Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

Bipartite Community Structure of eQTLs.

PubMed

Platig, John; Castaldi, Peter J; DeMeo, Dawn; Quackenbush, John

2016-09-01

Genome Wide Association Studies (GWAS) and expression quantitative trait locus (eQTL) analyses have identified genetic associations with a wide range of human phenotypes. However, many of these variants have weak effects and understanding their combined effect remains a challenge. One hypothesis is that multiple SNPs interact in complex networks to influence functional processes that ultimately lead to complex phenotypes, including disease states. Here we present CONDOR, a method that represents both cis- and trans-acting SNPs and the genes with which they are associated as a bipartite graph and then uses the modular structure of that graph to place SNPs into a functional context. In applying CONDOR to eQTLs in chronic obstructive pulmonary disease (COPD), we found the global network "hub" SNPs were devoid of disease associations through GWAS. However, the network was organized into 52 communities of SNPs and genes, many of which were enriched for genes in specific functional classes. We identified local hubs within each community ("core SNPs") and these were enriched for GWAS SNPs for COPD and many other diseases. These results speak to our intuition: rather than single SNPs influencing single genes, we see groups of SNPs associated with the expression of families of functionally related genes and that disease SNPs are associated with the perturbation of those functions. These methods are not limited in their application to COPD and can be used in the analysis of a wide variety of disease processes and other phenotypic traits.

LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

PubMed

Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

2005-06-15

The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.

The genomic architecture and association genetics of adaptive characters using a candidate SNP approach in boreal black spruce

PubMed Central

2013-01-01

Background The genomic architecture of adaptive traits remains poorly understood in non-model plants. Various approaches can be used to bridge this gap, including the mapping of quantitative trait loci (QTL) in pedigrees, and genetic association studies in non-structured populations. Here we present results on the genomic architecture of adaptive traits in black spruce, which is a widely distributed conifer of the North American boreal forest. As an alternative to the usual candidate gene approach, a candidate SNP approach was developed for association testing. Results A genetic map containing 231 gene loci was used to identify QTL that were related to budset timing and to tree height assessed over multiple years and sites. Twenty-two unique genomic regions were identified, including 20 that were related to budset timing and 6 that were related to tree height. From results of outlier detection and bulk segregant analysis for adaptive traits using DNA pool sequencing of 434 genes, 52 candidate SNPs were identified and subsequently tested in genetic association studies for budset timing and tree height assessed over multiple years and sites. A total of 34 (65%) SNPs were significantly associated with budset timing, or tree height, or both. Although the percentages of explained variance (PVE) by individual SNPs were small, several significant SNPs were shared between sites and among years. Conclusions The sharing of genomic regions and significant SNPs between budset timing and tree height indicates pleiotropic effects. Significant QTLs and SNPs differed quite greatly among years, suggesting that different sets of genes for the same characters are involved at different stages in the tree’s life history. The functional diversity of genes carrying significant SNPs and low observed PVE further indicated that a large number of polymorphisms are involved in adaptive genetic variation. Accordingly, for undomesticated species such as black spruce with natural populations of large effective size and low linkage disequilibrium, efficient marker systems that are predictive of adaptation should require the survey of large numbers of SNPs. Candidate SNP approaches like the one developed in the present study could contribute to reducing these numbers. PMID:23724860

Multi-variant study of obesity risk genes in African Americans: The Jackson Heart Study.

PubMed

Liu, Shijian; Wilson, James G; Jiang, Fan; Griswold, Michael; Correa, Adolfo; Mei, Hao

2016-11-30

Genome-wide association study (GWAS) has been successful in identifying obesity risk genes by single-variant association analysis. For this study, we designed steps of analysis strategy and aimed to identify multi-variant effects on obesity risk among candidate genes. Our analyses were focused on 2137 African American participants with body mass index measured in the Jackson Heart Study and 657 common single nucleotide polymorphisms (SNPs) genotyped at 8 GWAS-identified obesity risk genes. Single-variant association test showed that no SNPs reached significance after multiple testing adjustment. The following gene-gene interaction analysis, which was focused on SNPs with unadjusted p-value<0.10, identified 6 significant multi-variant associations. Logistic regression showed that SNPs in these associations did not have significant linear interactions; examination of genetic risk score evidenced that 4 multi-variant associations had significant additive effects of risk SNPs; and haplotype association test presented that all multi-variant associations contained one or several combinations of particular alleles or haplotypes, associated with increased obesity risk. Our study evidenced that obesity risk genes generated multi-variant effects, which can be additive or non-linear interactions, and multi-variant study is an important supplement to existing GWAS for understanding genetic effects of obesity risk genes. Copyright © 2016 Elsevier B.V. All rights reserved.

Pervasive sharing of genetic effects in autoimmune disease.

PubMed

Cotsapas, Chris; Voight, Benjamin F; Rossin, Elizabeth; Lage, Kasper; Neale, Benjamin M; Wallace, Chris; Abecasis, Gonçalo R; Barrett, Jeffrey C; Behrens, Timothy; Cho, Judy; De Jager, Philip L; Elder, James T; Graham, Robert R; Gregersen, Peter; Klareskog, Lars; Siminovitch, Katherine A; van Heel, David A; Wijmenga, Cisca; Worthington, Jane; Todd, John A; Hafler, David A; Rich, Stephen S; Daly, Mark J

2011-08-01

Genome-wide association (GWA) studies have identified numerous, replicable, genetic associations between common single nucleotide polymorphisms (SNPs) and risk of common autoimmune and inflammatory (immune-mediated) diseases, some of which are shared between two diseases. Along with epidemiological and clinical evidence, this suggests that some genetic risk factors may be shared across diseases-as is the case with alleles in the Major Histocompatibility Locus. In this work we evaluate the extent of this sharing for 107 immune disease-risk SNPs in seven diseases: celiac disease, Crohn's disease, multiple sclerosis, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, and type 1 diabetes. We have developed a novel statistic for Cross Phenotype Meta-Analysis (CPMA) which detects association of a SNP to multiple, but not necessarily all, phenotypes. With it, we find evidence that 47/107 (44%) immune-mediated disease risk SNPs are associated to multiple-but not all-immune-mediated diseases (SNP-wise P(CPMA)<0.01). We also show that distinct groups of interacting proteins are encoded near SNPs which predispose to the same subsets of diseases; we propose these as the mechanistic basis of shared disease risk. We are thus able to leverage genetic data across diseases to construct biological hypotheses about the underlying mechanism of pathogenesis.

An in-depth analysis identifies two new independent signals in 11q23.3 associated with vitiligo in the Chinese Han population.

PubMed

Zhao, Suli; Fang, Fang; Tang, Xianfa; Dou, Jinfa; Wang, Wenjun; Zheng, Xiaodong; Sun, Liangdan; Zhang, Anping

2017-10-01

Vitiligo is an autoimmune disease, characterized by progressive loss of skin pigmentation, which is caused by the interactions of multiple factors, such as heredity, immunity and environment. Recently, a single nucleotide polymorphism (SNP) rs638893 at 11q23.3 region was identified as a risk factor for vitiligo in genome-wide association studies and multiple SNPs in this region have been associated with other autoimmune diseases. This study aims to identify additional susceptibility variants associated with vitiligo at 11q23.3 in the Chinese Han population. We selected and genotyped 26 SNPs at 11q23.3 in an independent cohort including 2924 cases and 4048 controls using the Sequenom MassArray iPLEX ® system. Bonferroni adjustment was used for multiple comparisons and P value <1.92×10 -3 (0.05/26) was considered statistically significant. The A allele of rs613791 and G allele of rs523604 located in CXCR5 were observed to be significantly associated with vitiligo (OR=1.21, 95% CI: 1.11-1.31, P=1.20×10 -5 ; OR=1.14, 95% CI: 1.07-1.23, P=1.90×10 -4 , respectively). The C allele of rs638893 (a previously reported one) located upstream of DDX6 was also significantly associated with vitiligo (OR=1.25, 95% CI: 1.12-1.38, P=3.04×10 -5 ). The genotypes distribution of 3 SNPs also showed significant differences between case and control (rs613791: P=7.00×10 -6 , rs523604: P=4.00×10 -3 , rs638893: P=1.20×10 -5 , respectively). The two newly identified SNPs (rs613791 and rs523604) showed independent associations with vitiligo by linkage disequilibrium analysis and conditional logistic regression. The study identified two new independent signals in the associated locus 11q23.3 for vitiligo. The presence of multiple independent variants emphasizes an important role of this region in disease susceptibility. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.

PubMed

Ehret, Georg B; Ferreira, Teresa; Chasman, Daniel I; Jackson, Anne U; Schmidt, Ellen M; Johnson, Toby; Thorleifsson, Gudmar; Luan, Jian'an; Donnelly, Lousie A; Kanoni, Stavroula; Petersen, Ann-Kristin; Pihur, Vasyl; Strawbridge, Rona J; Shungin, Dmitry; Hughes, Maria F; Meirelles, Osorio; Kaakinen, Marika; Bouatia-Naji, Nabila; Kristiansson, Kati; Shah, Sonia; Kleber, Marcus E; Guo, Xiuqing; Lyytikäinen, Leo-Pekka; Fava, Cristiano; Eriksson, Niclas; Nolte, Ilja M; Magnusson, Patrik K; Salfati, Elias L; Rallidis, Loukianos S; Theusch, Elizabeth; Smith, Andrew J P; Folkersen, Lasse; Witkowska, Kate; Pers, Tune H; Joehanes, Roby; Kim, Stuart K; Lataniotis, Lazaros; Jansen, Rick; Johnson, Andrew D; Warren, Helen; Kim, Young Jin; Zhao, Wei; Wu, Ying; Tayo, Bamidele O; Bochud, Murielle; Absher, Devin; Adair, Linda S; Amin, Najaf; Arking, Dan E; Axelsson, Tomas; Baldassarre, Damiano; Balkau, Beverley; Bandinelli, Stefania; Barnes, Michael R; Barroso, Inês; Bevan, Stephen; Bis, Joshua C; Bjornsdottir, Gyda; Boehnke, Michael; Boerwinkle, Eric; Bonnycastle, Lori L; Boomsma, Dorret I; Bornstein, Stefan R; Brown, Morris J; Burnier, Michel; Cabrera, Claudia P; Chambers, John C; Chang, I-Shou; Cheng, Ching-Yu; Chines, Peter S; Chung, Ren-Hua; Collins, Francis S; Connell, John M; Döring, Angela; Dallongeville, Jean; Danesh, John; de Faire, Ulf; Delgado, Graciela; Dominiczak, Anna F; Doney, Alex S F; Drenos, Fotios; Edkins, Sarah; Eicher, John D; Elosua, Roberto; Enroth, Stefan; Erdmann, Jeanette; Eriksson, Per; Esko, Tonu; Evangelou, Evangelos; Evans, Alun; Fall, Tove; Farrall, Martin; Felix, Janine F; Ferrières, Jean; Ferrucci, Luigi; Fornage, Myriam; Forrester, Terrence; Franceschini, Nora; Duran, Oscar H Franco; Franco-Cereceda, Anders; Fraser, Ross M; Ganesh, Santhi K; Gao, He; Gertow, Karl; Gianfagna, Francesco; Gigante, Bruna; Giulianini, Franco; Goel, Anuj; Goodall, Alison H; Goodarzi, Mark O; Gorski, Mathias; Gräßler, Jürgen; Groves, Christopher; Gudnason, Vilmundur; Gyllensten, Ulf; Hallmans, Göran; Hartikainen, Anna-Liisa; Hassinen, Maija; Havulinna, Aki S; Hayward, Caroline; Hercberg, Serge; Herzig, Karl-Heinz; Hicks, Andrew A; Hingorani, Aroon D; Hirschhorn, Joel N; Hofman, Albert; Holmen, Jostein; Holmen, Oddgeir Lingaas; Hottenga, Jouke-Jan; Howard, Phil; Hsiung, Chao A; Hunt, Steven C; Ikram, M Arfan; Illig, Thomas; Iribarren, Carlos; Jensen, Richard A; Kähönen, Mika; Kang, Hyun; Kathiresan, Sekar; Keating, Brendan J; Khaw, Kay-Tee; Kim, Yun Kyoung; Kim, Eric; Kivimaki, Mika; Klopp, Norman; Kolovou, Genovefa; Komulainen, Pirjo; Kooner, Jaspal S; Kosova, Gulum; Krauss, Ronald M; Kuh, Diana; Kutalik, Zoltan; Kuusisto, Johanna; Kvaløy, Kirsti; Lakka, Timo A; Lee, Nanette R; Lee, I-Te; Lee, Wen-Jane; Levy, Daniel; Li, Xiaohui; Liang, Kae-Woei; Lin, Honghuang; Lin, Li; Lindström, Jaana; Lobbens, Stéphane; Männistö, Satu; Müller, Gabriele; Müller-Nurasyid, Martina; Mach, François; Markus, Hugh S; Marouli, Eirini; McCarthy, Mark I; McKenzie, Colin A; Meneton, Pierre; Menni, Cristina; Metspalu, Andres; Mijatovic, Vladan; Moilanen, Leena; Montasser, May E; Morris, Andrew D; Morrison, Alanna C; Mulas, Antonella; Nagaraja, Ramaiah; Narisu, Narisu; Nikus, Kjell; O'Donnell, Christopher J; O'Reilly, Paul F; Ong, Ken K; Paccaud, Fred; Palmer, Cameron D; Parsa, Afshin; Pedersen, Nancy L; Penninx, Brenda W; Perola, Markus; Peters, Annette; Poulter, Neil; Pramstaller, Peter P; Psaty, Bruce M; Quertermous, Thomas; Rao, Dabeeru C; Rasheed, Asif; Rayner, N William N W R; Renström, Frida; Rettig, Rainer; Rice, Kenneth M; Roberts, Robert; Rose, Lynda M; Rossouw, Jacques; Samani, Nilesh J; Sanna, Serena; Saramies, Jouko; Schunkert, Heribert; Sebert, Sylvain; Sheu, Wayne H-H; Shin, Young-Ah; Sim, Xueling; Smit, Johannes H; Smith, Albert V; Sosa, Maria X; Spector, Tim D; Stančáková, Alena; Stanton, Alice; Stirrups, Kathleen E; Stringham, Heather M; Sundstrom, Johan; Swift, Amy J; Syvänen, Ann-Christine; Tai, E-Shyong; Tanaka, Toshiko; Tarasov, Kirill V; Teumer, Alexander; Thorsteinsdottir, Unnur; Tobin, Martin D; Tremoli, Elena; Uitterlinden, Andre G; Uusitupa, Matti; Vaez, Ahmad; Vaidya, Dhananjay; van Duijn, Cornelia M; van Iperen, Erik P A; Vasan, Ramachandran S; Verwoert, Germaine C; Virtamo, Jarmo; Vitart, Veronique; Voight, Benjamin F; Vollenweider, Peter; Wagner, Aline; Wain, Louise V; Wareham, Nicholas J; Watkins, Hugh; Weder, Alan B; Westra, Harm-Jan; Wilks, Rainford; Wilsgaard, Tom; Wilson, James F; Wong, Tien Y; Yang, Tsun-Po; Yao, Jie; Yengo, Loic; Zhang, Weihua; Zhao, Jing Hua; Zhu, Xiaofeng; Bovet, Pascal; Cooper, Richard S; Mohlke, Karen L; Saleheen, Danish; Lee, Jong-Young; Elliott, Paul; Gierman, Hinco J; Willer, Cristen J; Franke, Lude; Hovingh, G Kees; Taylor, Kent D; Dedoussis, George; Sever, Peter; Wong, Andrew; Lind, Lars; Assimes, Themistocles L; Njølstad, Inger; Schwarz, Peter Eh; Langenberg, Claudia; Snieder, Harold; Caulfield, Mark J; Melander, Olle; Laakso, Markku; Saltevo, Juha; Rauramaa, Rainer; Tuomilehto, Jaakko; Ingelsson, Erik; Lehtimäki, Terho; Hveem, Kristian; Palmas, Walter; März, Winfried; Kumari, Meena; Salomaa, Veikko; Chen, Yii-Der I; Rotter, Jerome I; Froguel, Philippe; Jarvelin, Marjo-Riitta; Lakatta, Edward G; Kuulasmaa, Kari; Franks, Paul W; Hamsten, Anders; Wichmann, H-Erich; Palmer, Colin N A; Stefansson, Kari; Ridker, Paul M; Loos, Ruth J F; Chakravarti, Aravinda; Deloukas, Panos; Morris, Andrew P; Newton-Cheh, Christopher; Munroe, Patricia B

2016-10-01

To dissect the genetic architecture of blood pressure and assess effects on target organ damage, we analyzed 128,272 SNPs from targeted and genome-wide arrays in 201,529 individuals of European ancestry, and genotypes from an additional 140,886 individuals were used for validation. We identified 66 blood pressure-associated loci, of which 17 were new; 15 harbored multiple distinct association signals. The 66 index SNPs were enriched for cis-regulatory elements, particularly in vascular endothelial cells, consistent with a primary role in blood pressure control through modulation of vascular tone across multiple tissues. The 66 index SNPs combined in a risk score showed comparable effects in 64,421 individuals of non-European descent. The 66-SNP blood pressure risk score was significantly associated with target organ damage in multiple tissues but with minor effects in the kidney. Our findings expand current knowledge of blood pressure-related pathways and highlight tissues beyond the classical renal system in blood pressure regulation.

The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals

PubMed Central

Chasman, Daniel I.; Jackson, Anne U.; Schmidt, Ellen M.; Johnson, Toby; Thorleifsson, Gudmar; Luan, Jian'an; Donnelly, Lousie A.; Kanoni, Stavroula; Petersen, Ann-Kristin; Pihur, Vasyl; Strawbridge, Rona J.; Shungin, Dmitry; Hughes, Maria F.; Meirelles, Osorio; Kaakinen, Marika; Bouatia-Naji, Nabila; Kristiansson, Kati; Shah, Sonia; Kleber, Marcus E.; Guo, Xiuqing; Lyytikäinen, Leo-Pekka; Fava, Cristiano; Eriksson, Niclas; Nolte, Ilja M.; Magnusson, Patrik K.; Salfati, Elias L.; Rallidis, Loukianos S.; Theusch, Elizabeth; Smith, Andrew J.P.; Folkersen, Lasse; Witkowska, Kate; Pers, Tune H.; Joehanes, Roby; Kim, Stuart K.; Lataniotis, Lazaros; Jansen, Rick; Johnson, Andrew D.; Warren, Helen; Kim, Young Jin; Zhao, Wei; Wu, Ying; Tayo, Bamidele O.; Bochud, Murielle; Absher, Devin; Adair, Linda S.; Amin, Najaf; Arking, Dan E.; Axelsson, Tomas; Baldassarre, Damiano; Balkau, Beverley; Bandinelli, Stefania; Barnes, Michael R.; Barroso, Inês; Bevan, Stephen; Bis, Joshua C.; Bjornsdottir, Gyda; Boehnke, Michael; Boerwinkle, Eric; Bonnycastle, Lori L.; Boomsma, Dorret I.; Bornstein, Stefan R.; Brown, Morris J.; Burnier, Michel; Cabrera, Claudia P.; Chambers, John C.; Chang, I-Shou; Cheng, Ching-Yu; Chines, Peter S.; Chung, Ren-Hua; Collins, Francis S.; Connell, John M.; Döring, Angela; Dallongeville, Jean; Danesh, John; de Faire, Ulf; Delgado, Graciela; Dominiczak, Anna F.; Doney, Alex S.F.; Drenos, Fotios; Edkins, Sarah; Eicher, John D.; Elosua, Roberto; Enroth, Stefan; Erdmann, Jeanette; Eriksson, Per; Esko, Tonu; Evangelou, Evangelos; Evans, Alun; Fall, Tove; Farrall, Martin; Felix, Janine F.; Ferrières, Jean; Ferrucci, Luigi; Fornage, Myriam; Forrester, Terrence; Franceschini, Nora; Duran, Oscar H. Franco; Franco-Cereceda, Anders; Fraser, Ross M.; Ganesh, Santhi K.; Gao, He; Gertow, Karl; Gianfagna, Francesco; Gigante, Bruna; Giulianini, Franco; Goel, Anuj; Goodall, Alison H.; Goodarzi, Mark O.; Gorski, Mathias; Gräßler, Jürgen; Groves, Christopher; Gudnason, Vilmundur; Gyllensten, Ulf; Hallmans, Göran; Hartikainen, Anna-Liisa; Hassinen, Maija; Havulinna, Aki S.; Hayward, Caroline; Hercberg, Serge; Herzig, Karl-Heinz; Hicks, Andrew A.; Hingorani, Aroon D.; Hirschhorn, Joel N.; Hofman, Albert; Holmen, Jostein; Holmen, Oddgeir Lingaas; Hottenga, Jouke-Jan; Howard, Phil; Hsiung, Chao A.; Hunt, Steven C.; Ikram, M. Arfan; Illig, Thomas; Iribarren, Carlos; Jensen, Richard A.; Kähönen, Mika; Kang, Hyun; Kathiresan, Sekar; Keating, Brendan J.; Khaw, Kay-Tee; Kim, Yun Kyoung; Kim, Eric; Kivimaki, Mika; Klopp, Norman; Kolovou, Genovefa; Komulainen, Pirjo; Kooner, Jaspal S.; Kosova, Gulum; Krauss, Ronald M.; Kuh, Diana; Kutalik, Zoltan; Kuusisto, Johanna; Kvaløy, Kirsti; Lakka, Timo A; Lee, Nanette R.; Lee, I-Te; Lee, Wen-Jane; Levy, Daniel; Li, Xiaohui; Liang, Kae-Woei; Lin, Honghuang; Lin, Li; Lindström, Jaana; Lobbens, Stéphane; Männistö, Satu; Müller, Gabriele; Müller-Nurasyid, Martina; Mach, François; Markus, Hugh S.; Marouli, Eirini; McCarthy, Mark I.; McKenzie, Colin A.; Meneton, Pierre; Menni, Cristina; Metspalu, Andres; Mijatovic, Vladan; Moilanen, Leena; Montasser, May E.; Morris, Andrew D.; Morrison, Alanna C.; Mulas, Antonella; Nagaraja, Ramaiah; Narisu, Narisu; Nikus, Kjell; O'Donnell, Christopher J.; O'Reilly, Paul F.; Ong, Ken K.; Paccaud, Fred; Palmer, Cameron D.; Parsa, Afshin; Pedersen, Nancy L.; Penninx, Brenda W.; Perola, Markus; Peters, Annette; Poulter, Neil; Pramstaller, Peter P.; Psaty, Bruce M.; Quertermous, Thomas; Rao, Dabeeru C.; Rasheed, Asif; Rayner, N William N.W.R.; Renström, Frida; Rettig, Rainer; Rice, Kenneth M.; Roberts, Robert; Rose, Lynda M.; Rossouw, Jacques; Samani, Nilesh J.; Sanna, Serena; Saramies, Jouko; Schunkert, Heribert; Sebert, Sylvain; Sheu, Wayne H.-H.; Shin, Young-Ah; Sim, Xueling; Smit, Johannes H.; Smith, Albert V.; Sosa, Maria X.; Spector, Tim D.; Stančáková, Alena; Stanton, Alice; Stirrups, Kathleen E.; Stringham, Heather M.; Sundstrom, Johan; Swift, Amy J.; Syvänen, Ann-Christine; Tai, E-Shyong; Tanaka, Toshiko; Tarasov, Kirill V.; Teumer, Alexander; Thorsteinsdottir, Unnur; Tobin, Martin D.; Tremoli, Elena; Uitterlinden, Andre G.; Uusitupa, Matti; Vaez, Ahmad; Vaidya, Dhananjay; van Duijn, Cornelia M.; van Iperen, Erik P.A.; Vasan, Ramachandran S.; Verwoert, Germaine C.; Virtamo, Jarmo; Vitart, Veronique; Voight, Benjamin F.; Vollenweider, Peter; Wagner, Aline; Wain, Louise V.; Wareham, Nicholas J.; Watkins, Hugh; Weder, Alan B.; Westra, Harm-Jan; Wilks, Rainford; Wilsgaard, Tom; Wilson, James F.; Wong, Tien Y.; Yang, Tsun-Po; Yao, Jie; Yengo, Loic; Zhang, Weihua; Zhao, Jing Hua; Zhu, Xiaofeng; Bovet, Pascal; Cooper, Richard S.; Mohlke, Karen L.; Saleheen, Danish; Lee, Jong-Young; Elliott, Paul; Gierman, Hinco J.; Willer, Cristen J.; Franke, Lude; Hovingh, G Kees; Taylor, Kent D.; Dedoussis, George; Sever, Peter; Wong, Andrew; Lind, Lars; Assimes, Themistocles L.; Njølstad, Inger; Schwarz, Peter EH.; Langenberg, Claudia; Snieder, Harold; Caulfield, Mark J.; Melander, Olle; Laakso, Markku; Saltevo, Juha; Rauramaa, Rainer; Tuomilehto, Jaakko; Ingelsson, Erik; Lehtimäki, Terho; Hveem, Kristian; Palmas, Walter; März, Winfried; Kumari, Meena; Salomaa, Veikko; Chen, Yii-Der I.; Rotter, Jerome I.; Froguel, Philippe; Jarvelin, Marjo-Riitta; Lakatta, Edward G.; Kuulasmaa, Kari; Franks, Paul W.; Hamsten, Anders; Wichmann, H.-Erich; Palmer, Colin N.A.; Stefansson, Kari; Ridker, Paul M; Loos, Ruth J.F.; Chakravarti, Aravinda; Deloukas, Panos; Morris, Andrew P.; Newton-Cheh, Christopher; Munroe, Patricia B.

2016-01-01

To dissect the genetic architecture of blood pressure and assess effects on target-organ damage, we analyzed 128,272 SNPs from targeted and genome-wide arrays in 201,529 individuals of European ancestry and genotypes from an additional 140,886 individuals were used for validation. We identified 66 blood pressure loci, of which 17 were novel and 15 harbored multiple distinct association signals. The 66 index SNPs were enriched for cis-regulatory elements, particularly in vascular endothelial cells, consistent with a primary role in blood pressure control through modulation of vascular tone across multiple tissues. The 66 index SNPs combined in a risk score showed comparable effects in 64,421 individuals of non-European descent. The 66-SNP blood pressure risk score was significantly associated with target-organ damage in multiple tissues, with minor effects in the kidney. Our findings expand current knowledge of blood pressure pathways and highlight tissues beyond the classic renal system in blood pressure regulation. PMID:27618452

Genetic variation predicting cisplatin cytotoxicity associated with overall survival in lung cancer patients receiving platinum-based chemotherapy †, ‡

PubMed Central

Tan, Xiang-Lin; Moyer, Ann M.; Fridley, Brooke L.; Schaid, Daniel J.; Niu, Nifang; Batzler, Anthony J.; Jenkins, Gregory D.; Abo, Ryan P.; Li, Liang; Cunningham, Julie M.; Sun, Zhifu; Yang, Ping; Wang, Liewei

2011-01-01

Purpose Inherited variability in the prognosis of lung cancer patients treated with platinum-based chemotherapy has been widely investigated. However, the overall contribution of genetic variation to platinum response is not well established. To identify novel candidate SNPs/genes, we performed a genome-wide association study (GWAS) for cisplatin cytotoxicity using lymphoblastoid cell lines (LCLs), followed by an association study of selected SNPs from the GWAS with overall survival (OS) in lung cancer patients. Experimental Design GWAS for cisplatin were performed with 283 ethnically diverse LCLs. 168 top SNPs were genotyped in 222 small cell and 961 non-small cell lung cancer (SCLC, NSCLC) patients treated with platinum-based therapy. Association of the SNPs with OS was determined using the Cox regression model. Selected candidate genes were functionally validated by siRNA knockdown in human lung cancer cells. Results Among 157 successfully genotyped SNPs, 9 and 10 SNPs were top SNPs associated with OS for patients with NSCLC and SCLC, respectively, although they were not significant after adjusting for multiple testing. Fifteen genes, including 7 located within 200 kb up or downstream of the four top SNPs and 8 genes for which expression was correlated with three SNPs in LCLs were selected for siRNA screening. Knockdown of DAPK3 and METTL6, for which expression levels were correlated with the rs11169748 and rs2440915 SNPs, significantly decreased cisplatin sensitivity in lung cancer cells. Conclusions This series of clinical and complementary laboratory-based functional studies identified several candidate genes/SNPs that might help predict treatment outcomes for platinum-based therapy of lung cancer. PMID:21775533

Colorectal cancer risk variants at 8q23.3 and 11q23.1 are associated with disease phenotype in APC mutation carriers.

PubMed

Ghorbanoghli, Z; Nieuwenhuis, M H; Houwing-Duistermaat, J J; Jagmohan-Changur, S; Hes, F J; Tops, C M; Wagner, A; Aalfs, C M; Verhoef, S; Gómez García, E B; Sijmons, R H; Menko, F H; Letteboer, T G; Hoogerbrugge, N; van Wezel, T; Vasen, H F A; Wijnen, J T

2016-10-01

Familial adenomatous polyposis (FAP) is a dominantly inherited syndrome caused by germline mutations in the APC gene and characterized by the development of multiple colorectal adenomas and a high risk of developing colorectal cancer (CRC). The severity of polyposis is correlated with the site of the APC mutation. However, there is also phenotypic variability within families with the same underlying APC mutation, suggesting that additional factors influence the severity of polyposis. Genome-wide association studies identified several single nucleotide polymorphisms (SNPs) that are associated with CRC. We assessed whether these SNPs are associated with polyp multiplicity in proven APC mutation carriers. Sixteen CRC-associated SNPs were analysed in a cohort of 419 APC germline mutation carriers from 182 families. Clinical data were retrieved from the Dutch Polyposis Registry. Allele frequencies of the SNPs were compared for patients with <100 colorectal adenomas versus patients with ≥100 adenomas, using generalized estimating equations with the APC genotype as a covariate. We found a trend of association of two of the tested SNPs with the ≥100 adenoma phenotype: the C alleles of rs16892766 at 8q23.3 (OR 1.71, 95 % CI 1.05-2.76, p = 0.03, dominant model) and rs3802842 at 11q23.1 (OR 1.51, 95 % CI 1.03-2.22, p = 0.04, dominant model). We identified two risk variants that are associated with a more severe phenotype in APC mutation carriers. These risk variants may partly explain the phenotypic variability in families with the same APC gene defect. Further studies with a larger sample size are recommended to evaluate and confirm the phenotypic effect of these SNPs in FAP.

Identification of type 2 diabetes-associated combination of SNPs using support vector machine.

PubMed

Ban, Hyo-Jeong; Heo, Jee Yeon; Oh, Kyung-Soo; Park, Keun-Joon

2010-04-23

Type 2 diabetes mellitus (T2D), a metabolic disorder characterized by insulin resistance and relative insulin deficiency, is a complex disease of major public health importance. Its incidence is rapidly increasing in the developed countries. Complex diseases are caused by interactions between multiple genes and environmental factors. Most association studies aim to identify individual susceptibility single markers using a simple disease model. Recent studies are trying to estimate the effects of multiple genes and multi-locus in genome-wide association. However, estimating the effects of association is very difficult. We aim to assess the rules for classifying diseased and normal subjects by evaluating potential gene-gene interactions in the same or distinct biological pathways. We analyzed the importance of gene-gene interactions in T2D susceptibility by investigating 408 single nucleotide polymorphisms (SNPs) in 87 genes involved in major T2D-related pathways in 462 T2D patients and 456 healthy controls from the Korean cohort studies. We evaluated the support vector machine (SVM) method to differentiate between cases and controls using SNP information in a 10-fold cross-validation test. We achieved a 65.3% prediction rate with a combination of 14 SNPs in 12 genes by using the radial basis function (RBF)-kernel SVM. Similarly, we investigated subpopulation data sets of men and women and identified different SNP combinations with the prediction rates of 70.9% and 70.6%, respectively. As the high-throughput technology for genome-wide SNPs improves, it is likely that a much higher prediction rate with biologically more interesting combination of SNPs can be acquired by using this method. Support Vector Machine based feature selection method in this research found novel association between combinations of SNPs and T2D in a Korean population.

Multifaceted Genomic Risk for Brain Function in Schizophrenia

PubMed Central

Chen, Jiayu; Calhoun, Vince D.; Pearlson, Godfrey D.; Ehrlich, Stefan; Turner, Jessica A.; Ho, Beng-Choon; Wassink, Thomas H.; Michael, Andrew M; Liu, Jingyu

2012-01-01

Recently, deriving candidate endophenotypes from brain imaging data has become a valuable approach to study genetic influences on schizophrenia (SZ), whose pathophysiology remains unclear. In this work we utilized a multivariate approach, parallel independent component analysis, to identify genomic risk components associated with brain function abnormalities in SZ. 5157 candidate single nucleotide polymorphisms (SNPs) were derived from genome-wide array based on their possible connections with SZ and further investigated for their associations with brain activations captured with functional magnetic resonance imaging (fMRI) during a sensorimotor task. Using data from 92 SZ patients and 116 healthy controls, we detected a significant correlation (r= 0.29; p= 2.41×10−5) between one fMRI component and one SNP component, both of which significantly differentiated patients from controls. The fMRI component mainly consisted of precentral and postcentral gyri, the major activated regions in the motor task. On average, higher activation in these regions was observed in participants with higher loadings of the linked SNP component, predominantly contributed to by 253 SNPs. 138 identified SNPs were from known coding regions of 100 unique genes. 31 identified SNPs did not differ between groups, but moderately correlated with some other group-discriminating SNPs, indicating interactions among alleles contributing towards elevated SZ susceptibility. The genes associated with the identified SNPs participated in four neurotransmitter pathways: GABA receptor signaling, dopamine receptor signaling, neuregulin signaling and glutamate receptor signaling. In summary, our work provides further evidence for the complexity of genomic risk to the functional brain abnormality in SZ and suggests a pathological role of interactions between SNPs, genes and multiple neurotransmitter pathways. PMID:22440650

Population differences in platinum toxicity as a means to identify novel genetic susceptibility variants

PubMed Central

O'Donnell, Peter H.; Gamazon, Eric; Zhang, Wei; Stark, Amy L.; Kistner-Griffin, Emily O.; Huang, R. Stephanie; Dolan, M. Eileen

2010-01-01

Objectives Clinical studies show that Asians (ASN) are more susceptible to toxicities associated with platinum-containing regimens. We hypothesized that studying ASN as an `enriched phenotype' population could enable the discovery of novel genetic determinants of platinum susceptibility. Methods Using well-genotyped lymphoblastoid cell lines from the HapMap, we determined cisplatin and carboplatin cytotoxicity phenotypes (IC50s) for ASN, Caucasians (CEU), and Africans (YRI). IC50s were used in genome-wide association studies. Results ASN were most sensitive to platinums, corroborating clinical findings. ASN genome-wide association studies produced 479 single-nucleotide polymorphisms (SNPs) associating with cisplatin susceptibility and 199 with carboplatin susceptibility (P<10−4). Considering only the most significant variants (P< 9.99 × 10−6), backwards elimination was then used to identify reduced-model SNPs, which robustly described the drug phenotypes within ASN. These SNPs comprised highly descriptive genetic signatures of susceptibility, with 12 SNPs explaining more than 95% of the susceptibility phenotype variation for cisplatin, and eight SNPs approximately 75% for carboplatin. To determine the possible function of these variants in ASN, the SNPs were tested for association with differential expression of target genes. SNPs were highly associated with the expression of multiple target genes, and notably, the histone H3 family was implicated for both drugs, suggesting a platinum-class mechanism. Histone H3 has repeatedly been described as regulating the formation of platinum-DNA adducts, but this is the first evidence that specific genetic variants might mediate these interactions in a pharmacogenetic manner. Finally, to determine whether any ASN-identified SNPs might also be important in other human populations, we interrogated all 479/199 SNPs for association with platinum susceptibility in an independent combined CEU/YRI population. Three unique SNPs for cisplatin and 10 for carboplatin replicated in CEU/YRI. Conclusion Enriched `platinum susceptible' populations can be used to discover novel genetic determinants governing interindividual platinum chemotherapy susceptibility. PMID:20393316

Genotype-phenotype association study via new multi-task learning model

PubMed Central

Huo, Zhouyuan; Shen, Dinggang

2018-01-01

Research on the associations between genetic variations and imaging phenotypes is developing with the advance in high-throughput genotype and brain image techniques. Regression analysis of single nucleotide polymorphisms (SNPs) and imaging measures as quantitative traits (QTs) has been proposed to identify the quantitative trait loci (QTL) via multi-task learning models. Recent studies consider the interlinked structures within SNPs and imaging QTs through group lasso, e.g. ℓ2,1-norm, leading to better predictive results and insights of SNPs. However, group sparsity is not enough for representing the correlation between multiple tasks and ℓ2,1-norm regularization is not robust either. In this paper, we propose a new multi-task learning model to analyze the associations between SNPs and QTs. We suppose that low-rank structure is also beneficial to uncover the correlation between genetic variations and imaging phenotypes. Finally, we conduct regression analysis of SNPs and QTs. Experimental results show that our model is more accurate in prediction than compared methods and presents new insights of SNPs. PMID:29218896

Common genetic variants associated with cognitive performance identified using the proxy-phenotype method

PubMed Central

Rietveld, Cornelius A.; Esko, Tõnu; Davies, Gail; Pers, Tune H.; Turley, Patrick; Benyamin, Beben; Chabris, Christopher F.; Emilsson, Valur; Johnson, Andrew D.; Lee, James J.; de Leeuw, Christiaan; Marioni, Riccardo E.; Medland, Sarah E.; Miller, Michael B.; Rostapshova, Olga; van der Lee, Sven J.; Vinkhuyzen, Anna A. E.; Amin, Najaf; Conley, Dalton; Derringer, Jaime; van Duijn, Cornelia M.; Fehrmann, Rudolf; Franke, Lude; Glaeser, Edward L.; Hansell, Narelle K.; Hayward, Caroline; Iacono, William G.; Ibrahim-Verbaas, Carla; Jaddoe, Vincent; Karjalainen, Juha; Laibson, David; Lichtenstein, Paul; Liewald, David C.; Magnusson, Patrik K. E.; Martin, Nicholas G.; McGue, Matt; McMahon, George; Pedersen, Nancy L.; Pinker, Steven; Porteous, David J.; Posthuma, Danielle; Rivadeneira, Fernando; Smith, Blair H.; Starr, John M.; Tiemeier, Henning; Timpson, Nicholas J.; Trzaskowski, Maciej; Uitterlinden, André G.; Verhulst, Frank C.; Ward, Mary E.; Wright, Margaret J.; Davey Smith, George; Deary, Ian J.; Johannesson, Magnus; Plomin, Robert; Visscher, Peter M.; Benjamin, Daniel J.; Koellinger, Philipp D.

2014-01-01

We identify common genetic variants associated with cognitive performance using a two-stage approach, which we call the proxy-phenotype method. First, we conduct a genome-wide association study of educational attainment in a large sample (n = 106,736), which produces a set of 69 education-associated SNPs. Second, using independent samples (n = 24,189), we measure the association of these education-associated SNPs with cognitive performance. Three SNPs (rs1487441, rs7923609, and rs2721173) are significantly associated with cognitive performance after correction for multiple hypothesis testing. In an independent sample of older Americans (n = 8,652), we also show that a polygenic score derived from the education-associated SNPs is associated with memory and absence of dementia. Convergent evidence from a set of bioinformatics analyses implicates four specific genes (KNCMA1, NRXN1, POU2F3, and SCRT). All of these genes are associated with a particular neurotransmitter pathway involved in synaptic plasticity, the main cellular mechanism for learning and memory. PMID:25201988

Functional Characterization of Schizophrenia-Associated Variation in CACNA1C

PubMed Central

Eckart, Nicole; Song, Qifeng; Yang, Rebecca; Wang, Ruihua; Zhu, Heng; McCallion, Andrew S.; Avramopoulos, Dimitrios

2016-01-01

Calcium channel subunits, including CACNA1C, have been associated with multiple psychiatric disorders. Specifically, genome wide association studies (GWAS) have repeatedly identified the single nucleotide polymorphism (SNP) rs1006737 in intron 3 of CACNA1C to be strongly associated with schizophrenia and bipolar disorder. Here, we show that rs1006737 marks a quantitative trait locus for CACNA1C transcript levels. We test 16 SNPs in high linkage disequilibrium with rs1007637 and find one, rs4765905, consistently showing allele-dependent regulatory function in reporter assays. We find allele-specific protein binding for 13 SNPs including rs4765905. Using protein microarrays, we identify several proteins binding ≥3 SNPs, but not control sequences, suggesting possible functional interactions and combinatorial haplotype effects. Finally, using circular chromatin conformation capture, we show interaction of the disease-associated region including the 16 SNPs with the CACNA1C promoter and other potential regulatory regions. Our results elucidate the pathogenic relevance of one of the best-supported risk loci for schizophrenia and bipolar disorder. PMID:27276213

ARG1 Is a Novel Bronchodilator Response Gene

PubMed Central

Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.

2008-01-01

Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

Genetic variation affecting exon skipping contributes to brain structural atrophy in Alzheimer's disease.

PubMed

Lee, Younghee; Han, Seonggyun; Kim, Dongwook; Kim, Dokyoon; Horgousluoglu, Emrin; Risacher, Shannon L; Saykin, Andrew J; Nho, Kwangsik

2018-01-01

Genetic variation in cis-regulatory elements related to splicing machinery and splicing regulatory elements (SREs) results in exon skipping and undesired protein products. We developed a splicing decision model to identify actionable loci among common SNPs for gene regulation. The splicing decision model identified SNPs affecting exon skipping by analyzing sequence-driven alternative splicing (AS) models and by scanning the genome for the regions with putative SRE motifs. We used non-Hispanic Caucasians with neuroimaging, and fluid biomarkers for Alzheimer's disease (AD) and identified 17,088 common exonic SNPs affecting exon skipping. GWAS identified one SNP (rs1140317) in HLA-DQB1 as significantly associated with entorhinal cortical thickness, AD neuroimaging biomarker, after controlling for multiple testing. Further analysis revealed that rs1140317 was significantly associated with brain amyloid-f deposition (PET and CSF). HLA-DQB1 is an essential immune gene and may regulate AS, thereby contributing to AD pathology. SRE may hold potential as novel therapeutic targets for AD.

Oxytocin receptor gene variations predict neural and behavioral response to oxytocin in autism

PubMed Central

Watanabe, Takamitsu; Otowa, Takeshi; Abe, Osamu; Kuwabara, Hitoshi; Aoki, Yuta; Natsubori, Tatsunobu; Takao, Hidemasa; Kakiuchi, Chihiro; Kondo, Kenji; Ikeda, Masashi; Iwata, Nakao; Kasai, Kiyoto; Sasaki, Tsukasa

2017-01-01

Abstract Oxytocin appears beneficial for autism spectrum disorder (ASD), and more than 20 single-nucleotide polymorphisms (SNPs) in oxytocin receptor (OXTR) are relevant to ASD. However, neither biological functions of OXTR SNPs in ASD nor critical OXTR SNPs that determine oxytocin’s effects on ASD remains known. Here, using a machine-learning algorithm that was designed to evaluate collective effects of multiple SNPs and automatically identify most informative SNPs, we examined relationships between 27 representative OXTR SNPs and six types of behavioral/neural response to oxytocin in ASD individuals. The oxytocin effects were extracted from our previous placebo-controlled within-participant clinical trial administering single-dose intranasal oxytocin to 38 high-functioning adult Japanese ASD males. Consequently, we identified six different SNP sets that could accurately predict the six different oxytocin efficacies, and confirmed the robustness of these SNP selections against variations of the datasets and analysis parameters. Moreover, major alleles of several prominent OXTR SNPs—including rs53576 and rs2254298—were found to have dissociable effects on the oxytocin efficacies. These findings suggest biological functions of the OXTR SNP variants on autistic oxytocin responses, and implied that clinical oxytocin efficacy may be genetically predicted before its actual administration, which would contribute to establishment of future precision medicines for ASD. PMID:27798253

Association of variants in innate immune genes with asthma and eczema

PubMed Central

Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.

2012-01-01

Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

Large-scale gene-centric meta-analysis across 32 studies identifies multiple lipid loci

USDA-ARS?s Scientific Manuscript database

Genome-wide association studies (GWASs) have identified many SNPs underlying variations in plasma-lipid levels. We explore whether additional loci associated with plasma-lipid phenotypes, such as high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholest...

Joint Identification of Genetic Variants for Physical Activity in Korean Population

PubMed Central

Kim, Jayoun; Kim, Jaehee; Min, Haesook; Oh, Sohee; Kim, Yeonjung; Lee, Andy H.; Park, Taesung

2014-01-01

There has been limited research on genome-wide association with physical activity (PA). This study ascertained genetic associations between PA and 344,893 single nucleotide polymorphism (SNP) markers in 8842 Korean samples. PA data were obtained from a validated questionnaire that included information on PA intensity and duration. Metabolic equivalent of tasks were calculated to estimate the total daily PA level for each individual. In addition to single- and multiple-SNP association tests, a pathway enrichment analysis was performed to identify the biological significance of SNP markers. Although no significant SNP was found at genome-wide significance level via single-SNP association tests, 59 genetic variants mapped to 76 genes were identified via a multiple SNP approach using a bootstrap selection stability measure. Pathway analysis for these 59 variants showed that maturity onset diabetes of the young (MODY) was enriched. Joint identification of SNPs could enable the identification of multiple SNPs with good predictive power for PA and a pathway enriched for PA. PMID:25026172

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

PubMed

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Genetic polymorphisms associated with increased risk of developing chronic myelogenous leukemia

PubMed Central

Bruzzoni-Giovanelli, Heriberto; González, Juan R.; Sigaux, François; Villoutreix, Bruno O.; Cayuela, Jean Michel; Guilhot, Joëlle; Preudhomme, Claude; Guilhot, François; Poyet, Jean-Luc; Rousselot, Philippe

2015-01-01

Little is known about inherited factors associated with the risk of developing chronic myelogenous leukemia (CML). We used a dedicated DNA chip containing 16 561 single nucleotide polymorphisms (SNPs) covering 1 916 candidate genes to analyze 437 CML patients and 1 144 healthy control individuals. Single SNP association analysis identified 139 SNPs that passed multiple comparisons (1% false discovery rate). The HDAC9, AVEN, SEMA3C, IKBKB, GSTA3, RIPK1 and FGF2 genes were each represented by three SNPs, the PSM family by four SNPs and the SLC15A1 gene by six. Haplotype analysis showed that certain combinations of rare alleles of these genes increased the risk of developing CML by more than two or three-fold. A classification tree model identified five SNPs belonging to the genes PSMB10, TNFRSF10D, PSMB2, PPARD and CYP26B1, which were associated with CML predisposition. A CML-risk-allele score was created using these five SNPs. This score was accurate for discriminating CML status (AUC: 0.61, 95%CI: 0.58–0.64). Interestingly, the score was associated with age at diagnosis and the average number of risk alleles was significantly higher in younger patients. The risk-allele score showed the same distribution in the general population (HapMap CEU samples) as in our control individuals and was associated with differential gene expression patterns of two genes (VAPA and TDRKH). In conclusion, we describe haplotypes and a genetic score that are significantly associated with a predisposition to develop CML. The SNPs identified will also serve to drive fundamental research on the putative role of these genes in CML development. PMID:26474455

Analysis of recently identified prostate cancer susceptibility loci in a population-based study: Associations with family history and clinical features

PubMed Central

FitzGerald, Liesel M.; Kwon, Erika M.; Koopmeiners, Joseph S.; Salinas, Claudia A.; Stanford, Janet L.; Ostrander, Elaine A.

2009-01-01

Purpose Two recent genome-wide association studies have highlighted several SNPs purported to be associated with prostate cancer risk. We investigated the significance of these SNPs in a population-based study of Caucasian men, testing the effects of each SNP in relation to family history of prostate cancer and clinicopathological features of disease. Experimental Design We genotyped 13 SNPs in 1,308 prostate cancer patients and 1,267 unaffected controls frequency matched to cases by five-year age groups. The association of each SNP with disease risk and stratified by family history of prostate cancer and clinicopathological features of disease was calculated using logistic and polytomous regression. Results These results confirm the importance of multiple previously reported SNPs in relation to prostate cancer susceptibility; 11 of the 13 SNPs were significantly associated with risk of developing prostate cancer. However, none of the SNP associations were of comparable magnitude to that associated with having a first-degree family history of the disease. Risk estimates associated with SNPs rs4242382 and rs2735839 varied by family history, while risk estimates for rs10993994 and rs5945619 varied by Gleason score. Conclusions Our results confirm that several recently identified SNPs are associated with prostate cancer risk; however the variant alleles only confer a low to moderate relative risk of disease and are generally not associated with more aggressive disease features. PMID:19366831

Genotyping of the Alzheimer's Disease Genome-Wide Association Study Index Single Nucleotide Polymorphisms in the Brains for Dementia Research Cohort.

PubMed

Brookes, Keeley J; McConnell, George; Williams, Kirsty; Chaudhury, Sultan; Madhan, Gaganjit; Patel, Tulsi; Turley, Christopher; Guetta-Baranes, Tamar; Bras, Jose; Guerreiro, Rita; Hardy, John; Francis, Paul T; Morgan, Kevin

2018-06-08

The Brains for Dementia Research project is a recently established longitudinal cohort which aims to provide brain tissue for research purposes from neuropathologically defined samples. Here we present the findings from our analysis on the 19 established GWAS index SNPs for Alzheimer's disease, in order to demonstrate if the BDR sample also displays association to these variants. A highly significant association of the APOEɛ4 allele was identified (p = 3.99×10-12). Association tests for the 19 GWAS SNPs found that although no SNPs survive multiple testing, nominal significant findings were detected and concordance with the Lambert et al. GWAS meta-analysis was observed.

GenomeGems: evaluation of genetic variability from deep sequencing data

PubMed Central

2012-01-01

Background Detection of disease-causing mutations using Deep Sequencing technologies possesses great challenges. In particular, organizing the great amount of sequences generated so that mutations, which might possibly be biologically relevant, are easily identified is a difficult task. Yet, for this assignment only limited automatic accessible tools exist. Findings We developed GenomeGems to gap this need by enabling the user to view and compare Single Nucleotide Polymorphisms (SNPs) from multiple datasets and to load the data onto the UCSC Genome Browser for an expanded and familiar visualization. As such, via automatic, clear and accessible presentation of processed Deep Sequencing data, our tool aims to facilitate ranking of genomic SNP calling. GenomeGems runs on a local Personal Computer (PC) and is freely available at http://www.tau.ac.il/~nshomron/GenomeGems. Conclusions GenomeGems enables researchers to identify potential disease-causing SNPs in an efficient manner. This enables rapid turnover of information and leads to further experimental SNP validation. The tool allows the user to compare and visualize SNPs from multiple experiments and to easily load SNP data onto the UCSC Genome browser for further detailed information. PMID:22748151

Fast and robust group-wise eQTL mapping using sparse graphical models.

PubMed

Cheng, Wei; Shi, Yu; Zhang, Xiang; Wang, Wei

2015-01-16

Genome-wide expression quantitative trait loci (eQTL) studies have emerged as a powerful tool to understand the genetic basis of gene expression and complex traits. The traditional eQTL methods focus on testing the associations between individual single-nucleotide polymorphisms (SNPs) and gene expression traits. A major drawback of this approach is that it cannot model the joint effect of a set of SNPs on a set of genes, which may correspond to hidden biological pathways. We introduce a new approach to identify novel group-wise associations between sets of SNPs and sets of genes. Such associations are captured by hidden variables connecting SNPs and genes. Our model is a linear-Gaussian model and uses two types of hidden variables. One captures the set associations between SNPs and genes, and the other captures confounders. We develop an efficient optimization procedure which makes this approach suitable for large scale studies. Extensive experimental evaluations on both simulated and real datasets demonstrate that the proposed methods can effectively capture both individual and group-wise signals that cannot be identified by the state-of-the-art eQTL mapping methods. Considering group-wise associations significantly improves the accuracy of eQTL mapping, and the successful multi-layer regression model opens a new approach to understand how multiple SNPs interact with each other to jointly affect the expression level of a group of genes.

Cumulative Genetic Risk Predicts Platinum/Taxane-Induced Neurotoxicity

PubMed Central

McWhinney-Glass, Sarah; Winham, Stacey J.; Hertz, Daniel L.; Revollo, Jane Yen; Paul, Jim; He, Yijing; Brown, Robert; Motsinger-Reif, Alison A.; McLeod, Howard L.

2013-01-01

Purpose The combination of a platinum and taxane are standard of care for many cancers, but the utility is often limited due to debilitating neurotoxicity. We examined whether single nucleotide polymorphisms (SNPs) from annotated candidate genes will identify genetic risk for chemotherapy-induced neurotoxicity. Patients and Methods A candidate-gene association study was conducted to validate the relevance of 1261 SNPs within 60 candidate genes in 404 ovarian cancer patients receiving platinum/taxane chemotherapy on the SCOTROC1 trial. Statistically significant variants were then assessed for replication in a separate 404 patient replication cohort from SCOTROC1. Results Significant associations with chemotherapy-induced neurotoxicity were identified and replicated for four SNPs in SOX10, BCL2, OPRM1, and TRPV1. The Population Attributable Risk for each of the four SNPs ranged from 5–35%, with a cumulative risk of 62%. According to the multiplicative model, the odds of developing neurotoxicity increase by a factor of 1.64 for every risk genotype. Patients possessing 3 risk variants have an estimated odds ratio of 4.49 (2.36–8.54) compared to individuals with 0 risk variants. Neither the four SNPs nor the risk score were associated with progression free survival or overall survival. Conclusions This study demonstrates that SNPs in four genes have a significant cumulative association with increased risk for the development of chemotherapy-induced neurotoxicity, independent of patient survival. PMID:23963862

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Genome scan study of prostate cancer in Arabs: identification of three genomic regions with multiple prostate cancer susceptibility loci in Tunisians.

PubMed

Shan, Jingxuan; Al-Rumaihi, Khalid; Rabah, Danny; Al-Bozom, Issam; Kizhakayil, Dhanya; Farhat, Karim; Al-Said, Sami; Kfoury, Hala; Dsouza, Shoba P; Rowe, Jillian; Khalak, Hanif G; Jafri, Shahzad; Aigha, Idil I; Chouchane, Lotfi

2013-05-13

Large databases focused on genetic susceptibility to prostate cancer have been accumulated from population studies of different ancestries, including Europeans and African-Americans. Arab populations, however, have been only rarely studied. Using Affymetrix Genome-Wide Human SNP Array 6, we conducted a genome-wide association study (GWAS) in which 534,781 single nucleotide polymorphisms (SNPs) were genotyped in 221 Tunisians (90 prostate cancer patients and 131 age-matched healthy controls). TaqMan SNP Genotyping Assays on 11 prostate cancer associated SNPs were performed in a distinct cohort of 337 individuals from Arab ancestry living in Qatar and Saudi Arabia (155 prostate cancer patients and 182 age-matched controls). In-silico expression quantitative trait locus (eQTL) analysis along with mRNA quantification of nearby genes was performed to identify loci potentially cis-regulated by the identified SNPs. Three chromosomal regions, encompassing 14 SNPs, are significantly associated with prostate cancer risk in the Tunisian population (P = 1 × 10-4 to P = 1 × 10-5). In addition to SNPs located on chromosome 17q21, previously found associated with prostate cancer in Western populations, two novel chromosomal regions are revealed on chromosome 9p24 and 22q13. eQTL analysis and mRNA quantification indicate that the prostate cancer associated SNPs of chromosome 17 could enhance the expression of STAT5B gene. Our findings, identifying novel GWAS prostate cancer susceptibility loci, indicate that prostate cancer genetic risk factors could be ethnic specific.

Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Sarah L.; Ostrer, Harry; Stock, Richard

2010-12-01

Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score {<=}7) and 52 control subjects (post-treatment SHIM score {>=}16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, locatedmore » in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10{sup -8}, Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value < 10{sup -6}. Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened. This study demonstrates the feasibility of a genome-wide approach to investigate genetic predisposition to radiation injury.« less

Genetic signatures in choline and 1-carbon metabolism are associated with the severity of hepatic steatosis

PubMed Central

Corbin, Karen D.; Abdelmalek, Manal F.; Spencer, Melanie D.; da Costa, Kerry-Ann; Galanko, Joseph A.; Sha, Wei; Suzuki, Ayako; Guy, Cynthia D.; Cardona, Diana M.; Torquati, Alfonso; Diehl, Anna Mae; Zeisel, Steven H.

2013-01-01

Choline metabolism is important for very low-density lipoprotein secretion, making this nutritional pathway an important contributor to hepatic lipid balance. The purpose of this study was to assess whether the cumulative effects of multiple single nucleotide polymorphisms (SNPs) across genes of choline/1-carbon metabolism and functionally related pathways increase susceptibility to developing hepatic steatosis. In biopsy-characterized cases of nonalcoholic fatty liver disease and controls, we assessed 260 SNPs across 21 genes in choline/1-carbon metabolism. When SNPs were examined individually, using logistic regression, we only identified a single SNP (PNPLA3 rs738409) that was significantly associated with severity of hepatic steatosis after adjusting for confounders and multiple comparisons (P=0.02). However, when groupings of SNPs in similar metabolic pathways were defined using unsupervised hierarchical clustering, we identified groups of subjects with shared SNP signatures that were significantly correlated with steatosis burden (P=0.0002). The lowest and highest steatosis clusters could also be differentiated by ethnicity. However, unique SNP patterns defined steatosis burden irrespective of ethnicity. Our results suggest that analysis of SNP patterns in genes of choline/1-carbon metabolism may be useful for prediction of severity of steatosis in specific subsets of people, and the metabolic inefficiencies caused by these SNPs should be examined further.—Corbin, K. D., Abdelmalek, M. F., Spencer, M. D., da Costa, K.-A., Galanko, J. A., Sha, W., Suzuki, A., Guy, C. D., Cardona, D. M., Torquati, A., Diehl, A. M., Zeisel, S. H. Genetic signatures in choline and 1-carbon metabolism are associated with the severity of hepatic steatosis. PMID:23292069

Racial/ethnic variation in the association of lipid-related genetic variants with blood lipids in the US adult population.

PubMed

Chang, Man-huei; Ned, Renée M; Hong, Yuling; Yesupriya, Ajay; Yang, Quanhe; Liu, Tiebin; Janssens, A Cecile J W; Dowling, Nicole F

2011-10-01

Genome-wide association studies (GWAS) have identified a number of single-nucleotide polymorphisms (SNPs) associated with serum lipid level in populations of European descent. The individual and the cumulative effect of these SNPs on blood lipids are largely unclear for the US population. Using data from the second phase (1991-1994) of the Third National Health and Nutrition Examination Survey (NHANES III), a nationally representative survey of the US population, we examined associations of 57 GWAS-identified or well-established lipid-related genetic loci with plasma concentrations of high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol, total cholesterol, triglycerides, total cholesterol/HDL-C ratio, and non-HDL-C. We used multivariable linear regression to examine single SNP associations and the cumulative effect of multiple SNPs (using a genetic risk score [GRS]) on blood lipid levels. Analyses were conducted in adults from each of the 3 major racial/ethnic groups in the United States: non-Hispanic whites (n=2296), non-Hispanic blacks (n=1699), and Mexican Americans (n=1713). Allele frequencies for all SNPs varied significantly by race/ethnicity, except rs3764261 in CETP. Individual SNPs had very small effects on lipid levels, effects that were generally consistent in direction across racial/ethnic groups. More GWAS-validated SNPs were replicated in non-Hispanic whites (<67%) than in non-Hispanic blacks (<44%) or Mexican Americans (<44%). GRSs were strongly associated with increased lipid levels in each racial/ethnic group. The combination of all SNPs into a weighted GRS explained no more than 11% of the total variance in blood lipid levels. Our findings show that the combined association of SNPs, based on a GRS, was strongly associated with increased blood lipid measures in all major race/ethnic groups in the United States, which may help in identifying subgroups with a high risk for an unfavorable lipid profile.

Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

PubMed

Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

2018-06-27

Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

Genetic variants in VEGF pathway genes in neoadjuvant breast cancer patients receiving bevacizumab: Results from the randomized phase III GeparQuinto study.

PubMed

Hein, Alexander; Lambrechts, Diether; von Minckwitz, Gunter; Häberle, Lothar; Eidtmann, Holger; Tesch, Hans; Untch, Michael; Hilfrich, Jörn; Schem, Christian; Rezai, Mahdi; Gerber, Bernd; Dan Costa, Serban; Blohmer, Jens-Uwe; Schwedler, Kathrin; Kittel, Kornelia; Fehm, Tanja; Kunz, Georg; Beckmann, Matthias W; Ekici, Arif B; Hanusch, Claus; Huober, Jens; Liedtke, Cornelia; Mau, Christine; Moisse, Matthieu; Müller, Volkmar; Nekljudova, Valentina; Peuteman, Gilian; Rack, Brigitte; Rübner, Matthias; Van Brussel, Thomas; Wang, Liewei; Weinshilboum, Richard M; Loibl, Sibylle; Fasching, Peter A

2015-12-15

Studies assessing the effect of bevacizumab (BEV) on breast cancer (BC) outcome have shown different effects on progression-free and overall survival, suggesting that a subgroup of patients may benefit from this treatment. Unfortunately, no biomarkers exist to identify these patients. Here, we investigate whether single nucleotide polymorphisms (SNPs) in VEGF pathway genes correlate with pathological complete response (pCR) in the neoadjuvant GeparQuinto trial. HER2-negative patients were randomized into treatment arms receiving either BEV combined with standard chemotherapy or chemotherapy alone. In a pre-planned biomarker study, DNA was collected from 729 and 724 patients, respectively from both treatment arms, and genotyped for 125 SNPs. Logistic regression assessed interaction between individual SNPs and both treatment arms to predict pCR. Five SNPs may be associated with a better response to BEV, but none of them remained significant after correction for multiple testing. The two SNPs most strongly associated, rs833058 and rs699947, were located upstream of the VEGF-A promoter. Odds ratios for the homozygous common, heterozygous and homozygous rare rs833058 genotypes were 2.36 (95% CI, 1.49-3.75), 1.20 (95% CI, 0.88-1.64) and 0.61 (95% CI, 0.34-1.12). Notably, some SNPs in VEGF-A exhibited a more pronounced effect in the triple-negative subgroup. Several SNPs in VEGF-A may be associated with improved pCR when receiving BEV in the neoadjuvant setting. Although none of the observed effects survived correction for multiple testing, our observations are consistent with previous studies on BEV efficacy in BC. Further research is warranted to clarify the predictive value of these markers. © 2015 UICC.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Evaluation of Parkinson Disease Risk Variants as Expression-QTLs

PubMed Central

Latourelle, Jeanne C.; Dumitriu, Alexandra; Hadzi, Tiffany C.; Beach, Thomas G.; Myers, Richard H.

2012-01-01

The recent Parkinson Disease GWAS Consortium meta-analysis and replication study reports association at several previously confirmed risk loci SNCA, MAPT, GAK/DGKQ, and HLA and identified a novel risk locus at RIT2. To further explore functional consequences of these associations, we investigated modification of gene expression in prefrontal cortex brain samples of pathologically confirmed PD cases (N = 26) and controls (N = 24) by 67 associated SNPs in these 5 loci. Association between the eSNPs and expression was evaluated using a 2-degrees of freedom test of both association and difference in association between cases and controls, adjusted for relevant covariates. SNPs at each of the 5 loci were tested for cis-acting effects on all probes within 250 kb of each locus. Trans-effects of the SNPs on the 39,122 probes passing all QC on the microarray were also examined. From the analysis of cis-acting SNP effects, several SNPs in the MAPT region show significant association to multiple nearby probes, including two strongly correlated probes targeting the gene LOC644246 and the duplicated genes LRRC37A and LRRC37A2, and a third uncorrelated probe targeting the gene DCAKD. Significant cis-associations were also observed between SNPs and two probes targeting genes in the HLA region on chromosome 6. Expanding the association study to examine trans effects revealed an additional 23 SNP-probe associations reaching statistical significance (p<2.8×10−8) including SNPs from the SNCA, MAPT and RIT2 regions. These findings provide additional context for the interpretation of PD associated SNPs identified in recent GWAS as well as potential insight into the mechanisms underlying the observed SNP associations. PMID:23071545

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

Genetics of cortisol secretion and depressive symptoms: a candidate gene and genome wide association approach.

PubMed

Velders, Fleur P; Kuningas, Maris; Kumari, Meena; Dekker, Marieke J; Uitterlinden, Andre G; Kirschbaum, Clemens; Hek, Karin; Hofman, Albert; Verhulst, Frank C; Kivimaki, Mika; Van Duijn, Cornelia M; Walker, Brian R; Tiemeier, Henning

2011-08-01

Depressive patients often have altered cortisol secretion, but few studies have investigated genetic variants in relation to both cortisol secretion and depression. To identify genes related to both these conditions, we: (1) tested the association of single nucleotide polymorphisms (SNPs) in hypothalamic-pituitary-adrenal-axis (HPA-axis) candidate genes with a summary measure of total cortisol secretion during the day (cortisol(AUC)), (2) performed a genome wide association study (GWAS) of cortisol(AUC), and (3) tested the association of identified cortisol-related SNPs with depressive symptoms. We analyzed data on candidate SNPs for the HPA-axis, genome-wide scans, cortisol secretion (n=1711) and depressive symptoms (the Centre for Epidemiology Studies Depression Scale, CES-D) (n=2928) in elderly persons of the Rotterdam Study. We used data from the Whitehall II study (n=2836) to replicate the GWAS findings. Of the 1456 SNPs in 33 candidate genes, minor alleles of 4 SNPs (rs9470080, rs9394309, rs7748266 and rs1360780) in the FKBP5 gene were associated with a decreased cortisol(AUC) (p<1×10(-4) after correction for multiple testing using permutations). These SNPs were also associated with an increased risk of depressive symptoms (rs9470080: OR 1.19 (95%CI 1.0; 1.4)). The GWAS for cortisol yielded 2 SNPs with p-values of 1×10(-06) (rs8062512, rs2252459), but these associations could not be replicated. These results suggest that variation in the FKBP5 gene is associated with both cortisol(AUC) and the likelihood of depressive symptoms. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genome-wide interaction study of smoking and bladder cancer risk

PubMed Central

Figueroa, Jonine D.; Han, Summer S.; Garcia-Closas, Montserrat; Baris, Dalsu; Jacobs, Eric J.; Kogevinas, Manolis; Schwenn, Molly; Malats, Nuria; Johnson, Alison; Purdue, Mark P.; Caporaso, Neil; Landi, Maria Teresa; Prokunina-Olsson, Ludmila; Wang, Zhaoming; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Vineis, Paolo; Siddiq, Afshan; Cortessis, Victoria K.; Kooperberg, Charles; Cussenot, Olivier; Benhamou, Simone; Prescott, Jennifer; Porru, Stefano; Bueno-de-Mesquita, H.Bas; Trichopoulos, Dimitrios; Ljungberg, Börje; Clavel-Chapelon, Françoise; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth; Tjønneland, Anne; Brenan, Paul; Chang-Claude, Jenny; Riboli, Elio; Conti, David; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Hohensee, Chancellor; Rodabough, Rebecca; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Chen, Constance; De Vivo, Immaculata; Giovannucci, Edward; Hunter, David J.; Kraft, Peter; Lindstrom, Sara; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Karagas, Margaret R.; Schned, Alan; Armenti, Karla R.; Hosain, G.M.Monawar; Haiman, Chris A.; Fraumeni, Joseph F.; Chanock, Stephen J.; Chatterjee, Nilanjan; Rothman, Nathaniel; Silverman, Debra T.

2014-01-01

Bladder cancer is a complex disease with known environmental and genetic risk factors. We performed a genome-wide interaction study (GWAS) of smoking and bladder cancer risk based on primary scan data from 3002 cases and 4411 controls from the National Cancer Institute Bladder Cancer GWAS. Alternative methods were used to evaluate both additive and multiplicative interactions between individual single nucleotide polymorphisms (SNPs) and smoking exposure. SNPs with interaction P values < 5 × 10− 5 were evaluated further in an independent dataset of 2422 bladder cancer cases and 5751 controls. We identified 10 SNPs that showed association in a consistent manner with the initial dataset and in the combined dataset, providing evidence of interaction with tobacco use. Further, two of these novel SNPs showed strong evidence of association with bladder cancer in tobacco use subgroups that approached genome-wide significance. Specifically, rs1711973 (FOXF2) on 6p25.3 was a susceptibility SNP for never smokers [combined odds ratio (OR) = 1.34, 95% confidence interval (CI) = 1.20–1.50, P value = 5.18 × 10− 7]; and rs12216499 (RSPH3-TAGAP-EZR) on 6q25.3 was a susceptibility SNP for ever smokers (combined OR = 0.75, 95% CI = 0.67–0.84, P value = 6.35 × 10− 7). In our analysis of smoking and bladder cancer, the tests for multiplicative interaction seemed to more commonly identify susceptibility loci with associations in never smokers, whereas the additive interaction analysis identified more loci with associations among smokers—including the known smoking and NAT2 acetylation interaction. Our findings provide additional evidence of gene–environment interactions for tobacco and bladder cancer. PMID:24662972

Genetic variants in the immunoglobulin heavy chain locus are associated with the IgG index in multiple sclerosis.

PubMed

Buck, Dorothea; Albrecht, Eva; Aslam, Muhammad; Goris, An; Hauenstein, Natalie; Jochim, Angela; Cepok, Sabine; Grummel, Verena; Dubois, Bénédicte; Berthele, Achim; Lichtner, Peter; Gieger, Christian; Winkelmann, Juliane; Hemmer, Bernhard

2013-01-01

Intrathecal synthesis of immunoglobulin gamma (IgG) synthesis is frequently observed in patients with multiple sclerosis (MS). Whereas the extent of intrathecal IgG synthesis varies largely between patients, it remains rather constant in the individual patient over time. The aim of this study was to identify common genetic variants associated with the IgG index as a marker of intrathecal IgG synthesis in MS. We performed a genome-wide association study of the IgG index in a discovery series of 229 patients. For confirmation we performed a replication in 2 independent series comprising 256 and 153 patients, respectively. The impact of associated single nucleotide polymorphisms (SNPs) on MS susceptibility was analyzed in an additional 1,854 cases and 5,175 controls. Significant association between the IgG index and 5 SNPs was detected in the discovery and confirmed in both replication series reaching combined p values of p = 6.5 × 10(-11) to p = 7.5 × 10(-16) . All identified SNPs are clustered around the immunoglobulin heavy chain (IGHC) locus on chromosome 14q32.33 and are in linkage disequilibrium (r(2) range, 0.71-0.95). The best associated SNP is located in an intronic region of the immunoglobulin gamma3 heavy chain gene. Additional sequencing identified the GM21* haplotype to be associated with a high IgG index. Further evaluation of the IGHC SNPs revealed no association with susceptibility to MS in our data set. The extent of intrathecal IgG in MS is influenced by the IGHC locus. No association with susceptibility to MS was found. Therefore GM haplotypes might affect intrathecal IgG synthesis independently of the underlying disease. Copyright © 2012 American Neurological Association.

