-01
Mastitis is an inflammation-driven disease of the bovine mammary gland that occurs in response to physical damage or infection and is one of the most costly production-related diseases in the dairy industry worldwide. We performed a genome-wide association study (GWAS) to identify genetic loci associated with somatic cell score (SCS), an indicator trait of mammary gland inflammation. A total of 702 Holstein-Friesian bulls were genotyped for 777,962 single nucleotide polymorphisms (SNPs) and associated with SCS phenotypes. The SCS phenotypes were expressed as daughter yield deviations (DYD) based on a large number of progeny performance records. A total of 138 SNPs on 15 different chromosomes reached genome-wide significance (corrected p-value ≤ 0.05) for association with SCS (after correction for multiple testing). We defined 28 distinct QTL regions and a number of candidate genes located in these QTL regions were identified. The most significant association (p-value = 1.70 × 10−7) was observed on chromosome 6. This QTL had no known genes annotated within it, however, the Ensembl Genome Browser predicted the presence of a small non-coding RNA (a Y RNA gene) in this genomic region. This Y RNA gene was 99% identical to human RNY4. Y RNAs are a rare type of non-coding RNA that were originally discovered due to their association with the autoimmune disease, systemic lupus erythematosus. Examining small-RNA sequencing (RNAseq) data being generated by us in multiple different mastitis-pathogen challenged cell-types has revealed that this Y RNA is expressed (but not differentially expressed) in these cells. Other QTL regions identified in this study also encoded strong candidate genes for mastitis susceptibility. A QTL region on chromosome 13, for example, was found to contain a cluster of β-defensin genes, a gene family with known roles in innate immunity. Due to the increased SNP density, this study also refined the boundaries for several known QTL for SCS and mastitis. PMID:24223582
Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna
2012-12-15
In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.
Chasman, Daniel I.; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A.; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary F.; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid B.; Kardia, Sharon L.R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Kao, W.H. Linda; Fox, Caroline S.; Köttgen, Anna
2012-01-01
In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10−9) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10−4–2.2 × 10−7. Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general. PMID:22962313
Turner, Leslie M; Harr, Bettina
2014-01-01
Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone. DOI: http://dx.doi.org/10.7554/eLife.02504.001 PMID:25487987
Insights into DDT Resistance from the Drosophila melanogaster Genetic Reference Panel
Schmidt, Joshua M.; Battlay, Paul; Gledhill-Smith, Rebecca S.; Good, Robert T.; Lumb, Chris; Fournier-Level, Alexandre; Robin, Charles
2017-01-01
Insecticide resistance is considered a classic model of microevolution, where a strong selective agent is applied to a large natural population, resulting in a change in frequency of alleles that confer resistance. While many insecticide resistance variants have been characterized at the gene level, they are typically single genes of large effect identified in highly resistant pest species. In contrast, multiple variants have been implicated in DDT resistance in Drosophila melanogaster; however, only the Cyp6g1 locus has previously been shown to be relevant to field populations. Here we use genome-wide association studies (GWAS) to identify DDT-associated polygenes and use selective sweep analyses to assess their adaptive significance. We identify and verify two candidate DDT resistance loci. A largely uncharacterized gene, CG10737, has a function in muscles that ameliorates the effects of DDT, while a putative detoxifying P450, Cyp6w1, shows compelling evidence of positive selection. PMID:28935691
2014-01-01
Background Imprinted genes have been extensively documented in eutherian mammals and found to exhibit significant interspecific variation in the suites of genes that are imprinted and in their regulation between tissues and developmental stages. Much less is known about imprinted loci in metatherian (marsupial) mammals, wherein studies have been limited to a small number of genes previously known to be imprinted in eutherians. We describe the first ab initio search for imprinted marsupial genes, in fibroblasts from the opossum, Monodelphis domestica, based on a genome-wide ChIP-seq strategy to identify promoters that are simultaneously marked by mutually exclusive, transcriptionally opposing histone modifications. Results We identified a novel imprinted gene (Meis1) and two additional monoallelically expressed genes, one of which (Cstb) showed allele-specific, but non-imprinted expression. Imprinted vs. allele-specific expression could not be resolved for the third monoallelically expressed gene (Rpl17). Transcriptionally opposing histone modifications H3K4me3, H3K9Ac, and H3K9me3 were found at the promoters of all three genes, but differential DNA methylation was not detected at CpG islands at any of these promoters. Conclusions In generating the first genome-wide histone modification profiles for a marsupial, we identified the first gene that is imprinted in a marsupial but not in eutherian mammals. This outcome demonstrates the practicality of an ab initio discovery strategy and implicates histone modification, but not differential DNA methylation, as a conserved mechanism for marking imprinted genes in all therian mammals. Our findings suggest that marsupials use multiple epigenetic mechanisms for imprinting and support the concept that lineage-specific selective forces can produce sets of imprinted genes that differ between metatherian and eutherian lines. PMID:24484454
Xu, Lu; Wu, Min; Han, Zhaojun
2013-01-01
Background The small brown planthopper (SBPH), Laodelphax striatellus (Fallén), is one of the major rice pests in Asia and has developed resistance to multiple classes of insecticides. Understanding resistance mechanisms is essential to the management of this pest. Biochemical and molecular assays were performed in this study to systematically characterize deltamethrin resistance mechanisms with laboratory-selected resistant and susceptible strains of SBPH. Methodology/Principal Findings Deltamethrin resistant strains of SBPH (JH-del) were derived from a field population by continuously selections (up to 30 generations) in the laboratory, while a susceptible strain (JHS) was obtained from the same population by removing insecticide pressure for 30 generations. The role of detoxification enzymes in the resistance was investigated using synergism and enzyme activity assays with strains of different resistant levels. Furthermore, 71 cytochrome P450, 93 esterases and 12 glutathione-S-transferases cDNAs were cloned based on transcriptome data of a field collected population. Semi-quantitative RT-PCR screening analysis of 176 identified detoxification genes demonstrated that multiple P450 and esterase genes were overexpressed (>2-fold) in JH-del strains (G4 and G30) when compared to that in JHS, and the results of quantitative PCR coincided with the semi-quantitative RT-PCR results. Target mutation at IIS3–IIS6 regions encoded by the voltage-gated sodium channel gene was ruled out for conferring the observed resistance. Conclusion/Significance As the first attempt to discover genes potentially involved in SBPH pyrethroid resistance, this study putatively identified several candidate genes of detoxification enzymes that were significantly overexpressed in the resistant strain, which matched the synergism and enzyme activity testing. The biochemical and molecular evidences suggest that the high level pyrethroid resistance in L. striatellus could be due to enhanced detoxification rather than target insensitivity. The findings lay a solid ground for further resistance mechanism elucidation studies. PMID:24324548
Cui, Yan; Ying, Ying; van Hasselt, Andrew; Ng, Ka Man; Yu, Jun; Zhang, Qian; Jin, Jie; Liu, Dingxie; Rhim, Johng S; Rha, Sun Young; Loyo, Myriam; Chan, Anthony T C; Srivastava, Gopesh; Tsao, George S W; Sellar, Grant C; Sung, Joseph J Y; Sidransky, David; Tao, Qian
2008-08-20
Identification of tumor suppressor genes (TSGs) silenced by CpG methylation uncovers the molecular mechanism of tumorigenesis and potential tumor biomarkers. Loss of heterozygosity at 11q25 is common in multiple tumors including nasopharyngeal carcinoma (NPC). OPCML, located at 11q25, is one of the downregulated genes we identified through digital expression subtraction. Semi-quantitative RT-PCR showed frequent OPCML silencing in NPC and other common tumors, with no homozygous deletion detected by multiplex differential DNA-PCR. Instead, promoter methylation of OPCML was frequently detected in multiple carcinoma cell lines (nasopharyngeal, esophageal, lung, gastric, colon, liver, breast, cervix, prostate), lymphoma cell lines (non-Hodgkin and Hodgkin lymphoma, nasal NK/T-cell lymphoma) and primary tumors, but not in any non-tumor cell line and seldom weakly methylated in normal epithelial tissues. Pharmacological and genetic demethylation restored OPCML expression, indicating a direct epigenetic silencing. We further found that OPCML is stress-responsive, but this response is epigenetically impaired when its promoter becomes methylated. Ecotopic expression of OPCML led to significant inhibition of both anchorage-dependent and -independent growth of carcinoma cells with endogenous silencing. Thus, through functional epigenetics, we identified OPCML as a broad tumor suppressor, which is frequently inactivated by methylation in multiple malignancies.
2014-01-01
Background Discerning the traits evolving under neutral conditions from those traits evolving rapidly because of various selection pressures is a great challenge. We propose a new method, composite selection signals (CSS), which unifies the multiple pieces of selection evidence from the rank distribution of its diverse constituent tests. The extreme CSS scores capture highly differentiated loci and underlying common variants hauling excess haplotype homozygosity in the samples of a target population. Results The data on high-density genotypes were analyzed for evidence of an association with either polledness or double muscling in various cohorts of cattle and sheep. In cattle, extreme CSS scores were found in the candidate regions on autosome BTA-1 and BTA-2, flanking the POLL locus and MSTN gene, for polledness and double muscling, respectively. In sheep, the regions with extreme scores were localized on autosome OAR-2 harbouring the MSTN gene for double muscling and on OAR-10 harbouring the RXFP2 gene for polledness. In comparison to the constituent tests, there was a partial agreement between the signals at the four candidate loci; however, they consistently identified additional genomic regions harbouring no known genes. Persuasively, our list of all the additional significant CSS regions contains genes that have been successfully implicated to secondary phenotypic diversity among several subpopulations in our data. For example, the method identified a strong selection signature for stature in cattle capturing selective sweeps harbouring UQCC-GDF5 and PLAG1-CHCHD7 gene regions on BTA-13 and BTA-14, respectively. Both gene pairs have been previously associated with height in humans, while PLAG1-CHCHD7 has also been reported for stature in cattle. In the additional analysis, CSS identified significant regions harbouring multiple genes for various traits under selection in European cattle including polledness, adaptation, metabolism, growth rate, stature, immunity, reproduction traits and some other candidate genes for dairy and beef production. Conclusions CSS successfully localized the candidate regions in validation datasets as well as identified previously known and novel regions for various traits experiencing selection pressure. Together, the results demonstrate the utility of CSS by its improved power, reduced false positives and high-resolution of selection signals as compared to individual constituent tests. PMID:24636660
Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola
2014-12-01
We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.
Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ
2013-01-01
Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.
SET1A/COMPASS and shadow enhancers in the regulation of homeotic gene expression
Cao, Kaixiang; Collings, Clayton K.; Marshall, Stacy A.; Morgan, Marc A.; Rendleman, Emily J.; Wang, Lu; Sze, Christie C.; Sun, Tianjiao; Bartom, Elizabeth T.; Shilatifard, Ali
2017-01-01
The homeotic (Hox) genes are highly conserved in metazoans, where they are required for various processes in development, and misregulation of their expression is associated with human cancer. In the developing embryo, Hox genes are activated sequentially in time and space according to their genomic position within Hox gene clusters. Accumulating evidence implicates both enhancer elements and noncoding RNAs in controlling this spatiotemporal expression of Hox genes, but disentangling their relative contributions is challenging. Here, we identify two cis-regulatory elements (E1 and E2) functioning as shadow enhancers to regulate the early expression of the HoxA genes. Simultaneous deletion of these shadow enhancers in embryonic stem cells leads to impaired activation of HoxA genes upon differentiation, while knockdown of a long noncoding RNA overlapping E1 has no detectable effect on their expression. Although MLL/COMPASS (complex of proteins associated with Set1) family of histone methyltransferases is known to activate transcription of Hox genes in other contexts, we found that individual inactivation of the MLL1-4/COMPASS family members has little effect on early Hox gene activation. Instead, we demonstrate that SET1A/COMPASS is required for full transcriptional activation of multiple Hox genes but functions independently of the E1 and E2 cis-regulatory elements. Our results reveal multiple regulatory layers for Hox genes to fine-tune transcriptional programs essential for development. PMID:28487406
Convergent genetic and expression data implicate immunity in Alzheimer's disease
Jones, Lesley; Lambert, Jean-Charles; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Vedernikov, Alexey; Escott-Price, Valentina; Stone, Timothy; Richards, Alexander; Bellenguez, Céline; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Gerrish, Amy; Jun, Gyungah; DeStefano, Anita L; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Jones, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letteneur, Luc; Kornhuber, Johanes; Tárraga, Lluís; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Emilsson, Valur; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Kehoe, Pat; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleὀ, Alberti; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick; Hardy, John; Naranjo, Maria Candida Deniz; Razquin, Cristina; Bosco, Paola; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Mancuso, Michelangelo; Moebus, Susanne; Mecocci, Patrizia; del Zompo, Maria; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Bullido, Maria; Panza, Francesco; Caffarra, Paolo; Nacmias, Benedetta; Gilbert, John R; Mayhaus, Manuel; Jessen, Frank; Dichgans, Martin; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alavarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee FAG; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John SK; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Pastor, Pau; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Farrer, Lindsay A; van Duijn, Cornelia M; Van Broekhoven, Christine; Ramirez, Alfredo; Schellenberg, Gerard D; Seshadri, Sudha; Amouyel, Philippe; Holmans, Peter A
2015-01-01
Background Late–onset Alzheimer's disease (AD) is heritable with 20 genes showing genome wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease we extended these genetic data in a pathway analysis. Methods The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. Results ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (p = 3.27×10-12 after multiple testing correction for pathways), regulation of endocytosis (p = 1.31×10-11), cholesterol transport (p = 2.96 × 10-9) and proteasome-ubiquitin activity (p = 1.34×10-6). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected p 0.002 – 0.05). Conclusions The immune response, regulation of endocytosis, cholesterol transport and protein ubiquitination represent prime targets for AD therapeutics. PMID:25533204
Convergent genetic and expression data implicate immunity in Alzheimer's disease.
2015-06-01
Late-onset Alzheimer's disease (AD) is heritable with 20 genes showing genome-wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease, we extended these genetic data in a pathway analysis. The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (P = 3.27 × 10(-12) after multiple testing correction for pathways), regulation of endocytosis (P = 1.31 × 10(-11)), cholesterol transport (P = 2.96 × 10(-9)), and proteasome-ubiquitin activity (P = 1.34 × 10(-6)). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected P = .002-.05). The immune response, regulation of endocytosis, cholesterol transport, and protein ubiquitination represent prime targets for AD therapeutics. Copyright © 2015. Published by Elsevier Inc.
Benitez, Cecil M.; Qu, Kun; Sugiyama, Takuya; Pauerstein, Philip T.; Liu, Yinghua; Tsai, Jennifer; Gu, Xueying; Ghodasara, Amar; Arda, H. Efsun; Zhang, Jiajing; Dekker, Joseph D.; Tucker, Haley O.; Chang, Howard Y.; Kim, Seung K.
2014-01-01
The regulatory logic underlying global transcriptional programs controlling development of visceral organs like the pancreas remains undiscovered. Here, we profiled gene expression in 12 purified populations of fetal and adult pancreatic epithelial cells representing crucial progenitor cell subsets, and their endocrine or exocrine progeny. Using probabilistic models to decode the general programs organizing gene expression, we identified co-expressed gene sets in cell subsets that revealed patterns and processes governing progenitor cell development, lineage specification, and endocrine cell maturation. Purification of Neurog3 mutant cells and module network analysis linked established regulators such as Neurog3 to unrecognized gene targets and roles in pancreas development. Iterative module network analysis nominated and prioritized transcriptional regulators, including diabetes risk genes. Functional validation of a subset of candidate regulators with corresponding mutant mice revealed that the transcription factors Etv1, Prdm16, Runx1t1 and Bcl11a are essential for pancreas development. Our integrated approach provides a unique framework for identifying regulatory genes and functional gene sets underlying pancreas development and associated diseases such as diabetes mellitus. PMID:25330008
Comparative and evolutionary analysis of the 14-3-3 family genes in eleven fishes.