META-ANALYSIS OF GENOME-WIDE STUDIES IDENTIFIES WNT16 AND ESR1 SNPS ASSOCIATED WITH BONE MINERAL DENSITY IN PREMENOPAUSAL WOMEN

PubMed Central

Koller, Daniel L.; Zheng, Hou-Feng; Karasik, David; Yerges-Armstrong, Laura; Liu, Ching-Ti; McGuigan, Fiona; Kemp, John P.; Giroux, Sylvie; Lai, Dongbing; Edenberg, Howard J.; Peacock, Munro; Czerwinski, Stefan A.; Choh, Audrey C.; McMahon, George; St Pourcain, Beate; Timpson, Nicholas J.; Lawlor, Debbie A; Evans, David M; Towne, Bradford; Blangero, John; Carless, Melanie A.; Kammerer, Candace; Goltzman, David; Kovacs, Christopher S.; Prior, Jerilynn C.; Spector, Tim D.; Rousseau, Francois; Tobias, Jon H.; Akesson, Kristina; Econs, Michael J.; Mitchell, Braxton D.; Richards, J. Brent; Kiel, Douglas P.; Foroud, Tatiana

2013-01-01

Previous genome-wide association studies (GWAS) have identified common variants in genes associated with variation in bone mineral density (BMD), although most have been carried out in combined samples of older women and men. Meta-analyses of these results have identified numerous SNPs of modest effect at genome-wide significance levels in genes involved in both bone formation and resorption, as well as other pathways. We performed a meta-analysis restricted to premenopausal white women from four cohorts (n= 4,061 women, ages 20 to 45) to identify genes influencing peak bone mass at the lumbar spine and femoral neck. Following imputation, age- and weight-adjusted BMD values were tested for association with each SNP. Association of a SNP in the WNT16 gene (rs3801387; p=1.7 × 10−9) and multiple SNPs in the ESR1/C6orf97 (rs4870044; p=1.3 × 10−8) achieved genome-wide significance levels for lumbar spine BMD. These SNPs, along with others demonstrating suggestive evidence of association, were then tested for association in seven Replication cohorts that included premenopausal women of European, Hispanic-American, and African-American descent (combined n=5,597 for femoral neck; 4,744 for lumbar spine). When the data from the Discovery and Replication cohorts were analyzed jointly, the evidence was more significant (WNT16 joint p=1.3 × 10−11; ESR1/C6orf97 joint p= 1.4 × 10−10). Multiple independent association signals were observed with spine BMD at the ESR1 region after conditioning on the primary signal. Analyses of femoral neck BMD also supported association with SNPs in WNT16 and ESR1/C6orf97 (p< 1 × 10−5). Our results confirm that several of the genes contributing to BMD variation across a broad age range in both sexes have effects of similar magnitude on BMD of the spine in premenopausal women. These data support the hypothesis that variants in these genes of known skeletal function also affect BMD during the premenopausal period. PMID:23074152

A custom correlation coefficient (CCC) approach for fast identification of multi-SNP association patterns in genome-wide SNPs data.

PubMed

Climer, Sharlee; Yang, Wei; de las Fuentes, Lisa; Dávila-Román, Victor G; Gu, C Charles

2014-11-01

Complex diseases are often associated with sets of multiple interacting genetic factors and possibly with unique sets of the genetic factors in different groups of individuals (genetic heterogeneity). We introduce a novel concept of custom correlation coefficient (CCC) between single nucleotide polymorphisms (SNPs) that address genetic heterogeneity by measuring subset correlations autonomously. It is used to develop a 3-step process to identify candidate multi-SNP patterns: (1) pairwise (SNP-SNP) correlations are computed using CCC; (2) clusters of so-correlated SNPs identified; and (3) frequencies of these clusters in disease cases and controls compared to identify disease-associated multi-SNP patterns. This method identified 42 candidate multi-SNP associations with hypertensive heart disease (HHD), among which one cluster of 22 SNPs (six genes) included 13 in SLC8A1 (aka NCX1, an essential component of cardiac excitation-contraction coupling) and another of 32 SNPs had 29 from a different segment of SLC8A1. While allele frequencies show little difference between cases and controls, the cluster of 22 associated alleles were found in 20% of controls but no cases and the other in 3% of controls but 20% of cases. These suggest that both protective and risk effects on HHD could be exerted by combinations of variants in different regions of SLC8A1, modified by variants from other genes. The results demonstrate that this new correlation metric identifies disease-associated multi-SNP patterns overlooked by commonly used correlation measures. Furthermore, computation time using CCC is a small fraction of that required by other methods, thereby enabling the analyses of large GWAS datasets. © 2014 WILEY PERIODICALS, INC.

A custom correlation coefficient (CCC) approach for fast identification of multi-SNP association patterns in genome-wide SNPs data

PubMed Central

Climer, Sharlee; Yang, Wei; de las Fuentes, Lisa; Dávila-Román, Victor G.; Gu, C. Charles

2014-01-01

Complex diseases are often associated with sets of multiple interacting genetic factors and possibly with unique sets of the genetic factors in different groups of individuals (genetic heterogeneity). We introduce a novel concept of Custom Correlation Coefficient (CCC) between single nucleotide polymorphisms (SNPs) that address genetic heterogeneity by measuring subset correlations autonomously. It is used to develop a 3-step process to identify candidate multi-SNP patterns: (1) pairwise (SNP-SNP) correlations are computed using CCC; (2) clusters of so-correlated SNPs identified; and (3) frequencies of these clusters in disease cases and controls compared to identify disease-associated multi-SNP patterns. This method identified 42 candidate multi-SNP associations with hypertensive heart disease (HHD), among which one cluster of 22 SNPs (6 genes) included 13 in SLC8A1 (aka NCX1, an essential component of cardiac excitation-contraction coupling) and another of 32 SNPs had 29 from a different segment of SLC8A1. While allele frequencies show little difference between cases and controls, the cluster of 22 associated alleles were found in 20% of controls but no cases and the other in 3% of controls but 20% of cases. These suggest that both protective and risk effects on HHD could be exerted by combinations of variants in different regions of SLC8A1, modified by variants from other genes. The results demonstrate that this new correlation metric identifies disease-associated multi-SNP patterns overlooked by commonly used correlation measures. Furthermore, computation time using CCC is a small fraction of that required by other methods, thereby enabling the analyses of large GWAS datasets. PMID:25168954

Integrative Analysis of Prognosis Data on Multiple Cancer Subtypes

PubMed Central

Liu, Jin; Huang, Jian; Zhang, Yawei; Lan, Qing; Rothman, Nathaniel; Zheng, Tongzhang; Ma, Shuangge

2014-01-01

Summary In cancer research, profiling studies have been extensively conducted, searching for genes/SNPs associated with prognosis. Cancer is diverse. Examining the similarity and difference in the genetic basis of multiple subtypes of the same cancer can lead to a better understanding of their connections and distinctions. Classic meta-analysis methods analyze each subtype separately and then compare analysis results across subtypes. Integrative analysis methods, in contrast, analyze the raw data on multiple subtypes simultaneously and can outperform meta-analysis methods. In this study, prognosis data on multiple subtypes of the same cancer are analyzed. An AFT (accelerated failure time) model is adopted to describe survival. The genetic basis of multiple subtypes is described using the heterogeneity model, which allows a gene/SNP to be associated with prognosis of some subtypes but not others. A compound penalization method is developed to identify genes that contain important SNPs associated with prognosis. The proposed method has an intuitive formulation and is realized using an iterative algorithm. Asymptotic properties are rigorously established. Simulation shows that the proposed method has satisfactory performance and outperforms a penalization-based meta-analysis method and a regularized thresholding method. An NHL (non-Hodgkin lymphoma) prognosis study with SNP measurements is analyzed. Genes associated with the three major subtypes, namely DLBCL, FL, and CLL/SLL, are identified. The proposed method identifies genes that are different from alternatives and have important implications and satisfactory prediction performance. PMID:24766212

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast–ovarian cancer susceptibility locus

PubMed Central

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J.; Li, Qiyuan; Delgado, Melissa K.; Lee, Janet M.; Aittomäki, Kristiina; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K.; Arver, Brita; Bandera, Elisa V.; Barile, Monica; Barkardottir, Rosa B.; Barrowdale, Daniel; Beckmann, Matthias W.; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E.; Bolla, Manjeet K.; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S.; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B. M.; Collonge-Rame, Marie- Agnès; Damette, Alexandre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Sevenet, Nicolas; Longy, Michel; Berthet, Pascaline; Vaur, Dominique; Castera, Laurent; Ferrer, Sandra Fert; Bignon, Yves-Jean; Uhrhammer, Nancy; Coron, Fanny; Faivre, Laurence; Baurand, Amandine; Jacquot, Caroline; Bertolone, Geoffrey; Lizard, Sarab; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Adenis, Claude; Vénat-Bouvet, Laurence; Léone, Mélanie; Boutry-Kryza, Nadia; Calender, Alain; Giraud, Sophie; Verny-Pierre, Carole; Lasset, Christine; Bonadona, Valérie; Barjhoux, Laure; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Remenieras, Audrey; Coupier, Isabelle; Pujol, Pascal; Sokolowska, Johanna; Bronner, Myriam; Delnatte, Capucine; Bézieau, Stéphane; Mari, Véronique; Gauthier-Villars, Marion; Buecher, Bruno; Rouleau, Etienne; Golmard, Lisa; Moncoutier, Virginie; Belotti, Muriel; de Pauw, Antoine; Elan, Camille; Fourme, Emmanuelle; Birot, Anne-Marie; Saule, Claire; Laurent, Maïté; Houdayer, Claude; Lesueur, Fabienne; Mebirouk, Noura; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Warcoin, Mathilde; Prieur, Fabienne; Lebrun, Marine; Kientz, Caroline; Muller, Danièle; Fricker, Jean-Pierre; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Mortemousque, Isabelle; Bressac-de-Paillerets, Brigitte; Caron, Olivier; Guillaud-Bataille, Marine; Cook, Linda S.; Cox, Angela; Cramer, Daniel W.; Cross, Simon S.; Cybulski, Cezary; Czene, Kamila; Daly, Mary B.; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A.; Domchek, Susan M.; Dorfling, Cecilia M.; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Gregory, Helen; Miedzybrodzka, Zosia; Morrison, Patrick J.; Donaldson, Alan; Rogers, Mark T.; Kennedy, M. John; Porteous, Mary E.; Brady, Angela; Barwell, Julian; Foo, Claire; Lalloo, Fiona; Side, Lucy E.; Eason, Jacqueline; Henderson, Alex; Walker, Lisa; Cook, Jackie; Snape, Katie; Murray, Alex; McCann, Emma; Engel, Christoph; Lee, Eunjung; Evans, D. Gareth; Fasching, Peter A.; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D.; Fridley, Brooke L.; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A.; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G.; Glasspool, Rosalind; Godwin, Andrew K.; Goldberg, Mark S.; Goldgar, David E.; González-Neira, Anna; Goode, Ellen L.; Goodman, Marc T.; Greene, Mark H.; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A.; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V. O.; Harrington, Patricia A.; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Rookus, M. A.; van Leeuwen, F. E.; van der Kolk, L. E.; Schmidt, M. K.; Russell, N. S.; de Lange, J. L.; Wijnands, R.; Collée, J. M.; Hooning, M. J.; Seynaeve, C.; van Deurzen, C. H. M.; Obdeijn, I. M.; van Asperen, C. J.; Tollenaar, R. A. E. M.; van Cronenburg, T. C. T. E. F.; Kets, C. M.; Ausems, M. G. E. M.; van der Pol, C. C.; van Os, T. A. M.; Waisfisz, Q.; Meijers-Heijboer, H. E. J.; Gómez-Garcia, E. B.; Oosterwijk, J. C.; Mourits, M. J.; de Bock, G. H.; Vasen, H. F.; Siesling, S.; Verloop, J.; Overbeek, L. I. H.; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K.; Hogervorst, Frans B. L.; Hollestelle, Antoinette; Hopper, John L.; Hulick, Peter J.; Huzarski, Tomasz; Imyanitov, Evgeny N.; Fox, Stephen; Kirk, Judy; Lindeman, Geoff; Price, Melanie; Bowtell, David; deFazio, Anna; Webb, Penny; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M.; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y.; Khan, Sofia; Kiemeney, Lambertus A.; Kjaer, Susanne Kruger; Knight, Julia A.; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A.; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T.; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F. A. G.; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R.; Milne, Roger L.; Montagna, Marco; Moysich, Kirsten B.; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L.; Ness, Roberta B.; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L.; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I.; Olson, Janet E.; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L.; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Poole, Elizabeth M.; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A.; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B.; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schildkraut, Joellen M.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Sellers, Thomas A.; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F.; Sinilnikova, Olga M.; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C.; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R.; Teo, Soo H.; Terry, Kathryn L.; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-chen; Tung, Nadine; Tworoger, Shelley S.; Vachon, Celine; van den Ouweland, Ans M. W.; van Doorn, Helena C.; van Rensburg, Elizabeth J.; Van't Veer, Laura J.; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N.; Wentzensen, Nicolas; Whittemore, Alice S.; Wildiers, Hans; Winqvist, Robert; Wu, Anna H.; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N.; French, Juliet D.; Couch, Fergus J.; Freedman, Matthew L.; Easton, Douglas F.; Dunning, Alison M.; Pharoah, Paul D.; Edwards, Stacey L.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Gayther, Simon A.

2016-01-01

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10−20), ER-negative BC (P=1.1 × 10−13), BRCA1-associated BC (P=7.7 × 10−16) and triple negative BC (P-diff=2 × 10−5). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10−3) and ABHD8 (P<2 × 10−3). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3′-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk. PMID:27601076

Functional mechanisms underlying pleiotropic risk alleles at the 19p13.1 breast-ovarian cancer susceptibility locus.

PubMed

Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J; Li, Qiyuan; Delgado, Melissa K; Lee, Janet M; Aittomäki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K; Arver, Brita; Bandera, Elisa V; Barile, Monica; Barkardottir, Rosa B; Barrowdale, Daniel; Beckmann, Matthias W; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B M; Cook, Linda S; Cox, Angela; Cramer, Daniel W; Cross, Simon S; Cybulski, Cezary; Czene, Kamila; Daly, Mary B; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Engel, Christoph; Lee, Eunjung; Evans, D Gareth; Fasching, Peter A; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D; Fridley, Brooke L; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G; Glasspool, Rosalind; Godwin, Andrew K; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Goode, Ellen L; Goodman, Marc T; Greene, Mark H; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V O; Harrington, Patricia A; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K; Hogervorst, Frans B L; Hollestelle, Antoinette; Hopper, John L; Hulick, Peter J; Huzarski, Tomasz; Imyanitov, Evgeny N; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y; Khan, Sofia; Kiemeney, Lambertus A; Kjaer, Susanne Kruger; Knight, Julia A; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F A G; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R; Milne, Roger L; Montagna, Marco; Moysich, Kirsten B; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L; Ness, Roberta B; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I; Olson, Janet E; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M; Poole, Elizabeth M; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schildkraut, Joellen M; Schmidt, Marjanka K; Schmutzler, Rita K; Sellers, Thomas A; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F; Sinilnikova, Olga M; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R; Teo, Soo H; Terry, Kathryn L; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-Chen; Tung, Nadine; Tworoger, Shelley S; Vachon, Celine; van den Ouweland, Ans M W; van Doorn, Helena C; van Rensburg, Elizabeth J; Van't Veer, Laura J; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N; Wentzensen, Nicolas; Whittemore, Alice S; Wildiers, Hans; Winqvist, Robert; Wu, Anna H; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N; French, Juliet D; Couch, Fergus J; Freedman, Matthew L; Easton, Douglas F; Dunning, Alison M; Pharoah, Paul D; Edwards, Stacey L; Chenevix-Trench, Georgia; Antoniou, Antonis C; Gayther, Simon A

2016-09-07

A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10(-20)), ER-negative BC (P=1.1 × 10(-13)), BRCA1-associated BC (P=7.7 × 10(-16)) and triple negative BC (P-diff=2 × 10(-5)). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10(-3)) and ABHD8 (P<2 × 10(-3)). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3'-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk.

Resampling procedures to identify important SNPs using a consensus approach.

PubMed

Pardy, Christopher; Motyer, Allan; Wilson, Susan

2011-11-29

Our goal is to identify common single-nucleotide polymorphisms (SNPs) (minor allele frequency > 1%) that add predictive accuracy above that gained by knowledge of easily measured clinical variables. We take an algorithmic approach to predict each phenotypic variable using a combination of phenotypic and genotypic predictors. We perform our procedure on the first simulated replicate and then validate against the others. Our procedure performs well when predicting Q1 but is less successful for the other outcomes. We use resampling procedures where possible to guard against false positives and to improve generalizability. The approach is based on finding a consensus regarding important SNPs by applying random forests and the least absolute shrinkage and selection operator (LASSO) on multiple subsamples. Random forests are used first to discard unimportant predictors, narrowing our focus to roughly 100 important SNPs. A cross-validation LASSO is then used to further select variables. We combine these procedures to guarantee that cross-validation can be used to choose a shrinkage parameter for the LASSO. If the clinical variables were unavailable, this prefiltering step would be essential. We perform the SNP-based analyses simultaneously rather than one at a time to estimate SNP effects in the presence of other causal variants. We analyzed the first simulated replicate of Genetic Analysis Workshop 17 without knowledge of the true model. Post-conference knowledge of the simulation parameters allowed us to investigate the limitations of our approach. We found that many of the false positives we identified were substantially correlated with genuine causal SNPs.

Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

PubMed

Multani, Shaleen; Saranath, Dhananjaya

2016-11-01

Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

Exploiting Genome Structure in Association Analysis

PubMed Central

Kim, Seyoung

2014-01-01

Abstract A genome-wide association study involves examining a large number of single-nucleotide polymorphisms (SNPs) to identify SNPs that are significantly associated with the given phenotype, while trying to reduce the false positive rate. Although haplotype-based association methods have been proposed to accommodate correlation information across nearby SNPs that are in linkage disequilibrium, none of these methods directly incorporated the structural information such as recombination events along chromosome. In this paper, we propose a new approach called stochastic block lasso for association mapping that exploits prior knowledge on linkage disequilibrium structure in the genome such as recombination rates and distances between adjacent SNPs in order to increase the power of detecting true associations while reducing false positives. Following a typical linear regression framework with the genotypes as inputs and the phenotype as output, our proposed method employs a sparsity-enforcing Laplacian prior for the regression coefficients, augmented by a first-order Markov process along the sequence of SNPs that incorporates the prior information on the linkage disequilibrium structure. The Markov-chain prior models the structural dependencies between a pair of adjacent SNPs, and allows us to look for association SNPs in a coupled manner, combining strength from multiple nearby SNPs. Our results on HapMap-simulated datasets and mouse datasets show that there is a significant advantage in incorporating the prior knowledge on linkage disequilibrium structure for marker identification under whole-genome association. PMID:21548809

Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.

PubMed

Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole

2017-08-01

Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.

RTEL1 and TERT polymorphisms are associated with astrocytoma risk in the Chinese Han population.

PubMed

Jin, Tian-Bo; Zhang, Jia-Yi; Li, Gang; Du, Shu-Li; Geng, Ting-Ting; Gao, Jing; Liu, Qian-Ping; Gao, Guo-Dong; Kang, Long-Li; Chen, Chao; Li, Shan-Qu

2013-12-01

Common variants of multiple genes play a role in glioma onset. However, research related to astrocytoma, the most common primary brain neoplasm, is rare. In this study, we chose 21 tagging SNPs (tSNPs), previously reported to be associated with glioma risk in a Chinese case-control study from Xi'an, China, and identified their contributions to astrocytoma susceptibility. We found an association with astrocytoma susceptibility for two tSNPs (rs6010620 and rs2853676) in two different genes: regulator of telomere elongation helicase 1 (RTEL1) and telomerase reverse transcriptase (TERT), respectively. We confirmed our results using recessive, dominant, and additive models. In the recessive model, we found two tSNPs (rs2297440 and rs6010620) associated with increased astrocytoma risk. In the dominant model, we found that rs2853676 was associated with increased astrocytoma risk. In the additive model, all three tSNPs (rs2297440, rs2853676, and rs6010620) were associated with increased astrocytoma risk. Our results demonstrate, for the first time, the potential roles of RTEL1 and TERT in astrocytoma development.

Regulatory element-based prediction identifies new susceptibility regulatory variants for osteoporosis.

PubMed

Yao, Shi; Guo, Yan; Dong, Shan-Shan; Hao, Ruo-Han; Chen, Xiao-Feng; Chen, Yi-Xiao; Chen, Jia-Bin; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

2017-08-01

Despite genome-wide association studies (GWASs) have identified many susceptibility genes for osteoporosis, it still leaves a large part of missing heritability to be discovered. Integrating regulatory information and GWASs could offer new insights into the biological link between the susceptibility SNPs and osteoporosis. We generated five machine learning classifiers with osteoporosis-associated variants and regulatory features data. We gained the optimal classifier and predicted genome-wide SNPs to discover susceptibility regulatory variants. We further utilized Genetic Factors for Osteoporosis Consortium (GEFOS) and three in-house GWASs samples to validate the associations for predicted positive SNPs. The random forest classifier performed best among all machine learning methods with the F1 score of 0.8871. Using the optimized model, we predicted 37,584 candidate SNPs for osteoporosis. According to the meta-analysis results, a list of regulatory variants was significantly associated with osteoporosis after multiple testing corrections and contributed to the expression of known osteoporosis-associated protein-coding genes. In summary, combining GWASs and regulatory elements through machine learning could provide additional information for understanding the mechanism of osteoporosis. The regulatory variants we predicted will provide novel targets for etiology research and treatment of osteoporosis.

Genome-wide interaction study of smoking behavior and non-small cell lung cancer risk in Caucasian population.

PubMed

Li, Yafang; Xiao, Xiangjun; Han, Younghun; Gorlova, Olga; Qian, David; Leighl, Natasha; Johansen, Jakob S; Barnett, Matt; Chen, Chu; Goodman, Gary; Cox, Angela; Taylor, Fiona; Woll, Penella; Wichmann, H-Erich; Manz, Judith; Muley, Thomas; Risch, Angela; Rosenberger, Albert; Arnold, Susanne M; Haura, Eric B; Bolca, Ciprian; Holcatova, Ivana; Janout, Vladimir; Kontic, Milica; Lissowska, Jolanta; Mukeria, Anush; Ognjanovic, Simona; Orlowski, Tadeusz M; Scelo, Ghislaine; Swiatkowska, Beata; Zaridze, David; Bakke, Per; Skaug, Vidar; Zienolddiny, Shanbeh; Duell, Eric J; Butler, Lesley M; Houlston, Richard; Soler Artigas, María; Grankvist, Kjell; Johansson, Mikael; Shepherd, Frances A; Marcus, Michael W; Brunnström, Hans; Manjer, Jonas; Melander, Olle; Muller, David C; Overvad, Kim; Trichopoulou, Antonia; Tumino, Rosario; Liu, Geoffrey; Bojesen, Stig E; Wu, Xifeng; Marchand, Loic Le; Albanes, Demetrios; Bickeböller, Heike; Aldrich, Melinda C; Bush, William S; Tardon, Adonina; Rennert, Gad; Teare, M Dawn; Field, John K; Kiemeney, Lambertus A; Lazarus, Philip; Haugen, Aage; Lam, Stephen; Schabath, Matthew B; Andrew, Angeline S; Bertazzi, Pier Alberto; Pesatori, Angela C; Christiani, David C; Caporaso, Neil; Johansson, Mattias; McKay, James D; Brennan, Paul; Hung, Rayjean J; Amos, Christopher I

2018-03-08

Non-small cell lung cancer is the most common type of lung cancer. Both environmental and genetic risk factors contribute to lung carcinogenesis. We conducted a genome-wide interaction analysis between single nucleotide polymorphisms (SNPs) and smoking status (never- versus ever-smokers) in a European-descent population. We adopted a two-step analysis strategy in the discovery stage: we first conducted a case-only interaction analysis to assess the relationship between SNPs and smoking behavior using 13336 non-small cell lung cancer cases. Candidate SNPs with P-value <0.001 were further analyzed using a standard case-control interaction analysis including 13970 controls. The significant SNPs with P-value <3.5 × 10-5 (correcting for multiple tests) from the case-control analysis in the discovery stage were further validated using an independent replication dataset comprising 5377 controls and 3054 non-small cell lung cancer cases. We further stratified the analysis by histological subtypes. Two novel SNPs, rs6441286 and rs17723637, were identified for overall lung cancer risk. The interaction odds ratio and meta-analysis P-value for these two SNPs were 1.24 with 6.96 × 10-7 and 1.37 with 3.49 × 10-7, respectively. In addition, interaction of smoking with rs4751674 was identified in squamous cell lung carcinoma with an odds ratio of 0.58 and P-value of 8.12 × 10-7. This study is by far the largest genome-wide SNP-smoking interaction analysis reported for lung cancer. The three identified novel SNPs provide potential candidate biomarkers for lung cancer risk screening and intervention. The results from our study reinforce that gene-smoking interactions play important roles in the etiology of lung cancer and account for part of the missing heritability of this disease.

IL2RA/CD25 Gene Polymorphisms: Uneven Association with Multiple Sclerosis (MS) and Type 1 Diabetes (T1D)

PubMed Central

Alcina, Antonio; Fedetz, María; Ndagire, Dorothy; Fernández, Oscar; Leyva, Laura; Guerrero, Miguel; Abad-Grau, María M.; Arnal, Carmen; Delgado, Concepción; Lucas, Miguel; Izquierdo, Guillermo; Matesanz, Fuencisla

2009-01-01

Background IL-2 receptor (IL2R) alpha is the specific component of the high affinity IL2R system involved in the immune response and in the control of autoimmunity. Methods and Results Here we perform a replication and fine mapping of the IL2RA gene region analyzing 3 SNPs previously associated with multiple sclerosis (MS) and 5 SNPs associated with type 1 diabetes (T1D) in a collection of 798 MS patients and 927 matched Caucasian controls from the south of Spain. We observed association with MS in 6 of 8 SNPs. The rs1570538, at the 3′- UTR extreme of the gene, previously reported to have a weak association with MS, is replicated here (P = 0.032). The most associated T1D SNP (rs41295061) was not associated with MS in the present study. However, the rs35285258, belonging to another independent group of SNPs associated with T1D, showed the maximal association in this study but different risk allele. We replicated the association of only one (rs2104286) of the two IL2RA SNPs identified in the recently performed genome-wide association study of MS. Conclusions These findings confirm and extend the association of this gene with MS and reveal a genetic heterogeneity of the associated polymorphisms and risk alleles between MS and T1D suggesting different immunopathological roles of IL2RA in these two diseases. PMID:19125193

DNA repair variants and breast cancer risk.

PubMed

Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

2016-05-01

A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P < 0.05), although no associations were observed for other DNA repair SNPs. Interactions of six SNPs in multiple DNA repair pathways with physical activity were evident prior to correction for FDR, following which there was support for only one of the interaction terms (P < 0.05). No consistent associations between variants in DNA repair genes and breast cancer risk or their modification by breast cancer risk factors were observed. © 2016 Wiley Periodicals, Inc.

GENOME-WIDE GENETIC INTERACTION ANALYSIS OF GLAUCOMA USING EXPERT KNOWLEDGE DERIVED FROM HUMAN PHENOTYPE NETWORKS

PubMed Central

HU, TING; DARABOS, CHRISTIAN; CRICCO, MARIA E.; KONG, EMILY; MOORE, JASON H.

2014-01-01

The large volume of GWAS data poses great computational challenges for analyzing genetic interactions associated with common human diseases. We propose a computational framework for characterizing epistatic interactions among large sets of genetic attributes in GWAS data. We build the human phenotype network (HPN) and focus around a disease of interest. In this study, we use the GLAUGEN glaucoma GWAS dataset and apply the HPN as a biological knowledge-based filter to prioritize genetic variants. Then, we use the statistical epistasis network (SEN) to identify a significant connected network of pairwise epistatic interactions among the prioritized SNPs. These clearly highlight the complex genetic basis of glaucoma. Furthermore, we identify key SNPs by quantifying structural network characteristics. Through functional annotation of these key SNPs using Biofilter, a software accessing multiple publicly available human genetic data sources, we find supporting biomedical evidences linking glaucoma to an array of genetic diseases, proving our concept. We conclude by suggesting hypotheses for a better understanding of the disease. PMID:25592582

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans

PubMed Central

Kwon, Ki-Sung; Cho, Hye-Young

2016-01-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2, rs887369 in CXorf21, rs9782955 in LYST, and rs3794060 in NADSYN1). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans. PMID:27729837

Recapitulation of Candidate Systemic Lupus Erythematosus-Associated Variants in Koreans.

PubMed

Kwon, Ki-Sung; Cho, Hye-Young; Chung, Yeun-Jun

2016-09-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease that affects multiple organ systems. Although the etiology of SLE remains unclear, it is widely accepted that genetic factors could be involved in its pathogenesis. A number of genome-wide association studies (GWASs) have identified novel single-nucleotide polymorphisms (SNPs) associated with the risk of SLE in diverse populations. However, not all the SNP candidates identified from non-Asian populations have been validated in Koreans. In this study, we aimed to replicate the SNPs that were recently discovered in the GWAS; these SNPs have not been validated in Koreans or have only been replicated in Koreans with an insufficient sample size to conclude any association. For this, we selected five SNPs (rs1801274 in FCGR2A and rs2286672 in PLD2 , rs887369 in CXorf21 , rs9782955 in LYST , and rs3794060 in NADSYN1 ). Through the replication study with 656 cases and 622 controls, rs1801274 in FCGR2A was found to be significantly associated with SLE in Koreans (odds ratio, 1.26, 95% confidence interval, 1.06 to 1.50; p = 0.01 in allelic model). This association was also significant in two other models (dominant and recessive). The other four SNPs did not show a significant association. Our data support that FCGR polymorphisms play important roles in the susceptibility to SLE in diverse populations, including Koreans.

Haplotype-based approach to known MS-associated regions increases the amount of explained risk

PubMed Central

Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S

2015-01-01

Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

Application of Multi-SNP Approaches Bayesian LASSO and AUC-RF to Detect Main Effects of Inflammatory-Gene Variants Associated with Bladder Cancer Risk

PubMed Central

Calle, M. Luz; Rothman, Nathaniel; Urrea, Víctor; Kogevinas, Manolis; Petrus, Sandra; Chanock, Stephen J.; Tardón, Adonina; García-Closas, Montserrat; González-Neira, Anna; Vellalta, Gemma; Carrato, Alfredo; Navarro, Arcadi; Lorente-Galdós, Belén; Silverman, Debra T.; Real, Francisco X.; Wu, Xifeng; Malats, Núria

2013-01-01

The relationship between inflammation and cancer is well established in several tumor types, including bladder cancer. We performed an association study between 886 inflammatory-gene variants and bladder cancer risk in 1,047 cases and 988 controls from the Spanish Bladder Cancer (SBC)/EPICURO Study. A preliminary exploration with the widely used univariate logistic regression approach did not identify any significant SNP after correcting for multiple testing. We further applied two more comprehensive methods to capture the complexity of bladder cancer genetic susceptibility: Bayesian Threshold LASSO (BTL), a regularized regression method, and AUC-Random Forest, a machine-learning algorithm. Both approaches explore the joint effect of markers. BTL analysis identified a signature of 37 SNPs in 34 genes showing an association with bladder cancer. AUC-RF detected an optimal predictive subset of 56 SNPs. 13 SNPs were identified by both methods in the total population. Using resources from the Texas Bladder Cancer study we were able to replicate 30% of the SNPs assessed. The associations between inflammatory SNPs and bladder cancer were reexamined among non-smokers to eliminate the effect of tobacco, one of the strongest and most prevalent environmental risk factor for this tumor. A 9 SNP-signature was detected by BTL. Here we report, for the first time, a set of SNP in inflammatory genes jointly associated with bladder cancer risk. These results highlight the importance of the complex structure of genetic susceptibility associated with cancer risk. PMID:24391818

The TERT gene harbors multiple variants associated with pancreatic cancer susceptibility

PubMed Central

Campa, Daniele; Rizzato, Cosmeri; Stolzenberg-Solomon, Rachael; Pacetti, Paola; Vodicka, Pavel; Cleary, Sean P.; Capurso, Gabriele; Bueno-de-Mesquita, H. Bas; Werner, Jens; Gazouli, Maria; Butterbach, Katja; Ivanauskas, Audrius; Giese, Nathalia; Petersen, Gloria M.; Fogar, Paola; Wang, Zhaoming; Bassi, Claudio; Ryska, Miroslav; Theodoropoulos, George E.; Kooperberg, Charles; Li, Donghui; Greenhalf, William; Pasquali, Claudio; Hackert, Thilo; Fuchs, Charles S.; Mohelnikova-Duchonova, Beatrice; Sperti, Cosimo; Funel, Niccola; Dieffenbach, Aida Karina; Wareham, Nicholas J.; Buring, Julie; Holcátová, Ivana; Costello, Eithne; Zambon, Carlo-Federico; Kupcinskas, Juozas; Risch, Harvey A.; Kraft, Peter; Bracci, Paige M.; Pezzilli, Raffaele; Olson, Sara H.; Sesso, Howard D.; Hartge, Patricia; Strobel, Oliver; Małecka-Panas, Ewa; Visvanathan, Kala; Arslan, Alan A.; Pedrazzoli, Sergio; Souček, Pavel; Gioffreda, Domenica; Key, Timothy J.; Talar-Wojnarowska, Renata; Scarpa, Aldo; Mambrini, Andrea; Jacobs, Eric J.; Jamroziak, Krzysztof; Klein, Alison; Tavano, Francesca; Bambi, Franco; Landi, Stefano; Austin, Melissa A.; Vodickova, Ludmila; Brenner, Hermann; Chanock, Stephen J.; Fave, Gianfranco Delle; Piepoli, Ada; Cantore, Maurizio; Zheng, Wei; Wolpin, Brian M.; Amundadottir, Laufey T.; Canzian, Federico

2015-01-01

A small number of common susceptibility loci have been identified for pancreatic cancer, one of which is marked by rs401681 in the TERT – CLPTM1L gene region on chr5p15.33. Since this region is characterized by low linkage disequilibrium (LD), we sought to identify additional SNPs could be related to pancreatic cancer risk, independently of rs401681. We performed an in-depth analysis of genetic variability of the telomerase reverse transcriptase (TERT) and the telomerase RNA component (TERC) genes, in 5,550 subjects with pancreatic cancer and 7,585 controls from the PANcreatic Disease ReseArch (PANDoRA) and the PanScan consortia. We identified a significant association between a variant in TERT and pancreatic cancer risk (rs2853677, OR=0.85; 95% CI=0.80–0.90, P=8.3×10−8). Additional analysis adjusting rs2853677 for rs401681 indicated that the two SNPs are independently associated with pancreatic cancer risk, as suggested by the low LD between them (r2=0.07, D´=0.28). Three additional SNPs in TERT reached statistical significance after correction for multiple testing: rs2736100 (P=3.0×10−5), rs4583925 (P=4.0×10−5) and rs2735948 (P=5.0×10−5). In conclusion, we confirmed that the TERT locus is associated with pancreatic cancer risk, possibly through several independent variants. PMID:25940397

Association of ALOX5AP with ischemic stroke: a population-based case-control study.

PubMed

Kaushal, Ritesh; Pal, Prodipto; Alwell, Kathleen; Haverbusch, Mary; Flaherty, Matthew; Moomaw, Charles; Sekar, Padmini; Kissela, Brett; Kleindorfer, Dawn; Chakraborty, Ranajit; Broderick, Joseph; Deka, Ranjan; Woo, Daniel

2007-06-01

Arachidonate 5-lipoxygenase activating protein (ALOX5AP) has been reported to demonstrate linkage and association with ischemic stroke and myocardial infarction. However, replication studies have been conflicting and to date, a significant proportion of blacks have not been studied. We prospectively recruited cases of ischemic stroke from all 16 hospitals in the Greater Cincinnati/Northern Kentucky region and demographically matched them to stroke-free population-based controls. Single nucleotide polymorphisms (SNPs) were selected based on association with ischemic stroke in prior studies. Allelic, genotypic and haplotypic association testing was performed using HAPLOVIEW. Multiple logistic regression was used to control for the presence of traditional risk factors including hypertension, diabetes, hypercholesterolemia and smoking. A total of 357 cases and 482 controls were genotyped. The SNPs, rs9579646 and rs4769874 were found to be significantly associated at both allelic (P=0.019 and P<10(-4), respectively) and genotypic level with ischemic stroke among whites after correction for multiple testing. Haplotype association was identified with ischemic stroke as well as ischemic stroke subtypes among whites. Although an overall haplotype association with ischemic stroke was identified among blacks no evidence of association among individual haplotypes, alleles or genotypes were observed. Allele frequencies for the SNPs examined were markedly different among whites and blacks. In conclusion, we report significant association of variants of ALOX5AP with ischemic stroke and ischemic stroke subtypes among whites. No significant association was identified among blacks.

Identification of an Interaction between VWF rs7965413 and Platelet Count as a Novel Risk Marker for Metabolic Syndrome: An Extensive Search of Candidate Polymorphisms in a Case-Control Study

PubMed Central

Nakatochi, Masahiro; Ushida, Yasunori; Yasuda, Yoshinari; Yoshida, Yasuko; Kawai, Shun; Kato, Ryuji; Nakashima, Toru; Iwata, Masamitsu; Kuwatsuka, Yachiyo; Ando, Masahiko; Hamajima, Nobuyuki; Kondo, Takaaki; Oda, Hiroaki; Hayashi, Mutsuharu; Kato, Sawako; Yamaguchi, Makoto; Maruyama, Shoichi; Matsuo, Seiichi; Honda, Hiroyuki

2015-01-01

Although many single nucleotide polymorphisms (SNPs) have been identified to be associated with metabolic syndrome (MetS), there was only a slight improvement in the ability to predict future MetS by the simply addition of SNPs to clinical risk markers. To improve the ability to predict future MetS, combinational effects, such as SNP—SNP interaction, SNP—environment interaction, and SNP—clinical parameter (SNP × CP) interaction should be also considered. We performed a case-control study to explore novel SNP × CP interactions as risk markers for MetS based on health check-up data of Japanese male employees. We selected 99 SNPs that were previously reported to be associated with MetS and components of MetS; subsequently, we genotyped these SNPs from 360 cases and 1983 control subjects. First, we performed logistic regression analyses to assess the association of each SNP with MetS. Of these SNPs, five SNPs were significantly associated with MetS (P < 0.05): LRP2 rs2544390, rs1800592 between UCP1 and TBC1D9, APOA5 rs662799, VWF rs7965413, and rs1411766 between MYO16 and IRS2. Furthermore, we performed multiple logistic regression analyses, including an SNP term, a CP term, and an SNP × CP interaction term for each CP and SNP that was significantly associated with MetS. We identified a novel SNP × CP interaction between rs7965413 and platelet count that was significantly associated with MetS [SNP term: odds ratio (OR) = 0.78, P = 0.004; SNP × CP interaction term: OR = 1.33, P = 0.001]. This association of the SNP × CP interaction with MetS remained nominally significant in multiple logistic regression analysis after adjustment for either the number of MetS components or MetS components excluding obesity. Our results reveal new insight into platelet count as a risk marker for MetS. PMID:25646961

Identification of an interaction between VWF rs7965413 and platelet count as a novel risk marker for metabolic syndrome: an extensive search of candidate polymorphisms in a case-control study.

PubMed

Nakatochi, Masahiro; Ushida, Yasunori; Yasuda, Yoshinari; Yoshida, Yasuko; Kawai, Shun; Kato, Ryuji; Nakashima, Toru; Iwata, Masamitsu; Kuwatsuka, Yachiyo; Ando, Masahiko; Hamajima, Nobuyuki; Kondo, Takaaki; Oda, Hiroaki; Hayashi, Mutsuharu; Kato, Sawako; Yamaguchi, Makoto; Maruyama, Shoichi; Matsuo, Seiichi; Honda, Hiroyuki

2015-01-01

Although many single nucleotide polymorphisms (SNPs) have been identified to be associated with metabolic syndrome (MetS), there was only a slight improvement in the ability to predict future MetS by the simply addition of SNPs to clinical risk markers. To improve the ability to predict future MetS, combinational effects, such as SNP-SNP interaction, SNP-environment interaction, and SNP-clinical parameter (SNP × CP) interaction should be also considered. We performed a case-control study to explore novel SNP × CP interactions as risk markers for MetS based on health check-up data of Japanese male employees. We selected 99 SNPs that were previously reported to be associated with MetS and components of MetS; subsequently, we genotyped these SNPs from 360 cases and 1983 control subjects. First, we performed logistic regression analyses to assess the association of each SNP with MetS. Of these SNPs, five SNPs were significantly associated with MetS (P < 0.05): LRP2 rs2544390, rs1800592 between UCP1 and TBC1D9, APOA5 rs662799, VWF rs7965413, and rs1411766 between MYO16 and IRS2. Furthermore, we performed multiple logistic regression analyses, including an SNP term, a CP term, and an SNP × CP interaction term for each CP and SNP that was significantly associated with MetS. We identified a novel SNP × CP interaction between rs7965413 and platelet count that was significantly associated with MetS [SNP term: odds ratio (OR) = 0.78, P = 0.004; SNP × CP interaction term: OR = 1.33, P = 0.001]. This association of the SNP × CP interaction with MetS remained nominally significant in multiple logistic regression analysis after adjustment for either the number of MetS components or MetS components excluding obesity. Our results reveal new insight into platelet count as a risk marker for MetS.

Genome-wide association study of coronary and aortic calcification in lung cancer screening CT

NASA Astrophysics Data System (ADS)

de Vos, Bob D.; van Setten, Jessica; de Jong, Pim A.; Mali, Willem P.; Oudkerk, Matthijs; Viergever, Max A.; Išgum, Ivana

2016-03-01

Arterial calcification has been related to cardiovascular disease (CVD) and osteoporosis. However, little is known about the role of genetics and exact pathways leading to arterial calcification and its relation to bone density changes indicating osteoporosis. In this study, we conducted a genome-wide association study of arterial calcification burden, followed by a look-up of known single nucleotide polymorphisms (SNPs) for coronary artery disease (CAD) and myocardial infarction (MI), and bone mineral density (BMD) to test for a shared genetic basis between the traits. The study included a subcohort of the Dutch-Belgian lung cancer screening trial comprised of 2,561 participants. Participants underwent baseline CT screening in one of two hospitals participating in the trial. Low-dose chest CT images were acquired without contrast enhancement and without ECG-synchronization. In these images coronary and aortic calcifications were identified automatically. Subsequently, the detected calcifications were quantified using coronary artery calcium Agatston and volume scores. Genotype data was available for these participants. A genome-wide association study was conducted on 10,220,814 SNPs using a linear regression model. To reduce multiple testing burden, known CAD/MI and BMD SNPs were specifically tested (45 SNPs from the CARDIoGRAMplusC4D consortium and 60 SNPS from the GEFOS consortium). No novel significant SNPs were found. Significant enrichment for CAD/MI SNPs was observed in testing Agatston and coronary artery calcium volume scores. Moreover, a significant enrichment of BMD SNPs was shown in aortic calcium volume scores. This may indicate genetic relation of BMD SNPs and arterial calcification burden.

Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

PubMed

Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

2017-08-01

Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

A SNP resource for Douglas-fir: de novo transcriptome assembly and SNP detection and validation.

PubMed

Howe, Glenn T; Yu, Jianbin; Knaus, Brian; Cronn, Richard; Kolpak, Scott; Dolan, Peter; Lorenz, W Walter; Dean, Jeffrey F D

2013-02-28

Douglas-fir (Pseudotsuga menziesii), one of the most economically and ecologically important tree species in the world, also has one of the largest tree breeding programs. Although the coastal and interior varieties of Douglas-fir (vars. menziesii and glauca) are native to North America, the coastal variety is also widely planted for timber production in Europe, New Zealand, Australia, and Chile. Our main goal was to develop a SNP resource large enough to facilitate genomic selection in Douglas-fir breeding programs. To accomplish this, we developed a 454-based reference transcriptome for coastal Douglas-fir, annotated and evaluated the quality of the reference, identified putative SNPs, and then validated a sample of those SNPs using the Illumina Infinium genotyping platform. We assembled a reference transcriptome consisting of 25,002 isogroups (unique gene models) and 102,623 singletons from 2.76 million 454 and Sanger cDNA sequences from coastal Douglas-fir. We identified 278,979 unique SNPs by mapping the 454 and Sanger sequences to the reference, and by mapping four datasets of Illumina cDNA sequences from multiple seed sources, genotypes, and tissues. The Illumina datasets represented coastal Douglas-fir (64.00 and 13.41 million reads), interior Douglas-fir (80.45 million reads), and a Yakima population similar to interior Douglas-fir (8.99 million reads). We assayed 8067 SNPs on 260 trees using an Illumina Infinium SNP genotyping array. Of these SNPs, 5847 (72.5%) were called successfully and were polymorphic. Based on our validation efficiency, our SNP database may contain as many as ~200,000 true SNPs, and as many as ~69,000 SNPs that could be genotyped at ~20,000 gene loci using an Infinium II array-more SNPs than are needed to use genomic selection in tree breeding programs. Ultimately, these genomic resources will enhance Douglas-fir breeding and allow us to better understand landscape-scale patterns of genetic variation and potential responses to climate change.

A SNP resource for Douglas-fir: de novo transcriptome assembly and SNP detection and validation

PubMed Central

2013-01-01

Background Douglas-fir (Pseudotsuga menziesii), one of the most economically and ecologically important tree species in the world, also has one of the largest tree breeding programs. Although the coastal and interior varieties of Douglas-fir (vars. menziesii and glauca) are native to North America, the coastal variety is also widely planted for timber production in Europe, New Zealand, Australia, and Chile. Our main goal was to develop a SNP resource large enough to facilitate genomic selection in Douglas-fir breeding programs. To accomplish this, we developed a 454-based reference transcriptome for coastal Douglas-fir, annotated and evaluated the quality of the reference, identified putative SNPs, and then validated a sample of those SNPs using the Illumina Infinium genotyping platform. Results We assembled a reference transcriptome consisting of 25,002 isogroups (unique gene models) and 102,623 singletons from 2.76 million 454 and Sanger cDNA sequences from coastal Douglas-fir. We identified 278,979 unique SNPs by mapping the 454 and Sanger sequences to the reference, and by mapping four datasets of Illumina cDNA sequences from multiple seed sources, genotypes, and tissues. The Illumina datasets represented coastal Douglas-fir (64.00 and 13.41 million reads), interior Douglas-fir (80.45 million reads), and a Yakima population similar to interior Douglas-fir (8.99 million reads). We assayed 8067 SNPs on 260 trees using an Illumina Infinium SNP genotyping array. Of these SNPs, 5847 (72.5%) were called successfully and were polymorphic. Conclusions Based on our validation efficiency, our SNP database may contain as many as ~200,000 true SNPs, and as many as ~69,000 SNPs that could be genotyped at ~20,000 gene loci using an Infinium II array—more SNPs than are needed to use genomic selection in tree breeding programs. Ultimately, these genomic resources will enhance Douglas-fir breeding and allow us to better understand landscape-scale patterns of genetic variation and potential responses to climate change. PMID:23445355

Common variants associated with breast cancer in genome-wide association studies are modifiers of breast cancer risk in BRCA1 and BRCA2 mutation carriers.

PubMed

Wang, Xianshu; Pankratz, V Shane; Fredericksen, Zachary; Tarrell, Robert; Karaus, Mary; McGuffog, Lesley; Pharaoh, Paul D P; Ponder, Bruce A J; Dunning, Alison M; Peock, Susan; Cook, Margaret; Oliver, Clare; Frost, Debra; Sinilnikova, Olga M; Stoppa-Lyonnet, Dominique; Mazoyer, Sylvie; Houdayer, Claude; Hogervorst, Frans B L; Hooning, Maartje J; Ligtenberg, Marjolijn J; Spurdle, Amanda; Chenevix-Trench, Georgia; Schmutzler, Rita K; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Domchek, Susan M; Nathanson, Katherine L; Rebbeck, Timothy R; Singer, Christian F; Gschwantler-Kaulich, Daphne; Dressler, Catherina; Fink, Anneliese; Szabo, Csilla I; Zikan, Michal; Foretova, Lenka; Claes, Kathleen; Thomas, Gilles; Hoover, Robert N; Hunter, David J; Chanock, Stephen J; Easton, Douglas F; Antoniou, Antonis C; Couch, Fergus J

2010-07-15

Recent studies have identified single nucleotide polymorphisms (SNPs) that significantly modify breast cancer risk in BRCA1 and BRCA2 mutation carriers. Since these risk modifiers were originally identified as genetic risk factors for breast cancer in genome-wide association studies (GWASs), additional risk modifiers for BRCA1 and BRCA2 may be identified from promising signals discovered in breast cancer GWAS. A total of 350 SNPs identified as candidate breast cancer risk factors (P < 1 x 10(-3)) in two breast cancer GWAS studies were genotyped in 3451 BRCA1 and 2006 BRCA2 mutation carriers from nine centers. Associations with breast cancer risk were assessed using Cox models weighted for penetrance. Eight SNPs in BRCA1 carriers and 12 SNPs in BRCA2 carriers, representing an enrichment over the number expected, were significantly associated with breast cancer risk (P(trend) < 0.01). The minor alleles of rs6138178 in SNRPB and rs6602595 in CAMK1D displayed the strongest associations in BRCA1 carriers (HR = 0.78, 95% CI: 0.69-0.90, P(trend) = 3.6 x 10(-4) and HR = 1.25, 95% CI: 1.10-1.41, P(trend) = 4.2 x 10(-4)), whereas rs9393597 in LOC134997 and rs12652447 in FBXL7 showed the strongest associations in BRCA2 carriers (HR = 1.55, 95% CI: 1.25-1.92, P(trend) = 6 x 10(-5) and HR = 1.37, 95% CI: 1.16-1.62, P(trend) = 1.7 x 10(-4)). The magnitude and direction of the associations were consistent with the original GWAS. In subsequent risk assessment studies, the loci appeared to interact multiplicatively for breast cancer risk in BRCA1 and BRCA2 carriers. Promising candidate SNPs from GWAS were identified as modifiers of breast cancer risk in BRCA1 and BRCA2 carriers. Upon further validation, these SNPs together with other genetic and environmental factors may improve breast cancer risk assessment in these populations.

SNP discovery by high-throughput sequencing in soybean

PubMed Central

2010-01-01

Background With the advance of new massively parallel genotyping technologies, quantitative trait loci (QTL) fine mapping and map-based cloning become more achievable in identifying genes for important and complex traits. Development of high-density genetic markers in the QTL regions of specific mapping populations is essential for fine-mapping and map-based cloning of economically important genes. Single nucleotide polymorphisms (SNPs) are the most abundant form of genetic variation existing between any diverse genotypes that are usually used for QTL mapping studies. The massively parallel sequencing technologies (Roche GS/454, Illumina GA/Solexa, and ABI/SOLiD), have been widely applied to identify genome-wide sequence variations. However, it is still remains unclear whether sequence data at a low sequencing depth are enough to detect the variations existing in any QTL regions of interest in a crop genome, and how to prepare sequencing samples for a complex genome such as soybean. Therefore, with the aims of identifying SNP markers in a cost effective way for fine-mapping several QTL regions, and testing the validation rate of the putative SNPs predicted with Solexa short sequence reads at a low sequencing depth, we evaluated a pooled DNA fragment reduced representation library and SNP detection methods applied to short read sequences generated by Solexa high-throughput sequencing technology. Results A total of 39,022 putative SNPs were identified by the Illumina/Solexa sequencing system using a reduced representation DNA library of two parental lines of a mapping population. The validation rates of these putative SNPs predicted with low and high stringency were 72% and 85%, respectively. One hundred sixty four SNP markers resulted from the validation of putative SNPs and have been selectively chosen to target a known QTL, thereby increasing the marker density of the targeted region to one marker per 42 K bp. Conclusions We have demonstrated how to quickly identify large numbers of SNPs for fine mapping of QTL regions by applying massively parallel sequencing combined with genome complexity reduction techniques. This SNP discovery approach is more efficient for targeting multiple QTL regions in a same genetic population, which can be applied to other crops. PMID:20701770

The OncoArray Consortium: A Network for Understanding the Genetic Architecture of Common Cancers.

PubMed

Amos, Christopher I; Dennis, Joe; Wang, Zhaoming; Byun, Jinyoung; Schumacher, Fredrick R; Gayther, Simon A; Casey, Graham; Hunter, David J; Sellers, Thomas A; Gruber, Stephen B; Dunning, Alison M; Michailidou, Kyriaki; Fachal, Laura; Doheny, Kimberly; Spurdle, Amanda B; Li, Yafang; Xiao, Xiangjun; Romm, Jane; Pugh, Elizabeth; Coetzee, Gerhard A; Hazelett, Dennis J; Bojesen, Stig E; Caga-Anan, Charlisse; Haiman, Christopher A; Kamal, Ahsan; Luccarini, Craig; Tessier, Daniel; Vincent, Daniel; Bacot, François; Van Den Berg, David J; Nelson, Stefanie; Demetriades, Stephen; Goldgar, David E; Couch, Fergus J; Forman, Judith L; Giles, Graham G; Conti, David V; Bickeböller, Heike; Risch, Angela; Waldenberger, Melanie; Brüske-Hohlfeld, Irene; Hicks, Belynda D; Ling, Hua; McGuffog, Lesley; Lee, Andrew; Kuchenbaecker, Karoline; Soucy, Penny; Manz, Judith; Cunningham, Julie M; Butterbach, Katja; Kote-Jarai, Zsofia; Kraft, Peter; FitzGerald, Liesel; Lindström, Sara; Adams, Marcia; McKay, James D; Phelan, Catherine M; Benlloch, Sara; Kelemen, Linda E; Brennan, Paul; Riggan, Marjorie; O'Mara, Tracy A; Shen, Hongbing; Shi, Yongyong; Thompson, Deborah J; Goodman, Marc T; Nielsen, Sune F; Berchuck, Andrew; Laboissiere, Sylvie; Schmit, Stephanie L; Shelford, Tameka; Edlund, Christopher K; Taylor, Jack A; Field, John K; Park, Sue K; Offit, Kenneth; Thomassen, Mads; Schmutzler, Rita; Ottini, Laura; Hung, Rayjean J; Marchini, Jonathan; Amin Al Olama, Ali; Peters, Ulrike; Eeles, Rosalind A; Seldin, Michael F; Gillanders, Elizabeth; Seminara, Daniela; Antoniou, Antonis C; Pharoah, Paul D P; Chenevix-Trench, Georgia; Chanock, Stephen J; Simard, Jacques; Easton, Douglas F

2017-01-01

Common cancers develop through a multistep process often including inherited susceptibility. Collaboration among multiple institutions, and funding from multiple sources, has allowed the development of an inexpensive genotyping microarray, the OncoArray. The array includes a genome-wide backbone, comprising 230,000 SNPs tagging most common genetic variants, together with dense mapping of known susceptibility regions, rare variants from sequencing experiments, pharmacogenetic markers, and cancer-related traits. The OncoArray can be genotyped using a novel technology developed by Illumina to facilitate efficient genotyping. The consortium developed standard approaches for selecting SNPs for study, for quality control of markers, and for ancestry analysis. The array was genotyped at selected sites and with prespecified replicate samples to permit evaluation of genotyping accuracy among centers and by ethnic background. The OncoArray consortium genotyped 447,705 samples. A total of 494,763 SNPs passed quality control steps with a sample success rate of 97% of the samples. Participating sites performed ancestry analysis using a common set of markers and a scoring algorithm based on principal components analysis. Results from these analyses will enable researchers to identify new susceptibility loci, perform fine-mapping of new or known loci associated with either single or multiple cancers, assess the degree of overlap in cancer causation and pleiotropic effects of loci that have been identified for disease-specific risk, and jointly model genetic, environmental, and lifestyle-related exposures. Ongoing analyses will shed light on etiology and risk assessment for many types of cancer. Cancer Epidemiol Biomarkers Prev; 26(1); 126-35. ©2016 AACR. ©2016 American Association for Cancer Research.

The OncoArray Consortium: a Network for Understanding the Genetic Architecture of Common Cancers

PubMed Central

Amos, Christopher I.; Dennis, Joe; Wang, Zhaoming; Byun, Jinyoung; Schumacher, Fredrick R.; Gayther, Simon A.; Casey, Graham; Hunter, David J.; Sellers, Thomas A.; Gruber, Stephen B.; Dunning, Alison M.; Michailidou, Kyriaki; Fachal, Laura; Doheny, Kimberly; Spurdle, Amanda B.; Li, Yafang; Xiao, Xiangjun; Romm, Jane; Pugh, Elizabeth; Coetzee, Gerhard A.; Hazelett, Dennis J.; Bojesen, Stig E.; Caga-Anan, Charlisse; Haiman, Christopher A.; Kamal, Ahsan; Luccarini, Craig; Tessier, Daniel; Vincent, Daniel; Bacot, François; Van Den Berg, David J.; Nelson, Stefanie; Demetriades, Stephen; Goldgar, David E.; Couch, Fergus J.; Forman, Judith L.; Giles, Graham G.; Conti, David V.; Bickeböller, Heike; Risch, Angela; Waldenberger, Melanie; Brüske, Irene; Hicks, Belynda D.; Ling, Hua; McGuffog, Lesley; Lee, Andrew; Kuchenbaecker, Karoline B.; Soucy, Penny; Manz, Judith; Cunningham, Julie M.; Butterbach, Katja; Kote-Jarai, Zsofia; Kraft, Peter; FitzGerald, Liesel M.; Lindström, Sara; Adams, Marcia; McKay, James D.; Phelan, Catherine M.; Benlloch, Sara; Kelemen, Linda E.; Brennan, Paul; Riggan, Marjorie; O’Mara, Tracy A.; Shen, Hongbin; Shi, Yongyong; Thompson, Deborah J.; Goodman, Marc T.; Nielsen, Sune F.; Berchuck, Andrew; Laboissiere, Sylvie; Schmit, Stephanie L.; Shelford, Tameka; Edlund, Christopher K.; Taylor, Jack A.; Field, John K.; Park, Sue K.; Offit, Kenneth; Thomassen, Mads; Schmutzler, Rita; Ottini, Laura; Hung, Rayjean J.; Marchini, Jonathan; Al Olama, Ali Amin; Peters, Ulrike; Eeles, Rosalind A.; Seldin, Michael F.; Gillanders, Elizabeth; Seminara, Daniela; Antoniou, Antonis C.; Pharoah, Paul D.; Chenevix-Trench, Georgia; Chanock, Stephen J.; Simard, Jacques; Easton, Douglas F.

2016-01-01

Background Common cancers develop through a multistep process often including inherited susceptibility. Collaboration among multiple institutions, and funding from multiple sources, has allowed the development of an inexpensive genotyping microarray, the OncoArray. The array includes a genome-wide backbone, comprising 230,000 SNPs tagging most common genetic variants, together with dense mapping of known susceptibility regions, rare variants from sequencing experiments, pharmacogenetic markers and cancer related traits. Methods The OncoArray can be genotyped using a novel technology developed by Illumina to facilitate efficient genotyping. The consortium developed standard approaches for selecting SNPs for study, for quality control of markers and for ancestry analysis. The array was genotyped at selected sites and with prespecified replicate samples to permit evaluation of genotyping accuracy among centers and by ethnic background. Results The OncoArray consortium genotyped 447,705 samples. A total of 494,763 SNPs passed quality control steps with a sample success rate of 97% of the samples. Participating sites performed ancestry analysis using a common set of markers and a scoring algorithm based on principal components analysis. Conclusions Results from these analyses will enable researchers to identify new susceptibility loci, perform fine mapping of new or known loci associated with either single or multiple cancers, assess the degree of overlap in cancer causation and pleiotropic effects of loci that have been identified for disease-specific risk, and jointly model genetic, environmental and lifestyle related exposures. Impact Ongoing analyses will shed light on etiology and risk assessment for many types of cancer. PMID:27697780

Meta-analysis of genome-wide studies identifies WNT16 and ESR1 SNPs associated with bone mineral density in premenopausal women.

PubMed

Koller, Daniel L; Zheng, Hou-Feng; Karasik, David; Yerges-Armstrong, Laura; Liu, Ching-Ti; McGuigan, Fiona; Kemp, John P; Giroux, Sylvie; Lai, Dongbing; Edenberg, Howard J; Peacock, Munro; Czerwinski, Stefan A; Choh, Audrey C; McMahon, George; St Pourcain, Beate; Timpson, Nicholas J; Lawlor, Debbie A; Evans, David M; Towne, Bradford; Blangero, John; Carless, Melanie A; Kammerer, Candace; Goltzman, David; Kovacs, Christopher S; Prior, Jerilynn C; Spector, Tim D; Rousseau, Francois; Tobias, Jon H; Akesson, Kristina; Econs, Michael J; Mitchell, Braxton D; Richards, J Brent; Kiel, Douglas P; Foroud, Tatiana

2013-03-01

Previous genome-wide association studies (GWAS) have identified common variants in genes associated with variation in bone mineral density (BMD), although most have been carried out in combined samples of older women and men. Meta-analyses of these results have identified numerous single-nucleotide polymorphisms (SNPs) of modest effect at genome-wide significance levels in genes involved in both bone formation and resorption, as well as other pathways. We performed a meta-analysis restricted to premenopausal white women from four cohorts (n = 4061 women, aged 20 to 45 years) to identify genes influencing peak bone mass at the lumbar spine and femoral neck. After imputation, age- and weight-adjusted bone-mineral density (BMD) values were tested for association with each SNP. Association of an SNP in the WNT16 gene (rs3801387; p = 1.7 × 10(-9) ) and multiple SNPs in the ESR1/C6orf97 region (rs4870044; p = 1.3 × 10(-8) ) achieved genome-wide significance levels for lumbar spine BMD. These SNPs, along with others demonstrating suggestive evidence of association, were then tested for association in seven replication cohorts that included premenopausal women of European, Hispanic-American, and African-American descent (combined n = 5597 for femoral neck; n = 4744 for lumbar spine). When the data from the discovery and replication cohorts were analyzed jointly, the evidence was more significant (WNT16 joint p = 1.3 × 10(-11) ; ESR1/C6orf97 joint p = 1.4 × 10(-10) ). Multiple independent association signals were observed with spine BMD at the ESR1 region after conditioning on the primary signal. Analyses of femoral neck BMD also supported association with SNPs in WNT16 and ESR1/C6orf97 (p < 1 × 10(-5) ). Our results confirm that several of the genes contributing to BMD variation across a broad age range in both sexes have effects of similar magnitude on BMD of the spine in premenopausal women. These data support the hypothesis that variants in these genes of known skeletal function also affect BMD during the premenopausal period. Copyright © 2013 American Society for Bone and Mineral Research.

Influence of SNPs in nutrient-sensitive candidate genes and gene-diet interactions on blood lipids: the DiOGenes study.

PubMed

Brahe, Lena K; Ängquist, Lars; Larsen, Lesli H; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Hlavaty, Petr; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild I A; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

2013-09-14

Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile after weight loss and in response to a given diet, among overweight European adults participating in the Diet Obesity and Genes study. By multiple linear regressions, 240 SNPs in twenty-four candidate genes were investigated for SNP main and SNP-diet interaction effects on total cholesterol, LDL-cholesterol, HDL-cholesterol and TAG after an 8-week low-energy diet (only main effect) ,and a 6-month ad libitum weight maintenance diet, with different contents of dietary protein or glycaemic index. After adjusting for multiple testing, a SNP-dietary protein interaction effect on TAG was identified for lipin 1 (LPIN1) rs4315495, with a decrease in TAG of 20.26 mmol/l per A-allele/protein unit (95% CI 20.38, 20.14, P=0.000043). In conclusion, we investigated SNP-diet interactions for blood lipid profiles for 240 SNPs in twenty-four candidate genes, selected for their involvement in lipid metabolism pathways, and identified one significant interaction between LPIN1 rs4315495 and dietary protein for TAG concentration.

PRKCA: A Positional Candidate Gene for Body Mass Index and Asthma

PubMed Central

Murphy, Amy; Tantisira, Kelan G.; Soto-Quirós, Manuel E.; Avila, Lydiana; Klanderman, Barbara J.; Lake, Stephen; Weiss, Scott T.; Celedón, Juan C.

2009-01-01

Asthma incidence and prevalence are higher in obese individuals. A potential mechanistic basis for this relationship is pleiotropy. We hypothesized that significant linkage and candidate-gene association would be found for body mass index (BMI) in a population ascertained on asthma affection status. Linkage analysis for BMI was performed on 657 subjects in eight Costa Rican families enrolled in a study of asthma. Family-based association studies were conducted for BMI with SNPs within a positional candidate gene, PRKCA. SNPs within PRKCA were also tested for association with asthma. Association studies were conducted in 415 Costa Rican parent-child trios and 493 trios participating in the Childhood Asthma Management Program (CAMP). Although only modest evidence of linkage for BMI was obtained for the whole cohort, significant linkage was noted for BMI in females on chromosome 17q (peak LOD = 3.39). Four SNPs in a candidate gene in this region (PRKCA) had unadjusted association p values < 0.05 for BMI in both cohorts, with the joint p value for two SNPs remaining significant after adjustment for multiple comparisons (rs228883 and rs1005651, joint p values = 9.5 × 10−5 and 5.6 × 10−5). Similarly, eight SNPs had unadjusted association p values < 0.05 for asthma in both populations, with one SNP remaining significant after adjustment for multiple comparisons (rs11079657, joint p value = 2.6 × 10−5). PRKCA is a pleiotropic locus that is associated with both BMI and asthma and that has been identified via linkage analysis of BMI in a population ascertained on asthma. PMID:19576566

Genetic variants associated with fasting glucose and insulin concentrations in an ethnically diverse population: results from the Population Architecture using Genomics and Epidemiology (PAGE) study.

PubMed

Fesinmeyer, Megan D; Meigs, James B; North, Kari E; Schumacher, Fredrick R; Bůžková, Petra; Franceschini, Nora; Haessler, Jeffrey; Goodloe, Robert; Spencer, Kylee L; Voruganti, Venkata Saroja; Howard, Barbara V; Jackson, Rebecca; Kolonel, Laurence N; Liu, Simin; Manson, JoAnn E; Monroe, Kristine R; Mukamal, Kenneth; Dilks, Holli H; Pendergrass, Sarah A; Nato, Andrew; Wan, Peggy; Wilkens, Lynne R; Le Marchand, Loic; Ambite, José Luis; Buyske, Steven; Florez, Jose C; Crawford, Dana C; Hindorff, Lucia A; Haiman, Christopher A; Peters, Ulrike; Pankow, James S

2013-09-25

Multiple genome-wide association studies (GWAS) within European populations have implicated common genetic variants associated with insulin and glucose concentrations. In contrast, few studies have been conducted within minority groups, which carry the highest burden of impaired glucose homeostasis and type 2 diabetes in the U.S. As part of the 'Population Architecture using Genomics and Epidemiology (PAGE) Consortium, we investigated the association of up to 10 GWAS-identified single nucleotide polymorphisms (SNPs) in 8 genetic regions with glucose or insulin concentrations in up to 36,579 non-diabetic subjects including 23,323 European Americans (EA) and 7,526 African Americans (AA), 3,140 Hispanics, 1,779 American Indians (AI), and 811 Asians. We estimated the association between each SNP and fasting glucose or log-transformed fasting insulin, followed by meta-analysis to combine results across PAGE sites. Overall, our results show that 9/9 GWAS SNPs are associated with glucose in EA (p = 0.04 to 9 × 10-15), versus 3/9 in AA (p= 0.03 to 6 × 10-5), 3/4 SNPs in Hispanics, 2/4 SNPs in AI, and 1/2 SNPs in Asians. For insulin we observed a significant association with rs780094/GCKR in EA, Hispanics and AI only. Generalization of results across multiple racial/ethnic groups helps confirm the relevance of some of these loci for glucose and insulin metabolism. Lack of association in non-EA groups may be due to insufficient power, or to unique patterns of linkage disequilibrium.

Genetic Modifiers of Patent Ductus Arteriosus in Term Infants.

PubMed

Patel, Priti M; Momany, Allison M; Schaa, Kendra L; Romitti, Paul A; Druschel, Charlotte; Cooper, Margaret E; Marazita, Mary L; Murray, Jeffrey C; Dagle, John M

2016-09-01

To identify single-nucleotide polymorphisms (SNPs) in specific candidate genes associated with patent ductus arteriosus in term infants. We conducted an initial family-based, candidate gene study to analyze genotype data from DNA samples obtained from 171 term infants and their parents enrolled in the National Birth Defects Prevention Study (NBDPS). We performed transmission disequilibrium testing (TDT) using a panel of 55 SNPs in 17 genes. Replication of SNPs with P < .1 in the NBDPS trios was performed with a case-control strategy in an independent population. TDT analysis of the NBDPS trios resulted in 6 SNPs reaching the predetermined cutoff (P < .1) to be included in the replication study. These 6 SNPs were genotyped in the independent case-control population. A SNP in TGFBR2 was found to be associated with term patent ductus arteriosus in both populations after we corrected for multiple comparisons. (rs934328, TDT P = 2 × 10(-4), case-control P = 6.6 × 10(-5)). These findings confirm the importance of the transforming growth factor-beta pathway in the closure of the term ductus arteriosus and may suggest new therapeutic targets. Published by Elsevier Inc.

Common genetic determinants of breast-cancer risk in East Asian women: a collaborative study of 23 637 breast cancer cases and 25 579 controls

PubMed Central

Zheng, Wei; Zhang, Ben; Cai, Qiuyin; Sung, Hyuna; Michailidou, Kyriaki; Shi, Jiajun; Choi, Ji-Yeob; Long, Jirong; Dennis, Joe; Humphreys, Manjeet K.; Wang, Qin; Lu, Wei; Gao, Yu-Tang; Li, Chun; Cai, Hui; Park, Sue K.; Yoo, Keun-Young; Noh, Dong-Young; Han, Wonshik; Dunning, Alison M.; Benitez, Javier; Vincent, Daniel; Bacot, Francois; Tessier, Daniel; Kim, Sung-Won; Lee, Min Hyuk; Lee, Jong Won; Lee, Jong-Young; Xiang, Yong-Bing; Zheng, Ying; Wang, Wenjin; Ji, Bu-Tian; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tanaka, Hideo; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Teo, Soo Hwang; Yip, Cheng Har; Kang, In Nee; Wong, Tien Y.; Shen, Chen-Yang; Yu, Jyh-Cherng; Huang, Chiun-Sheng; Hou, Ming-Feng; Hartman, Mikael; Miao, Hui; Lee, Soo Chin; Putti, Thomas Choudary; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Sangrajrang, Suleeporn; Shen, Hongbing; Chen, Kexin; Wu, Pei-Ei; Ren, Zefang; Haiman, Christopher A.; Sueta, Aiko; Kim, Mi Kyung; Khoo, Ui Soon; Iwasaki, Motoki; Pharoah, Paul D.P.; Wen, Wanqing; Hall, Per; Shu, Xiao-Ou; Easton, Douglas F.; Kang, Daehee

2013-01-01

In a consortium including 23 637 breast cancer patients and 25 579 controls of East Asian ancestry, we investigated 70 single-nucleotide polymorphisms (SNPs) in 67 independent breast cancer susceptibility loci recently identified by genome-wide association studies (GWASs) conducted primarily in European-ancestry populations. SNPs in 31 loci showed an association with breast cancer risk at P < 0.05 in a direction consistent with that reported previously. Twenty-one of them remained statistically significant after adjusting for multiple comparisons with the Bonferroni-corrected significance level of <0.0015. Eight of the 70 SNPs showed a significantly different association with breast cancer risk by estrogen receptor (ER) status at P < 0.05. With the exception of rs2046210 at 6q25.1, the seven other SNPs showed a stronger association with ER-positive than ER-negative cancer. This study replicated all five genetic risk variants initially identified in Asians and provided evidence for associations of breast cancer risk in the East Asian population with nearly half of the genetic risk variants initially reported in GWASs conducted in European descendants. Taken together, these common genetic risk variants explain ∼10% of excess familial risk of breast cancer in Asian populations. PMID:23535825

Effects of interactions between common genetic variants and alcohol consumption on colorectal cancer risk

PubMed Central

Song, Nan; Shin, Aesun; Oh, Jae Hwan; Kim, Jeongseon

2018-01-01

Background Genome-wide association studies (GWAS) have identified approximately 40 common genetic loci associated with colorectal cancer risk. To investigate possible gene-environment interactions (GEIs) between GWAS-identified single-nucleotide polymorphisms (SNPs) and alcohol consumption with respect to colorectal cancer, a hospital-based case-control study was conducted. Results Higher levels of alcohol consumption as calculated based on a standardized definition of a drink (1 drink=12.5g of ethanol) were associated with increased risk of colorectal cancer (OR=2.47, 95% CI=1.62-3.76 for heavy drinkers [>50g/day] compared to never drinkers; ptrend<0.01). SNP rs6687758 near the DUSP10 gene at 1q41 had a statistically significant interaction with alcohol consumption in analyses of standardized drinks (p=4.6×10-3), although this did not surpass the corrected threshold for multiple testing. When stratified by alcohol consumption levels, in an additive model the risk of colorectal cancer associated with the G allele of rs6687758 tended to increase among individuals in the heavier alcohol consumption strata. A statistically significant association between rs6687758 and colorectal cancer risk was observed among moderate alcohol drinkers who consumed between >12.5 and ≤50g of alcohol per day (OR=1.46, 95% CI=1.01-2.11). Methods A total of 2,109 subjects (703 colorectal cancer patients and 1,406 healthy controls) were recruited from the Korean National Cancer Center. For genotyping, 30 GWAS-identified SNPs were selected. A logistic regression model was used to evaluate associations of SNPs and alcohol consumption with colorectal cancer risk. We also tested GEIs between SNPs and alcohol consumption using a logistic model with multiplicative interaction terms. Conclusions Our results suggest that SNP rs6687758 at 1q41 may interact with alcohol consumption in the etiology of colorectal cancer. PMID:29464080

Effects of interactions between common genetic variants and alcohol consumption on colorectal cancer risk.

PubMed

Song, Nan; Shin, Aesun; Oh, Jae Hwan; Kim, Jeongseon

2018-01-19

Genome-wide association studies (GWAS) have identified approximately 40 common genetic loci associated with colorectal cancer risk. To investigate possible gene-environment interactions (GEIs) between GWAS-identified single-nucleotide polymorphisms (SNPs) and alcohol consumption with respect to colorectal cancer, a hospital-based case-control study was conducted. Higher levels of alcohol consumption as calculated based on a standardized definition of a drink (1 drink=12.5g of ethanol) were associated with increased risk of colorectal cancer (OR=2.47, 95% CI=1.62-3.76 for heavy drinkers [>50g/day] compared to never drinkers; p trend <0.01). SNP rs6687758 near the DUSP10 gene at 1q41 had a statistically significant interaction with alcohol consumption in analyses of standardized drinks ( p =4.6×10 -3 ), although this did not surpass the corrected threshold for multiple testing. When stratified by alcohol consumption levels, in an additive model the risk of colorectal cancer associated with the G allele of rs6687758 tended to increase among individuals in the heavier alcohol consumption strata. A statistically significant association between rs6687758 and colorectal cancer risk was observed among moderate alcohol drinkers who consumed between >12.5 and ≤50g of alcohol per day (OR=1.46, 95% CI=1.01-2.11). A total of 2,109 subjects (703 colorectal cancer patients and 1,406 healthy controls) were recruited from the Korean National Cancer Center. For genotyping, 30 GWAS-identified SNPs were selected. A logistic regression model was used to evaluate associations of SNPs and alcohol consumption with colorectal cancer risk. We also tested GEIs between SNPs and alcohol consumption using a logistic model with multiplicative interaction terms. Our results suggest that SNP rs6687758 at 1q41 may interact with alcohol consumption in the etiology of colorectal cancer.

CREB1 is a strong genetic predictor of the variation in exercise heart rate response to regular exercise: the HERITAGE Family Study.

PubMed

Rankinen, Tuomo; Argyropoulos, George; Rice, Treva; Rao, D C; Bouchard, Claude

2010-06-01

A genome-wide linkage scan identified a quantitative trait locus for exercise training-induced changes in submaximal exercise (50 W) heart rate (DeltaHR50) on chromosome 2q33.3-q34 in the HERITAGE Family Study (n=472). To fine-map the region, 1450 tag SNPs were genotyped between 205 and 215 Mb on chromosome 2. The strongest evidence of association with DeltaHR50 was observed with 2 single-nucleotide polymorphisms (SNPs) located in the 5' region of the cAMP-responsive element-binding protein 1 (CREB1) gene (rs2253206: P=1.6x10(-5) and rs2360969: P=4.3x10(-5)). The associations remained significant (P=0.01 and P=0.023, respectively) after accounting for multiple testing. Regression modeling of the 39 most significant SNPs in the single-SNP analysis identified 9 SNPs that collectively explained 20% of the DeltaHR50 variance. CREB1 SNP rs2253206 had the strongest effect (5.45% of variance), followed by SNPs in the FASTKD2 (3.1%), MAP2 (2.6%), SPAG16 (2.1%), ERBB4 (3 SNPs approximately 1.4% each), IKZF2 (1.4%), and PARD3B (1.0%) loci. In conditional linkage analysis, 6 SNPs from the final regression model (CREB1, FASTKD2, MAP2, ERBB4, IKZF2, and PARD3B) accounted for the original linkage signal: The log of the odds score dropped from 2.10 to 0.41 after adjusting for all 6 SNPs. Functional studies revealed that the common allele of rs2253206 exhibits significantly (P<0.05) lower promoter activity than the minor allele. Our data suggest that functional DNA sequence variation in the CREB1 locus is strongly associated with DeltaHR50 and explains a considerable proportion of the quantitative trait locus variance. However, at least 5 additional SNPs seem to be required to fully account for the original linkage signal.

CREB1 is a strong genetic predictor of the variation in exercise heart rate response to regular exercise: the HERITAGE Family Study

PubMed Central

Rankinen, Tuomo; Argyropoulos, George; Rice, Treva; Rao, D.C.; Bouchard, Claude

2011-01-01

Background A genome-wide linkage scan identified a quantitative trait locus (QTL) for exercise training-induced changes in submaximal exercise (50W) heart rate (ΔHR50) on chromosome 2q33.3-q34 in the HERITAGE Family Study (N=472). Methods and Results To fine map the region, 1,450 tagSNPs were genotyped between 205 and 215 Mb on chromosome 2. The strongest evidence of association with ΔHR50 was observed with two SNPs located in the 5′ region of the cAMP responsive element binding protein 1 (CREB1) gene (rs2253206: p=1.6×10−5 and rs2360969: p=4.3×10−5). The associations remained significant (p=0.01 and p=0.023, respectively) after accounting for multiple testing. Regression modeling of the 39 most significant SNPs in the single-SNP analyses identified nine SNPs that collectively explained 20% of the ΔHR50 variance. CREB1 SNP rs2253206 had the strongest effect (5.45% of variance), followed by SNPs in the FASTKD2 (3.1%), MAP2 (2.6%), SPAG16 (2.1%), ERBB4 (3 SNPs ~1.4% each), IKZF2 (1.4%), and PARD3B (1.0%) loci. In conditional linkage analysis, six SNPs from the final regression model (CREB1, FASTKD2, MAP2, ERBB4, IKZF2, and PARD3B) accounted for the original linkage signal: the LOD score dropped from 2.10 to 0.41 after adjusting for all six SNPs. Functional studies revealed that the common allele of rs2253206 exhibits significantly (p<0.05) lower promoter activity than the minor allele. Conclusions Our data suggest that functional DNA sequence variation in the CREB1 locus is strongly associated with ΔHR50 and explains considerable proportion of the QTL variance. However, at least five additional SNPs seem to be required to fully account for the original linkage signal. PMID:20407090

Genome-wide association study of smoking behaviors in COPD patients

PubMed Central

Siedlinski, Mateusz; Cho, Michael H.; Bakke, Per; Gulsvik, Amund; Lomas, David A.; Anderson, Wayne; Kong, Xiangyang; Rennard, Stephen I.; Beaty, Terri H.; Hokanson, John E.; Crapo, James D.; Silverman, Edwin K.

2012-01-01

Background Cigarette smoking is a major risk factor for COPD and COPD severity. Previous genome-wide association studies (GWAS) have identified numerous single nucleotide polymorphisms (SNPs) associated with the number of cigarettes smoked per day (CPD) and a Dopamine Beta-Hydroxylase (DBH) locus associated with smoking cessation in multiple populations. Objective To identify SNPs associated with lifetime average and current CPD, age at smoking initiation, and smoking cessation in COPD subjects. Methods GWAS were conducted in 4 independent cohorts encompassing 3,441 ever-smoking COPD subjects (GOLD stage II or higher). Untyped SNPs were imputed using HapMap (phase II) panel. Results from all cohorts were meta-analyzed. Results Several SNPs near the HLA region on chromosome 6p21 and in an intergenic region on chromosome 2q21 showed associations with age at smoking initiation, both with the lowest p=2×10−7. No SNPs were associated with lifetime average CPD, current CPD or smoking cessation with p<10−6. Nominally significant associations with candidate SNPs within alpha-nicotinic acetylcholine receptors 3/5 (CHRNA3/CHRNA5; e.g. p=0.00011 for SNP rs1051730) and Cytochrome P450 2A6 (CYP2A6; e.g. p=2.78×10−5 for a nonsynonymous SNP rs1801272) regions were observed for lifetime average CPD, however only CYP2A6 showed evidence of significant association with current CPD. A candidate SNP (rs3025343) in the DBH was significantly (p=0.015) associated with smoking cessation. Conclusion We identified two candidate regions associated with age at smoking initiation in COPD subjects. Associations of CHRNA3/CHRNA5 and CYP2A6 loci with CPD and DBH with smoking cessation are also likely of importance in the smoking behaviors of COPD patients. PMID:21685187

Genome-Wide Association Analysis of Blood Biomarkers in Chronic Obstructive Pulmonary Disease

PubMed Central

Kim, Deog Kyeom; Cho, Michael H.; Hersh, Craig P.; Lomas, David A.; Miller, Bruce E.; Kong, Xiangyang; Bakke, Per; Gulsvik, Amund; Agustí, Alvar; Wouters, Emiel; Celli, Bartolome; Coxson, Harvey; Vestbo, Jørgen; MacNee, William; Yates, Julie C.; Rennard, Stephen; Litonjua, Augusto; Qiu, Weiliang; Beaty, Terri H.; Crapo, James D.; Riley, John H.; Tal-Singer, Ruth

2012-01-01

Rationale: A genome-wide association study (GWAS) for circulating chronic obstructive pulmonary disease (COPD) biomarkers could identify genetic determinants of biomarker levels and COPD susceptibility. Objectives: To identify genetic variants of circulating protein biomarkers and novel genetic determinants of COPD. Methods: GWAS was performed for two pneumoproteins, Clara cell secretory protein (CC16) and surfactant protein D (SP-D), and five systemic inflammatory markers (C-reactive protein, fibrinogen, IL-6, IL-8, and tumor necrosis factor-α) in 1,951 subjects with COPD. For genome-wide significant single nucleotide polymorphisms (SNPs) (P < 1 × 10−8), association with COPD susceptibility was tested in 2,939 cases with COPD and 1,380 smoking control subjects. The association of candidate SNPs with mRNA expression in induced sputum was also elucidated. Measurements and Main Results: Genome-wide significant susceptibility loci affecting biomarker levels were found only for the two pneumoproteins. Two discrete loci affecting CC16, one region near the CC16 coding gene (SCGB1A1) on chromosome 11 and another locus approximately 25 Mb away from SCGB1A1, were identified, whereas multiple SNPs on chromosomes 6 and 16, in addition to SNPs near SFTPD, had genome-wide significant associations with SP-D levels. Several SNPs affecting circulating CC16 levels were significantly associated with sputum mRNA expression of SCGB1A1 (P = 0.009–0.03). Several SNPs highly associated with CC16 or SP-D levels were nominally associated with COPD in a collaborative GWAS (P = 0.001–0.049), although these COPD associations were not replicated in two additional cohorts. Conclusions: Distant genetic loci and biomarker-coding genes affect circulating levels of COPD-related pneumoproteins. A subset of these protein quantitative trait loci may influence their gene expression in the lung and/or COPD susceptibility. Clinical trial registered with www.clinicaltrials.gov (NCT 00292552). PMID:23144326

Complex Variation in Measures of General Intelligence and Cognitive Change

PubMed Central

Rowe, Suzanne J.; Rowlatt, Amy; Davies, Gail; Harris, Sarah E.; Porteous, David J.; Liewald, David C.; McNeill, Geraldine; Starr, John M.

2013-01-01

Combining information from multiple SNPs may capture a greater amount of genetic variation than from the sum of individual SNP effects and help identifying missing heritability. Regions may capture variation from multiple common variants of small effect, multiple rare variants or a combination of both. We describe regional heritability mapping of human cognition. Measures of crystallised (gc) and fluid intelligence (gf) in late adulthood (64–79 years) were available for 1806 individuals genotyped for 549,692 autosomal single nucleotide polymorphisms (SNPs). The same individuals were tested at age 11, enabling us the rare opportunity to measure cognitive change across most of their lifespan. 547,750 SNPs ranked by position are divided into 10, 908 overlapping regions of 101 SNPs to estimate the genetic variance each region explains, an approach that resembles classical linkage methods. We also estimate the genetic variation explained by individual autosomes and by SNPs within genes. Empirical significance thresholds are estimated separately for each trait from whole genome scans of 500 permutated data sets. The 5% significance threshold for the likelihood ratio test of a single region ranged from 17–17.5 for the three traits. This is the equivalent to nominal significance under the expectation of a chi-squared distribution (between 1df and 0) of P<1.44×10−5. These thresholds indicate that the distribution of the likelihood ratio test from this type of variance component analysis should be estimated empirically. Furthermore, we show that estimates of variation explained by these regions can be grossly overestimated. After applying permutation thresholds, a region for gf on chromosome 5 spanning the PRRC1 gene is significant at a genome-wide 10% empirical threshold. Analysis of gene methylation on the temporal cortex provides support for the association of PRRC1 and fluid intelligence (P = 0.004), and provides a prime candidate gene for high throughput sequencing of these uniquely informative cohorts. PMID:24349040

Identification of nine genes as novel susceptibility loci for early-onset ischemic stroke, intracerebral hemorrhage, or subarachnoid hemorrhage.

PubMed

Yamada, Yoshiji; Kato, Kimihiko; Oguri, Mitsutoshi; Horibe, Hideki; Fujimaki, Tetsuo; Yasukochi, Yoshiki; Takeuchi, Ichiro; Sakuma, Jun

2018-07-01

Given that substantial genetic components have been shown in ischemic stroke, intracerebral hemorrhage (ICH), and subarachnoid hemorrhage (SAH), heritability may be higher in early-onset than late-onset individuals with these conditions. Although genome-wide association studies (GWASs) have identified various genes and loci significantly associated with ischemic stroke, ICH, or intracranial aneurysm mainly in European ancestry populations, genetic variants that contribute to susceptibility to these disorders remain to be identified definitively. We performed exome-wide association studies (EWASs) to identify genetic variants that confer susceptibility to ischemic stroke, ICH, or SAH in early-onset subjects with these conditions. A total of 6,649 individuals aged ≤65 years were examined. For the EWAS of ischemic or hemorrhagic stroke, 6,224 individuals (450 subjects with ischemic stroke, 5,774 controls) or 6,179 individuals (261 subjects with ICH, 176 subjects with SAH, 5,742 controls), respectively, were examined. EWASs were performed with the use of Illumina Human Exome-12 v1.2 DNA Analysis BeadChip or Infinium Exome-24 v1.0 BeadChip. To compensate for multiple comparisons of allele frequencies with ischemic stroke, ICH, or SAH, we applied a false discovery rate (FDR) of <0.05 for statistical significance of association. The association of allele frequencies of 31,245 single nucleotide polymorphisms (SNPs) that passed quality control to ischemic stroke was examined with Fisher's exact test, and 31 SNPs were significantly (FDR <0.05) associated with ischemic stroke. The association of allele frequencies of 31,253 or 30,970 SNPs to ICH or SAH, respectively, was examined with Fisher's exact test, and six or two SNPs were significantly associated with ICH or SAH, respectively. Multivariable logistic regression analysis with adjustment for age, sex, and the prevalence of hypertension and diabetes mellitus revealed that 12 SNPs were significantly [P<0.0004 (0.05/124)] related to ischemic stroke. Similar analysis with adjustment for age, sex, and the prevalence of hypertension revealed that six or two SNPs were significantly [P<0.0016 (0.05/32)] related to ICH or SAH, respectively. After examination of linkage disequilibrium of identified SNPs and results of previous GWASs, we identified HHIPL2, CTNNA3, LOC643770, UTP20 , and TRIB3 as susceptibility loci for ischemic stroke, DNTTIP2 and FAM205A as susceptibility loci for ICH, and FAM160A1 and OR52E4 as such loci for SAH. Therefore, to the best of our knowledge, we have newly identified nine genes that confer susceptibility to early-onset ischemic stroke, ICH, or SAH. Determination of genotypes for the SNPs in these genes may prove informative for assessment of the genetic risk for ischemic stroke, ICH, or SAH in Japanese.

SNP-associations and phenotype predictions from hundreds of microbial genomes without genome alignments.

PubMed

Hall, Barry G

2014-01-01

SNP-association studies are a starting point for identifying genes that may be responsible for specific phenotypes, such as disease traits. The vast bulk of tools for SNP-association studies are directed toward SNPs in the human genome, and I am unaware of any tools designed specifically for such studies in bacterial or viral genomes. The PPFS (Predict Phenotypes From SNPs) package described here is an add-on to kSNP , a program that can identify SNPs in a data set of hundreds of microbial genomes. PPFS identifies those SNPs that are non-randomly associated with a phenotype based on the χ² probability, then uses those diagnostic SNPs for two distinct, but related, purposes: (1) to predict the phenotypes of strains whose phenotypes are unknown, and (2) to identify those diagnostic SNPs that are most likely to be causally related to the phenotype. In the example illustrated here, from a set of 68 E. coli genomes, for 67 of which the pathogenicity phenotype was known, there were 418,500 SNPs. Using the phenotypes of 36 of those strains, PPFS identified 207 diagnostic SNPs. The diagnostic SNPs predicted the phenotypes of all of the genomes with 97% accuracy. It then identified 97 SNPs whose probability of being causally related to the pathogenic phenotype was >0.999. In a second example, from a set of 116 E. coli genome sequences, using the phenotypes of 65 strains PPFS identified 101 SNPs that predicted the source host (human or non-human) with 90% accuracy.

An In-Depth Characterization of the Major Psoriasis Susceptibility Locus Identifies Candidate Susceptibility Alleles within an HLA-C Enhancer Element

PubMed Central

Clop, Alex; Bertoni, Anna; Spain, Sarah L.; Simpson, Michael A.; Pullabhatla, Venu; Tonda, Raul; Hundhausen, Christian; Di Meglio, Paola; De Jong, Pieter; Hayday, Adrian C.; Nestle, Frank O.; Barker, Jonathan N.; Bell, Robert J. A.; Capon, Francesca; Trembath, Richard C.

2013-01-01

Psoriasis is an immune-mediated skin disorder that is inherited as a complex genetic trait. Although genome-wide association scans (GWAS) have identified 36 disease susceptibility regions, more than 50% of the genetic variance can be attributed to a single Major Histocompatibility Complex (MHC) locus, known as PSORS1. Genetic studies indicate that HLA-C is the strongest PSORS1 candidate gene, since markers tagging HLA-Cw*0602 consistently generate the most significant association signals in GWAS. However, it is unclear whether HLA-Cw*0602 is itself the causal PSORS1 allele, especially as the role of SNPs that may affect its expression has not been investigated. Here, we have undertaken an in-depth molecular characterization of the PSORS1 interval, with a view to identifying regulatory variants that may contribute to disease susceptibility. By analysing high-density SNP data, we refined PSORS1 to a 179 kb region encompassing HLA-C and the neighbouring HCG27 pseudogene. We compared multiple MHC sequences spanning this refined locus and identified 144 candidate susceptibility variants, which are unique to chromosomes bearing HLA-Cw*0602. In parallel, we investigated the epigenetic profile of the critical PSORS1 interval and uncovered three enhancer elements likely to be active in T lymphocytes. Finally we showed that nine candidate susceptibility SNPs map within a HLA-C enhancer and that three of these variants co-localise with binding sites for immune-related transcription factors. These data indicate that SNPs affecting HLA-Cw*0602 expression are likely to contribute to psoriasis susceptibility and highlight the importance of integrating multiple experimental approaches in the investigation of complex genomic regions such as the MHC. PMID:23990973

Genome Wide Association Study for Drought, Aflatoxin Resistance, and Important Agronomic Traits of Maize Hybrids in the Sub-Tropics

PubMed Central

Farfan, Ivan D. Barrero; De La Fuente, Gerald N.; Murray, Seth C.; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L.; Kolomiets, Mike

2015-01-01

The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5–10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort.

PubMed

Kim, S; Swaminathan, S; Shen, L; Risacher, S L; Nho, K; Foroud, T; Shaw, L M; Trojanowski, J Q; Potkin, S G; Huentelman, M J; Craig, D W; DeChairo, B M; Aisen, P S; Petersen, R C; Weiner, M W; Saykin, A J

2011-01-04

CSF levels of Aβ1-42, t-tau, and p-tau181p are potential early diagnostic markers for probable Alzheimer disease (AD). The influence of genetic variation on these markers has been investigated for candidate genes but not on a genome-wide basis. We report a genome-wide association study (GWAS) of CSF biomarkers (Aβ1-42, t-tau, p-tau181p, p-tau181p/Aβ1-42, and t-tau/Aβ1-42). A total of 374 non-Hispanic Caucasian participants in the Alzheimer's Disease Neuroimaging Initiative cohort with quality-controlled CSF and genotype data were included in this analysis. The main effect of single nucleotide polymorphisms (SNPs) under an additive genetic model was assessed on each of 5 CSF biomarkers. The p values of all SNPs for each CSF biomarker were adjusted for multiple comparisons by the Bonferroni method. We focused on SNPs with corrected p<0.01 (uncorrected p<3.10×10(-8)) and secondarily examined SNPs with uncorrected p values less than 10(-5) to identify potential candidates. Four SNPs in the regions of the APOE, LOC100129500, TOMM40, and EPC2 genes reached genome-wide significance for associations with one or more CSF biomarkers. SNPs in CCDC134, ABCG2, SREBF2, and NFATC4, although not reaching genome-wide significance, were identified as potential candidates. In addition to known candidate genes, APOE, TOMM40, and one hypothetical gene LOC100129500 partially overlapping APOE; one novel gene, EPC2, and several other interesting genes were associated with CSF biomarkers that are related to AD. These findings, especially the new EPC2 results, require replication in independent cohorts.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

SNP selection and classification of genome-wide SNP data using stratified sampling random forests.

PubMed

Wu, Qingyao; Ye, Yunming; Liu, Yang; Ng, Michael K

2012-09-01

For high dimensional genome-wide association (GWA) case-control data of complex disease, there are usually a large portion of single-nucleotide polymorphisms (SNPs) that are irrelevant with the disease. A simple random sampling method in random forest using default mtry parameter to choose feature subspace, will select too many subspaces without informative SNPs. Exhaustive searching an optimal mtry is often required in order to include useful and relevant SNPs and get rid of vast of non-informative SNPs. However, it is too time-consuming and not favorable in GWA for high-dimensional data. The main aim of this paper is to propose a stratified sampling method for feature subspace selection to generate decision trees in a random forest for GWA high-dimensional data. Our idea is to design an equal-width discretization scheme for informativeness to divide SNPs into multiple groups. In feature subspace selection, we randomly select the same number of SNPs from each group and combine them to form a subspace to generate a decision tree. The advantage of this stratified sampling procedure can make sure each subspace contains enough useful SNPs, but can avoid a very high computational cost of exhaustive search of an optimal mtry, and maintain the randomness of a random forest. We employ two genome-wide SNP data sets (Parkinson case-control data comprised of 408 803 SNPs and Alzheimer case-control data comprised of 380 157 SNPs) to demonstrate that the proposed stratified sampling method is effective, and it can generate better random forest with higher accuracy and lower error bound than those by Breiman's random forest generation method. For Parkinson data, we also show some interesting genes identified by the method, which may be associated with neurological disorders for further biological investigations.

Novel genes identified in a high-density genome wide association study for nicotine dependence.

PubMed

Bierut, Laura Jean; Madden, Pamela A F; Breslau, Naomi; Johnson, Eric O; Hatsukami, Dorothy; Pomerleau, Ovide F; Swan, Gary E; Rutter, Joni; Bertelsen, Sarah; Fox, Louis; Fugman, Douglas; Goate, Alison M; Hinrichs, Anthony L; Konvicka, Karel; Martin, Nicholas G; Montgomery, Grant W; Saccone, Nancy L; Saccone, Scott F; Wang, Jen C; Chase, Gary A; Rice, John P; Ballinger, Dennis G

2007-01-01

Tobacco use is a leading contributor to disability and death worldwide, and genetic factors contribute in part to the development of nicotine dependence. To identify novel genes for which natural variation contributes to the development of nicotine dependence, we performed a comprehensive genome wide association study using nicotine dependent smokers as cases and non-dependent smokers as controls. To allow the efficient, rapid, and cost effective screen of the genome, the study was carried out using a two-stage design. In the first stage, genotyping of over 2.4 million single nucleotide polymorphisms (SNPs) was completed in case and control pools. In the second stage, we selected SNPs for individual genotyping based on the most significant allele frequency differences between cases and controls from the pooled results. Individual genotyping was performed in 1050 cases and 879 controls using 31 960 selected SNPs. The primary analysis, a logistic regression model with covariates of age, gender, genotype and gender by genotype interaction, identified 35 SNPs with P-values less than 10(-4) (minimum P-value 1.53 x 10(-6)). Although none of the individual findings is statistically significant after correcting for multiple tests, additional statistical analyses support the existence of true findings in this group. Our study nominates several novel genes, such as Neurexin 1 (NRXN1), in the development of nicotine dependence while also identifying a known candidate gene, the beta3 nicotinic cholinergic receptor. This work anticipates the future directions of large-scale genome wide association studies with state-of-the-art methodological approaches and sharing of data with the scientific community.

GWAS-identified schizophrenia risk SNPs at TSPAN18 are highly diverged between Europeans and East Asians.

PubMed

Liu, Jiewei; Li, Ming; Su, Bing

2016-12-01

Genome-wide association studies (GWASs) have identified multiple schizophrenia (SCZ) risk variants for samples of European and East Asian descent, but most of the identified susceptibility variants are population-specific to either Europeans or East Asians. This strong genetic heterogeneity suggests that differential population histories may play a role in SCZ susceptibility. Here, we explored this possibility by examining the allele frequency divergence of 136 previously reported genome-wide SCZ risk SNPs between European and East Asian populations. Our results showed that two SNPs (rs11038167 and rs11038172) at TSPAN18, reported as genome-wide significant SCZ risk variants in Han Chinese, were entirely monomorphic in Europeans, indicating a deep between-population divergence at this gene locus. To explore the evolutionary history of TSPAN18 in East Asians, we conducted population genetic analyses including multiple neutrality tests, the haplotype-based iHS and EHH tests, as well as haplotype bifurcation map and network constructions. We found that the protective allele of rs11038172 (G allele) had a long extended haplotype with much slower decay compared to the A allele. The star-like shape of the G-allele-carrying haplotypes indicates a recent enrichment in East Asians. Together, the evidences suggest that the protective allele of rs11038172 has experienced recent Darwinian positive selection in East Asians. These findings provide new insights that may help explain the strong genetic heterogeneity in SCZ risk and previous inconsistent association results for SCZ among both Europeans and East Asians. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

PubMed

Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

2015-06-01

Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

Pleiotropic analysis of cancer risk loci on esophageal adenocarcinoma risk

PubMed Central

Lee, Eunjung; Stram, Daniel O.; Ek, Weronica E.; Onstad, Lynn E; MacGregor, Stuart; Gharahkhani, Puya; Ye, Weimin; Lagergren, Jesper; Shaheen, Nicholas J.; Murray, Liam J.; Hardie, Laura J; Gammon, Marilie D.; Chow, Wong-Ho; Risch, Harvey A.; Corley, Douglas A.; Levine, David M; Whiteman, David C.; Bernstein, Leslie; Bird, Nigel C.; Vaughan, Thomas L.; Wu, Anna H.

2015-01-01

Background Several cancer-associated loci identified from genome-wide association studies (GWAS) have been associated with risks of multiple cancer sites, suggesting pleiotropic effects. We investigated whether GWAS-identified risk variants for other common cancers are associated with risk of esophageal adenocarcinoma (EA) or its precursor, Barrett's esophagus (BE). Methods We examined the associations between risks of EA and BE and 387 single nucleotide polymorphisms (SNPs) that have been associated with risks of other cancers, by using genotype imputation data on 2,163 control participants and 3,885 (1,501 EA and 2,384 BE) case patients from the Barrett's and Esophageal Adenocarcinoma Genetic Susceptibility Study, and investigated effect modification by smoking history, body mass index (BMI), and reflux/heartburn. Results After correcting for multiple testing, none of the tested 387 SNPs were statistically significantly associated with risk of EA or BE. No evidence of effect modification by smoking, BMI, or reflux/heartburn was observed. Conclusions Genetic risk variants for common cancers identified from GWAS appear not to be associated with risks of EA or BE. Impact To our knowledge, this is the first investigation of pleiotropic genetic associations with risks of EA and BE. PMID:26364162

Evidence that multiple genetic variants of MC4R play a functional role in the regulation of energy expenditure and appetite in Hispanic children1234

PubMed Central

Cole, Shelley A; Voruganti, V Saroja; Cai, Guowen; Haack, Karin; Kent, Jack W; Blangero, John; Comuzzie, Anthony G; McPherson, John D; Gibbs, Richard A

2010-01-01

Background: Melanocortin-4-receptor (MC4R) haploinsufficiency is the most common form of monogenic obesity; however, the frequency of MC4R variants and their functional effects in general populations remain uncertain. Objective: The aim was to identify and characterize the effects of MC4R variants in Hispanic children. Design: MC4R was resequenced in 376 parents, and the identified single nucleotide polymorphisms (SNPs) were genotyped in 613 parents and 1016 children from the Viva la Familia cohort. Measured genotype analysis (MGA) tested associations between SNPs and phenotypes. Bayesian quantitative trait nucleotide (BQTN) analysis was used to infer the most likely functional polymorphisms influencing obesity-related traits. Results: Seven rare SNPs in coding and 18 SNPs in flanking regions of MC4R were identified. MGA showed suggestive associations between MC4R variants and body size, adiposity, glucose, insulin, leptin, ghrelin, energy expenditure, physical activity, and food intake. BQTN analysis identified SNP 1704 in a predicted micro-RNA target sequence in the downstream flanking region of MC4R as a strong, probable functional variant influencing total, sedentary, and moderate activities with posterior probabilities of 1.0. SNP 2132 was identified as a variant with a high probability (1.0) of exerting a functional effect on total energy expenditure and sleeping metabolic rate. SNP rs34114122 was selected as having likely functional effects on the appetite hormone ghrelin, with a posterior probability of 0.81. Conclusion: This comprehensive investigation provides strong evidence that MC4R genetic variants are likely to play a functional role in the regulation of weight, not only through energy intake but through energy expenditure. PMID:19889825

Replication of Caucasian loci associated with bone mineral density in Koreans.

PubMed

Kim, Y A; Choi, H J; Lee, J Y; Han, B G; Shin, C S; Cho, N H

2013-10-01

Most bone mineral density (BMD) loci were reported in Caucasian genome-wide association studies (GWAS). This study investigated the association between 59 known BMD loci (+200 suggestive SNPs) and DXA-derived BMD in East Asian population with respect to sex and site specificity. We also identified four novel BMD candidate loci from the suggestive SNPs. Most GWAS have reported BMD-related variations in Caucasian populations. This study investigates whether the BMD loci discovered in Caucasian GWAS are also associated with BMD in East Asian ethnic samples. A total of 2,729 unrelated Korean individuals from a population-based cohort were analyzed. We selected 747 single-nucleotide polymorphisms (SNPs). These markers included 547 SNPs from 59 loci with genome-wide significance (GWS, p value less than 5 × 10(-8)) levels and 200 suggestive SNPs that showed weaker BMD association with p value less than 5 × 10(-5). After quality control, 535 GWS SNPs and 182 suggestive SNPs were included in the replication analysis. Of the 535 GWS SNPs, 276 from 25 loci were replicated (p < 0.05) in the Korean population with 51.6 % replication rate. Of the 182 suggestive variants, 16 were replicated (p < 0.05, 8.8 % of replication rate), and five reached a significant combined p value (less than 7.0 × 10(-5), 0.05/717 SNPs, corrected for multiple testing). Two markers (rs11711157, rs3732477) are for the same signal near the gene CPN2 (carboxypeptidase N, polypeptide 2). The other variants, rs6436440 and rs2291296, were located in the genes AP1S3 (adaptor-related protein complex 1, sigma 3 subunit) and RARB (retinoic acid receptor, beta). Our results illustrate ethnic differences in BMD susceptibility genes and underscore the need for further genetic studies in each ethnic group. We were also able to replicate some SNPs with suggestive associations. These SNPs may be BMD-related genetic markers and should be further investigated.

Inherited genetic variants associated with occurrence of multiple primary melanoma.

PubMed

Gibbs, David C; Orlow, Irene; Kanetsky, Peter A; Luo, Li; Kricker, Anne; Armstrong, Bruce K; Anton-Culver, Hoda; Gruber, Stephen B; Marrett, Loraine D; Gallagher, Richard P; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J; Cust, Anne E; Ollila, David W; Begg, Colin B; Berwick, Marianne; Thomas, Nancy E

2015-06-01

Recent studies, including genome-wide association studies, have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 SNPs from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% confidence intervals were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma, while NCOA6 rs4911442 approached significance (P = 0.06). The GEM Study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. ©2015 American Association for Cancer Research.

Characterization of SNPs Associated with Prostate Cancer in Men of Ashkenazic Descent from the Set of GWAS Identified SNPs: Impact of Cancer Family History and Cumulative SNP Risk Prediction

PubMed Central

Agalliu, Ilir; Wang, Zhaoming; Wang, Tao; Dunn, Anne; Parikh, Hemang; Myers, Timothy

2013-01-01

Background Genome-wide association studies (GWAS) have identified multiple SNPs associated with prostate cancer (PrCa). Population isolates may have different sets of risk alleles for PrCa constituting unique population and individual risk profiles. Methods To test this hypothesis, associations between 31 GWAS SNPs of PrCa were examined among 979 PrCa cases and 1,251 controls of Ashkenazic descent using logistic regression. We also investigated risks by age at diagnosis, pathological features of PrCa, and family history of cancer. Moreover, we examined associations between cumulative number of risk alleles and PrCa and assessed the utility of risk alleles in PrCa risk prediction by comparing the area under the curve (AUC) for different logistic models. Results Of the 31 genotyped SNPs, 8 were associated with PrCa at p≤0.002 (corrected p-value threshold) with odds ratios (ORs) ranging from 1.22 to 1.42 per risk allele. Four SNPs were associated with aggressive PrCa, while three other SNPs showed potential interactions for PrCa by family history of PrCa (rs8102476; 19q13), lung cancer (rs17021918; 4q22), and breast cancer (rs10896449; 11q13). Men in the highest vs. lowest quartile of cumulative number of risk alleles had ORs of 3.70 (95% CI 2.76–4.97); 3.76 (95% CI 2.57–5.50), and 5.20 (95% CI 2.94–9.19) for overall PrCa, aggressive cancer and younger age at diagnosis, respectively. The addition of cumulative risk alleles to the model containing age at diagnosis and family history of PrCa yielded a slightly higher AUC (0.69 vs. 0.64). Conclusion These data define a set of risk alleles associated with PrCa in men of Ashkenazic descent and indicate possible genetic differences for PrCa between populations of European and Ashkenazic ancestry. Use of genetic markers might provide an opportunity to identify men at highest risk for younger age of onset PrCa; however, their clinical utility in identifying men at highest risk for aggressive cancer remains limited. PMID:23573233

Design of the Illumina Porcine 50K+ SNP Iselect(TM) Beadchip and Characterization of the Porcine HapMap Population

USDA-ARS?s Scientific Manuscript database

Using next generation sequencing technology the International Swine SNP Consortium has identified 500,000 SNPs and used these to design an Illumina Infinium iSelect™ SNP BeadChip with a selection of 60,218 SNPs. The selected SNPs include previously validated SNPs and SNPs identified de novo using se...

Multi-Ancestral Analysis of Inflammation-Related Genetic Variants and C-Reactive Protein in the Population Architecture using Genomics and Epidemiology (PAGE) Study

PubMed Central

Kocarnik, Jonathan M.; Pendergrass, Sarah A.; Carty, Cara L.; Pankow, James S.; Schumacher, Fredrick R.; Cheng, Iona; Durda, Peter; Ambite, JoséLuis; Deelman, Ewa; Cook, Nancy R.; Liu, Simin; Wactawski-Wende, Jean; Hutter, Carolyn; Brown-Gentry, Kristin; Wilson, Sarah; Best, Lyle G.; Pankratz, Nathan; Hong, Ching-Ping; Cole, Shelley A.; Voruganti, V. Saroja; Bůžková, Petra; Jorgensen, Neal W.; Jenny, Nancy S.; Wilkens, Lynne R.; Haiman, Christopher A.; Kolonel, Laurence N.; LaCroix, Andrea; North, Kari; Jackson, Rebecca; Le Marchand, Loic; Hindorff, Lucia A.; Crawford, Dana C.; Gross, Myron; Peters, Ulrike

2014-01-01

Background C-reactive protein (CRP) is a biomarker of inflammation. Genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) associated with CRP concentrations and inflammation-related traits such as cardiovascular disease, type 2 diabetes, and obesity. We aimed to replicate previous CRP-SNP associations, assess whether these associations generalize to additional race/ethnicity groups, and evaluate inflammation-related SNPs for a potentially pleiotropic association with CRP. Methods and Results We selected and analyzed 16 CRP-associated and 250 inflammation-related GWAS SNPs among 40,473 African American, American Indian, Asian/Pacific Islander, European American, and Hispanic participants from 7 studies collaborating in the Population Architecture using Genomics and Epidemiology (PAGE) study. Fixed-effect meta-analyses combined study-specific race/ethnicity-stratified linear regression estimates to evaluate the association between each SNP and high-sensitivity CRP. Overall, 18 SNPs in 8 loci were significantly associated with CRP (Bonferroni-corrected p<3.1×10−3 for replication, p<2.0×10−4 for pleiotropy): Seven of these were specific to European Americans, while 9 additionally generalized to African Americans (1), Hispanics (5), or both (3); 1 SNP was seen only in African Americans and Hispanics. Two SNPs in the CELSR2/PSRC1/SORT1 locus showed a potentially novel association with CRP: rs599839 (p=2.0×10−6) and rs646776 (p=3.1×10−5). Conclusions We replicated 16 SNP-CRP associations, 10 of which generalized to African Americans and/or Hispanics. We also identified potentially novel pleiotropic associations with CRP for two SNPs previously associated with coronary artery disease and LDL cholesterol. These findings demonstrate the benefit of evaluating genotype-phenotype associations in multiple race/ethnicity groups, and of looking for pleiotropic relationships among SNPs previously associated with related phenotypes. PMID:24622110

Multiancestral analysis of inflammation-related genetic variants and C-reactive protein in the population architecture using genomics and epidemiology study.

PubMed

Kocarnik, Jonathan M; Pendergrass, Sarah A; Carty, Cara L; Pankow, James S; Schumacher, Fredrick R; Cheng, Iona; Durda, Peter; Ambite, José Luis; Deelman, Ewa; Cook, Nancy R; Liu, Simin; Wactawski-Wende, Jean; Hutter, Carolyn; Brown-Gentry, Kristin; Wilson, Sarah; Best, Lyle G; Pankratz, Nathan; Hong, Ching-Ping; Cole, Shelley A; Voruganti, V Saroja; Bůžkova, Petra; Jorgensen, Neal W; Jenny, Nancy S; Wilkens, Lynne R; Haiman, Christopher A; Kolonel, Laurence N; Lacroix, Andrea; North, Kari; Jackson, Rebecca; Le Marchand, Loic; Hindorff, Lucia A; Crawford, Dana C; Gross, Myron; Peters, Ulrike

2014-04-01

C-reactive protein (CRP) is a biomarker of inflammation. Genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) associated with CRP concentrations and inflammation-related traits such as cardiovascular disease, type 2 diabetes mellitus, and obesity. We aimed to replicate previous CRP-SNP associations, assess whether these associations generalize to additional race/ethnicity groups, and evaluate inflammation-related SNPs for a potentially pleiotropic association with CRP. We selected and analyzed 16 CRP-associated and 250 inflammation-related GWAS SNPs among 40 473 African American, American Indian, Asian/Pacific Islander, European American, and Hispanic participants from 7 studies collaborating in the Population Architecture using Genomics and Epidemiology (PAGE) study. Fixed-effect meta-analyses combined study-specific race/ethnicity-stratified linear regression estimates to evaluate the association between each SNP and high-sensitivity CRP. Overall, 18 SNPs in 8 loci were significantly associated with CRP (Bonferroni-corrected P<3.1×10(-3) for replication, P<2.0×10(-4) for pleiotropy): Seven of these were specific to European Americans, while 9 additionally generalized to African Americans (1), Hispanics (5), or both (3); 1 SNP was seen only in African Americans and Hispanics. Two SNPs in the CELSR2/PSRC1/SORT1 locus showed a potentially novel association with CRP: rs599839 (P=2.0×10(-6)) and rs646776 (P=3.1×10(-5)). We replicated 16 SNP-CRP associations, 10 of which generalized to African Americans and/or Hispanics. We also identified potentially novel pleiotropic associations with CRP for two SNPs previously associated with coronary artery disease and/or low-density lipoprotein-cholesterol. These findings demonstrate the benefit of evaluating genotype-phenotype associations in multiple race/ethnicity groups and looking for pleiotropic relationships among SNPs previously associated with related phenotypes.

Genome-Wide Analysis of Polymorphisms Associated with Cytokine Responses in Smallpox Vaccine Recipients

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, V. Shane; Haralambieva, Iana H.; Vierkant, Robert A.; Poland, Gregory A.

2014-01-01

The role that genetics plays in response to infection or disease is becoming increasingly clear as we learn more about immunogenetics and host-pathogen interactions. Here we report a genome-wide analysis of the effects of host genetic variation on cytokine responses to vaccinia virus stimulation in smallpox vaccine recipients. Our data show that vaccinia stimulation of immune individuals results in secretion of inflammatory and Th1 cytokines. We identified multiple SNPs significantly associated with variations in cytokine secretion. These SNPs are found in genes with known immune function, as well as in genes encoding for proteins involved in signal transduction, cytoskeleton, membrane channels and ion transport, as well as others with no previously identified connection to immune responses. The large number of significant SNP associations implies that cytokine secretion in response to vaccinia virus is a complex process controlled by multiple genes and gene families. Follow-up studies to replicate these findings and then pursue mechanistic studies will provide a greater understanding of how genetic variation influences vaccine responses. PMID:22610502

New genetic associations in thiopurine-related bone marrow toxicity among inflammatory bowel disease patients.

PubMed

Zabala, William; Cruz, Raquel; Barreiro-de Acosta, Manuel; Chaparro, María; Panes, Julián; Echarri, Ana; Esteve, Maria; Carpio, Daniel; Andreu, Montserrat; García-Planella, Esther; Domenech, Eugeni; Carracedo, Angel; Gisbert, Javier P; Barros, Francisco

2013-04-01

The toxicity related to thiopurine drug therapy for inflammatory bowel disease (IBD) varies widely among patients. Almost 15-30% of patients with IBD develop side effects during treatment, often bone marrow suppression. Several factors have been implicated in determining this toxicity, mainly individual genetic variation related to formation of active thiopurine metabolites. The aim was to identify genes involved in thiopurine-related myelosuppression. A two-stage investigation of 19,217 coding SNPs (cSNPs) was performed in a Spanish (Inflammatory Bowel Disease Group of Galicia [EIGA]) cohort of 173 IBD patients, 15 with bone marrow suppression. The top 20 cSNPs identified in the first stage with p < 10(-3) for allelic test association and SNPs that define the common TPMT alleles were replicated in a different Spanish (ENEIDA) cohort (87 patients, 29 with bone marrow suppression). Several cSNPs showed a significant p-value in the allelic joint analysis (p-Cochran-Mantel-Haenszel test ≤2.55 × 10(-3)) despite no cSNP passing correction for multiple testing in the first cohort. Of note is rs3729961 in the gene IL6ST, a transducer signal chain shared by many cytokines including IL6 (p-value combined = 2.36 × 10(-4), odds ratio [95% CI]: 3.41 [1.71-6.78]). In addition, we detected association with rs3749598 in the FSTL5 gene that appears to interact with metalloproteases at the extracellular matrix level (p-value combined = 4.89 × 10(-4)), odds ratio (95% CI): 3.67 (1.68-8.01). We have identified IL6ST and FSLT5 as new bone marrow suppression susceptibility candidate genes after thiopurine treatment in IBD patients. This is the first report of variants associated with thiopurine-related myelosuppression that was identified by a genome-wide association study. Its validation awaits functional analyses and replication in additional studies. Original submitted 14 September 2012; Revision submitted 13 February 2013.

Replication of Caucasian Loci Associated with Osteoporosis-related Traits in East Asians

PubMed Central

Kim, Beom-Jun; Ahn, Seong Hee; Kim, Hyeon-Mok; Ikegawa, Shiro; Yang, Tie-Lin; Guo, Yan; Deng, Hong-Wen; Koh, Jung-Min

2016-01-01

Background Most reported genome-wide association studies (GWAS) seeking to identify the loci of osteoporosis-related traits have involved Caucasian populations. We aimed to identify the single nucleotide polymorphisms (SNPs) of osteoporosis-related traits among East Asian populations from the bone mineral density (BMD)-related loci of an earlier GWAS meta-analysis. Methods A total of 95 SNPs, identified at the discovery stage of the largest GWAS meta-analysis of BMD, were tested to determine associations with osteoporosis-related traits (BMD, osteoporosis, or fracture) in Korean subjects (n=1,269). The identified SNPs of osteoporosis-related traits in Korean subjects were included in the replication analysis using Chinese (n=2,327) and Japanese (n=768) cohorts. Results A total of 17 SNPs were associated with low BMD in Korean subjects. Specifically, 9, 6, 9, and 5 SNPs were associated with the presence of osteoporosis, non-vertebral fractures, vertebral fractures, and any fracture, respectively. Collectively, 35 of the 95 SNPs (36.8%) were associated with one or more osteoporosis-related trait in Korean subjects. Of the 35 SNPs, 19 SNPs (54.3%) were also associated with one or more osteoporosis-related traits in East Asian populations. Twelve SNPs were associated with low BMD in the Chinese and Japanese cohorts. Specifically, 3, 4, and 2 SNPs were associated with the presence of hip fractures, vertebral fractures, and any fracture, respectively. Conclusions Our results identified the common SNPs of osteoporosis-related traits in both Caucasian and East Asian populations. These SNPs should be further investigated to assess whether they are true genetic markers of osteoporosis. PMID:27965945

The α‐synuclein gene in multiple system atrophy

PubMed Central

Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

2006-01-01

Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

The Relationship between Smoking and Replicated Sequence Variants on Chromosomes 8 and 9 with Familial Intracranial Aneurysm

PubMed Central

Deka, Ranjan; Koller, Daniel L.; Lai, Dongbing; Indugula, Subba Rao; Sun, Guangyun; Woo, Daniel; Sauerbeck, Laura; Moomaw, Charles J.; Hornung, Richard; Connolly, E. Sander; Anderson, Craig; Rouleau, Guy; Meissner, Irene; Bailey-Wilson, Joan E.; Huston, John; Brown, Robert D.; Kleindorfer, Dawn O.; Flaherty, Matthew L.; Langefeld, Carl; Foroud, Tatiana; Broderick, Joseph P.

2010-01-01

Purpose To replicate the previous association of single nucleotide polymorphisms (SNPs) with risk of intracranial aneurysm (IA) and to examine the relationship of smoking with these variants and the risk of IA. Methods White probands with an IA from families with multiple affected members were identified by 26 clinical centers located throughout North America, New Zealand, and Australia. White controls free of stroke and IA were selected by random digit dialing from the Greater Cincinnati population. SNPs previously associated with IA on chromosome 2, 8, and 9 were genotyped using a TaqMan assay or were included in the Affymetrix 6.0 array that was part of a genome-wide association study of 406 IA cases and 392 controls. Logistic regression modeling tested whether the association of replicated SNPs with IA was modulated by smoking. Results The strongest evidence of association with IA was found with the 8q SNP rs10958409 (genotypic P = 9.2 × 10-5; allelic P = 1.3 × 10-5; OR = 1.86, 95% CI: 1.40−2.47). We also replicated association with both SNPs on chromosome 9p, rs1333040 and rs10757278, but were not able to replicate the previously reported association of the two SNPs on chromosome 2q. Statistical testing showed a multiplicative relationship between the risk alleles and smoking with regard to the risk of IA. Conclusion Our data provide complementary evidence that the variants on chromosome 8q and 9p are associated with IA and that the risk of IA in patients with these variants are greatly increased with cigarette smoking. PMID:20190001

Fine-mapping and initial characterization of QT interval loci in African Americans.

PubMed

Avery, Christy L; Sethupathy, Praveen; Buyske, Steven; He, Qianchuan; Lin, Dan-Yu; Arking, Dan E; Carty, Cara L; Duggan, David; Fesinmeyer, Megan D; Hindorff, Lucia A; Jeff, Janina M; Klein, Liviu; Patton, Kristen K; Peters, Ulrike; Shohet, Ralph V; Sotoodehnia, Nona; Young, Alicia M; Kooperberg, Charles; Haiman, Christopher A; Mohlke, Karen L; Whitsel, Eric A; North, Kari E

2012-01-01

The QT interval (QT) is heritable and its prolongation is a risk factor for ventricular tachyarrhythmias and sudden death. Most genetic studies of QT have examined European ancestral populations; however, the increased genetic diversity in African Americans provides opportunities to narrow association signals and identify population-specific variants. We therefore evaluated 6,670 SNPs spanning eleven previously identified QT loci in 8,644 African American participants from two Population Architecture using Genomics and Epidemiology (PAGE) studies: the Atherosclerosis Risk in Communities study and Women's Health Initiative Clinical Trial. Of the fifteen known independent QT variants at the eleven previously identified loci, six were significantly associated with QT in African American populations (P≤1.20×10(-4)): ATP1B1, PLN1, KCNQ1, NDRG4, and two NOS1AP independent signals. We also identified three population-specific signals significantly associated with QT in African Americans (P≤1.37×10(-5)): one at NOS1AP and two at ATP1B1. Linkage disequilibrium (LD) patterns in African Americans assisted in narrowing the region likely to contain the functional variants for several loci. For example, African American LD patterns showed that 0 SNPs were in LD with NOS1AP signal rs12143842, compared with European LD patterns that indicated 87 SNPs, which spanned 114.2 Kb, were in LD with rs12143842. Finally, bioinformatic-based characterization of the nine African American signals pointed to functional candidates located exclusively within non-coding regions, including predicted binding sites for transcription factors such as TBX5, which has been implicated in cardiac structure and conductance. In this detailed evaluation of QT loci, we identified several African Americans SNPs that better define the association with QT and successfully narrowed intervals surrounding established loci. These results demonstrate that the same loci influence variation in QT across multiple populations, that novel signals exist in African Americans, and that the SNPs identified as strong candidates for functional evaluation implicate gene regulatory dysfunction in QT prolongation.

Fine-Mapping and Initial Characterization of QT Interval Loci in African Americans

PubMed Central

Avery, Christy L.; Sethupathy, Praveen; Buyske, Steven; He, Qianchuan; Lin, Dan-Yu; Arking, Dan E.; Carty, Cara L.; Duggan, David; Fesinmeyer, Megan D.; Hindorff, Lucia A.; Jeff, Janina M.; Klein, Liviu; Patton, Kristen K.; Peters, Ulrike; Shohet, Ralph V.; Sotoodehnia, Nona; Young, Alicia M.; Kooperberg, Charles; Haiman, Christopher A.; Mohlke, Karen L.; Whitsel, Eric A.; North, Kari E.

2012-01-01

The QT interval (QT) is heritable and its prolongation is a risk factor for ventricular tachyarrhythmias and sudden death. Most genetic studies of QT have examined European ancestral populations; however, the increased genetic diversity in African Americans provides opportunities to narrow association signals and identify population-specific variants. We therefore evaluated 6,670 SNPs spanning eleven previously identified QT loci in 8,644 African American participants from two Population Architecture using Genomics and Epidemiology (PAGE) studies: the Atherosclerosis Risk in Communities study and Women's Health Initiative Clinical Trial. Of the fifteen known independent QT variants at the eleven previously identified loci, six were significantly associated with QT in African American populations (P≤1.20×10−4): ATP1B1, PLN1, KCNQ1, NDRG4, and two NOS1AP independent signals. We also identified three population-specific signals significantly associated with QT in African Americans (P≤1.37×10−5): one at NOS1AP and two at ATP1B1. Linkage disequilibrium (LD) patterns in African Americans assisted in narrowing the region likely to contain the functional variants for several loci. For example, African American LD patterns showed that 0 SNPs were in LD with NOS1AP signal rs12143842, compared with European LD patterns that indicated 87 SNPs, which spanned 114.2 Kb, were in LD with rs12143842. Finally, bioinformatic-based characterization of the nine African American signals pointed to functional candidates located exclusively within non-coding regions, including predicted binding sites for transcription factors such as TBX5, which has been implicated in cardiac structure and conductance. In this detailed evaluation of QT loci, we identified several African Americans SNPs that better define the association with QT and successfully narrowed intervals surrounding established loci. These results demonstrate that the same loci influence variation in QT across multiple populations, that novel signals exist in African Americans, and that the SNPs identified as strong candidates for functional evaluation implicate gene regulatory dysfunction in QT prolongation. PMID:22912591

Identification of homogeneous genetic architecture of multiple genetically correlated traits by block clustering of genome-wide associations.

PubMed

Gupta, Mayetri; Cheung, Ching-Lung; Hsu, Yi-Hsiang; Demissie, Serkalem; Cupples, L Adrienne; Kiel, Douglas P; Karasik, David

2011-06-01

Genome-wide association studies (GWAS) using high-density genotyping platforms offer an unbiased strategy to identify new candidate genes for osteoporosis. It is imperative to be able to clearly distinguish signal from noise by focusing on the best phenotype in a genetic study. We performed GWAS of multiple phenotypes associated with fractures [bone mineral density (BMD), bone quantitative ultrasound (QUS), bone geometry, and muscle mass] with approximately 433,000 single-nucleotide polymorphisms (SNPs) and created a database of resulting associations. We performed analysis of GWAS data from 23 phenotypes by a novel modification of a block clustering algorithm followed by gene-set enrichment analysis. A data matrix of standardized regression coefficients was partitioned along both axes--SNPs and phenotypes. Each partition represents a distinct cluster of SNPs that have similar effects over a particular set of phenotypes. Application of this method to our data shows several SNP-phenotype connections. We found a strong cluster of association coefficients of high magnitude for 10 traits (BMD at several skeletal sites, ultrasound measures, cross-sectional bone area, and section modulus of femoral neck and shaft). These clustered traits were highly genetically correlated. Gene-set enrichment analyses indicated the augmentation of genes that cluster with the 10 osteoporosis-related traits in pathways such as aldosterone signaling in epithelial cells, role of osteoblasts, osteoclasts, and chondrocytes in rheumatoid arthritis, and Parkinson signaling. In addition to several known candidate genes, we also identified PRKCH and SCNN1B as potential candidate genes for multiple bone traits. In conclusion, our mining of GWAS results revealed the similarity of association results between bone strength phenotypes that may be attributed to pleiotropic effects of genes. This knowledge may prove helpful in identifying novel genes and pathways that underlie several correlated phenotypes, as well as in deciphering genetic and phenotypic modularity underlying osteoporosis risk. Copyright © 2011 American Society for Bone and Mineral Research.

Genetic Variants Associated with Lipid Profiles in Chinese Patients with Type 2 Diabetes

PubMed Central

Xing, Xiaoyan; Zhang, Bo; Zhang, Xuelian; Hong, Jing; Yang, Wenying

2015-01-01

Dyslipidemia is a strong risk factor for cardiovascular disease among patients with type 2 diabetes (T2D). The aim of this study was to identify lipid-related genetic variants in T2D patients of Han Chinese ancestry. Among 4,908 Chinese T2D patients who were not taking lipid-lowering medications, single nucleotide polymorphisms (SNPs) in seven genes previously found to be associated with lipid traits in genome-wide association studies conducted in populations of European ancestry (ABCA1, GCKR, BAZ1B, TOMM40, DOCK7, HNF1A, and HNF4A) were genotyped. After adjusting for multiple covariates, SNPs in ABCA1, GCKR, BAZ1B, TOMM40, and HNF1A were identified as significantly associated with triglyceride levels in T2D patients (P < 0.05). The associations between the SNPs in ABCA1 (rs3890182), GCKR (rs780094), and BAZ1B (rs2240466) remained significant even after correction for multiple testing (P = 8.85×10−3, 7.88×10−7, and 2.03×10−6, respectively). BAZ1B (rs2240466) also was associated with the total cholesterol level (P = 4.75×10−2). In addition, SNP rs157580 in TOMM40 was associated with the low-density lipoprotein cholesterol level (P = 6.94×10−3). Our findings confirm that lipid-related genetic loci are associated with lipid profiles in Chinese patients with type 2 diabetes. PMID:26252223

Predicting adaptive phenotypes from multilocus genotypes in Sitka spruce (Picea sitchensis) using random forest.

PubMed

Holliday, Jason A; Wang, Tongli; Aitken, Sally

2012-09-01

Climate is the primary driver of the distribution of tree species worldwide, and the potential for adaptive evolution will be an important factor determining the response of forests to anthropogenic climate change. Although association mapping has the potential to improve our understanding of the genomic underpinnings of climatically relevant traits, the utility of adaptive polymorphisms uncovered by such studies would be greatly enhanced by the development of integrated models that account for the phenotypic effects of multiple single-nucleotide polymorphisms (SNPs) and their interactions simultaneously. We previously reported the results of association mapping in the widespread conifer Sitka spruce (Picea sitchensis). In the current study we used the recursive partitioning algorithm 'Random Forest' to identify optimized combinations of SNPs to predict adaptive phenotypes. After adjusting for population structure, we were able to explain 37% and 30% of the phenotypic variation, respectively, in two locally adaptive traits--autumn budset timing and cold hardiness. For each trait, the leading five SNPs captured much of the phenotypic variation. To determine the role of epistasis in shaping these phenotypes, we also used a novel approach to quantify the strength and direction of pairwise interactions between SNPs and found such interactions to be common. Our results demonstrate the power of Random Forest to identify subsets of markers that are most important to climatic adaptation, and suggest that interactions among these loci may be widespread.

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Gene-environment interaction involving recently identified colorectal cancer susceptibility loci

PubMed Central

Kantor, Elizabeth D.; Hutter, Carolyn M.; Minnier, Jessica; Berndt, Sonja I.; Brenner, Hermann; Caan, Bette J.; Campbell, Peter T.; Carlson, Christopher S.; Casey, Graham; Chan, Andrew T.; Chang-Claude, Jenny; Chanock, Stephen J.; Cotterchio, Michelle; Du, Mengmeng; Duggan, David; Fuchs, Charles S.; Giovannucci, Edward L.; Gong, Jian; Harrison, Tabitha A.; Hayes, Richard B.; Henderson, Brian E.; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Jiao, Shuo; Kolonel, Laurence N.; Le Marchand, Loic; Lemire, Mathieu; Ma, Jing; Newcomb, Polly A.; Ochs-Balcom, Heather M.; Pflugeisen, Bethann M.; Potter, John D.; Rudolph, Anja; Schoen, Robert E.; Seminara, Daniela; Slattery, Martha L.; Stelling, Deanna L.; Thomas, Fridtjof; Thornquist, Mark; Ulrich, Cornelia M.; Warnick, Greg S.; Zanke, Brent W.; Peters, Ulrike; Hsu, Li; White, Emily

2014-01-01

BACKGROUND Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) that are associated with risk of colorectal cancer (CRC). Prior research has evaluated the presence of gene-environment interaction involving the first 10 identified susceptibility loci, but little work has been conducted on interaction involving SNPs at recently identified susceptibility loci, including: rs10911251, rs6691170, rs6687758, rs11903757, rs10936599, rs647161, rs1321311, rs719725, rs1665650, rs3824999, rs7136702, rs11169552, rs59336, rs3217810, rs4925386, and rs2423279. METHODS Data on 9160 cases and 9280 controls from the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) and Colon Cancer Family Registry (CCFR) were used to evaluate the presence of interaction involving the above-listed SNPs and sex, body mass index (BMI), alcohol consumption, smoking, aspirin use, post-menopausal hormone (PMH) use, as well as intake of dietary calcium, dietary fiber, dietary folate, red meat, processed meat, fruit, and vegetables. Interaction was evaluated using a fixed-effects meta-analysis of an efficient Empirical Bayes estimator, and permutation was used to account for multiple comparisons. RESULTS None of the permutation-adjusted p-values reached statistical significance. CONCLUSIONS The associations between recently identified genetic susceptibility loci and CRC are not strongly modified by sex, BMI, alcohol, smoking, aspirin, PMH use, and various dietary factors. IMPACT Results suggest no evidence of strong gene-environment interactions involving the recently identified 16 susceptibility loci for CRC taken one at a time. PMID:24994789

Strong Signature of Natural Selection within an FHIT Intron Implicated in Prostate Cancer Risk

PubMed Central

Ding, Yan; Larson, Garrett; Rivas, Guillermo; Lundberg, Cathryn; Geller, Louis; Ouyang, Ching; Weitzel, Jeffrey; Archambeau, John; Slater, Jerry; Daly, Mary B.; Benson, Al B.; Kirkwood, John M.; O'Dwyer, Peter J.; Sutphen, Rebecca; Stewart, James A.; Johnson, David; Nordborg, Magnus; Krontiris, Theodore G.

2008-01-01

Previously, a candidate gene linkage approach on brother pairs affected with prostate cancer identified a locus of prostate cancer susceptibility at D3S1234 within the fragile histidine triad gene (FHIT), a tumor suppressor that induces apoptosis. Subsequent association tests on 16 SNPs spanning approximately 381 kb surrounding D3S1234 in Americans of European descent revealed significant evidence of association for a single SNP within intron 5 of FHIT. In the current study, re-sequencing and genotyping within a 28.5 kb region surrounding this SNP further delineated the association with prostate cancer risk to a 15 kb region. Multiple SNPs in sequences under evolutionary constraint within intron 5 of FHIT defined several related haplotypes with an increased risk of prostate cancer in European-Americans. Strong associations were detected for a risk haplotype defined by SNPs 138543, 142413, and 152494 in all cases (Pearson's χ2 = 12.34, df 1, P = 0.00045) and for the homozygous risk haplotype defined by SNPs 144716, 142413, and 148444 in cases that shared 2 alleles identical by descent with their affected brothers (Pearson's χ2 = 11.50, df 1, P = 0.00070). In addition to highly conserved sequences encompassing SNPs 148444 and 152413, population studies revealed strong signatures of natural selection for a 1 kb window covering the SNP 144716 in two human populations, the European American (π = 0.0072, Tajima's D = 3.31, 14 SNPs) and the Japanese (π = 0.0049, Fay & Wu's H = 8.05, 14 SNPs), as well as in chimpanzees (Fay & Wu's H = 8.62, 12 SNPs). These results strongly support the involvement of the FHIT intronic region in an increased risk of prostate cancer. PMID:18953408

Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

PubMed

Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

2015-01-01

The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

Contribution of Large Region Joint Associations to Complex Traits Genetics

PubMed Central

Paré, Guillaume; Asma, Senay; Deng, Wei Q.

2015-01-01

A polygenic model of inheritance, whereby hundreds or thousands of weakly associated variants contribute to a trait’s heritability, has been proposed to underlie the genetic architecture of complex traits. However, relatively few genetic variants have been positively identified so far and they collectively explain only a small fraction of the predicted heritability. We hypothesized that joint association of multiple weakly associated variants over large chromosomal regions contributes to complex traits variance. Confirmation of such regional associations can help identify new loci and lead to a better understanding of known ones. To test this hypothesis, we first characterized the ability of commonly used genetic association models to identify large region joint associations. Through theoretical derivation and simulation, we showed that multivariate linear models where multiple SNPs are included as independent predictors have the most favorable association profile. Based on these results, we tested for large region association with height in 3,740 European participants from the Health and Retirement Study (HRS) study. Adjusting for SNPs with known association with height, we demonstrated clustering of weak associations (p = 2x10-4) in regions extending up to 433.0 Kb from known height loci. The contribution of regional associations to phenotypic variance was estimated at 0.172 (95% CI 0.063-0.279; p < 0.001), which compared favorably to 0.129 explained by known height variants. Conversely, we showed that suggestively associated regions are enriched for known height loci. To extend our findings to other traits, we also tested BMI, HDLc and CRP for large region associations, with consistent results for CRP. Our results demonstrate the presence of large region joint associations and suggest these can be used to pinpoint weakly associated SNPs. PMID:25856144

Oceanographic variation influences spatial genomic structure in the sea scallop, Placopecten magellanicus.

PubMed

Van Wyngaarden, Mallory; Snelgrove, Paul V R; DiBacco, Claudio; Hamilton, Lorraine C; Rodríguez-Ezpeleta, Naiara; Zhan, Luyao; Beiko, Robert G; Bradbury, Ian R

2018-03-01

Environmental factors can influence diversity and population structure in marine species and accurate understanding of this influence can both improve fisheries management and help predict responses to environmental change. We used 7163 SNPs derived from restriction site-associated DNA sequencing genotyped in 245 individuals of the economically important sea scallop, Placopecten magellanicus , to evaluate the correlations between oceanographic variation and a previously identified latitudinal genomic cline. Sea scallops span a broad latitudinal area (>10 degrees), and we hypothesized that climatic variation significantly drives clinal trends in allele frequency. Using a large environmental dataset, including temperature, salinity, chlorophyll a, and nutrient concentrations, we identified a suite of SNPs (285-621, depending on analysis and environmental dataset) potentially under selection through correlations with environmental variation. Principal components analysis of different outlier SNPs and environmental datasets revealed similar northern and southern clusters, with significant associations between the first axes of each ( R 2 adj  = .66-.79). Multivariate redundancy analysis of outlier SNPs and the environmental principal components indicated that environmental factors explained more than 32% of the variance. Similarly, multiple linear regressions and random-forest analysis identified winter average and minimum ocean temperatures as significant parameters in the link between genetic and environmental variation. This work indicates that oceanographic variation is associated with the observed genomic cline in this species and that seasonal periods of extreme cold may restrict gene flow along a latitudinal gradient in this marine benthic bivalve. Incorporating this finding into management may improve accuracy of management strategies and future predictions.

SNPs in putative regulatory regions identified by human mouse comparative sequencing and transcription factor binding site data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.

2002-01-01

Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs inmore » gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.« less

Genome-Wide Associations between Genetic and Epigenetic Variation Influence mRNA Expression and Insulin Secretion in Human Pancreatic Islets

PubMed Central

Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte

2014-01-01

Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650

Candidate Genes Involved in Beneficial or Adverse Responses to Commonly Eaten Brassica Vegetables in a New Zealand Crohn’s Disease Cohort

PubMed Central

Laing, Bobbi; Han, Dug Yeo; Ferguson, Lynnette R.

2013-01-01

Crohn’s disease (CD) is one of the two manifestations of inflammatory bowel disease. Particular foods are thought with CD to exacerbate their illness. Vegetables, especially Brassicaceae, are often shunned by people with CD because of the negative effects they are alleged to have on their symptoms. Brassicaceae supply key nutrients which are necessary to meet recommended daily intakes. We sought to identify the candidate genes involved in the beneficial or adverse effects of Brassicaceae most commonly eaten, as reported by the New Zealand adults from the “Genes and Diet in Inflammatory Bowel disease Study” based in Auckland. An analysis of associations between the single nucleotide polymorphisms (SNPs) and the beneficial or adverse effects of the ten most commonly eaten Brassicaceae was carried out. A total of 37 SNPs were significantly associated with beneficial effects (p = 0.00097 to 0.0497) and 64 SNPs were identified with adverse effects (p = 0.0000751 to 0.049). After correcting for multiple testing, rs7515322 (DIO1) and rs9469220 (HLA) remained significant. Our findings show that the tolerance of some varieties of Brassicaceae may be shown by analysis of a person’s genotype. PMID:24352087

A population genomic scan in Chorthippus grasshoppers unveils previously unknown phenotypic divergence.

PubMed

Berdan, Emma L; Mazzoni, Camila J; Waurick, Isabelle; Roehr, Johannes T; Mayer, Frieder

2015-08-01

Understanding the genetics of speciation and the processes that drive it is a central goal of evolutionary biology. Grasshoppers of the Chorthippus species group differ strongly in calling song (and corresponding female preferences) but are exceedingly similar in other characteristics such as morphology. Here, we performed a population genomic scan on three Chorthippus species (Chorthippus biguttulus, C. mollis and C. brunneus) to gain insight into the genes and processes involved in divergence and speciation in this group. Using an RNA-seq approach, we examined functional variation between the species by calling SNPs for each of the three species pairs and using FST -based approaches to identify outliers. We found approximately 1% of SNPs in each comparison to be outliers. Between 37% and 40% of these outliers were nonsynonymous SNPs (as opposed to a global level of 17%) indicating that we recovered loci under selection. Among the outliers were several genes that may be involved in song production and hearing as well as genes involved in other traits such as food preferences and metabolism. Differences in food preferences between species were confirmed with a behavioural experiment. This indicates that multiple phenotypic differences implicating multiple evolutionary processes (sexual selection and natural selection) are present between the species. © 2015 John Wiley & Sons Ltd.

Application of a Combination of a Knowledge-Based Algorithm and 2-Stage Screening to Hypothesis-Free Genomic Data on Irinotecan-Treated Patients for Identification of a Candidate Single Nucleotide Polymorphism Related to an Adverse Effect

PubMed Central

Takahashi, Hiro; Sai, Kimie; Saito, Yoshiro; Kaniwa, Nahoko; Matsumura, Yasuhiro; Hamaguchi, Tetsuya; Shimada, Yasuhiro; Ohtsu, Atsushi; Yoshino, Takayuki; Doi, Toshihiko; Okuda, Haruhiro; Ichinohe, Risa; Takahashi, Anna; Doi, Ayano; Odaka, Yoko; Okuyama, Misuzu; Saijo, Nagahiro; Sawada, Jun-ichi; Sakamoto, Hiromi; Yoshida, Teruhiko

2014-01-01

Interindividual variation in a drug response among patients is known to cause serious problems in medicine. Genomic information has been proposed as the basis for “personalized” health care. The genome-wide association study (GWAS) is a powerful technique for examining single nucleotide polymorphisms (SNPs) and their relationship with drug response variation; however, when using only GWAS, it often happens that no useful SNPs are identified due to multiple testing problems. Therefore, in a previous study, we proposed a combined method consisting of a knowledge-based algorithm, 2 stages of screening, and a permutation test for identifying SNPs. In the present study, we applied this method to a pharmacogenomics study where 109,365 SNPs were genotyped using Illumina Human-1 BeadChip in 168 cancer patients treated with irinotecan chemotherapy. We identified the SNP rs9351963 in potassium voltage-gated channel subfamily KQT member 5 (KCNQ5) as a candidate factor related to incidence of irinotecan-induced diarrhea. The p value for rs9351963 was 3.31×10−5 in Fisher's exact test and 0.0289 in the permutation test (when multiple testing problems were corrected). Additionally, rs9351963 was clearly superior to the clinical parameters and the model involving rs9351963 showed sensitivity of 77.8% and specificity of 57.6% in the evaluation by means of logistic regression. Recent studies showed that KCNQ4 and KCNQ5 genes encode members of the M channel expressed in gastrointestinal smooth muscle and suggested that these genes are associated with irritable bowel syndrome and similar peristalsis diseases. These results suggest that rs9351963 in KCNQ5 is a possible predictive factor of incidence of diarrhea in cancer patients treated with irinotecan chemotherapy and for selecting chemotherapy regimens, such as irinotecan alone or a combination of irinotecan with a KCNQ5 opener. Nonetheless, clinical importance of rs9351963 should be further elucidated. PMID:25127363

Application of a combination of a knowledge-based algorithm and 2-stage screening to hypothesis-free genomic data on irinotecan-treated patients for identification of a candidate single nucleotide polymorphism related to an adverse effect.