Cao, Jun; Tan, Xiaona
2018-07-01
14-3-3 proteins are a type of highly conserved acidic proteins, which are distributed over a wide variety of organisms and are involved in multiple cellular processes. While the comparative and evolutionary analysis of this gene family is unavailable in various fish species. In this study, we identified 101 putative 14-3-3 genes in 11 fish species and divided them into 5 groups via phylogenetic analysis. Synteny analysis implied conserved and dynamic evolution characteristics near the 14-3-3 gene loci in some vertebrates. We also found that some recombination events have accelerated the evolution of this gene family. Moreover, a positive selection site was also identified, and mutation of this site could reduce the 14-3-3 stability. Divergent expression profiles of the zebrafish 14-3-3 genes were further investigated under organophosphorus stress, suggesting that they may be involved in the different osmoregulation and immune response. The results will serve as a foundation for the further functional investigation into the 14-3-3 genes in fishes. Copyright © 2018 Elsevier B.V. All rights reserved.
Similarity of markers identified from cancer gene expression studies: observations from GEO.
Shi, Xingjie; Shen, Shihao; Liu, Jin; Huang, Jian; Zhou, Yong; Ma, Shuangge
2014-09-01
Gene expression profiling has been extensively conducted in cancer research. The analysis of multiple independent cancer gene expression datasets may provide additional information and complement single-dataset analysis. In this study, we conduct multi-dataset analysis and are interested in evaluating the similarity of cancer-associated genes identified from different datasets. The first objective of this study is to briefly review some statistical methods that can be used for such evaluation. Both marginal analysis and joint analysis methods are reviewed. The second objective is to apply those methods to 26 Gene Expression Omnibus (GEO) datasets on five types of cancers. Our analysis suggests that for the same cancer, the marker identification results may vary significantly across datasets, and different datasets share few common genes. In addition, datasets on different cancers share few common genes. The shared genetic basis of datasets on the same or different cancers, which has been suggested in the literature, is not observed in the analysis of GEO data. © The Author 2013. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Different EGFR gene mutations in two patients with synchronous multiple lung cancers: A case report
Sakai, Hiroki; Kimura, Hiroyuki; Tsuda, Masataka; Wakiyama, Yoichi; Miyazawa, Tomoyuki; Marushima, Hideki; Kojima, Koji; Hoshikawa, Masahiro; Takagi, Masayuki; Nakamura, Haruhiko
2017-01-01
Routine clinical and pathological evaluations to determine the relationship between different lesions are often not completely conclusive. Interestingly, detailed genetic analysis of tumor samples may provide important additional information and identify second primary lung cancers. In the present study, we report cases of two synchronous lung adenocarcinomas composed of two distinct pathological subtypes with different EGFR gene mutations: a homozygous deletion in exon 19 of the papillary adenocarcinoma subtype and a point mutation of L858R in exon 21 of the tubular adenocarcinoma. The present report highlights the clinical importance of molecular cancer biomarkers to guide management decisions in cases involving multiple lung tumors. PMID:29090842
Pharmacogenomic prediction of anthracycline-induced cardiotoxicity in children.
Visscher, Henk; Ross, Colin J D; Rassekh, S Rod; Barhdadi, Amina; Dubé, Marie-Pierre; Al-Saloos, Hesham; Sandor, George S; Caron, Huib N; van Dalen, Elvira C; Kremer, Leontien C; van der Pal, Helena J; Brown, Andrew M K; Rogers, Paul C; Phillips, Michael S; Rieder, Michael J; Carleton, Bruce C; Hayden, Michael R
2012-05-01
Anthracycline-induced cardiotoxicity (ACT) is a serious adverse drug reaction limiting anthracycline use and causing substantial morbidity and mortality. Our aim was to identify genetic variants associated with ACT in patients treated for childhood cancer. We carried out a study of 2,977 single-nucleotide polymorphisms (SNPs) in 220 key drug biotransformation genes in a discovery cohort of 156 anthracycline-treated children from British Columbia, with replication in a second cohort of 188 children from across Canada and further replication of the top SNP in a third cohort of 96 patients from Amsterdam, the Netherlands. We identified a highly significant association of a synonymous coding variant rs7853758 (L461L) within the SLC28A3 gene with ACT (odds ratio, 0.35; P = 1.8 × 10(-5) for all cohorts combined). Additional associations (P < .01) with risk and protective variants in other genes including SLC28A1 and several adenosine triphosphate-binding cassette transporters (ABCB1, ABCB4, and ABCC1) were present. We further explored combining multiple variants into a single-prediction model together with clinical risk factors and classification of patients into three risk groups. In the high-risk group, 75% of patients were accurately predicted to develop ACT, with 36% developing this within the first year alone, whereas in the low-risk group, 96% of patients were accurately predicted not to develop ACT. We have identified multiple genetic variants in SLC28A3 and other genes associated with ACT. Combined with clinical risk factors, genetic risk profiling might be used to identify high-risk patients who can then be provided with safer treatment options.
Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-01-01
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699
Cao, Heping; Zhang, Lin; Tan, Xiaofeng; Long, Hongxu; Shockey, Jay M.
2014-01-01
Triacylglycerols (TAG) are the major molecules of energy storage in eukaryotes. TAG are packed in subcellular structures called oil bodies or lipid droplets. Oleosins (OLE) are the major proteins in plant oil bodies. Multiple isoforms of OLE are present in plants such as tung tree (Vernicia fordii), whose seeds are rich in novel TAG with a wide range of industrial applications. The objectives of this study were to identify OLE genes, classify OLE proteins and analyze OLE gene expression in tung trees. We identified five tung tree OLE genes coding for small hydrophobic proteins. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that the five tung OLE genes represented the five OLE subfamilies and all contained the “proline knot” motif (PX5SPX3P) shared among 65 OLE from 19 tree species, including the sequenced genomes of Prunus persica (peach), Populus trichocarpa (poplar), Ricinus communis (castor bean), Theobroma cacao (cacao) and Vitis vinifera (grapevine). Tung OLE1, OLE2 and OLE3 belong to the S type and OLE4 and OLE5 belong to the SM type of Arabidopsis OLE. TaqMan and SYBR Green qPCR methods were used to study the differential expression of OLE genes in tung tree tissues. Expression results demonstrated that 1) All five OLE genes were expressed in developing tung seeds, leaves and flowers; 2) OLE mRNA levels were much higher in seeds than leaves or flowers; 3) OLE1, OLE2 and OLE3 genes were expressed in tung seeds at much higher levels than OLE4 and OLE5 genes; 4) OLE mRNA levels rapidly increased during seed development; and 5) OLE gene expression was well-coordinated with tung oil accumulation in the seeds. These results suggest that tung OLE genes 1–3 probably play major roles in tung oil accumulation and/or oil body development. Therefore, they might be preferred targets for tung oil engineering in transgenic plants. PMID:24516650
Cao, Heping; Zhang, Lin; Tan, Xiaofeng; Long, Hongxu; Shockey, Jay M
2014-01-01
Triacylglycerols (TAG) are the major molecules of energy storage in eukaryotes. TAG are packed in subcellular structures called oil bodies or lipid droplets. Oleosins (OLE) are the major proteins in plant oil bodies. Multiple isoforms of OLE are present in plants such as tung tree (Vernicia fordii), whose seeds are rich in novel TAG with a wide range of industrial applications. The objectives of this study were to identify OLE genes, classify OLE proteins and analyze OLE gene expression in tung trees. We identified five tung tree OLE genes coding for small hydrophobic proteins. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that the five tung OLE genes represented the five OLE subfamilies and all contained the "proline knot" motif (PX5SPX3P) shared among 65 OLE from 19 tree species, including the sequenced genomes of Prunus persica (peach), Populus trichocarpa (poplar), Ricinus communis (castor bean), Theobroma cacao (cacao) and Vitis vinifera (grapevine). Tung OLE1, OLE2 and OLE3 belong to the S type and OLE4 and OLE5 belong to the SM type of Arabidopsis OLE. TaqMan and SYBR Green qPCR methods were used to study the differential expression of OLE genes in tung tree tissues. Expression results demonstrated that 1) All five OLE genes were expressed in developing tung seeds, leaves and flowers; 2) OLE mRNA levels were much higher in seeds than leaves or flowers; 3) OLE1, OLE2 and OLE3 genes were expressed in tung seeds at much higher levels than OLE4 and OLE5 genes; 4) OLE mRNA levels rapidly increased during seed development; and 5) OLE gene expression was well-coordinated with tung oil accumulation in the seeds. These results suggest that tung OLE genes 1-3 probably play major roles in tung oil accumulation and/or oil body development. Therefore, they might be preferred targets for tung oil engineering in transgenic plants.
Computational Identification and Functional Predictions of Long Noncoding RNA in Zea mays
Boerner, Susan; McGinnis, Karen M.
2012-01-01
Background Computational analysis of cDNA sequences from multiple organisms suggests that a large portion of transcribed DNA does not code for a functional protein. In mammals, noncoding transcription is abundant, and often results in functional RNA molecules that do not appear to encode proteins. Many long noncoding RNAs (lncRNAs) appear to have epigenetic regulatory function in humans, including HOTAIR and XIST. While epigenetic gene regulation is clearly an essential mechanism in plants, relatively little is known about the presence or function of lncRNAs in plants. Methodology/Principal Findings To explore the connection between lncRNA and epigenetic regulation of gene expression in plants, a computational pipeline using the programming language Python has been developed and applied to maize full length cDNA sequences to identify, classify, and localize potential lncRNAs. The pipeline was used in parallel with an SVM tool for identifying ncRNAs to identify the maximal number of ncRNAs in the dataset. Although the available library of sequences was small and potentially biased toward protein coding transcripts, 15% of the sequences were predicted to be noncoding. Approximately 60% of these sequences appear to act as precursors for small RNA molecules and may function to regulate gene expression via a small RNA dependent mechanism. ncRNAs were predicted to originate from both genic and intergenic loci. Of the lncRNAs that originated from genic loci, ∼20% were antisense to the host gene loci. Conclusions/Significance Consistent with similar studies in other organisms, noncoding transcription appears to be widespread in the maize genome. Computational predictions indicate that maize lncRNAs may function to regulate expression of other genes through multiple RNA mediated mechanisms. PMID:22916204
2012-01-01
Background Colorectal carcinomas (CRC) carry massive genetic and transcriptional alterations that influence multiple cellular pathways. The study of proteins whose loss-of-function (LOF) alters the growth of CRC cells can be used to further understand the cellular processes cancer cells depend upon for survival. Results A small-scale RNAi screen of ~400 genes conducted in SW480 CRC cells identified several candidate genes as required for the viability of CRC cells, most prominently CASP8AP2/FLASH. To understand the function of this gene in maintaining the viability of CRC cells in an unbiased manner, we generated gene specific expression profiles following RNAi. Silencing of CASP8AP2/FLASH resulted in altered expression of over 2500 genes enriched for genes associated with cellular growth and proliferation. Loss of CASP8AP2/FLASH function was significantly associated with altered transcription of the genes encoding the replication-dependent histone proteins as a result of the expression of the non-canonical polyA variants of these transcripts. Silencing of CASP8AP2/FLASH also mediated enrichment of changes in the expression of targets of the NFκB and MYC transcription factors. These findings were confirmed by whole transcriptome analysis of CASP8AP2/FLASH silenced cells at multiple time points. Finally, we identified and validated that CASP8AP2/FLASH LOF increases the expression of neurofilament heavy polypeptide (NEFH), a protein recently linked to regulation of the AKT1/ß-catenin pathway. Conclusions We have used unbiased RNAi based approaches to identify and characterize the function of CASP8AP2/FLASH, a protein not previously reported as required for cell survival. This study further defines the role CASP8AP2/FLASH plays in the regulating expression of the replication-dependent histones and shows that its LOF results in broad and reproducible effects on the transcriptome of colorectal cancer cells including the induction of expression of the recently described tumor suppressor gene NEFH. PMID:22216762
Hummon, Amanda B; Pitt, Jason J; Camps, Jordi; Emons, Georg; Skube, Susan B; Huppi, Konrad; Jones, Tamara L; Beissbarth, Tim; Kramer, Frank; Grade, Marian; Difilippantonio, Michael J; Ried, Thomas; Caplen, Natasha J
2012-01-04
Colorectal carcinomas (CRC) carry massive genetic and transcriptional alterations that influence multiple cellular pathways. The study of proteins whose loss-of-function (LOF) alters the growth of CRC cells can be used to further understand the cellular processes cancer cells depend upon for survival. A small-scale RNAi screen of ~400 genes conducted in SW480 CRC cells identified several candidate genes as required for the viability of CRC cells, most prominently CASP8AP2/FLASH. To understand the function of this gene in maintaining the viability of CRC cells in an unbiased manner, we generated gene specific expression profiles following RNAi. Silencing of CASP8AP2/FLASH resulted in altered expression of over 2500 genes enriched for genes associated with cellular growth and proliferation. Loss of CASP8AP2/FLASH function was significantly associated with altered transcription of the genes encoding the replication-dependent histone proteins as a result of the expression of the non-canonical polyA variants of these transcripts. Silencing of CASP8AP2/FLASH also mediated enrichment of changes in the expression of targets of the NFκB and MYC transcription factors. These findings were confirmed by whole transcriptome analysis of CASP8AP2/FLASH silenced cells at multiple time points. Finally, we identified and validated that CASP8AP2/FLASH LOF increases the expression of neurofilament heavy polypeptide (NEFH), a protein recently linked to regulation of the AKT1/ß-catenin pathway. We have used unbiased RNAi based approaches to identify and characterize the function of CASP8AP2/FLASH, a protein not previously reported as required for cell survival. This study further defines the role CASP8AP2/FLASH plays in the regulating expression of the replication-dependent histones and shows that its LOF results in broad and reproducible effects on the transcriptome of colorectal cancer cells including the induction of expression of the recently described tumor suppressor gene NEFH.
Variation of types of alcoholism: review and subtypes identified in Han Chinese.
Lee, Sheng-Yu; Chen, Shiou-Lan; Chang, Yun-Hsuan; Lu, Ru-Band
2014-01-03
Alcoholism, as it has been hypothesized, is caused by a highly heterogeneous genetic load. Since 1960, many reports have used the bio-psycho-social approach to subtype alcoholism; however, no subtypes have been genetically validated. We reviewed and compared the major single-gene, multiple-gene, and gene-to-gene interaction studies on alcoholism published during the past quarter-century, including many recent studies that have made contributions to the subtyping of alcoholism. Four subtypes of alcoholism have been reported: [1] pure alcoholism, [2] anxiety/depression alcoholism, [3] antisocial alcoholism, and [4] mixed alcoholism. Most of the important studies focused on three genes: DRD2, MAOA, and ALDH2. Therefore, our review focuses on these three genes. © 2013.
Plant metabolic clusters - from genetics to genomics.
Nützmann, Hans-Wilhelm; Huang, Ancheng; Osbourn, Anne
2016-08-01
Contents 771 I. 771 II. 772 III. 780 IV. 781 V. 786 786 References 786 SUMMARY: Plant natural products are of great value for agriculture, medicine and a wide range of other industrial applications. The discovery of new plant natural product pathways is currently being revolutionized by two key developments. First, breakthroughs in sequencing technology and reduced cost of sequencing are accelerating the ability to find enzymes and pathways for the biosynthesis of new natural products by identifying the underlying genes. Second, there are now multiple examples in which the genes encoding certain natural product pathways have been found to be grouped together in biosynthetic gene clusters within plant genomes. These advances are now making it possible to develop strategies for systematically mining multiple plant genomes for the discovery of new enzymes, pathways and chemistries. Increased knowledge of the features of plant metabolic gene clusters - architecture, regulation and assembly - will be instrumental in expediting natural product discovery. This review summarizes progress in this area. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Two FGFRL-Wnt circuits organize the planarian anteroposterior axis.