PubMed

Takahashi, Hiro; Sai, Kimie; Saito, Yoshiro; Kaniwa, Nahoko; Matsumura, Yasuhiro; Hamaguchi, Tetsuya; Shimada, Yasuhiro; Ohtsu, Atsushi; Yoshino, Takayuki; Doi, Toshihiko; Okuda, Haruhiro; Ichinohe, Risa; Takahashi, Anna; Doi, Ayano; Odaka, Yoko; Okuyama, Misuzu; Saijo, Nagahiro; Sawada, Jun-ichi; Sakamoto, Hiromi; Yoshida, Teruhiko

2014-01-01

Interindividual variation in a drug response among patients is known to cause serious problems in medicine. Genomic information has been proposed as the basis for "personalized" health care. The genome-wide association study (GWAS) is a powerful technique for examining single nucleotide polymorphisms (SNPs) and their relationship with drug response variation; however, when using only GWAS, it often happens that no useful SNPs are identified due to multiple testing problems. Therefore, in a previous study, we proposed a combined method consisting of a knowledge-based algorithm, 2 stages of screening, and a permutation test for identifying SNPs. In the present study, we applied this method to a pharmacogenomics study where 109,365 SNPs were genotyped using Illumina Human-1 BeadChip in 168 cancer patients treated with irinotecan chemotherapy. We identified the SNP rs9351963 in potassium voltage-gated channel subfamily KQT member 5 (KCNQ5) as a candidate factor related to incidence of irinotecan-induced diarrhea. The p value for rs9351963 was 3.31×10-5 in Fisher's exact test and 0.0289 in the permutation test (when multiple testing problems were corrected). Additionally, rs9351963 was clearly superior to the clinical parameters and the model involving rs9351963 showed sensitivity of 77.8% and specificity of 57.6% in the evaluation by means of logistic regression. Recent studies showed that KCNQ4 and KCNQ5 genes encode members of the M channel expressed in gastrointestinal smooth muscle and suggested that these genes are associated with irritable bowel syndrome and similar peristalsis diseases. These results suggest that rs9351963 in KCNQ5 is a possible predictive factor of incidence of diarrhea in cancer patients treated with irinotecan chemotherapy and for selecting chemotherapy regimens, such as irinotecan alone or a combination of irinotecan with a KCNQ5 opener. Nonetheless, clinical importance of rs9351963 should be further elucidated.

Genome-wide association study identifies multiple loci influencing human serum metabolite levels

PubMed Central

Kettunen, Johannes; Tukiainen, Taru; Sarin, Antti-Pekka; Ortega-Alonso, Alfredo; Tikkanen, Emmi; Lyytikäinen, Leo-Pekka; Kangas, Antti J; Soininen, Pasi; Würtz, Peter; Silander, Kaisa; Dick, Danielle M; Rose, Richard J; Savolainen, Markku J; Viikari, Jorma; Kähönen, Mika; Lehtimäki, Terho; Pietiläinen, Kirsi H; Inouye, Michael; McCarthy, Mark I; Jula, Antti; Eriksson, Johan; Raitakari, Olli T; Salomaa, Veikko; Kaprio, Jaakko; Järvelin, Marjo-Riitta; Peltonen, Leena; Perola, Markus; Freimer, Nelson B; Ala-Korpela, Mika; Palotie, Aarno; Ripatti, Samuli

2013-01-01

Nuclear magnetic resonance assays allow for measurement of a wide range of metabolic phenotypes. We report here the results of a GWAS on 8,330 Finnish individuals genotyped and imputed at 7.7 million SNPs for a range of 216 serum metabolic phenotypes assessed by NMR of serum samples. We identified significant associations (P < 2.31 × 10−10) at 31 loci, including 11 for which there have not been previous reports of associations to a metabolic trait or disorder. Analyses of Finnish twin pairs suggested that the metabolic measures reported here show higher heritability than comparable conventional metabolic phenotypes. In accordance with our expectations, SNPs at the 31 loci associated with individual metabolites account for a greater proportion of the genetic component of trait variance (up to 40%) than is typically observed for conventional serum metabolic phenotypes. The identification of such associations may provide substantial insight into cardiometabolic disorders. PMID:22286219

Fine Mapping and Functional Analysis of the Multiple Sclerosis Risk Gene CD6

PubMed Central

Swaminathan, Bhairavi; Cuapio, Angélica; Alloza, Iraide; Matesanz, Fuencisla; Alcina, Antonio; García-Barcina, Maria; Fedetz, Maria; Fernández, Óscar; Lucas, Miguel; Órpez, Teresa; Pinto-Medel, Mª Jesus; Otaegui, David; Olascoaga, Javier; Urcelay, Elena; Ortiz, Miguel A.; Arroyo, Rafael; Oksenberg, Jorge R.; Antigüedad, Alfredo; Tolosa, Eva; Vandenbroeck, Koen

2013-01-01

CD6 has recently been identified and validated as risk gene for multiple sclerosis (MS), based on the association of a single nucleotide polymorphism (SNP), rs17824933, located in intron 1. CD6 is a cell surface scavenger receptor involved in T-cell activation and proliferation, as well as in thymocyte differentiation. In this study, we performed a haptag SNP screen of the CD6 gene locus using a total of thirteen tagging SNPs, of which three were non-synonymous SNPs, and replicated the recently reported GWAS SNP rs650258 in a Spanish-Basque collection of 814 controls and 823 cases. Validation of the six most strongly associated SNPs was performed in an independent collection of 2265 MS patients and 2600 healthy controls. We identified association of haplotypes composed of two non-synonymous SNPs [rs11230563 (R225W) and rs2074225 (A257V)] in the 2nd SRCR domain with susceptibility to MS (P max(T) permutation = 1×10−4). The effect of these haplotypes on CD6 surface expression and cytokine secretion was also tested. The analysis showed significantly different CD6 expression patterns in the distinct cell subsets, i.e. – CD4+ naïve cells, P = 0.0001; CD8+ naïve cells, P<0.0001; CD4+ and CD8+ central memory cells, P = 0.01 and 0.05, respectively; and natural killer T (NKT) cells, P = 0.02; with the protective haplotype (RA) showing higher expression of CD6. However, no significant changes were observed in natural killer (NK) cells, effector memory and terminally differentiated effector memory T cells. Our findings reveal that this new MS-associated CD6 risk haplotype significantly modifies expression of CD6 on CD4+ and CD8+ T cells. PMID:23638056

An investigation of gene-environment interactions between 47 newly identified breast cancer susceptibility loci and environmental risk factors

PubMed Central

Rudolph, Anja; Milne, Roger L.; Truong, Thérèse; Knight, Julia A.; Seibold, Petra; Flesch-Janys, Dieter; Behrens, Sabine; Eilber, Ursula; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Dunning, Alison M.; Shah, Mitul; Munday, Hannah R.; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S.; Olson, Janet; Vachon, Celine M.; Hallberg, Emily; Castelao, J. Esteban; Carracedo, Angel; Torres, Maria; Li, Jingmei; Humphreys, Keith; Cordina-Duverger, Emilie; Menegaux, Florence; Flyger, Henrik; Nordestgaard, Børge G.; Nielsen, Sune F.; Yesilyurt, Betul T.; Floris, Giuseppe; Leunen, Karin; Engelhardt, Ellen G.; Broeks, Annegien; Rutgers, Emiel J.; Glendon, Gord; Mulligan, Anna Marie; Cross, Simon; Reed, Malcolm; Gonzalez-Neira, Anna; Perez, José Ignacio Arias; Provenzano, Elena; Apicella, Carmel; Southey, Melissa C.; Spurdle, Amanda; Investigators, kConFab; Group, AOCS; Häberle, Lothar; Beckmann, Matthias W.; Ekici, Arif B.; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; McLean, Catriona; Baglietto, Laura; Chanock, Stephen J.; Lissowska, Jolanta; Sherman, Mark E.; Brüning, Thomas; Hamann, Ute; Ko, Yon-Dschun; Orr, Nick; Schoemaker, Minouk; Ashworth, Alan; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana M.; Mannermaa, Arto; Swerdlow, Anthony; Giles, Graham G.; Brenner, Hermann; Fasching, Peter A.; Chenevix-Trench, Georgia; Hopper, John; Benítez, Javier; Cox, Angela; Andrulis, Irene L.; Lambrechts, Diether; Gago-Dominguez, Manuela; Couch, Fergus; Czene, Kamila; Bojesen, Stig E.; Easton, Doug F.; Schmidt, Marjanka K.; Guénel, Pascal; Hall, Per; Pharoah, Paul D. P.; Garcia-Closas, Montserrat; Chang-Claude, Jenny

2014-01-01

A large genotyping project within the Breast Cancer Association Consortium (BCAC) recently identified 41 associations between single nucleotide polymorphisms (SNPs) and overall breast cancer (BC) risk. We investigated whether the effects of these 41 SNPs, as well as six SNPs associated with estrogen receptor (ER) negative BC risk are modified by 13 environmental risk factors for BC. Data from 22 studies participating in BCAC were pooled, comprising up to 26,633 cases and 30,119 controls. Interactions between SNPs and environmental factors were evaluated using an empirical Bayes-type shrinkage estimator. Six SNPs showed interactions with associated p-values (pint) <1.1×10−3. None of the observed interactions was significant after accounting for multiple testing. The Bayesian False Discovery Probability was used to rank the findings, which indicated three interactions as being noteworthy at 1% prior probability of interaction. SNP rs6828523 was associated with increased ER-negative BC risk in women ≥170cm (OR=1.22, p=0.017), but inversely associated with ER-negative BC risk in women <160cm (OR=0.83, p=0.039, pint=1.9×10−4). The inverse association between rs4808801 and overall BC risk was stronger for women who had had four or more pregnancies (OR=0.85, p=2.0×10−4), and absent in women who had had just one (OR=0.96, p=0.19, pint = 6.1×10−4). SNP rs11242675 was inversely associated with overall BC risk in never/former smokers (OR=0.93, p=2.8×10−5), but no association was observed in current smokers (OR=1.07, p=0.14, pint = 3.4×10−4). In conclusion, recently identified breast cancer susceptibility loci are not strongly modified by established risk factors and the observed potential interactions require confirmation in independent studies. PMID:25227710

Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.

PubMed

Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K

2010-09-15

Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans.

Investigation of gene-environment interactions between 47 newly identified breast cancer susceptibility loci and environmental risk factors.

PubMed

Rudolph, Anja; Milne, Roger L; Truong, Thérèse; Knight, Julia A; Seibold, Petra; Flesch-Janys, Dieter; Behrens, Sabine; Eilber, Ursula; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Dunning, Alison M; Shah, Mitul; Munday, Hannah R; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S; Olson, Janet; Vachon, Celine M; Hallberg, Emily; Castelao, J Esteban; Carracedo, Angel; Torres, Maria; Li, Jingmei; Humphreys, Keith; Cordina-Duverger, Emilie; Menegaux, Florence; Flyger, Henrik; Nordestgaard, Børge G; Nielsen, Sune F; Yesilyurt, Betul T; Floris, Giuseppe; Leunen, Karin; Engelhardt, Ellen G; Broeks, Annegien; Rutgers, Emiel J; Glendon, Gord; Mulligan, Anna Marie; Cross, Simon; Reed, Malcolm; Gonzalez-Neira, Anna; Arias Perez, José Ignacio; Provenzano, Elena; Apicella, Carmel; Southey, Melissa C; Spurdle, Amanda; Häberle, Lothar; Beckmann, Matthias W; Ekici, Arif B; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; McLean, Catriona; Baglietto, Laura; Chanock, Stephen J; Lissowska, Jolanta; Sherman, Mark E; Brüning, Thomas; Hamann, Ute; Ko, Yon-Dschun; Orr, Nick; Schoemaker, Minouk; Ashworth, Alan; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana M; Mannermaa, Arto; Swerdlow, Anthony; Giles, Graham G; Brenner, Hermann; Fasching, Peter A; Chenevix-Trench, Georgia; Hopper, John; Benítez, Javier; Cox, Angela; Andrulis, Irene L; Lambrechts, Diether; Gago-Dominguez, Manuela; Couch, Fergus; Czene, Kamila; Bojesen, Stig E; Easton, Doug F; Schmidt, Marjanka K; Guénel, Pascal; Hall, Per; Pharoah, Paul D P; Garcia-Closas, Montserrat; Chang-Claude, Jenny

2015-03-15

A large genotyping project within the Breast Cancer Association Consortium (BCAC) recently identified 41 associations between single nucleotide polymorphisms (SNPs) and overall breast cancer (BC) risk. We investigated whether the effects of these 41 SNPs, as well as six SNPs associated with estrogen receptor (ER) negative BC risk are modified by 13 environmental risk factors for BC. Data from 22 studies participating in BCAC were pooled, comprising up to 26,633 cases and 30,119 controls. Interactions between SNPs and environmental factors were evaluated using an empirical Bayes-type shrinkage estimator. Six SNPs showed interactions with associated p-values (pint ) <1.1 × 10(-3) . None of the observed interactions was significant after accounting for multiple testing. The Bayesian False Discovery Probability was used to rank the findings, which indicated three interactions as being noteworthy at 1% prior probability of interaction. SNP rs6828523 was associated with increased ER-negative BC risk in women ≥170 cm (OR = 1.22, p = 0.017), but inversely associated with ER-negative BC risk in women <160 cm (OR = 0.83, p = 0.039, pint = 1.9 × 10(-4) ). The inverse association between rs4808801 and overall BC risk was stronger for women who had had four or more pregnancies (OR = 0.85, p = 2.0 × 10(-4) ), and absent in women who had had just one (OR = 0.96, p = 0.19, pint = 6.1 × 10(-4) ). SNP rs11242675 was inversely associated with overall BC risk in never/former smokers (OR = 0.93, p = 2.8 × 10(-5) ), but no association was observed in current smokers (OR = 1.07, p = 0.14, pint = 3.4 × 10(-4) ). In conclusion, recently identified BC susceptibility loci are not strongly modified by established risk factors and the observed potential interactions require confirmation in independent studies. © 2014 UICC.

Genetics of Sputum Gene Expression in Chronic Obstructive Pulmonary Disease

PubMed Central

Qiu, Weiliang; Cho, Michael H.; Riley, John H.; Anderson, Wayne H.; Singh, Dave; Bakke, Per; Gulsvik, Amund; Litonjua, Augusto A.; Lomas, David A.; Crapo, James D.; Beaty, Terri H.; Celli, Bartolome R.; Rennard, Stephen; Tal-Singer, Ruth; Fox, Steven M.; Silverman, Edwin K.; Hersh, Craig P.

2011-01-01

Previous expression quantitative trait loci (eQTL) studies have performed genetic association studies for gene expression, but most of these studies examined lymphoblastoid cell lines from non-diseased individuals. We examined the genetics of gene expression in a relevant disease tissue from chronic obstructive pulmonary disease (COPD) patients to identify functional effects of known susceptibility genes and to find novel disease genes. By combining gene expression profiling on induced sputum samples from 131 COPD cases from the ECLIPSE Study with genomewide single nucleotide polymorphism (SNP) data, we found 4315 significant cis-eQTL SNP-probe set associations (3309 unique SNPs). The 3309 SNPs were tested for association with COPD in a genomewide association study (GWAS) dataset, which included 2940 COPD cases and 1380 controls. Adjusting for 3309 tests (p<1.5e-5), the two SNPs which were significantly associated with COPD were located in two separate genes in a known COPD locus on chromosome 15: CHRNA5 and IREB2. Detailed analysis of chromosome 15 demonstrated additional eQTLs for IREB2 mapping to that gene. eQTL SNPs for CHRNA5 mapped to multiple linkage disequilibrium (LD) bins. The eQTLs for IREB2 and CHRNA5 were not in LD. Seventy-four additional eQTL SNPs were associated with COPD at p<0.01. These were genotyped in two COPD populations, finding replicated associations with a SNP in PSORS1C1, in the HLA-C region on chromosome 6. Integrative analysis of GWAS and gene expression data from relevant tissue from diseased subjects has located potential functional variants in two known COPD genes and has identified a novel COPD susceptibility locus. PMID:21949713

Glucocorticoid Receptor Related Genes: Genotype And Brain Gene Expression Relationships To Suicide And Major Depressive Disorder

PubMed Central

Pantazatos, Spiro P.; Huang, Yung-yu; Rosoklija, Gorazd B.; Dwork, Andrew J.; Burke, Ainsley; Arango, Victoria; Oquendo, Maria A.; Mann, J. John

2016-01-01

Introduction We tested the relationship between genotype, gene expression and suicidal behavior and MDD in live subjects and postmortem samples for three genes, associated with the hypothalamic-pituitary-adrenal axis, suicidal behavior and major depressive disorder (MDD); FK506 binding protein 5 (FKBP5), Spindle and kinetochore-associated protein 2 (SKA2) and Glucocorticoid Receptor (NR3C1). Materials and Methods Single-nucleotide polymorphisms (SNPs) and haplotypes were tested for association with suicidal behavior and MDD in a live (N=277) and a postmortem sample (N=209). RNA-seq was used to examine gene and isoform-level brain expression postmortem (Brodmann Area 9) (N=59). Expression quantitative trait loci (eQTL) relationships were examined using a public database (UK Brain Expression Consortium). Results We identified a haplotype within the FKBP5 gene, present in 47% of the live subjects, that was associated with increased risk of suicide attempt (OR=1.58, t=6.03, p=0.014). Six SNPs on this gene, three SNPs on SKA2 and one near NR3C1 showed before-adjustment association with attempted suicide, and two SNPs of SKA2 with suicide death, but none stayed significant after adjustment for multiple testing. Only the SKA2 SNPs were related to expression in the prefrontal cortex. One NR3C1 transcript had lower expression in suicide relative to non-suicide sudden death cases (b=-0.48, SE=0.12, t=-4.02, adjusted p=0.004). Conclusion We have identified an association of FKBP5 haplotype with risk of suicide attempt and found an association between suicide and altered NR3C1 gene expression in the prefrontal cortex. Our findings further implicate hypothalamic pituitary axis dysfunction in suicidal behavior. PMID:27030168

GLUCOCORTICOID RECEPTOR-RELATED GENES: GENOTYPE AND BRAIN GENE EXPRESSION RELATIONSHIPS TO SUICIDE AND MAJOR DEPRESSIVE DISORDER.

PubMed

Yin, Honglei; Galfalvy, Hanga; Pantazatos, Spiro P; Huang, Yung-Yu; Rosoklija, Gorazd B; Dwork, Andrew J; Burke, Ainsley; Arango, Victoria; Oquendo, Maria A; Mann, J John

2016-06-01

We tested the relationship between genotype, gene expression and suicidal behavior and major depressive disorder (MDD) in live subjects and postmortem samples for three genes, associated with the hypothalamic-pituitary-adrenal axis, suicidal behavior, and MDD; FK506-binding protein 5 (FKBP5), Spindle and kinetochore-associated protein 2 (SKA2), and Glucocorticoid Receptor (NR3C1). Single-nucleotide polymorphisms (SNPs) and haplotypes were tested for association with suicidal behavior and MDD in a live (N = 277) and a postmortem sample (N = 209). RNA-seq was used to examine gene and isoform-level brain expression postmortem (Brodmann Area 9; N = 59). Expression quantitative trait loci (eQTL) relationships were examined using a public database (UK Brain Expression Consortium). We identified a haplotype within the FKBP5 gene, present in 47% of the live subjects, which was associated with increased risk of suicide attempt (OR = 1.58, t = 6.03, P = .014). Six SNPs on this gene, three SNPs on SKA2, and one near NR3C1 showed before-adjustment association with attempted suicide, and two SNPs of SKA2 with suicide death, but none stayed significant after adjustment for multiple testing. Only the SKA2 SNPs were related to expression in the prefrontal cortex (pFCTX). One NR3C1 transcript had lower expression in suicide relative to nonsuicide sudden death cases (b = -0.48, SE = 0.12, t = -4.02, adjusted P = .004). We have identified an association of FKBP5 haplotype with risk of suicide attempt and found an association between suicide and altered NR3C1 gene expression in the pFCTX. Our findings further implicate hypothalamic pituitary axis dysfunction in suicidal behavior. © 2016 Wiley Periodicals, Inc.

Integration of Population-Level Genotype Data with Functional Annotation Reveals Over-Representation of Long Noncoding RNAs at Ovarian Cancer Susceptibility Loci.

PubMed

Reid, Brett M; Permuth, Jennifer B; Chen, Y Ann; Teer, Jamie K; Monteiro, Alvaro N A; Chen, Zhihua; Tyrer, Jonathan; Berchuck, Andrew; Chenevix-Trench, Georgia; Doherty, Jennifer A; Goode, Ellen L; Iverson, Edwin S; Lawrenson, Kate; Pearce, Celeste L; Pharoah, Paul D; Phelan, Catherine M; Ramus, Susan J; Rossing, Mary Anne; Schildkraut, Joellen M; Cheng, Jin Q; Gayther, Simon A; Sellers, Thomas A

2017-01-01

Genome-wide association studies (GWAS) have identified multiple loci associated with epithelial ovarian cancer (EOC) susceptibility, but further progress requires integration of epidemiology and biology to illuminate true risk loci below genome-wide significance levels (P < 5 × 10 -8 ). Most risk SNPs lie within non-protein-encoding regions, and we hypothesize that long noncoding RNA (lncRNA) genes are enriched at EOC risk regions and represent biologically relevant functional targets. Using imputed GWAS data from about 18,000 invasive EOC cases and 34,000 controls of European ancestry, the GENCODE (v19) lncRNA database was used to annotate SNPs from 13,442 lncRNAs for permutation-based enrichment analysis. Tumor expression quantitative trait locus (eQTL) analysis was performed for sub-genome-wide regions (1 × 10 -5 > P > 5 × 10 -8 ) overlapping lncRNAs. Of 5,294 EOC-associated SNPs (P < 1.0 × 10 -5 ), 1,464 (28%) mapped within 53 unique lncRNAs and an additional 3,484 (66%) SNPs were correlated (r 2 > 0.2) with SNPs within 115 lncRNAs. EOC-associated SNPs comprised 130 independent regions, of which 72 (55%) overlapped with lncRNAs, representing a significant enrichment (P = 5.0 × 10 -4 ) that was more pronounced among a subset of 5,401 lncRNAs with active epigenetic regulation in normal ovarian tissue. EOC-associated lncRNAs and their putative promoters and transcription factors were enriched for biologically relevant pathways and eQTL analysis identified five novel putative risk regions with allele-specific effects on lncRNA gene expression. lncRNAs are significantly enriched at EOC risk regions, suggesting a mechanistic role for lncRNAs in driving predisposition to EOC. lncRNAs represent key candidates for integrative epidemiologic and functional studies. Further research on their biologic role in ovarian cancer is indicated. Cancer Epidemiol Biomarkers Prev; 26(1); 116-25. ©2016 AACR. ©2016 American Association for Cancer Research.

Whole-genome analysis of mycobacteria from birds at the San Diego Zoo.

PubMed

Pfeiffer, Wayne; Braun, Josephine; Burchell, Jennifer; Witte, Carmel L; Rideout, Bruce A

2017-01-01

Mycobacteria isolated from more than 100 birds diagnosed with avian mycobacteriosis at the San Diego Zoo and its Safari Park were cultured postmortem and had their whole genomes sequenced. Computational workflows were developed and applied to identify the mycobacterial species in each DNA sample, to find single-nucleotide polymorphisms (SNPs) between samples of the same species, to further differentiate SNPs between as many as three different genotypes within a single sample, and to identify which samples are closely clustered genomically. Nine species of mycobacteria were found in 123 samples from 105 birds. The most common species were Mycobacterium avium and Mycobacterium genavense, which were in 49 and 48 birds, respectively. Most birds contained only a single mycobacterial species, but two birds contained a mixture of two species. The M. avium samples represent diverse strains of M. avium avium and M. avium hominissuis, with many pairs of samples differing by hundreds or thousands of SNPs across their common genome. By contrast, the M. genavense samples are much closer genomically; samples from 46 of 48 birds differ from each other by less than 110 SNPs. Some birds contained two, three, or even four genotypes of the same bacterial species. Such infections were found in 4 of 49 birds (8%) with M. avium and in 11 of 48 birds (23%) with M. genavense. Most were mixed infections, in which the bird was infected by multiple mycobacterial strains, but three infections with two genotypes differing by ≤ 10 SNPs were likely the result of within-host evolution. The samples from 31 birds with M. avium can be grouped into nine clusters within which any sample is ≤ 12 SNPs from at least one other sample in the cluster. Similarly, the samples from 40 birds with M. genavense can be grouped into ten such clusters. Information about these genomic clusters is being used in an ongoing, companion study of mycobacterial transmission to help inform management of bird collections.

Whole-genome analysis of mycobacteria from birds at the San Diego Zoo

PubMed Central

Pfeiffer, Wayne; Braun, Josephine; Burchell, Jennifer; Witte, Carmel L.; Rideout, Bruce A.

2017-01-01

Methods Mycobacteria isolated from more than 100 birds diagnosed with avian mycobacteriosis at the San Diego Zoo and its Safari Park were cultured postmortem and had their whole genomes sequenced. Computational workflows were developed and applied to identify the mycobacterial species in each DNA sample, to find single-nucleotide polymorphisms (SNPs) between samples of the same species, to further differentiate SNPs between as many as three different genotypes within a single sample, and to identify which samples are closely clustered genomically. Results Nine species of mycobacteria were found in 123 samples from 105 birds. The most common species were Mycobacterium avium and Mycobacterium genavense, which were in 49 and 48 birds, respectively. Most birds contained only a single mycobacterial species, but two birds contained a mixture of two species. The M. avium samples represent diverse strains of M. avium avium and M. avium hominissuis, with many pairs of samples differing by hundreds or thousands of SNPs across their common genome. By contrast, the M. genavense samples are much closer genomically; samples from 46 of 48 birds differ from each other by less than 110 SNPs. Some birds contained two, three, or even four genotypes of the same bacterial species. Such infections were found in 4 of 49 birds (8%) with M. avium and in 11 of 48 birds (23%) with M. genavense. Most were mixed infections, in which the bird was infected by multiple mycobacterial strains, but three infections with two genotypes differing by ≤ 10 SNPs were likely the result of within-host evolution. The samples from 31 birds with M. avium can be grouped into nine clusters within which any sample is ≤ 12 SNPs from at least one other sample in the cluster. Similarly, the samples from 40 birds with M. genavense can be grouped into ten such clusters. Information about these genomic clusters is being used in an ongoing, companion study of mycobacterial transmission to help inform management of bird collections. PMID:28267758

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

Role of DISC1 interacting proteins in schizophrenia risk from genome-wide analysis of missense SNPs.

PubMed

Costas, Javier; Suárez-Rama, Jose Javier; Carrera, Noa; Paz, Eduardo; Páramo, Mario; Agra, Santiago; Brenlla, Julio; Ramos-Ríos, Ramón; Arrojo, Manuel

2013-11-01

A balanced translocation affecting DISC1 cosegregates with several psychiatric disorders, including schizophrenia, in a Scottish family. DISC1 is a hub protein of a network of protein-protein interactions involved in multiple developmental pathways within the brain. Gene set-based analysis has been proposed as an alternative to individual analysis of single nucleotide polymorphisms (SNPs) to get information from genome-wide association studies. In this work, we tested for an overrepresentation of the DISC1 interacting proteins within the top results of our ranked list of genes based on our previous genome-wide association study of missense SNPs in schizophrenia. Our data set consisted of 5100 common missense SNPs genotyped in 476 schizophrenic patients and 447 control subjects from Galicia, NW Spain. We used a modification of the Gene Set Enrichment Analysis adapted for SNPs, as implemented in the GenGen software. The analysis detected an overrepresentation of the DISC1 interacting proteins (permuted P-value=0.0158), indicative of the role of this gene set in schizophrenia risk. We identified seven leading-edge genes, MACF1, UTRN, DST, DISC1, KIF3A, SYNE1, and AKAP9, responsible for the overrepresentation. These genes are involved in neuronal cytoskeleton organization and intracellular transport through the microtubule cytoskeleton, suggesting that these processes may be impaired in schizophrenia. © 2013 John Wiley & Sons Ltd/University College London.

Generalization and dilution of association results from European GWAS in populations of non-European ancestry: the PAGE study.

PubMed

Carlson, Christopher S; Matise, Tara C; North, Kari E; Haiman, Christopher A; Fesinmeyer, Megan D; Buyske, Steven; Schumacher, Fredrick R; Peters, Ulrike; Franceschini, Nora; Ritchie, Marylyn D; Duggan, David J; Spencer, Kylee L; Dumitrescu, Logan; Eaton, Charles B; Thomas, Fridtjof; Young, Alicia; Carty, Cara; Heiss, Gerardo; Le Marchand, Loic; Crawford, Dana C; Hindorff, Lucia A; Kooperberg, Charles L

2013-09-01

The vast majority of genome-wide association study (GWAS) findings reported to date are from populations with European Ancestry (EA), and it is not yet clear how broadly the genetic associations described will generalize to populations of diverse ancestry. The Population Architecture Using Genomics and Epidemiology (PAGE) study is a consortium of multi-ancestry, population-based studies formed with the objective of refining our understanding of the genetic architecture of common traits emerging from GWAS. In the present analysis of five common diseases and traits, including body mass index, type 2 diabetes, and lipid levels, we compare direction and magnitude of effects for GWAS-identified variants in multiple non-EA populations against EA findings. We demonstrate that, in all populations analyzed, a significant majority of GWAS-identified variants have allelic associations in the same direction as in EA, with none showing a statistically significant effect in the opposite direction, after adjustment for multiple testing. However, 25% of tagSNPs identified in EA GWAS have significantly different effect sizes in at least one non-EA population, and these differential effects were most frequent in African Americans where all differential effects were diluted toward the null. We demonstrate that differential LD between tagSNPs and functional variants within populations contributes significantly to dilute effect sizes in this population. Although most variants identified from GWAS in EA populations generalize to all non-EA populations assessed, genetic models derived from GWAS findings in EA may generate spurious results in non-EA populations due to differential effect sizes. Regardless of the origin of the differential effects, caution should be exercised in applying any genetic risk prediction model based on tagSNPs outside of the ancestry group in which it was derived. Models based directly on functional variation may generalize more robustly, but the identification of functional variants remains challenging.

Generalization and Dilution of Association Results from European GWAS in Populations of Non-European Ancestry: The PAGE Study

PubMed Central

Carlson, Christopher S.; Matise, Tara C.; North, Kari E.; Haiman, Christopher A.; Fesinmeyer, Megan D.; Buyske, Steven; Schumacher, Fredrick R.; Peters, Ulrike; Franceschini, Nora; Ritchie, Marylyn D.; Duggan, David J.; Spencer, Kylee L.; Dumitrescu, Logan; Eaton, Charles B.; Thomas, Fridtjof; Young, Alicia; Carty, Cara; Heiss, Gerardo; Le Marchand, Loic; Crawford, Dana C.; Hindorff, Lucia A.; Kooperberg, Charles L.

2013-01-01

The vast majority of genome-wide association study (GWAS) findings reported to date are from populations with European Ancestry (EA), and it is not yet clear how broadly the genetic associations described will generalize to populations of diverse ancestry. The Population Architecture Using Genomics and Epidemiology (PAGE) study is a consortium of multi-ancestry, population-based studies formed with the objective of refining our understanding of the genetic architecture of common traits emerging from GWAS. In the present analysis of five common diseases and traits, including body mass index, type 2 diabetes, and lipid levels, we compare direction and magnitude of effects for GWAS-identified variants in multiple non-EA populations against EA findings. We demonstrate that, in all populations analyzed, a significant majority of GWAS-identified variants have allelic associations in the same direction as in EA, with none showing a statistically significant effect in the opposite direction, after adjustment for multiple testing. However, 25% of tagSNPs identified in EA GWAS have significantly different effect sizes in at least one non-EA population, and these differential effects were most frequent in African Americans where all differential effects were diluted toward the null. We demonstrate that differential LD between tagSNPs and functional variants within populations contributes significantly to dilute effect sizes in this population. Although most variants identified from GWAS in EA populations generalize to all non-EA populations assessed, genetic models derived from GWAS findings in EA may generate spurious results in non-EA populations due to differential effect sizes. Regardless of the origin of the differential effects, caution should be exercised in applying any genetic risk prediction model based on tagSNPs outside of the ancestry group in which it was derived. Models based directly on functional variation may generalize more robustly, but the identification of functional variants remains challenging. PMID:24068893

PGen: large-scale genomic variations analysis workflow and browser in SoyKB.

PubMed

Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti

2016-10-06

With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most efficient analysis of soybean data using thorough testing and validation. This research serves as an example of best practices for development of genomics data analysis workflows by integrating remote HPC resources and efficient data management with ease of use for biological users. PGen workflow can also be easily customized for analysis of data in other species.

The more from East-Asian, the better: risk prediction of colorectal cancer risk by GWAS-identified SNPs among Japanese.

PubMed

Abe, Makiko; Ito, Hidemi; Oze, Isao; Nomura, Masatoshi; Ogawa, Yoshihiro; Matsuo, Keitaro

2017-12-01

Little is known about the difference of genetic predisposition for CRC between ethnicities; however, many genetic traits common to colorectal cancer have been identified. This study investigated whether more SNPs identified in GWAS in East Asian population could improve the risk prediction of Japanese and explored possible application of genetic risk groups as an instrument of the risk communication. 558 Patients histologically verified colorectal cancer and 1116 first-visit outpatients were included for derivation study, and 547 cases and 547 controls were for replication study. Among each population, we evaluated prediction models for the risk of CRC that combined the genetic risk group based on SNPs from GWASs in European-population and a similarly developed model adding SNPs from GWASs in East Asian-population. We examined whether adding East Asian-specific SNPs would improve the discrimination. Six SNPs (rs6983267, rs4779584, rs4444235, rs9929218, rs10936599, rs16969681) from 23 SNPs by European-based GWAS and five SNPs (rs704017, rs11196172, rs10774214, rs647161, rs2423279) among ten SNPs by Asian-based GWAS were selected in CRC risk prediction model. Compared with a 6-SNP-based model, an 11-SNP model including Asian GWAS-SNPs showed improved discrimination capacity in Receiver operator characteristic analysis. A model with 11 SNPs resulted in statistically significant improvement in both derivation (P = 0.0039) and replication studies (P = 0.0018) compared with six SNP model. We estimated cumulative risk of CRC by using genetic risk group based on 11 SNPs and found that the cumulative risk at age 80 is approximately 13% in the high-risk group while 6% in the low-risk group. We constructed a more efficient CRC risk prediction model with 11 SNPs including newly identified East Asian-based GWAS SNPs (rs704017, rs11196172, rs10774214, rs647161, rs2423279). Risk grouping based on 11 SNPs depicted lifetime difference of CRC risk. This might be useful for effective individualized prevention for East Asian.

In silico identification of genetic variants in glucocerebrosidase (GBA) gene involved in Gaucher's disease using multiple software tools.

PubMed

Manickam, Madhumathi; Ravanan, Palaniyandi; Singh, Pratibha; Talwar, Priti

2014-01-01

Gaucher's disease (GD) is an autosomal recessive disorder caused by the deficiency of glucocerebrosidase, a lysosomal enzyme that catalyses the hydrolysis of the glycolipid glucocerebroside to ceramide and glucose. Polymorphisms in GBA gene have been associated with the development of Gaucher disease. We hypothesize that prediction of SNPs using multiple state of the art software tools will help in increasing the confidence in identification of SNPs involved in GD. Enzyme replacement therapy is the only option for GD. Our goal is to use several state of art SNP algorithms to predict/address harmful SNPs using comparative studies. In this study seven different algorithms (SIFT, MutPred, nsSNP Analyzer, PANTHER, PMUT, PROVEAN, and SNPs&GO) were used to predict the harmful polymorphisms. Among the seven programs, SIFT found 47 nsSNPs as deleterious, MutPred found 46 nsSNPs as harmful. nsSNP Analyzer program found 43 out of 47 nsSNPs are disease causing SNPs whereas PANTHER found 32 out of 47 as highly deleterious, 22 out of 47 are classified as pathological mutations by PMUT, 44 out of 47 were predicted to be deleterious by PROVEAN server, all 47 shows the disease related mutations by SNPs&GO. Twenty two nsSNPs were commonly predicted by all the seven different algorithms. The common 22 targeted mutations are F251L, C342G, W312C, P415R, R463C, D127V, A309V, G46E, G202E, P391L, Y363C, Y205C, W378C, I402T, S366R, F397S, Y418C, P401L, G195E, W184R, R48W, and T43R.

Deep Resequencing Unveils Genetic Architecture of ADIPOQ and Identifies a Novel Low-Frequency Variant Strongly Associated With Adiponectin Variation

PubMed Central

Warren, Liling L.; Li, Li; Nelson, Matthew R.; Ehm, Margaret G.; Shen, Judong; Fraser, Dana J.; Aponte, Jennifer L.; Nangle, Keith L.; Slater, Andrew J.; Woollard, Peter M.; Hall, Matt D.; Topp, Simon D.; Yuan, Xin; Cardon, Lon R.; Chissoe, Stephanie L.; Mooser, Vincent; Morris, Andrew D.; Palmer, Colin N.A.; Perry, John R.; Frayling, Timothy M.; Whittaker, John C.; Waterworth, Dawn M.

2012-01-01

Increased adiponectin levels have been shown to be associated with a lower risk of type 2 diabetes. To understand the relations between genetic variation at the adiponectin-encoding gene, ADIPOQ, and adiponectin levels, and subsequently its role in disease, we conducted a deep resequencing experiment of ADIPOQ in 14,002 subjects, including 12,514 Europeans, 594 African Americans, and 567 Indian Asians. We identified 296 single nucleotide polymorphisms (SNPs), including 30 amino acid changes, and carried out association analyses in a subset of 3,665 subjects from two independent studies. We confirmed multiple genome-wide association study findings and identified a novel association between a low-frequency SNP (rs17366653) and adiponectin levels (P = 2.2E–17). We show that seven SNPs exert independent effects on adiponectin levels. Together, they explained 6% of adiponectin variation in our samples. We subsequently assessed association between these SNPs and type 2 diabetes in the Genetics of Diabetes Audit and Research in Tayside Scotland (GO-DARTS) study, comprised of 5,145 case and 6,374 control subjects. No evidence of association with type 2 diabetes was found, but we were also unable to exclude the possibility of substantial effects (e.g., odds ratio 95% CI for rs7366653 [0.91–1.58]). Further investigation by large-scale and well-powered Mendelian randomization studies is warranted. PMID:22403302

A genome-wide association scan for acute insulin response to glucose in Hispanic Americans: The IRAS Family Study

PubMed Central

Rich, S. S.; Goodarzi, M. O.; Palmer, N. D.; Langefeld, C. D.; Ziegler, J.; Haffner, S. M.; Bryer-Ash, M.; Norris, J. M.; Taylor, K. D.; Haritunians, T.; Rotter, J. I.; Chen, Y-D. I.; Wagenknecht, L. E.; Bowden, D. W.; Bergman, R. N.

2009-01-01

Aims/Hypothesis The goal of this study was to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). Methods A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 318K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples (from 34 families) from San Antonio, TX. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. Results No individual SNP achieved genome-wide levels of significance (P < 5 × 10-7); however, two regions — chromosomes 6p21 and 20p11 — had multiple highly-ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence for variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21 while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and R4-691N24.1). Conclusions/Interpretation A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport and provide preliminary evidence that these processes have importance in beta cell response. PMID:19430760

Genetic neuropathology of obsessive psychiatric syndromes

PubMed Central

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-01-01

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets. PMID:25180571

Genetic neuropathology of obsessive psychiatric syndromes.

PubMed

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-09-02

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets.

A genome-wide association scan for acute insulin response to glucose in Hispanic-Americans: the Insulin Resistance Atherosclerosis Family Study (IRAS FS).

PubMed

Rich, S S; Goodarzi, M O; Palmer, N D; Langefeld, C D; Ziegler, J; Haffner, S M; Bryer-Ash, M; Norris, J M; Taylor, K D; Haritunians, T; Rotter, J I; Chen, Y-D I; Wagenknecht, L E; Bowden, D W; Bergman, R N

2009-07-01

This study sought to identify genes and regions in the human genome that are associated with the acute insulin response to glucose (AIRg), an important predictor of type 2 diabetes, in Hispanic-American participants from the Insulin Resistance Atherosclerosis Family Study (IRAS FS). A two-stage genome-wide association scan (GWAS) was performed in IRAS FS Hispanic-American samples. In the first stage, 317K single nucleotide polymorphisms (SNPs) were assessed in 229 Hispanic-American DNA samples from 34 families from San Antonio, TX, USA. SNPs with the most significant associations with AIRg were genotyped in the entire set of IRAS FS Hispanic-American samples (n = 1,190). In chromosomal regions with evidence of association, additional SNPs were genotyped to capture variation in genes. No individual SNP achieved genome-wide levels of significance (p < 5 x 10(-7)); however, two regions (chromosomes 6p21 and 20p11) had multiple highly ranked SNPs that were associated with AIRg. Additional genotyping in these regions supported the initial evidence of variants contributing to variation in AIRg. One region resides in a gene desert between PXT1 and KCTD20 on 6p21, while the region on 20p11 has several viable candidate genes (ENTPD6, PYGB, GINS1 and RP4-691N24.1). A GWAS in Hispanic-American samples identified several candidate genes and loci that may be associated with AIRg. These associations explain a small component of variation in AIRg. The genes identified are involved in phosphorylation and ion transport, and provide preliminary evidence that these processes are important in beta cell response.

Network-Assisted Investigation of Combined Causal Signals from Genome-Wide Association Studies in Schizophrenia

PubMed Central

Jia, Peilin; Wang, Lily; Fanous, Ayman H.; Pato, Carlos N.; Edwards, Todd L.; Zhao, Zhongming

2012-01-01

With the recent success of genome-wide association studies (GWAS), a wealth of association data has been accomplished for more than 200 complex diseases/traits, proposing a strong demand for data integration and interpretation. A combinatory analysis of multiple GWAS datasets, or an integrative analysis of GWAS data and other high-throughput data, has been particularly promising. In this study, we proposed an integrative analysis framework of multiple GWAS datasets by overlaying association signals onto the protein-protein interaction network, and demonstrated it using schizophrenia datasets. Building on a dense module search algorithm, we first searched for significantly enriched subnetworks for schizophrenia in each single GWAS dataset and then implemented a discovery-evaluation strategy to identify module genes with consistent association signals. We validated the module genes in an independent dataset, and also examined them through meta-analysis of the related SNPs using multiple GWAS datasets. As a result, we identified 205 module genes with a joint effect significantly associated with schizophrenia; these module genes included a number of well-studied candidate genes such as DISC1, GNA12, GNA13, GNAI1, GPR17, and GRIN2B. Further functional analysis suggested these genes are involved in neuronal related processes. Additionally, meta-analysis found that 18 SNPs in 9 module genes had P meta<1×10−4, including the gene HLA-DQA1 located in the MHC region on chromosome 6, which was reported in previous studies using the largest cohort of schizophrenia patients to date. These results demonstrated our bi-directional network-based strategy is efficient for identifying disease-associated genes with modest signals in GWAS datasets. This approach can be applied to any other complex diseases/traits where multiple GWAS datasets are available. PMID:22792057

Multiple signals at the extended 8p23 locus are associated with susceptibility to systemic lupus erythematosus.

PubMed

Demirci, F Yesim; Wang, Xingbin; Morris, David L; Feingold, Eleanor; Bernatsky, Sasha; Pineau, Christian; Clarke, Ann; Ramsey-Goldman, Rosalind; Manzi, Susan; Vyse, Timothy J; Kamboh, M I

2017-06-01

A major systemic lupus erythematosus (SLE) susceptibility locus lies within a common inversion polymorphism region (encompassing 3.8 - 4.5  Mb) located at 8p23. Initially implicated genes included FAM167A-BLK and XKR6 , of which BLK received major attention due to its known role in B-cell biology. Recently, additional SLE risk carried in non-inverted background was also reported. In this case -control study, we further investigated the 'extended' 8p23 locus (~ 4  Mb) where we observed multiple SLE signals and assessed these signals for their relation to the inversion affecting this region. The study involved a North American discovery data set ( ~ 1200  subjects) and a replication data set (> 10 000  subjects) comprising European-descent individuals. Meta-analysis of 8p23 SNPs, with p < 0.05 in both data sets, identified 51 genome-wide significant SNPs (p < 5.0 × 10 -8 ). While most of these SNPs were related to previously implicated signals ( XKR6-FAM167A-BLK subregion), our results also revealed two 'new' SLE signals, including SGK223-CLDN23-MFHAS1 (6.06 × 10 -9 ≤ meta p ≤ 4.88 × 10 -8 ) and CTSB (meta p = 4.87 × 10 -8 ) subregions that are located > 2 Mb upstream and ~ 0.3  Mb downstream from previously reported signals. Functional assessment of relevant SNPs indicated putative cis -effects on the expression of various genes at 8p23. Additional analyses in discovery sample, where the inversion genotypes were inferred, replicated the association of non-inverted status with SLE risk and suggested that a number of SLE risk alleles are predominantly carried in non-inverted background. Our results implicate multiple (known+novel) SLE signals/genes at the extended 8p23 locus, beyond previously reported signals/genes, and suggest that this broad locus contributes to SLE risk through the effects of multiple genes/pathways. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Mendelian randomization of blood lipids for coronary heart disease

PubMed Central

Holmes, Michael V.; Asselbergs, Folkert W.; Palmer, Tom M.; Drenos, Fotios; Lanktree, Matthew B.; Nelson, Christopher P.; Dale, Caroline E.; Padmanabhan, Sandosh; Finan, Chris; Swerdlow, Daniel I.; Tragante, Vinicius; van Iperen, Erik P.A.; Sivapalaratnam, Suthesh; Shah, Sonia; Elbers, Clara C.; Shah, Tina; Engmann, Jorgen; Giambartolomei, Claudia; White, Jon; Zabaneh, Delilah; Sofat, Reecha; McLachlan, Stela; Doevendans, Pieter A.; Balmforth, Anthony J.; Hall, Alistair S.; North, Kari E.; Almoguera, Berta; Hoogeveen, Ron C.; Cushman, Mary; Fornage, Myriam; Patel, Sanjay R.; Redline, Susan; Siscovick, David S.; Tsai, Michael Y.; Karczewski, Konrad J.; Hofker, Marten H.; Verschuren, W. Monique; Bots, Michiel L.; van der Schouw, Yvonne T.; Melander, Olle; Dominiczak, Anna F.; Morris, Richard; Ben-Shlomo, Yoav; Price, Jackie; Kumari, Meena; Baumert, Jens; Peters, Annette; Thorand, Barbara; Koenig, Wolfgang; Gaunt, Tom R.; Humphries, Steve E.; Clarke, Robert; Watkins, Hugh; Farrall, Martin; Wilson, James G.; Rich, Stephen S.; de Bakker, Paul I.W.; Lange, Leslie A.; Davey Smith, George; Reiner, Alex P.; Talmud, Philippa J.; Kivimäki, Mika; Lawlor, Debbie A.; Dudbridge, Frank; Samani, Nilesh J.; Keating, Brendan J.; Hingorani, Aroon D.; Casas, Juan P.

2015-01-01

Aims To investigate the causal role of high-density lipoprotein cholesterol (HDL-C) and triglycerides in coronary heart disease (CHD) using multiple instrumental variables for Mendelian randomization. Methods and results We developed weighted allele scores based on single nucleotide polymorphisms (SNPs) with established associations with HDL-C, triglycerides, and low-density lipoprotein cholesterol (LDL-C). For each trait, we constructed two scores. The first was unrestricted, including all independent SNPs associated with the lipid trait identified from a prior meta-analysis (threshold P < 2 × 10−6); and the second a restricted score, filtered to remove any SNPs also associated with either of the other two lipid traits at P ≤ 0.01. Mendelian randomization meta-analyses were conducted in 17 studies including 62,199 participants and 12,099 CHD events. Both the unrestricted and restricted allele scores for LDL-C (42 and 19 SNPs, respectively) associated with CHD. For HDL-C, the unrestricted allele score (48 SNPs) was associated with CHD (OR: 0.53; 95% CI: 0.40, 0.70), per 1 mmol/L higher HDL-C, but neither the restricted allele score (19 SNPs; OR: 0.91; 95% CI: 0.42, 1.98) nor the unrestricted HDL-C allele score adjusted for triglycerides, LDL-C, or statin use (OR: 0.81; 95% CI: 0.44, 1.46) showed a robust association. For triglycerides, the unrestricted allele score (67 SNPs) and the restricted allele score (27 SNPs) were both associated with CHD (OR: 1.62; 95% CI: 1.24, 2.11 and 1.61; 95% CI: 1.00, 2.59, respectively) per 1-log unit increment. However, the unrestricted triglyceride score adjusted for HDL-C, LDL-C, and statin use gave an OR for CHD of 1.01 (95% CI: 0.59, 1.75). Conclusion The genetic findings support a causal effect of triglycerides on CHD risk, but a causal role for HDL-C, though possible, remains less certain. PMID:24474739

Mendelian randomization of blood lipids for coronary heart disease.

PubMed

Holmes, Michael V; Asselbergs, Folkert W; Palmer, Tom M; Drenos, Fotios; Lanktree, Matthew B; Nelson, Christopher P; Dale, Caroline E; Padmanabhan, Sandosh; Finan, Chris; Swerdlow, Daniel I; Tragante, Vinicius; van Iperen, Erik P A; Sivapalaratnam, Suthesh; Shah, Sonia; Elbers, Clara C; Shah, Tina; Engmann, Jorgen; Giambartolomei, Claudia; White, Jon; Zabaneh, Delilah; Sofat, Reecha; McLachlan, Stela; Doevendans, Pieter A; Balmforth, Anthony J; Hall, Alistair S; North, Kari E; Almoguera, Berta; Hoogeveen, Ron C; Cushman, Mary; Fornage, Myriam; Patel, Sanjay R; Redline, Susan; Siscovick, David S; Tsai, Michael Y; Karczewski, Konrad J; Hofker, Marten H; Verschuren, W Monique; Bots, Michiel L; van der Schouw, Yvonne T; Melander, Olle; Dominiczak, Anna F; Morris, Richard; Ben-Shlomo, Yoav; Price, Jackie; Kumari, Meena; Baumert, Jens; Peters, Annette; Thorand, Barbara; Koenig, Wolfgang; Gaunt, Tom R; Humphries, Steve E; Clarke, Robert; Watkins, Hugh; Farrall, Martin; Wilson, James G; Rich, Stephen S; de Bakker, Paul I W; Lange, Leslie A; Davey Smith, George; Reiner, Alex P; Talmud, Philippa J; Kivimäki, Mika; Lawlor, Debbie A; Dudbridge, Frank; Samani, Nilesh J; Keating, Brendan J; Hingorani, Aroon D; Casas, Juan P

2015-03-01

To investigate the causal role of high-density lipoprotein cholesterol (HDL-C) and triglycerides in coronary heart disease (CHD) using multiple instrumental variables for Mendelian randomization. We developed weighted allele scores based on single nucleotide polymorphisms (SNPs) with established associations with HDL-C, triglycerides, and low-density lipoprotein cholesterol (LDL-C). For each trait, we constructed two scores. The first was unrestricted, including all independent SNPs associated with the lipid trait identified from a prior meta-analysis (threshold P < 2 × 10(-6)); and the second a restricted score, filtered to remove any SNPs also associated with either of the other two lipid traits at P ≤ 0.01. Mendelian randomization meta-analyses were conducted in 17 studies including 62,199 participants and 12,099 CHD events. Both the unrestricted and restricted allele scores for LDL-C (42 and 19 SNPs, respectively) associated with CHD. For HDL-C, the unrestricted allele score (48 SNPs) was associated with CHD (OR: 0.53; 95% CI: 0.40, 0.70), per 1 mmol/L higher HDL-C, but neither the restricted allele score (19 SNPs; OR: 0.91; 95% CI: 0.42, 1.98) nor the unrestricted HDL-C allele score adjusted for triglycerides, LDL-C, or statin use (OR: 0.81; 95% CI: 0.44, 1.46) showed a robust association. For triglycerides, the unrestricted allele score (67 SNPs) and the restricted allele score (27 SNPs) were both associated with CHD (OR: 1.62; 95% CI: 1.24, 2.11 and 1.61; 95% CI: 1.00, 2.59, respectively) per 1-log unit increment. However, the unrestricted triglyceride score adjusted for HDL-C, LDL-C, and statin use gave an OR for CHD of 1.01 (95% CI: 0.59, 1.75). The genetic findings support a causal effect of triglycerides on CHD risk, but a causal role for HDL-C, though possible, remains less certain. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Cardiology.

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Genomic predictors of the maximal O2 uptake response to standardized exercise training programs

PubMed Central

Sarzynski, Mark A.; Rice, Treva K.; Kraus, William E.; Church, Timothy S.; Sung, Yun Ju; Rao, D. C.; Rankinen, Tuomo

2011-01-01

Low cardiorespiratory fitness is a powerful predictor of morbidity and cardiovascular mortality. In 473 sedentary adults, all whites, from 99 families of the Health, Risk Factors, Exercise Training, and Genetics (HERITAGE) Family Study, the heritability of gains in maximal O2 uptake (V̇o2max) after exposure to a standardized 20-wk exercise program was estimated at 47%. A genome-wide association study based on 324,611 single-nucleotide polymorphisms (SNPs) was undertaken to identify SNPs associated with improvements in V̇o2max Based on single-SNP analysis, 39 SNPs were associated with the gains with P < 1.5 × 10−4. Stepwise multiple regression analysis of the 39 SNPs identified a panel of 21 SNPs that accounted for 49% of the variance in V̇o2max trainability. Subjects who carried ≤9 favorable alleles at these 21 SNPs improved their V̇o2max by 221 ml/min, whereas those who carried ≥19 of these alleles gained, on average, 604 ml/min. The strongest association was with rs6552828, located in the acyl-CoA synthase long-chain member 1 (ACSL1) gene, which accounted by itself for ∼6% of the training response of V̇o2max. The genes nearest to the SNPs that were the strongest predictors were PR domain-containing 1 with ZNF domain (PRDM1); glutamate receptor, ionotropic, N-methyl-d-aspartate 3A (GRIN3A); K+ channel, voltage gated, subfamily H, member 8 (KCNH8); and zinc finger protein of the cerebellum 4 (ZIC4). The association with the SNP nearest to ZIC4 was replicated in 40- to 65-yr-old, sedentary, overweight, and dyslipidemic subjects trained in Studies of a Targeted Risk Reduction Intervention Through Defined Exercise (STRRIDE; n = 183). Two SNPs were replicated in sedentary obese white women exercise trained in the Dose Response to Exercise (DREW) study (n = 112): rs1956197 near dishevelled associated activator of morphogenesis 1 (DAAM1) and rs17117533 in the vicinity of necdin (NDN). The association of SNPs rs884736 in the calmodulin-binding transcription activator 1 (CAMTA1) locus and rs17581162 ∼68 kb upstream from regulator of G protein signaling 18 (RGS18) with the gains in V̇o2max in HERITAGE whites were replicated in HERITAGE blacks (n = 247). These genomic predictors of the response of V̇o2max to regular exercise provide new targets for the study of the biology of fitness and its adaptation to regular exercise. Large-scale replication studies are warranted. PMID:21183627

Association of interleukin-1 gene variations with moderate to severe chronic periodontitis in multiple ethnicities

PubMed Central

Wu, X; Offenbacher, S; Lόpez, N J; Chen, D; Wang, H-Y; Rogus, J; Zhou, J; Beck, J; Jiang, S; Bao, X; Wilkins, L; Doucette-Stamm, L; Kornman, K

2015-01-01

Background and Objective Genetic markers associated with disease are often non-functional and generally tag one or more functional “causative” variants in linkage disequilibrium. Markers may not show tight linkage to the causative variants across multiple ethnicities due to evolutionary divergence, and therefore may not be informative across different population groups. Validated markers of disease suggest causative variants exist in the gene and, if the causative variants can be identified, it is reasonable to hypothesize that such variants will be informative across diverse populations. The aim of this study was to test that hypothesis using functional Interleukin-1 (IL-1) gene variations across multiple ethnic populations to replace the non-functional markers originally associated with chronic adult periodontitis in Caucasians. Material and Methods Adult chronic periodontitis cases and controls from four ethnic groups (Caucasians, African Americans, Hispanics and Asians) were recruited in the USA, Chile and China. Genotypes of IL1B gene single nucleotide polymorphisms (SNPs), including three functional SNPs (rs16944, rs1143623, rs4848306) in the promoter and one intronic SNP (rs1143633), were determined using a single base extension method or TaqMan 5′ nuclease assay. Logistic regression and other statistical analyses were used to examine the association between moderate to severe periodontitis and IL1B gene variations, including SNPs, haplotypes and composite genotypes. Genotype patterns associated with disease in the discovery study were then evaluated in independent validation studies. Results Significant associations were identified in the discovery study, consisting of Caucasians and African Americans, between moderate to severe adult chronic periodontitis and functional variations in the IL1B gene, including a pattern of four IL1B SNPs (OR = 1.87, p < 0.0001). The association between the disease and this IL1B composite genotype pattern was validated in two additional studies consisting of Hispanics (OR = 1.95, p = 0.04) or Asians (OR = 3.27, p = 0.01). A meta-analysis of the three populations supported the association between the IL-1 genotype pattern and moderate to severe periodontitis (OR 1.95; p < 0.001). Our analysis also demonstrated that IL1B gene variations had added value to conventional risk factors in predicting chronic periodontitis. Conclusion This study validated the influence of IL-1 genetic factors on the severity of chronic periodontitis in four different ethnicities. PMID:24690098

Inferring Alcoholism SNPs and Regulatory Chemical Compounds Based on Ensemble Bayesian Network.

PubMed

Chen, Huan; Sun, Jiatong; Jiang, Hong; Wang, Xianyue; Wu, Lingxiang; Wu, Wei; Wang, Qh

2017-01-01

The disturbance of consciousness is one of the most common symptoms of those have alcoholism and may cause disability and mortality. Previous studies indicated that several single nucleotide polymorphisms (SNP) increase the susceptibility of alcoholism. In this study, we utilized the Ensemble Bayesian Network (EBN) method to identify causal SNPs of alcoholism based on the verified GAW14 data. We built a Bayesian network combining random process and greedy search by using Genetic Analysis Workshop 14 (GAW14) dataset to establish EBN of SNPs. Then we predicted the association between SNPs and alcoholism by determining Bayes' prior probability. Thirteen out of eighteen SNPs directly connected with alcoholism were found concordance with potential risk regions of alcoholism in OMIM database. As many SNPs were found contributing to alteration on gene expression, known as expression quantitative trait loci (eQTLs), we further sought to identify chemical compounds acting as regulators of alcoholism genes captured by causal SNPs. Chloroprene and valproic acid were identified as the expression regulators for genes C11orf66 and SALL3 which were captured by alcoholism SNPs, respectively. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Human longevity and variation in GH/IGF-1/insulin signaling, DNA damage signaling and repair and pro/antioxidant pathway genes: cross sectional and longitudinal studies.

PubMed

Soerensen, Mette; Dato, Serena; Tan, Qihua; Thinggaard, Mikael; Kleindorp, Rabea; Beekman, Marian; Jacobsen, Rune; Suchiman, H Eka D; de Craen, Anton J M; Westendorp, Rudi G J; Schreiber, Stefan; Stevnsner, Tinna; Bohr, Vilhelm A; Slagboom, P Eline; Nebel, Almut; Vaupel, James W; Christensen, Kaare; McGue, Matt; Christiansen, Lene

2012-05-01

Here we explore association with human longevity of common genetic variation in three major candidate pathways: GH/IGF-1/insulin signaling, DNA damage signaling and repair and pro/antioxidants by investigating 1273 tagging SNPs in 148 genes composing these pathways. In a case-control study of 1089 oldest-old (age 92-93) and 736 middle-aged Danes we found 1 pro/antioxidant SNP (rs1002149 (GSR)), 5 GH/IGF-1/INS SNPs (rs1207362 (KL), rs2267723 (GHRHR), rs3842755 (INS), rs572169 (GHSR), rs9456497 (IGF2R)) and 5 DNA repair SNPs (rs11571461 (RAD52), rs13251813 (WRN), rs1805329 (RAD23B), rs2953983 (POLB), rs3211994 (NTLH1)) to be associated with longevity after correction for multiple testing. In a longitudinal study with 11 years of follow-up on survival in the oldest-old Danes we found 2 pro/antioxidant SNPs (rs10047589 (TNXRD1), rs207444 (XDH)), 1 GH/IGF-1/INS SNP (rs26802 (GHRL)) and 3 DNA repair SNPs (rs13320360 (MLH1), rs2509049 (H2AFX) and rs705649 (XRCC5)) to be associated with mortality in late life after correction for multiple testing. When examining the 11 SNPs from the case-control study in the longitudinal data, rs3842755 (INS), rs13251813 (WRN) and rs3211994 (NTHL1) demonstrated the same directions of effect (p<0.05), while rs9456497 (IGF2R) and rs1157146 (RAD52) showed non-significant tendencies, indicative of effects also in late life survival. In addition, rs207444 (XDH) presented the same direction of effect when inspecting the 6 SNPs from the longitudinal study in the case-control data, hence, suggesting an effect also in survival from middle age to old age. No formal replications were observed when investigating the 11 SNPs from the case-control study in 1613 oldest-old (age 95-110) and 1104 middle-aged Germans, although rs11571461 (RAD52) did show a supportive non-significant tendency (OR=1.162, 95% CI=0.927-1.457). The same was true for rs10047589 (TNXRD1) (HR=0.758, 95%CI=0.543-1.058) when examining the 6 SNPs from the longitudinal study in a Dutch longitudinal cohort of oldest-old (age 85+, N=563). In conclusion, the present candidate gene based association study, the largest to date applying a pathway approach, not only points to potential new longevity loci, but also underlines the difficulties of replicating association findings in independent study populations and thus the difficulties in identifying universal longevity polymorphisms. Copyright © 2012 Elsevier Inc. All rights reserved.

Dissection of genetic architecture of rice plant height and heading date by multiple-strategy-based association studies

PubMed Central

Zhou, Liyuan; Liu, Shouye; Wu, Weixun; Chen, Daibo; Zhan, Xiaodeng; Zhu, Aike; Zhang, Yingxin; Cheng, Shihua; Cao, Liyong; Lou, Xiangyang; Xu, Haiming

2016-01-01

Xieyou9308 is a certified super hybrid rice cultivar with a high grain yield. To investigate its underlying genetic basis of high yield potential, a recombinant inbred line (RIL) population derived from the cross between the maintainer line XieqingzaoB (XQZB) and the restorer line Zhonghui9308 (ZH9308) was constructed for identification of quantitative trait SNPs (QTSs) associated with two important agronomic traits, plant height (PH) and heading date (HD). By re-sequencing of 138 recombinant inbred lines (RILs), a total of ~0.7 million SNPs were identified for the association studies on the PH and HD. Three association mapping strategies (including hypothesis-free genome-wide association and its two complementary hypothesis-engaged ones, QTL-based association and gene-based association) were adopted for data analysis. Using a saturated mixed linear model including epistasis and environmental interaction, we identified a total of 31 QTSs associated with either the PH or the HD. The total estimated heritability across three analyses ranged from 37.22% to 45.63% and from 37.53% to 55.96% for the PH and HD, respectively. In this study we examined the feasibility of association studies in an experimental population (RIL) and identified several common loci through multiple strategies which could be preferred candidates for further research. PMID:27406081

Racial/Ethnic Disparities in Inflammatory Gene SNPs as Predictors of High Risk for Symptom Burden in Patients with Multiple Myeloma 1 Year Post-Diagnosis

PubMed Central

Shi, Qiuling; Wang, Xin Shelley; Li, Guojun; Shah, Nina D.; Orlowski, Robert Z.; Williams, Loretta A.; Mendoza, Tito R.; Cleeland, Charles S.

2015-01-01

Background We conducted a study to determine whether any regulatory single-nucleotide polymorphism (SNP) in an inflammatory gene was associated with high symptom burden in patients 1 year after diagnosis with multiple myeloma (MM). Methods MM patients rated symptoms using the MD Anderson Symptom Inventory (MDASI)-MM module and provided buccal-swab DNA samples. SNPs for 4 cytokine genes (IL6 –174G>C, IL1β –511C>T, TNFα –308G>A, IL10 –1082G>A) were tested. Logistic regression models were used to identify SNPs that might predict moderate/severe symptoms (rated ≥4 on the MDASI-MM’s 0–10 scale). To evaluate the relationship between SNPs and overall symptom burden, we used 2-step cluster analysis to divide patients into subgroups with high or low symptom levels. Results Of the 344 patients enrolled, 41% had high overall symptom burden. The most prevalent moderate/severe symptoms were fatigue (47%), pain (42%), numbness (38%), and bone aches (32%). For non-Hispanic whites, the IL1β –511 CC genotype was associated with high overall symptom burden (OR, 2.35; 95% CI, 1.25–4.72; P = .004), while IL6 –174 GG genotype predicted less moderate/severe fatigue (OR, 0.53; 95% CI, 0.29–0.88; P = .013). For other patients, IL6 –174 GG genotype predicted moderate/severe pain (OR, 3.36; 95% CI 1.23–13.64; P = .010). Conclusions Our results support growing evidence that inflammation is associated with cancer-related symptoms and suggest that racial/ethnic factors contribute to this association. PMID:25469832

LINGO1 rs9652490 and rs11856808 polymorphisms are not associated with risk for multiple sclerosis

PubMed Central

2013-01-01

Background Some recent experimental data suggest a possible role of LINGO-1 in the pathogenesis of multiple sclerosis (MS). In an attempt to identify genetic biomarkers related to MS susceptibility, we genotyped two common SNPs in the LINGO1 gene which have been associated to other neurological conditions, in patients with MS and in healthy subjects. These SNPs are linked to several SNPs within the LINGO1 gene, especially in individuals of Oriental or Caucasian descent. Methods We analyzed the allelic and genotype frequency of two LINGO1 variants (rs9652490 and rs11856808) in 293 patients with MS and 318 healthy controls, using KASPar assays. Results LINGO1 rs9652490 and rs11856808 allelic and genotype frequencies did not differ significantly between MS patients and controls. The minor allele frequencies for rs9652490 were 0.171 (95% CI = 0.140-0.201) and 0.167 (95% CI = 0.138-0.196 for cases and controls respectively (p = 0.853). For rs11856808 the minor allele frequencies were 0.317 (95% CI = 0.280-0.355) and 0.310 (95% CI = 0.274-0.346) for cases and controls, respectively (p = 0.773). Allele and genotype frequencies were unrelated with the age of onset of MS, gender, and clinical course of MS. In addition, haplotype analyses did not reveal any putative risk related to haplotypes. Conclusions These results suggest that LINGO1 rs9652490 and rs11856808 polymorphisms are not related with risk for MS. This study adds to other published evidence indicating that, to date, the LINGO1 SNPs studied here could be useful risk biomarkers of developing essential tremor, but not other movement disorders. PMID:23574883

ICSNPathway: identify candidate causal SNPs and pathways from genome-wide association study by one analytical framework.

PubMed

Zhang, Kunlin; Chang, Suhua; Cui, Sijia; Guo, Liyuan; Zhang, Liuyan; Wang, Jing

2011-07-01

Genome-wide association study (GWAS) is widely utilized to identify genes involved in human complex disease or some other trait. One key challenge for GWAS data interpretation is to identify causal SNPs and provide profound evidence on how they affect the trait. Currently, researches are focusing on identification of candidate causal variants from the most significant SNPs of GWAS, while there is lack of support on biological mechanisms as represented by pathways. Although pathway-based analysis (PBA) has been designed to identify disease-related pathways by analyzing the full list of SNPs from GWAS, it does not emphasize on interpreting causal SNPs. To our knowledge, so far there is no web server available to solve the challenge for GWAS data interpretation within one analytical framework. ICSNPathway is developed to identify candidate causal SNPs and their corresponding candidate causal pathways from GWAS by integrating linkage disequilibrium (LD) analysis, functional SNP annotation and PBA. ICSNPathway provides a feasible solution to bridge the gap between GWAS and disease mechanism study by generating hypothesis of SNP → gene → pathway(s). The ICSNPathway server is freely available at http://icsnpathway.psych.ac.cn/.

Caucasian Families Exhibit Significant Linkage of Myopia to Chromosome 11p.

PubMed

Musolf, Anthony M; Simpson, Claire L; Moiz, Bilal A; Long, Kyle A; Portas, Laura; Murgia, Federico; Ciner, Elise B; Stambolian, Dwight; Bailey-Wilson, Joan E

2017-07-01

Myopia is a common visual disorder caused by eye overgrowth, resulting in blurry vision. It affects one in four Americans, and its prevalence is increasing. The genetic mechanisms that underpin myopia are not completely understood. Here, we use genotype data and linkage analyses to identify high-risk genetic loci that are significantly linked to myopia. Individuals from 56 Caucasian families with a history of myopia were genotyped on an exome-based array, and the single nucleotide polymorphism (SNP) data were merged with microsatellite genotype data. Refractive error measures on the samples were converted into binary phenotypes consisting of affected, unaffected, or unknown myopia status. Parametric linkage analyses assuming an autosomal dominant model with 90% penetrance and 10% phenocopy rate were performed. Single variant two-point analyses yielded three significantly linked SNPs at 11p14.1 and 11p11.2; a further 45 SNPs at 11p were found to be suggestive. No other chromosome had any significant SNPs or more than seven suggestive linkages. Two of the significant SNPs were located in BBOX1-AS1 and one in the intergenic region between ORA47 and TRIM49B. Collapsed haplotype pattern two-point analysis and multipoint analyses also yielded multiple suggestively linked genes at 11p. Multipoint analysis also identified suggestive evidence of linkage on 20q13. We identified three genome-wide significant linked variants on 11p for myopia in Caucasians. Although the novel specific signals still need to be replicated, 11p is a promising region that has been identified by other linkage studies with a number of potentially interesting candidate genes. We hope that the identification of these regions on 11p as potential causal regions for myopia will lead to more focus on these regions and maybe possible replication of our specific linkage peaks in other studies. We further plan targeted sequencing on 11p for our most highly linked families to more clearly understand the source of the linkage in this region.

Three ulcerative colitis susceptibility loci are associated with primary sclerosing cholangitis and indicate a role for IL2, REL, and CARD9.

PubMed

Janse, Marcel; Lamberts, Laetitia E; Franke, Lude; Raychaudhuri, Soumya; Ellinghaus, Eva; Muri Boberg, Kirsten; Melum, Espen; Folseraas, Trine; Schrumpf, Erik; Bergquist, Annika; Björnsson, Einar; Fu, Jingyuan; Jan Westra, Harm; Groen, Harry J M; Fehrmann, Rudolf S N; Smolonska, Joanna; van den Berg, Leonard H; Ophoff, Roel A; Porte, Robert J; Weismüller, Tobias J; Wedemeyer, Jochen; Schramm, Christoph; Sterneck, Martina; Günther, Rainer; Braun, Felix; Vermeire, Severine; Henckaerts, Liesbet; Wijmenga, Cisca; Ponsioen, Cyriel Y; Schreiber, Stefan; Karlsen, Tom H; Franke, Andre; Weersma, Rinse K

2011-06-01

Primary sclerosing cholangitis (PSC) is a chronic cholestatic liver disease characterized by inflammation and fibrosis of the bile ducts. Both environmental and genetic factors contribute to its pathogenesis. To further clarify its genetic background, we investigated susceptibility loci recently identified for ulcerative colitis (UC) in a large cohort of 1,186 PSC patients and 1,748 controls. Single nucleotide polymorphisms (SNPs) tagging 13 UC susceptibility loci were initially genotyped in 854 PSC patients and 1,491 controls from Benelux (331 cases, 735 controls), Germany (265 cases, 368 controls), and Scandinavia (258 cases, 388 controls). Subsequently, a joint analysis was performed with an independent second Scandinavian cohort (332 cases, 257 controls). SNPs at chromosomes 2p16 (P-value 4.12 × 10(-4) ), 4q27 (P-value 4.10 × 10(-5) ), and 9q34 (P-value 8.41 × 10(-4) ) were associated with PSC in the joint analysis after correcting for multiple testing. In PSC patients without inflammatory bowel disease (IBD), SNPs at 4q27 and 9q34 were nominally associated (P < 0.05). We applied additional in silico analyses to identify likely candidate genes at PSC susceptibility loci. To identify nonrandom, evidence-based links we used GRAIL (Gene Relationships Across Implicated Loci) analysis showing interconnectivity between genes in six out of in total nine PSC-associated regions. Expression quantitative trait analysis from 1,469 Dutch and UK individuals demonstrated that five out of nine SNPs had an effect on cis-gene expression. These analyses prioritized IL2, CARD9, and REL as novel candidates. We have identified three UC susceptibility loci to be associated with PSC, harboring the putative candidate genes REL, IL2, and CARD9. These results add to the scarce knowledge on the genetic background of PSC and imply an important role for both innate and adaptive immunological factors. Copyright © 2011 American Association for the Study of Liver Diseases.