Scimone, M Lucila; Cote, Lauren E; Rogers, Travis; Reddien, Peter W
2016-04-11
How positional information instructs adult tissue maintenance is poorly understood. Planarians undergo whole-body regeneration and tissue turnover, providing a model for adult positional information studies. Genes encoding secreted and transmembrane components of multiple developmental pathways are predominantly expressed in planarian muscle cells. Several of these genes regulate regional identity, consistent with muscle harboring positional information. Here, single-cell RNA-sequencing of 115 muscle cells from distinct anterior-posterior regions identified 44 regionally expressed genes, including multiple Wnt and ndk/FGF receptor-like (ndl/FGFRL) genes. Two distinct FGFRL-Wnt circuits, involving juxtaposed anterior FGFRL and posterior Wnt expression domains, controlled planarian head and trunk patterning. ndl-3 and wntP-2 inhibition expanded the trunk, forming ectopic mouths and secondary pharynges, which independently extended and ingested food. fz5/8-4 inhibition, like that of ndk and wntA, caused posterior brain expansion and ectopic eye formation. Our results suggest that FGFRL-Wnt circuits operate within a body-wide coordinate system to control adult axial positioning.
Functional cis-regulatory modules encoded by mouse-specific endogenous retrovirus
Sundaram, Vasavi; Choudhary, Mayank N. K.; Pehrsson, Erica; Xing, Xiaoyun; Fiore, Christopher; Pandey, Manishi; Maricque, Brett; Udawatta, Methma; Ngo, Duc; Chen, Yujie; Paguntalan, Asia; Ray, Tammy; Hughes, Ava; Cohen, Barak A.; Wang, Ting
2017-01-01
Cis-regulatory modules contain multiple transcription factor (TF)-binding sites and integrate the effects of each TF to control gene expression in specific cellular contexts. Transposable elements (TEs) are uniquely equipped to deposit their regulatory sequences across a genome, which could also contain cis-regulatory modules that coordinate the control of multiple genes with the same regulatory logic. We provide the first evidence of mouse-specific TEs that encode a module of TF-binding sites in mouse embryonic stem cells (ESCs). The majority (77%) of the individual TEs tested exhibited enhancer activity in mouse ESCs. By mutating individual TF-binding sites within the TE, we identified a module of TF-binding motifs that cooperatively enhanced gene expression. Interestingly, we also observed the same motif module in the in silico constructed ancestral TE that also acted cooperatively to enhance gene expression. Our results suggest that ancestral TE insertions might have brought in cis-regulatory modules into the mouse genome. PMID:28348391
Genetic variations in the serotonergic system contribute to amygdala volume in humans.
Li, Jin; Chen, Chunhui; Wu, Karen; Zhang, Mingxia; Zhu, Bi; Chen, Chuansheng; Moyzis, Robert K; Dong, Qi
2015-01-01
The amygdala plays a critical role in emotion processing and psychiatric disorders associated with emotion dysfunction. Accumulating evidence suggests that amygdala structure is modulated by serotonin-related genes. However, there is a gap between the small contributions of single loci (less than 1%) and the reported 63-65% heritability of amygdala structure. To understand the "missing heritability," we systematically explored the contribution of serotonin genes on amygdala structure at the gene set level. The present study of 417 healthy Chinese volunteers examined 129 representative polymorphisms in genes from multiple biological mechanisms in the regulation of serotonin neurotransmission. A system-level approach using multiple regression analyses identified that nine SNPs collectively accounted for approximately 8% of the variance in amygdala volume. Permutation analyses showed that the probability of obtaining these findings by chance was low (p = 0.043, permuted for 1000 times). Findings showed that serotonin genes contribute moderately to individual differences in amygdala volume in a healthy Chinese sample. These results indicate that the system-level approach can help us to understand the genetic basis of a complex trait such as amygdala structure.
Chen, Jing; Zhang, Hanping; Feng, Mingfeng; Zuo, Dengpan; Hu, Yahui; Jiang, Tong
2016-07-13
Woodland strawberry (Fragaria vesca) infected with Strawberry vein banding virus (SVBV) exhibits chlorotic symptoms along the leaf veins. However, little is known about the molecular mechanism of strawberry disease caused by SVBV. We performed the next-generation sequencing (RNA-Seq) study to identify gene expression changes induced by SVBV in woodland strawberry using mock-inoculated plants as a control. Using RNA-Seq, we have identified 36,850 unigenes, of which 517 were differentially expressed in the virus-infected plants (DEGs). The unigenes were annotated and classified with Gene Ontology (GO), Clusters of Orthologous Group (COG) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. The KEGG pathway analysis of these genes suggested that strawberry disease caused by SVBV may affect multiple processes including pigment metabolism, photosynthesis and plant-pathogen interactions. Our research provides comprehensive transcriptome information regarding SVBV infection in strawberry.
Yoshikawa, Miho; Zhang, Ming; Kurisu, Futoshi; Toyota, Koki
2017-01-01
Most bioremediation studies on volatile organic compounds (VOCs) have focused on a single contaminant or its derived compounds and degraders have been identified under single contaminant conditions. Bioremediation of multiple contaminants remains a challenging issue. To identify a bacterial consortium that degrades multiple VOCs (dichloromethane (DCM), benzene, and toluene), we applied DNA-stable isotope probing. For individual tests, we combined a 13 C-labeled VOC with other two unlabeled VOCs, and prepared three unlabeled VOCs as a reference. Over 11 days, DNA was periodically extracted from the consortia, and the bacterial community was evaluated by next-generation sequencing of bacterial 16S rRNA gene amplicons. Density gradient fractions of the DNA extracts were amplified by universal bacterial primers for the 16S rRNA gene sequences, and the amplicons were analyzed by terminal restriction fragment length polymorphism (T-RFLP) using restriction enzymes: Hha I and Msp I. The T-RFLP fragments were identified by 16S rRNA gene cloning and sequencing. Under all test conditions, the consortia were dominated by Rhodanobacter , Bradyrhizobium / Afipia , Rhizobium , and Hyphomicrobium . DNA derived from Hyphomicrobium and Propioniferax shifted toward heavier fractions under the condition added with 13 C-DCM and 13 C-benzene, respectively, compared with the reference, but no shifts were induced by 13 C-toluene addition. This implies that Hyphomicrobium and Propioniferax were the main DCM and benzene degraders, respectively, under the coexisting condition. The known benzene degrader Pseudomonas sp. was present but not actively involved in the degradation.
Prediction of regulatory gene pairs using dynamic time warping and gene ontology.
Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K
2014-01-01
Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.
Blazier, J. Chris; Ruhlman, Tracey A.; Weng, Mao-Lun; Rehman, Sumaiyah K.; Sabir, Jamal S. M.; Jansen, Robert K.
2016-01-01
Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA. PMID:27087667
A Multiomics Approach to Identify Genes Associated with Childhood Asthma Risk and Morbidity.
Forno, Erick; Wang, Ting; Yan, Qi; Brehm, John; Acosta-Perez, Edna; Colon-Semidey, Angel; Alvarez, Maria; Boutaoui, Nadia; Cloutier, Michelle M; Alcorn, John F; Canino, Glorisa; Chen, Wei; Celedón, Juan C
2017-10-01
Childhood asthma is a complex disease. In this study, we aim to identify genes associated with childhood asthma through a multiomics "vertical" approach that integrates multiple analytical steps using linear and logistic regression models. In a case-control study of childhood asthma in Puerto Ricans (n = 1,127), we used adjusted linear or logistic regression models to evaluate associations between several analytical steps of omics data, including genome-wide (GW) genotype data, GW methylation, GW expression profiling, cytokine levels, asthma-intermediate phenotypes, and asthma status. At each point, only the top genes/single-nucleotide polymorphisms/probes/cytokines were carried forward for subsequent analysis. In step 1, asthma modified the gene expression-protein level association for 1,645 genes; pathway analysis showed an enrichment of these genes in the cytokine signaling system (n = 269 genes). In steps 2-3, expression levels of 40 genes were associated with intermediate phenotypes (asthma onset age, forced expiratory volume in 1 second, exacerbations, eosinophil counts, and skin test reactivity); of those, methylation of seven genes was also associated with asthma. Of these seven candidate genes, IL5RA was also significant in analytical steps 4-8. We then measured plasma IL-5 receptor α levels, which were associated with asthma age of onset and moderate-severe exacerbations. In addition, in silico database analysis showed that several of our identified IL5RA single-nucleotide polymorphisms are associated with transcription factors related to asthma and atopy. This approach integrates several analytical steps and is able to identify biologically relevant asthma-related genes, such as IL5RA. It differs from other methods that rely on complex statistical models with various assumptions.
Evidence for the evolution of tenascin and fibronectin early in the chordate lineage.
Tucker, Richard P; Chiquet-Ehrismann, Ruth
2009-02-01
Fibronectin and tenascin are extracellular matrix glycoproteins that play important roles in cell adhesion and motility. In a previous study we provided evidence that tenascin first appeared early in the chordate lineage. As tenascin has been proposed to act, in part, through modulation of cell-fibronectin interactions, we sought here to identify fibronectin genes in non-vertebrate chordates and other invertebrates to determine if tenascin and fibronectin evolved separately or together, and to identify phylogenetically conserved features of both proteins. We found that the genome of the urochordate Ciona savignyi contains both a tenascin gene and a gene encoding a fibronectin-like protein with fibronectin type 1, 2 and 3 repeats. The genome of the cephalochordate Branchiostoma floridae (amphioxus) also has a tenascin gene. However, we could not identify a fibronectin-like gene in B. floridae, nor could we identify fibronectin or tenascin genes in echinoderms, protostomes or cnidarians. If urochordates are more closely related to vertebrates, tenascin may have evolved before fibronectin in an ancestor common to tunicates and amphioxus. Alternatively, tenascin and fibronectin may have evolved in an ancestor common to B. floridae and C. savignyi and the fibronectin gene was subsequently lost in the cephalochordate lineage. The fibronectin-like gene from C. savignyi does not encode the RGD motif for integrin binding found in all vertebrate fibronectins, and it lacks most of the fibronectin type 1 domains believed to be critical for fibrillogenesis. In contrast, the tenascin gene in B. floridae encodes multiple RGD motifs, suggesting that integrin binding is fundamental to tenascin function.
Identification and characterization of nuclear genes involved in photosynthesis in Populus
2014-01-01
Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P < 0.05), 163 up-regulated and 352 down-regulated. Real-time PCR expression analysis confirmed the microarray data. Singular Enrichment Analysis identified 48 significantly enriched GO terms for molecular functions (28), biological processes (18) and cell components (2). Furthermore, we selected six candidate genes for functional examination by a single-marker association approach, which demonstrated that 20 SNPs in five candidate genes significantly associated with photosynthetic traits, and the phenotypic variance explained by each SNP ranged from 2.3% to 12.6%. This revealed that regulation of photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936
Bioprospecting the Bibleome: Adding Evidence to Support the Inflammatory Basis of Cancer.
Elkin, Peter L; Frankel, Andrew; Liebow-Liebling, Ester H; Elkin, Jared R; Tuttle, Mark S; Brown, Steven H
2012-05-05
BioProspecting is a novel approach that enabled our team to mine genetic marker related data from the New England Journal of Medicine (NEJM) utilizing Systematized Nomenclature of Medicine-Clinical Terms (SNOMED CT) and the Human Gene Ontology (HUGO). Genes associated with disorders using the Multi-threaded Clinical Vocabulary Server (MCVS) Natural Language Processing (NLP) engine, whose output was represented as an ontology-network incorporating the semantic encodings of the literature. Metabolic functions were used to identify potentially novel relationships between (genes or proteins) and (diseases or drugs). In an effort to identify genes important to transformation of normal tissue into a malignancy, we went on to identify the genes linked to multiple cancers and then mapped those genes to metabolic and signaling pathways. Ten Genes were related to 30 or more cancers, 72 genes were related to 20 or more cancers and 191 genes were related to 10 or more cancers. The three pathways most often associated with the top 200 novel cancer markers were the Acute Phase Response Signaling, the Glucocorticoid Receptor Signaling and the Hepatic Fibrosis/Hepatic Stellate Cell Activation pathway. This association highlights the role of inflammation in the induction and perhaps transformation of mortal cells into cancers. BioProspecting can speed our identification and understanding of synergies between articles in the biomedical literature. In this case we found considerable synergy between the Oncology literature and the Sepsis literature. By mapping these associations to known metabolic, regulatory and signaling pathways we were able to identify further evidence for the inflammatory basis of cancer.
Hook, Sharon E; Skillman, Ann D; Gopalan, Banu; Small, Jack A; Schultz, Irvin R
2008-03-01
Among proposed uses for microarrays in environmental toxiciology is the identification of key contributors to toxicity within a mixture. However, it remains uncertain whether the transcriptomic profiles resulting from exposure to a mixture have patterns of altered gene expression that contain identifiable contributions from each toxicant component. We exposed isogenic rainbow trout Onchorynchus mykiss, to sublethal levels of ethynylestradiol, 2,2,4,4-tetrabromodiphenyl ether, and chromium VI or to a mixture of all three toxicants Fluorescently labeled complementary DNA (cDNA) were generated and hybridized against a commercially available Salmonid array spotted with 16,000 cDNAs. Data were analyzed using analysis of variance (p<0.05) with a Benjamani-Hochberg multiple test correction (Genespring [Agilent] software package) to identify up and downregulated genes. Gene clustering patterns that can be used as "expression signatures" were determined using hierarchical cluster analysis. The gene ontology terms associated with significantly altered genes were also used to identify functional groups that were associated with toxicant exposure. Cross-ontological analytics approach was used to assign functional annotations to genes with "unknown" function. Our analysis indicates that transcriptomic profiles resulting from the mixture exposure resemble those of the individual contaminant exposures, but are not a simple additive list. However, patterns of altered genes representative of each component of the mixture are clearly discernible, and the functional classes of genes altered represent the individual components of the mixture. These findings indicate that the use of microarrays to identify transcriptomic profiles may aid in the identification of key stressors within a chemical mixture, ultimately improving environmental assessment.
Hersh, Bradley M
2016-12-01
SummaryA single gene might have several functions within an organism, and so mutational loss of that gene has multiple effects across different physiological systems in the organism. Though the white gene in Drosophila melanogaster was identified originally for its effect on fly eye color, an article by Xiao and Robertson in the June 2016 issue of GENETICS describes a function for the white gene in the response of Drosophila to oxygen deprivation. This Primer article provides background information on the white gene, the phenomenon of pleiotropy, and the molecular and genetic approaches used in the study to demonstrate a new behavioral function for the white gene. Copyright © 2016 by the Genetics Society of America.
Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis
Sawcer, Stephen; Hellenthal, Garrett; Pirinen, Matti; Spencer, Chris C.A.; Patsopoulos, Nikolaos A.; Moutsianas, Loukas; Dilthey, Alexander; Su, Zhan; Freeman, Colin; Hunt, Sarah E.; Edkins, Sarah; Gray, Emma; Booth, David R.; Potter, Simon C.; Goris, An; Band, Gavin; Oturai, Annette Bang; Strange, Amy; Saarela, Janna; Bellenguez, Céline; Fontaine, Bertrand; Gillman, Matthew; Hemmer, Bernhard; Gwilliam, Rhian; Zipp, Frauke; Jayakumar, Alagurevathi; Martin, Roland; Leslie, Stephen; Hawkins, Stanley; Giannoulatou, Eleni; D’alfonso, Sandra; Blackburn, Hannah; Boneschi, Filippo Martinelli; Liddle, Jennifer; Harbo, Hanne F.; Perez, Marc L.; Spurkland, Anne; Waller, Matthew J; Mycko, Marcin P.; Ricketts, Michelle; Comabella, Manuel; Hammond, Naomi; Kockum, Ingrid; McCann, Owen T.; Ban, Maria; Whittaker, Pamela; Kemppinen, Anu; Weston, Paul; Hawkins, Clive; Widaa, Sara; Zajicek, John; Dronov, Serge; Robertson, Neil; Bumpstead, Suzannah J.; Barcellos, Lisa F.; Ravindrarajah, Rathi; Abraham, Roby; Alfredsson, Lars; Ardlie, Kristin; Aubin, Cristin; Baker, Amie; Baker, Katharine; Baranzini, Sergio E.; Bergamaschi, Laura; Bergamaschi, Roberto; Bernstein, Allan; Berthele, Achim; Boggild, Mike; Bradfield, Jonathan P.; Brassat, David; Broadley, Simon A.; Buck, Dorothea; Butzkueven, Helmut; Capra, Ruggero; Carroll, William M.; Cavalla, Paola; Celius, Elisabeth G.; Cepok, Sabine; Chiavacci, Rosetta; Clerget-Darpoux, Françoise; Clysters, Katleen; Comi, Giancarlo; Cossburn, Mark; Cournu-Rebeix, Isabelle; Cox, Mathew B.; Cozen, Wendy; Cree, Bruce A.C.; Cross, Anne H.; Cusi, Daniele; Daly, Mark J.; Davis, Emma; de Bakker, Paul I.W.; Debouverie, Marc; D’hooghe, Marie Beatrice; Dixon, Katherine; Dobosi, Rita; Dubois, Bénédicte; Ellinghaus, David; Elovaara, Irina; Esposito, Federica; Fontenille, Claire; Foote, Simon; Franke, Andre; Galimberti, Daniela; Ghezzi, Angelo; Glessner, Joseph; Gomez, Refujia; Gout, Olivier; Graham, Colin; Grant, Struan F.A.; Guerini, Franca Rosa; Hakonarson, Hakon; Hall, Per; Hamsten, Anders; Hartung, Hans-Peter; Heard, Rob N.; Heath, Simon; Hobart, Jeremy; Hoshi, Muna; Infante-Duarte, Carmen; Ingram, Gillian; Ingram, Wendy; Islam, Talat; Jagodic, Maja; Kabesch, Michael; Kermode, Allan G.; Kilpatrick, Trevor J.; Kim, Cecilia; Klopp, Norman; Koivisto, Keijo; Larsson, Malin; Lathrop, Mark; Lechner-Scott, Jeannette S.; Leone, Maurizio A.; Leppä, Virpi; Liljedahl, Ulrika; Bomfim, Izaura Lima; Lincoln, Robin R.; Link, Jenny; Liu, Jianjun; Lorentzen, Åslaug R.; Lupoli, Sara; Macciardi, Fabio; Mack, Thomas; Marriott, Mark; Martinelli, Vittorio; Mason, Deborah; McCauley, Jacob L.; Mentch, Frank; Mero, Inger-Lise; Mihalova, Tania; Montalban, Xavier; Mottershead, John; Myhr, Kjell-Morten; Naldi, Paola; Ollier, William; Page, Alison; Palotie, Aarno; Pelletier, Jean; Piccio, Laura; Pickersgill, Trevor; Piehl, Fredrik; Pobywajlo, Susan; Quach, Hong L.; Ramsay, Patricia P.; Reunanen, Mauri; Reynolds, Richard; Rioux, John D.; Rodegher, Mariaemma; Roesner, Sabine; Rubio, Justin P.; Rückert, Ina-Maria; Salvetti, Marco; Salvi, Erika; Santaniello, Adam; Schaefer, Catherine A.; Schreiber, Stefan; Schulze, Christian; Scott, Rodney J.; Sellebjerg, Finn; Selmaj, Krzysztof W.; Sexton, David; Shen, Ling; Simms-Acuna, Brigid; Skidmore, Sheila; Sleiman, Patrick M.A.; Smestad, Cathrine; Sørensen, Per Soelberg; Søndergaard, Helle Bach; Stankovich, Jim; Strange, Richard C.; Sulonen, Anna-Maija; Sundqvist, Emilie; Syvänen, Ann-Christine; Taddeo, Francesca; Taylor, Bruce; Blackwell, Jenefer M.; Tienari, Pentti; Bramon, Elvira; Tourbah, Ayman; Brown, Matthew A.; Tronczynska, Ewa; Casas, Juan P.; Tubridy, Niall; Corvin, Aiden; Vickery, Jane; Jankowski, Janusz; Villoslada, Pablo; Markus, Hugh S.; Wang, Kai; Mathew, Christopher G.; Wason, James; Palmer, Colin N.A.; Wichmann, H-Erich; Plomin, Robert; Willoughby, Ernest; Rautanen, Anna; Winkelmann, Juliane; Wittig, Michael; Trembath, Richard C.; Yaouanq, Jacqueline; Viswanathan, Ananth C.; Zhang, Haitao; Wood, Nicholas W.; Zuvich, Rebecca; Deloukas, Panos; Langford, Cordelia; Duncanson, Audrey; Oksenberg, Jorge R.; Pericak-Vance, Margaret A.; Haines, Jonathan L.; Olsson, Tomas; Hillert, Jan; Ivinson, Adrian J.; De Jager, Philip L.; Peltonen, Leena; Stewart, Graeme J.; Hafler, David A.; Hauser, Stephen L.; McVean, Gil; Donnelly, Peter; Compston, Alastair
2011-01-01
Multiple sclerosis (OMIM 126200) is a common disease of the central nervous system in which the interplay between inflammatory and neurodegenerative processes typically results in intermittent neurological disturbance followed by progressive accumulation of disability.1 Epidemiological studies have shown that genetic factors are primarily responsible for the substantially increased frequency of the disease seen in the relatives of affected individuals;2,3 and systematic attempts to identify linkage in multiplex families have confirmed that variation within the Major Histocompatibility Complex (MHC) exerts the greatest individual effect on risk.4 Modestly powered Genome-Wide Association Studies (GWAS)5-10 have enabled more than 20 additional risk loci to be identified and have shown that multiple variants exerting modest individual effects play a key role in disease susceptibility.11 Most of the genetic architecture underlying susceptibility to the disease remains to be defined and is anticipated to require the analysis of sample sizes that are beyond the numbers currently available to individual research groups. In a collaborative GWAS involving 9772 cases of European descent collected by 23 research groups working in 15 different countries, we have replicated almost all of the previously suggested associations and identified at least a further 29 novel susceptibility loci. Within the MHC we have refined the identity of the DRB1 risk alleles and confirmed that variation in the HLA-A gene underlies the independent protective effect attributable to the Class I region. Immunologically relevant genes are significantly over-represented amongst those mapping close to the identified loci and particularly implicate T helper cell differentiation in the pathogenesis of multiple sclerosis. PMID:21833088
Planar cell polarity pathway genes and risk for spina bifida.
Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E; Shaw, Gary M; Lammer, Edward J; Finnell, Richard H
2010-02-01
Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologs of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled, and Scrib, two of the homologs of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologs of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted P-value <0.01. In conclusion, our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. Copyright 2010 Wiley-Liss, Inc.
Inference of Evolutionary Forces Acting on Human Biological Pathways
Daub, Josephine T.; Dupanloup, Isabelle; Robinson-Rechavi, Marc; Excoffier, Laurent
2015-01-01
Because natural selection is likely to act on multiple genes underlying a given phenotypic trait, we study here the potential effect of ongoing and past selection on the genetic diversity of human biological pathways. We first show that genes included in gene sets are generally under stronger selective constraints than other genes and that their evolutionary response is correlated. We then introduce a new procedure to detect selection at the pathway level based on a decomposition of the classical McDonald–Kreitman test extended to multiple genes. This new test, called 2DNS, detects outlier gene sets and takes into account past demographic effects and evolutionary constraints specific to gene sets. Selective forces acting on gene sets can be easily identified by a mere visual inspection of the position of the gene sets relative to their two-dimensional null distribution. We thus find several outlier gene sets that show signals of positive, balancing, or purifying selection but also others showing an ancient relaxation of selective constraints. The principle of the 2DNS test can also be applied to other genomic contrasts. For instance, the comparison of patterns of polymorphisms private to African and non-African populations reveals that most pathways show a higher proportion of nonsynonymous mutations in non-Africans than in Africans, potentially due to different demographic histories and selective pressures. PMID:25971280
Integrative prescreening in analysis of multiple cancer genomic studies
2012-01-01
Background In high throughput cancer genomic studies, results from the analysis of single datasets often suffer from a lack of reproducibility because of small sample sizes. Integrative analysis can effectively pool and analyze multiple datasets and provides a cost effective way to improve reproducibility. In integrative analysis, simultaneously analyzing all genes profiled may incur high computational cost. A computationally affordable remedy is prescreening, which fits marginal models, can be conducted in a parallel manner, and has low computational cost. Results An integrative prescreening approach is developed for the analysis of multiple cancer genomic datasets. Simulation shows that the proposed integrative prescreening has better performance than alternatives, particularly including prescreening with individual datasets, an intensity approach and meta-analysis. We also analyze multiple microarray gene profiling studies on liver and pancreatic cancers using the proposed approach. Conclusions The proposed integrative prescreening provides an effective way to reduce the dimensionality in cancer genomic studies. It can be coupled with existing analysis methods to identify cancer markers. PMID:22799431
Xiao, Xiaolin; Moreno-Moral, Aida; Rotival, Maxime; Bottolo, Leonardo; Petretto, Enrico
2014-01-01
Recent high-throughput efforts such as ENCODE have generated a large body of genome-scale transcriptional data in multiple conditions (e.g., cell-types and disease states). Leveraging these data is especially important for network-based approaches to human disease, for instance to identify coherent transcriptional modules (subnetworks) that can inform functional disease mechanisms and pathological pathways. Yet, genome-scale network analysis across conditions is significantly hampered by the paucity of robust and computationally-efficient methods. Building on the Higher-Order Generalized Singular Value Decomposition, we introduce a new algorithmic approach for efficient, parameter-free and reproducible identification of network-modules simultaneously across multiple conditions. Our method can accommodate weighted (and unweighted) networks of any size and can similarly use co-expression or raw gene expression input data, without hinging upon the definition and stability of the correlation used to assess gene co-expression. In simulation studies, we demonstrated distinctive advantages of our method over existing methods, which was able to recover accurately both common and condition-specific network-modules without entailing ad-hoc input parameters as required by other approaches. We applied our method to genome-scale and multi-tissue transcriptomic datasets from rats (microarray-based) and humans (mRNA-sequencing-based) and identified several common and tissue-specific subnetworks with functional significance, which were not detected by other methods. In humans we recapitulated the crosstalk between cell-cycle progression and cell-extracellular matrix interactions processes in ventricular zones during neocortex expansion and further, we uncovered pathways related to development of later cognitive functions in the cortical plate of the developing brain which were previously unappreciated. Analyses of seven rat tissues identified a multi-tissue subnetwork of co-expressed heat shock protein (Hsp) and cardiomyopathy genes (Bag3, Cryab, Kras, Emd, Plec), which was significantly replicated using separate failing heart and liver gene expression datasets in humans, thus revealing a conserved functional role for Hsp genes in cardiovascular disease.
NASA Astrophysics Data System (ADS)
Sundaresan, A.; Pellis, N. R.
2005-08-01
Genetic response suites in human lymphocytes in response to microgravity are important to identify and further study in order to augment human physiological adaptation to novel environments. Emerging technologies, such as DNA micro array profiling, have the potential to identify novel genes that are involved in mediating adaptation to these environments. These genes may prove to be therapeutically valuable as new targets for countermeasures, or as predictive biomarkers of response to these new environments. Human lymphocytes cultured in 1g and microgravity analog culture were analyzed for their differential gene expression response. Different groups of genes related to the immune response, cardiovascular system and stress response were then analyzed. Analysis of cells from multiple donors reveals a small shared set that are likely to be essential to adaptation. These three groups focus on human adaptation to new environments. The shared set contains genes related to T cell activation, immune response and stress response to analog microgravity.
Severe sensory neuropathy in patients with adult-onset multiple acyl-CoA dehydrogenase deficiency.
Wang, Zhaoxia; Hong, Daojun; Zhang, Wei; Li, Wurong; Shi, Xin; Zhao, Danhua; Yang, Xu; Lv, He; Yuan, Yun
2016-02-01
Multiple Acyl-CoA dehydrogenase deficiency (MADD) is an autosomal recessive disorder of fatty acid oxidation. Most patients with late-onset MADD are clinically characterized by lipid storage myopathy with dramatic responsiveness to riboflavin treatment. Abnormalities of peripheral neuropathy have rarely been reported in patients with late-onset MADD. We describe six patients who presented with proximal limb weakness and loss of sensation in the distal limbs. Muscle biopsy revealed typical myopathological patterns of lipid storage myopathy and blood acylcarnitine profiles showed a combined elevation of multiple acylcarnitines supporting the diagnosis of MADD. However, nerve conduction investigations and sural nerve biopsies in these patients indicated severe axonal sensory neuropathy. Causative ETFDH gene mutations were found in all six cases. No other causative gene mutations were identified in mitochondrial DNA and genes associated with hereditary neuropathies through next-generation-sequencing panel. Late-onset patients with ETFDH mutations can present with proximal muscle weakness and distal sensory neuropathy, which might be a new phenotypic variation, but the precise underlying pathogenesis remains to be elucidated. Copyright © 2015. Published by Elsevier B.V.
Xu, Peng; Wang, Junhua; Sun, Bo; Xiao, Zhongdang
2018-06-15
Investigating the potential biological function of differential changed genes through integrating multiple omics data including miRNA and mRNA expression profiles, is always hot topic. However, how to evaluate the repression effect on target genes integrating miRNA and mRNA expression profiles are not fully solved. In this study, we provide an analyzing method by integrating both miRNAs and mRNAs expression data simultaneously. Difference analysis was adopted based on the repression score, then significantly repressed mRNAs were screened out by DEGseq. Pathway analysis for the significantly repressed mRNAs shows that multiple pathways such as MAPK signaling pathway, TGF-beta signaling pathway and so on, may correlated to the colorectal cancer(CRC). Focusing on the MAPK signaling pathway, a miRNA-mRNA network that centering the cell fate genes was constructed. Finally, the miRNA-mRNAs that potentially important in the CRC carcinogenesis were screened out and scored by impact index. Copyright © 2018 Elsevier B.V. All rights reserved.
Kim, Ju Young; Duan, Xin; Liu, Cindy Y; Jang, Mi-Hyeon; Guo, Junjie U; Pow-anpongkul, Nattapol; Kang, Eunchai; Song, Hongjun; Ming, Guo-li
2009-09-24
Disrupted-in-schizophrenia 1 (DISC1), a susceptibility gene for major mental illnesses, regulates multiple aspects of embryonic and adult neurogenesis. Here, we show that DISC1 suppression in newborn neurons of the adult hippocampus leads to overactivated signaling of AKT, another schizophrenia susceptibility gene. Mechanistically, DISC1 directly interacts with KIAA1212, an AKT binding partner that enhances AKT signaling in the absence of DISC1, and DISC1 binding to KIAA1212 prevents AKT activation in vitro. Functionally, multiple genetic manipulations to enhance AKT signaling in adult-born neurons in vivo exhibit similar defects as DISC1 suppression in neuronal development that can be rescued by pharmacological inhibition of mammalian target of rapamycin (mTOR), an AKT downstream effector. Our study identifies the AKT-mTOR signaling pathway as a critical DISC1 target in regulating neuronal development and provides a framework for understanding how multiple susceptibility genes may functionally converge onto a common pathway in contributing to the etiology of certain psychiatric disorders.
COGENT (COlorectal cancer GENeTics) revisited
Houlston, Richard S.
2012-01-01
Many colorectal cancers (CRCs) develop in genetically susceptible individuals most of whom are not carriers of germ line mismatch repair or APC gene mutations and much of the heritable risk of CRC appears to be attributable to the co-inheritance of multiple low-risk variants. The accumulated experience to date in identifying this class of susceptibility allele has highlighted the need to conduct statistically and methodologically rigorous studies and the need for the multi-centre collaboration. This has been the motivation for establishing the COGENT (COlorectal cancer GENeTics) consortium which now includes over 20 research groups in Europe, Australia, the Americas, China and Japan actively working on CRC genetics. Here, we review the rationale for identifying low-penetrance variants for CRC and the current and future challenges for COGENT. PMID:22294761
Investigation of First Identified mcr-1 Gene in an Isolate from a U.S. Patient - Pennsylvania, 2016.