Identification of SNPs involved in regulating a novel alternative transcript of P450 CYP6ER1 in the brown planthopper.

PubMed

Liang, Zhi-Kun; Pang, Rui; Dong, Yi; Sun, Zhong-Xiang; Ling, Yan; Zhang, Wen-Qing

2017-04-29

Cytochrome P450-mediated metabolic resistance is one of the major mechanisms involved in insecticide resistance. Although the up-regulation of cytochrome P450 plays a vital role in insecticide metabolism, the molecular basis for the transcriptional regulation of cytochrome P450 remains largely unknown. The P450 gene CYP6ER1, has been reported to confer imidacloprid resistance to the brown planthopper, Nilaparvata lugens. Here, we identified a novel alternative transcript of CYP6ER1 (transcript A2) that had different expression patterns between resistant and susceptible populations, and was more stable after insecticide induction. The promoter of this transcript was sequenced and multiple single nucleotide polymorphisms (SNPs) were detected in individuals from susceptible and resistant field-collected populations. Resistant alleles of four SNPs were found to significantly enhance the promoter activity of the CYP6ER1 transcript A2. Electrophoretic mobility shift assays (EMSAs) revealed that these SNPs might regulate the binding of transcription factors to the promoter. Our findings provide novel evidence regarding the transcriptional regulation of a metabolic resistance-related gene and may be useful to understand the resistance mechanism of N. lugens in the field. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Replication of Previous Genome-wide Association Studies of Bone Mineral Density in Premenopausal American Women

PubMed Central

Ichikawa, Shoji; Koller, Daniel L; Padgett, Leah R; Lai, Dongbing; Hui, Siu L; Peacock, Munro; Foroud, Tatiana; Econs, Michael J

2010-01-01

Bone mineral density (BMD) achieved during young adulthood (peak BMD) is one of the major determinants of osteoporotic fracture in later life. Genetic variants associated with BMD have been identified by three recent genome-wide association studies. The most significant single-nucleotide polymorphisms (SNPs) from these studies were genotyped to test whether they were associated with peak BMD in premenopausal American women. Femoral neck and lumbar spine BMD were determined by dual-energy X-ray absorptiometry in two groups of premenopausal women: 1524 white women and 512 black women. In premenopausal white women, two SNPs in the C6orf97/ESR1 region were significantly associated with BMD (p < 4.8 × 10−4), with suggestive evidence for CTNNBL1 and LRP5 (p < .01). Evidence of association with one of the two SNPs in the C6orf97/ESR1 region also was observed in premenopausal black women. Furthermore, SNPs in SP7 and a chromosome 4 intergenic region showed suggestive association with BMD in black women. Detailed analyses of additional SNPs in the C6orf97/ESR1 region revealed multiple genomic blocks independently associated with femoral neck and lumbar spine BMD. Findings in the three published genome-wide association studies were replicated in independent samples of premenopausal American women, suggesting that genetic variants in these genes or regions contribute to peak BMD in healthy women in various populations. © 2010 American Society for Bone and Mineral Research. PMID:20200978

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

Genome-wide association data classification and SNPs selection using two-stage quality-based Random Forests.

PubMed

Nguyen, Thanh-Tung; Huang, Joshua; Wu, Qingyao; Nguyen, Thuy; Li, Mark

2015-01-01

Single-nucleotide polymorphisms (SNPs) selection and identification are the most important tasks in Genome-wide association data analysis. The problem is difficult because genome-wide association data is very high dimensional and a large portion of SNPs in the data is irrelevant to the disease. Advanced machine learning methods have been successfully used in Genome-wide association studies (GWAS) for identification of genetic variants that have relatively big effects in some common, complex diseases. Among them, the most successful one is Random Forests (RF). Despite of performing well in terms of prediction accuracy in some data sets with moderate size, RF still suffers from working in GWAS for selecting informative SNPs and building accurate prediction models. In this paper, we propose to use a new two-stage quality-based sampling method in random forests, named ts-RF, for SNP subspace selection for GWAS. The method first applies p-value assessment to find a cut-off point that separates informative and irrelevant SNPs in two groups. The informative SNPs group is further divided into two sub-groups: highly informative and weak informative SNPs. When sampling the SNP subspace for building trees for the forest, only those SNPs from the two sub-groups are taken into account. The feature subspaces always contain highly informative SNPs when used to split a node at a tree. This approach enables one to generate more accurate trees with a lower prediction error, meanwhile possibly avoiding overfitting. It allows one to detect interactions of multiple SNPs with the diseases, and to reduce the dimensionality and the amount of Genome-wide association data needed for learning the RF model. Extensive experiments on two genome-wide SNP data sets (Parkinson case-control data comprised of 408,803 SNPs and Alzheimer case-control data comprised of 380,157 SNPs) and 10 gene data sets have demonstrated that the proposed model significantly reduced prediction errors and outperformed most existing the-state-of-the-art random forests. The top 25 SNPs in Parkinson data set were identified by the proposed model including four interesting genes associated with neurological disorders. The presented approach has shown to be effective in selecting informative sub-groups of SNPs potentially associated with diseases that traditional statistical approaches might fail. The new RF works well for the data where the number of case-control objects is much smaller than the number of SNPs, which is a typical problem in gene data and GWAS. Experiment results demonstrated the effectiveness of the proposed RF model that outperformed the state-of-the-art RFs, including Breiman's RF, GRRF and wsRF methods.

Hormone-Related Pathways and Risk of Breast Cancer Subtypes in African American Women

PubMed Central

Haddad, Stephen A.; Lunetta, Kathryn L.; Ruiz-Narváez, Edward A.; Bensen, Jeannette T.; Hong, Chi-Chen; Sucheston-Campbell, Lara E.; Yao, Song; Bandera, Elisa V.; Rosenberg, Lynn; Haiman, Christopher A.; Troester, Melissa A.; Ambrosone, Christine B.; Palmer, Julie R.

2016-01-01

Purpose We sought to investigate genetic variation in hormone pathways in relation to risk of overall and subtype-specific breast cancer in women of African ancestry (AA). Methods Genotyping and imputation yielded data on 143,934 SNPs in 308 hormone-related genes for 3663 breast cancer cases (1098 ER-, 1983 ER+, 582 ER unknown) and 4687 controls from the African American Breast Cancer Epidemiology and Risk (AMBER) Consortium. AMBER includes data from four large studies of AA women: the Carolina Breast Cancer Study, the Women's Circle of Health Study, the Black Women's Health Study, and the Multiethnic Cohort Study. Pathway- and gene-based analyses were conducted, and single SNP tests were run for the top genes. Results There were no strong associations at the pathway level. The most significantly associated genes were GHRH, CALM2, CETP, and AKR1C1 for overall breast cancer (gene-based nominal p ≤0.01); NR0B1, IGF2R, CALM2, CYP1B1, and GRB2 for ER+ breast cancer (p ≤0.02); and PGR, MAPK3, MAP3K1, and LHCGR for ER- disease (p ≤0.02). Single-SNP tests for SNPs with pairwise linkage disequilibrium r2 <0.8 in the top genes identified 12 common SNPs (in CALM2, CETP, NR0B1, IGF2R, CYP1B1, PGR, MAPK3, and MAP3K1) associated with overall or subtype-specific breast cancer after gene-level correction for multiple testing. Rs11571215 in PGR (progesterone receptor) was the SNP most strongly associated with ER- disease. Conclusion We identified eight genes in hormone pathways that contain common variants associated with breast cancer in AA women after gene-level correction for multiple testing. PMID:26458823

Chiari Malformation Type I: A Case-Control Association Study of 58 Developmental Genes

PubMed Central

Urbizu, Aintzane; Toma, Claudio; Poca, Maria A.; Sahuquillo, Juan; Cuenca-León, Ester; Cormand, Bru; Macaya, Alfons

2013-01-01

Chiari malformation type I (CMI) is a disorder characterized by hindbrain overcrowding into an underdeveloped posterior cranial fossa (PCF), often causing progressive neurological symptoms. The etiology of CMI remains unclear and is most likely multifactorial. A putative genetic contribution to CMI is suggested by familial aggregation and twin studies. Experimental models and human morphometric studies have suggested an underlying paraxial mesoderm insufficiency. We performed a case-control association study of 303 tag single nucleotide polymorphisms (SNP) across 58 candidate genes involved in early paraxial mesoderm development in a sample of 415 CMI patients and 524 sex-matched controls. A subgroup of patients diagnosed with classical, small-PCF CMI by means of MRI-based PCF morphometry (n = 186), underwent additional analysis. The genes selected are involved in signalling gradients occurring during segmental patterning of the occipital somites (FGF8, Wnt, and retinoic acid pathways and from bone morphogenetic proteins or BMP, Notch, Cdx and Hox pathways) or in placental angiogenesis, sclerotome development or CMI-associated syndromes. Single-marker analysis identified nominal associations with 18 SNPs in 14 genes (CDX1, FLT1, RARG, NKD2, MSGN1, RBPJ1, FGFR1, RDH10, NOG, RARA, LFNG, KDR, ALDH1A2, BMPR1A) considering the whole CMI sample. None of these overcame corrections for multiple comparisons, in contrast with four SNPs in CDX1, FLT1 and ALDH1A2 in the classical CMI group. Multiple marker analysis identified a risk haplotype for classical CMI in ALDH1A2 and CDX1. Furthermore, we analyzed the possible contributions of the most significantly associated SNPs to different PCF morphometric traits. These findings suggest that common variants in genes involved in somitogenesis and fetal vascular development may confer susceptibility to CMI. PMID:23437350

Common colorectal cancer risk alleles contribute to the multiple colorectal adenoma phenotype, but do not influence colonic polyposis in FAP.

PubMed

Cheng, Timothy H T; Gorman, Maggie; Martin, Lynn; Barclay, Ella; Casey, Graham; Saunders, Brian; Thomas, Huw; Clark, Sue; Tomlinson, Ian

2015-02-01

The presence of multiple (5-100) colorectal adenomas suggests an inherited predisposition, but the genetic aetiology of this phenotype is undetermined if patients test negative for Mendelian polyposis syndromes such as familial adenomatous polyposis (FAP) and MUTYH-associated polyposis (MAP). We investigated whether 18 common colorectal cancer (CRC) predisposition single-nucleotide polymorphisms (SNPs) could help to explain some cases with multiple adenomas who phenocopied FAP or MAP, but had no pathogenic APC or MUTYH variant. No multiple adenoma case had an outlying number of CRC SNP risk alleles, but multiple adenoma patients did have a significantly higher number of risk alleles than population controls (P=5.7 × 10(-7)). The association was stronger in those with ≥10 adenomas. The CRC SNPs accounted for 4.3% of the variation in multiple adenoma risk, with three SNPs (rs6983267, rs10795668, rs3802842) explaining 3.0% of the variation. In FAP patients, the CRC risk score did not differ significantly from the controls, as we expected given the overwhelming effect of pathogenic germline APC variants on the phenotype of these cases. More unexpectedly, we found no evidence that the CRC SNPs act as modifier genes for the number of colorectal adenomas in FAP patients. In conclusion, common colorectal tumour risk alleles contribute to the development of multiple adenomas in patients without pathogenic germline APC or MUTYH variants. This phenotype may have 'polygenic' or monogenic origins. The risk of CRC in relatives of multiple adenoma cases is probably much lower for cases with polygenic disease, and this should be taken into account when counselling such patients.

Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

PubMed Central

Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

2012-01-01

Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

PubMed

Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

2017-08-01

Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

EST-derived SNP discovery and selective pressure analysis in Pacific white shrimp ( Litopenaeus vannamei)

NASA Astrophysics Data System (ADS)

Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua

2012-09-01

Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.

Physical mapping of QTL for tuber yield, starch content and starch yield in tetraploid potato (Solanum tuberosum L.) by means of genome wide genotyping by sequencing and the 8.3 K SolCAP SNP array.

PubMed

Schönhals, Elske Maria; Ding, Jia; Ritter, Enrique; Paulo, Maria João; Cara, Nicolás; Tacke, Ekhard; Hofferbert, Hans-Reinhard; Lübeck, Jens; Strahwald, Josef; Gebhardt, Christiane

2017-08-22

Tuber yield and starch content of the cultivated potato are complex traits of decisive importance for breeding improved varieties. Natural variation of tuber yield and starch content depends on the environment and on multiple, mostly unknown genetic factors. Dissection and molecular identification of the genes and their natural allelic variants controlling these complex traits will lead to the development of diagnostic DNA-based markers, by which precision and efficiency of selection can be increased (precision breeding). Three case-control populations were assembled from tetraploid potato cultivars based on maximizing the differences between high and low tuber yield (TY), starch content (TSC) and starch yield (TSY, arithmetic product of TY and TSC). The case-control populations were genotyped by restriction-site associated DNA sequencing (RADseq) and the 8.3 k SolCAP SNP genotyping array. The allele frequencies of single nucleotide polymorphisms (SNPs) were compared between cases and controls. RADseq identified, depending on data filtering criteria, between 6664 and 450 genes with one or more differential SNPs for one, two or all three traits. Differential SNPs in 275 genes were detected using the SolCAP array. A genome wide association study using the SolCAP array on an independent, unselected population identified SNPs associated with tuber starch content in 117 genes. Physical mapping of the genes containing differential or associated SNPs, and comparisons between the two genome wide genotyping methods and two different populations identified genome segments on all twelve potato chromosomes harboring one or more quantitative trait loci (QTL) for TY, TSC and TSY. Several hundred genes control tuber yield and starch content in potato. They are unequally distributed on all potato chromosomes, forming clusters between 0.5-4 Mbp width. The largest fraction of these genes had unknown function, followed by genes with putative signalling and regulatory functions. The genetic control of tuber yield and starch content is interlinked. Most differential SNPs affecting both traits had antagonistic effects: The allele increasing TY decreased TSC and vice versa. Exceptions were 89 SNP alleles which had synergistic effects on TY, TSC and TSY. These and the corresponding genes are primary targets for developing diagnostic markers.

Genetic variants associated with myocardial infarction risk factors in over 8000 individuals from five ethnic groups: The INTERHEART Genetics Study.

PubMed

Anand, Sonia S; Xie, Changchun; Paré, Guillaume; Montpetit, Alexandre; Rangarajan, Sumathy; McQueen, Matthew J; Cordell, Heather J; Keavney, Bernard; Yusuf, Salim; Hudson, Thomas J; Engert, James C

2009-02-01

Myocardial infarction (MI) is a leading cause of death globally, but specific genetic variants that influence MI and MI risk factors have not been assessed on a global basis. We included 8795 individuals of European, South Asian, Arab, Iranian, and Nepalese origin from the INTERHEART case-control study that genotyped 1536 single-nucleotide polymorphisms (SNPs) from 103 genes. One hundred and two SNPs were nominally associated with MI, but the statistical significance did not remain after adjustment for multiple testing. A subset of 940 SNPs from 69 genes were tested against MI risk factors. One hundred and sixty-three SNPs were nominally associated with a MI risk factor and 13 remained significant after adjusting for multiple testing. Of these 13, 11 were associated with apolipoprotein (Apo) B/A1 levels: 8 SNPs from 3 genes were associated with Apo B, and 3 cholesteryl ester transfer protein SNPs were associated with Apo A1. Seven of 8 of the SNPs associated with Apo B levels were nominally associated with MI (P<0.05), whereas none of the 3 cholesteryl ester transfer protein SNPs were associated with MI (P> or =0.17). Of the 3 SNPs most significantly associated with MI, rs7412, which defines the Apo E2 isoform, was associated with both a lower Apo B/A1 ratio (P=1.0x10(-7)) and lower MI risk (P=0.0004). Two low-density lipoprotein receptor variants, 1 intronic (rs6511720) and 1 in the 3' untranslated region (rs1433099) were both associated with a lower Apo B/A1 ratio (P<1.0x10(-5)) and a lower risk of MI (P=0.004 and P=0.003, respectively). Thirteen common SNPs were associated with MI risk factors. Importantly, SNPs associated with Apo B levels were associated with MI, whereas SNPs associated with Apo A1 levels were not. The Apo E isoform, and 2 common low-density lipoprotein receptor variants (rs1433099 and rs6511720) influence MI risk in this multiethnic sample.

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Comprehensive evaluation of the Estrogen Receptor Alpha gene reveals further evidence for association with type 2 diabetes enriched for nephropathy in an African American population

PubMed Central

Keene, Keith L.; Mychaleckyj, Josyf C.; Smith, Shelly G.; Leak, Tennille S.; Perlegas, Peter S.; Langefeld, Carl D.; Herrington, David M.; Freedman, Barry I.; Rich, Stephen S.; Bowden, Donald W.; Sale, Michèle M.

2009-01-01

We previously investigated the estrogen receptor α gene (ESR1) as a positional candidate for type 2 diabetes (T2DM), and found evidence for association between the intron 1-intron 2 region of this gene and type 2 diabetes and/or nephropathy in an African American (AA) population. Our objective was to comprehensively evaluate variants across the entire ESR1 gene for association in AA with T2DM and End Stage Renal Disease (T2DM-ESRD). One hundred fifty SNPs in ESR1, spanning 476 kb, were genotyped in 577 AA individuals with T2DM-ESRD and 596 AA controls. Genotypic association tests for dominant, additive, and recessive models, and haplotypic association, were calculated using a χ2 statistic and corresponding P value. Thirty-one SNPs showed nominal evidence for association (P< 0.05) with T2DM-ESRD in one or more genotypic model. After correcting for multiple tests, promoter SNP rs11964281 (nominal P=0.000291, adjusted P=0.0289), and intron 4 SNPs rs1569788 (nominal P=0.000754, adjusted P=0.0278) and rs9340969 (nominal P=0.00109, adjusted P=0.0467) remained significant at experimentwise error rate (EER) P<0.05 for the dominant class of tests. Twenty-three of the thirty-one associated SNPs cluster within the intron 4-intron 6 region. Gender stratification revealed nominal evidence for association with 35 SNPs in females (352 cases; 306 controls) and seven SNPs in males (225 cases; 290 controls). We have identified a novel region of the ESR1 gene that may contain important functional polymorphisms in relation to susceptibility to T2DM and/or diabetic nephropathy. PMID:18305958

Comprehensive evaluation of the estrogen receptor alpha gene reveals further evidence for association with type 2 diabetes enriched for nephropathy in an African American population.

PubMed

Keene, Keith L; Mychaleckyj, Josyf C; Smith, Shelly G; Leak, Tennille S; Perlegas, Peter S; Langefeld, Carl D; Herrington, David M; Freedman, Barry I; Rich, Stephen S; Bowden, Donald W; Sale, Michèle M

2008-05-01

We previously investigated the estrogen receptor alpha gene (ESR1) as a positional candidate for type 2 diabetes (T2DM), and found evidence for association between the intron 1-intron 2 region of this gene and T2DM and/or nephropathy in an African American (AA) population. Our objective was to comprehensively evaluate variants across the entire ESR1 gene for association in AA with T2DM and end stage renal disease (T2DM-ESRD). One hundred fifty SNPs in ESR1, spanning 476 kb, were genotyped in 577 AA individuals with T2DM-ESRD and 596 AA controls. Genotypic association tests for dominant, additive, and recessive models, and haplotypic association, were calculated using a chi(2) statistic and corresponding P value. Thirty-one SNPs showed nominal evidence for association (P < 0.05) with T2DM-ESRD in one or more genotypic model. After correcting for multiple tests, promoter SNP rs11964281 (nominal P = 0.000291, adjusted P = 0.0289), and intron 4 SNPs rs1569788 (nominal P = 0.000754, adjusted P = 0.0278) and rs9340969 (nominal P = 0.00109, adjusted P = 0.0467) remained significant at experimentwise error rate (EER) P

Association analysis of 9,560 prostate cancer cases from the International Consortium of Prostate Cancer Genetics confirms the role of reported prostate-cancer associated SNPs for familial disease

PubMed Central

Teerlink, Craig C.; Thibodeau, Stephen N.; McDonnell, Shannon K.; Schaid, Daniel J.; Rinckleb, Antje; Maier, Christiane; Vogel, Walther; Cancel-Tassin, Geraldine; Egrot, Christophe; Cussenot, Olivier; Foulkes, William D.; Giles, Graham G.; Hopper, John L.; Severi, Gianluca; Eeles, Ros; Easton, Douglas; Kote-Jarai, Zsofia; Guy, Michelle; Cooney, Kathleen A.; Ray, Anna M.; Zuhlke, Kimberly A.; Lange, Ethan M.; FitzGerald, Liesel M.; Stanford, Janet L.; Ostrander, Elaine A.; Wiley, Kathleen E.; Isaacs, Sarah D.; Walsh, Patrick C.; Isaacs, William B.; Wahlfors, Tiina; Tammela, Teuvo; Schleutker, Johanna; Wiklund, Fredrik; Grönberg, Henrik; Emanuelsson, Monica; Carpten, John; Bailey-Wilson, Joan; Whittemore, Alice S.; Oakley-Girvan, Ingrid; Hsieh, Chih-Lin; Catalona, William J.; Zheng, S. Lilly; Jin, Guangfu; Lu, Lingyi; Xu, Jianfeng; Camp, Nicola J.; Cannon-Albright, Lisa A.

2013-01-01

Previous GWAS studies have reported significant associations between various common SNPs and prostate cancer risk using cases unselected for family history. How these variants influence risk in familial prostate cancer is not well studied. Here, we analyzed 25 previously reported SNPs across 14 loci from prior prostate cancer GWAS. The International Consortium for Prostate Cancer Genetics (ICPCG) previously validated some of these using a family-based association method (FBAT). However, this approach suffered reduced power due to the conditional statistics implemented in FBAT. Here, we use a case-control design with an empirical analysis strategy to analyze the ICPCG resource for association between these 25 SNPs and familial prostate cancer risk. Fourteen sites contributed 12,506 samples (9,560 prostate cancer cases, 3,368 with aggressive disease, and 2,946 controls from 2,283 pedigrees). We performed association analysis with Genie software which accounts for relationships. We analyzed all familial prostate cancer cases and the subset of aggressive cases. For the familial prostate cancer phenotype, 20 of the 25 SNPs were at least nominally associated with prostate cancer and 16 remained significant after multiple testing correction (p≤1E−3) occurring on chromosomal bands 6q25, 7p15, 8q24, 10q11, 11q13, 17q12, 17q24, and Xp11. For aggressive disease, 16 of the SNPs had at least nominal evidence and 8 were statistically significant including 2p15. The results indicate that the majority of common, low-risk alleles identified in GWAS studies for all prostate cancer also contribute risk for familial prostate cancer, and that some may be contribute risk to aggressive disease. PMID:24162621

An xQTL map integrates the genetic architecture of the human brain's transcriptome and epigenome.

PubMed

Ng, Bernard; White, Charles C; Klein, Hans-Ulrich; Sieberts, Solveig K; McCabe, Cristin; Patrick, Ellis; Xu, Jishu; Yu, Lei; Gaiteri, Chris; Bennett, David A; Mostafavi, Sara; De Jager, Philip L

2017-10-01

We report a multi-omic resource generated by applying quantitative trait locus (xQTL) analyses to RNA sequence, DNA methylation and histone acetylation data from the dorsolateral prefrontal cortex of 411 older adults who have all three data types. We identify SNPs significantly associated with gene expression, DNA methylation and histone modification levels. Many of these SNPs influence multiple molecular features, and we demonstrate that SNP effects on RNA expression are fully mediated by epigenetic features in 9% of these loci. Further, we illustrate the utility of our new resource, xQTL Serve, by using it to prioritize the cell type(s) most affected by an xQTL. We also reanalyze published genome wide association studies using an xQTL-weighted analysis approach and identify 18 new schizophrenia and 2 new bipolar susceptibility variants, which is more than double the number of loci that can be discovered with a larger blood-based expression eQTL resource.

Identification of FGF7 as a novel susceptibility locus for chronic obstructive pulmonary disease.

PubMed

Brehm, John M; Hagiwara, Koichi; Tesfaigzi, Yohannes; Bruse, Shannon; Mariani, Thomas J; Bhattacharya, Soumyaroop; Boutaoui, Nadia; Ziniti, John P; Soto-Quiros, Manuel E; Avila, Lydiana; Cho, Michael H; Himes, Blanca; Litonjua, Augusto A; Jacobson, Francine; Bakke, Per; Gulsvik, Amund; Anderson, Wayne H; Lomas, David A; Forno, Erick; Datta, Soma; Silverman, Edwin K; Celedón, Juan C

2011-12-01

Traditional genome-wide association studies (GWASs) of large cohorts of subjects with chronic obstructive pulmonary disease (COPD) have successfully identified novel candidate genes, but several other plausible loci do not meet strict criteria for genome-wide significance after correction for multiple testing. The authors hypothesise that by applying unbiased weights derived from unique populations we can identify additional COPD susceptibility loci. Methods The authors performed a homozygosity haplotype analysis on a group of subjects with and without COPD to identify regions of conserved homozygosity haplotype (RCHHs). Weights were constructed based on the frequency of these RCHHs in case versus controls, and used to adjust the p values from a large collaborative GWAS of COPD. The authors identified 2318 RCHHs, of which 576 were significantly (p<0.05) over-represented in cases. After applying the weights constructed from these regions to a collaborative GWAS of COPD, the authors identified two single nucleotide polymorphisms (SNPs) in a novel gene (fibroblast growth factor-7 (FGF7)) that gained genome-wide significance by the false discovery rate method. In a follow-up analysis, both SNPs (rs12591300 and rs4480740) were significantly associated with COPD in an independent population (combined p values of 7.9E-7 and 2.8E-6, respectively). In another independent population, increased lung tissue FGF7 expression was associated with worse measures of lung function. Weights constructed from a homozygosity haplotype analysis of an isolated population successfully identify novel genetic associations from a GWAS on a separate population. This method can be used to identify promising candidate genes that fail to meet strict correction for multiple testing.

Differences in candidate gene association between European ancestry and African American asthmatic children.

PubMed

Baye, Tesfaye M; Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M; Martin, Lisa J; Lindsey, Mark; Patterson, Tia L; He, Hua; Ericksen, Mark B; Gupta, Jayanta; Tsoras, Anna M; Lindsley, Andrew; Rothenberg, Marc E; Wills-Karp, Marsha; Eissa, N Tony; Borish, Larry; Khurana Hershey, Gurjit K

2011-02-28

Candidate gene case-control studies have identified several single nucleotide polymorphisms (SNPs) that are associated with asthma susceptibility. Most of these studies have been restricted to evaluations of specific SNPs within a single gene and within populations from European ancestry. Recently, there is increasing interest in understanding racial differences in genetic risk associated with childhood asthma. Our aim was to compare association patterns of asthma candidate genes between children of European and African ancestry. Using a custom-designed Illumina SNP array, we genotyped 1,485 children within the Greater Cincinnati Pediatric Clinic Repository and Cincinnati Genomic Control Cohort for 259 SNPs in 28 genes and evaluated their associations with asthma. We identified 14 SNPs located in 6 genes that were significantly associated (p-values <0.05) with childhood asthma in African Americans. Among Caucasians, 13 SNPs in 5 genes were associated with childhood asthma. Two SNPs in IL4 were associated with asthma in both races (p-values <0.05). Gene-gene interaction studies identified race specific sets of genes that best discriminate between asthmatic children and non-allergic controls. We identified IL4 as having a role in asthma susceptibility in both African American and Caucasian children. However, while IL4 SNPs were associated with asthma in asthmatic children with European and African ancestry, the relative contributions of the most replicated asthma-associated SNPs varied by ancestry. These data provides valuable insights into the pathways that may predispose to asthma in individuals with European vs. African ancestry.

Multiple Loci are associated with dilated cardiomyopathy in Irish wolfhounds.

PubMed

Philipp, Ute; Vollmar, Andrea; Häggström, Jens; Thomas, Anne; Distl, Ottmar

2012-01-01

Dilated cardiomyopathy (DCM) is a highly prevalent and often lethal disease in Irish wolfhounds. Complex segregation analysis indicated different loci involved in pathogenesis. Linear fixed and mixed models were used for the genome-wide association study. Using 106 DCM cases and 84 controls we identified one SNP significantly associated with DCM on CFA37 and five SNPs suggestively associated with DCM on CFA1, 10, 15, 21 and 17. On CFA37 MOGAT1 and ACSL3 two enzymes of the lipid metabolism were located near the identified SNP.

Multiple Loci Are Associated with Dilated Cardiomyopathy in Irish Wolfhounds

PubMed Central

Philipp, Ute; Vollmar, Andrea; Häggström, Jens; Thomas, Anne; Distl, Ottmar

2012-01-01

Dilated cardiomyopathy (DCM) is a highly prevalent and often lethal disease in Irish wolfhounds. Complex segregation analysis indicated different loci involved in pathogenesis. Linear fixed and mixed models were used for the genome-wide association study. Using 106 DCM cases and 84 controls we identified one SNP significantly associated with DCM on CFA37 and five SNPs suggestively associated with DCM on CFA1, 10, 15, 21 and 17. On CFA37 MOGAT1 and ACSL3 two enzymes of the lipid metabolism were located near the identified SNP. PMID:22761652

Candidate-gene association study of mothers with pre-eclampsia, and their infants, analyzing 775 SNPs in 190 genes.

PubMed

Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena

2007-01-01

Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications, since women with PE are at increased risk of death from cardiovascular diseases later in life.

Multiple mutations in the para-sodium channel gene are associated with pyrethroid resistance in Rhipicephalus microplus from the United States and Mexico.

PubMed

Stone, Nathan E; Olafson, Pia U; Davey, Ronald B; Buckmeier, Greta; Bodine, Deanna; Sidak-Loftis, Lindsay C; Giles, John R; Duhaime, Roberta; Miller, Robert J; Mosqueda, Juan; Scoles, Glen A; Wagner, David M; Busch, Joseph D

2014-10-01

Acaricide resistant Rhipicephalus microplus populations have become a major problem for many cattle producing areas of the world. Pyrethroid resistance in arthropods is typically associated with mutations in domains I, II, III, and IV of voltage-gated sodium channel genes. In R. microplus, known resistance mutations include a domain II change (C190A) in populations from Australia, Africa, and South America and a domain III mutation (T2134A) that only occurs in Mexico and the U.S. We investigated pyrethroid resistance in cattle fever ticks from Texas and Mexico by estimating resistance levels in field-collected ticks using larval packet discriminating dose (DD) assays and identifying single nucleotide polymorphisms (SNPs) in the para-sodium channel gene that associated with resistance. We then developed qPCR assays for three SNPs and screened a larger set of 1,488 R. microplus ticks, representing 77 field collections and four laboratory strains, for SNP frequency. We detected resistance SNPs in 21 of 68 U.S. field collections and six of nine Mexico field collections. We expected to identify the domain III SNP (T2134A) at a high frequency; however, we only found it in three U.S. collections. A much more common SNP in the U.S. (detected in 19 of 21 field collections) was the C190A domain II mutation, which has never before been reported from North America. We also discovered a novel domain II SNP (T170C) in ten U.S. and two Mexico field collections. The T170C transition mutation has previously been associated with extreme levels of resistance (super-knockdown resistance) in insects. We found a significant correlation (r = 0.81) between the proportion of individuals in field collections that carried any two resistance SNPs and the percent survivorship of F1 larvae from these collections in DD assays. This relationship is accurately predicted by a simple linear regression model (R2 = 0.6635). These findings demonstrate that multiple mutations in the para-sodium channel gene independently associate with pyrethroid resistance in R. microplus ticks, which is likely a consequence of human-induced selection.

A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

PubMed

Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

2016-04-05

Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

Genetic Indicators of Drug Resistance in the Highly Repetitive Genome of Trichomonas vaginalis.

PubMed

Bradic, Martina; Warring, Sally D; Tooley, Grace E; Scheid, Paul; Secor, William E; Land, Kirkwood M; Huang, Po-Jung; Chen, Ting-Wen; Lee, Chi-Ching; Tang, Petrus; Sullivan, Steven A; Carlton, Jane M

2017-06-01

Trichomonas vaginalis, the most common nonviral sexually transmitted parasite, causes ∼283 million trichomoniasis infections annually and is associated with pregnancy complications and increased risk of HIV-1 acquisition. The antimicrobial drug metronidazole is used for treatment, but in a fraction of clinical cases, the parasites can become resistant to this drug. We undertook sequencing of multiple clinical isolates and lab derived lines to identify genetic markers and mechanisms of metronidazole resistance. Reduced representation genome sequencing of ∼100 T. vaginalis clinical isolates identified 3,923 SNP markers and presence of a bipartite population structure. Linkage disequilibrium was found to decay rapidly, suggesting genome-wide recombination and the feasibility of genetic association studies in the parasite. We identified 72 SNPs associated with metronidazole resistance, and a comparison of SNPs within several lab-derived resistant lines revealed an overlap with the clinically resistant isolates. We identified SNPs in genes for which no function has yet been assigned, as well as in functionally-characterized genes relevant to drug resistance (e.g., pyruvate:ferredoxin oxidoreductase). Transcription profiles of resistant strains showed common changes in genes involved in drug activation (e.g., flavin reductase), accumulation (e.g., multidrug resistance pump), and detoxification (e.g., nitroreductase). Finally, we identified convergent genetic changes in lab-derived resistant lines of Tritrichomonas foetus, a distantly related species that causes venereal disease in cattle. Shared genetic changes within and between T. vaginalis and Tr. foetus parasites suggest conservation of the pathways through which adaptation has occurred. These findings extend our knowledge of drug resistance in the parasite, providing a panel of markers that can be used as a diagnostic tool. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Genetic Indicators of Drug Resistance in the Highly Repetitive Genome of Trichomonas vaginalis

PubMed Central

Bradic, Martina; Warring, Sally D.; Tooley, Grace E.; Scheid, Paul; Secor, William E.; Land, Kirkwood M.; Huang, Po-Jung; Chen, Ting-Wen; Lee, Chi-Ching; Tang, Petrus; Sullivan, Steven A.

2017-01-01

Abstract Trichomonas vaginalis, the most common nonviral sexually transmitted parasite, causes ∼283 million trichomoniasis infections annually and is associated with pregnancy complications and increased risk of HIV-1 acquisition. The antimicrobial drug metronidazole is used for treatment, but in a fraction of clinical cases, the parasites can become resistant to this drug. We undertook sequencing of multiple clinical isolates and lab derived lines to identify genetic markers and mechanisms of metronidazole resistance. Reduced representation genome sequencing of ∼100 T. vaginalis clinical isolates identified 3,923 SNP markers and presence of a bipartite population structure. Linkage disequilibrium was found to decay rapidly, suggesting genome-wide recombination and the feasibility of genetic association studies in the parasite. We identified 72 SNPs associated with metronidazole resistance, and a comparison of SNPs within several lab-derived resistant lines revealed an overlap with the clinically resistant isolates. We identified SNPs in genes for which no function has yet been assigned, as well as in functionally-characterized genes relevant to drug resistance (e.g., pyruvate:ferredoxin oxidoreductase). Transcription profiles of resistant strains showed common changes in genes involved in drug activation (e.g., flavin reductase), accumulation (e.g., multidrug resistance pump), and detoxification (e.g., nitroreductase). Finally, we identified convergent genetic changes in lab-derived resistant lines of Tritrichomonas foetus, a distantly related species that causes venereal disease in cattle. Shared genetic changes within and between T. vaginalis and Tr. foetus parasites suggest conservation of the pathways through which adaptation has occurred. These findings extend our knowledge of drug resistance in the parasite, providing a panel of markers that can be used as a diagnostic tool. PMID:28633446

Allelic expression mapping across cellular lineages to establish impact of non-coding SNPs

PubMed Central

Adoue, Veronique; Schiavi, Alicia; Light, Nicholas; Almlöf, Jonas Carlsson; Lundmark, Per; Ge, Bing; Kwan, Tony; Caron, Maxime; Rönnblom, Lars; Wang, Chuan; Chen, Shu-Huang; Goodall, Alison H; Cambien, Francois; Deloukas, Panos; Ouwehand, Willem H; Syvänen, Ann-Christine; Pastinen, Tomi

2014-01-01

Most complex disease-associated genetic variants are located in non-coding regions and are therefore thought to be regulatory in nature. Association mapping of differential allelic expression (AE) is a powerful method to identify SNPs with direct cis-regulatory impact (cis-rSNPs). We used AE mapping to identify cis-rSNPs regulating gene expression in 55 and 63 HapMap lymphoblastoid cell lines from a Caucasian and an African population, respectively, 70 fibroblast cell lines, and 188 purified monocyte samples and found 40–60% of these cis-rSNPs to be shared across cell types. We uncover a new class of cis-rSNPs, which disrupt footprint-derived de novo motifs that are predominantly bound by repressive factors and are implicated in disease susceptibility through overlaps with GWAS SNPs. Finally, we provide the proof-of-principle for a new approach for genome-wide functional validation of transcription factor–SNP interactions. By perturbing NFκB action in lymphoblasts, we identified 489 cis-regulated transcripts with altered AE after NFκB perturbation. Altogether, we perform a comprehensive analysis of cis-variation in four cell populations and provide new tools for the identification of functional variants associated to complex diseases. PMID:25326100

Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

PubMed

Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

2016-05-01

The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

Evaluation of association between common genetic variants on chromosome 9p21 and coronary artery disease in Turkish population.

PubMed

Çakmak, Hüseyin Altuğ; Bayoğlu, Burcu; Durmaz, Eser; Can, Günay; Karadağ, Bilgehan; Cengiz, Müjgan; Vural, Vural Ali; Yüksel, Hüsniye

2015-03-01

Coronary artery disease (CAD), which develops from complex interactions between genetic and enviromental factors, is a leading cause of death worldwide. Based on genome-wide association studies (GWAS), the chromosomal region 9p21 has been identified as the most relevant locus presenting a strong association with CAD in different populations. The aim of the present study was to investigate the association of two SNPs on chromosome 9p21 on susceptibility to CAD and the effect of these SNPs along with cardiovascular risk factors on the severity of CAD in the Turkish population. This study had an observational case-control design. We genotyped 460 subjects, aged 30-65 years, to investigate the association of 2 SNPs (rs1333049, rs2383207) on chromosome 9p21 and CAD risk in Turkish population. Real-time polymerase chain reaction (RT-PCR) was used to analyze the 2 SNPs in CAD patients and healthy controls. The genotype and allelic variations of these SNPs with the severity of CAD was also assessed using semi-quantitative methods such as the Gensini score. Student's t test and multiple regression analysis were used for statistical analysis. The SNPs rs1333049 and rs2383207 were found to be associated with CAD with an adjusted OR of 1.81 (95% Cl 1.05-3.12) and 2.12 (95% CI 1.19-4.10) respectively. After adjustment of CAD risk factors such as smoking, family history of CAD and diabetes, the homozygous AA genotype for rs2383207 increased the CAD risk with an OR 3.69. Also a very strong association was found between rs1333049 and rs2383207 and Gensini scores representing the severity of CAD (p<0.001). The rs2383207 and rs1333049 SNPs on 9p21 chromosome were significantly associated with the risk and severity of CAD in the Turkish population.

Interactions of Cigarette Smoking with NAT2 Polymorphisms Impact Rheumatoid Arthritis Risk in African Americans

PubMed Central

Mikuls, Ted R.; LeVan, Tricia; Gould, Karen A.; Yu, Fang; Thiele, Geoffrey M.; Bynote, Kimberly K.; Conn, Doyt; Jonas, Beth L.; Callahan, Leigh F.; Smith, Edwin; Brasington, Richard; Moreland, Larry W.; Reynolds, Richard; Gaffo, Angelo; Bridges, S. Louis

2011-01-01

Objective To examine whether polymorphisms in genes coding for drug metabolizing enzymes (DMEs) impact rheumatoid arthritis (RA) risk due to cigarette smoking in African Americans. Methods Smoking status was evaluated in African American RA cases and non-RA controls categorized as heavy (≥ 10 pack-years) vs. other. Individuals were genotyped for a homozygous deletion polymorphism in glutathione S-transferase Mu-1 (GSTM1-null) in addition to tagging single nucleotide polymorphisms (SNPs) in N-acetyltransferase (NAT)1, NAT2, and epoxide hydrolase (EPXH1). Associations of genotypes with RA were examined using logistic regression and gene-smoking interactions were assessed. Results There were no significant associations of any DME genotype with RA. After adjustment for multiple comparisons, there were significant additive interactions between heavy smoking and NAT2 SNPs rs9987109 (Padd = 0.000003) and rs1208 (Padd = 0.00001); attributable proportions (APs) due to interaction ranged from 0.61 to 0.67. None of the multiplicative gene-smoking interactions examined remained significant after adjustment for multiple testing in overall disease risk. There was no evidence of significant gene-smoking interactions in analyses of GSTM1-null, NAT1, or EPXH1. DME gene-smoking interactions were similar when cases were limited to anti-citrullinated protein antibody (ACPA) positive individuals. Conclusion Among African Americans, RA risk imposed by heavy smoking appears to be mediated in part by genetic variation in NAT2. While further studies are needed to elucidate mechanisms underpinning these interactions, these SNPs appear to identify African American smokers at a much higher risk for RA with relative risks that are at least two-fold higher compared to non-smokers lacking these risk alleles. PMID:21989592

Associations and interactions between SNPs in the alcohol metabolizing genes and alcoholism phenotypes in European Americans.

PubMed

Sherva, Richard; Rice, John P; Neuman, Rosalind J; Rochberg, Nanette; Saccone, Nancy L; Bierut, Laura J

2009-05-01

Alcohol dependence is a major cause of morbidity and mortality worldwide and has a strong familial component. Several linkage and association studies have identified chromosomal regions and/or genes that affect alcohol consumption, notably in genes involved in the 2-stage pathway of alcohol metabolism. Here, we use multiple regression models to test for associations and interactions between 2 alcohol-related phenotypes and SNPs in 17 genes involved in alcohol metabolism in a sample of 1,588 European American subjects. The strongest evidence for association after correcting for multiple testing was between rs1229984, a nonsynonymous coding SNP in ADH1B, and DSM-IV symptom count (p = 0.0003). This SNP was also associated with maximum number of drinks in 24 hours (p = 0.0004). Each minor allele at this SNP predicts 45% fewer DSM-IV symptoms and 18% fewer max drinks. Another SNP in a splice site in ALDH1A1 (rs8187974) showed evidence for association with both phenotypes as well (p = 0.02 and 0.004, respectively), but neither association was significant after accounting for multiple testing. Minor alleles at this SNP predict greater alcohol consumption. In addition, pairwise interactions were observed between SNPs in several genes (p = 0.00002). We replicated the large effect of rs1229984 on alcohol behavior, and although not common (MAF = 4%), this polymorphism may be highly relevant from a public health perspective in European Americans. Another SNP, rs8187974, may also affect alcohol behavior but requires replication. Also, interactions between polymorphisms in genes involved in alcohol metabolism are likely determinants of the parameters that ultimately affect alcohol consumption.

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

Variants for HDL-C, LDL-C and Triglycerides Identified from Admixture Mapping and Fine-Mapping Analysis in African-American Families

PubMed Central

Shetty, Priya B.; Tang, Hua; Feng, Tao; Tayo, Bamidele; Morrison, Alanna C.; Kardia, Sharon L.R.; Hanis, Craig L.; Arnett, Donna K.; Hunt, Steven C.; Boerwinkle, Eric; Rao, D.C.; Cooper, R.S.; Risch, Neil; Zhu, Xiaofeng

2015-01-01

Background Admixture mapping of lipids was followed-up by family-based association analysis to identify variants for cardiovascular disease in African-Americans. Methods and Results The present study conducted admixture mapping analysis for total cholesterol, high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and triglycerides. The analysis was performed in 1,905 unrelated African-American subjects from the National Heart, Lung and Blood Institute’s Family Blood Pressure Program. Regions showing admixture evidence were followed-up with family-based association analysis in 3,556 African-American subjects from the FBPP. The admixture mapping and family-based association analyses were adjusted for age, age2, sex, body-mass-index, and genome-wide mean ancestry to minimize the confounding due to population stratification. Regions that were suggestive of local ancestry association evidence were found on chromosomes 7 (LDL-C), 8 (HDL-C), 14 (triglycerides) and 19 (total cholesterol and triglycerides). In the fine-mapping analysis, 52,939 SNPs were tested and 11 SNPs (8 independent SNPs) showed nominal significant association with HDL-C (2 SNPs), LDL-C (4 SNPs) and triglycerides (5 SNPs). The family data was used in the fine-mapping to identify SNPs that showed novel associations with lipids and regions including genes with known associations for cardiovascular disease. Conclusions This study identified regions on chromosomes 7, 8, 14 and 19 and 11 SNPs from the fine-mapping analysis that were associated with HDL-C, LDL-C and triglycerides for further studies of cardiovascular disease in African-Americans. PMID:25552592

Recapitulation of genome-wide association studies on body mass index in the Korean population.

PubMed

Hong, K W; Oh, B

2012-08-01

Obesity is a risk factor for multiple disorders such as diabetes and cardiovascular disease. Recently, a genome-wide association study for body mass index (BMI) was conducted in 249 796 individuals of European ancestry by the Genetic Investigation of Anthropometric Traits (GIANT) consortium. They identified 14 known obesity susceptibility loci and 18 new loci associated with BMI at the genome-wide significance level (P<5 × 10⁻⁸). Because the prevalence and severity of obesity vary among ethnic groups, it is worthy to investigate these results in another ethnic population. We examined the BMI association of 19 single-nucleotide polymorphisms (SNPs) out of the 32 in 8842 individuals from the Korean Association Resource data, and found 12 SNPs to be associated with BMI in the Korean population. Eight loci, rs10968576 (BDNF), rs3817334 (MTCH2), rs1558902 (FTO), rs571312 (MC4R), rs543874 (SEC16B), rs987237 (TFAP2B), rs2867125 (TMEM18) and rs7138803 (FAIM2), were previously known obesity susceptibility loci, and the remaining four loci, rs1514175 (TNNI3K), rs206936 (NUDT3), rs4771122 (MTIF3) and rs2241423 (MAP2K5), were newly identified as BMI loci by the GIANT study. Further, all 12 SNPs showed the same direction of effect on BMI between the two ethnic groups, suggesting a similar genetic architecture governing the obesity.

A comprehensive screen for SNP associations on chromosome region 5q31-33 in Swedish/Norwegian celiac disease families.

PubMed

Amundsen, Silja Svanstrøm; Adamovic, Svetlana; Hellqvist, Asa; Nilsson, Staffan; Gudjónsdóttir, Audur H; Ascher, Henry; Ek, Johan; Larsson, Kristina; Wahlström, Jan; Lie, Benedicte A; Sollid, Ludvig M; Naluai, Asa Torinsson

2007-09-01

Celiac disease (CD) is a gluten-induced enteropathy, which results from the interplay between environmental and genetic factors. There is a strong human leukocyte antigen (HLA) association with the disease, and HLA-DQ alleles represent a major genetic risk factor. In addition to HLA-DQ, non-HLA genes appear to be crucial for CD development. Chromosomal region 5q31-33 has demonstrated linkage with CD in several genome-wide studies, including in our Swedish/Norwegian cohort. In a European meta-analysis 5q31-33 was the only region that reached a genome-wide level of significance except for the HLA region. To identify the genetic variant(s) responsible for this linkage signal, we performed a comprehensive single nucleotide polymorphism (SNP) association screen in 97 Swedish/Norwegian multiplex families who demonstrate linkage to the region. We selected tag SNPs from a 16 Mb region representing the 95% confidence interval of the linkage peak. A total of 1,404 SNPs were used for the association analysis. We identified several regions with SNPs demonstrating moderate single- or multipoint associations. However, the isolated association signals appeared insufficient to account for the linkage signal seen in our cohort. Collective effects of multiple risk genes within the region, incomplete genetic coverage or effects related to copy number variation are possible explanations for our findings.

Development of a Genetic Map for Onion (Allium cepa L.) Using Reference-Free Genotyping-by-Sequencing and SNP Assays

PubMed Central

Jo, Jinkwan; Purushotham, Preethi M.; Han, Koeun; Lee, Heung-Ryul; Nah, Gyoungju; Kang, Byoung-Cheorl

2017-01-01

Single nucleotide polymorphisms (SNPs) play important roles as molecular markers in plant genomics and breeding studies. Although onion (Allium cepa L.) is an important crop globally, relatively few molecular marker resources have been reported due to its large genome and high heterozygosity. Genotyping-by-sequencing (GBS) offers a greater degree of complexity reduction followed by concurrent SNP discovery and genotyping for species with complex genomes. In this study, GBS was employed for SNP mining in onion, which currently lacks a reference genome. A segregating F2 population, derived from a cross between ‘NW-001’ and ‘NW-002,’ as well as multiple parental lines were used for GBS analysis. A total of 56.15 Gbp of raw sequence data were generated and 1,851,428 SNPs were identified from the de novo assembled contigs. Stringent filtering resulted in 10,091 high-fidelity SNP markers. Robust SNPs that satisfied the segregation ratio criteria and with even distribution in the mapping population were used to construct an onion genetic map. The final map contained eight linkage groups and spanned a genetic length of 1,383 centiMorgans (cM), with an average marker interval of 8.08 cM. These robust SNPs were further analyzed using the high-throughput Fluidigm platform for marker validation. This is the first study in onion to develop genome-wide SNPs using GBS. The resulting SNP markers and developed linkage map will be valuable tools for genetic mapping of important agronomic traits and marker-assisted selection in onion breeding programs. PMID:28959273

A GENOME WIDE ASSOCIATION STUDY FOR DIABETIC NEPHROPATHY GENES IN AFRICAN AMERICANS

PubMed Central

McDonough, Caitrin W.; Palmer, Nicholette D.; Hicks, Pamela J.; Roh, Bong H.; An, S. Sandy; Cooke, Jessica N.; Hester, Jessica M.; Wing, Maria R.; Bostrom, Meredith A.; Rudock, Megan E.; Lewis, Joshua P.; Talbert, Matthew E.; Blevins, Rebecca A.; Lu, Lingyi; Ng, Maggie C.Y.; Sale, Michele M.; Divers, Jasmin; Langefeld, Carl D.; Freedman, Barry I.; Bowden, Donald W.

2011-01-01

A genome-wide association study was performed using the Affymetrix 6.0 chip to identify genes associated with diabetic nephropathy in African Americans. Association analysis was performed adjusting for admixture in 965 type 2 diabetic African American patients with end-stage renal disease (ESRD) and in 1029 African Americans without type 2 diabetes or kidney disease as controls. The top 724 single nucleotide polymorphisms (SNPs) with evidence of association to diabetic nephropathy were then genotyped in a replication sample of an additional 709 type 2 diabetes-ESRD patients and 690 controls. SNPs with evidence of association in both the original and replication studies were tested in additional African American cohorts consisting of 1246 patients with type 2 diabetes without kidney disease and 1216 with non-diabetic ESRD to differentiate candidate loci for type 2 diabetes-ESRD, type 2 diabetes, and/or all-cause ESRD. Twenty-five SNPs were significantly associated with type 2 diabetes-ESRD in the genome-wide association and initial replication. Although genome-wide significance with type 2 diabetes was not found for any of these 25 SNPs, several genes, including RPS12, LIMK2, and SFI1 are strong candidates for diabetic nephropathy. A combined analysis of all 2890 patients with ESRD showed significant association SNPs in LIMK2 and SFI1 suggesting that they also contribute to all-cause ESRD. Thus, our results suggest that multiple loci underlie susceptibility to kidney disease in African Americans with type 2 diabetes and some may also contribute to all-cause ESRD. PMID:21150874

A genome-wide association study for diabetic nephropathy genes in African Americans.

PubMed

McDonough, Caitrin W; Palmer, Nicholette D; Hicks, Pamela J; Roh, Bong H; An, S Sandy; Cooke, Jessica N; Hester, Jessica M; Wing, Maria R; Bostrom, Meredith A; Rudock, Megan E; Lewis, Joshua P; Talbert, Matthew E; Blevins, Rebecca A; Lu, Lingyi; Ng, Maggie C Y; Sale, Michele M; Divers, Jasmin; Langefeld, Carl D; Freedman, Barry I; Bowden, Donald W

2011-03-01

A genome-wide association study was performed using the Affymetrix 6.0 chip to identify genes associated with diabetic nephropathy in African Americans. Association analysis was performed adjusting for admixture in 965 type 2 diabetic African American patients with end-stage renal disease (ESRD) and in 1029 African Americans without type 2 diabetes or kidney disease as controls. The top 724 single nucleotide polymorphisms (SNPs) with evidence of association to diabetic nephropathy were then genotyped in a replication sample of an additional 709 type 2 diabetes-ESRD patients and 690 controls. SNPs with evidence of association in both the original and replication studies were tested in additional African American cohorts consisting of 1246 patients with type 2 diabetes without kidney disease and 1216 with non-diabetic ESRD to differentiate candidate loci for type 2 diabetes-ESRD, type 2 diabetes, and/or all-cause ESRD. Twenty-five SNPs were significantly associated with type 2 diabetes-ESRD in the genome-wide association and initial replication. Although genome-wide significance with type 2 diabetes was not found for any of these 25 SNPs, several genes, including RPS12, LIMK2, and SFI1 are strong candidates for diabetic nephropathy. A combined analysis of all 2890 patients with ESRD showed significant association SNPs in LIMK2 and SFI1 suggesting that they also contribute to all-cause ESRD. Thus, our results suggest that multiple loci underlie susceptibility to kidney disease in African Americans with type 2 diabetes and some may also contribute to all-cause ESRD.

Diet and Colorectal Cancer: Analysis of a Candidate Pathway Using SNPS, Haplotypes, and Multi-Gene Assessment

PubMed Central

Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Caan, Bette J.; Potter, John D.; Wolff, Roger K.

2012-01-01

There is considerable biologic plausibility to the hypothesis that genetic variability in pathways involved in insulin signaling and energy homeostasis may modulate dietary risk associated with colorectal cancer. We utilized data from 2 population-based case-control studies of colon (n = 1,574 cases, 1,970 controls) and rectal (n = 791 cases, 999 controls) cancer to evaluate genetic variation in candidate SNPs identified from 9 genes in a candidate pathway: PDK1, RP6KA1, RPS6KA2, RPS6KB1, RPS6KB2, PTEN, FRAP1 (mTOR), TSC1, TSC2, Akt1, PIK3CA, and PRKAG2 with dietary intake of total energy, carbohydrates, fat, and fiber. We employed SNP, haplotype, and multiple-gene analysis to evaluate associations. PDK1 interacted with dietary fat for both colon and rectal cancer and with dietary carbohydrates for colon cancer. Statistically significant interaction with dietary carbohydrates and rectal cancer was detected by haplotype analysis of PDK1. Evaluation of dietary interactions with multiple genes in this candidate pathway showed several interactions with pairs of genes: Akt1 and PDK1, PDK1 and PTEN, PDK1 and TSC1, and PRKAG2 and PTEN. Analyses show that genetic variation influences risk of colorectal cancer associated with diet and illustrate the importance of evaluating dietary interactions beyond the level of single SNPs or haplotypes when a biologically relevant candidate pathway is examined. PMID:21999454

Genetic variants associated with celiac disease and the risk for coronary artery disease.

PubMed

Jansen, Henning; Willenborg, Christina; Schlesinger, Sabrina; Ferrario, Paola G; König, Inke R; Erdmann, Jeanette; Samani, Nilesh J; Lieb, Wolfgang; Schunkert, Heribert

2015-10-01

Epidemiological evidence suggests that patients with celiac disease are at increased risk for coronary artery disease (CAD). Genetic-epidemiological analyses identified many single nucleotide polymorphisms (SNPs) associated with celiac disease. If there is a causal relation between celiac disease and CAD, one might expect that risk alleles primarily associated with celiac disease also increase the risk of CAD. In this study we identified from literature 41 SNPs that have been previously described to be genome-wide associated with celiac disease (p < 5 × 10(-08)). These SNPs were evaluated for their association with CAD in the Coronary ARtery DIsease Genome-wide Replication and Meta-analysis (CARDIoGRAM) dataset, a meta-analysis comprising genome-wide SNP association data from 22,233 CAD cases and 64,762 controls. 24 out of 41 (58.5 %) risk alleles for celiac disease displayed a positive association with CAD (CAD-OR range 1.001-1.081). The remaining risk alleles for celiac disease (n = 16) revealed CAD-ORs of ≤1.0 (range 0.951-1.0). The proportion of CAD associated alleles was greater but did not differ significantly from the proportion of 50 % expected by chance (p = 0.069). One SNP (rs653178 at the SH2B3/ATXN2 locus) displayed study-wise statistically significant association with CAD with directionality consistent effects on celiac disease and CAD. However, the effect of this locus is most likely driven by pleiotropic effects on multiple other diseases. In conclusion, this genetically based approach provided no convincing evidence that SNPs associated with celiac disease contribute to the risk of CAD. Hence, common non-genetic factors may play a more important role explaining the coincidence of these two complex disease conditions.

Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies

PubMed Central

Abnet, Christian C.; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D.; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M.; Liao, Linda M.; Lee, Maxwell P.; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C.; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B.; Giffen, Carol A.; Burdett, Laurie; Fraumeni, Joseph F.; Tucker, Margaret A.; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M.; Yuan, Zhi-Qing; Chanock, Stephen J.; Zhang, Xue-Jun; Taylor, Philip R.; Wang, Li-Dong

2012-01-01

Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10−8, and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19–1.40) and P= 7.63 × 10−10. An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants. PMID:22323360

Genotypic variants at 2q33 and risk of esophageal squamous cell carcinoma in China: a meta-analysis of genome-wide association studies.

PubMed

Abnet, Christian C; Wang, Zhaoming; Song, Xin; Hu, Nan; Zhou, Fu-You; Freedman, Neal D; Li, Xue-Min; Yu, Kai; Shu, Xiao-Ou; Yuan, Jian-Min; Zheng, Wei; Dawsey, Sanford M; Liao, Linda M; Lee, Maxwell P; Ding, Ti; Qiao, You-Lin; Gao, Yu-Tang; Koh, Woon-Puay; Xiang, Yong-Bing; Tang, Ze-Zhong; Fan, Jin-Hu; Chung, Charles C; Wang, Chaoyu; Wheeler, William; Yeager, Meredith; Yuenger, Jeff; Hutchinson, Amy; Jacobs, Kevin B; Giffen, Carol A; Burdett, Laurie; Fraumeni, Joseph F; Tucker, Margaret A; Chow, Wong-Ho; Zhao, Xue-Ke; Li, Jiang-Man; Li, Ai-Li; Sun, Liang-Dan; Wei, Wu; Li, Ji-Lin; Zhang, Peng; Li, Hong-Lei; Cui, Wen-Yan; Wang, Wei-Peng; Liu, Zhi-Cai; Yang, Xia; Fu, Wen-Jing; Cui, Ji-Li; Lin, Hong-Li; Zhu, Wen-Liang; Liu, Min; Chen, Xi; Chen, Jie; Guo, Li; Han, Jing-Jing; Zhou, Sheng-Li; Huang, Jia; Wu, Yue; Yuan, Chao; Huang, Jing; Ji, Ai-Fang; Kul, Jian-Wei; Fan, Zhong-Min; Wang, Jian-Po; Zhang, Dong-Yun; Zhang, Lian-Qun; Zhang, Wei; Chen, Yuan-Fang; Ren, Jing-Li; Li, Xiu-Min; Dong, Jin-Cheng; Xing, Guo-Lan; Guo, Zhi-Gang; Yang, Jian-Xue; Mao, Yi-Ming; Yuan, Yuan; Guo, Er-Tao; Zhang, Wei; Hou, Zhi-Chao; Liu, Jing; Li, Yan; Tang, Sa; Chang, Jia; Peng, Xiu-Qin; Han, Min; Yin, Wan-Li; Liu, Ya-Li; Hu, Yan-Long; Liu, Yu; Yang, Liu-Qin; Zhu, Fu-Guo; Yang, Xiu-Feng; Feng, Xiao-Shan; Wang, Zhou; Li, Yin; Gao, She-Gan; Liu, Hai-Lin; Yuan, Ling; Jin, Yan; Zhang, Yan-Rui; Sheyhidin, Ilyar; Li, Feng; Chen, Bao-Ping; Ren, Shu-Wei; Liu, Bin; Li, Dan; Zhang, Gao-Fu; Yue, Wen-Bin; Feng, Chang-Wei; Qige, Qirenwang; Zhao, Jian-Ting; Yang, Wen-Jun; Lei, Guang-Yan; Chen, Long-Qi; Li, En-Min; Xu, Li-Yan; Wu, Zhi-Yong; Bao, Zhi-Qin; Chen, Ji-Li; Li, Xian-Chang; Zhuang, Xiang; Zhou, Ying-Fa; Zuo, Xian-Bo; Dong, Zi-Ming; Wang, Lu-Wen; Fan, Xue-Pin; Wang, Jin; Zhou, Qi; Ma, Guo-Shun; Zhang, Qin-Xian; Liu, Hai; Jian, Xin-Ying; Lian, Sin-Yong; Wang, Jin-Sheng; Chang, Fu-Bao; Lu, Chang-Dong; Miao, Jian-Jun; Chen, Zhi-Guo; Wang, Ran; Guo, Ming; Fan, Zeng-Lin; Tao, Ping; Liu, Tai-Jing; Wei, Jin-Chang; Kong, Qing-Peng; Fan, Lei; Wang, Xian-Zeng; Gao, Fu-Sheng; Wang, Tian-Yun; Xie, Dong; Wang, Li; Chen, Shu-Qing; Yang, Wan-Cai; Hong, Jun-Yan; Wang, Liang; Qiu, Song-Liang; Goldstein, Alisa M; Yuan, Zhi-Qing; Chanock, Stephen J; Zhang, Xue-Jun; Taylor, Philip R; Wang, Li-Dong

2012-05-01

Genome-wide association studies have identified susceptibility loci for esophageal squamous cell carcinoma (ESCC). We conducted a meta-analysis of all single-nucleotide polymorphisms (SNPs) that showed nominally significant P-values in two previously published genome-wide scans that included a total of 2961 ESCC cases and 3400 controls. The meta-analysis revealed five SNPs at 2q33 with P< 5 × 10(-8), and the strongest signal was rs13016963, with a combined odds ratio (95% confidence interval) of 1.29 (1.19-1.40) and P= 7.63 × 10(-10). An imputation analysis of 4304 SNPs at 2q33 suggested a single association signal, and the strongest imputed SNP associations were similar to those from the genotyped SNPs. We conducted an ancestral recombination graph analysis with 53 SNPs to identify one or more haplotypes that harbor the variants directly responsible for the detected association signal. This showed that the five SNPs exist in a single haplotype along with 45 imputed SNPs in strong linkage disequilibrium, and the strongest candidate was rs10201587, one of the genotyped SNPs. Our meta-analysis found genome-wide significant SNPs at 2q33 that map to the CASP8/ALS2CR12/TRAK2 gene region. Variants in CASP8 have been extensively studied across a spectrum of cancers with mixed results. The locus we identified appears to be distinct from the widely studied rs3834129 and rs1045485 SNPs in CASP8. Future studies of esophageal and other cancers should focus on comprehensive sequencing of this 2q33 locus and functional analysis of rs13016963 and rs10201587 and other strongly correlated variants.

A candidate gene approach to study nematode resistance traits in naturally infected sheep.

PubMed

Wilkie, Hazel; Riggio, Valentina; Matika, Oswald; Nicol, Louise; Watt, Kathryn A; Sinclair, Rona; Sparks, Alexandra M; Nussey, Daniel H; Pemberton, Josephine M; Houston, Ross D; Hopkins, John

2017-08-30

Sheep naturally acquire a degree of resistant immunity to parasitic worm infection through repeated exposure. However, the immune response and clinical outcome vary greatly between animals. Genetic polymorphisms in genes integral to differential T helper cell polarization may contribute to variation in host response and disease outcome. A total of twelve single nucleotide polymorphisms (SNPs) were sequenced in IL23R, RORC2 and TBX21 from genomic DNA of Scottish Blackface lambs. Of the twelve SNPs, six were non-synonymous (missense), four were within the 3' UTRs and two were intronic. The association between nine of these SNPs and the traits of body weight, faecal egg count (FEC) and relative T. circumcincta L3-specific IgA antibody levels was assessed in a population of domestic Scottish Blackface ewe lambs and a population of free-living Soay ewe lambs both naturally infected with a mixture of nematodes. There were no significant associations identified between any of the SNPs and phenotypes recorded in either of the populations after adjustment for multiple testing (Bonferroni corrected P value≤0.002). In the Blackface lambs, there was a nominally significant association (P=0.007) between IL23R p.V324M and weight at 20 weeks. This association may be worthy of further investigation in a larger sample of sheep. Copyright © 2017. Published by Elsevier B.V.

HapMap filter 1.0: a tool to preprocess the HapMap genotypic data for association studies.

PubMed

Zhang, Wei; Duan, Shiwei; Dolan, M Eileen

2008-05-13

The International HapMap Project provides a resource of genotypic data on single nucleotide polymorphisms (SNPs), which can be used in various association studies to identify the genetic determinants for phenotypic variations. Prior to the association studies, the HapMap dataset should be preprocessed in order to reduce the computation time and control the multiple testing problem. The less informative SNPs including those with very low genotyping rate and SNPs with rare minor allele frequencies to some extent in one or more population are removed. Some research designs only use SNPs in a subset of HapMap cell lines. Although the HapMap website and other association software packages have provided some basic tools for optimizing these datasets, a fast and user-friendly program to generate the output for filtered genotypic data would be beneficial for association studies. Here, we present a flexible, straight-forward bioinformatics program that can be useful in preparing the HapMap genotypic data for association studies by specifying cell lines and two common filtering criteria: minor allele frequencies and genotyping rate. The software was developed for Microsoft Windows and written in C++. The Windows executable and source code in Microsoft Visual C++ are available at Google Code (http://hapmap-filter-v1.googlecode.com/) or upon request. Their distribution is subject to GNU General Public License v3.

Utilizing the protein corona around silica nanoparticles for dual drug loading and release

NASA Astrophysics Data System (ADS)

Shahabi, Shakiba; Treccani, Laura; Dringen, Ralf; Rezwan, Kurosch

2015-10-01

A protein corona forms spontaneously around silica nanoparticles (SNPs) in serum-containing media. To test whether this protein corona can be utilized for the loading and release of anticancer drugs we incorporated the hydrophilic doxorubicin, the hydrophobic meloxicam as well as their combination in the corona around SNPs. The application of corona-covered SNPs to osteosarcoma cells revealed that drug-free particles did not affect the cell viability. In contrast, SNPs carrying a protein corona with doxorubicin or meloxicam lowered the cell proliferation in a concentration-dependent manner. In addition, these particles had an even greater antiproliferative potential than the respective concentrations of free drugs. The best antiproliferative effects were observed for SNPs containing both doxorubicin and meloxicam in their corona. Co-localization studies revealed the presence of doxorubicin fluorescence in the nucleus and lysosomes of cells exposed to doxorubicin-containing coated SNPs, suggesting that endocytotic uptake of the SNPs facilitates the cellular accumulation of the drug. Our data demonstrate that the protein corona, which spontaneously forms around nanoparticles, can be efficiently exploited for loading the particles with multiple drugs for therapeutic purposes. As drugs are efficiently released from such particles they may have a great potential for nanomedical applications.A protein corona forms spontaneously around silica nanoparticles (SNPs) in serum-containing media. To test whether this protein corona can be utilized for the loading and release of anticancer drugs we incorporated the hydrophilic doxorubicin, the hydrophobic meloxicam as well as their combination in the corona around SNPs. The application of corona-covered SNPs to osteosarcoma cells revealed that drug-free particles did not affect the cell viability. In contrast, SNPs carrying a protein corona with doxorubicin or meloxicam lowered the cell proliferation in a concentration-dependent manner. In addition, these particles had an even greater antiproliferative potential than the respective concentrations of free drugs. The best antiproliferative effects were observed for SNPs containing both doxorubicin and meloxicam in their corona. Co-localization studies revealed the presence of doxorubicin fluorescence in the nucleus and lysosomes of cells exposed to doxorubicin-containing coated SNPs, suggesting that endocytotic uptake of the SNPs facilitates the cellular accumulation of the drug. Our data demonstrate that the protein corona, which spontaneously forms around nanoparticles, can be efficiently exploited for loading the particles with multiple drugs for therapeutic purposes. As drugs are efficiently released from such particles they may have a great potential for nanomedical applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04726a

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

PubMed

Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael

2016-01-01

Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Genome-wide association study in Asia-adapted tropical maize reveals novel and explored genomic regions for sorghum downy mildew resistance.

PubMed

Rashid, Zerka; Singh, Pradeep Kumar; Vemuri, Hindu; Zaidi, Pervez Haider; Prasanna, Boddupalli Maruthi; Nair, Sudha Krishnan

2018-01-10

Globally, downy mildews are among the important foliar diseases of maize that cause significant yield losses. We conducted a genome-wide association study for sorghum downy mildew (SDM; Peronosclerospora sorghi) resistance in a panel of 368 inbred lines adapted to the Asian tropics. High density SNPs from Genotyping-by-sequencing were used in GWAS after controlling for population structure and kinship in the panel using a single locus mixed model. The study identified a set of 26 SNPs that were significantly associated with SDM resistance, with Bonferroni corrected P values ≤ 0.05. Among all the identified SNPs, the minor alleles were found to be favorable to SDM resistance in the mapping panel. Trend regression analysis with 16 independent genetic variants including 12 SNPs and four haplotype blocks identified SNP S2_6154311 on chromosome 2 with P value 2.61E-24 and contributing 26.7% of the phenotypic variation. Six of the SNPs/haplotypes were within the same chromosomal bins as the QTLs for SDM resistance mapped in previous studies. Apart from this, eight novel genomic regions for SDM resistance were identified in this study; they need further validation before being applied in the breeding pipeline. Ten SNPs identified in this study were co-located in reported mildew resistance genes.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K

2016-05-01

To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Quantifying the heritability of testicular germ cell tumour using both population-based and genomic approaches.

PubMed

Litchfield, Kevin; Thomsen, Hauke; Mitchell, Jonathan S; Sundquist, Jan; Houlston, Richard S; Hemminki, Kari; Turnbull, Clare

2015-09-09

A sizable fraction of testicular germ cell tumour (TGCT) risk is expected to be explained by heritable factors. Recent genome-wide association studies (GWAS) have successfully identified a number of common SNPs associated with TGCT. It is however, unclear how much common variation there is left to be accounted for by other, yet to be identified, common SNPs and what contribution common genetic variation makes to the heritable risk of TGCT. We approached this question using two complimentary analytical techniques. We undertook a population-based analysis of the Swedish family-cancer database, through which we estimated that the heritability of TGCT at 48.9% (CI:47.2%-52.3%). We also applied Genome-Wide Complex Trait Analysis to 922 cases and 4,842 controls to estimate the heritability of TGCT. The heritability explained by known common risk SNPs identified by GWAS was 9.1%, whereas the heritability explained by all common SNPs was 37.4% (CI:27.6%-47.2%). These complementary findings indicate that the known TGCT SNPs only explain a small proportion of the heritability and many additional common SNPs remain to be identified. The data also suggests that a fraction of the heritability of TGCT is likely to be explained by other classes of genetic variation, such as rare disease-causing alleles.

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

USDA-ARS?s Scientific Manuscript database

The dissection of complex traits of economic importance for the pig industry requires the availability of a significant number of genetic markers, such as SNPs. This study was conducted in order to discover thousands of porcine SNPs using next generation sequencing technologies and use those SNPs, a...

Variants for HDL-C, LDL-C, and triglycerides identified from admixture mapping and fine-mapping analysis in African American families.

PubMed

Shetty, Priya B; Tang, Hua; Feng, Tao; Tayo, Bamidele; Morrison, Alanna C; Kardia, Sharon L R; Hanis, Craig L; Arnett, Donna K; Hunt, Steven C; Boerwinkle, Eric; Rao, Dabeeru C; Cooper, Richard S; Risch, Neil; Zhu, Xiaofeng

2015-02-01

Admixture mapping of lipids was followed-up by family-based association analysis to identify variants for cardiovascular disease in African Americans. The present study conducted admixture mapping analysis for total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides. The analysis was performed in 1905 unrelated African American subjects from the National Heart, Lung and Blood Institute's Family Blood Pressure Program (FBPP). Regions showing admixture evidence were followed-up with family-based association analysis in 3556 African American subjects from the FBPP. The admixture mapping and family-based association analyses were adjusted for age, age(2), sex, body mass index, and genome-wide mean ancestry to minimize the confounding caused by population stratification. Regions that were suggestive of local ancestry association evidence were found on chromosomes 7 (low-density lipoprotein cholesterol), 8 (high-density lipoprotein cholesterol), 14 (triglycerides), and 19 (total cholesterol and triglycerides). In the fine-mapping analysis, 52 939 single-nucleotide polymorphisms (SNPs) were tested and 11 SNPs (8 independent SNPs) showed nominal significant association with high-density lipoprotein cholesterol (2 SNPs), low-density lipoprotein cholesterol (4 SNPs), and triglycerides (5 SNPs). The family data were used in the fine-mapping to identify SNPs that showed novel associations with lipids and regions, including genes with known associations for cardiovascular disease. This study identified regions on chromosomes 7, 8, 14, and 19 and 11 SNPs from the fine-mapping analysis that were associated with high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides for further studies of cardiovascular disease in African Americans. © 2014 American Heart Association, Inc.

Inferring causal relationships between phenotypes using summary statistics from genome-wide association studies.

PubMed

Meng, Xiang-He; Shen, Hui; Chen, Xiang-Ding; Xiao, Hong-Mei; Deng, Hong-Wen

2018-03-01

Genome-wide association studies (GWAS) have successfully identified numerous genetic variants associated with diverse complex phenotypes and diseases, and provided tremendous opportunities for further analyses using summary association statistics. Recently, Pickrell et al. developed a robust method for causal inference using independent putative causal SNPs. However, this method may fail to infer the causal relationship between two phenotypes when only a limited number of independent putative causal SNPs identified. Here, we extended Pickrell's method to make it more applicable for the general situations. We extended the causal inference method by replacing the putative causal SNPs with the lead SNPs (the set of the most significant SNPs in each independent locus) and tested the performance of our extended method using both simulation and empirical data. Simulations suggested that when the same number of genetic variants is used, our extended method had similar distribution of test statistic under the null model as well as comparable power under the causal model compared with the original method by Pickrell et al. But in practice, our extended method would generally be more powerful because the number of independent lead SNPs was often larger than the number of independent putative causal SNPs. And including more SNPs, on the other hand, would not cause more false positives. By applying our extended method to summary statistics from GWAS for blood metabolites and femoral neck bone mineral density (FN-BMD), we successfully identified ten blood metabolites that may causally influence FN-BMD. We extended a causal inference method for inferring putative causal relationship between two phenotypes using summary statistics from GWAS, and identified a number of potential causal metabolites for FN-BMD, which may provide novel insights into the pathophysiological mechanisms underlying osteoporosis.

Association between genetic variation within vitamin D receptor-DNA binding sites and risk of basal cell carcinoma.

PubMed

Lin, Yuan; Chahal, Harvind S; Wu, Wenting; Cho, Hyunje G; Ransohoff, Katherine J; Dai, Hongji; Tang, Jean Y; Sarin, Kavita Y; Han, Jiali

2017-05-01

An increasing number of studies have reported a protective association between vitamin D and cancer risk. The vitamin D endocrine system regulates transcriptional programs involved in inflammation, cell growth and differentiation through the binding of vitamin D receptor (VDR) to specific VDR elements. However, limited attention has been given to the role of variation within VDR binding sites in the development of basal cell carcinoma (BCC). Across 2,776 previously identified VDR binding sites, we identified 2,540 independent single-nucleotide polymorphisms (SNPs) and examined their associations with BCC risk in a genome-wide association meta-analysis totaling 17,187 BCC cases and 287,054 controls from two data sets. After multiple testing corrections, we identified two SNPs at new loci (rs16917546 at 10q21.1: odds ratio (OR) = 1.06, p = 3.16 × 10 -7 and rs79824801 at 12q13.3: OR = 1.10, p = 1.88 × 10 -5 ) for the first time as independently related to BCC risk in meta-analysis; and both SNPs were nominally significant in two data sets. In addition, the SNP rs3769823 within VDR binding site at a previously reported BCC susceptibility locus (2q33.1, rs13014235) also exhibited a significant association (OR = 1.12, p = 3.99 × 10 -18 ). A mutually adjusted model suggested that rs3769823 explained the signal in this region. Our findings support the hypothesis that inherited common variation in VDR binding sites affects the development of BCC. © 2017 UICC.

Identification of SNPs associated with muscle yield and quality traits using allelic-imbalance analyses of pooled RNA-Seq samples in rainbow trout.

PubMed

Al-Tobasei, Rafet; Ali, Ali; Leeds, Timothy D; Liu, Sixin; Palti, Yniv; Kenney, Brett; Salem, Mohamed

2017-08-07

Coding/functional SNPs change the biological function of a gene and, therefore, could serve as "large-effect" genetic markers. In this study, we used two bioinformatics pipelines, GATK and SAMtools, for discovering coding/functional SNPs with allelic-imbalances associated with total body weight, muscle yield, muscle fat content, shear force, and whiteness. Phenotypic data were collected for approximately 500 fish, representing 98 families (5 fish/family), from a growth-selected line, and the muscle transcriptome was sequenced from 22 families with divergent phenotypes (4 low- versus 4 high-ranked families per trait). GATK detected 59,112 putative SNPs; of these SNPs, 4798 showed allelic imbalances (>2.0 as an amplification and <0.5 as loss of heterozygosity). SAMtools detected 87,066 putative SNPs; and of them, 4962 had allelic imbalances between the low- and high-ranked families. Only 1829 SNPs with allelic imbalances were common between the two datasets, indicating significant differences in algorithms. The two datasets contained 7930 non-redundant SNPs of which 4439 mapped to 1498 protein-coding genes (with 6.4% non-synonymous SNPs) and 684 mapped to 295 lncRNAs. Validation of a subset of 92 SNPs revealed 1) 86.7-93.8% success rate in calling polymorphic SNPs and 2) 95.4% consistent matching between DNA and cDNA genotypes indicating a high rate of identifying SNPs with allelic imbalances. In addition, 4.64% SNPs revealed random monoallelic expression. Genome distribution of the SNPs with allelic imbalances exhibited high density for all five traits in several chromosomes, especially chromosome 9, 20 and 28. Most of the SNP-harboring genes were assigned to important growth-related metabolic pathways. These results demonstrate utility of RNA-Seq in assessing phenotype-associated allelic imbalances in pooled RNA-Seq samples. The SNPs identified in this study were included in a new SNP-Chip design (available from Affymetrix) for genomic and genetic analyses in rainbow trout.

Fine-scale mapping of 8q24 locus identifies multiple independent risk variants for breast cancer

PubMed Central

Zheng, Wei; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Lush, Michael; Milne, Roger L.; Shu, Xiao-Ou; Beesley, Jonathan; Kar, Siddhartha; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W.; Zhao, Zhiguo; Guo, Xingyi; Benitez, Javier; Beeghly-Fadiel, Alicia; Blot, William; Bogdanova, Natalia V.; Bojesen, Stig E.; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dork, Thilo; Fasching, Peter A.; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G.; Guenel, Pascal; Haiman, Christopher A.; Hamann, Ute; Hartman, Mikael; Miao, Hui; Hollestelle, Antoinette; Hopper, John L.; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Torres, Diana; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A.; Kosma, Veli-Matti; Lambrechts, Diether; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Børresen-Dale, Anne-Lise; Olson, Janet E.; Orr, Nick; van den Ouweland, Ans M.W.; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Shen, Chen-Yang; Hou, Ming-Feng; Shrubsole, Matha J; Southey, Melissa C.; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda E.; Tollenaar, Robert A.E.M.; Tomlinson, Ian; Truong, Therese; Tseng, Chiu-chen; Wen, Wanqing; Winqvist, Robert; Wu, Anna H.; Yip, Cheng Har; Zamora, Pilar M.; Zheng, Ying; Floris, Giuseppe; Cheng, Ching-Yu; Hooning, Maartje J.; Martens, John W.M.; Seynaeve, Caroline; Kristensen, Vessela N.; Hall, Per; Pharoah, Paul D.P.; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M.; Antoniou, Antonis C.; Easton, Douglas F.; Cai, Qiuyin; Long, Jirong

2016-01-01

Previous genome-wide association studies among women of European ancestry identified two independent breast cancer susceptibility loci represented by single nucleotide polymorphisms (SNPs) rs13281615 and rs11780156 at 8q24. We conducted a fine-mapping study across 2.06 Mb (chr8:127,561,724 −129,624,067, hg19) in 55,540 breast cancer cases and 51,168 controls within the Breast Cancer Association Consortium. We found three additional independent association signals in women of European ancestry, represented by rs35961416 (OR = 0.95, 95% CI = 0.93-0.97, conditional P = 5.8 × 10−6), rs7815245 (OR = 0.94, 95% CI = 0.91-0.96, conditional P = 1.1 × 10−6), and rs2033101 (OR = 1.05, 95% CI = 1.02-1.07, conditional P = 1.1 × 10−4). Integrative analysis using functional genomic data from the Roadmap Epigenomics, the Encyclopedia of DNA Elements project, the Cancer Genome Atlas, and other public resources implied that SNPs rs7815245 in Signal 3, and rs1121948 in Signal 5 (in linkage disequilibrium with rs11780156, r2 = 0.77), were putatively functional variants for two of the five independent association signals. Our results highlight multiple 8q24 variants associated with breast cancer susceptibility in women of European ancestry. PMID:27087578

Fine-scale mapping of 8q24 locus identifies multiple independent risk variants for breast cancer.

PubMed

Shi, Jiajun; Zhang, Yanfeng; Zheng, Wei; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Lush, Michael; Milne, Roger L; Shu, Xiao-Ou; Beesley, Jonathan; Kar, Siddhartha; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W; Zhao, Zhiguo; Guo, Xingyi; Benitez, Javier; Beeghly-Fadiel, Alicia; Blot, William; Bogdanova, Natalia V; Bojesen, Stig E; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dork, Thilo; Fasching, Peter A; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G; Guenel, Pascal; Haiman, Christopher A; Hamann, Ute; Hartman, Mikael; Miao, Hui; Hollestelle, Antoinette; Hopper, John L; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Torres, Diana; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A; Kosma, Veli-Matti; Lambrechts, Diether; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Børresen-Dale, Anne-Lise; Olson, Janet E; Orr, Nick; van den Ouweland, Ans M W; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Shen, Chen-Yang; Hou, Ming-Feng; Shrubsole, Matha J; Southey, Melissa C; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda E; Tollenaar, Robert A E M; Tomlinson, Ian; Truong, Therese; Tseng, Chiu-Chen; Wen, Wanqing; Winqvist, Robert; Wu, Anna H; Yip, Cheng Har; Zamora, Pilar M; Zheng, Ying; Floris, Giuseppe; Cheng, Ching-Yu; Hooning, Maartje J; Martens, John W M; Seynaeve, Caroline; Kristensen, Vessela N; Hall, Per; Pharoah, Paul D P; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M; Antoniou, Antonis C; Easton, Douglas F; Cai, Qiuyin; Long, Jirong

2016-09-15

Previous genome-wide association studies among women of European ancestry identified two independent breast cancer susceptibility loci represented by single nucleotide polymorphisms (SNPs) rs13281615 and rs11780156 at 8q24. A fine-mapping study across 2.06 Mb (chr8:127,561,724-129,624,067, hg19) in 55,540 breast cancer cases and 51,168 controls within the Breast Cancer Association Consortium was conducted. Three additional independent association signals in women of European ancestry, represented by rs35961416 (OR = 0.95, 95% CI = 0.93-0.97, conditional p = 5.8 × 10(-6) ), rs7815245 (OR = 0.94, 95% CI = 0.91-0.96, conditional p = 1.1 × 10(-6) ) and rs2033101 (OR = 1.05, 95% CI = 1.02-1.07, conditional p = 1.1 × 10(-4) ) were found. Integrative analysis using functional genomic data from the Roadmap Epigenomics, the Encyclopedia of DNA Elements project, the Cancer Genome Atlas and other public resources implied that SNPs rs7815245 in Signal 3, and rs1121948 in Signal 5 (in linkage disequilibrium with rs11780156, r(2)  = 0.77), were putatively functional variants for two of the five independent association signals. The results highlighted multiple 8q24 variants associated with breast cancer susceptibility in women of European ancestry. © 2016 UICC.

Pharmacogenetics of steroid-responsive acute graft-versus-host disease.

PubMed

Arora, Mukta; Weisdorf, Daniel J; Shanley, Ryan M; Thyagarajan, Bharat

2017-05-01

Glucocorticoids are central to effective therapy of acute graft-versus-host disease (GVHD). However, only about half of the patients respond to steroids in initial therapy. Based on postulated mechanisms for anti-inflammatory effectiveness, we explored genetic variations in glucocorticoid receptor, co-chaperone proteins, membrane transporters, inflammatory mediators, and variants in the T-cell receptor complex in hematopoietic cell transplant recipients with acute GVHD requiring treatment with steroids and their donors toward response at day 28 after initiation of therapy. A total of 300 recipient and donor samples were analyzed. Twenty-three SNPs in 17 genes affecting glucocorticoid pathways were included in the analysis. In multiple regression analysis, donor SNP rs3192177 in the ZAP70 gene (O.R. 2.8, 95% CI: 1.3-6.0, P=.008) and donor SNP rs34471628 in the DUSPI gene (O.R. 0.3, 95% CI: 0.1-1.0, P=.048) were significantly associated with complete or partial response. However, after adjustment for multiple testing, these SNPs did not remain statistically significant. Our results, on this small, exploratory, hypothesis generating analysis suggest that common genetic variation in glucocorticoid pathways may help identify subjects with differential response to glucocorticoids. This needs further assessment in larger datasets and if validated could help identify subjects for alternative treatments and design targeted treatments to overcome steroid resistance. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genome-wide Association Studies for Female Fertility Traits in Chinese and Nordic Holsteins.

PubMed

Liu, Aoxing; Wang, Yachun; Sahana, Goutam; Zhang, Qin; Liu, Lin; Lund, Mogens Sandø; Su, Guosheng

2017-08-16

Reduced female fertility could cause considerable economic loss and has become a worldwide problem in the modern dairy industry. The objective of this study was to detect quantitative trait loci (QTL) for female fertility traits in Chinese and Nordic Holsteins using various strategies. First, single-trait association analyses were performed for female fertility traits in Chinese and Nordic Holsteins. Second, the SNPs with P-value < 0.005 discovered in Chinese Holsteins were validated in Nordic Holsteins. Third, the summary statistics from single-trait association analyses were combined into meta-analyses to: (1) identify common QTL for multiple fertility traits within each Holstein population; (2) detect SNPs which were associated with a female fertility trait across two Holstein populations. A large numbers of QTL were discovered or confirmed for female fertility traits. The QTL segregating at 31.4~34.1 Mb on BTA13, 48.3~51.9 Mb on BTA23 and 34.0~37.6 Mb on BTA28 shared between Chinese and Nordic Holsteins were further ascertained using a validation approach and meta-analyses. Furthermore, multiple novel variants identified in Chinese Holsteins were validated with Nordic data as well as meta-analyses. The genes IL6R, SLC39A12, CACNB2, ZEB1, ZMIZ1 and FAM213A were concluded to be strong candidate genes for female fertility in Holsteins.

Large-scale genotyping identifies 41 new loci associated with breast cancer risk.

PubMed

Michailidou, Kyriaki; Hall, Per; Gonzalez-Neira, Anna; Ghoussaini, Maya; Dennis, Joe; Milne, Roger L; Schmidt, Marjanka K; Chang-Claude, Jenny; Bojesen, Stig E; Bolla, Manjeet K; Wang, Qin; Dicks, Ed; Lee, Andrew; Turnbull, Clare; Rahman, Nazneen; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; Dos Santos Silva, Isabel; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel; van der Luijt, Rob B; Hein, Rebecca; Dahmen, Norbert; Beckman, Lars; Meindl, Alfons; Schmutzler, Rita K; Müller-Myhsok, Bertram; Lichtner, Peter; Hopper, John L; Southey, Melissa C; Makalic, Enes; Schmidt, Daniel F; Uitterlinden, Andre G; Hofman, Albert; Hunter, David J; Chanock, Stephen J; Vincent, Daniel; Bacot, François; Tessier, Daniel C; Canisius, Sander; Wessels, Lodewyk F A; Haiman, Christopher A; Shah, Mitul; Luben, Robert; Brown, Judith; Luccarini, Craig; Schoof, Nils; Humphreys, Keith; Li, Jingmei; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Stevens, Kristen N; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Johnson, Nichola; Aitken, Zoe; Aaltonen, Kirsimari; Heikkinen, Tuomas; Broeks, Annegien; Veer, Laura J Van't; van der Schoot, C Ellen; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Zamora, M Pilar; Perez, Jose Ignacio Arias; Pita, Guillermo; Alonso, M Rosario; Cox, Angela; Brock, Ian W; Cross, Simon S; Reed, Malcolm W R; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Lindblom, Annika; Margolin, Sara; Hooning, Maartje J; Hollestelle, Antoinette; van den Ouweland, Ans M W; Jager, Agnes; Bui, Quang M; Stone, Jennifer; Dite, Gillian S; Apicella, Carmel; Tsimiklis, Helen; Giles, Graham G; Severi, Gianluca; Baglietto, Laura; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Brüning, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Devilee, Peter; Tollenaar, Rob A E M; Seynaeve, Caroline; van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Bogdanova, Natalia V; Antonenkova, Natalia N; Dörk, Thilo; Kristensen, Vessela N; Anton-Culver, Hoda; Slager, Susan; Toland, Amanda E; Edge, Stephen; Fostira, Florentia; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Teo, Soo Hwang; Yip, Cheng Har; Phuah, Sze Yee; Cornes, Belinda K; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Sng, Jen-Hwei; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-Ling; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Blot, William J; Signorello, Lisa B; Cai, Qiuyin; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Simard, Jacques; Garcia-Closas, Montse; Pharoah, Paul D P; Chenevix-Trench, Georgia; Dunning, Alison M; Benitez, Javier; Easton, Douglas F

2013-04-01

Breast cancer is the most common cancer among women. Common variants at 27 loci have been identified as associated with susceptibility to breast cancer, and these account for ∼9% of the familial risk of the disease. We report here a meta-analysis of 9 genome-wide association studies, including 10,052 breast cancer cases and 12,575 controls of European ancestry, from which we selected 29,807 SNPs for further genotyping. These SNPs were genotyped in 45,290 cases and 41,880 controls of European ancestry from 41 studies in the Breast Cancer Association Consortium (BCAC). The SNPs were genotyped as part of a collaborative genotyping experiment involving four consortia (Collaborative Oncological Gene-environment Study, COGS) and used a custom Illumina iSelect genotyping array, iCOGS, comprising more than 200,000 SNPs. We identified SNPs at 41 new breast cancer susceptibility loci at genome-wide significance (P < 5 × 10(-8)). Further analyses suggest that more than 1,000 additional loci are involved in breast cancer susceptibility.

Large-scale genotyping identifies 41 new loci associated with breast cancer risk

PubMed Central

Michailidou, Kyriaki; Hall, Per; Gonzalez-Neira, Anna; Ghoussaini, Maya; Dennis, Joe; Milne, Roger L; Schmidt, Marjanka K; Chang-Claude, Jenny; Bojesen, Stig E; Bolla, Manjeet K; Wang, Qin; Dicks, Ed; Lee, Andrew; Turnbull, Clare; Rahman, Nazneen; Fletcher, Olivia; Peto, Julian; Gibson, Lorna; Silva, Isabel dos Santos; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Czene, Kamila; Irwanto, Astrid; Liu, Jianjun; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel; van der Luijt, Rob B; Hein, Rebecca; Dahmen, Norbert; Beckman, Lars; Meindl, Alfons; Schmutzler, Rita K; Müller-Myhsok, Bertram; Lichtner, Peter; Hopper, John L; Southey, Melissa C; Makalic, Enes; Schmidt, Daniel F; Uitterlinden, Andre G; Hofman, Albert; Hunter, David J; Chanock, Stephen J; Vincent, Daniel; Bacot, François; Tessier, Daniel C; Canisius, Sander; Wessels, Lodewyk F A; Haiman, Christopher A; Shah, Mitul; Luben, Robert; Brown, Judith; Luccarini, Craig; Schoof, Nils; Humphreys, Keith; Li, Jingmei; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Stevens, Kristen N; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Johnson, Nichola; Aitken, Zoe; Aaltonen, Kirsimari; Heikkinen, Tuomas; Broeks, Annegien; Van’t Veer, Laura J; van der Schoot, C Ellen; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Zamora, M Pilar; Perez, Jose Ignacio Arias; Pita, Guillermo; Alonso, M Rosario; Cox, Angela; Brock, Ian W; Cross, Simon S; Reed, Malcolm W R; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Lindblom, Annika; Margolin, Sara; Hooning, Maartje J; Hollestelle, Antoinette; van den Ouweland, Ans M W; Jager, Agnes; Bui, Quang M; Stone, Jennifer; Dite, Gillian S; Apicella, Carmel; Tsimiklis, Helen; Giles, Graham G; Severi, Gianluca; Baglietto, Laura; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Brauch, Hiltrud; Hamann, Ute; Brüning, Thomas; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Devilee, Peter; Tollenaar, Rob A E M; Seynaeve, Caroline; van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Bogdanova, Natalia V; Antonenkova, Natalia N; Dörk, Thilo; Kristensen, Vessela N; Anton-Culver, Hoda; Slager, Susan; Toland, Amanda E; Edge, Stephen; Fostira, Florentia; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Teo, Soo Hwang; Yip, Cheng Har; Phuah, Sze Yee; Cornes, Belinda K; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Sng, Jen-Hwei; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-Ling; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Blot, William J; Signorello, Lisa B; Cai, Qiuyin; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Simard, Jacques; Garcia-Closas, Montse; Pharoah, Paul D P; Chenevix-Trench, Georgia; Dunning, Alison M; Benitez, Javier; Easton, Douglas F

2013-01-01

Breast cancer is the most common cancer among women. Common variants at 27 loci have been identified as associated with susceptibility to breast cancer, and these account for ~9% of the familial risk of the disease. We report here a meta-analysis of 9 genome-wide association studies, including 10,052 breast cancer cases and 12,575 controls of European ancestry, from which we selected 29,807 SNPs for further genotyping. These SNPs were genotyped in 45,290 cases and 41,880 controls of European ancestry from 41 studies in the Breast Cancer Association Consortium (BCAC). The SNPs were genotyped as part of a collaborative genotyping experiment involving four consortia (Collaborative Oncological Gene-environment Study, COGS) and used a custom Illumina iSelect genotyping array, iCOGS, comprising more than 200,000 SNPs. We identified SNPs at 41 new breast cancer susceptibility loci at genome-wide significance (P < 5 × 10−8). Further analyses suggest that more than 1,000 additional loci are involved in breast cancer susceptibility. PMID:23535729

Computational Methods to Work as First-Pass Filter in Deleterious SNP Analysis of Alkaptonuria

PubMed Central

Magesh, R.; George Priya Doss, C.

2012-01-01

A major challenge in the analysis of human genetic variation is to distinguish functional from nonfunctional SNPs. Discovering these functional SNPs is one of the main goals of modern genetics and genomics studies. There is a need to effectively and efficiently identify functionally important nsSNPs which may be deleterious or disease causing and to identify their molecular effects. The prediction of phenotype of nsSNPs by computational analysis may provide a good way to explore the function of nsSNPs and its relationship with susceptibility to disease. In this context, we surveyed and compared variation databases along with in silico prediction programs to assess the effects of deleterious functional variants on protein functions. In other respects, we attempted these methods to work as first-pass filter to identify the deleterious substitutions worth pursuing for further experimental research. In this analysis, we used the existing computational methods to explore the mutation-structure-function relationship in HGD gene causing alkaptonuria. PMID:22606059

Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

PubMed

Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

2018-01-01

Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In general, our results demonstrated the usefulness of Random Forest in combination to other reduction techniques to identify population informative SNPs.

Use of Multiple Metabolic and Genetic Markers to Improve the Prediction of Type 2 Diabetes: the EPIC-Potsdam Study

PubMed Central

Schulze, Matthias B.; Weikert, Cornelia; Pischon, Tobias; Bergmann, Manuela M.; Al-Hasani, Hadi; Schleicher, Erwin; Fritsche, Andreas; Häring, Hans-Ulrich; Boeing, Heiner; Joost, Hans-Georg

2009-01-01

OBJECTIVE We investigated whether metabolic biomarkers and single nucleotide polymorphisms (SNPs) improve diabetes prediction beyond age, anthropometry, and lifestyle risk factors. RESEARCH DESIGN AND METHODS A case-cohort study within a prospective study was designed. We randomly selected a subcohort (n = 2,500) from 26,444 participants, of whom 1,962 were diabetes free at baseline. Of the 801 incident type 2 diabetes cases identified in the cohort during 7 years of follow-up, 579 remained for analyses after exclusions. Prediction models were compared by receiver operatoring characteristic (ROC) curve and integrated discrimination improvement. RESULTS Case-control discrimination by the lifestyle characteristics (ROC-AUC: 0.8465) improved with plasma glucose (ROC-AUC: 0.8672, P < 0.001) and A1C (ROC-AUC: 0.8859, P < 0.001). ROC-AUC further improved with HDL cholesterol, triglycerides, γ-glutamyltransferase, and alanine aminotransferase (0.9000, P = 0.002). Twenty SNPs did not improve discrimination beyond these characteristics (P = 0.69). CONCLUSIONS Metabolic markers, but not genotyping for 20 diabetogenic SNPs, improve discrimination of incident type 2 diabetes beyond lifestyle risk factors. PMID:19720844

IL2RA Allele Increases Risk of Neuromyelitis Optica in Southern Han Chinese.

PubMed

Dai, Yongqiang; Li, Jin; Zhong, Xiaonan; Wang, Yuge; Qiu, Wei; Lu, Zhengqi; Wu, Aimin; Bao, Jian; Peng, Fuhua; Hu, Xueqiang

2013-11-01

Neuromyelitis optica (NMO) and multiple sclerosis (MS) are chronic neuro-inflammatory diseases believed to arise from complex interactions between environmental and genetic factors. Recently, single nucleotide polymorphisms (SNPs) in interleukin (IL)-2 and -7 receptor alpha genes have been identified as novel susceptibility alleles for MS in genome-wide association studies. However, similar research on NMO is limited. We aimed to investigate the association of IL2RA SNPs rs2104286 and rs12722489 and IL7RA SNP rs6897932 with Southern Han Chinese NMO and MS patients. Frequencies of the three SNPs were examined in Southern Han Chinese mS cases (n=78), NMS cases (n=67) and controls (n=133) using sequencing-based typing. The rs2104286(G) frequency in the IL2RA gene was significantly higher in NMO patients than in controls (p(uncorr)=0.013, p(corr)=0.026, OR:1.942, 95%CI:1.146-3.291). The rs2104286 G allele in IL2RA is present at higher frequencies in NMO patients than in healthy controls within a Southern Han Chinese population. Les allèles IL2RA augmentent le risque de neuromyélite optique chez les Chinois Han du sud.

Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

PubMed Central

Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

2007-01-01

Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

Portability of tag SNPs across isolated population groups: an example from India.

PubMed

Sarkar Roy, N; Farheen, S; Roy, N; Sengupta, S; Majumder, P P

2008-01-01

Isolated population groups are useful in conducting association studies of complex diseases to avoid various pitfalls, including those arising from population stratification. Since DNA resequencing is expensive, it is recommended that genotyping be carried out at tagSNP (tSNP) loci. For this, tSNPs identified in one isolated population need to be used in another. Unless tSNPs are highly portable across populations this strategy may result in loss of information in association studies. We examined the issue of tSNP portability by sampling individuals from 10 isolated ethnic groups from India. We generated DNA resequencing data pertaining to 3 genomic regions and identified tSNPs in each population. We defined an index of tSNP portability and showed that portability is low across isolated Indian ethnic groups. The extent of portability did not significantly correlate with genetic similarity among the populations studied here. We also analyzed our data with sequence data from individuals of African and European descent. Our results indicated that it may be necessary to carry out resequencing in a small number of individuals to discover SNPs and identify tSNPs in the specific isolated population in which a disease association study is to be conducted.

Joint Effects of Known Type 2 Diabetes Susceptibility Loci in Genome-Wide Association Study of Singapore Chinese: The Singapore Chinese Health Study

PubMed Central

Chen, Zhanghua; Pereira, Mark A.; Seielstad, Mark; Koh, Woon-Puay; Tai, E. Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O.; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D.; Stram, Daniel O.

2014-01-01

Background Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. Methods 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r2>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ±100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Results Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69–2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72×10−14). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. Conclusions While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease. PMID:24520337

Joint effects of known type 2 diabetes susceptibility loci in genome-wide association study of Singapore Chinese: the Singapore Chinese health study.

PubMed

Chen, Zhanghua; Pereira, Mark A; Seielstad, Mark; Koh, Woon-Puay; Tai, E Shyong; Teo, Yik-Ying; Liu, Jianjun; Hsu, Chris; Wang, Renwei; Odegaard, Andrew O; Thyagarajan, Bharat; Koratkar, Revati; Yuan, Jian-Min; Gross, Myron D; Stram, Daniel O

2014-01-01

Genome-wide association studies (GWAS) have identified genetic factors in type 2 diabetes (T2D), mostly among individuals of European ancestry. We tested whether previously identified T2D-associated single nucleotide polymorphisms (SNPs) replicate and whether SNPs in regions near known T2D SNPs were associated with T2D within the Singapore Chinese Health Study. 2338 cases and 2339 T2D controls from the Singapore Chinese Health Study were genotyped for 507,509 SNPs. Imputation extended the genotyped SNPs to 7,514,461 with high estimated certainty (r(2)>0.8). Replication of known index SNP associations in T2D was attempted. Risk scores were computed as the sum of index risk alleles. SNPs in regions ± 100 kb around each index were tested for associations with T2D in conditional fine-mapping analysis. Of 69 index SNPs, 20 were genotyped directly and genotypes at 35 others were well imputed. Among the 55 SNPs with data, disease associations were replicated (at p<0.05) for 15 SNPs, while 32 more were directionally consistent with previous reports. Risk score was a significant predictor with a 2.03 fold higher risk CI (1.69-2.44) of T2D comparing the highest to lowest quintile of risk allele burden (p = 5.72 × 10(-14)). Two improved SNPs around index rs10923931 and 5 new candidate SNPs around indices rs10965250 and rs1111875 passed simple Bonferroni corrections for significance in conditional analysis. Nonetheless, only a small fraction (2.3% on the disease liability scale) of T2D burden in Singapore is explained by these SNPs. While diabetes risk in Singapore Chinese involves genetic variants, most disease risk remains unexplained. Further genetic work is ongoing in the Singapore Chinese population to identify unique common variants not already seen in earlier studies. However rapid increases in T2D risk have occurred in recent decades in this population, indicating that dynamic environmental influences and possibly gene by environment interactions complicate the genetic architecture of this disease.

Associations between RNA splicing regulatory variants of stemness-related genes and racial disparities in susceptibility to prostate cancer.

PubMed

Wang, Yanru; Freedman, Jennifer A; Liu, Hongliang; Moorman, Patricia G; Hyslop, Terry; George, Daniel J; Lee, Norman H; Patierno, Steven R; Wei, Qingyi

2017-08-15

Evidence suggests that cells with a stemness phenotype play a pivotal role in oncogenesis, and prostate cells exhibiting this phenotype have been identified. We used two genome-wide association study (GWAS) datasets of African descendants, from the Multiethnic/Minority Cohort Study of Diet and Cancer (MEC) and the Ghana Prostate Study, and two GWAS datasets of non-Hispanic whites, from the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial and the Breast and Prostate Cancer Cohort Consortium (BPC3), to analyze the associations between genetic variants of stemness-related genes and racial disparities in susceptibility to prostate cancer. We evaluated associations of single-nucleotide polymorphisms (SNPs) in 25 stemness-related genes with prostate cancer risk in 1,609 cases and 2,550 controls of non-Hispanic whites (4,934 SNPs) and 1,144 cases and 1,116 controls of African descendants (5,448 SNPs) with correction by false discovery rate ≤0.2. We identified 32 SNPs in five genes (TP63, ALDH1A1, WNT1, MET and EGFR) that were significantly associated with prostate cancer risk, of which six SNPs in three genes (TP63, ALDH1A1 and WNT1) and eight EGFR SNPs showed heterogeneity in susceptibility between these two racial groups. In addition, 13 SNPs in MET and one in ALDH1A1 were found only in African descendants. The in silico bioinformatics analyses revealed that EGFR rs2072454 and SNPs in linkage with the identified SNPs in MET and ALDH1A1 (r 2  > 0.6) were predicted to regulate RNA splicing. These variants may serve as novel biomarkers for racial disparities in prostate cancer risk. © 2017 UICC.

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Combining Genome Wide Association Study and lung eQTL analysis provides evidence for novel genes associated with asthma

PubMed Central

Nieuwenhuis, Maartje A.; Siedlinski, Matteusz; van den Berge, Maarten; Granell, Raquel; Li, Xingnan; Niens, Marijke; van der Vlies, Pieter; Altmüller, Janine; Nürnberg, Peter; Kerkhof, Marjan; van Schayck, Onno C.; Riemersma, Ronald A.; van der Molen, Thys; de Monchy, Jan G.; Bossé, Yohan; Sandford, Andrew; Bruijnzeel-Koomen, Carla A.; van Wijk, Roy G.; ten Hacken, Nick H.; Timens, Wim; Boezen, H. Marike; Henderson, John; Kabesch, Michael; Vonk, Judith M.; Postma, Dirkje S.; Koppelman, Gerard H.

2016-01-01

Background Genome wide association studies (GWAS) of asthma have identified single nucleotide polymorphisms (SNPs) that modestly increase the risk for asthma. This could be due to phenotypic heterogeneity of asthma. Bronchial hyperresponsiveness (BHR) is a phenotypic hallmark of asthma. We aim to identify susceptibility genes for asthma combined with BHR and analyse the presence of cis-eQTLs among replicated SNPs. Secondly, we compare the genetic association of SNPs previously associated with (doctor diagnosed) asthma to our GWAS of asthma with BHR. Methods A GWAS was performed in 920 asthmatics with BHR and 980 controls. Top SNPs of our GWAS were analysed in four replication cohorts and lung cis-eQTL analysis was performed on replicated SNPs. We investigated association of SNPs previously associated with asthma in our data. Results 368 SNPs were followed up for replication. Six SNPs in genes encoding ABI3BP, NAF1, MICA and the 17q21 locus replicated in one or more cohorts, with one locus (17q21) achieving genome wide significance after meta-analysis. Five out of 6 replicated SNPs regulated 35 gene transcripts in whole lung. Eight of 20 asthma associated SNPs from previous GWAS were significantly associated with asthma and BHR. Three SNPs, in IL-33 and GSDMB, showed larger effect sizes in our data compared to published literature. Conclusions Combining GWAS with subsequent lung eQTL analysis revealed disease associated SNPs regulating lung mRNA expression levels of potential new asthma genes. Adding BHR to the asthma definition does not lead to an overall larger genetic effect size than analysing (doctor’s diagnosed) asthma. PMID:27439200

A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

PubMed Central

Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

2007-01-01

Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

PubMed

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation <92%. Control children were defined as non-snoring children with AHI <2/h TST (NOSA). Endothelial function was assessed using a modified post-occlusive hyperemic test. The time to peak reperfusion (Tmax) was considered as the indicator for normal endothelial function (NEF; Tmax<45 sec), or ED (Tmax ≥ 45 sec). Genomic DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular morbidity. Thus, analysis of genotype-phenotype interactions in children with OSA may assist in the formulation of categorical risk estimates.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Association Between Genes Involved in Craniofacial Development and Nonsyndromic Cleft Lip and/or Palate in the Brazilian Population.

PubMed

Machado, Renato Assis; Messetti, Ana Camila; de Aquino, Sibele Nascimento; Martelli-Júnior, Hercílio; Swerts, Mário Sérgio Oliveira; de Almeida Reis, Silvia Regina; Moreira, Helenara Salvati Bertolossi; Persuhn, Darlene Camati; Coletta, Ricardo D

2016-09-01

To determine the association of single-nucleotide polymorphisms (SNPs) in genes related to craniofacial development, which were previously identified as susceptibility signals for nonsyndromic oral clefts, in Brazilians with nonsyndromic cleft lip and/or palate (NSCL/P). The SNPs rs748044 (TNP1), rs1106514 (MSX1), rs28372960, rs15251 and rs2569062 (TCOF1), rs7829058 (FGFR1), rs1793949 (COL2A1), rs11653738 (WNT3), and rs242082 (TIMP3) were assessed in a family-based transmission disequilibrium test (TDT) and a structured case-control analysis based on the individual ancestry proportions. The SNPs were initially analyzed by TDT, and polymorphisms showing a trend toward excess transmission were subsequently studied in an independent case-control sample. The study sample consisted of 189 case-parent trios of nonsyndromic cleft lip with or without cleft palate (NSCL±P), 107 case-parent trios of nonsyndromic cleft palate (NSCP), 318 isolated samples of NSCL±P, 189 isolated samples of NSCP, and 599 healthy controls. Association of alleles with NSCL/P pathogenesis. Preferential transmission of SNPs rs28372960 and rs7829058 in NSCL±P trios and rs11653738 in NSCP trios (P = .04) were observed, although the structured case-control analysis did not confirm these associations. The haplotype T-C-C formed by TCOF1 SNPs rs28372960, rs15251, and rs2569062 was more frequently transmitted from healthy parents to NSCL±P offspring, but the P value (P = .01) did not withstand Bonferroni correction for multiple tests. With the modest associations, our results do not support the hypothesis that TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3, and TIMP3 variants are risk factors for nonsyndromic oral clefts in the Brazilian population.

Strong influence of dietary intake and physical activity on body fatness in elderly Japanese men: age-associated loss of polygenic resistance against obesity.

PubMed

Tanisawa, Kumpei; Ito, Tomoko; Sun, Xiaomin; Ise, Ryuken; Oshima, Satomi; Cao, Zhen-Bo; Sakamoto, Shizuo; Tanaka, Masashi; Higuchi, Mitsuru

2014-09-01

Genome-wide association studies identified single nucleotide polymorphisms (SNPs) associated with body mass index (BMI) in middle-aged populations; however, it is unclear whether these SNPs are associated with body fatness in elderly people. We examined the association between genetic risk score (GRS) from BMI-associated SNPs and body fatness in elderly Japanese men. We also examined the contribution of GRS, dietary macronutrient intake, and physical activity to body fatness by different age groups. GRS was calculated from 10 BMI-associated SNPs in 84 middle-aged (30-64 years) and 97 elderly (65-79 years) Japanese men; subjects were divided into low, middle, and high GRS groups. Dietary macronutrient intake was assessed using a questionnaire, and physical activity was evaluated using both a questionnaire and an accelerometer. The middle-aged individuals with a high GRS had greater BMI; waist circumference; and total abdominal fat, visceral fat, and subcutaneous fat areas than the middle-aged individuals with low GRS, whereas the indicators were not different between the GRS groups in elderly individuals. Multiple linear regression analysis showed that GRS was the strongest predictor of BMI, total abdominal fat, and visceral fat in the middle-aged group, whereas fat, alcohol, and protein intakes or vigorous-intensity physical activity were more strongly associated with these indicators than was GRS in the elderly group. These results suggest that GRS from BMI-associated SNPs is not predictive of body fatness in elderly Japanese men. The stronger contribution of dietary macronutrient intake and physical activity to body fatness may attenuate the genetic predisposition in elderly men.

Using SNP markers to dissect linkage disequilibrium at a major quantitative trait locus for resistance to the potato cyst nematode Globodera pallida on potato chromosome V.

PubMed

Achenbach, Ute; Paulo, Joao; Ilarionova, Evgenyia; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhard; Gebhardt, Christiane

2009-02-01

The damage caused by the parasitic root cyst nematode Globodera pallida is a major yield-limiting factor in potato cultivation . Breeding for resistance is facilitated by the PCR-based marker 'HC', which is diagnostic for an allele conferring high resistance against G. pallida pathotype Pa2/3 that has been introgressed from the wild potato species Solanum vernei into the Solanum tuberosum tetraploid breeding pool. The major quantitative trait locus (QTL) controlling this nematode resistance maps on potato chromosome V in a hot spot for resistance to various pathogens including nematodes and the oomycete Phytophthora infestans. An unstructured sample of 79 tetraploid, highly heterozygous varieties and breeding clones was selected based on presence (41 genotypes) or absence (38 genotypes) of the HC marker. Testing the clones for resistance to G. pallida confirmed the diagnostic power of the HC marker. The 79 individuals were genotyped for 100 single nucleotide polymorphisms (SNPs) at 10 loci distributed over 38 cM on chromosome V. Forty-five SNPs at six loci spanning 2 cM in the interval between markers GP21-GP179 were associated with resistance to G. pallida. Based on linkage disequilibrium (LD) between SNP markers, six LD groups comprising between 2 and 18 SNPs were identified. The LD groups indicated the existence of multiple alleles at a single resistance locus or at several, physically linked resistance loci. LD group C comprising 18 SNPs corresponded to the 'HC' marker. LD group E included 16 SNPs and showed an association peak, which positioned one nematode resistance locus physically close to the R1 gene family.

Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

PubMed

Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

2012-01-15

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.

Vitamin D receptor polymorphisms in patients with cutaneous melanoma

PubMed Central

Orlow, Irene; Roy, Pampa; Reiner, Anne S.; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Millikan, Robert C.; Thomas, Nancy E.; Gruber, Stephen B.; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P.; Dwyer, Terence; Kanetsky, Peter A.; Busam, Klaus; From, Lynn; Begg, Colin B.; Berwick, Marianne

2011-01-01

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene SNPs in a large international multi-center population-based case-control study of melanoma. Buccal DNAs were obtained from 1207 people with incident multiple primary melanoma and 2469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, htSNPs with ≥10% MAF in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3’ gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25% to 33% for 6 polymorphisms: rs10875712 (OR 1.28; 95%CI, 1.01–1.62), rs4760674 (OR 1.33; 95% CI, 1.06–1.67), rs7139166 (OR 1.26; 95%CI, 1.02–1.56), rs4516035 (OR 1.25; 95%CI, 1.01–1.55), rs11168287 (OR 1.27; 95%CI, 1.03–1.57), rs1544410 (OR 1.30; 95%CI, 1.04–1.63); for 2 polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65–1.02), rs7965281 (OR, 0.78; 95%CI, 0.62–0.99). We recognize the potential false positive findings due to multiple comparisons; however the 8 significant SNPs in this study outnumbered the 2 significant tests expected to occur by chance. The vitamin D receptor may play a role in melanomagenesis. PMID:21365644

Identification of candidate genes associated with fibromyalgia susceptibility in southern Spanish women: the al-Ándalus project.

PubMed

Estévez-López, Fernando; Camiletti-Moirón, Daniel; Aparicio, Virginia A; Segura-Jiménez, Víctor; Álvarez-Gallardo, Inmaculada C; Soriano-Maldonado, Alberto; Borges-Cosic, Milkana; Acosta-Manzano, Pedro; Geenen, Rinie; Delgado-Fernández, Manuel; Martínez-González, Luis J; Ruiz, Jonatan R; Álvarez-Cubero, María J

2018-02-27

Candidate-gene studies on fibromyalgia susceptibility often include a small number of single nucleotide polymorphisms (SNPs), which is a limitation. Moreover, there is a paucity of evidence in Europe. Therefore, we compared genotype frequencies of candidate SNPs in a well-characterised sample of Spanish women with fibromyalgia and healthy non-fibromyalgia women. A total of 314 women with a diagnosis of fibromyalgia (cases) and 112 non-fibromyalgia healthy (controls) women participated in this candidate-gene study. Buccal swabs were collected for DNA extraction. Using TaqMan™ OpenArray™, we analysed 61 SNPs of 33 genes related to fibromyalgia susceptibility, symptoms, or potential mechanisms. We observed that the rs841 and rs1799971 GG genotype was more frequently observed in fibromyalgia than in controls (p = 0.04 and p = 0.02, respectively). The rs2097903 AT/TT genotypes were also more often present in the fibromyalgia participants than in their control peers (p = 0.04). There were no differences for the remaining SNPs. We identified, for the first time, associations of the rs841 (guanosine triphosphate cyclohydrolase 1 gene) and rs2097903 (catechol-O-methyltransferase gene) SNPs with higher risk of fibromyalgia susceptibility. We also confirmed that the rs1799971 SNP (opioid receptor μ1 gene) might confer genetic risk of fibromyalgia. We did not adjust for multiple comparisons, which would be too stringent and yield to non-significant differences in the genotype frequencies between cases and controls. Our findings may be biologically meaningful and informative, and should be further investigated in other populations. Of particular interest is to replicate the present study in a larger independent sample to confirm or refute our findings. On the other hand, by including 61 SNPs of 33 candidate-genes with a strong rationale (they were previously investigated in relation to fibromyalgia susceptibility, symptoms or potential mechanisms), the present research is the most comprehensive candidate-gene study on fibromyalgia susceptibility to date.

Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

PubMed

Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

2013-01-01

Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

PubMed Central

Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

2012-01-01

BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

regSNPs: a strategy for prioritizing regulatory single nucleotide substitutions

PubMed Central

Teng, Mingxiang; Ichikawa, Shoji; Padgett, Leah R.; Wang, Yadong; Mort, Matthew; Cooper, David N.; Koller, Daniel L.; Foroud, Tatiana; Edenberg, Howard J.; Econs, Michael J.; Liu, Yunlong

2012-01-01

Motivation: One of the fundamental questions in genetics study is to identify functional DNA variants that are responsible to a disease or phenotype of interest. Results from large-scale genetics studies, such as genome-wide association studies (GWAS), and the availability of high-throughput sequencing technologies provide opportunities in identifying causal variants. Despite the technical advances, informatics methodologies need to be developed to prioritize thousands of variants for potential causative effects. Results: We present regSNPs, an informatics strategy that integrates several established bioinformatics tools, for prioritizing regulatory SNPs, i.e. the SNPs in the promoter regions that potentially affect phenotype through changing transcription of downstream genes. Comparing to existing tools, regSNPs has two distinct features. It considers degenerative features of binding motifs by calculating the differences on the binding affinity caused by the candidate variants and integrates potential phenotypic effects of various transcription factors. When tested by using the disease-causing variants documented in the Human Gene Mutation Database, regSNPs showed mixed performance on various diseases. regSNPs predicted three SNPs that can potentially affect bone density in a region detected in an earlier linkage study. Potential effects of one of the variants were validated using luciferase reporter assay. Contact: yunliu@iupui.edu Supplementary information: Supplementary data are available at Bioinformatics online PMID:22611130

Association and interaction of myopia with SNP markers rs13382811 and rs6469937 at ZFHX1B and SNTB1 in Han Chinese and European populations.

PubMed

Li, Jiali; Jiao, Xiaodong; Zhang, Qingjiong; Hejtmancik, J Fielding

2017-01-01

Previously, a genome-wide association study (GWAS) identified rs13382811 (near ZFHX1B) and rs6469937 (near SNTB1) to be associated with high myopia. The present study evaluates the association of these two single nucleotide polymorphisms (SNPs) with moderate to high myopia in two Chinese cohorts and two cohorts of European populations. Two Chinese university student cohorts, including one with 300 unrelated subjects with high myopia and 308 emmetropic controls from Guangzhou and a second with 96 unrelated individuals with moderate to high myopia and 96 emmetropic controls of Chaoshanese origin in Guangzhou, were enrolled in this study. Two SNPs, rs6469937 and rs13382811, were selected for genotyping based on their reported associations with severe myopia. The SNPs were genotyped via DNA sequencing. In addition, association analysis of both SNPs was performed using genotype data from the database of Genotypes and Phenotypes (dbGaP) involving a total of 2,423 samples in two independent cohorts of European-derived populations, as follows: Kooperative Gesundheitsforschung in der Region Augsburg (KORA) and TwinsUK. The allelic and genotypic distribution among cases and controls were analyzed using the Chi-square test. Logistic regression was used to evaluate the SNP-SNP interaction. Fisher's exact test was used for two-SNP comparisons. In the Guangzhou cohort, SNP rs13382811 near ZFHX1B showed significant association with high myopia ( p allelic = 0.0001, p genotypic = 4.07 × 10 -5 ), with the minor T allele showing an increased risk of high myopia (odds ratio [OR] = 1.68, 95% confidence interval [CI] = 1.28-2.20). SNP rs6469937 near SNTB1 showed nominal evidence of association ( p allelic = 0.0085, p genotypic = 0.0166), which did not withstand correction for multiple testing. No significant association was detected in the smaller Chaoshan cohort alone. The association of SNPs rs13382811 and rs6469937 remained significant when both Han Chinese cohorts were combined ( p allelic = 0.0033 and 0.0016, respectively), and it was also significant under the genotypic test ( p genotypic = 0.0036 and 0.0053, respectively). When both SNPs were considered together under a recessive model, their significance increased ( p = 8.37 × 10 -4 ), as did their effect (OR = 4.09, 95%CI = 1.7-9.8). The association between either of these two SNPs alone and myopia did not replicate significantly in the combined cohorts of European descent, providing only suggestive results ( p allelic = 0.0088 for rs13382811 and p allelic = 0.0319 for rs6469937). However, the effects of the combined SNPs showed significant association ( p = 8.2 × 10 -4 ; OR = 1.56, 95%CI = 1.2-2.0). While the risk for myopia increased with risk alleles from both SNPs, the increase was additive rather representing a multiplicative interaction in both populations. Our study confirms that the two susceptibility loci ZFHX1B and SNTB1 are associated with moderate to high myopia in a Han Chinese population, as well as in a European population, when both SNPs are combined. These results confirm previous reports of their associations, extend these observations to a European population, and suggest that additional interactive and possibly population-specific genetic or environmental factors may affect their contribution to myopia.

BAYESIAN LARGE-SCALE MULTIPLE REGRESSION WITH SUMMARY STATISTICS FROM GENOME-WIDE ASSOCIATION STUDIES1

PubMed Central

Zhu, Xiang; Stephens, Matthew

2017-01-01

Bayesian methods for large-scale multiple regression provide attractive approaches to the analysis of genome-wide association studies (GWAS). For example, they can estimate heritability of complex traits, allowing for both polygenic and sparse models; and by incorporating external genomic data into the priors, they can increase power and yield new biological insights. However, these methods require access to individual genotypes and phenotypes, which are often not easily available. Here we provide a framework for performing these analyses without individual-level data. Specifically, we introduce a “Regression with Summary Statistics” (RSS) likelihood, which relates the multiple regression coefficients to univariate regression results that are often easily available. The RSS likelihood requires estimates of correlations among covariates (SNPs), which also can be obtained from public databases. We perform Bayesian multiple regression analysis by combining the RSS likelihood with previously proposed prior distributions, sampling posteriors by Markov chain Monte Carlo. In a wide range of simulations RSS performs similarly to analyses using the individual data, both for estimating heritability and detecting associations. We apply RSS to a GWAS of human height that contains 253,288 individuals typed at 1.06 million SNPs, for which analyses of individual-level data are practically impossible. Estimates of heritability (52%) are consistent with, but more precise, than previous results using subsets of these data. We also identify many previously unreported loci that show evidence for association with height in our analyses. Software is available at https://github.com/stephenslab/rss. PMID:29399241

Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

PubMed Central

Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

2012-01-01

Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

No Evidence That Genetic Variation in the Myeloid-Derived Suppressor Cell Pathway Influences Ovarian Cancer Survival.

PubMed

Sucheston-Campbell, Lara E; Cannioto, Rikki; Clay, Alyssa I; Etter, John Lewis; Eng, Kevin H; Liu, Song; Battaglia, Sebastiano; Hu, Qiang; Szender, J Brian; Minlikeeva, Albina; Joseph, Janine M; Mayor, Paul; Abrams, Scott I; Segal, Brahm H; Wallace, Paul K; Soh, Kah Teong; Zsiros, Emese; Anton-Culver, Hoda; Bandera, Elisa V; Beckmann, Matthias W; Berchuck, Andrew; Bjorge, Line; Bruegl, Amanda; Campbell, Ian G; Campbell, Shawn Patrice; Chenevix-Trench, Georgia; Cramer, Daniel W; Dansonka-Mieszkowska, Agnieszka; Dao, Fanny; Diergaarde, Brenda; Doerk, Thilo; Doherty, Jennifer A; du Bois, Andreas; Eccles, Diana; Engelholm, Svend Aage; Fasching, Peter A; Gayther, Simon A; Gentry-Maharaj, Aleksandra; Glasspool, Rosalind M; Goodman, Marc T; Gronwald, Jacek; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hillemmanns, Peter; Høgdall, Claus; Høgdall, Estrid V S; Huzarski, Tomasz; Jensen, Allan; Johnatty, Sharon E; Jung, Audrey; Karlan, Beth Y; Klapdor, Reudiger; Kluz, Tomasz; Konopka, Bożena; Kjær, Susanne Krüger; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lester, Jenny; Lubiński, Jan; Levine, Douglas A; Lundvall, Lene; McGuire, Valerie; McNeish, Iain A; Menon, Usha; Modugno, Francesmary; Ness, Roberta B; Orsulic, Sandra; Paul, James; Pearce, Celeste Leigh; Pejovic, Tanja; Pharoah, Paul; Ramus, Susan J; Rothstein, Joseph; Rossing, Mary Anne; Rübner, Matthias; Schildkraut, Joellen M; Schmalfeldt, Barbara; Schwaab, Ira; Siddiqui, Nadeem; Sieh, Weiva; Sobiczewski, Piotr; Song, Honglin; Terry, Kathryn L; Van Nieuwenhuysen, Els; Vanderstichele, Adriaan; Vergote, Ignace; Walsh, Christine S; Webb, Penelope M; Wentzensen, Nicolas; Whittemore, Alice S; Wu, Anna H; Ziogas, Argyrios; Odunsi, Kunle; Chang-Claude, Jenny; Goode, Ellen L; Moysich, Kirsten B

2017-03-01

Background: The precise mechanism by which the immune system is adversely affected in cancer patients remains poorly understood, but the accumulation of immunosuppressive/protumorigenic myeloid-derived suppressor cells (MDSCs) is thought to be a prominent mechanism contributing to immunologic tolerance of malignant cells in epithelial ovarian cancer (EOC). To this end, we hypothesized genetic variation in MDSC pathway genes would be associated with survival after EOC diagnoses. Methods: We measured the hazard of death due to EOC within 10 years of diagnosis, overall and by invasive subtype, attributable to SNPs in 24 genes relevant in the MDSC pathway in 10,751 women diagnosed with invasive EOC. Versatile Gene-based Association Study and the admixture likelihood method were used to test gene and pathway associations with survival. Results: We did not identify individual SNPs that were significantly associated with survival after correction for multiple testing ( P < 3.5 × 10 -5 ), nor did we identify significant associations between the MDSC pathway overall, or the 24 individual genes and EOC survival. Conclusions: In this well-powered analysis, we observed no evidence that inherited variations in MDSC-associated SNPs, individual genes, or the collective genetic pathway contributed to EOC survival outcomes. Impact: Common inherited variation in genes relevant to MDSCs was not associated with survival in women diagnosed with invasive EOC. Cancer Epidemiol Biomarkers Prev; 26(3); 420-4. ©2016 AACR . ©2016 American Association for Cancer Research.

Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine.

PubMed

Dean, Jon G

2018-01-01

N,N -dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine- N -methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role.

Indolethylamine-N-methyltransferase Polymorphisms: Genetic and Biochemical Approaches for Study of Endogenous N,N,-dimethyltryptamine

PubMed Central

Dean, Jon G.

2018-01-01

N,N-dimethyltryptamine (DMT) is a powerful serotonergic psychedelic whose exogenous administration elicits striking psychedelic effects in humans. Studies have identified DMT and analogous compounds (e.g., 5-hydroxy-DMT, 5-methoxy-DMT) alongside of an enzyme capable of synthesizing DMT endogenously from tryptamine, indolethylamine-N-methyltransferase (INMT), in human and several other mammalian tissues. Subsequently, multiple hypotheses for the physiological role of endogenous DMT have emerged, from proposed immunomodulatory functions to an emphasis on the overlap between the mental states generated by exogenous DMT and naturally occurring altered states of consciousness; e.g., schizophrenia. However, no clear relationship between endogenous DMT and naturally occurring altered states of consciousness has yet been established from in vivo assays of DMT in bodily fluids. The advent of genetic screening has afforded the capability to link alterations in the sequence of specific genes to behavioral and molecular phenotypes via expression of identified single nucleotide polymorphisms (SNPs) in cell and animal models. As SNPs in INMT may impact endogenous DMT synthesis and levels via changes in INMT expression and/or INMT structure and function, these combined genetic and biochemical approaches circumvent the limitations of assaying DMT in bodily fluids and may augment data from prior in vitro and in vivo work. Therefore, all reported SNPs in INMT were amassed from genetic and biochemical literature and genomic databases to consolidate a blueprint for future studies aimed at elucidating whether DMT plays a physiological role. PMID:29740267

Early developmental gene enhancers affect subcortical volumes in the adult human brain.

PubMed

Becker, Martin; Guadalupe, Tulio; Franke, Barbara; Hibar, Derrek P; Renteria, Miguel E; Stein, Jason L; Thompson, Paul M; Francks, Clyde; Vernes, Sonja C; Fisher, Simon E

2016-05-01

Genome-wide association screens aim to identify common genetic variants contributing to the phenotypic variability of complex traits, such as human height or brain morphology. The identified genetic variants are mostly within noncoding genomic regions and the biology of the genotype-phenotype association typically remains unclear. In this article, we propose a complementary targeted strategy to reveal the genetic underpinnings of variability in subcortical brain volumes, by specifically selecting genomic loci that are experimentally validated forebrain enhancers, active in early embryonic development. We hypothesized that genetic variation within these enhancers may affect the development and ultimately the structure of subcortical brain regions in adults. We tested whether variants in forebrain enhancer regions showed an overall enrichment of association with volumetric variation in subcortical structures of >13,000 healthy adults. We observed significant enrichment of genomic loci that affect the volume of the hippocampus within forebrain enhancers (empirical P = 0.0015), a finding which robustly passed the adjusted threshold for testing of multiple brain phenotypes (cutoff of P < 0.0083 at an alpha of 0.05). In analyses of individual single nucleotide polymorphisms (SNPs), we identified an association upstream of the ID2 gene with rs7588305 and variation in hippocampal volume. This SNP-based association survived multiple-testing correction for the number of SNPs analyzed but not for the number of subcortical structures. Targeting known regulatory regions offers a way to understand the underlying biology that connects genotypes to phenotypes, particularly in the context of neuroimaging genetics. This biology-driven approach generates testable hypotheses regarding the functional biology of identified associations. Hum Brain Mapp 37:1788-1800, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

SNPs selected by information content outperform randomly selected microsatellite loci for delineating genetic identification and introgression in the endangered dark European honeybee (Apis mellifera mellifera).

PubMed

Muñoz, Irene; Henriques, Dora; Jara, Laura; Johnston, J Spencer; Chávez-Galarza, Julio; De La Rúa, Pilar; Pinto, M Alice

2017-07-01

The honeybee (Apis mellifera) has been threatened by multiple factors including pests and pathogens, pesticides and loss of locally adapted gene complexes due to replacement and introgression. In western Europe, the genetic integrity of the native A. m. mellifera (M-lineage) is endangered due to trading and intensive queen breeding with commercial subspecies of eastern European ancestry (C-lineage). Effective conservation actions require reliable molecular tools to identify pure-bred A. m. mellifera colonies. Microsatellites have been preferred for identification of A. m. mellifera stocks across conservation centres. However, owing to high throughput, easy transferability between laboratories and low genotyping error, SNPs promise to become popular. Here, we compared the resolving power of a widely utilized microsatellite set to detect structure and introgression with that of different sets that combine a variable number of SNPs selected for their information content and genomic proximity to the microsatellite loci. Contrary to every SNP data set, microsatellites did not discriminate between the two lineages in the PCA space. Mean introgression proportions were identical across the two marker types, although at the individual level, microsatellites' performance was relatively poor at the upper range of Q-values, a result reflected by their lower precision. Our results suggest that SNPs are more accurate and powerful than microsatellites for identification of A. m. mellifera colonies, especially when they are selected by information content. © 2016 John Wiley & Sons Ltd.

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

Genetic Polymorphisms Associated with Rubella Virus-Specific Cellular Immunity Following MMR Vaccination

PubMed Central

Kennedy, Richard B.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Lambert, Nathaniel D.; Pankratz, V. Shane; Poland, Gregory A.

2014-01-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single dose seroconversion rates ~95%. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects ages 11–22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (ages 18–40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. PMID:25098560

Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

PubMed

Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

2014-11-01

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

Genome-wide scan in Hispanics highlights candidate loci for brain white matter hyperintensities

PubMed Central

Beecham, Ashley; Dong, Chuanhui; Wright, Clinton B.; Dueker, Nicole; Brickman, Adam M.; Wang, Liyong; DeCarli, Charles; Blanton, Susan H.; Rundek, Tatjana; Mayeux, Richard

2017-01-01

Objective: To investigate genetic variants influencing white matter hyperintensities (WMHs) in the understudied Hispanic population. Methods: Using 6.8 million single nucleotide polymorphisms (SNPs), we conducted a genome-wide association study (GWAS) to identify SNPs associated with WMH volume (WMHV) in 922 Hispanics who underwent brain MRI as a cross-section of 2 community-based cohorts in the Northern Manhattan Study and the Washington Heights–Inwood Columbia Aging Project. Multiple linear modeling with PLINK was performed to examine the additive genetic effects on ln(WMHV) after controlling for age, sex, total intracranial volume, and principal components of ancestry. Gene-based tests of association were performed using VEGAS. Replication was performed in independent samples of Europeans, African Americans, and Asians. Results: From the SNP analysis, a total of 17 independent SNPs in 7 genes had suggestive evidence of association with WMHV in Hispanics (p < 1 × 10−5) and 5 genes from the gene-based analysis with p < 1 × 10−3. One SNP (rs9957475 in GATA6) and 1 gene (UBE2C) demonstrated evidence of association (p < 0.05) in the African American sample. Four SNPs with p < 1 × 10−5 were shown to affect binding of SPI1 using RegulomeDB. Conclusions: This GWAS of 2 community-based Hispanic cohorts revealed several novel WMH-associated genetic variants. Further replication is needed in independent Hispanic samples to validate these suggestive associations, and fine mapping is needed to pinpoint causal variants. PMID:28975155

CSF protein changes associated with hippocampal sclerosis risk gene variants highlight impact of GRN/PGRN.

PubMed

Fardo, David W; Katsumata, Yuriko; Kauwe, John S K; Deming, Yuetiva; Harari, Oscar; Cruchaga, Carlos; Nelson, Peter T

2017-04-01

Hippocampal sclerosis of aging (HS-Aging) is a common cause of dementia in older adults. We tested the variability in cerebrospinal fluid (CSF) proteins associated with previously identified HS-Aging risk single nucleotide polymorphisms (SNPs). Alzheimer's Disease Neuroimaging Initiative cohort (ADNI; n=237) data, combining both multiplexed proteomics CSF and genotype data, were used to assess the association between CSF analytes and risk SNPs in four genes (SNPs): GRN (rs5848), TMEM106B (rs1990622), ABCC9 (rs704180), and KCNMB2 (rs9637454). For controls, non-HS-Aging SNPs in APOE (rs429358/rs7412) and MAPT (rs8070723) were also analyzed against Aβ1-42 and total tau CSF analytes. The GRN risk SNP (rs5848) status correlated with variation in CSF proteins, with the risk allele (T) associated with increased levels of AXL Receptor Tyrosine Kinase (AXL), TNF-Related Apoptosis-Inducing Ligand Receptor 3 (TRAIL-R3), Vascular Cell Adhesion Molecule-1 (VCAM-1) and clusterin (CLU) (all p<0.05 after Bonferroni correction). The TRAIL-R3 correlation was significant in meta-analysis with an additional dataset (p=5.05×10 -5 ). Further, the rs5848 SNP status was associated with increased CSF tau protein - a marker of neurodegeneration (p=0.015). These data are remarkable since this GRN SNP has been found to be a risk factor for multiple types of dementia-related brain pathologies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

An obesity genetic risk score is associated with metabolic syndrome in Chinese children.

PubMed

Zhao, Xiaoyuan; Xi, Bo; Shen, Yue; Wu, Lijun; Hou, Dongqing; Cheng, Hong; Mi, Jie

2014-02-10

Recent genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) associated with body mass index (BMI)/obesity. In this study, we aim to examine the associations of obesity related loci with risk of metabolic syndrome (MetS) in a children population from China. A total of 431 children with MetS and 3046 controls were identified based on the modified ATPIII definition. 11 SNPs (FTO rs9939609, MC4R rs17782313, GNPDA2 rs10938397, BDNF rs6265, FAIM2 rs7138803, NPC1 rs1805081, SEC16B rs10913469, SH2B1 rs4788102, PCSK1rs6235, KCTD15 rs29941, BAT2 rs2844479) were genotyped by TaqMan 7900. Of 11 SNPs, GNPDA2 rs10938397, BDNF rs6265, and FAIM2 rs7138803 were nominally associated with risk of MetS (GNPDA2 rs10938397: odds ratio (OR)=1.21, 95% confidence interval (CI)=1.04-1.40, P=0.016; BDNF rs6265: OR=1.19, 95% CI=1.03-1.39, P=0.021; FAIM2 rs7138803: OR=1.20, 95% CI=1.02-1.40, P=0.025); genetic risk score (GRS) was significantly associated with risk of MetS (OR=1.09, 95% CI=1.04-1.15, P=5.26×10(-4)). After further adjustment for BMI, none of SNPs were associated with risk of MetS (all P>0.05); the association between GRS and risk of MetS remained nominally (OR=1.02, 95%CI=0.96-1.08, P=0.557). However, after correction for multiple testing, only GRS was statistically associated with risk of MetS in the model without adjustment for BMI. The present study demonstrated that there were nominal associations of GNPDA2 rs10938397, BDNF rs6265, and FAIM2 rs7138803 with risk of MetS. The SNPs in combination have a significant effect on risk of MetS among Chinese children. These associations above were mediated by adiposity. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene-centric Association Signals for Lipids and Apolipoproteins Identified via the HumanCVD BeadChip

PubMed Central

Talmud, Philippa J.; Drenos, Fotios; Shah, Sonia; Shah, Tina; Palmen, Jutta; Verzilli, Claudio; Gaunt, Tom R.; Pallas, Jacky; Lovering, Ruth; Li, Kawah; Casas, Juan Pablo; Sofat, Reecha; Kumari, Meena; Rodriguez, Santiago; Johnson, Toby; Newhouse, Stephen J.; Dominiczak, Anna; Samani, Nilesh J.; Caulfield, Mark; Sever, Peter; Stanton, Alice; Shields, Denis C.; Padmanabhan, Sandosh; Melander, Olle; Hastie, Claire; Delles, Christian; Ebrahim, Shah; Marmot, Michael G.; Smith, George Davey; Lawlor, Debbie A.; Munroe, Patricia B.; Day, Ian N.; Kivimaki, Mika; Whittaker, John; Humphries, Steve E.; Hingorani, Aroon D.

2009-01-01

Blood lipids are important cardiovascular disease (CVD) risk factors with both genetic and environmental determinants. The Whitehall II study (n = 5592) was genotyped with the gene-centric HumanCVD BeadChip (Illumina). We identified 195 SNPs in 16 genes/regions associated with 3 major lipid fractions and 2 apolipoprotein components at p < 10−5, with the associations being broadly concordant with prior genome-wide analysis. SNPs associated with LDL cholesterol and apolipoprotein B were located in LDLR, PCSK9, APOB, CELSR2, HMGCR, CETP, the TOMM40-APOE-C1-C2-C4 cluster, and the APOA5-A4-C3-A1 cluster; SNPs associated with HDL cholesterol and apolipoprotein AI were in CETP, LPL, LIPC, APOA5-A4-C3-A1, and ABCA1; and SNPs associated with triglycerides in GCKR, BAZ1B, MLXIPL, LPL, and APOA5-A4-C3-A1. For 48 SNPs in previously unreported loci that were significant at p < 10−4 in Whitehall II, in silico analysis including the British Women's Heart and Health Study, BRIGHT, ASCOT, and NORDIL studies (total n > 12,500) revealed previously unreported associations of SH2B3 (p < 2.2 × 10−6), BMPR2 (p < 2.3 × 10−7), BCL3/PVRL2 (flanking APOE; p < 4.4 × 10−8), and SMARCA4 (flanking LDLR; p < 2.5 × 10−7) with LDL cholesterol. Common alleles in these genes explained 6.1%–14.7% of the variance in the five lipid-related traits, and individuals at opposite tails of the additive allele score exhibited substantial differences in trait levels (e.g., >1 mmol/L in LDL cholesterol [∼1 SD of the trait distribution]). These data suggest that multiple common alleles of small effect can make important contributions to individual differences in blood lipids potentially relevant to the assessment of CVD risk. These genes provide further insights into lipid metabolism and the likely effects of modifying the encoded targets therapeutically. PMID:19913121

Impact of genetic factors on dyslipidemia in HIV-infected patients starting antiretroviral therapy.

PubMed

Egaña-Gorroño, Lander; Martínez, Esteban; Cormand, Bru; Escribà, Tuixent; Gatell, Jose; Arnedo, Mireia

2013-02-20

The impact of host genetic factors on the incidence of dyslipidemia in antiretroviral-naive HIV patients starting antiretroviral therapy (ART) is not clear. We assessed the role of single nucleotide polymorphisms (SNPs) identified from previous genome-wide association studies adjusting for the contribution of nongenetic factors. We assessed 192 SNPs in an HIV cohort who started ART (1997-2008) including a protease inhibitor or a nonnucleoside reverse transcriptase inhibitor (NNRTI). Patients had fasting plasma lipids, total cholesterol (T-Chol), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C) and triglycerides measured prior to their ART initiation and after 1 year. A logistic regression model was constructed and multiple test was corrected using 10% false discovery rate (FDR). Haplotypes and gene interactions were analysed. A total of 727 individuals were successfully genotyped (n = 381_PI-group; n = 346_NNRTI-group). Age and hepatitis C virus (HCV) coinfection were associated with increases and decreases in T-Chol and LDL-C (P < 0.01), respectively. Protease inhibitor containing ART showed an unfavourable association with T-Chol (P < 0.01) and triglycerides (P = 7.4E-4) and NNRTI-containing ART was favourably associated with HDL-C (P < 0.01). Moreover, SNPs in apolipoprotein B (APOB) were associated with an increase of LDL-C [rs10495712 (P = 3.18E-4); rs754524 (P = 1.26E-3)]. Six SNPs in three genes showed an association with a favourable effect on HDL-C levels when ART included NNRTI: ABCA1 (rs4149313, P = 2.97E-4), LIPC (rs1800588, P = 2.13E-3; rs473224, P = 3.06E-4; rs261336, P = 2.23E-3) and CETP (rs173539, P = 2.96E-3; rs3764261, P = 1.52E-3). After 10% FDR correction for multiple testing, one and six SNPs displayed significant associations with LDL-C and HDL-C, respectively. In HIV-infected patients staring ART, one SNP in APOB was associated with an increase of LDL-C. SNPs in ABCA1/LIPC/CETP were favourably associated with HDL-C when ART included NNRTI. However, an unfavourable effect on T-Chol and triglyceride levels was observed when ART included protease inhibitor. The risk of hypercholesterolaemia increased with age and decreased with HCV coinfection. These findings might help to individualize the selection of ART.