Kline, Kelly E; Shover, Jordan; Kallen, Alexander J; Lonsway, David R; Watkins, Sharon; Miller, Jeffrey R
2016-09-16
In 2015, scientists reported the emergence of the plasmid-encoded mcr-1 gene conferring bacterial resistance to the antibiotic colistin (1), signaling potential emergence of a pandrug-resistant bacterium. In May 2016, mcr-1-positive Escherichia coli was first isolated from a specimen from a U.S. patient (2) when a Pennsylvania woman was evaluated for a urinary tract infection. The urine culture and subsequent testing identified the gene in an extended-spectrum beta-lactamase (ESBL)-producing E. coli with reduced susceptibility to colistin. The patient had no international travel for approximately 1 year, no livestock exposure, and a limited role in meal preparation with store-bought groceries; however, she had multiple and repeated admissions to four medical facilities during 2016.
Cornish, Alex J; Filippis, Ioannis; David, Alessia; Sternberg, Michael J E
2015-09-01
Each cell type found within the human body performs a diverse and unique set of functions, the disruption of which can lead to disease. However, there currently exists no systematic mapping between cell types and the diseases they can cause. In this study, we integrate protein-protein interaction data with high-quality cell-type-specific gene expression data from the FANTOM5 project to build the largest collection of cell-type-specific interactomes created to date. We develop a novel method, called gene set compactness (GSC), that contrasts the relative positions of disease-associated genes across 73 cell-type-specific interactomes to map genes associated with 196 diseases to the cell types they affect. We conduct text-mining of the PubMed database to produce an independent resource of disease-associated cell types, which we use to validate our method. The GSC method successfully identifies known disease-cell-type associations, as well as highlighting associations that warrant further study. This includes mast cells and multiple sclerosis, a cell population currently being targeted in a multiple sclerosis phase 2 clinical trial. Furthermore, we build a cell-type-based diseasome using the cell types identified as manifesting each disease, offering insight into diseases linked through etiology. The data set produced in this study represents the first large-scale mapping of diseases to the cell types in which they are manifested and will therefore be useful in the study of disease systems. Overall, we demonstrate that our approach links disease-associated genes to the phenotypes they produce, a key goal within systems medicine.
Systems genetic analysis of multivariate response to iron deficiency in mice
Yin, Lina; Unger, Erica L.; Jellen, Leslie C.; Earley, Christopher J.; Allen, Richard P.; Tomaszewicz, Ann; Fleet, James C.
2012-01-01
The aim of this study was to identify genes that influence iron regulation under varying dietary iron availability. Male and female mice from 20+ BXD recombinant inbred strains were fed iron-poor or iron-adequate diets from weaning until 4 mo of age. At death, the spleen, liver, and blood were harvested for the measurement of hemoglobin, hematocrit, total iron binding capacity, transferrin saturation, and liver, spleen and plasma iron concentration. For each measure and diet, we found large, strain-related variability. A principal-components analysis (PCA) was performed on the strain means for the seven parameters under each dietary condition for each sex, followed by quantitative trait loci (QTL) analysis on the factors. Compared with the iron-adequate diet, iron deficiency altered the factor structure of the principal components. QTL analysis, combined with PosMed (a candidate gene searching system) published gene expression data and literature citations, identified seven candidate genes, Ptprd, Mdm1, Picalm, lip1, Tcerg1, Skp2, and Frzb based on PCA factor, diet, and sex. Expression of each of these is cis-regulated, significantly correlated with the corresponding PCA factor, and previously reported to regulate iron, directly or indirectly. We propose that polymorphisms in multiple genes underlie individual differences in iron regulation, especially in response to dietary iron challenge. This research shows that iron management is a highly complex trait, influenced by multiple genes. Systems genetics analysis of iron homeostasis holds promise for developing new methods for prevention and treatment of iron deficiency anemia and related diseases. PMID:22461179
Genetic Determinants Influencing Human Serum Metabolome among African Americans
Yu, Bing; Zheng, Yan; Alexander, Danny; Morrison, Alanna C.; Coresh, Josef; Boerwinkle, Eric
2014-01-01
Phenotypes proximal to gene action generally reflect larger genetic effect sizes than those that are distant. The human metabolome, a result of multiple cellular and biological processes, are functional intermediate phenotypes proximal to gene action. Here, we present a genome-wide association study of 308 untargeted metabolite levels among African Americans from the Atherosclerosis Risk in Communities (ARIC) Study. Nineteen significant common variant-metabolite associations were identified, including 13 novel loci (p<1.6×10−10). These loci were associated with 7–50% of the difference in metabolite levels per allele, and the variance explained ranged from 4% to 20%. Fourteen genes were identified within the nineteen loci, and four of them contained non-synonymous substitutions in four enzyme-encoding genes (KLKB1, SIAE, CPS1, and NAT8); the other significant loci consist of eight other enzyme-encoding genes (ACE, GATM, ACY3, ACSM2B, THEM4, ADH4, UGT1A, TREH), a transporter gene (SLC6A13) and a polycystin protein gene (PKD2L1). In addition, four potential disease-associated paths were identified, including two direct longitudinal predictive relationships: NAT8 with N-acetylornithine, N-acetyl-1-methylhistidine and incident chronic kidney disease, and TREH with trehalose and incident diabetes. These results highlight the value of using endophenotypes proximal to gene function to discover new insights into biology and disease pathology. PMID:24625756
Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K
2015-01-01
Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola
2014-01-01
We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918
Molecular Profile of Peripheral Blood Mononuclear Cells from Patients with Rheumatoid Arthritis
Edwards, Christopher J; Feldman, Jeffrey L; Beech, Jonathan; Shields, Kathleen M; Stover, Jennifer A; Trepicchio, William L; Larsen, Glenn; Foxwell, Brian MJ; Brennan, Fionula M; Feldmann, Marc; Pittman, Debra D
2007-01-01
Rheumatoid arthritis (RA) is a chronic inflammatory arthritis. Currently, diagnosis of RA may take several weeks, and factors used to predict a poor prognosis are not always reliable. Gene expression in RA may consist of a unique signature. Gene expression analysis has been applied to synovial tissue to define molecularly distinct forms of RA; however, expression analysis of tissue taken from a synovial joint is invasive and clinically impractical. Recent studies have demonstrated that unique gene expression changes can be identified in peripheral blood mononuclear cells (PBMCs) from patients with cancer, multiple sclerosis, and lupus. To identify RA disease-related genes, we performed a global gene expression analysis. RNA from PBMCs of 9 RA patients and 13 normal volunteers was analyzed on an oligonucleotide array. Compared with normal PBMCs, 330 transcripts were differentially expressed in RA. The differentially regulated genes belong to diverse functional classes and include genes involved in calcium binding, chaperones, cytokines, transcription, translation, signal transduction, extracellular matrix, integral to plasma membrane, integral to intracellular membrane, mitochondrial, ribosomal, structural, enzymes, and proteases. A k-nearest neighbor analysis identified 29 transcripts that were preferentially expressed in RA. Ten genes with increased expression in RA PBMCs compared with controls mapped to a RA susceptibility locus, 6p21.3. These results suggest that analysis of RA PBMCs at the molecular level may provide a set of candidate genes that could yield an easily accessible gene signature to aid in early diagnosis and treatment. PMID:17515956
A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
Maier, Helena J.; Van Borm, Steven; Young, John R.; Fife, Mark
2016-01-01
Quantitative real-time PCR assays are widely used for the quantification of mRNA within avian experimental samples. Multiple stably-expressed reference genes, selected for the lowest variation in representative samples, can be used to control random technical variation. Reference gene assays must be reliable, have high amplification specificity and efficiency, and not produce signals from contaminating DNA. Whilst recent research papers identify specific genes that are stable in particular tissues and experimental treatments, here we describe a panel of ten avian gene primer and probe sets that can be used to identify suitable reference genes in many experimental contexts. The panel was tested with TaqMan and SYBR Green systems in two experimental scenarios: a tissue collection and virus infection of cultured fibroblasts. GeNorm and NormFinder algorithms were able to select appropriate reference gene sets in each case. We show the effects of using the selected genes on the detection of statistically significant differences in expression. The results are compared with those obtained using 28s ribosomal RNA, the present most widely accepted reference gene in chicken work, identifying circumstances where its use might provide misleading results. Methods for eliminating DNA contamination of RNA reduced, but did not completely remove, detectable DNA. We therefore attached special importance to testing each qPCR assay for absence of signal using DNA template. The assays and analyses developed here provide a useful resource for selecting reference genes for investigations of avian biology. PMID:27537060
Yoneda, Aki; Wittmann, Bruce J; King, Jeremy D; Blankenship, Robert E; Dantas, Gautam
2016-08-01
Acaryochloris species are a genus of cyanobacteria that utilize chlorophyll (chl) d as their primary chlorophyll molecule during oxygenic photosynthesis. Chl d allows Acaryochloris to harvest red-shifted light, which gives them the ability to live in filtered light environments that are depleted in visible light. Although genomes of multiple Acaryochloris species have been sequenced, their analysis has not revealed how chl d is synthesized. Here, we demonstrate that Acaryochloris sp. CCMEE 5410 cells undergo chlorosis by nitrogen depletion and exhibit robust regeneration of chl d by nitrogen repletion. We performed a time course RNA-Seq experiment to quantify global transcriptomic changes during chlorophyll recovery. We observed upregulation of numerous known chl biosynthesis genes and also identified an oxygenase gene with a similar transcriptional profile as these chl biosynthesis genes, suggesting its possible involvement in chl d biosynthesis. Moreover, our data suggest that multiple prochlorophyte chlorophyll-binding homologs are important during chlorophyll recovery, and light-independent chl synthesis genes are more dominant than the light-dependent gene at the transcription level. Transcriptomic characterization of this organism provides crucial clues toward mechanistic elucidation of chl d biosynthesis.
Sugimoto, Takuma; Kato, Masayasu; Yoshida, Shinya; Matsumoto, Isao; Kobayashi, Tamotsu; Kaga, Akito; Hajika, Makita; Yamamoto, Ryo; Watanabe, Kazuhiko; Aino, Masataka; Matoh, Toru; Walker, David R.; Biggs, Alan R.; Ishimoto, Masao
2012-01-01
Phytophthora stem and root rot, caused by Phytophthora sojae, is one of the most destructive diseases of soybean [Glycine max (L.) Merr.], and the incidence of this disease has been increasing in several soybean-producing areas around the world. This presents serious limitations for soybean production, with yield losses from 4 to 100%. The most effective method to reduce damage would be to grow Phytophthora-resistant soybean cultivars, and two types of host resistance have been described. Race-specific resistance conditioned by single dominant Rps (“resistance to Phytophthora sojae”) genes and quantitatively inherited partial resistance conferred by multiple genes could both provide protection from the pathogen. Molecular markers linked to Rps genes or quantitative trait loci (QTLs) underlying partial resistance have been identified on several molecular linkage groups corresponding to chromosomes. These markers can be used to screen for Phytophthora-resistant plants rapidly and efficiently, and to combine multiple resistance genes in the same background. This paper reviews what is currently known about pathogenic races of P. sojae in the USA and Japan, selection of sources of Rps genes or minor genes providing partial resistance, and the current state and future scope of breeding Phytophthora-resistant soybean cultivars. PMID:23136490
Tang, Yuanman; Liu, Qiuping; Liu, Ying; Zhang, Linli; Ding, Wei
2017-01-01
Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA)-responsive genes NtPR1a/c , NtPR2 and NtCHN50 , JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26 . Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum . Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.
Genome Wide Search for Biomarkers to Diagnose Yersinia Infections.
Kalia, Vipin Chandra; Kumar, Prasun
2015-12-01
Bacterial identification on the basis of the highly conserved 16S rRNA (rrs) gene is limited by its presence in multiple copies and a very high level of similarity among them. The need is to look for other genes with unique characteristics to be used as biomarkers. Fifty-one sequenced genomes belonging to 10 different Yersinia species were used for searching genes common to all the genomes. Out of 304 common genes, 34 genes of sizes varying from 0.11 to 4.42 kb, were selected and subjected to in silico digestion with 10 different Restriction endonucleases (RE) (4-6 base cutters). Yersinia species have 6-7 copies of rrs per genome, which are difficult to distinguish by multiple sequence alignments or their RE digestion patterns. However, certain unique combinations of other common gene sequences-carB, fadJ, gluM, gltX, ileS, malE, nusA, ribD, and rlmL and their RE digestion patterns can be used as markers for identifying 21 strains belonging to 10 Yersinia species: Y. aldovae, Y. enterocolitica, Y. frederiksenii, Y. intermedia, Y. kristensenii, Y. pestis, Y. pseudotuberculosis, Y. rohdei, Y. ruckeri, and Y. similis. This approach can be applied for rapid diagnostic applications.
Barret, Matthieu; Egan, Frank; Fargier, Emilie; Morrissey, John P; O'Gara, Fergal
2011-06-01
Bacteria encode multiple protein secretion systems that are crucial for interaction with the environment and with hosts. In recent years, attention has focused on type VI secretion systems (T6SSs), which are specialized transporters widely encoded in Proteobacteria. The myriad of processes associated with these secretion systems could be explained by subclasses of T6SS, each involved in specialized functions. To assess diversity and predict function associated with different T6SSs, comparative genomic analysis of 34 Pseudomonas genomes was performed. This identified 70 T6SSs, with at least one locus in every strain, except for Pseudomonas stutzeri A1501. By comparing 11 core genes of the T6SS, it was possible to identify five main Pseudomonas phylogenetic clusters, with strains typically carrying T6SSs from more than one clade. In addition, most strains encode additional vgrG and hcp genes, which encode extracellular structural components of the secretion apparatus. Using a combination of phylogenetic and meta-analysis of transcriptome datasets it was possible to associate specific subsets of VgrG and Hcp proteins with each Pseudomonas T6SS clade. Moreover, a closer examination of the genomic context of vgrG genes in multiple strains highlights a number of additional genes associated with these regions. It is proposed that these genes may play a role in secretion or alternatively could be new T6S effectors.
Gene-environment interplay in the etiology of psychosis.
Zwicker, Alyson; Denovan-Wright, Eileen M; Uher, Rudolf
2018-01-15
Schizophrenia and other types of psychosis incur suffering, high health care costs and loss of human potential, due to the combination of early onset and poor response to treatment. Our ability to prevent or cure psychosis depends on knowledge of causal mechanisms. Molecular genetic studies show that thousands of common and rare variants contribute to the genetic risk for psychosis. Epidemiological studies have identified many environmental factors associated with increased risk of psychosis. However, no single genetic or environmental factor is sufficient to cause psychosis on its own. The risk of developing psychosis increases with the accumulation of many genetic risk variants and exposures to multiple adverse environmental factors. Additionally, the impact of environmental exposures likely depends on genetic factors, through gene-environment interactions. Only a few specific gene-environment combinations that lead to increased risk of psychosis have been identified to date. An example of replicable gene-environment interaction is a common polymorphism in the AKT1 gene that makes its carriers sensitive to developing psychosis with regular cannabis use. A synthesis of results from twin studies, molecular genetics, and epidemiological research outlines the many genetic and environmental factors contributing to psychosis. The interplay between these factors needs to be considered to draw a complete picture of etiology. To reach a more complete explanation of psychosis that can inform preventive strategies, future research should focus on longitudinal assessments of multiple environmental exposures within large, genotyped cohorts beginning early in life.
Blakely, Collin M; Stoddard, Alexander J; Belka, George K; Dugan, Katherine D; Notarfrancesco, Kathleen L; Moody, Susan E; D'Cruz, Celina M; Chodosh, Lewis A
2006-06-15
Women who have their first child early in life have a substantially lower lifetime risk of breast cancer. The mechanism for this is unknown. Similar to humans, rats exhibit parity-induced protection against mammary tumorigenesis. To explore the basis for this phenomenon, we identified persistent pregnancy-induced changes in mammary gene expression that are tightly associated with protection against tumorigenesis in multiple inbred rat strains. Four inbred rat strains that exhibit marked differences in their intrinsic susceptibilities to carcinogen-induced mammary tumorigenesis were each shown to display significant protection against methylnitrosourea-induced mammary tumorigenesis following treatment with pregnancy levels of estradiol and progesterone. Microarray expression profiling of parous and nulliparous mammary tissue from these four strains yielded a common 70-gene signature. Examination of the genes constituting this signature implicated alterations in transforming growth factor-beta signaling, the extracellular matrix, amphiregulin expression, and the growth hormone/insulin-like growth factor I axis in pregnancy-induced alterations in breast cancer risk. Notably, related molecular changes have been associated with decreased mammographic density, which itself is strongly associated with decreased breast cancer risk. Our findings show that hormone-induced protection against mammary tumorigenesis is widely conserved among divergent rat strains and define a gene expression signature that is tightly correlated with reduced mammary tumor susceptibility as a consequence of a normal developmental event. Given the conservation of this signature, these pathways may contribute to pregnancy-induced protection against breast cancer.
Gene-environment studies: any advantage over environmental studies?
Bermejo, Justo Lorenzo; Hemminki, Kari
2007-07-01
Gene-environment studies have been motivated by the likely existence of prevalent low-risk genes that interact with common environmental exposures. The present study assessed the statistical advantage of the simultaneous consideration of genes and environment to investigate the effect of environmental risk factors on disease. In particular, we contemplated the possibility that several genes modulate the environmental effect. Environmental exposures, genotypes and phenotypes were simulated according to a wide range of parameter settings. Different models of gene-gene-environment interaction were considered. For each parameter combination, we estimated the probability of detecting the main environmental effect, the power to identify the gene-environment interaction and the frequency of environmentally affected individuals at which environmental and gene-environment studies show the same statistical power. The proportion of cases in the population attributable to the modeled risk factors was also calculated. Our data indicate that environmental exposures with weak effects may account for a significant proportion of the population prevalence of the disease. A general result was that, if the environmental effect was restricted to rare genotypes, the power to detect the gene-environment interaction was higher than the power to identify the main environmental effect. In other words, when few individuals contribute to the overall environmental effect, individual contributions are large and result in easily identifiable gene-environment interactions. Moreover, when multiple genes interacted with the environment, the statistical benefit of gene-environment studies was limited to those studies that included major contributors to the gene-environment interaction. The advantage of gene-environment over plain environmental studies also depends on the inheritance mode of the involved genes, on the study design and, to some extend, on the disease prevalence.
Youssef, Noha H.; Couger, M. B.; Struchtemeyer, Christopher G.; Liggenstoffer, Audra S.; Prade, Rolf A.; Najar, Fares Z.; Atiyeh, Hasan K.; Wilkins, Mark R.
2013-01-01
Anaerobic gut fungi represent a distinct early-branching fungal phylum (Neocallimastigomycota) and reside in the rumen, hindgut, and feces of ruminant and nonruminant herbivores. The genome of an anaerobic fungal isolate, Orpinomyces sp. strain C1A, was sequenced using a combination of Illumina and PacBio single-molecule real-time (SMRT) technologies. The large genome (100.95 Mb, 16,347 genes) displayed extremely low G+C content (17.0%), large noncoding intergenic regions (73.1%), proliferation of microsatellite repeats (4.9%), and multiple gene duplications. Comparative genomic analysis identified multiple genes and pathways that are absent in Dikarya genomes but present in early-branching fungal lineages and/or nonfungal Opisthokonta. These included genes for posttranslational fucosylation, the production of specific intramembrane proteases and extracellular protease inhibitors, the formation of a complete axoneme and intraflagellar trafficking machinery, and a near-complete focal adhesion machinery. Analysis of the lignocellulolytic machinery in the C1A genome revealed an extremely rich repertoire, with evidence of horizontal gene acquisition from multiple bacterial lineages. Experimental analysis indicated that strain C1A is a remarkable biomass degrader, capable of simultaneous saccharification and fermentation of the cellulosic and hemicellulosic fractions in multiple untreated grasses and crop residues examined, with the process significantly enhanced by mild pretreatments. This capability, acquired during its separate evolutionary trajectory in the rumen, along with its resilience and invasiveness compared to prokaryotic anaerobes, renders anaerobic fungi promising agents for consolidated bioprocessing schemes in biofuels production. PMID:23709508
Youssef, Noha H; Couger, M B; Struchtemeyer, Christopher G; Liggenstoffer, Audra S; Prade, Rolf A; Najar, Fares Z; Atiyeh, Hasan K; Wilkins, Mark R; Elshahed, Mostafa S
2013-08-01
Anaerobic gut fungi represent a distinct early-branching fungal phylum (Neocallimastigomycota) and reside in the rumen, hindgut, and feces of ruminant and nonruminant herbivores. The genome of an anaerobic fungal isolate, Orpinomyces sp. strain C1A, was sequenced using a combination of Illumina and PacBio single-molecule real-time (SMRT) technologies. The large genome (100.95 Mb, 16,347 genes) displayed extremely low G+C content (17.0%), large noncoding intergenic regions (73.1%), proliferation of microsatellite repeats (4.9%), and multiple gene duplications. Comparative genomic analysis identified multiple genes and pathways that are absent in Dikarya genomes but present in early-branching fungal lineages and/or nonfungal Opisthokonta. These included genes for posttranslational fucosylation, the production of specific intramembrane proteases and extracellular protease inhibitors, the formation of a complete axoneme and intraflagellar trafficking machinery, and a near-complete focal adhesion machinery. Analysis of the lignocellulolytic machinery in the C1A genome revealed an extremely rich repertoire, with evidence of horizontal gene acquisition from multiple bacterial lineages. Experimental analysis indicated that strain C1A is a remarkable biomass degrader, capable of simultaneous saccharification and fermentation of the cellulosic and hemicellulosic fractions in multiple untreated grasses and crop residues examined, with the process significantly enhanced by mild pretreatments. This capability, acquired during its separate evolutionary trajectory in the rumen, along with its resilience and invasiveness compared to prokaryotic anaerobes, renders anaerobic fungi promising agents for consolidated bioprocessing schemes in biofuels production.
Genetic variation influences glutamate concentrations in brains of patients with multiple sclerosis.
Baranzini, Sergio E; Srinivasan, Radhika; Khankhanian, Pouya; Okuda, Darin T; Nelson, Sarah J; Matthews, Paul M; Hauser, Stephen L; Oksenberg, Jorge R; Pelletier, Daniel
2010-09-01
Glutamate is the main excitatory neurotransmitter in the mammalian brain. Appropriate transmission of nerve impulses through glutamatergic synapses is required throughout the brain and forms the basis of many processes including learning and memory. However, abnormally high levels of extracellular brain glutamate can lead to neuroaxonal cell death. We have previously reported elevated glutamate levels in the brains of patients suffering from multiple sclerosis. Here two complementary analyses to assess the extent of genomic control over glutamate levels were used. First, a genome-wide association analysis in 382 patients with multiple sclerosis using brain glutamate concentration as a quantitative trait was conducted. In a second approach, a protein interaction network was used to find associated genes within the same pathway. The top associated marker was rs794185 (P < 6.44 x 10(-7)), a non-coding single nucleotide polymorphism within the gene sulphatase modifying factor 1. Our pathway approach identified a module composed of 70 genes with high relevance to glutamate biology. Individuals carrying a higher number of associated alleles from genes in this module showed the highest levels of glutamate. These individuals also showed greater decreases in N-acetylaspartate and in brain volume over 1 year of follow-up. Patients were then stratified by the amount of annual brain volume loss and the same approach was performed in the 'high' (n = 250) and 'low' (n = 132) neurodegeneration groups. The association with rs794185 was highly significant in the group with high neurodegeneration. Further, results from the network-based pathway analysis remained largely unchanged even after stratification. Results from these analyses indicated that variance in the activity of neurochemical pathways implicated in neurodegeneration is explained, at least in part, by the inheritance of common genetic polymorphisms. Spectroscopy-based imaging provides a novel quantitative endophenotype for genetic association studies directed towards identifying new factors that contribute to the heterogeneity of clinical expression of multiple sclerosis.
Puah, Wee Choo; Wasser, Martin
2016-03-01
Time-lapse microscopy in developmental biology is an emerging tool for functional genomics. Phenotypic effects of gene perturbations can be studied non-invasively at multiple time points in chronological order. During metamorphosis of Drosophila melanogaster, time-lapse microscopy using fluorescent reporters allows visualization of alternative fates of larval muscles, which are a model for the study of genes related to muscle wasting. While doomed muscles enter hormone-induced programmed cell death, a smaller population of persistent muscles survives to adulthood and undergoes morphological remodeling that involves atrophy in early, and hypertrophy in late pupation. We developed a method that combines in vivo imaging, targeted gene perturbation and image analysis to identify and characterize genes involved in muscle development. Macrozoom microscopy helps to screen for interesting muscle phenotypes, while confocal microscopy in multiple locations over 4-5 days produces time-lapse images that are used to quantify changes in cell morphology. Performing a similar investigation using fixed pupal tissues would be too time-consuming and therefore impractical. We describe three applications of our pipeline. First, we show how quantitative microscopy can track and measure morphological changes of muscle throughout metamorphosis and analyze genes involved in atrophy. Second, our assay can help to identify genes that either promote or prevent histolysis of abdominal muscles. Third, we apply our approach to test new fluorescent proteins as live markers for muscle development. We describe mKO2 tagged Cysteine proteinase 1 (Cp1) and Troponin-I (TnI) as examples of proteins showing developmental changes in subcellular localization. Finally, we discuss strategies to improve throughput of our pipeline to permit genome-wide screens in the future. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhao, Qian; Sun, Yeqing; Wang, Wei
2016-07-01
Highly ionizing radiation (HZE) in space is considered as a main factor causing biological effects on plant seeds. To investigate the different effects on genome-wide gene expression of low-dose and high-dose ion radiation, we carried out ground-base carbon particle HZE experiments with different cumulative doses (0Gy, 0.2Gy, 2Gy) to rice seeds and then performed comparative transcriptome analysis of the rice seedlings. We identified a total of 2551 and 1464 differentially expressed genes (DEGs) in low-dose and high-dose radiation groups, respectively. Gene ontology analyses indicated that low-dose and high-dose ion radiation both led to multiple physiological and biochemical activities changes in rice. By Gene Ontology analyses, the results showed that only one process-oxidation reduction process was enriched in the biological process category after high-dose ion radiation, while more processes such as response to biotic stimulus, heme binding, tetrapyrrole binding, oxidoreductase activity, catalytic activity and oxidoreductase activity were significantly enriched after low-dose ion radiation. The results indicated that the rice plants only focused on the process of oxidation reduction to response to high-dose ion radiation, whereas it was a coordination of multiple biological processes to response to low-dose ion radiation. To elucidate the transcriptional regulation of radiation stress-responsive genes, we identified several DEGs-encoding TFs. AP2/EREBP, bHLH, C2H2, MYB and WRKY TF families were altered significantly in response to ion radiation. Mapman analysis speculated that the biological effects on rice seedlings caused by the radiation stress might share similar mechanisms with the biotic stress. Our findings highlight important alterations in the expression of radiation response genes, metabolic pathways, and TF-encoding genes in rice seedlings exposed to low-dose and high-dose ion radiation.
Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P
2015-08-01
Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.
Uezato, Akihito; Yamamoto, Naoki; Jitoku, Daisuke; Haramo, Emiko; Hiraaki, Eri; Iwayama, Yoshimi; Toyota, Tomoko; Umino, Masakazu; Umino, Asami; Iwata, Yasuhide; Suzuki, Katsuaki; Kikuchi, Mitsuru; Hashimoto, Tasuku; Kanahara, Nobuhisa; Kurumaji, Akeo; Yoshikawa, Takeo; Nishikawa, Toru
2017-12-01
The synapse-associated protein 97/discs, large homolog 1 of Drosophila (DLG1) gene encodes synaptic scaffold PDZ proteins interacting with ionotropic glutamate receptors including the N-methyl-D-aspartate type glutamate receptor (NMDAR) that is presumed to be hypoactive in brains of patients with schizophrenia. The DLG1 gene resides in the chromosomal position 3q29, the microdeletion of which confers a 40-fold increase in the risk for schizophrenia. In the present study, we performed genetic association analyses for DLG1 gene using a Japanese cohort with 1808 schizophrenia patients and 2170 controls. We detected an association which remained significant after multiple comparison testing between schizophrenia and the single nucleotide polymorphism (SNP) rs3915512 that is located within the newly identified primate-specific exon (exon 3b) of the DLG1 gene and constitutes the exonic splicing enhancer sequence. When stratified by onset age, although it did not survive multiple comparisons, the association was observed in non-early onset schizophrenia, whose onset-age selectivity is consistent with our recent postmortem study demonstrating a decrease in the expression of the DLG1 variant in early-onset schizophrenia. Although the present study did not demonstrate the previously reported association of the SNP rs9843659 by itself, a meta-analysis revealed a significant association between DLG1 gene and schizophrenia. These findings provide a valuable clue for molecular mechanisms on how genetic variations in the primate-specific exon of the gene in the schizophrenia-associated 3q29 locus affect its regulation in the glutamate system and lead to the disease onset around a specific stage of brain development. © 2017 Wiley Periodicals, Inc.
Dunne, Philip D; McArt, Darragh G; Bradley, Conor A; O'Reilly, Paul G; Barrett, Helen L; Cummins, Robert; O'Grady, Tony; Arthur, Ken; Loughrey, Maurice B; Allen, Wendy L; McDade, Simon S; Waugh, David J; Hamilton, Peter W; Longley, Daniel B; Kay, Elaine W; Johnston, Patrick G; Lawler, Mark; Salto-Tellez, Manuel; Van Schaeybroeck, Sandra
2016-08-15
A number of independent gene expression profiling studies have identified transcriptional subtypes in colorectal cancer with potential diagnostic utility, culminating in publication of a colorectal cancer Consensus Molecular Subtype classification. The worst prognostic subtype has been defined by genes associated with stem-like biology. Recently, it has been shown that the majority of genes associated with this poor prognostic group are stromal derived. We investigated the potential for tumor misclassification into multiple diagnostic subgroups based on tumoral region sampled. We performed multiregion tissue RNA extraction/transcriptomic analysis using colorectal-specific arrays on invasive front, central tumor, and lymph node regions selected from tissue samples from 25 colorectal cancer patients. We identified a consensus 30-gene list, which represents the intratumoral heterogeneity within a cohort of primary colorectal cancer tumors. Using a series of online datasets, we showed that this gene list displays prognostic potential HR = 2.914 (confidence interval 0.9286-9.162) in stage II/III colorectal cancer patients, but in addition, we demonstrated that these genes are stromal derived, challenging the assumption that poor prognosis tumors with stem-like biology have undergone a widespread epithelial-mesenchymal transition. Most importantly, we showed that patients can be simultaneously classified into multiple diagnostically relevant subgroups based purely on the tumoral region analyzed. Gene expression profiles derived from the nonmalignant stromal region can influence assignment of colorectal cancer transcriptional subtypes, questioning the current molecular classification dogma and highlighting the need to consider pathology sampling region and degree of stromal infiltration when employing transcription-based classifiers to underpin clinical decision making in colorectal cancer. Clin Cancer Res; 22(16); 4095-104. ©2016 AACRSee related commentary by Morris and Kopetz, p. 3989. ©2016 American Association for Cancer Research.