Effects of GWAS-Associated Genetic Variants on lncRNAs within IBD and T1D Candidate Loci

PubMed Central

Brorsson, Caroline A.; Pociot, Flemming

2014-01-01

Long non-coding RNAs are a new class of non-coding RNAs that are at the crosshairs in many human diseases such as cancers, cardiovascular disorders, inflammatory and autoimmune disease like Inflammatory Bowel Disease (IBD) and Type 1 Diabetes (T1D). Nearly 90% of the phenotype-associated single-nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) lie outside of the protein coding regions, and map to the non-coding intervals. However, the relationship between phenotype-associated loci and the non-coding regions including the long non-coding RNAs (lncRNAs) is poorly understood. Here, we systemically identified all annotated IBD and T1D loci-associated lncRNAs, and mapped nominally significant GWAS/ImmunoChip SNPs for IBD and T1D within these lncRNAs. Additionally, we identified tissue-specific cis-eQTLs, and strong linkage disequilibrium (LD) signals associated with these SNPs. We explored sequence and structure based attributes of these lncRNAs, and also predicted the structural effects of mapped SNPs within them. We also identified lncRNAs in IBD and T1D that are under recent positive selection. Our analysis identified putative lncRNA secondary structure-disruptive SNPs within and in close proximity (+/−5 kb flanking regions) of IBD and T1D loci-associated candidate genes, suggesting that these RNA conformation-altering polymorphisms might be associated with diseased-phenotype. Disruption of lncRNA secondary structure due to presence of GWAS SNPs provides valuable information that could be potentially useful for future structure-function studies on lncRNAs. PMID:25144376

Inherited genetic variants associated with occurrence of multiple primary melanoma

PubMed Central

Gibbs, David C.; Orlow, Irene; Kanetsky, Peter A.; Luo, Li; Kricker, Anne; Armstrong, Bruce K.; Anton-Culver, Hoda; Gruber, Stephen B.; Marrett, Loraine D.; Gallagher, Richard P.; Zanetti, Roberto; Rosso, Stefano; Dwyer, Terence; Sharma, Ajay; La Pilla, Emily; From, Lynn; Busam, Klaus J.; Cust, Anne E.; Ollila, David W.; Begg, Colin B.; Berwick, Marianne; Thomas, Nancy E.

2015-01-01

Recent studies including genome-wide association studies have identified several putative low-penetrance susceptibility loci for melanoma. We sought to determine their generalizability to genetic predisposition for multiple primary melanoma in the international population-based Genes, Environment, and Melanoma (GEM) Study. GEM is a case-control study of 1,206 incident cases of multiple primary melanoma and 2,469 incident first primary melanoma participants as the control group. We investigated the odds of developing multiple primary melanoma for 47 single nucleotide polymorphisms (SNP) from 21 distinct genetic regions previously reported to be associated with melanoma. ORs and 95% CIs were determined using logistic regression models adjusted for baseline features (age, sex, age by sex interaction, and study center). We investigated univariable models and built multivariable models to assess independent effects of SNPs. Eleven SNPs in 6 gene neighborhoods (TERT/CLPTM1L, TYRP1, MTAP, TYR, NCOA6, and MX2) and a PARP1 haplotype were associated with multiple primary melanoma. In a multivariable model that included only the most statistically significant findings from univariable modeling and adjusted for pigmentary phenotype, back nevi, and baseline features, we found TERT/CLPTM1L rs401681 (P = 0.004), TYRP1 rs2733832 (P = 0.006), MTAP rs1335510 (P = 0.0005), TYR rs10830253 (P = 0.003), and MX2 rs45430 (P = 0.008) to be significantly associated with multiple primary melanoma while NCOA6 rs4911442 approached significance (P = 0.06). The GEM study provides additional evidence for the relevance of these genetic regions to melanoma risk and estimates the magnitude of the observed genetic effect on development of subsequent primary melanoma. PMID:25837821

SORL1 variants and risk of late-onset Alzheimer's disease.

PubMed

Li, Yonghong; Rowland, Charles; Catanese, Joseph; Morris, John; Lovestone, Simon; O'Donovan, Michael C; Goate, Alison; Owen, Michael; Williams, Julie; Grupe, Andrew

2008-02-01

A recent study reported significant association of late-onset Alzheimer's disease (LOAD) with multiple single nucleotide polymorphisms (SNPs) and haplotypes in SORL1, a neuronal sortilin-related receptor protein known to be involved in the trafficking and processing of amyloid precursor protein. Here we attempted to validate this finding in three large, well characterized case-control series. Approximately 2000 samples from the three series were individually genotyped for 12 SNPs, including the 10 reported significant SNPs and 2 that constitute the reported significant haplotypes. A total of 25 allelic and haplotypic association tests were performed. One SNP rs2070045 was marginally replicated in the three sample sets combined (nominal P=0.035); however, this result does not remain significant when accounting for multiple comparisons. Further validation in other sample sets will be required to assess the true effects of SORL1 variants in LOAD.

Multiple SNPs Within and Surrounding the Apolipoprotein E Gene Influence Cerebrospinal Fluid Apolipoprotein E Protein Levels

PubMed Central

Bekris, Lynn M.; Millard, Steven P.; Galloway, Nichole M.; Vuletic, Simona; Albers, John J.; Li, Ge; Galasko, Douglas R.; DeCarli, Charles; Farlow, Martin R.; Clark, Chris M.; Quinn, Joseph F.; Kaye, Jeffrey A.; Schellenberg, Gerard D.; Tsuang, Debby; Peskind, Elaine R.; Yu, Chang-En

2010-01-01

The ε4 allele of the apolipoprotein E gene (APOE) is associated with increased risk and earlier age at onset in late onset Alzheimer’s disease (AD). Other factors, such as expression level of apolipoprotein E protein (apoE), have been postulated to modify the APOE related risk of developing AD. Multiple loci in and outside of APOE are associated with a high risk of AD. The aim of this exploratory hypothesis generating investigation was to determine if some of these loci predict cerebrospinal fluid (CSF) apoE levels in healthy non-demented subjects. CSF apoE levels were measured from healthy non-demented subjects 21–87 years of age (n = 134). Backward regression models were used to evaluate the influence of 21 SNPs, within and surrounding APOE, on CSF apoE levels while taking into account age, gender, APOE ε4 and correlation between SNPs (linkage disequilibrium). APOE ε4 genotype does not predict CSF apoE levels. Three SNPs within the TOMM40 gene, one APOE promoter SNP and two SNPs within distal APOE enhancer elements (ME1 and BCR) predict CSF apoE levels. Further investigation of the genetic influence of these loci on apoE expression levels in the central nervous system is likely to provide new insight into apoE regulation as well as AD pathogenesis. PMID:18430993

Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

PubMed

Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

2018-01-01

Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

Dissecting the genetics of the human transcriptome identifies novel trait-related trans-eQTLs and corroborates the regulatory relevance of non-protein coding loci†

PubMed Central

Kirsten, Holger; Al-Hasani, Hoor; Holdt, Lesca; Gross, Arnd; Beutner, Frank; Krohn, Knut; Horn, Katrin; Ahnert, Peter; Burkhardt, Ralph; Reiche, Kristin; Hackermüller, Jörg; Löffler, Markus; Teupser, Daniel; Thiery, Joachim; Scholz, Markus

2015-01-01

Genetics of gene expression (eQTLs or expression QTLs) has proved an indispensable tool for understanding biological pathways and pathomechanisms of trait-associated SNPs. However, power of most genome-wide eQTL studies is still limited. We performed a large eQTL study in peripheral blood mononuclear cells of 2112 individuals increasing the power to detect trans-effects genome-wide. Going beyond univariate SNP-transcript associations, we analyse relations of eQTLs to biological pathways, polygenetic effects of expression regulation, trans-clusters and enrichment of co-localized functional elements. We found eQTLs for about 85% of analysed genes, and 18% of genes were trans-regulated. Local eSNPs were enriched up to a distance of 5 Mb to the transcript challenging typically implemented ranges of cis-regulations. Pathway enrichment within regulated genes of GWAS-related eSNPs supported functional relevance of identified eQTLs. We demonstrate that nearest genes of GWAS-SNPs might frequently be misleading functional candidates. We identified novel trans-clusters of potential functional relevance for GWAS-SNPs of several phenotypes including obesity-related traits, HDL-cholesterol levels and haematological phenotypes. We used chromatin immunoprecipitation data for demonstrating biological effects. Yet, we show for strongly heritable transcripts that still little trans-chromosomal heritability is explained by all identified trans-eSNPs; however, our data suggest that most cis-heritability of these transcripts seems explained. Dissection of co-localized functional elements indicated a prominent role of SNPs in loci of pseudogenes and non-coding RNAs for the regulation of coding genes. In summary, our study substantially increases the catalogue of human eQTLs and improves our understanding of the complex genetic regulation of gene expression, pathways and disease-related processes. PMID:26019233

Identification of Polymorphisms in the 3′-Untranslated Region of the Human Pregnane X Receptor (PXR) Gene Associated with Variability in Cytochrome P450 3A (CYP3A) Metabolism

PubMed Central

Oleson, Lauren; von Moltke, Lisa L.; Greenblatt, David J.; Court, Michael H.

2013-01-01

Single nucleotide polymorphisms (SNPs) in the 3′untranslated region (3′UTR) of human pregnane X receptor (PXR) gene may contribute to interindividual variability in cytochrome P450 3A (CYP3A) activity. Genotype-phenotype associations involving PXR-3′UTR SNPs were investigated through in vitro (53 human livers from primarily white donors) and in vivo (26 white or African-American volunteers) studies using midazolam 1′-hydroxylation and midazolam apparent oral clearance (CL/F), respectively, as CYP3A-specific probes. PXR-3′UTR resequencing identified 12 SNPs, including 2 that were novel. Although none of the SNPs evaluated were associated with altered midazolam 1′-hydroxylation in the liver bank, both rs3732359 homozygotes and rs3732360 carriers showed 80% higher (P<0.05) CL/F compared with homozygous reference individuals. These differences in CL/F were even larger (100 and 120% higher, respectively; P<0.01) when only African-American subjects (n=14) were considered. Five major haplotypes were identified containing the PXR-3′UTR SNPs and previously identified intron SNPs. Although CL/F differences were not statistically significant within the entire study cohort, African-American carriers of Haplotype-1 (which includes both rs3732359 and rs3732360 variants) exhibited 70% higher median CL/F compared with African-American non-carriers (P=0.036). Our results identify rs3732359 and rs3732360 as PXR-3′UTR SNPs associated with higher CYP3A activity in vivo in African-Americans. PMID:20082578

Current BPC3 Research Plan

Cancer.gov

This will expand the BPC3 to serve as a rapid verification test set for SNPs identified in the scans other than the CGEMS scan, and to examine gene-environment interactions in the SNPs identified in CGEMS and other studies as being associated with breast and prostate cancer.

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

A genome-wide pleiotropy scan for prostate cancer risk.

PubMed

Panagiotou, Orestis A; Travis, Ruth C; Campa, Daniele; Berndt, Sonja I; Lindstrom, Sara; Kraft, Peter; Schumacher, Fredrick R; Siddiq, Afshan; Papatheodorou, Stefania I; Stanford, Janet L; Albanes, Demetrius; Virtamo, Jarmo; Weinstein, Stephanie J; Diver, W Ryan; Gapstur, Susan M; Stevens, Victoria L; Boeing, Heiner; Bueno-de-Mesquita, H Bas; Barricarte Gurrea, Aurelio; Kaaks, Rudolf; Khaw, Kay-Tee; Krogh, Vittorio; Overvad, Kim; Riboli, Elio; Trichopoulos, Dimitrios; Giovannucci, Edward; Stampfer, Meir; Haiman, Christopher; Henderson, Brian; Le Marchand, Loic; Gaziano, J Michael; Hunter, David J; Koutros, Stella; Yeager, Meredith; Hoover, Robert N; Chanock, Stephen J; Wacholder, Sholom; Key, Timothy J; Tsilidis, Konstantinos K

2015-04-01

No single-nucleotide polymorphisms (SNPs) specific for aggressive prostate cancer have been identified in genome-wide association studies (GWAS). To test if SNPs associated with other traits may also affect the risk of aggressive prostate cancer. SNPs implicated in any phenotype other than prostate cancer (p≤10(-7)) were identified through the catalog of published GWAS and tested in 2891 aggressive prostate cancer cases and 4592 controls from the Breast and Prostate Cancer Cohort Consortium (BPC3). The 40 most significant SNPs were followed up in 4872 aggressive prostate cancer cases and 24,534 controls from the Prostate Cancer Association Group to Investigate Cancer Associated Alterations in the Genome (PRACTICAL) consortium. Odds ratios (ORs) and 95% confidence intervals (CIs) for aggressive prostate cancer were estimated. A total of 4666 SNPs were evaluated by the BPC3. Two signals were seen in regions already reported for prostate cancer risk. rs7014346 at 8q24.21 was marginally associated with aggressive prostate cancer in the BPC3 trial (p=1.6×10(-6)), whereas after meta-analysis by PRACTICAL the summary OR was 1.21 (95% CI 1.16-1.27; p=3.22×10(-18)). rs9900242 at 17q24.3 was also marginally associated with aggressive disease in the meta-analysis (OR 0.90, 95% CI 0.86-0.94; p=2.5×10(-6)). Neither of these SNPs remained statistically significant when conditioning on correlated known prostate cancer SNPs. The meta-analysis by BPC3 and PRACTICAL identified a third promising signal, marked by rs16844874 at 2q34, independent of known prostate cancer loci (OR 1.12, 95% CI 1.06-1.19; p=4.67×10(-5)); it has been shown that SNPs correlated with this signal affect glycine concentrations. The main limitation is the heterogeneity in the definition of aggressive prostate cancer between BPC3 and PRACTICAL. We did not identify new SNPs for aggressive prostate cancer. However, rs16844874 may provide preliminary genetic evidence on the role of the glycine pathway in prostate cancer etiology. We evaluated whether genetic variants associated with several traits are linked to the risk of aggressive prostate cancer. No new such variants were identified. Copyright © 2014 European Association of Urology. All rights reserved.

Loci influencing blood pressure identified using a cardiovascular gene-centric array.

PubMed

Ganesh, Santhi K; Tragante, Vinicius; Guo, Wei; Guo, Yiran; Lanktree, Matthew B; Smith, Erin N; Johnson, Toby; Castillo, Berta Almoguera; Barnard, John; Baumert, Jens; Chang, Yen-Pei Christy; Elbers, Clara C; Farrall, Martin; Fischer, Mary E; Franceschini, Nora; Gaunt, Tom R; Gho, Johannes M I H; Gieger, Christian; Gong, Yan; Isaacs, Aaron; Kleber, Marcus E; Mateo Leach, Irene; McDonough, Caitrin W; Meijs, Matthijs F L; Mellander, Olle; Molony, Cliona M; Nolte, Ilja M; Padmanabhan, Sandosh; Price, Tom S; Rajagopalan, Ramakrishnan; Shaffer, Jonathan; Shah, Sonia; Shen, Haiqing; Soranzo, Nicole; van der Most, Peter J; Van Iperen, Erik P A; Van Setten, Jessica; Van Setten, Jessic A; Vonk, Judith M; Zhang, Li; Beitelshees, Amber L; Berenson, Gerald S; Bhatt, Deepak L; Boer, Jolanda M A; Boerwinkle, Eric; Burkley, Ben; Burt, Amber; Chakravarti, Aravinda; Chen, Wei; Cooper-Dehoff, Rhonda M; Curtis, Sean P; Dreisbach, Albert; Duggan, David; Ehret, Georg B; Fabsitz, Richard R; Fornage, Myriam; Fox, Ervin; Furlong, Clement E; Gansevoort, Ron T; Hofker, Marten H; Hovingh, G Kees; Kirkland, Susan A; Kottke-Marchant, Kandice; Kutlar, Abdullah; Lacroix, Andrea Z; Langaee, Taimour Y; Li, Yun R; Lin, Honghuang; Liu, Kiang; Maiwald, Steffi; Malik, Rainer; Murugesan, Gurunathan; Newton-Cheh, Christopher; O'Connell, Jeffery R; Onland-Moret, N Charlotte; Ouwehand, Willem H; Palmas, Walter; Penninx, Brenda W; Pepine, Carl J; Pettinger, Mary; Polak, Joseph F; Ramachandran, Vasan S; Ranchalis, Jane; Redline, Susan; Ridker, Paul M; Rose, Lynda M; Scharnag, Hubert; Schork, Nicholas J; Shimbo, Daichi; Shuldiner, Alan R; Srinivasan, Sathanur R; Stolk, Ronald P; Taylor, Herman A; Thorand, Barbara; Trip, Mieke D; van Duijn, Cornelia M; Verschuren, W Monique; Wijmenga, Cisca; Winkelmann, Bernhard R; Wyatt, Sharon; Young, J Hunter; Boehm, Bernhard O; Caulfield, Mark J; Chasman, Daniel I; Davidson, Karina W; Doevendans, Pieter A; Fitzgerald, Garret A; Gums, John G; Hakonarson, Hakon; Hillege, Hans L; Illig, Thomas; Jarvik, Gail P; Johnson, Julie A; Kastelein, John J P; Koenig, Wolfgang; März, Winfried; Mitchell, Braxton D; Murray, Sarah S; Oldehinkel, Albertine J; Rader, Daniel J; Reilly, Muredach P; Reiner, Alex P; Schadt, Eric E; Silverstein, Roy L; Snieder, Harold; Stanton, Alice V; Uitterlinden, André G; van der Harst, Pim; van der Schouw, Yvonne T; Samani, Nilesh J; Johnson, Andrew D; Munroe, Patricia B; de Bakker, Paul I W; Zhu, Xiaofeng; Levy, Daniel; Keating, Brendan J; Asselbergs, Folkert W

2013-04-15

Blood pressure (BP) is a heritable determinant of risk for cardiovascular disease (CVD). To investigate genetic associations with systolic BP (SBP), diastolic BP (DBP), mean arterial pressure (MAP) and pulse pressure (PP), we genotyped ∼50 000 single-nucleotide polymorphisms (SNPs) that capture variation in ∼2100 candidate genes for cardiovascular phenotypes in 61 619 individuals of European ancestry from cohort studies in the USA and Europe. We identified novel associations between rs347591 and SBP (chromosome 3p25.3, in an intron of HRH1) and between rs2169137 and DBP (chromosome1q32.1 in an intron of MDM4) and between rs2014408 and SBP (chromosome 11p15 in an intron of SOX6), previously reported to be associated with MAP. We also confirmed 10 previously known loci associated with SBP, DBP, MAP or PP (ADRB1, ATP2B1, SH2B3/ATXN2, CSK, CYP17A1, FURIN, HFE, LSP1, MTHFR, SOX6) at array-wide significance (P < 2.4 × 10(-6)). We then replicated these associations in an independent set of 65 886 individuals of European ancestry. The findings from expression QTL (eQTL) analysis showed associations of SNPs in the MDM4 region with MDM4 expression. We did not find any evidence of association of the two novel SNPs in MDM4 and HRH1 with sequelae of high BP including coronary artery disease (CAD), left ventricular hypertrophy (LVH) or stroke. In summary, we identified two novel loci associated with BP and confirmed multiple previously reported associations. Our findings extend our understanding of genes involved in BP regulation, some of which may eventually provide new targets for therapeutic intervention.

Genome wide association mapping for grain shape traits in indica rice.

PubMed

Feng, Yue; Lu, Qing; Zhai, Rongrong; Zhang, Mengchen; Xu, Qun; Yang, Yaolong; Wang, Shan; Yuan, Xiaoping; Yu, Hanyong; Wang, Yiping; Wei, Xinghua

2016-10-01

Using genome-wide association mapping, 47 SNPs within 27 significant loci were identified for four grain shape traits, and 424 candidate genes were predicted from public database. Grain shape is a key determinant of grain yield and quality in rice (Oryza sativa L.). However, our knowledge of genes controlling rice grain shape remains limited. Genome-wide association mapping based on linkage disequilibrium (LD) has recently emerged as an effective approach for identifying genes or quantitative trait loci (QTL) underlying complex traits in plants. In this study, association mapping based on 5291 single nucleotide polymorphisms (SNPs) was conducted to identify significant loci associated with grain shape traits in a global collection of 469 diverse rice accessions. A total of 47 SNPs were located in 27 significant loci for four grain traits, and explained ~44.93-65.90 % of the phenotypic variation for each trait. In total, 424 candidate genes within a 200 kb extension region (±100 kb of each locus) of these loci were predicted. Of them, the cloned genes GS3 and qSW5 showed very strong effects on grain length and grain width in our study. Comparing with previously reported QTLs for grain shape traits, we found 11 novel loci, including 3, 3, 2 and 3 loci for grain length, grain width, grain length-width ratio and thousand grain weight, respectively. Validation of these new loci would be performed in the future studies. These results revealed that besides GS3 and qSW5, multiple novel loci and mechanisms were involved in determining rice grain shape. These findings provided valuable information for understanding of the genetic control of grain shape and molecular marker assistant selection (MAS) breeding in rice.

A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

PubMed

Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

2015-09-01

The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Breast cancer risk-associated SNPs modulate the affinity of chromatin for FOXA1 and alter gene expression

PubMed Central

Cowper-Sal·lari, Richard; Zhang, Xiaoyang; Wright, Jason B.; Bailey, Swneke D.; Cole, Michael D.; Eeckhoute, Jerome; Moore, Jason H.; Lupien, Mathieu

2012-01-01

Genome-wide association studies (GWASs) have identified thousands of single nucleotide polymorphisms (SNPs) associated with human traits and diseases. But because the vast majority of these SNPs are located in the noncoding regions of the genome their risk promoting mechanisms are elusive. Employing a new methodology combining cistromics, epigenomics and genotype imputation we annotate the noncoding regions of the genome in breast cancer cells and systematically identify the functional nature of SNPs associated with breast cancer risk. Our results demonstrate that breast cancer risk-associated SNPs are enriched in the cistromes of FOXA1 and ESR1 and the epigenome of H3K4me1 in a cancer and cell-type-specific manner. Furthermore, the majority of these risk-associated SNPs modulate the affinity of chromatin for FOXA1 at distal regulatory elements, which results in allele-specific gene expression, exemplified by the effect of the rs4784227 SNP on the TOX3 gene found within the 16q12.1 risk locus. PMID:23001124

Analysis of the genome-wide variations among multiple strains of the plant pathogenic bacterium Xylella fastidiosa

PubMed Central

Doddapaneni, Harshavardhan; Yao, Jiqiang; Lin, Hong; Walker, M Andrew; Civerolo, Edwin L

2006-01-01

Background The Gram-negative, xylem-limited phytopathogenic bacterium Xylella fastidiosa is responsible for causing economically important diseases in grapevine, citrus and many other plant species. Despite its economic impact, relatively little is known about the genomic variations among strains isolated from different hosts and their influence on the population genetics of this pathogen. With the availability of genome sequence information for four strains, it is now possible to perform genome-wide analyses to identify and categorize such DNA variations and to understand their influence on strain functional divergence. Results There are 1,579 genes and 194 non-coding homologous sequences present in the genomes of all four strains, representing a 76. 2% conservation of the sequenced genome. About 60% of the X. fastidiosa unique sequences exist as tandem gene clusters of 6 or more genes. Multiple alignments identified 12,754 SNPs and 14,449 INDELs in the 1528 common genes and 20,779 SNPs and 10,075 INDELs in the 194 non-coding sequences. The average SNP frequency was 1.08 × 10-2 per base pair of DNA and the average INDEL frequency was 2.06 × 10-2 per base pair of DNA. On an average, 60.33% of the SNPs were synonymous type while 39.67% were non-synonymous type. The mutation frequency, primarily in the form of external INDELs was the main type of sequence variation. The relative similarity between the strains was discussed according to the INDEL and SNP differences. The number of genes unique to each strain were 60 (9a5c), 54 (Dixon), 83 (Ann1) and 9 (Temecula-1). A sub-set of the strain specific genes showed significant differences in terms of their codon usage and GC composition from the native genes suggesting their xenologous origin. Tandem repeat analysis of the genomic sequences of the four strains identified associations of repeat sequences with hypothetical and phage related functions. Conclusion INDELs and strain specific genes have been identified as the main source of variations among strains, with individual strains showing different rates of genome evolution. Based on these genome comparisons, it appears that the Pierce's disease strain Temecula-1 genome represents the ancestral genome of the X. fastidiosa. Results of this analysis are publicly available in the form of a web database. PMID:16948851

Evaluating the transferability of 15 European-derived fasting plasma glucose SNPs in Mexican children and adolescents

PubMed Central

Langlois, Christine; Abadi, Arkan; Peralta-Romero, Jesus; Alyass, Akram; Suarez, Fernando; Gomez-Zamudio, Jaime; Burguete-Garcia, Ana I.; Yazdi, Fereshteh T.; Cruz, Miguel; Meyre, David

2016-01-01

Genome wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with fasting plasma glucose (FPG) in adult European populations. The contribution of these SNPs to FPG in non-Europeans and children is unclear. We studied the association of 15 GWAS SNPs and a genotype score (GS) with FPG and 7 metabolic traits in 1,421 Mexican children and adolescents from Mexico City. Genotyping of the 15 SNPs was performed using TaqMan Open Array. We used multivariate linear regression models adjusted for age, sex, body mass index standard deviation score, and recruitment center. We identified significant associations between 3 SNPs (G6PC2 (rs560887), GCKR (rs1260326), MTNR1B (rs10830963)), the GS and FPG level. The FPG risk alleles of 11 out of the 15 SNPs (73.3%) displayed significant or non-significant beta values for FPG directionally consistent with those reported in adult European GWAS. The risk allele frequencies for 11 of 15 (73.3%) SNPs differed significantly in Mexican children and adolescents compared to European adults from the 1000G Project, but no significant enrichment in FPG risk alleles was observed in the Mexican population. Our data support a partial transferability of European GWAS FPG association signals in children and adolescents from the admixed Mexican population. PMID:27782183

De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes.

PubMed

Ashrafi, Hamid; Hill, Theresa; Stoffel, Kevin; Kozik, Alexander; Yao, Jiqiang; Chin-Wo, Sebastian Reyes; Van Deynze, Allen

2012-10-30

Molecular breeding of pepper (Capsicum spp.) can be accelerated by developing DNA markers associated with transcriptomes in breeding germplasm. Before the advent of next generation sequencing (NGS) technologies, the majority of sequencing data were generated by the Sanger sequencing method. By leveraging Sanger EST data, we have generated a wealth of genetic information for pepper including thousands of SNPs and Single Position Polymorphic (SPP) markers. To complement and enhance these resources, we applied NGS to three pepper genotypes: Maor, Early Jalapeño and Criollo de Morelos-334 (CM334) to identify SNPs and SSRs in the assembly of these three genotypes. Two pepper transcriptome assemblies were developed with different purposes. The first reference sequence, assembled by CAP3 software, comprises 31,196 contigs from >125,000 Sanger-EST sequences that were mainly derived from a Korean F1-hybrid line, Bukang. Overlapping probes were designed for 30,815 unigenes to construct a pepper Affymetrix GeneChip® microarray for whole genome analyses. In addition, custom Python scripts were used to identify 4,236 SNPs in contigs of the assembly. A total of 2,489 simple sequence repeats (SSRs) were identified from the assembly, and primers were designed for the SSRs. Annotation of contigs using Blast2GO software resulted in information for 60% of the unigenes in the assembly. The second transcriptome assembly was constructed from more than 200 million Illumina Genome Analyzer II reads (80-120 nt) using a combination of Velvet, CLC workbench and CAP3 software packages. BWA, SAMtools and in-house Perl scripts were used to identify SNPs among three pepper genotypes. The SNPs were filtered to be at least 50 bp from any intron-exon junctions as well as flanking SNPs. More than 22,000 high-quality putative SNPs were identified. Using the MISA software, 10,398 SSR markers were also identified within the Illumina transcriptome assembly and primers were designed for the identified markers. The assembly was annotated by Blast2GO and 14,740 (12%) of annotated contigs were associated with functional proteins. Before availability of pepper genome sequence, assembling transcriptomes of this economically important crop was required to generate thousands of high-quality molecular markers that could be used in breeding programs. In order to have a better understanding of the assembled sequences and to identify candidate genes underlying QTLs, we annotated the contigs of Sanger-EST and Illumina transcriptome assemblies. These and other information have been curated in a database that we have dedicated for pepper project.

Systematic identification of DNA variants associated with ultraviolet radiation using a novel Geographic-Wide Association Study (GeoWAS).

PubMed

Hsu, Irving; Chen, Rong; Ramesh, Aditya; Corona, Erik; Kang, Hyunseok Peter; Ruau, David; Butte, Atul J

2013-06-20

Long-term environmental variables are widely understood to play important roles in DNA variation. Previously, clinical studies examining the impacts of these variables on the human genome were localized to a single country, and used preselected DNA variants. Furthermore, clinical studies or surveys are either not available or difficult to carry out for developing countries. A systematic approach utilizing bioinformatics to identify associations among environmental variables, genetic variation, and diseases across various geographical locations is needed but has been lacking. Using a novel Geographic-Wide Association Study (GeoWAS) methodology, we identified Single Nucleotide Polymorphisms (SNPs) in the Human Genome Diversity Project (HGDP) with population allele frequencies associated geographical ultraviolet radiation exposure, and then assessed the diseases known to be assigned with these SNPs. 2,857 radiation SNPs were identified from over 650,000 SNPs in 52 indigenous populations across the world. Using a quantitative disease-SNP database curated from 5,065 human genetic papers, we identified disease associations with those radiation SNPs. The correlation of the rs16891982 SNP in the SLC45A2 gene with melanoma was used as a case study for analysis of disease risk, and the results were consistent with the incidence and mortality rates of melanoma in published scientific literature. Finally, by analyzing the ontology of genes in which the radiation SNPs were significantly enriched, potential associations between SNPs and neurological disorders such as Alzheimer's disease were hypothesized. A systematic approach using GeoWAS has enabled us to identify DNA variation associated with ultraviolet radiation and their connections to diseases such as skin cancers. Our analyses have led to a better understating at the genetic level of why certain diseases are more predominant in specific geographical locations, due to the interactions between environmental variables such as ultraviolet radiation and the population types in those regions. The hypotheses proposed in GeoWAS can lead to future testing and interdisciplinary research.

snpTree--a web-server to identify and construct SNP trees from whole genome sequence data.

PubMed

Leekitcharoenphon, Pimlapas; Kaas, Rolf S; Thomsen, Martin Christen Frølund; Friis, Carsten; Rasmussen, Simon; Aarestrup, Frank M

2012-01-01

The advances and decreasing economical cost of whole genome sequencing (WGS), will soon make this technology available for routine infectious disease epidemiology. In epidemiological studies, outbreak isolates have very little diversity and require extensive genomic analysis to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed from concatenated SNPs using FastTree and a perl script. The online server was implemented by HTML, Java and python script.The server was evaluated using four published bacterial WGS data sets (V. cholerae, S. aureus CC398, S. Typhimurium and M. tuberculosis). The evaluation results for the first three cases was consistent and concordant for both raw reads and assembled genomes. In the latter case the original publication involved extensive filtering of SNPs, which could not be repeated using snpTree. The snpTree server is an easy to use option for rapid standardised and automatic SNP analysis in epidemiological studies also for users with limited bioinformatic experience. The web server is freely accessible at http://www.cbs.dtu.dk/services/snpTree-1.0/.

Discovery of Pod Shatter-Resistant Associated SNPs by Deep Sequencing of a Representative Library Followed by Bulk Segregant Analysis in Rapeseed

PubMed Central

Huang, Shunmou; Yang, Hongli; Zhan, Gaomiao; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Background Single nucleotide polymorphisms (SNPs) are an important class of genetic marker for target gene mapping. As of yet, there is no rapid and effective method to identify SNPs linked with agronomic traits in rapeseed and other crop species. Methodology/Principal Findings We demonstrate a novel method for identifying SNP markers in rapeseed by deep sequencing a representative library and performing bulk segregant analysis. With this method, SNPs associated with rapeseed pod shatter-resistance were discovered. Firstly, a reduced representation of the rapeseed genome was used. Genomic fragments ranging from 450–550 bp were prepared from the susceptible bulk (ten F2 plants with the silique shattering resistance index, SSRI <0.10) and the resistance bulk (ten F2 plants with SSRI >0.90), and also Solexa sequencing-produced 90 bp reads. Approximately 50 million of these sequence reads were assembled into contigs to a depth of 20-fold coverage. Secondly, 60,396 ‘simple SNPs’ were identified, and the statistical significance was evaluated using Fisher's exact test. There were 70 associated SNPs whose –log10 p value over 16 were selected to be further analyzed. The distribution of these SNPs appeared a tight cluster, which consisted of 14 associated SNPs within a 396 kb region on chromosome A09. Our evidence indicates that this region contains a major quantitative trait locus (QTL). Finally, two associated SNPs from this region were mapped on a major QTL region. Conclusions/Significance 70 associated SNPs were discovered and a major QTL for rapeseed pod shatter-resistance was found on chromosome A09 using our novel method. The associated SNP markers were used for mapping of the QTL, and may be useful for improving pod shatter-resistance in rapeseed through marker-assisted selection and map-based cloning. This approach will accelerate the discovery of major QTLs and the cloning of functional genes for important agronomic traits in rapeseed and other crop species. PMID:22529909

Powerful Identification of Cis-regulatory SNPs in Human Primary Monocytes Using Allele-Specific Gene Expression

PubMed Central

Almlöf, Jonas Carlsson; Lundmark, Per; Lundmark, Anders; Ge, Bing; Maouche, Seraya; Göring, Harald H. H.; Liljedahl, Ulrika; Enström, Camilla; Brocheton, Jessy; Proust, Carole; Godefroy, Tiphaine; Sambrook, Jennifer G.; Jolley, Jennifer; Crisp-Hihn, Abigail; Foad, Nicola; Lloyd-Jones, Heather; Stephens, Jonathan; Gwilliam, Rhian; Rice, Catherine M.; Hengstenberg, Christian; Samani, Nilesh J.; Erdmann, Jeanette; Schunkert, Heribert; Pastinen, Tomi; Deloukas, Panos; Goodall, Alison H.; Ouwehand, Willem H.; Cambien, François; Syvänen, Ann-Christine

2012-01-01

A large number of genome-wide association studies have been performed during the past five years to identify associations between SNPs and human complex diseases and traits. The assignment of a functional role for the identified disease-associated SNP is not straight-forward. Genome-wide expression quantitative trait locus (eQTL) analysis is frequently used as the initial step to define a function while allele-specific gene expression (ASE) analysis has not yet gained a wide-spread use in disease mapping studies. We compared the power to identify cis-acting regulatory SNPs (cis-rSNPs) by genome-wide allele-specific gene expression (ASE) analysis with that of traditional expression quantitative trait locus (eQTL) mapping. Our study included 395 healthy blood donors for whom global gene expression profiles in circulating monocytes were determined by Illumina BeadArrays. ASE was assessed in a subset of these monocytes from 188 donors by quantitative genotyping of mRNA using a genome-wide panel of SNP markers. The performance of the two methods for detecting cis-rSNPs was evaluated by comparing associations between SNP genotypes and gene expression levels in sample sets of varying size. We found that up to 8-fold more samples are required for eQTL mapping to reach the same statistical power as that obtained by ASE analysis for the same rSNPs. The performance of ASE is insensitive to SNPs with low minor allele frequencies and detects a larger number of significantly associated rSNPs using the same sample size as eQTL mapping. An unequivocal conclusion from our comparison is that ASE analysis is more sensitive for detecting cis-rSNPs than standard eQTL mapping. Our study shows the potential of ASE mapping in tissue samples and primary cells which are difficult to obtain in large numbers. PMID:23300628

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

PubMed

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

Bioinformatics challenges for genome-wide association studies.

PubMed

Moore, Jason H; Asselbergs, Folkert W; Williams, Scott M

2010-02-15

The sequencing of the human genome has made it possible to identify an informative set of >1 million single nucleotide polymorphisms (SNPs) across the genome that can be used to carry out genome-wide association studies (GWASs). The availability of massive amounts of GWAS data has necessitated the development of new biostatistical methods for quality control, imputation and analysis issues including multiple testing. This work has been successful and has enabled the discovery of new associations that have been replicated in multiple studies. However, it is now recognized that most SNPs discovered via GWAS have small effects on disease susceptibility and thus may not be suitable for improving health care through genetic testing. One likely explanation for the mixed results of GWAS is that the current biostatistical analysis paradigm is by design agnostic or unbiased in that it ignores all prior knowledge about disease pathobiology. Further, the linear modeling framework that is employed in GWAS often considers only one SNP at a time thus ignoring their genomic and environmental context. There is now a shift away from the biostatistical approach toward a more holistic approach that recognizes the complexity of the genotype-phenotype relationship that is characterized by significant heterogeneity and gene-gene and gene-environment interaction. We argue here that bioinformatics has an important role to play in addressing the complexity of the underlying genetic basis of common human diseases. The goal of this review is to identify and discuss those GWAS challenges that will require computational methods.

SNPs and Haplotypes in Native American Populations

PubMed Central

Kidd, Judith R.; Friedlaender, Françoise; Pakstis, Andrew J.; Furtado, Manohar; Fang, Rixun; Wang, Xudong; Nievergelt, Caroline M.; Kidd, Kenneth K.

2013-01-01

Autosomal DNA polymorphisms can provide new information and understanding of both the origins of and relationships among modern Native American populations. At the same time that autosomal markers can be highly informative, they are also susceptible to ascertainment biases in the selection of the markers to use. Identifying markers that can be used for ancestry inference among Native American populations can be considered separate from identifying markers to further the quest for history. In the current study we are using data on nine Native American populations to compare the results based on a large haplotype-based dataset with relatively small independent sets of SNPs. We are interested in what types of limited datasets an individual laboratory might be able to collect are best for addressing two different questions of interest. First, how well can we differentiate the Native American populations and/or infer ancestry by assigning an individual to her population(s) of origin? Second, how well can we infer the historical/evolutionary relationships among Native American populations and their Eurasian origins. We conclude that only a large comprehensive dataset involving multiple autosomal markers on multiple populations will be able to answer both questions; different small sets of markers are able to answer only one or the other of these questions. Using our largest dataset we see a general increasing distance from Old World populations from North to South in the New World except for an unexplained close relationship between our Maya and Quechua samples. PMID:21913176

Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

PubMed

Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

2001-11-23

Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

Association of High Myopia with Crystallin Beta A4 (CRYBA4) Gene Polymorphisms in the Linkage-Identified MYP6 Locus

PubMed Central

Ho, Daniel W. H.; Yap, Maurice K. H.; Ng, Po Wah; Fung, Wai Yan; Yip, Shea Ping

2012-01-01

Background Myopia is the most common ocular disorder worldwide and imposes tremendous burden on the society. It is a complex disease. The MYP6 locus at 22 q12 is of particular interest because many studies have detected linkage signals at this interval. The MYP6 locus is likely to contain susceptibility gene(s) for myopia, but none has yet been identified. Methodology/Principal Findings Two independent subject groups of southern Chinese in Hong Kong participated in the study an initial study using a discovery sample set of 342 cases and 342 controls, and a follow-up study using a replication sample set of 316 cases and 313 controls. Cases with high myopia were defined by spherical equivalent ≤ -8 dioptres and emmetropic controls by spherical equivalent within ±1.00 dioptre for both eyes. Manual candidate gene selection from the MYP6 locus was supported by objective in silico prioritization. DNA samples of discovery sample set were genotyped for 178 tagging single nucleotide polymorphisms (SNPs) from 26 genes. For replication, 25 SNPs (tagging or located at predicted transcription factor or microRNA binding sites) from 4 genes were subsequently examined using the replication sample set. Fisher P value was calculated for all SNPs and overall association results were summarized by meta-analysis. Based on initial and replication studies, rs2009066 located in the crystallin beta A4 (CRYBA4) gene was identified to be the most significantly associated with high myopia (initial study: P = 0.02; replication study: P = 1.88e-4; meta-analysis: P = 1.54e-5) among all the SNPs tested. The association result survived correction for multiple comparisons. Under the allelic genetic model for the combined sample set, the odds ratio of the minor allele G was 1.41 (95% confidence intervals, 1.21-1.64). Conclusions/Significance A novel susceptibility gene (CRYBA4) was discovered for high myopia. Our study also signified the potential importance of appropriate gene prioritization in candidate selection. PMID:22792142

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

PubMed Central

Asp, Torben; Kristensen, Michael

2016-01-01

Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205

Resequencing and Analysis of Variation in the TCF7L2 Gene in African Americans Suggests That SNP rs7903146 Is the Causal Diabetes Susceptibility Variant

PubMed Central

Palmer, Nicholette D.; Hester, Jessica M.; An, S. Sandy; Adeyemo, Adebowale; Rotimi, Charles; Langefeld, Carl D.; Freedman, Barry I.; Ng, Maggie C.Y.; Bowden, Donald W.

2011-01-01

OBJECTIVE Variation in the transcription factor 7-like 2 (TCF7L2) locus is associated with type 2 diabetes across multiple ethnicities. The aim of this study was to elucidate which variant in TCF7L2 confers diabetes susceptibility in African Americans. RESEARCH DESIGN AND METHODS Through the evaluation of tagging single nucleotide polymorphisms (SNPs), type 2 diabetes susceptibility was limited to a 4.3-kb interval, which contains the YRI (African) linkage disequilibrium (LD) block containing rs7903146. To better define the relationship between type 2 diabetes risk and genetic variation we resequenced this 4.3-kb region in 96 African American DNAs. Thirty-three novel and 13 known SNPs were identified: 20 with minor allele frequencies (MAF) >0.05 and 12 with MAF >0.10. These polymorphisms and the previously identified DG10S478 microsatellite were evaluated in African American type 2 diabetic cases (n = 1,033) and controls (n = 1,106). RESULTS Variants identified from direct sequencing and databases were genotyped or imputed. Fifteen SNPs showed association with type 2 diabetes (P < 0.05) with rs7903146 being the most significant (P = 6.32 × 10−6). Results of imputation, haplotype, and conditional analysis of SNPs were consistent with rs7903146 being the trait-defining SNP. Analysis of the DG10S478 microsatellite, which is outside the 4.3-kb LD block, revealed consistent association of risk allele 8 with type 2 diabetes (odds ratio [OR] = 1.33; P = 0.022) as reported in European populations; however, allele 16 (MAF = 0.016 cases and 0.032 controls) was strongly associated with reduced risk (OR = 0.39; P = 5.02 × 10−5) in contrast with previous studies. CONCLUSIONS In African Americans, these observations suggest that rs7903146 is the trait-defining polymorphism associated with type 2 diabetes risk. Collectively, these results support ethnic differences in type 2 diabetes associations. PMID:20980453

A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

PubMed Central

Volkov, Petr; Olsson, Anders H.; Gillberg, Linn; Jørgensen, Sine W.; Brøns, Charlotte; Eriksson, Karl-Fredrik; Groop, Leif; Jansson, Per-Anders; Nilsson, Emma; Rönn, Tina; Vaag, Allan; Ling, Charlotte

2016-01-01

Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI), lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT) demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL), hemoglobin A1c (HbA1c) and homeostatic model assessment of insulin resistance (HOMA-IR)) via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and diabetes. PMID:27322064

Network-based Analysis of Genome Wide Association Data Provides Novel Candidate Genes for Lipid and Lipoprotein Traits*

PubMed Central

Sharma, Amitabh; Gulbahce, Natali; Pevzner, Samuel J.; Menche, Jörg; Ladenvall, Claes; Folkersen, Lasse; Eriksson, Per; Orho-Melander, Marju; Barabási, Albert-László

2013-01-01

Genome wide association studies (GWAS) identify susceptibility loci for complex traits, but do not identify particular genes of interest. Integration of functional and network information may help in overcoming this limitation and identifying new susceptibility loci. Using GWAS and comorbidity data, we present a network-based approach to predict candidate genes for lipid and lipoprotein traits. We apply a prediction pipeline incorporating interactome, co-expression, and comorbidity data to Global Lipids Genetics Consortium (GLGC) GWAS for four traits of interest, identifying phenotypically coherent modules. These modules provide insights regarding gene involvement in complex phenotypes with multiple susceptibility alleles and low effect sizes. To experimentally test our predictions, we selected four candidate genes and genotyped representative SNPs in the Malmö Diet and Cancer Cardiovascular Cohort. We found significant associations with LDL-C and total-cholesterol levels for a synonymous SNP (rs234706) in the cystathionine beta-synthase (CBS) gene (p = 1 × 10−5 and adjusted-p = 0.013, respectively). Further, liver samples taken from 206 patients revealed that patients with the minor allele of rs234706 had significant dysregulation of CBS (p = 0.04). Despite the known biological role of CBS in lipid metabolism, SNPs within the locus have not yet been identified in GWAS of lipoprotein traits. Thus, the GWAS-based Comorbidity Module (GCM) approach identifies candidate genes missed by GWAS studies, serving as a broadly applicable tool for the investigation of other complex disease phenotypes. PMID:23882023

Fine-Mapping of Common Genetic Variants Associated with Colorectal Tumor Risk Identified Potential Functional Variants

PubMed Central

Gala, Manish; Abecasis, Goncalo; Bezieau, Stephane; Brenner, Hermann; Butterbach, Katja; Caan, Bette J.; Carlson, Christopher S.; Casey, Graham; Chang-Claude, Jenny; Conti, David V.; Curtis, Keith R.; Duggan, David; Gallinger, Steven; Haile, Robert W.; Harrison, Tabitha A.; Hayes, Richard B.; Hoffmeister, Michael; Hopper, John L.; Hudson, Thomas J.; Jenkins, Mark A.; Küry, Sébastien; Le Marchand, Loic; Leal, Suzanne M.; Newcomb, Polly A.; Nickerson, Deborah A.; Potter, John D.; Schoen, Robert E.; Schumacher, Fredrick R.; Seminara, Daniela; Slattery, Martha L.; Hsu, Li; Chan, Andrew T.; White, Emily; Berndt, Sonja I.; Peters, Ulrike

2016-01-01

Genome-wide association studies (GWAS) have identified many common single nucleotide polymorphisms (SNPs) associated with colorectal cancer risk. These SNPs may tag correlated variants with biological importance. Fine-mapping around GWAS loci can facilitate detection of functional candidates and additional independent risk variants. We analyzed 11,900 cases and 14,311 controls in the Genetics and Epidemiology of Colorectal Cancer Consortium and the Colon Cancer Family Registry. To fine-map genomic regions containing all known common risk variants, we imputed high-density genetic data from the 1000 Genomes Project. We tested single-variant associations with colorectal tumor risk for all variants spanning genomic regions 250-kb upstream or downstream of 31 GWAS-identified SNPs (index SNPs). We queried the University of California, Santa Cruz Genome Browser to examine evidence for biological function. Index SNPs did not show the strongest association signals with colorectal tumor risk in their respective genomic regions. Bioinformatics analysis of SNPs showing smaller P-values in each region revealed 21 functional candidates in 12 loci (5q31.1, 8q24, 11q13.4, 11q23, 12p13.32, 12q24.21, 14q22.2, 15q13, 18q21, 19q13.1, 20p12.3, and 20q13.33). We did not observe evidence of additional independent association signals in GWAS-identified regions. Our results support the utility of integrating data from comprehensive fine-mapping with expanding publicly available genomic databases to help clarify GWAS associations and identify functional candidates that warrant more onerous laboratory follow-up. Such efforts may aid the eventual discovery of disease-causing variant(s). PMID:27379672

Association analysis of 528 intra-genic SNPs in a region of chromosome 10 linked to late onset Alzheimer's disease.

PubMed

Morgan, A R; Hamilton, G; Turic, D; Jehu, L; Harold, D; Abraham, R; Hollingworth, P; Moskvina, V; Brayne, C; Rubinsztein, D C; Lynch, A; Lawlor, B; Gill, M; O'Donovan, M; Powell, J; Lovestone, S; Williams, J; Owen, M J

2008-09-05

Late-onset Alzheimer's disease (LOAD) is a genetically complex neurodegenerative disorder. Currently, only the epsilon4 allele of the Apolipoprotein E gene has been identified unequivocally as a genetic susceptibility factor for LOAD. Others remain to be found. In 2002 we observed genome-wide significant evidence of linkage to a region on chromosome 10q11.23-q21.3 [Myers et al. (2002) Am J Med Genet 114:235-244]. Our objective in this study was to test every gene within the maximum LOD-1 linkage region, for association with LOAD. We obtained results for 528 SNPs from 67 genes, with an average density of 1 SNP every 10 kb within the genes. We demonstrated nominally significant association with LOAD for 4 SNPs: rs1881747 near DKK1 (P = 0.011, OR = 1.24), rs2279420 in ANK3 (P = 0.022, OR = 0.79), rs2306402 in CTNNA3 (P = 0.024, OR = 1.18), and rs5030882 in CXXC6 (P = 0.046, OR = 1.29) in 1,160 cases and 1,389 controls. These results would not survive correction for multiple testing but warrant attempts at confirmation in independent samples. 2007 Wiley-Liss, Inc.

Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

PubMed

Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

2015-11-10

Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs can inform control programs. This manuscript describes modifications to high resolution melting technology that further increase its sensitivity to identify polygenomic infections in patient samples.

Association of type 1 diabetes with two Loci on 12q13 and 16p13 and the influence coexisting thyroid autoimmunity in Japanese.

PubMed

Awata, Takuya; Kawasaki, Eiji; Tanaka, Shoichiro; Ikegami, Hiroshi; Maruyama, Taro; Shimada, Akira; Nakanishi, Koji; Kobayashi, Tetsuro; Iizuka, Hiroyuki; Uga, Miho; Kawabata, Yumiko; Kanazawa, Yasuhiko; Kurihara, Susumu; Osaki, Masataka; Katayama, Shigehiro

2009-01-01

Recent genome-wide association studies have identified several novel type 1 diabetes (T1D) loci in white populations. In line with recent findings, we conducted a replication study of two loci on chromosome 12p13 and 16p13 and assessed their potential associations with thyroid autoimmunity in a Japanese population. Two single-nucleotide polymorphisms (SNPs), rs2292399 in ERBB3 on 12q13 and rs2903692 in CLEC16A (or KIAA0350) on 16p13, were analyzed in Japanese subjects consisting of 735 T1D patients, 330 patients with autoimmune thyroid disease (AITD), and 621 control subjects. According to a case-control study and logistic regression adjusting for sex and age, we observed that these SNPs in ERBB3 and CLEC16A were both significantly associated with T1D, with the risk alleles being consistent with those in white populations [adjusting odds ratio by multiplicative model: 1.37 (1.13-1.67), P = 0.001; and 1.28 (1.02-1.60), P = 0.030, respectively]. In both SNPs, the association was suggested to be stronger in T1D complicated with AITD (Graves' disease, Hashimoto's thyroiditis, or thyroid autoantibodies). Furthermore, a joint analysis, with the INS and CTLA4 SNPs, revealed that CTLA4 rs3087243, ERBB3 rs2292399, and CLEC16A rs2903692, but not INS rs689, were significant risk factors for the cooccurrence of AITD in Japanese T1D. We confirmed two loci on 12q13 and 16p13 that were identified by the independent genome-wide association studies in white populations, thus suggesting that these loci contribute to T1D susceptibility across different ethnic groups. In addition, these loci may also be associated with the cooccurrence of thyroid autoimmunity in T1D.

Population-based study of the association of variants in mismatch repair genes with prostate cancer risk and outcomes

PubMed Central

Langeberg, Wendy J.; Kwon, Erika M.; Koopmeiners, Joseph S.; Ostrander, Elaine A.; Stanford, Janet L.

2009-01-01

Background Mismatch repair (MMR) gene activity may be associated with prostate cancer (PC) risk and outcomes. This study evaluated whether single nucleotide polymorphisms (SNPs) in key MMR genes are related to PC outcomes. Methods Data from two population-based case-control studies of PC among Caucasian and African-American men residing in King County, Washington were combined for this analysis. Cases (n=1,458) were diagnosed with PC in 1993–96 or 2002–05 and identified via the Seattle-Puget Sound SEER cancer registry. Controls (n=1,351) were age-matched to cases and identified via random digit dialing. Logistic regression was used to assess the relationship between haplotype-tagging SNPs and PC risk and disease aggressiveness. Cox proportional hazards regression was used to assess the relationship between SNPs and PC recurrence and PC-specific death. Results Nineteen SNPs were evaluated in the key MMR genes: five in MLH1, 10 in MSH2, and 4 in PMS2. Among Caucasian men, one SNP in MLH1 (rs9852810) was associated with: overall PC risk (OR=1.21, 95% CI=1.02, 1.44; p=0.03), more aggressive PC (OR=1.49, 95% CI=1.15–1.91; p<0.01), and PC recurrence (HR=1.83, 95% CI=1.18, 2.86; p<0.01), but not PC-specific mortality. A non-synonymous coding SNP in MLH1, rs1799977 (I219V), was also found to be associated with more aggressive disease. These results did not remain significant after adjusting for multiple comparisons. Conclusion This population-based case-control study provides evidence for a possible association with a gene variant in MLH1 in relation to risk of overall PC, more aggressive disease, and PC recurrence, which warrants replication. PMID:20056646

Fine-Scale Variation and Genetic Determinants of Alternative Splicing across Individuals

PubMed Central

Coulombe-Huntington, Jasmin; Lam, Kevin C. L.; Dias, Christel; Majewski, Jacek

2009-01-01

Recently, thanks to the increasing throughput of new technologies, we have begun to explore the full extent of alternative pre–mRNA splicing (AS) in the human transcriptome. This is unveiling a vast layer of complexity in isoform-level expression differences between individuals. We used previously published splicing sensitive microarray data from lymphoblastoid cell lines to conduct an in-depth analysis on splicing efficiency of known and predicted exons. By combining publicly available AS annotation with a novel algorithm designed to search for AS, we show that many real AS events can be detected within the usually unexploited, speculative majority of the array and at significance levels much below standard multiple-testing thresholds, demonstrating that the extent of cis-regulated differential splicing between individuals is potentially far greater than previously reported. Specifically, many genes show subtle but significant genetically controlled differences in splice-site usage. PCR validation shows that 42 out of 58 (72%) candidate gene regions undergo detectable AS, amounting to the largest scale validation of isoform eQTLs to date. Targeted sequencing revealed a likely causative SNP in most validated cases. In all 17 incidences where a SNP affected a splice-site region, in silico splice-site strength modeling correctly predicted the direction of the micro-array and PCR results. In 13 other cases, we identified likely causative SNPs disrupting predicted splicing enhancers. Using Fst and REHH analysis, we uncovered significant evidence that 2 putative causative SNPs have undergone recent positive selection. We verified the effect of five SNPs using in vivo minigene assays. This study shows that splicing differences between individuals, including quantitative differences in isoform ratios, are frequent in human populations and that causative SNPs can be identified using in silico predictions. Several cases affected disease-relevant genes and it is likely some of these differences are involved in phenotypic diversity and susceptibility to complex diseases. PMID:20011102

Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Shared polymorphisms and modifiable behavior factors for myocardial infarction and high cholesterol in a retrospective population study

PubMed Central

Liang, Yulan; Kelemen, Arpad

2017-01-01

Abstract Genetic and environmental (behavior, clinical, and demographic) factors are associated with increased risks of both myocardial infarction (MI) and high cholesterol (HC). It is known that HC is major risk factor that may cause MI. However, whether there are common single nucleotide polymorphism (SNPs) associated with both MI and HC is not firmly established, and whether there are modulate and modified effects (interactions of genetic and known environmental factors) on either HC or MI, and whether these joint effects improve the predictions of MI, is understudied. The purpose of this study is to identify novel shared SNPs and modifiable environmental factors on MI and HC. We assess whether SNPs from a metabolic pathway related to MI may relate to HC; whether there are moderate effects among SNPs, lifestyle (smoke and drinking), HC, and MI after controlling other factors [gender, body mass index (BMI), and hypertension (HTN)]; and evaluate prediction power of the joint and modulate genetic and environmental factors influencing the MI and HC. This is a retrospective study with residents of Erie and Niagara counties in New York with a history of MI or with no history of MI. The data set includes environmental variables (demographic, clinical, lifestyle). Thirty-one tagSNPs from a metabolic pathway related to MI are genotyped. Generalized linear models (GLMs) with imputation-based analysis are conducted for examining the common effects of tagSNPs and environmental exposures and their interactions on having a history of HC or MI. MI, BMI, and HTN are significant risk factors for HC. HC shows the strongest effect on risk of MI in addition to HTN; gender and smoking status while drinking status shows protective effect on MI. rs16944 (gene IL-1β) and rs17222772 (gene ALOX) increase the risks of HC, while rs17231896 (gene CETP) has protective effects on HC either with or without the clinical, behavioral, demographic factors with different effect sizes that may indicate the existence of moderate or modifiable effects. Further analysis with the inclusions of gene–gene and gene–environmental interactions shows interactions between rs17231896 (CETP) and rs17222772 (ALOX); rs17231896 (CETP) and gender. rs17237890 (CETP) and rs2070744 (NOS3) are found to be significantly associated with risks of MI adjusted by both SNPs and environmental factors. After multiple testing adjustments, these effects diminished as expected. In addition, an interaction between drinking and smoking status is significant. Overall, the prediction power in successfully classifying MI status is increased to 80% with inclusions of all significant tagSNPs and environmental factors and their interactions compared with environmental factors only (72%). Having a history of either HC or MI has significant effects on each other in both directions, in addition to HTN and gender. Genes/SNPs identified from this analysis that are associated with HC may be potentially linked to MI, which could be further examined and validated through haplotype-pairs analysis with appropriate population stratification corrections, and function/pathway regulation analysis to eliminate the limitations of the current analysis. PMID:28906356

Shared polymorphisms and modifiable behavior factors for myocardial infarction and high cholesterol in a retrospective population study.

PubMed

Liang, Yulan; Kelemen, Arpad

2017-09-01

Genetic and environmental (behavior, clinical, and demographic) factors are associated with increased risks of both myocardial infarction (MI) and high cholesterol (HC). It is known that HC is major risk factor that may cause MI. However, whether there are common single nucleotide polymorphism (SNPs) associated with both MI and HC is not firmly established, and whether there are modulate and modified effects (interactions of genetic and known environmental factors) on either HC or MI, and whether these joint effects improve the predictions of MI, is understudied.The purpose of this study is to identify novel shared SNPs and modifiable environmental factors on MI and HC. We assess whether SNPs from a metabolic pathway related to MI may relate to HC; whether there are moderate effects among SNPs, lifestyle (smoke and drinking), HC, and MI after controlling other factors [gender, body mass index (BMI), and hypertension (HTN)]; and evaluate prediction power of the joint and modulate genetic and environmental factors influencing the MI and HC.This is a retrospective study with residents of Erie and Niagara counties in New York with a history of MI or with no history of MI. The data set includes environmental variables (demographic, clinical, lifestyle). Thirty-one tagSNPs from a metabolic pathway related to MI are genotyped. Generalized linear models (GLMs) with imputation-based analysis are conducted for examining the common effects of tagSNPs and environmental exposures and their interactions on having a history of HC or MI.MI, BMI, and HTN are significant risk factors for HC. HC shows the strongest effect on risk of MI in addition to HTN; gender and smoking status while drinking status shows protective effect on MI. rs16944 (gene IL-1β) and rs17222772 (gene ALOX) increase the risks of HC, while rs17231896 (gene CETP) has protective effects on HC either with or without the clinical, behavioral, demographic factors with different effect sizes that may indicate the existence of moderate or modifiable effects. Further analysis with the inclusions of gene-gene and gene-environmental interactions shows interactions between rs17231896 (CETP) and rs17222772 (ALOX); rs17231896 (CETP) and gender. rs17237890 (CETP) and rs2070744 (NOS3) are found to be significantly associated with risks of MI adjusted by both SNPs and environmental factors. After multiple testing adjustments, these effects diminished as expected. In addition, an interaction between drinking and smoking status is significant. Overall, the prediction power in successfully classifying MI status is increased to 80% with inclusions of all significant tagSNPs and environmental factors and their interactions compared with environmental factors only (72%).Having a history of either HC or MI has significant effects on each other in both directions, in addition to HTN and gender. Genes/SNPs identified from this analysis that are associated with HC may be potentially linked to MI, which could be further examined and validated through haplotype-pairs analysis with appropriate population stratification corrections, and function/pathway regulation analysis to eliminate the limitations of the current analysis.

Re-sequencing and genetic variation identification of a rice line with ideal plant architecture.

PubMed

Li, Shuangcheng; Xie, Kailong; Li, Wenbo; Zou, Ting; Ren, Yun; Wang, Shiquan; Deng, Qiming; Zheng, Aiping; Zhu, Jun; Liu, Huainian; Wang, Lingxia; Ai, Peng; Gao, Fengyan; Huang, Bin; Cao, Xuemei; Li, Ping

2012-12-01

The ideal plant architecture (IPA) includes several important characteristics such as low tiller numbers, few or no unproductive tillers, more grains per panicle, and thick and sturdy stems. We have developed an indica restorer line 7302R that displays the IPA phenotype in terms of tiller number, grain number, and stem strength. However, its mechanism had to be clarified. We performed re-sequencing and genome-wide variation analysis of 7302R using the Solexa sequencing technology. With the genomic sequence of the indica cultivar 9311 as reference, 307 627 SNPs, 57 372 InDels, and 3 096 SVs were identified in the 7302R genome. The 7302R-specific variations were investigated via the synteny analysis of all the SNPs of 7302R with those of the previous sequenced none-IPA-type lines IR24, MH63, and SH527. Moreover, we found 178 168 7302R-specific SNPs across the whole genome and 30 239 SNPs in the predicted mRNA regions, among which 8 517 were Non-syn CDS. In addition, 263 large-effect SNPs that were expected to affect the integrity of encoded proteins were identified from the 7302R-specific SNPs. SNPs of several important previously cloned rice genes were also identified by aligning the 7302R sequence with other sequence lines. Our results provided several candidates account for the IPA phenotype of 7302R. These results therefore lay the groundwork for long-term efforts to uncover important genes and alleles for rice plant architecture construction, also offer useful data resources for future genetic and genomic studies in rice.

A scoring strategy combining statistics and functional genomics supports a possible role for common polygenic variation in autism

PubMed Central

Carayol, Jérôme; Schellenberg, Gerard D.; Dombroski, Beth; Amiet, Claire; Génin, Bérengère; Fontaine, Karine; Rousseau, Francis; Vazart, Céline; Cohen, David; Frazier, Thomas W.; Hardan, Antonio Y.; Dawson, Geraldine; Rio Frio, Thomas

2014-01-01

Autism spectrum disorders (ASD) are highly heritable complex neurodevelopmental disorders with a 4:1 male: female ratio. Common genetic variation could explain 40–60% of the variance in liability to autism. Because of their small effect, genome-wide association studies (GWASs) have only identified a small number of individual single-nucleotide polymorphisms (SNPs). To increase the power of GWASs in complex disorders, methods like convergent functional genomics (CFG) have emerged to extract true association signals from noise and to identify and prioritize genes from SNPs using a scoring strategy combining statistics and functional genomics. We adapted and applied this approach to analyze data from a GWAS performed on families with multiple children affected with autism from Autism Speaks Autism Genetic Resource Exchange (AGRE). We identified a set of 133 candidate markers that were localized in or close to genes with functional relevance in ASD from a discovery population (545 multiplex families); a gender specific genetic score (GS) based on these common variants explained 1% (P = 0.01 in males) and 5% (P = 8.7 × 10−7 in females) of genetic variance in an independent sample of multiplex families. Overall, our work demonstrates that prioritization of GWAS data based on functional genomics identified common variants associated with autism and provided additional support for a common polygenic background in autism. PMID:24600472

Genome-wide association study identifies novel breast cancer susceptibility loci

PubMed Central

Easton, Douglas F.; Pooley, Karen A.; Dunning, Alison M.; Pharoah, Paul D. P.; Thompson, Deborah; Ballinger, Dennis G.; Struewing, Jeffery P.; Morrison, Jonathan; Field, Helen; Luben, Robert; Wareham, Nicholas; Ahmed, Shahana; Healey, Catherine S.; Bowman, Richard; Meyer, Kerstin B.; Haiman, Christopher A.; Kolonel, Laurence K.; Henderson, Brian E.; Marchand, Loic Le; Brennan, Paul; Sangrajrang, Suleeporn; Gaborieau, Valerie; Odefrey, Fabrice; Shen, Chen-Yang; Wu, Pei-Ei; Wang, Hui-Chun; Eccles, Diana; Evans, D. Gareth; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Seal, Sheila; Stratton, Michael R.; Rahman, Nazneen; Chenevix-Trench, Georgia; Bojesen, Stig E.; Nordestgaard, Børge G.; Axelsson, Christen K.; Garcia-Closas, Montserrat; Brinton, Louise; Chanock, Stephen; Lissowska, Jolanta; Peplonska, Beata; Nevanlinna, Heli; Fagerholm, Rainer; Eerola, Hannaleena; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Cox, David G.; Hall, Per; Wedren, Sara; Liu, Jianjun; Low, Yen-Ling; Bogdanova, Natalia; Schürmann, Peter; Dörk, Thilo; Tollenaar, Rob A. E. M.; Jacobi, Catharina E.; Devilee, Peter; Klijn, Jan G. M.; Sigurdson, Alice J.; Doody, Michele M.; Alexander, Bruce H.; Zhang, Jinghui; Cox, Angela; Brock, Ian W.; MacPherson, Gordon; Reed, Malcolm W. R.; Couch, Fergus J.; Goode, Ellen L.; Olson, Janet E.; Meijers-Heijboer, Hanne; van den Ouweland, Ans; Uitterlinden, André; Rivadeneira, Fernando; Milne, Roger L.; Ribas, Gloria; Gonzalez-Neira, Anna; Benitez, Javier; Hopper, John L.; McCredie, Margaret; Southey, Melissa; Giles, Graham G.; Schroen, Chris; Justenhoven, Christina; Brauch, Hiltrud; Hamann, Ute; Ko, Yon-Dschun; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Mannermaa, Arto; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana; Day, Nicholas E.; Cox, David R.; Ponder, Bruce A. J.; Luccarini, Craig; Conroy, Don; Shah, Mitul; Munday, Hannah; Jordan, Clare; Perkins, Barbara; West, Judy; Redman, Karen; Driver, Kristy; Aghmesheh, Morteza; Amor, David; Andrews, Lesley; Antill, Yoland; Armes, Jane; Armitage, Shane; Arnold, Leanne; Balleine, Rosemary; Begley, Glenn; Beilby, John; Bennett, Ian; Bennett, Barbara; Berry, Geoffrey; Blackburn, Anneke; Brennan, Meagan; Brown, Melissa; Buckley, Michael; Burke, Jo; Butow, Phyllis; Byron, Keith; Callen, David; Campbell, Ian; Chenevix-Trench, Georgia; Clarke, Christine; Colley, Alison; Cotton, Dick; Cui, Jisheng; Culling, Bronwyn; Cummings, Margaret; Dawson, Sarah-Jane; Dixon, Joanne; Dobrovic, Alexander; Dudding, Tracy; Edkins, Ted; Eisenbruch, Maurice; Farshid, Gelareh; Fawcett, Susan; Field, Michael; Firgaira, Frank; Fleming, Jean; Forbes, John; Friedlander, Michael; Gaff, Clara; Gardner, Mac; Gattas, Mike; George, Peter; Giles, Graham; Gill, Grantley; Goldblatt, Jack; Greening, Sian; Grist, Scott; Haan, Eric; Harris, Marion; Hart, Stewart; Hayward, Nick; Hopper, John; Humphrey, Evelyn; Jenkins, Mark; Jones, Alison; Kefford, Rick; Kirk, Judy; Kollias, James; Kovalenko, Sergey; Lakhani, Sunil; Leary, Jennifer; Lim, Jacqueline; Lindeman, Geoff; Lipton, Lara; Lobb, Liz; Maclurcan, Mariette; Mann, Graham; Marsh, Deborah; McCredie, Margaret; McKay, Michael; McLachlan, Sue Anne; Meiser, Bettina; Milne, Roger; Mitchell, Gillian; Newman, Beth; O'Loughlin, Imelda; Osborne, Richard; Peters, Lester; Phillips, Kelly; Price, Melanie; Reeve, Jeanne; Reeve, Tony; Richards, Robert; Rinehart, Gina; Robinson, Bridget; Rudzki, Barney; Salisbury, Elizabeth; Sambrook, Joe; Saunders, Christobel; Scott, Clare; Scott, Elizabeth; Scott, Rodney; Seshadri, Ram; Shelling, Andrew; Southey, Melissa; Spurdle, Amanda; Suthers, Graeme; Taylor, Donna; Tennant, Christopher; Thorne, Heather; Townshend, Sharron; Tucker, Kathy; Tyler, Janet; Venter, Deon; Visvader, Jane; Walpole, Ian; Ward, Robin; Waring, Paul; Warner, Bev; Warren, Graham; Watson, Elizabeth; Williams, Rachael; Wilson, Judy; Winship, Ingrid; Young, Mary Ann; Bowtell, David; Green, Adele; deFazio, Anna; Chenevix-Trench, Georgia; Gertig, Dorota; Webb, Penny

2009-01-01

Breast cancer exhibits familial aggregation, consistent with variation in genetic susceptibility to the disease. Known susceptibility genes account for less than 25% of the familial risk of breast cancer, and the residual genetic variance is likely to be due to variants conferring more moderate risks. To identify further susceptibility alleles, we conducted a two-stage genome-wide association study in 4,398 breast cancer cases and 4,316 controls, followed by a third stage in which 30 single nucleotide polymorphisms (SNPs) were tested for confirmation in 21,860 cases and 22,578 controls from 22 studies. We used 227,876 SNPs that were estimated to correlate with 77% of known common SNPs in Europeans at r2>0.5. SNPs in five novel independent loci exhibited strong and consistent evidence of association with breast cancer (P<10−7). Four of these contain plausible causative genes (FGFR2, TNRC9, MAP3K1 and LSP1). At the second stage, 1,792 SNPs were significant at the P<0.05 level compared with an estimated 1,343 that would be expected by chance, indicating that many additional common susceptibility alleles may be identifiable by this approach. PMID:17529967

Meta-analysis of the Association Between Variants in SORL1 and Alzheimer Disease

PubMed Central

Reitz, Christiane; Cheng, Rong; Rogaeva, Ekaterina; Lee, Joseph H.; Tokuhiro, Shinya; Zou, Fanggeng; Bettens, Karolien; Sleegers, Kristel; Tan, Eng King; Kimura, Ryo; Shibata, Nobuto; Arai, Heii; Kamboh, M. Ilyas; Prince, Jonathan A.; Maier, Wolfgang; Riemenschneider, Matthias; Owen, Michael; Harold, Denise; Hollingworth, Paul; Cellini, Elena; Sorbi, Sandro; Nacmias, Benedetta; Takeda, Masatoshi; Pericak-Vance, Margaret A.; Haines, Jonathan L.; Younkin, Steven; Williams, Julie; van Broeckhoven, Christine; Farrer, Lindsay A.; St George–Hyslop, Peter H.; Mayeux, Richard

2011-01-01

Objective To reexamine the association between the neuronal sortilin-related receptor gene (SORL1) and Alzheimer disease (AD). Design Comprehensive and unbiased meta-analysis of all published and unpublished data from case-control studies for the SORL1 single-nucleotide polymorphisms (SNPs) that had been repeatedly assessed across studies. Setting Academic research institutions in the United States, the Netherlands, Canada, Belgium, the United Kingdom, Singapore, Japan, Sweden, Germany, France, and Italy. Participants All published white and Asian case-control data sets, which included a total of 12 464 cases and 17 929 controls. Main Outcome Measures Alzheimer disease according to the Diagnostic and Statistical Manual of Mental Disorders (Fourth Edition) and the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer’s Disease and Related Disorders Association (now known as the Alzheimer’s Association). Results In the white data sets, several markers were associated with AD after correction for multiple testing, including previously reported SNPs 8, 9, and 10 (P<.001). In addition, the C-G-C haplotype at SNPs 8 through 10 was associated with AD risk (P<.001). In the combined Asian data sets, SNPs 19 and 23 through 25 were associated with AD risk (P<.001). The disease-associated alleles at SNPs 8, 9, and 10 (120 873 131-120 886 175 base pairs [bp]; C-G-C alleles), at SNP 19 (120 953 300 bp; G allele), and at SNPs 24 through 25 (120 988 611 bp; T and C alleles) were the same previously reported alleles. The SNPs 4 through 5, 8 through 10, 12, and 19 through 25 belong to distinct linkage disequilibrium blocks. The same alleles at SNPs 8 through 10 (C-G-C), 19 (G), and 24 and 25 (T and C) have also been associated with AD endophenotypes, including white matter hyperintensities and hippocampal atrophy on magnetic resonance imaging, cerebrospinal fluid measures of amyloid β-peptide 42, and full-length SORL1 expression in the human brain. Conclusion This comprehensive meta-analysis provides confirmatory evidence that multiple SORL1 variants in distinct linkage disequilibrium blocks are associated with AD. PMID:21220680

GrigoraSNPs: Optimized Analysis of SNPs for DNA Forensics.