Ming, De-Song; Chen, Qing-Qing; Chen, Xiao-Tin
2018-05-14
To clarify the resistance mechanisms of Pannonibacter phragmitetus 31801, isolated from the blood of a liver abscess patient, at the genomic level, we performed whole genomic sequencing using a PacBio RS II single-molecule real-time long-read sequencer. Bioinformatic analysis of the resulting sequence was then carried out to identify any possible resistance genes. Analyses included Basic Local Alignment Search Tool searches against the Antibiotic Resistance Genes Database, ResFinder analysis of the genome sequence, and Resistance Gene Identifier analysis within the Comprehensive Antibiotic Resistance Database. Prophages, clustered regularly interspaced short palindromic repeats (CRISPR), and other putative virulence factors were also identified using PHAST, CRISPRfinder, and the Virulence Factors Database, respectively. The circular chromosome and single plasmid of P. phragmitetus 31801 contained multiple antibiotic resistance genes, including those coding for three different types of β-lactamase [NPS β-lactamase (EC 3.5.2.6), β-lactamase class C, and a metal-dependent hydrolase of β-lactamase superfamily I]. In addition, genes coding for subunits of several multidrug-resistance efflux pumps were identified, including those targeting macrolides (adeJ, cmeB), tetracycline (acrB, adeAB), fluoroquinolones (acrF, ceoB), and aminoglycosides (acrD, amrB, ceoB, mexY, smeB). However, apart from the tripartite macrolide efflux pump macAB-tolC, the genome did not appear to contain the complete complement of subunit genes required for production of most of the major multidrug-resistance efflux pumps.
The sequence, structure and evolutionary features of HOTAIR in mammals
2011-01-01
Background An increasing number of long noncoding RNAs (lncRNAs) have been identified recently. Different from all the others that function in cis to regulate local gene expression, the newly identified HOTAIR is located between HoxC11 and HoxC12 in the human genome and regulates HoxD expression in multiple tissues. Like the well-characterised lncRNA Xist, HOTAIR binds to polycomb proteins to methylate histones at multiple HoxD loci, but unlike Xist, many details of its structure and function, as well as the trans regulation, remain unclear. Moreover, HOTAIR is involved in the aberrant regulation of gene expression in cancer. Results To identify conserved domains in HOTAIR and study the phylogenetic distribution of this lncRNA, we searched the genomes of 10 mammalian and 3 non-mammalian vertebrates for matches to its 6 exons and the two conserved domains within the 1800 bp exon6 using Infernal. There was just one high-scoring hit for each mammal, but many low-scoring hits were found in both mammals and non-mammalian vertebrates. These hits and their flanking genes in four placental mammals and platypus were examined to determine whether HOTAIR contained elements shared by other lncRNAs. Several of the hits were within unknown transcripts or ncRNAs, many were within introns of, or antisense to, protein-coding genes, and conservation of the flanking genes was observed only between human and chimpanzee. Phylogenetic analysis revealed discrete evolutionary dynamics for orthologous sequences of HOTAIR exons. Exon1 at the 5' end and a domain in exon6 near the 3' end, which contain domains that bind to multiple proteins, have evolved faster in primates than in other mammals. Structures were predicted for exon1, two domains of exon6 and the full HOTAIR sequence. The sequence and structure of two fragments, in exon1 and the domain B of exon6 respectively, were identified to robustly occur in predicted structures of exon1, domain B of exon6 and the full HOTAIR in mammals. Conclusions HOTAIR exists in mammals, has poorly conserved sequences and considerably conserved structures, and has evolved faster than nearby HoxC genes. Exons of HOTAIR show distinct evolutionary features, and a 239 bp domain in the 1804 bp exon6 is especially conserved. These features, together with the absence of some exons and sequences in mouse, rat and kangaroo, suggest ab initio generation of HOTAIR in marsupials. Structure prediction identifies two fragments in the 5' end exon1 and the 3' end domain B of exon6, with sequence and structure invariably occurring in various predicted structures of exon1, the domain B of exon6 and the full HOTAIR. PMID:21496275
Genetic dissection of sorghum grain quality traits using diverse and segregating populations.
Boyles, Richard E; Pfeiffer, Brian K; Cooper, Elizabeth A; Rauh, Bradley L; Zielinski, Kelsey J; Myers, Matthew T; Brenton, Zachary; Rooney, William L; Kresovich, Stephen
2017-04-01
Coordinated association and linkage mapping identified 25 grain quality QTLs in multiple environments, and fine mapping of the Wx locus supports the use of high-density genetic markers in linkage mapping. There is a wide range of end-use products made from cereal grains, and these products often demand different grain characteristics. Fortunately, cereal crop species including sorghum [Sorghum bicolor (L.) Moench] contain high phenotypic variation for traits influencing grain quality. Identifying genetic variants underlying this phenotypic variation allows plant breeders to develop genotypes with grain attributes optimized for their intended usage. Multiple sorghum mapping populations were rigorously phenotyped across two environments (SC Coastal Plain and Central TX) in 2 years for five major grain quality traits: amylose, starch, crude protein, crude fat, and gross energy. Coordinated association and linkage mapping revealed several robust QTLs that make prime targets to improve grain quality for food, feed, and fuel products. Although the amylose QTL interval spanned many megabases, the marker with greatest significance was located just 12 kb from waxy (Wx), the primary gene regulating amylose production in cereal grains. This suggests higher resolution mapping in recombinant inbred line (RIL) populations can be obtained when genotyped at a high marker density. The major QTL for crude fat content, identified in both a RIL population and grain sorghum diversity panel, encompassed the DGAT1 locus, a critical gene involved in maize lipid biosynthesis. Another QTL on chromosome 1 was consistently mapped in both RIL populations for multiple grain quality traits including starch, crude protein, and gross energy. Collectively, these genetic regions offer excellent opportunities to manipulate grain composition and set up future studies for gene validation.
Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L
2006-01-01
Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851
Thiopeptide antibiotics stimulate biofilm formation in Bacillus subtilis
Bleich, Rachel; Watrous, Jeramie D.; Dorrestein, Pieter C.; Bowers, Albert A.; Shank, Elizabeth A.
2015-01-01
Bacteria have evolved the ability to produce a wide range of structurally complex natural products historically called “secondary” metabolites. Although some of these compounds have been identified as bacterial communication cues, more frequently natural products are scrutinized for antibiotic activities that are relevant to human health. However, there has been little regard for how these compounds might otherwise impact the physiology of neighboring microbes present in complex communities. Bacillus cereus secretes molecules that activate expression of biofilm genes in Bacillus subtilis. Here, we use imaging mass spectrometry to identify the thiocillins, a group of thiazolyl peptide antibiotics, as biofilm matrix-inducing compounds produced by B. cereus. We found that thiocillin increased the population of matrix-producing B. subtilis cells and that this activity could be abolished by multiple structural alterations. Importantly, a mutation that eliminated thiocillin’s antibiotic activity did not affect its ability to induce biofilm gene expression in B. subtilis. We go on to show that biofilm induction appears to be a general phenomenon of multiple structurally diverse thiazolyl peptides and use this activity to confirm the presence of thiazolyl peptide gene clusters in other bacterial species. Our results indicate that the roles of secondary metabolites initially identified as antibiotics may have more complex effects—acting not only as killing agents, but also as specific modulators of microbial cellular phenotypes. PMID:25713360
Multiple Regression Analysis of mRNA-miRNA Associations in Colorectal Cancer Pathway
Wang, Fengfeng; Wong, S. C. Cesar; Chan, Lawrence W. C.; Cho, William C. S.; Yip, S. P.; Yung, Benjamin Y. M.
2014-01-01
Background. MicroRNA (miRNA) is a short and endogenous RNA molecule that regulates posttranscriptional gene expression. It is an important factor for tumorigenesis of colorectal cancer (CRC), and a potential biomarker for diagnosis, prognosis, and therapy of CRC. Our objective is to identify the related miRNAs and their associations with genes frequently involved in CRC microsatellite instability (MSI) and chromosomal instability (CIN) signaling pathways. Results. A regression model was adopted to identify the significantly associated miRNAs targeting a set of candidate genes frequently involved in colorectal cancer MSI and CIN pathways. Multiple linear regression analysis was used to construct the model and find the significant mRNA-miRNA associations. We identified three significantly associated mRNA-miRNA pairs: BCL2 was positively associated with miR-16 and SMAD4 was positively associated with miR-567 in the CRC tissue, while MSH6 was positively associated with miR-142-5p in the normal tissue. As for the whole model, BCL2 and SMAD4 models were not significant, and MSH6 model was significant. The significant associations were different in the normal and the CRC tissues. Conclusion. Our results have laid down a solid foundation in exploration of novel CRC mechanisms, and identification of miRNA roles as oncomirs or tumor suppressor mirs in CRC. PMID:24895601
Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu
2014-01-01
Background Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. Principal Findings In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Conclusions Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers. PMID:24988079
Zhang, Yuannv; Qiu, Zhaoping; Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu
2014-01-01
Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers.
Oliva, Carlos; Molina-Fernandez, Claudia; Maureira, Miguel; Candia, Noemi; López, Estefanía; Hassan, Bassem; Aerts, Stein; Cánovas, José; Olguín, Patricio; Sierralta, Jimena
2015-09-01
During axon targeting, a stereotyped pattern of connectivity is achieved by the integration of intrinsic genetic programs and the response to extrinsic long and short-range directional cues. How this coordination occurs is the subject of intense study. Transcription factors play a central role due to their ability to regulate the expression of multiple genes required to sense and respond to these cues during development. Here we show that the transcription factor HNT regulates layer-specific photoreceptor axon targeting in Drosophila through transcriptional control of jbug/Filamin and multiple genes involved in axon guidance and cytoskeleton organization.Using a microarray analysis we identified 235 genes whose expression levels were changed by HNT overexpression in the eye primordia. We analyzed nine candidate genes involved in cytoskeleton regulation and axon guidance, six of which displayed significantly altered gene expression levels in hnt mutant retinas. Functional analysis confirmed the role of OTK/PTK7 in photoreceptor axon targeting and uncovered Tiggrin, an integrin ligand, and Jbug/Filamin, a conserved actin- binding protein, as new factors that participate of photoreceptor axon targeting. Moreover, we provided in silico and molecular evidence that supports jbug/Filamin as a direct transcriptional target of HNT and that HNT acts partially through Jbug/Filamin in vivo to regulate axon guidance. Our work broadens the understanding of how HNT regulates the coordinated expression of a group of genes to achieve the correct connectivity pattern in the Drosophila visual system. © 2015 Wiley Periodicals, Inc. Develop Neurobiol 75: 1018-1032, 2015. © 2015 Wiley Periodicals, Inc.
Dong, S-S; Guo, Y; Zhu, D-L; Chen, X-F; Wu, X-M; Shen, H; Chen, X-D; Tan, L-J; Tian, Q; Deng, H-W; Yang, T-L
2016-07-01
With ENCODE epigenomic data and results from published genome-wide association studies (GWASs), we aimed to find regulatory signatures of obesity genes and discover novel susceptibility genes. Obesity genes were obtained from public GWAS databases and their promoters were annotated based on the regulatory element information. Significantly enriched or depleted epigenomic elements in the promoters of obesity genes were evaluated and all human genes were then prioritized according to the existence of the selected elements to predict new candidate genes. Top-ranked genes were subsequently applied to validate their associations with obesity-related traits in three independent in-house GWAS samples. We identified RAD21 and EZH2 as over-represented, and STAT2 (signal transducer and activator of transcription 2) and IRF3 (interferon regulatory transcription factor 3) as depleted transcription factors. Histone modification of H3K9me3 and chromatin state segmentation of 'poised promoter' and 'repressed' were over-represented. All genes were prioritized and we selected the top five genes for validation at the population level. Combining results from the three GWAS samples, rs7522101 in ESRRG (estrogen-related receptor-γ) remained significantly associated with body mass index after multiple testing corrections (P=7.25 × 10(-5)). It was also associated with β-cell function (P=1.99 × 10(-3)) and fasting glucose level (P<0.05) in the meta-analyses of glucose and insulin-related traits consortium (MAGIC) data set.Cnoclusions:In summary, we identified epigenomic characteristics for obesity genes and suggested ESRRG as a novel obesity-susceptibility gene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa
Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less
Multiple genomic signatures of selection in goats and sheep indigenous to a hot arid environment
Kim, E-S; Elbeltagy, A R; Aboul-Naga, A M; Rischkowsky, B; Sayre, B; Mwacharo, J M; Rothschild, M F
2016-01-01
Goats and sheep are versatile domesticates that have been integrated into diverse environments and production systems. Natural and artificial selection have shaped the variation in the two species, but natural selection has played the major role among indigenous flocks. To investigate signals of natural selection, we analyzed genotype data generated using the caprine and ovine 50K SNP BeadChips from Barki goats and sheep that are indigenous to a hot arid environment in Egypt's Coastal Zone of the Western Desert. We identify several candidate regions under selection that spanned 119 genes. A majority of the genes were involved in multiple signaling and signal transduction pathways in a wide variety of cellular and biochemical processes. In particular, selection signatures spanning several genes that directly or indirectly influenced traits for adaptation to hot arid environments, such as thermo-tolerance (melanogenesis) (FGF2, GNAI3, PLCB1), body size and development (BMP2, BMP4, GJA3, GJB2), energy and digestive metabolism (MYH, TRHDE, ALDH1A3), and nervous and autoimmune response (GRIA1, IL2, IL7, IL21, IL1R1) were identified. We also identified eight common candidate genes under selection in the two species and a shared selection signature that spanned a conserved syntenic segment to bovine chromosome 12 on caprine and ovine chromosomes 12 and 10, respectively, providing, most likely, the evidence for selection in a common environment in two different but closely related species. Our study highlights the importance of indigenous livestock as model organisms for investigating selection sweeps and genome-wide association mapping. PMID:26555032
Peterson, Nathan A; Anderson, Tavis K; Yoshino, Timothy P
2013-01-01
Fucosylated glycans of the parasitic flatworm Schistosoma mansoni play key roles in its development and immunobiology. In the present study we used a genome-wide homology-based bioinformatics approach to search for genes that contribute to fucosylated glycan expression in S. mansoni, specifically the α2-, α3-, and α6-fucosyltransferases (FucTs), which transfer L-fucose from a GDP-L-fucose donor to an oligosaccharide acceptor. We identified and in silico characterized several novel schistosome FucT homologs, including six α3-FucTs and six α6-FucTs, as well as two protein O-FucTs that catalyze the unrelated transfer of L-fucose to serine and threonine residues of epidermal growth factor- and thrombospondin-type repeats. No α2-FucTs were observed. Primary sequence analyses identified key conserved FucT motifs as well as characteristic transmembrane domains, consistent with their putative roles as fucosyltransferases. Most genes exhibit alternative splicing, with multiple transcript variants generated. A phylogenetic analysis demonstrated that schistosome α3- and α6-FucTs form monophyletic clades within their respective gene families, suggesting multiple gene duplications following the separation of the schistosome lineage from the main evolutionary tree. Quantitative decreases in steady-state transcript levels of some FucTs during early larval development suggest a possible mechanism for differential expression of fucosylated glycans in schistosomes. This study systematically identifies the complete repertoire of FucT homologs in S. mansoni and provides fundamental information regarding their genomic organization, genetic variation, developmental expression, and evolutionary history.
Klempan, Timothy A; Ernst, Carl; Deleva, Vesselina; Labonte, Benoit; Turecki, Gustavo
2009-11-01
A number of studies have suggested deficits in myelination and glial gene expression in different psychiatric disorders. We examined the brain expression and genetic/epigenetic regulation of QKI, an oligodendrocyte-specific RNA binding protein important for cell development and myelination. The microarray-based expression of QKI was evaluated in cortical and subcortical brain regions from suicide victims with a diagnosis of major depression (n = 16) and control subjects (n = 13). These findings were also assessed with a real-time (quantitative polymerase chain reaction [qPCR]) approach, with QKI protein levels evaluated through immunoblotting. Identification of a QKI promoter sequence was then used to examine genetic and epigenetic variation at the QKI locus. The messenger RNA (mRNA) levels of multiple transcripts of QKI were evaluated on Affymetrix microarrays, revealing significant reductions in 11 cortical regions and the hippocampus and amygdala of suicide victims compared with control subjects. Microarray findings were confirmed by qPCR, and reduced expression of QKI protein was identified in orbitofrontal cortex. Analysis of promoter variation and methylation state in a subset of individuals did not identify differences at the genetic or epigenetic level between depressed suicide victims and control subjects. The observation of consistent reductions in multiple isoforms of QKI mRNA in depressed suicide victims supports the growing body of evidence for a role of myelination-related deficits in the etiology of psychiatric disorders. A specific role of QKI in this process is implied by its reduced expression and known interactions with genes involved in oligodendrocyte determination; however, QKI gene variation responsible for these changes remains to be identified.
Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A
2015-06-01
Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.
Detection of alternative splice variants at the proteome level in Aspergillus flavus.
Chang, Kung-Yen; Georgianna, D Ryan; Heber, Steffen; Payne, Gary A; Muddiman, David C
2010-03-05
Identification of proteins from proteolytic peptides or intact proteins plays an essential role in proteomics. Researchers use search engines to match the acquired peptide sequences to the target proteins. However, search engines depend on protein databases to provide candidates for consideration. Alternative splicing (AS), the mechanism where the exon of pre-mRNAs can be spliced and rearranged to generate distinct mRNA and therefore protein variants, enable higher eukaryotic organisms, with only a limited number of genes, to have the requisite complexity and diversity at the proteome level. Multiple alternative isoforms from one gene often share common segments of sequences. However, many protein databases only include a limited number of isoforms to keep minimal redundancy. As a result, the database search might not identify a target protein even with high quality tandem MS data and accurate intact precursor ion mass. We computationally predicted an exhaustive list of putative isoforms of Aspergillus flavus proteins from 20 371 expressed sequence tags to investigate whether an alternative splicing protein database can assign a greater proportion of mass spectrometry data. The newly constructed AS database provided 9807 new alternatively spliced variants in addition to 12 832 previously annotated proteins. The searches of the existing tandem MS spectra data set using the AS database identified 29 new proteins encoded by 26 genes. Nine fungal genes appeared to have multiple protein isoforms. In addition to the discovery of splice variants, AS database also showed potential to improve genome annotation. In summary, the introduction of an alternative splicing database helps identify more proteins and unveils more information about a proteome.
Bernick, David L.; Dennis, Patrick P.; Lui, Lauren M.; Lowe, Todd M.
2012-01-01
A great diversity of small, non-coding RNA (ncRNA) molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs (sRNA) in archaea is limited. We employed RNA-seq to identify novel sRNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense sRNAs encoded opposite to key regulatory (ferric uptake regulator), metabolic (triose-phosphate isomerase), and core transcriptional apparatus genes (transcription factor B). We also found a large increase in the number of conserved C/D box sRNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these sRNAs indicates they are relatively recent, stable adaptations. PMID:22783241
Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor
Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.
2015-01-01
Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148
Modrák, Martin; Vohradský, Jiří
2018-04-13
Identifying regulons of sigma factors is a vital subtask of gene network inference. Integrating multiple sources of data is essential for correct identification of regulons and complete gene regulatory networks. Time series of expression data measured with microarrays or RNA-seq combined with static binding experiments (e.g., ChIP-seq) or literature mining may be used for inference of sigma factor regulatory networks. We introduce Genexpi: a tool to identify sigma factors by combining candidates obtained from ChIP experiments or literature mining with time-course gene expression data. While Genexpi can be used to infer other types of regulatory interactions, it was designed and validated on real biological data from bacterial regulons. In this paper, we put primary focus on CyGenexpi: a plugin integrating Genexpi with the Cytoscape software for ease of use. As a part of this effort, a plugin for handling time series data in Cytoscape called CyDataseries has been developed and made available. Genexpi is also available as a standalone command line tool and an R package. Genexpi is a useful part of gene network inference toolbox. It provides meaningful information about the composition of regulons and delivers biologically interpretable results.
Paria, Nandina; Cho, Tae-Joon; Choi, In Ho; Kamiya, Nobuhiro; Kayembe, Kay; Mao, Rong; Margraf, Rebecca L.; Obermosser, Gerlinde; Oxendine, Ila; Sant, David W.; Song, Mi Hyun; Stevenson, David A.; Viskochil, David H.; Wise, Carol A.; Kim, Harry K.W.; Rios, Jonathan J
2014-01-01
Neurofibromatosis type 1 (NF1) is an autosomal dominant disease caused by mutations in NF1. Among the earliest manifestations is tibial pseudoarthrosis and persistent nonunion after fracture. To further understand the pathogenesis of pseudoarthrosis and the underlying bone remodeling defect, pseudoarthrosis tissue and cells cultured from surgically resected pseudoarthrosis tissue from NF1 individuals were analyzed using whole-exome and whole-transcriptome sequencing as well as genomewide microarray analysis. Genomewide analysis identified multiple genetic mechanisms resulting in somatic bi-allelic NF1 inactivation; no other genes with recurring somatic mutations were identified. Gene expression profiling identified dysregulated pathways associated with neurofibromin deficiency, including phosphoinosital-3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) signaling pathways. Unlike aggressive NF1-associated malignancies, tibial pseudoarthrosis tissue does not harbor a high frequency of somatic mutations in oncogenes or other tumor-suppressor genes, such as p53. However, gene expression profiling indicates pseudoarthrosis tissue has a tumor-promoting transcriptional pattern, despite lacking tumorigenic somatic mutations. Significant over-expression of specific cancer-associated genes in pseudoarthrosis highlights a potential for receptor tyrosine kinase inhibitors to target neurofibromin-deficient pseudoarthrosis and promote proper bone remodeling and fracture healing. PMID:24932921
Pérez-de-Mora, Alfredo; Lacourt, Anna; McMaster, Michaye L.; Liang, Xiaoming; Dworatzek, Sandra M.; Edwards, Elizabeth A.
2018-01-01
Dehalococcoides mccartyi (D. mccartyi) strains differ primarily from one another by the number and identity of the reductive dehalogenase homologous catalytic subunit A (rdhA) genes within their respective genomes. While multiple rdhA genes have been sequenced, the activity of the corresponding proteins has been identified in only a few cases. Examples include the enzymes whose substrates are groundwater contaminants such as trichloroethene (TCE), cis-dichloroethene (cDCE) and vinyl chloride (VC). The associated rdhA genes, namely tceA, bvcA, and vcrA, along with the D. mccartyi 16S rRNA gene are often used as biomarkers of growth in field samples. In this study, we monitored an additional 12 uncharacterized rdhA sequences identified in the metagenome in the mixed D. mccartyi-containing culture KB-1 to monitor population shifts in more detail. Quantitative PCR (qPCR) assays were developed for 15 D. mccartyi rdhA genes and used to measure population diversity in 11 different sub-cultures of KB-1, each enriched on different chlorinated ethenes and ethanes. The proportion of rdhA gene copies relative to D. mccartyi 16S rRNA gene copies revealed the presence of multiple distinct D. mccartyi strains in each culture, many more than the two strains inferred from 16S rRNA analysis. The specific electron acceptor amended to each culture had a major influence on the distribution of D. mccartyi strains and their associated rdhA genes. We also surveyed the abundance of rdhA genes in samples from two bioaugmented field sites (Canada and United Kingdom). Growth of the dominant D. mccartyi strain in KB-1 was detected at the United Kingdom site. At both field sites, the measurement of relative rdhA abundances revealed D. mccartyi population shifts over time as dechlorination progressed from TCE through cDCE to VC and ethene. These shifts indicate a selective pressure of the most abundant chlorinated electron acceptor, as was also observed in lab cultures. These results also suggest that reductive dechlorination at contaminated sites is brought about by multiple strains of D. mccartyi whether or not the site is bioaugmented. Understanding the driving forces behind D. mccartyi population selection and activity is improving predictability of remediation performance at chlorinated solvent contaminated sites.
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
von Both, Ulrich; Berk, Maurice; Agapow, Paul-Michael; Wright, Joseph D; Git, Anna; Hamilton, Melissa Shea; Goldgof, Greg; Siddiqui, Nazneen; Bellos, Evangelos; Wright, Victoria J; Coin, Lachlan J; Newton, Sandra M; Levin, Michael
2018-01-12
Mycobacterium tuberculosis (M. tuberculosis) survives and multiplies inside human macrophages by subversion of immune mechanisms. Although these immune evasion strategies are well characterised functionally, the underlying molecular mechanisms are poorly understood. Here we show that during infection of human whole blood with M. tuberculosis, host gene transcriptional suppression, rather than activation, is the predominant response. Spatial, temporal and functional characterisation of repressed genes revealed their involvement in pathogen sensing and phagocytosis, degradation within the phagolysosome and antigen processing and presentation. To identify mechanisms underlying suppression of multiple immune genes we undertook epigenetic analyses. We identified significantly differentially expressed microRNAs with known targets in suppressed genes. In addition, after searching regions upstream of the start of transcription of suppressed genes for common sequence motifs, we discovered novel enriched composite sequence patterns, which corresponded to Alu repeat elements, transposable elements known to have wide ranging influences on gene expression. Our findings suggest that to survive within infected cells, mycobacteria exploit a complex immune "molecular off switch" controlled by both microRNAs and Alu regulatory elements.
O’Connor, Sean Timothy Francis; Lan, Jiaqi; North, Matthew; Loguinov, Alexandre; Zhang, Luoping; Smith, Martyn T.; Gu, April Z.; Vulpe, Chris
2012-01-01
Benzo[a]pyrene (BaP) is a ubiquitous, potent, and complete carcinogen resulting from incomplete organic combustion. BaP can form DNA adducts but other mechanisms may play a role in toxicity. We used a functional toxicology approach in S. cerevisiae to assess the genetic requirements for cellular resistance to BaP. In addition, we examined translational activities of key genes involved in various stress response pathways. We identified multiple genes and processes involved in modulating BaP toxicity in yeast which support DNA damage as a primary mechanism of toxicity, but also identify other potential toxicity pathways. Gene ontology enrichment analysis indicated that DNA damage and repair as well as redox homeostasis and oxidative stress are key processes in cellular response to BaP suggesting a similar mode of action of BaP in yeast and mammals. Interestingly, toxicant export is also implicated as a potential novel modulator of cellular susceptibility. In particular, we identified several transporters with human orthologs (solute carrier family 22) which may play a role in mammalian systems. PMID:23403841
A comprehensive strategy for identifying long-distance mobile peptides in xylem sap.
Okamoto, Satoru; Suzuki, Takamasa; Kawaguchi, Masayoshi; Higashiyama, Tetsuya; Matsubayashi, Yoshikatsu
2015-11-01
There is a growing awareness that secreted pemediate organ-to-organ communication in higher plants. Xylem sap peptidomics is an effective but challenging approach for identifying long-distance mobile peptides. In this study we developed a simple, gel-free purification system that combines o-chlorophenol extraction with HPLC separation. Using this system, we successfully identified seven oligopeptides from soybean xylem sap exudate that had one or more post-transcriptional modifications: glycosylation, sulfation and/or hydroxylation. RNA sequencing and quantitative PCR analyses showed that the peptide-encoding genes are expressed in multiple tissues. We further analyzed the long-distance translocation of four of the seven peptides using gene-encoding peptides with single amino acid substitutions, and identified these four peptides as potential root-to-shoot mobile oligopeptides. Promoter-GUS analysis showed that all four peptide-encoding genes were expressed in the inner tissues of the root endodermis. Moreover, we found that some of these peptide-encoding genes responded to biotic and/or abiotic factors. These results indicate that our purification system provides a comprehensive approach for effectively identifying endogenous small peptides and reinforce the concept that higher plants employ various peptides in root-to-shoot signaling. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Using whole-exome sequencing to identify variants inherited from mosaic parents
Rios, Jonathan J; Delgado, Mauricio R
2015-01-01
Whole-exome sequencing (WES) has allowed the discovery of genes and variants causing rare human disease. This is often achieved by comparing nonsynonymous variants between unrelated patients, and particularly for sporadic or recessive disease, often identifies a single or few candidate genes for further consideration. However, despite the potential for this approach to elucidate the genetic cause of rare human disease, a majority of patients fail to realize a genetic diagnosis using standard exome analysis methods. Although genetic heterogeneity contributes to the difficulty of exome sequence analysis between patients, it remains plausible that rare human disease is not caused by de novo or recessive variants. Multiple human disorders have been described for which the variant was inherited from a phenotypically normal mosaic parent. Here we highlight the potential for exome sequencing to identify a reasonable number of candidate genes when dominant disease variants are inherited from a mosaic parent. We show the power of WES to identify a limited number of candidate genes using this disease model and how sequence coverage affects identification of mosaic variants by WES. We propose this analysis as an alternative to discover genetic causes of rare human disorders for which typical WES approaches fail to identify likely pathogenic variants. PMID:24986828
Gerloff, Nancy A.; Jones, Joyce; Simpson, Natosha; Balish, Amanda; ElBadry, Maha Adel; Baghat, Verina; Rusev, Ivan; de Mattos, Cecilia C.; de Mattos, Carlos A.; Zonkle, Luay Elsayed Ahmed; Kis, Zoltan; Davis, C. Todd; Yingst, Sam; Cornelius, Claire; Soliman, Atef; Mohareb, Emad; Klimov, Alexander; Donis, Ruben O.
2013-01-01
Surveillance for influenza A viruses in wild birds has increased substantially as part of efforts to control the global movement of highly pathogenic avian influenza A (H5N1) virus. Studies conducted in Egypt from 2003 to 2007 to monitor birds for H5N1 identified multiple subtypes of low pathogenicity avian influenza A viruses isolated primarily from migratory waterfowl collected in the Nile Delta. Phylogenetic analysis of 28 viral genomes was performed to estimate their nearest ancestors and identify possible reassortants. Migratory flyway patterns were included in the analysis to assess gene flow between overlapping flyways. Overall, the viruses were most closely related to Eurasian, African and/or Central Asian lineage low pathogenicity viruses and belonged to 15 different subtypes. A subset of the internal genes seemed to originate from specific flyways (Black Sea-Mediterranean, East African-West Asian). The remaining genes were derived from a mixture of viruses broadly distributed across as many as 4 different flyways suggesting the importance of the Nile Delta for virus dispersal. Molecular clock date estimates suggested that the time to the nearest common ancestor of all viruses analyzed ranged from 5 to 10 years, indicating frequent genetic exchange with viruses sampled elsewhere. The intersection of multiple migratory bird flyways and the resulting diversity of influenza virus gene lineages in the Nile Delta create conditions favoring reassortment, as evident from the gene constellations identified by this study. In conclusion, we present for the first time a comprehensive phylogenetic analysis of full genome sequences from low pathogenic avian influenza viruses circulating in Egypt, underscoring the significance of the region for viral reassortment and the potential emergence of novel avian influenza A viruses, as well as representing a highly diverse influenza A virus gene pool that merits continued monitoring. PMID:23874653
Li, Ming-Rui; Shi, Feng-Xue; Li, Ya-Ling; Jiang, Peng; Jiao, Lili
2017-01-01
Abstract Chinese ginseng (Panax ginseng Meyer) is a medicinally important herb and plays crucial roles in traditional Chinese medicine. Pharmacological analyses identified diverse bioactive components from Chinese ginseng. However, basic biological attributes including domestication and selection of the ginseng plant remain under-investigated. Here, we presented a genome-wide view of the domestication and selection of cultivated ginseng based on the whole genome data. A total of 8,660 protein-coding genes were selected for genome-wide scanning of the 30 wild and cultivated ginseng accessions. In complement, the 45s rDNA, chloroplast and mitochondrial genomes were included to perform phylogenetic and population genetic analyses. The observed spatial genetic structure between northern cultivated ginseng (NCG) and southern cultivated ginseng (SCG) accessions suggested multiple independent origins of cultivated ginseng. Genome-wide scanning further demonstrated that NCG and SCG have undergone distinct selection pressures during the domestication process, with more genes identified in the NCG (97 genes) than in the SCG group (5 genes). Functional analyses revealed that these genes are involved in diverse pathways, including DNA methylation, lignin biosynthesis, and cell differentiation. These findings suggested that the SCG and NCG groups have distinct demographic histories. Candidate genes identified are useful for future molecular breeding of cultivated ginseng. PMID:28922794