PubMed

Ricke, Darrell O; Shcherbina, Anna; Michaleas, Adam; Fremont-Smith, Philip

2018-04-16

High-throughput sequencing (HTS) of single nucleotide polymorphisms (SNPs) enables additional DNA forensic capabilities not attainable using traditional STR panels. However, the inclusion of sets of loci selected for mixture analysis, extended kinship, phenotype, biogeographic ancestry prediction, etc., can result in large panel sizes that are difficult to analyze in a rapid fashion. GrigoraSNP was developed to address the allele-calling bottleneck that was encountered when analyzing SNP panels with more than 5000 loci using HTS. GrigoraSNPs uses a MapReduce parallel data processing on multiple computational threads plus a novel locus-identification hashing strategy leveraging target sequence tags. This tool optimizes the SNP calling module of the DNA analysis pipeline with runtimes that scale linearly with the number of HTS reads. Results are compared with SNP analysis pipelines implemented with SAMtools and GATK. GrigoraSNPs removes a computational bottleneck for processing forensic samples with large HTS SNP panels. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.

Genome-wide analysis of epistasis in body mass index using multiple human populations.

PubMed

Wei, Wen-Hua; Hemani, Gib; Gyenesei, Attila; Vitart, Veronique; Navarro, Pau; Hayward, Caroline; Cabrera, Claudia P; Huffman, Jennifer E; Knott, Sara A; Hicks, Andrew A; Rudan, Igor; Pramstaller, Peter P; Wild, Sarah H; Wilson, James F; Campbell, Harry; Hastie, Nicholas D; Wright, Alan F; Haley, Chris S

2012-08-01

We surveyed gene-gene interactions (epistasis) in human body mass index (BMI) in four European populations (n<1200) via exhaustive pair-wise genome scans where interactions were computed as F ratios by testing a linear regression model fitting two single-nucleotide polymorphisms (SNPs) with interactions against the one without. Before the association tests, BMI was corrected for sex and age, normalised and adjusted for relatedness. Neither single SNPs nor SNP interactions were genome-wide significant in either cohort based on the consensus threshold (P=5.0E-08) and a Bonferroni corrected threshold (P=1.1E-12), respectively. Next we compared sub genome-wide significant SNP interactions (P<5.0E-08) across cohorts to identify common epistatic signals, where SNPs were annotated to genes to test for gene ontology (GO) enrichment. Among the epistatic genes contributing to the commonly enriched GO terms, 19 were shared across study cohorts of which 15 are previously published genome-wide association loci, including CDH13 (cadherin 13) associated with height and SORCS2 (sortilin-related VPS10 domain containing receptor 2) associated with circulating insulin-like growth factor 1 and binding protein 3. Interactions between the 19 shared epistatic genes and those involving BMI candidate loci (P<5.0E-08) were tested across cohorts and found eight replicated at the SNP level (P<0.05) in at least one cohort, which were further tested and showed limited replication in a separate European population (n>5000). We conclude that genome-wide analysis of epistasis in multiple populations is an effective approach to provide new insights into the genetic regulation of BMI but requires additional efforts to confirm the findings.

Association with replication between estrogen-related receptor gamma (ESRRgamma) polymorphisms and bone phenotypes in women of European ancestry.

PubMed

Elfassihi, Latifa; Giroux, Sylvie; Bureau, Alexandre; Laflamme, Nathalie; Cole, David Ec; Rousseau, François

2010-04-01

Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable polygenic trait. Women are more prone than men to develop osteoporosis owing to a lower peak bone mass and accelerated bone loss at menopause. Lack of estrogen thus is a major risk factor for osteoporosis. In addition to having strong similarity to the estrogen receptor 1 (ESR1), the orphan nuclear estrogen-related receptor gamma (ESRRgamma) is widely expressed and shows overlap with ESR1 expression in tissues where estrogen has important physiologic functions. For these reasons, we have undertaken a study of ESRRgamma sequence variants in association with bone measurements [heel quantitative ultrasound (QUS) by measurements of broadband ultrasound attenuation (BUA), speed of sound (SOS), and stiffness index (SI) and dual-energy X-ray absorptiometry (DXA) at the femoral neck (FN) and lumbar spine (LS)]. A silent variant was found to be associated with multiple bone measurements (LS, BUA, SOS, and SI), the p values ranging from .006 to .04 in a sample of 5144 Quebec women. The region of this variant was analyzed using the HapMap database and the Gabriel method to define a block of 20 kb. Using the Tagger method, eight TagSNPs were identified and genotyped in a sample of 1335 women. Four of these SNPs capture the five major block haplotypes. One SNP (rs2818964) and one haplotype were significantly associated with multiple bone measures. All SNPs involved in the associations were analyzed in two other sample sets with significant results in the same direction. These results suggest involvement of ESRRgamma in the determination of bone density in women. Copyright 2010 American Society for Bone and Mineral Research.

Interaction between arsenic exposure from drinking water and genetic polymorphisms on cardiovascular disease in Bangladesh: a prospective case-cohort study.

PubMed

Wu, Fen; Jasmine, Farzana; Kibriya, Muhammad G; Liu, Mengling; Cheng, Xin; Parvez, Faruque; Islam, Tariqul; Ahmed, Alauddin; Rakibuz-Zaman, Muhammad; Jiang, Jieying; Roy, Shantanu; Paul-Brutus, Rachelle; Slavkovich, Vesna; Islam, Tariqul; Levy, Diane; VanderWeele, Tyler J; Pierce, Brandon L; Graziano, Joseph H; Ahsan, Habibul; Chen, Yu

2015-05-01

Epidemiologic data on genetic susceptibility to cardiovascular effects of arsenic exposure from drinking water are limited. We investigated whether the association between well-water arsenic and cardiovascular disease (CVD) differed by 170 single nucleotide polymorphisms (SNPs) in 17 genes related to arsenic metabolism, oxidative stress, inflammation, and endothelial dysfunction. We conducted a prospective case-cohort study nested in the Health Effects of Arsenic Longitudinal Study, with a random subcohort of 1,375 subjects and 447 incident fatal and nonfatal cases of CVD. Well-water arsenic was measured in 2000 at baseline. The CVD cases, 56 of which occurred in the subcohort, included 238 coronary heart disease cases, 165 stroke cases, and 44 deaths due to other CVD identified during follow-up from 2000 to 2012. Of the 170 SNPs tested, multiplicative interactions between well-water arsenic and two SNPs, rs281432 in ICAM1 (padj = 0.0002) and rs3176867 in VCAM1 (padj = 0.035), were significant for CVD after adjustment for multiple testing. Compared with those with GC or CC genotype in rs281432 and lower well-water arsenic, the adjusted hazard ratio (aHR) for CVD was 1.82 (95% CI: 1.31, 2.54) for a 1-SD increase in well-water arsenic combined with the GG genotype, which was greater than expected given aHRs of 1.08 and 0.96 for separate effects of arsenic and the genotype alone, respectively. Similarly, the joint aHR for arsenic and the rs3176867 CC genotype was 1.34 (95% CI: 0.95, 1.87), greater than expected given aHRs for their separate effects of 1.02 and 0.84, respectively. Associations between CVD and arsenic exposure may be modified by genetic variants related to endothelial dysfunction.

An integrated pipeline of open source software adapted for multi-CPU architectures: use in the large-scale identification of single nucleotide polymorphisms.

PubMed

Jayashree, B; Hanspal, Manindra S; Srinivasan, Rajgopal; Vigneshwaran, R; Varshney, Rajeev K; Spurthi, N; Eshwar, K; Ramesh, N; Chandra, S; Hoisington, David A

2007-01-01

The large amounts of EST sequence data available from a single species of an organism as well as for several species within a genus provide an easy source of identification of intra- and interspecies single nucleotide polymorphisms (SNPs). In the case of model organisms, the data available are numerous, given the degree of redundancy in the deposited EST data. There are several available bioinformatics tools that can be used to mine this data; however, using them requires a certain level of expertise: the tools have to be used sequentially with accompanying format conversion and steps like clustering and assembly of sequences become time-intensive jobs even for moderately sized datasets. We report here a pipeline of open source software extended to run on multiple CPU architectures that can be used to mine large EST datasets for SNPs and identify restriction sites for assaying the SNPs so that cost-effective CAPS assays can be developed for SNP genotyping in genetics and breeding applications. At the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), the pipeline has been implemented to run on a Paracel high-performance system consisting of four dual AMD Opteron processors running Linux with MPICH. The pipeline can be accessed through user-friendly web interfaces at http://hpc.icrisat.cgiar.org/PBSWeb and is available on request for academic use. We have validated the developed pipeline by mining chickpea ESTs for interspecies SNPs, development of CAPS assays for SNP genotyping, and confirmation of restriction digestion pattern at the sequence level.

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans.

PubMed

Cha, Seongwon; Yu, Hyunjoo; Park, Ah Yeon; Song, Kwang Hoon

2014-03-12

Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C-G-A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS.

Effects of apolipoprotein A5 haplotypes on the ratio of triglyceride to high-density lipoprotein cholesterol and the risk for metabolic syndrome in Koreans

PubMed Central

2014-01-01

Background Single-nucleotide polymorphisms (SNPs) around the apolipoprotein A5 gene (APOA5) have pleiotropic effects on the levels of triglyceride (TG) and high-density lipoprotein cholesterol (HDL-C). APOA5 SNPs have also been associated with metabolic syndrome (MS). Here, we constructed haplotypes with SNPs spanning APOA5 and ZNF259, which are approximately 1.3 kb apart, to perform association analyses with the risk for MS and the levels of TG and HDL-C in terms of a TG:HDL-C ratio. Methods The effects of three constructed haplotypes (TAA, CGG, and CGA, in the order of rs662799, rs651821, and rs6589566) on the TG:HDL-C ratio and MS were estimated using multiple regression analyses in 2,949 Koreans and in each gender separately (1,082 men and 1,867 women). Results The haplotypes, CGG and CGA, were associated with the TG:HDL-C ratio and the risk of MS development in both genders. That is, the minor alleles of the rs662799 and rs651821 in APOA5, irrespective of which allele was present at rs6589566, had the marked effects. Interestingly, a C–G–A haplotype at these three SNPs had the most marked effects on the TG:HDL-C ratio and the risk of MS development in women. Conclusions We have identified the novel APOA5-ZNF259 haplotype manifesting sex-dependent effects on elevation of the TG:HDL-C ratio as well as the increased risk for MS. PMID:24618354

Transcriptome analysis of Capsicum annuum varieties Mandarin and Blackcluster: assembly, annotation and molecular marker discovery.

PubMed

Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Cho, Young-Il; Lee, Hye-Eun; Kim, Do-Sun; Woo, Jong-Gyu; Cho, Myeong-Cheoul

2014-01-10

Next generation sequencing technologies have proven to be a rapid and cost-effective means to assemble and characterize gene content and identify molecular markers in various organisms. Pepper (Capsicum annuum L., Solanaceae) is a major staple vegetable crop, which is economically important and has worldwide distribution. High-throughput transcriptome profiling of two pepper cultivars, Mandarin and Blackcluster, using 454 GS-FLX pyrosequencing yielded 279,221 and 316,357 sequenced reads with a total 120.44 and 142.54Mb of sequence data (average read length of 431 and 450 nucleotides). These reads resulted from 17,525 and 16,341 'isogroups' and were assembled into 19,388 and 18,057 isotigs, and 22,217 and 13,153 singletons for both the cultivars, respectively. Assembled sequences were annotated functionally based on homology to genes in multiple public databases. Detailed sequence variant analysis identified a total of 9701 and 12,741 potential SNPs which eventually resulted in 1025 and 1059 genotype specific SNPs, for both the varieties, respectively, after examining SNP frequency distribution for each mapped unigenes. These markers for pepper will be highly valuable for marker-assisted breeding and other genetic studies. © 2013 Elsevier B.V. All rights reserved.

Trans-ancestry genome-wide association study identifies 12 genetic loci influencing blood pressure and implicates a role for DNA methylation

PubMed Central

Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James

2016-01-01

We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057

Trans-ancestry genome-wide association study identifies 12 genetic loci influencing blood pressure and implicates a role for DNA methylation.

PubMed

Kato, Norihiro; Loh, Marie; Takeuchi, Fumihiko; Verweij, Niek; Wang, Xu; Zhang, Weihua; Kelly, Tanika N; Saleheen, Danish; Lehne, Benjamin; Leach, Irene Mateo; Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian'an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; Kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James; Teo, Yik-Ying; He, Jiang; Elliott, Paul; Tai, E Shyong; van der Harst, Pim; Kooner, Jaspal S; Chambers, John C

2015-11-01

We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10(-11) to 5.0 × 10(-21)). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10(-6)). Our results provide new evidence for the role of DNA methylation in blood pressure regulation.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Genome-wide association analysis for feed efficiency in Angus cattle.

PubMed

Rolf, M M; Taylor, J F; Schnabel, R D; McKay, S D; McClure, M C; Northcutt, S L; Kerley, M S; Weaber, R L

2012-08-01

Estimated breeding values for average daily feed intake (AFI; kg/day), residual feed intake (RFI; kg/day) and average daily gain (ADG; kg/day) were generated using a mixed linear model incorporating genomic relationships for 698 Angus steers genotyped with the Illumina BovineSNP50 assay. Association analyses of estimated breeding values (EBVs) were performed for 41,028 single nucleotide polymorphisms (SNPs), and permutation analysis was used to empirically establish the genome-wide significance threshold (P < 0.05) for each trait. SNPs significantly associated with each trait were used in a forward selection algorithm to identify genomic regions putatively harbouring genes with effects on each trait. A total of 53, 66 and 68 SNPs explained 54.12% (24.10%), 62.69% (29.85%) and 55.13% (26.54%) of the additive genetic variation (when accounting for the genomic relationships) in steer breeding values for AFI, RFI and ADG, respectively, within this population. Evaluation by pathway analysis revealed that many of these SNPs are in genomic regions that harbour genes with metabolic functions. The presence of genetic correlations between traits resulted in 13.2% of SNPs selected for AFI and 4.5% of SNPs selected for RFI also being selected for ADG in the analysis of breeding values. While our study identifies panels of SNPs significant for efficiency traits in our population, validation of all SNPs in independent populations will be necessary before commercialization. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

Spectroscopic and microscopic characterization of silver nanoparticles synthesized using Justicia adhatoda flower

NASA Astrophysics Data System (ADS)

Singh, Tej; Shekhawat, Dharmender Singh; Jyoti, Kumari

2018-05-01

The synthesis of silver nanoparticles (SNPs) by chemical and physical methods produce harmful products which may cause various environmental problems, thus, there is an increasing demand to use ecofriendly methods. Therefore, biosynthesis of SNPs using Justicia adhatoda flower extract is demonstrated in the present study. The biosynthesized SNPs were characterized by UV-visible spectroscopy, Fourier transform-infrared spectroscopy (FTIR), transmission electron microscopy (TEM), selected area electron diffraction (SAED) and atomic force microscopy (AFM) analysis. The result of UV-visible spectroscopy peaked at 417 nm corresponding to the plasmon absorbance of SNPs. The TEM and SAED result reveals the crystalline nature of SNPs. FTIR spectroscopy used to identify the possible biomolecules responsible for the conversion of silver ions to SNPs. The study concluded that Justicia adhatoda flower extract act as an excellent reducing agent and the green synthesized SNPs are safer to the environment.

A Drosophila model for toxicogenomics: Genetic variation in susceptibility to heavy metal exposure

PubMed Central

Luoma, Sarah E.; St. Armour, Genevieve E.; Thakkar, Esha

2017-01-01

The genetic factors that give rise to variation in susceptibility to environmental toxins remain largely unexplored. Studies on genetic variation in susceptibility to environmental toxins are challenging in human populations, due to the variety of clinical symptoms and difficulty in determining which symptoms causally result from toxic exposure; uncontrolled environments, often with exposure to multiple toxicants; and difficulty in relating phenotypic effect size to toxic dose, especially when symptoms become manifest with a substantial time lag. Drosophila melanogaster is a powerful model that enables genome-wide studies for the identification of allelic variants that contribute to variation in susceptibility to environmental toxins, since the genetic background, environmental rearing conditions and toxic exposure can be precisely controlled. Here, we used extreme QTL mapping in an outbred population derived from the D. melanogaster Genetic Reference Panel to identify alleles associated with resistance to lead and/or cadmium, two ubiquitous environmental toxins that present serious health risks. We identified single nucleotide polymorphisms (SNPs) associated with variation in resistance to both heavy metals as well as SNPs associated with resistance specific to each of them. The effects of these SNPs were largely sex-specific. We applied mutational and RNAi analyses to 33 candidate genes and functionally validated 28 of them. We constructed networks of candidate genes as blueprints for orthologous networks of human genes. The latter not only provided functional contexts for known human targets of heavy metal toxicity, but also implicated novel candidate susceptibility genes. These studies validate Drosophila as a translational toxicogenomics gene discovery system. PMID:28732062

Pathways-Driven Sparse Regression Identifies Pathways and Genes Associated with High-Density Lipoprotein Cholesterol in Two Asian Cohorts

PubMed Central

Silver, Matt; Chen, Peng; Li, Ruoying; Cheng, Ching-Yu; Wong, Tien-Yin; Tai, E-Shyong; Teo, Yik-Ying; Montana, Giovanni

2013-01-01

Standard approaches to data analysis in genome-wide association studies (GWAS) ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs) or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK signalling and immune function. PMID:24278029

Pathways-driven sparse regression identifies pathways and genes associated with high-density lipoprotein cholesterol in two Asian cohorts.

PubMed

Silver, Matt; Chen, Peng; Li, Ruoying; Cheng, Ching-Yu; Wong, Tien-Yin; Tai, E-Shyong; Teo, Yik-Ying; Montana, Giovanni

2013-11-01

Standard approaches to data analysis in genome-wide association studies (GWAS) ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs) or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK signalling and immune function.

A statistical method for the detection of variants from next-generation resequencing of DNA pools.

PubMed

Bansal, Vikas

2010-06-15

Next-generation sequencing technologies have enabled the sequencing of several human genomes in their entirety. However, the routine resequencing of complete genomes remains infeasible. The massive capacity of next-generation sequencers can be harnessed for sequencing specific genomic regions in hundreds to thousands of individuals. Sequencing-based association studies are currently limited by the low level of multiplexing offered by sequencing platforms. Pooled sequencing represents a cost-effective approach for studying rare variants in large populations. To utilize the power of DNA pooling, it is important to accurately identify sequence variants from pooled sequencing data. Detection of rare variants from pooled sequencing represents a different challenge than detection of variants from individual sequencing. We describe a novel statistical approach, CRISP [Comprehensive Read analysis for Identification of Single Nucleotide Polymorphisms (SNPs) from Pooled sequencing] that is able to identify both rare and common variants by using two approaches: (i) comparing the distribution of allele counts across multiple pools using contingency tables and (ii) evaluating the probability of observing multiple non-reference base calls due to sequencing errors alone. Information about the distribution of reads between the forward and reverse strands and the size of the pools is also incorporated within this framework to filter out false variants. Validation of CRISP on two separate pooled sequencing datasets generated using the Illumina Genome Analyzer demonstrates that it can detect 80-85% of SNPs identified using individual sequencing while achieving a low false discovery rate (3-5%). Comparison with previous methods for pooled SNP detection demonstrates the significantly lower false positive and false negative rates for CRISP. Implementation of this method is available at http://polymorphism.scripps.edu/~vbansal/software/CRISP/.

Genome wide association study and genomic prediction for fatty acid composition in Chinese Simmental beef cattle using high density SNP array.

PubMed

Zhu, Bo; Niu, Hong; Zhang, Wengang; Wang, Zezhao; Liang, Yonghu; Guan, Long; Guo, Peng; Chen, Yan; Zhang, Lupei; Guo, Yong; Ni, Heming; Gao, Xue; Gao, Huijiang; Xu, Lingyang; Li, Junya

2017-06-14

Fatty acid composition of muscle is an important trait contributing to meat quality. Recently, genome-wide association study (GWAS) has been extensively used to explore the molecular mechanism underlying important traits in cattle. In this study, we performed GWAS using high density SNP array to analyze the association between SNPs and fatty acids and evaluated the accuracy of genomic prediction for fatty acids in Chinese Simmental cattle. Using the BayesB method, we identified 35 and 7 regions in Chinese Simmental cattle that displayed significant associations with individual fatty acids and fatty acid groups, respectively. We further obtained several candidate genes which may be involved in fatty acid biosynthesis including elongation of very long chain fatty acids protein 5 (ELOVL5), fatty acid synthase (FASN), caspase 2 (CASP2) and thyroglobulin (TG). Specifically, we obtained strong evidence of association signals for one SNP located at 51.3 Mb for FASN using Genome-wide Rapid Association Mixed Model and Regression-Genomic Control (GRAMMAR-GC) approaches. Also, region-based association test identified multiple SNPs within FASN and ELOVL5 for C14:0. In addition, our result revealed that the effectiveness of genomic prediction for fatty acid composition using BayesB was slightly superior over GBLUP in Chinese Simmental cattle. We identified several significantly associated regions and loci which can be considered as potential candidate markers for genomics-assisted breeding programs. Using multiple methods, our results revealed that FASN and ELOVL5 are associated with fatty acids with strong evidence. Our finding also suggested that it is feasible to perform genomic selection for fatty acids in Chinese Simmental cattle.

Multiple testing and power calculations in genetic association studies.

PubMed

So, Hon-Cheong; Sham, Pak C

2011-01-01

Modern genetic association studies typically involve multiple single-nucleotide polymorphisms (SNPs) and/or multiple genes. With the development of high-throughput genotyping technologies and the reduction in genotyping cost, investigators can now assay up to a million SNPs for direct or indirect association with disease phenotypes. In addition, some studies involve multiple disease or related phenotypes and use multiple methods of statistical analysis. The combination of multiple genetic loci, multiple phenotypes, and multiple methods of evaluating associations between genotype and phenotype means that modern genetic studies often involve the testing of an enormous number of hypotheses. When multiple hypothesis tests are performed in a study, there is a risk of inflation of the type I error rate (i.e., the chance of falsely claiming an association when there is none). Several methods for multiple-testing correction are in popular use, and they all have strengths and weaknesses. Because no single method is universally adopted or always appropriate, it is important to understand the principles, strengths, and weaknesses of the methods so that they can be applied appropriately in practice. In this article, we review the three principle methods for multiple-testing correction and provide guidance for calculating statistical power.

Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

USDA-ARS?s Scientific Manuscript database

The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

Single Marker and Haplotype-Based Association Analysis of Semolina and Pasta Colour in Elite Durum Wheat Breeding Lines Using a High-Density Consensus Map.

PubMed

N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J

2017-01-01

Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype-based analysis over single marker analysis to detect loci associated with colour traits in durum wheat.

Combined sequence and sequence-structure-based methods for analyzing RAAS gene SNPs: a computational approach.

PubMed

Singh, Kh Dhanachandra; Karthikeyan, Muthusamy

2014-12-01

The renin-angiotensin-aldosterone system (RAAS) plays a key role in the regulation of blood pressure (BP). Mutations on the genes that encode components of the RAAS have played a significant role in genetic susceptibility to hypertension and have been intensively scrutinized. The identification of such probably causal mutations not only provides insight into the RAAS but may also serve as antihypertensive therapeutic targets and diagnostic markers. The methods for analyzing the SNPs from the huge dataset of SNPs, containing both functional and neutral SNPs is challenging by the experimental approach on every SNPs to determine their biological significance. To explore the functional significance of genetic mutation (SNPs), we adopted combined sequence and sequence-structure-based SNP analysis algorithm. Out of 3864 SNPs reported in dbSNP, we found 108 missense SNPs in the coding region and remaining in the non-coding region. In this study, we are reporting only those SNPs in coding region to be deleterious when three or more tools are predicted to be deleterious and which have high RMSD from the native structure. Based on these analyses, we have identified two SNPs of REN gene, eight SNPs of AGT gene, three SNPs of ACE gene, two SNPs of AT1R gene, three SNPs of CYP11B2 gene and three SNPs of CMA1 gene in the coding region were found to be deleterious. Further this type of study will be helpful in reducing the cost and time for identification of potential SNP and also helpful in selecting potential SNP for experimental study out of SNP pool.

QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

PubMed

Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

2017-08-01

Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

PubMed Central

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-01-01

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

PubMed

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-12-23

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Analysis of Genome-Wide Association Studies with Multiple Outcomes Using Penalization

PubMed Central

Liu, Jin; Huang, Jian; Ma, Shuangge

2012-01-01

Genome-wide association studies have been extensively conducted, searching for markers for biologically meaningful outcomes and phenotypes. Penalization methods have been adopted in the analysis of the joint effects of a large number of SNPs (single nucleotide polymorphisms) and marker identification. This study is partly motivated by the analysis of heterogeneous stock mice dataset, in which multiple correlated phenotypes and a large number of SNPs are available. Existing penalization methods designed to analyze a single response variable cannot accommodate the correlation among multiple response variables. With multiple response variables sharing the same set of markers, joint modeling is first employed to accommodate the correlation. The group Lasso approach is adopted to select markers associated with all the outcome variables. An efficient computational algorithm is developed. Simulation study and analysis of the heterogeneous stock mice dataset show that the proposed method can outperform existing penalization methods. PMID:23272092

Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

PubMed

Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

2017-06-14

Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

Finding missing heritability in less significant Loci and allelic heterogeneity: genetic variation in human height.

PubMed

Zhang, Ge; Karns, Rebekah; Sun, Guangyun; Indugula, Subba Rao; Cheng, Hong; Havas-Augustin, Dubravka; Novokmet, Natalija; Durakovic, Zijad; Missoni, Sasa; Chakraborty, Ranajit; Rudan, Pavao; Deka, Ranjan

2012-01-01

Genome-wide association studies (GWAS) have identified many common variants associated with complex traits in human populations. Thus far, most reported variants have relatively small effects and explain only a small proportion of phenotypic variance, leading to the issues of 'missing' heritability and its explanation. Using height as an example, we examined two possible sources of missing heritability: first, variants with smaller effects whose associations with height failed to reach genome-wide significance and second, allelic heterogeneity due to the effects of multiple variants at a single locus. Using a novel analytical approach we examined allelic heterogeneity of height-associated loci selected from SNPs of different significance levels based on the summary data of the GIANT (stage 1) studies. In a sample of 1,304 individuals collected from an island population of the Adriatic coast of Croatia, we assessed the extent of height variance explained by incorporating the effects of less significant height loci and multiple effective SNPs at the same loci. Our results indicate that approximately half of the 118 loci that achieved stringent genome-wide significance (p-value<5×10(-8)) showed evidence of allelic heterogeneity. Additionally, including less significant loci (i.e., p-value<5×10(-4)) and accounting for effects of allelic heterogeneity substantially improved the variance explained in height.

Planar Cell Polarity Pathway Genes and Risk for Spina Bifida

PubMed Central

Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E.; Shaw, Gary M.; Lammer, Edward J.; Finnell, Richard H.

2009-01-01

Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologues of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled and Scrib, two of the homologues of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologues of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted p value<0.01. In conclusion our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. PMID:20101694

De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes

PubMed Central

2012-01-01

Background Molecular breeding of pepper (Capsicum spp.) can be accelerated by developing DNA markers associated with transcriptomes in breeding germplasm. Before the advent of next generation sequencing (NGS) technologies, the majority of sequencing data were generated by the Sanger sequencing method. By leveraging Sanger EST data, we have generated a wealth of genetic information for pepper including thousands of SNPs and Single Position Polymorphic (SPP) markers. To complement and enhance these resources, we applied NGS to three pepper genotypes: Maor, Early Jalapeño and Criollo de Morelos-334 (CM334) to identify SNPs and SSRs in the assembly of these three genotypes. Results Two pepper transcriptome assemblies were developed with different purposes. The first reference sequence, assembled by CAP3 software, comprises 31,196 contigs from >125,000 Sanger-EST sequences that were mainly derived from a Korean F1-hybrid line, Bukang. Overlapping probes were designed for 30,815 unigenes to construct a pepper Affymetrix GeneChip® microarray for whole genome analyses. In addition, custom Python scripts were used to identify 4,236 SNPs in contigs of the assembly. A total of 2,489 simple sequence repeats (SSRs) were identified from the assembly, and primers were designed for the SSRs. Annotation of contigs using Blast2GO software resulted in information for 60% of the unigenes in the assembly. The second transcriptome assembly was constructed from more than 200 million Illumina Genome Analyzer II reads (80–120 nt) using a combination of Velvet, CLC workbench and CAP3 software packages. BWA, SAMtools and in-house Perl scripts were used to identify SNPs among three pepper genotypes. The SNPs were filtered to be at least 50 bp from any intron-exon junctions as well as flanking SNPs. More than 22,000 high-quality putative SNPs were identified. Using the MISA software, 10,398 SSR markers were also identified within the Illumina transcriptome assembly and primers were designed for the identified markers. The assembly was annotated by Blast2GO and 14,740 (12%) of annotated contigs were associated with functional proteins. Conclusions Before availability of pepper genome sequence, assembling transcriptomes of this economically important crop was required to generate thousands of high-quality molecular markers that could be used in breeding programs. In order to have a better understanding of the assembled sequences and to identify candidate genes underlying QTLs, we annotated the contigs of Sanger-EST and Illumina transcriptome assemblies. These and other information have been curated in a database that we have dedicated for pepper project. PMID:23110314

Genome-Wide Association Study Identifies Novel Loci Associated With Diisocyanate-Induced Occupational Asthma

PubMed Central

Yucesoy, Berran; Kaufman, Kenneth M.; Lummus, Zana L.; Weirauch, Matthew T.; Zhang, Ge; Cartier, André; Boulet, Louis-Philippe; Sastre, Joaquin; Quirce, Santiago; Tarlo, Susan M.; Cruz, Maria-Jesus; Munoz, Xavier; Harley, John B.; Bernstein, David I.

2015-01-01

Diisocyanates, reactive chemicals used to produce polyurethane products, are the most common causes of occupational asthma. The aim of this study is to identify susceptibility gene variants that could contribute to the pathogenesis of diisocyanate asthma (DA) using a Genome-Wide Association Study (GWAS) approach. Genome-wide single nucleotide polymorphism (SNP) genotyping was performed in 74 diisocyanate-exposed workers with DA and 824 healthy controls using Omni-2.5 and Omni-5 SNP microarrays. We identified 11 SNPs that exceeded genome-wide significance; the strongest association was for the rs12913832 SNP located on chromosome 15, which has been mapped to the HERC2 gene (p = 6.94 × 10−14). Strong associations were also found for SNPs near the ODZ3 and CDH17 genes on chromosomes 4 and 8 (rs908084, p = 8.59 × 10−9 and rs2514805, p = 1.22 × 10−8, respectively). We also prioritized 38 SNPs with suggestive genome-wide significance (p < 1 × 10−6). Among them, 17 SNPs map to the PITPNC1, ACMSD, ZBTB16, ODZ3, and CDH17 gene loci. Functional genomics data indicate that 2 of the suggestive SNPs (rs2446823 and rs2446824) are located within putative binding sites for the CCAAT/Enhancer Binding Protein (CEBP) and Hepatocyte Nuclear Factor 4, Alpha transcription factors (TFs), respectively. This study identified SNPs mapping to the HERC2, CDH17, and ODZ3 genes as potential susceptibility loci for DA. Pathway analysis indicated that these genes are associated with antigen processing and presentation, and other immune pathways. Overlap of 2 suggestive SNPs with likely TF binding sites suggests possible roles in disruption of gene regulation. These results provide new insights into the genetic architecture of DA and serve as a basis for future functional and mechanistic studies. PMID:25918132

Dissecting the genetics of the human transcriptome identifies novel trait-related trans-eQTLs and corroborates the regulatory relevance of non-protein coding loci†.

PubMed

Kirsten, Holger; Al-Hasani, Hoor; Holdt, Lesca; Gross, Arnd; Beutner, Frank; Krohn, Knut; Horn, Katrin; Ahnert, Peter; Burkhardt, Ralph; Reiche, Kristin; Hackermüller, Jörg; Löffler, Markus; Teupser, Daniel; Thiery, Joachim; Scholz, Markus

2015-08-15

Genetics of gene expression (eQTLs or expression QTLs) has proved an indispensable tool for understanding biological pathways and pathomechanisms of trait-associated SNPs. However, power of most genome-wide eQTL studies is still limited. We performed a large eQTL study in peripheral blood mononuclear cells of 2112 individuals increasing the power to detect trans-effects genome-wide. Going beyond univariate SNP-transcript associations, we analyse relations of eQTLs to biological pathways, polygenetic effects of expression regulation, trans-clusters and enrichment of co-localized functional elements. We found eQTLs for about 85% of analysed genes, and 18% of genes were trans-regulated. Local eSNPs were enriched up to a distance of 5 Mb to the transcript challenging typically implemented ranges of cis-regulations. Pathway enrichment within regulated genes of GWAS-related eSNPs supported functional relevance of identified eQTLs. We demonstrate that nearest genes of GWAS-SNPs might frequently be misleading functional candidates. We identified novel trans-clusters of potential functional relevance for GWAS-SNPs of several phenotypes including obesity-related traits, HDL-cholesterol levels and haematological phenotypes. We used chromatin immunoprecipitation data for demonstrating biological effects. Yet, we show for strongly heritable transcripts that still little trans-chromosomal heritability is explained by all identified trans-eSNPs; however, our data suggest that most cis-heritability of these transcripts seems explained. Dissection of co-localized functional elements indicated a prominent role of SNPs in loci of pseudogenes and non-coding RNAs for the regulation of coding genes. In summary, our study substantially increases the catalogue of human eQTLs and improves our understanding of the complex genetic regulation of gene expression, pathways and disease-related processes. © The Author 2015. Published by Oxford University Press.

Genome-wide association study of sporadic brain arteriovenous malformations.

PubMed

Weinsheimer, Shantel; Bendjilali, Nasrine; Nelson, Jeffrey; Guo, Diana E; Zaroff, Jonathan G; Sidney, Stephen; McCulloch, Charles E; Al-Shahi Salman, Rustam; Berg, Jonathan N; Koeleman, Bobby P C; Simon, Matthias; Bostroem, Azize; Fontanella, Marco; Sturiale, Carmelo L; Pola, Roberto; Puca, Alfredo; Lawton, Michael T; Young, William L; Pawlikowska, Ludmila; Klijn, Catharina J M; Kim, Helen

2016-09-01

The pathogenesis of sporadic brain arteriovenous malformations (BAVMs) remains unknown, but studies suggest a genetic component. We estimated the heritability of sporadic BAVM and performed a genome-wide association study (GWAS) to investigate association of common single nucleotide polymorphisms (SNPs) with risk of sporadic BAVM in the international, multicentre Genetics of Arteriovenous Malformation (GEN-AVM) consortium. The Caucasian discovery cohort included 515 BAVM cases and 1191 controls genotyped using Affymetrix genome-wide SNP arrays. Genotype data were imputed to 1000 Genomes Project data, and well-imputed SNPs (>0.01 minor allele frequency) were analysed for association with BAVM. 57 top BAVM-associated SNPs (51 SNPs with p<10(-05) or p<10(-04) in candidate pathway genes, and 6 candidate BAVM SNPs) were tested in a replication cohort including 608 BAVM cases and 744 controls. The estimated heritability of BAVM was 17.6% (SE 8.9%, age and sex-adjusted p=0.015). None of the SNPs were significantly associated with BAVM in the replication cohort after correction for multiple testing. 6 SNPs had a nominal p<0.1 in the replication cohort and map to introns in EGFEM1P, SP4 and CDKAL1 or near JAG1 and BNC2. Of the 6 candidate SNPs, 2 in ACVRL1 and MMP3 had a nominal p<0.05 in the replication cohort. We performed the first GWAS of sporadic BAVM in the largest BAVM cohort assembled to date. No GWAS SNPs were replicated, suggesting that common SNPs do not contribute strongly to BAVM susceptibility. However, heritability estimates suggest a modest but significant genetic contribution. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

PubMed Central

Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

2009-01-01

Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

Genome-wide analysis of central corneal thickness in primary open-angle glaucoma cases in the NEIGHBOR and GLAUGEN consortia.

PubMed

Ulmer, Megan; Li, Jun; Yaspan, Brian L; Ozel, Ayse Bilge; Richards, Julia E; Moroi, Sayoko E; Hawthorne, Felicia; Budenz, Donald L; Friedman, David S; Gaasterland, Douglas; Haines, Jonathan; Kang, Jae H; Lee, Richard; Lichter, Paul; Liu, Yutao; Pasquale, Louis R; Pericak-Vance, Margaret; Realini, Anthony; Schuman, Joel S; Singh, Kuldev; Vollrath, Douglas; Weinreb, Robert; Wollstein, Gadi; Zack, Donald J; Zhang, Kang; Young, Terri; Allingham, R Rand; Wiggs, Janey L; Ashley-Koch, Allison; Hauser, Michael A

2012-07-03

To investigate the effects of central corneal thickness (CCT)-associated variants on primary open-angle glaucoma (POAG) risk using single nucleotide polymorphisms (SNP) data from the Glaucoma Genes and Environment (GLAUGEN) and National Eye Institute (NEI) Glaucoma Human Genetics Collaboration (NEIGHBOR) consortia. A replication analysis of previously reported CCT SNPs was performed in a CCT dataset (n = 1117) and these SNPs were then tested for association with POAG using a larger POAG dataset (n = 6470). Then a CCT genome-wide association study (GWAS) was performed. Top SNPs from this analysis were selected and tested for association with POAG. cDNA libraries from fetal and adult brain and ocular tissue samples were generated and used for candidate gene expression analysis. Association with one of 20 previously published CCT SNPs was replicated: rs12447690, near the ZNF469 gene (P = 0.001; β = -5.08 μm/allele). None of these SNPs were significantly associated with POAG. In the CCT GWAS, no SNPs reached genome-wide significance. After testing 50 candidate SNPs for association with POAG, one SNP was identified, rs7481514 within the neurotrimin (NTM) gene, that was significantly associated with POAG in a low-tension subset (P = 0.00099; Odds Ratio [OR] = 1.28). Additionally, SNPs in the CNTNAP4 gene showed suggestive association with POAG (top SNP = rs1428758; P = 0.018; OR = 0.84). NTM and CNTNAP4 were shown to be expressed in ocular tissues. The results suggest previously reported CCT loci are not significantly associated with POAG susceptibility. By performing a quantitative analysis of CCT and a subsequent analysis of POAG, SNPs in two cell adhesion molecules, NTM and CNTNAP4, were identified and may increase POAG susceptibility in a subset of cases.

Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

PubMed

Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

2018-04-01

To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Mining sequence variations in representative polyploid sugarcane germplasm accessions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiping; Song, Jian; You, Qian

Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

Mining sequence variations in representative polyploid sugarcane germplasm accessions

DOE PAGES

Yang, Xiping; Song, Jian; You, Qian; ...

2017-08-09

Sugarcane (Saccharum spp.) is one of the most important economic crops because of its high sugar production and biofuel potential. Due to the high polyploid level and complex genome of sugarcane, it has been a huge challenge to investigate genomic sequence variations, which are critical for identifying alleles contributing to important agronomic traits. In order to mine the genetic variations in sugarcane, genotyping by sequencing (GBS), was used to genotype 14 representative Saccharum complex accessions. GBS is a method to generate a large number of markers, enabled by next generation sequencing (NGS) and the genome complexity reduction using restriction enzymes.more » To use GBS for high throughput genotyping highly polyploid sugarcane, the GBS analysis pipelines in 14 Saccharum complex accessions were established by evaluating different alignment methods, sequence variants callers, and sequence depth for single nucleotide polymorphism (SNP) filtering. By using the established pipeline, a total of 76,251 non-redundant SNPs, 5642 InDels, 6380 presence/absence variants (PAVs), and 826 copy number variations (CNVs) were detected among the 14 accessions. In addition, non-reference based universal network enabled analysis kit and Stacks de novo called 34,353 and 109,043 SNPs, respectively. In the 14 accessions, the percentages of single dose SNPs ranged from 38.3% to 62.3% with an average of 49.6%, much more than the portions of multiple dosage SNPs. Concordantly called SNPs were used to evaluate the phylogenetic relationship among the 14 accessions. The results showed that the divergence time between the Erianthus genus and the Saccharum genus was more than 10 million years ago (MYA). The Saccharum species separated from their common ancestors ranging from 0.19 to 1.65 MYA. The GBS pipelines including the reference sequences, alignment methods, sequence variant callers, and sequence depth were recommended and discussed for the Saccharum complex and other related species. A large number of sequence variations were discovered in the Saccharum complex, including SNPs, InDels, PAVs, and CNVs. Genome-wide SNPs were further used to illustrate sequence features of polyploid species and demonstrated the divergence of different species in the Saccharum complex. The results of this study showed that GBS was an effective NGS-based method to discover genomic sequence variations in highly polyploid and heterozygous species.« less

SNPassoc: an R package to perform whole genome association studies.

PubMed

González, Juan R; Armengol, Lluís; Solé, Xavier; Guinó, Elisabet; Mercader, Josep M; Estivill, Xavier; Moreno, Víctor

2007-03-01

The popularization of large-scale genotyping projects has led to the widespread adoption of genetic association studies as the tool of choice in the search for single nucleotide polymorphisms (SNPs) underlying susceptibility to complex diseases. Although the analysis of individual SNPs is a relatively trivial task, when the number is large and multiple genetic models need to be explored it becomes necessary a tool to automate the analyses. In order to address this issue, we developed SNPassoc, an R package to carry out most common analyses in whole genome association studies. These analyses include descriptive statistics and exploratory analysis of missing values, calculation of Hardy-Weinberg equilibrium, analysis of association based on generalized linear models (either for quantitative or binary traits), and analysis of multiple SNPs (haplotype and epistasis analysis). Package SNPassoc is available at CRAN from http://cran.r-project.org. A tutorial is available on Bioinformatics online and in http://davinci.crg.es/estivill_lab/snpassoc.

mQTL-seq delineates functionally relevant candidate gene harbouring a major QTL regulating pod number in chickpea

PubMed Central

Das, Shouvik; Singh, Mohar; Srivastava, Rishi; Bajaj, Deepak; Saxena, Maneesha S.; Rana, Jai C.; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.

2016-01-01

The present study used a whole-genome, NGS resequencing-based mQTL-seq (multiple QTL-seq) strategy in two inter-specific mapping populations (Pusa 1103 × ILWC 46 and Pusa 256 × ILWC 46) to scan the major genomic region(s) underlying QTL(s) governing pod number trait in chickpea. Essentially, the whole-genome resequencing of low and high pod number-containing parental accessions and homozygous individuals (constituting bulks) from each of these two mapping populations discovered >8 million high-quality homozygous SNPs with respect to the reference kabuli chickpea. The functional significance of the physically mapped SNPs was apparent from the identified 2,264 non-synonymous and 23,550 regulatory SNPs, with 8–10% of these SNPs-carrying genes corresponding to transcription factors and disease resistance-related proteins. The utilization of these mined SNPs in Δ (SNP index)-led QTL-seq analysis and their correlation between two mapping populations based on mQTL-seq, narrowed down two (CaqaPN4.1: 867.8 kb and CaqaPN4.2: 1.8 Mb) major genomic regions harbouring robust pod number QTLs into the high-resolution short QTL intervals (CaqbPN4.1: 637.5 kb and CaqbPN4.2: 1.28 Mb) on chickpea chromosome 4. The integration of mQTL-seq-derived one novel robust QTL with QTL region-specific association analysis delineated the regulatory (C/T) and coding (C/A) SNPs-containing one pentatricopeptide repeat (PPR) gene at a major QTL region regulating pod number in chickpea. This target gene exhibited anther, mature pollen and pod-specific expression, including pronounced higher up-regulated (∼3.5-folds) transcript expression in high pod number-containing parental accessions and homozygous individuals of two mapping populations especially during pollen and pod development. The proposed mQTL-seq-driven combinatorial strategy has profound efficacy in rapid genome-wide scanning of potential candidate gene(s) underlying trait-associated high-resolution robust QTL(s), thereby expediting genomics-assisted breeding and genetic enhancement of crop plants, including chickpea. PMID:26685680

Contribution of Common Genetic Variants to Obesity and Obesity-Related Traits in Mexican Children and Adults

PubMed Central

Villalobos-Comparán, Marisela; Villarreal-Molina, Teresa; Romero-Hidalgo, Sandra; López-Contreras, Blanca; Gutiérrez-Vidal, Roxana; Vega-Badillo, Joel; Jacobo-Albavera, Leonor; Posadas-Romeros, Carlos; Canizalez-Román, Adrián; Río-Navarro, Blanca Del; Campos-Pérez, Francisco; Acuña-Alonzo, Victor; Aguilar-Salinas, Carlos; Canizales-Quinteros, Samuel

2013-01-01

Background Several studies have identified multiple obesity-associated loci mainly in European populations. However, their contribution to obesity in other ethnicities such as Mexicans is largely unknown. The aim of this study was to examine 26 obesity-associated single-nucleotide polymorphisms (SNP) in a sample of Mexican mestizos. Methods 9 SNPs in biological candidate genes showing replications (PPARG, ADRB3, ADRB2, LEPR, GNB3, UCP3, ADIPOQ, UCP2, and NR3C1), and 17 SNPs in or near genes associated with obesity in first, second and third wave GWAS (INSIG2, FTO, MC4R, TMEM18, FAIM2/BCDIN3, BDNF, SH2B1, GNPDA2, NEGR1, KCTD15, SEC16B/RASAL2, NPC1, SFRF10/ETV5, MAF, PRL, MTCH2, and PTER) were genotyped in 1,156 unrelated Mexican-Mestizos including 683 cases (441 obese class I/II and 242 obese class III) and 473 normal-weight controls. In a second stage we selected 12 of the SNPs showing nominal associations with obesity, to seek associations with quantitative obesity-related traits in 3 cohorts including 1,218 Mexican Mestizo children, 945 Mexican Mestizo adults, and 543 Indigenous Mexican adults. Results After adjusting for age, sex and admixture, significant associations with obesity were found for 6 genes in the case-control study (ADIPOQ, FTO, TMEM18, INSIG2, FAIM2/BCDIN3 and BDNF). In addition, SH2B1 was associated only with class I/II obesity and MC4R only with class III obesity. SNPs located at or near FAIM2/BCDIN3, TMEM18, INSIG2, GNPDA2 and SEC16B/RASAL2 were significantly associated with BMI and/or WC in the combined analysis of Mexican-mestizo children and adults, and FTO locus was significantly associated with increased BMI in Indigenous Mexican populations. Conclusions Our findings replicate the association of 8 obesity-related SNPs with obesity risk in Mexican adults, and confirm the role of some of these SNPs in BMI in Mexican adults and children. PMID:23950976

The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

PubMed

Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

2012-01-01

DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

Role of genetic & environment risk factors in the aetiology of colorectal cancer in Malaysia.

PubMed

Ramzi, Nurul Hanis; Chahil, Jagdish Kaur; Lye, Say Hean; Munretnam, Khamsigan; Sahadevappa, Kavitha Itagi; Velapasamy, Sharmila; Hashim, Nikman Adli Nor; Cheah, Soon Keat; Lim, Gerard Chin Chye; Hussein, Heselynn; Haron, Mohd Roslan; Alex, Livy; Ler, Lian Wee

2014-06-01

Colorectal cancer (CRC) is second only to breast cancer as the leading cause of cancer-related deaths in Malaysia. In the Asia-Pacific area, it is the highest emerging gastrointestinal cancer. The aim of this study was to identify single nucleotide polymorphisms (SNPs) and environmental factors associated with CRC risk in Malaysia from a panel of cancer associated SNPs. In this case-control study, 160 Malaysian subjects were recruited, including both with CRC and controls. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. Genotyping was carried out using Illumina's BeadArray platform. Information on blood group, occupation, medical history, family history of cancer, intake of red meat and vegetables, exposure to radiation, smoking and drinking habits, etc was collected. Odds ratio (OR), 95% confidence interval (CI) were calculated. A panel of 23 SNPs significantly associated with colorectal cancer risk was identified (P<0.01). Of these, 12 SNPs increased the risk of CRC and 11 reduced the risk. Among the environmental risk factors investigated, high intake of red meat (more than 50% daily proportion) was found to be significantly associated with increased risk of CRC (OR=6.52, 95% CI :1.93-2.04, P=0.003). Two SNPs including rs2069521 and rs10046 in genes of cytochrome P450 (CYP) superfamily were found significantly associated with CRC risk. For gene-environment analysis, the A allele of rs2069521 showed a significant association with CRC risk when stratified by red meat intake. In this preliminary study, a panel of SNPs found to be significantly associated with CRC in Malaysian population, was identified. Also, red meat consumption and lack of physical exercise were risk factors for CRC, while consumption of fruits and vegetables served as protective factor.

Identification of susceptible genes for complex chronic diseases based on disease risk functional SNPs and interaction networks.

PubMed

Li, Wan; Zhu, Lina; Huang, Hao; He, Yuehan; Lv, Junjie; Li, Weimin; Chen, Lina; He, Weiming

2017-10-01

Complex chronic diseases are caused by the effects of genetic and environmental factors. Single nucleotide polymorphisms (SNPs), one common type of genetic variations, played vital roles in diseases. We hypothesized that disease risk functional SNPs in coding regions and protein interaction network modules were more likely to contribute to the identification of disease susceptible genes for complex chronic diseases. This could help to further reveal the pathogenesis of complex chronic diseases. Disease risk SNPs were first recognized from public SNP data for coronary heart disease (CHD), hypertension (HT) and type 2 diabetes (T2D). SNPs in coding regions that were classified into nonsense and missense by integrating several SNP functional annotation databases were treated as functional SNPs. Then, regions significantly associated with each disease were screened using random permutations for disease risk functional SNPs. Corresponding to these regions, 155, 169 and 173 potential disease susceptible genes were identified for CHD, HT and T2D, respectively. A disease-related gene product interaction network in environmental context was constructed for interacting gene products of both disease genes and potential disease susceptible genes for these diseases. After functional enrichment analysis for disease associated modules, 5 CHD susceptible genes, 7 HT susceptible genes and 3 T2D susceptible genes were finally identified, some of which had pleiotropic effects. Most of these genes were verified to be related to these diseases in literature. This was similar for disease genes identified from another method proposed by Lee et al. from a different aspect. This research could provide novel perspectives for diagnosis and treatment of complex chronic diseases and susceptible genes identification for other diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children.

PubMed

Butte, Nancy F; Voruganti, V Saroja; Cole, Shelley A; Haack, Karin; Comuzzie, Anthony G; Muzny, Donna M; Wheeler, David A; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A

2011-09-22

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3'-UTR, and 2 in the 5'-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001-0.009) were associated with obesity-related traits (P = 0.01-0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77-0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children.

Single nucleotide polymorphisms for feed efficiency and performance in crossbred beef cattle

PubMed Central

2014-01-01

Background This study was conducted to: (1) identify new SNPs for residual feed intake (RFI) and performance traits within candidate genes identified in a genome wide association study (GWAS); (2) estimate the proportion of variation in RFI explained by the detected SNPs; (3) estimate the effects of detected SNPs on carcass traits to avoid undesirable correlated effects on these economically important traits when selecting for feed efficiency; and (4) map the genes to biological mechanisms and pathways. A total number of 339 SNPs corresponding to 180 genes were tested for association with phenotypes using a single locus regression (SLRM) and genotypic model on 726 and 990 crossbred animals for feed efficiency and carcass traits, respectively. Results Strong evidence of associations for RFI were located on chromosomes 8, 15, 16, 18, 19, 21, and 28. The strongest association with RFI (P = 0.0017) was found with a newly discovered SNP located on BTA 8 within the ELP3 gene. SNPs rs41820824 and rs41821600 on BTA 16 within the gene HMCN1 were strongly associated with RFI (P = 0.0064 and P = 0.0033, respectively). A SNP located on BTA 18 within the ZNF423 gene provided strong evidence for association with RFI (P = 0.0028). Genomic estimated breeding values (GEBV) from 98 significant SNPs were moderately correlated (0.47) to the estimated breeding values (EBVs) from a mixed animal model. The significant (P < 0.05) SNPs (98) explained 26% of the genetic variance for RFI. In silico functional analysis for the genes suggested 35 and 39 biological processes and pathways, respectively for feed efficiency traits. Conclusions This study identified several positional and functional candidate genes involved in important biological mechanisms associated with feed efficiency and performance. Significant SNPs should be validated in other populations to establish their potential utilization in genetic improvement programs. PMID:24476087

Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

PubMed

Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

2015-12-01

Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome-wide association studies. © 2015 American Heart Association, Inc.

Common genetic variants associated with disease from genome-wide association studies are mutually exclusive in prostate cancer and rheumatoid arthritis.

PubMed

Orozco, Gisela; Goh, Chee L; Al Olama, Ali Amin; Benlloch-Garcia, Sara; Govindasami, Koveela; Guy, Michelle; Muir, Kenneth R; Giles, Graham G; Severi, Gianluca; Neal, David E; Hamdy, Freddie C; Donovan, Jenny L; Kote-Jarai, Zsofia; Easton, Douglas F; Eyre, Steve; Eeles, Rosalind A

2013-06-01

WHAT'S KNOWN ON THE SUBJECT? AND WHAT DOES THE STUDY ADD?: The link between inflammation and cancer has long been reported and inflammation is thought to play a role in the pathogenesis of many cancers, including prostate cancer (PrCa). Over the last 5 years, genome-wide association studies (GWAS) have reported numerous susceptibility loci that predispose individuals to many different traits. The present study aims to ascertain if there are common genetic risk profiles that might predispose individuals to both PrCa and the autoimmune inflammatory condition, rheumatoid arthritis. These results could have potential public heath impact in terms of screening and chemoprevention. To investigate if potential common pathways exist for the pathogenesis of autoimmune disease and prostate cancer (PrCa). To ascertain if the single nucleotide polymorphisms (SNPs) reported by genome-wide association studies (GWAS) as being associated with susceptibility to PrCa are also associated with susceptibility to the autoimmune disease rheumatoid arthritis (RA). The original Wellcome Trust Case Control Consortium (WTCCC) UK RA GWAS study was expanded to include a total of 3221 cases and 5272 controls. In all, 37 germline autosomal SNPs at genome-wide significance associated with PrCa risk were identified from a UK/Australian PrCa GWAS. Allele frequencies were compared for these 37 SNPs between RA cases and controls using a chi-squared trend test and corrected for multiple testing (Bonferroni). In all, 33 SNPs were able to be analysed in the RA dataset. Proxies could not be located for the SNPs in 3q26, 5p15 and for two SNPs in 17q12. After applying a Bonferroni correction for the number of SNPs tested, the SNP mapping to CCHCR1 (rs130067) retained statistically significant evidence for association (P = 6 × 10(-4) ; odds ratio [OR] = 1.15, 95% CI: 1.06-1.24); this has also been associated with psoriasis. However, further analyses showed that the association of this allele was due to confounding by RA-associated HLA-DRB1 alleles. There is currently no evidence that SNPs associated with PrCa at genome-wide significance are associated with the development of RA. Studies like this are important in determining if common genetic risk profiles might predispose individuals to many diseases, which could have implications for public health in terms of screening and chemoprevention. © 2012 BJU International.

Genetic effects of PDGFRB and MARCH1 identified in GWAS revealing strong associations with semen production traits in Chinese Holstein bulls.

PubMed

Liu, Shuli; Yin, Hongwei; Li, Cong; Qin, Chunhua; Cai, Wentao; Cao, Mingyue; Zhang, Shengli

2017-07-03

Using a genome-wide association study strategy, our previous study discovered 19 significant single-nucleotide polymorphisms (SNPs) related to semen production traits in Chinese Holstein bulls. Among them, three SNPs were within or close to the phosphodiesterase 3A (PDE3A), membrane associated ring-CH-type finger 1 (MARCH1) and platelet derived growth factor receptor beta (PDGFRB) genes. The present study was designed with the objectives of identifying genetic polymorphism of the PDE3A, PDGFRB and MARCH1 genes and their effects on semen production traits in a Holstein bull population. A total of 20 SNPs were detected and genotyped in 730 bulls. Association analyses using de-regressed estimated breeding values of each semen production trait revealed four statistically significant SNPs for one or more semen production traits (P < 0.05): one SNP was located downstream of PDGFRB and three SNPs were located in the promoter of MARCH1. Interestingly, for MARCH1, haplotype-based analysis revealed significant associations of haplotypes with semen volume per ejaculate. Furthermore, high expression of the MARCH1 gene was observed in sperm cells. One SNP (rs43445726) in the regulatory region of MARCH1 had a significant effect on gene expression. Our study demonstrated the significant associations of genetic variants of the PDGFRB and MARCH1 genes with semen production traits. The identified SNPs may serve as genetic markers to optimize breeding programs for semen production traits in Holstein bull populations.

Prioritizing individual genetic variants after kernel machine testing using variable selection.

PubMed

He, Qianchuan; Cai, Tianxi; Liu, Yang; Zhao, Ni; Harmon, Quaker E; Almli, Lynn M; Binder, Elisabeth B; Engel, Stephanie M; Ressler, Kerry J; Conneely, Karen N; Lin, Xihong; Wu, Michael C

2016-12-01

Kernel machine learning methods, such as the SNP-set kernel association test (SKAT), have been widely used to test associations between traits and genetic polymorphisms. In contrast to traditional single-SNP analysis methods, these methods are designed to examine the joint effect of a set of related SNPs (such as a group of SNPs within a gene or a pathway) and are able to identify sets of SNPs that are associated with the trait of interest. However, as with many multi-SNP testing approaches, kernel machine testing can draw conclusion only at the SNP-set level, and does not directly inform on which one(s) of the identified SNP set is actually driving the associations. A recently proposed procedure, KerNel Iterative Feature Extraction (KNIFE), provides a general framework for incorporating variable selection into kernel machine methods. In this article, we focus on quantitative traits and relatively common SNPs, and adapt the KNIFE procedure to genetic association studies and propose an approach to identify driver SNPs after the application of SKAT to gene set analysis. Our approach accommodates several kernels that are widely used in SNP analysis, such as the linear kernel and the Identity by State (IBS) kernel. The proposed approach provides practically useful utilities to prioritize SNPs, and fills the gap between SNP set analysis and biological functional studies. Both simulation studies and real data application are used to demonstrate the proposed approach. © 2016 WILEY PERIODICALS, INC.

miRNA-Mediated Relationships between Cis-SNP Genotypes and Transcript Intensities in Lymphocyte Cell Lines

PubMed Central

Zhang, Wensheng; Edwards, Andrea; Zhu, Dongxiao; Flemington, Erik K.; Deininger, Prescott; Zhang, Kun

2012-01-01

In metazoans, miRNAs regulate gene expression primarily through binding to target sites in the 3′ UTRs (untranslated regions) of messenger RNAs (mRNAs). Cis-acting variants within, or close to, a gene are crucial in explaining the variability of gene expression measures. Single nucleotide polymorphisms (SNPs) in the 3′ UTRs of genes can affect the base-pairing between miRNAs and mRNAs, and hence disrupt existing target sites (in the reference sequence) or create novel target sites, suggesting a possible mechanism for cis regulation of gene expression. Moreover, because the alleles of different SNPs within a DNA sequence of limited length tend to be in strong linkage disequilibrium (LD), we hypothesize the variants of miRNA target sites caused by SNPs potentially function as bridges linking the documented cis-SNP markers to the expression of the associated genes. A large-scale analysis was herein performed to test this hypothesis. By systematically integrating multiple latest information sources, we found 21 significant gene-level SNP-involved miRNA-mediated post-transcriptional regulation modules (SNP-MPRMs) in the form of SNP-miRNA-mRNA triplets in lymphocyte cell lines for the CEU and YRI populations. Among the cognate genes, six including ALG8, DGKE, GNA12, KLF11, LRPAP1, and MMAB are related to multiple genetic diseases such as depressive disorder and Type-II diabetes. Furthermore, we found that ∼35% of the documented transcript intensity-related cis-SNPs (∼950) in a recent publication are identical to, or in significant linkage disequilibrium (LD) (p<0.01) with, one or multiple SNPs located in miRNA target sites. Based on these associations (or identities), 69 significant exon-level SNP-MPRMs and 12 disease genes were further determined for two populations. These results provide concrete in silico evidence for the proposed hypothesis. The discovered modules warrant additional follow-up in independent laboratory studies. PMID:22348086

When Whole-Genome Alignments Just Won't Work: kSNP v2 Software for Alignment-Free SNP Discovery and Phylogenetics of Hundreds of Microbial Genomes

PubMed Central

Gardner, Shea N.; Hall, Barry G.

2013-01-01

Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four “raw read” genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths. PMID:24349125

Fine-mapping of the HNF1B multicancer locus identifies candidate variants that mediate endometrial cancer risk.

PubMed

Painter, Jodie N; O'Mara, Tracy A; Batra, Jyotsna; Cheng, Timothy; Lose, Felicity A; Dennis, Joe; Michailidou, Kyriaki; Tyrer, Jonathan P; Ahmed, Shahana; Ferguson, Kaltin; Healey, Catherine S; Kaufmann, Susanne; Hillman, Kristine M; Walpole, Carina; Moya, Leire; Pollock, Pamela; Jones, Angela; Howarth, Kimberley; Martin, Lynn; Gorman, Maggie; Hodgson, Shirley; De Polanco, Ma Magdalena Echeverry; Sans, Monica; Carracedo, Angel; Castellvi-Bel, Sergi; Rojas-Martinez, Augusto; Santos, Erika; Teixeira, Manuel R; Carvajal-Carmona, Luis; Shu, Xiao-Ou; Long, Jirong; Zheng, Wei; Xiang, Yong-Bing; Montgomery, Grant W; Webb, Penelope M; Scott, Rodney J; McEvoy, Mark; Attia, John; Holliday, Elizabeth; Martin, Nicholas G; Nyholt, Dale R; Henders, Anjali K; Fasching, Peter A; Hein, Alexander; Beckmann, Matthias W; Renner, Stefan P; Dörk, Thilo; Hillemanns, Peter; Dürst, Matthias; Runnebaum, Ingo; Lambrechts, Diether; Coenegrachts, Lieve; Schrauwen, Stefanie; Amant, Frederic; Winterhoff, Boris; Dowdy, Sean C; Goode, Ellen L; Teoman, Attila; Salvesen, Helga B; Trovik, Jone; Njolstad, Tormund S; Werner, Henrica M J; Ashton, Katie; Proietto, Tony; Otton, Geoffrey; Tzortzatos, Gerasimos; Mints, Miriam; Tham, Emma; Hall, Per; Czene, Kamila; Liu, Jianjun; Li, Jingmei; Hopper, John L; Southey, Melissa C; Ekici, Arif B; Ruebner, Matthias; Johnson, Nicola; Peto, Julian; Burwinkel, Barbara; Marme, Frederik; Brenner, Hermann; Dieffenbach, Aida K; Meindl, Alfons; Brauch, Hiltrud; Lindblom, Annika; Depreeuw, Jeroen; Moisse, Matthieu; Chang-Claude, Jenny; Rudolph, Anja; Couch, Fergus J; Olson, Janet E; Giles, Graham G; Bruinsma, Fiona; Cunningham, Julie M; Fridley, Brooke L; Børresen-Dale, Anne-Lise; Kristensen, Vessela N; Cox, Angela; Swerdlow, Anthony J; Orr, Nicholas; Bolla, Manjeet K; Wang, Qin; Weber, Rachel Palmieri; Chen, Zhihua; Shah, Mitul; French, Juliet D; Pharoah, Paul D P; Dunning, Alison M; Tomlinson, Ian; Easton, Douglas F; Edwards, Stacey L; Thompson, Deborah J; Spurdle, Amanda B

2015-03-01

Common variants in the hepatocyte nuclear factor 1 homeobox B (HNF1B) gene are associated with the risk of Type II diabetes and multiple cancers. Evidence to date indicates that cancer risk may be mediated via genetic or epigenetic effects on HNF1B gene expression. We previously found single-nucleotide polymorphisms (SNPs) at the HNF1B locus to be associated with endometrial cancer, and now report extensive fine-mapping and in silico and laboratory analyses of this locus. Analysis of 1184 genotyped and imputed SNPs in 6608 Caucasian cases and 37 925 controls, and 895 Asian cases and 1968 controls, revealed the best signal of association for SNP rs11263763 (P = 8.4 × 10(-14), odds ratio = 0.86, 95% confidence interval = 0.82-0.89), located within HNF1B intron 1. Haplotype analysis and conditional analyses provide no evidence of further independent endometrial cancer risk variants at this locus. SNP rs11263763 genotype was associated with HNF1B mRNA expression but not with HNF1B methylation in endometrial tumor samples from The Cancer Genome Atlas. Genetic analyses prioritized rs11263763 and four other SNPs in high-to-moderate linkage disequilibrium as the most likely causal SNPs. Three of these SNPs map to the extended HNF1B promoter based on chromatin marks extending from the minimal promoter region. Reporter assays demonstrated that this extended region reduces activity in combination with the minimal HNF1B promoter, and that the minor alleles of rs11263763 or rs8064454 are associated with decreased HNF1B promoter activity. Our findings provide evidence for a single signal associated with endometrial cancer risk at the HNF1B locus, and that risk is likely mediated via altered HNF1B gene expression. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

When whole-genome alignments just won't work: kSNP v2 software for alignment-free SNP discovery and phylogenetics of hundreds of microbial genomes.

PubMed

Gardner, Shea N; Hall, Barry G

2013-01-01

Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four "raw read" genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths.

Fine-mapping of the HNF1B multicancer locus identifies candidate variants that mediate endometrial cancer risk

PubMed Central

Painter, Jodie N.; O'Mara, Tracy A.; Batra, Jyotsna; Cheng, Timothy; Lose, Felicity A.; Dennis, Joe; Michailidou, Kyriaki; Tyrer, Jonathan P.; Ahmed, Shahana; Ferguson, Kaltin; Healey, Catherine S.; Kaufmann, Susanne; Hillman, Kristine M.; Walpole, Carina; Moya, Leire; Pollock, Pamela; Jones, Angela; Howarth, Kimberley; Martin, Lynn; Gorman, Maggie; Hodgson, Shirley; De Polanco, Ma. Magdalena Echeverry; Sans, Monica; Carracedo, Angel; Castellvi-Bel, Sergi; Rojas-Martinez, Augusto; Santos, Erika; Teixeira, Manuel R.; Carvajal-Carmona, Luis; Shu, Xiao-Ou; Long, Jirong; Zheng, Wei; Xiang, Yong-Bing; Montgomery, Grant W.; Webb, Penelope M.; Scott, Rodney J.; McEvoy, Mark; Attia, John; Holliday, Elizabeth; Martin, Nicholas G.; Nyholt, Dale R.; Henders, Anjali K.; Fasching, Peter A.; Hein, Alexander; Beckmann, Matthias W.; Renner, Stefan P.; Dörk, Thilo; Hillemanns, Peter; Dürst, Matthias; Runnebaum, Ingo; Lambrechts, Diether; Coenegrachts, Lieve; Schrauwen, Stefanie; Amant, Frederic; Winterhoff, Boris; Dowdy, Sean C.; Goode, Ellen L.; Teoman, Attila; Salvesen, Helga B.; Trovik, Jone; Njolstad, Tormund S.; Werner, Henrica M.J.; Ashton, Katie; Proietto, Tony; Otton, Geoffrey; Tzortzatos, Gerasimos; Mints, Miriam; Tham, Emma; Hall, Per; Czene, Kamila; Liu, Jianjun; Li, Jingmei; Hopper, John L.; Southey, Melissa C.; Ekici, Arif B.; Ruebner, Matthias; Johnson, Nicola; Peto, Julian; Burwinkel, Barbara; Marme, Frederik; Brenner, Hermann; Dieffenbach, Aida K.; Meindl, Alfons; Brauch, Hiltrud; Lindblom, Annika; Depreeuw, Jeroen; Moisse, Matthieu; Chang-Claude, Jenny; Rudolph, Anja; Couch, Fergus J.; Olson, Janet E.; Giles, Graham G.; Bruinsma, Fiona; Cunningham, Julie M.; Fridley, Brooke L.; Børresen-Dale, Anne-Lise; Kristensen, Vessela N.; Cox, Angela; Swerdlow, Anthony J.; Orr, Nicholas; Bolla, Manjeet K.; Wang, Qin; Weber, Rachel Palmieri; Chen, Zhihua; Shah, Mitul; French, Juliet D.; Pharoah, Paul D.P.; Dunning, Alison M.; Tomlinson, Ian; Easton, Douglas F.; Edwards, Stacey L.; Thompson, Deborah J.; Spurdle, Amanda B.

2015-01-01

Common variants in the hepatocyte nuclear factor 1 homeobox B (HNF1B) gene are associated with the risk of Type II diabetes and multiple cancers. Evidence to date indicates that cancer risk may be mediated via genetic or epigenetic effects on HNF1B gene expression. We previously found single-nucleotide polymorphisms (SNPs) at the HNF1B locus to be associated with endometrial cancer, and now report extensive fine-mapping and in silico and laboratory analyses of this locus. Analysis of 1184 genotyped and imputed SNPs in 6608 Caucasian cases and 37 925 controls, and 895 Asian cases and 1968 controls, revealed the best signal of association for SNP rs11263763 (P = 8.4 × 10−14, odds ratio = 0.86, 95% confidence interval = 0.82–0.89), located within HNF1B intron 1. Haplotype analysis and conditional analyses provide no evidence of further independent endometrial cancer risk variants at this locus. SNP rs11263763 genotype was associated with HNF1B mRNA expression but not with HNF1B methylation in endometrial tumor samples from The Cancer Genome Atlas. Genetic analyses prioritized rs11263763 and four other SNPs in high-to-moderate linkage disequilibrium as the most likely causal SNPs. Three of these SNPs map to the extended HNF1B promoter based on chromatin marks extending from the minimal promoter region. Reporter assays demonstrated that this extended region reduces activity in combination with the minimal HNF1B promoter, and that the minor alleles of rs11263763 or rs8064454 are associated with decreased HNF1B promoter activity. Our findings provide evidence for a single signal associated with endometrial cancer risk at the HNF1B locus, and that risk is likely mediated via altered HNF1B gene expression. PMID:25378557

Genetic Risk Score Analysis in Early-Onset Bipolar Disorder.

PubMed

Croarkin, Paul E; Luby, Joan L; Cercy, Kelly; Geske, Jennifer R; Veldic, Marin; Simonson, Matthew; Joshi, Paramjit T; Wagner, Karen Dineen; Walkup, John T; Nassan, Malik M; Cuellar-Barboza, Alfredo B; Casuto, Leah; McElroy, Susan L; Jensen, Peter S; Frye, Mark A; Biernacka, Joanna M

In this study, we performed a candidate genetic risk score (GRS) analysis of early-onset bipolar disorder (BD). Treatment of Early Age Mania (TEAM) study enrollment and sample collection took place from 2003 to 2008. Mayo Clinic Bipolar Biobank samples were collected from 2009 to 2013. Genotyping and analyses for the present study took place from 2013 to 2014. The diagnosis of BD was based on Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision criteria. Eight single-nucleotide polymorphisms (SNPs), previously reported in genome-wide association studies to be associated with BD, were chosen for GRS analysis in early-onset bipolar disease. These SNPs map to 3 genes: CACNA1C (calcium channel, voltage-dependent, L type, alpha 1C subunit), ANK3 (ankyrin-3, node of Ranvier [ankyrin G]), and ODZ4 (teneurin transmembrane protein 4 [formerly "odz, odd Oz/10-m homolog 4 {Drosophila}, ODZ4"]). The 8 candidate SNPs were genotyped in patients from the TEAM study (n = 69); adult patients with BD (n = 732), including a subset with early-onset illness (n = 192); and healthy controls (n = 776). GRS analyses were performed to compare early-onset cases with controls. In addition, associations of early-onset BD with individual SNPs and haplotypes were explored. GRS analysis revealed associations of the risk score with early-onset BD (P = .01). Gene-level haplotype analysis comparing TEAM patients with controls suggested association of early-onset BD with a CACNA1C haplotype (global test, P = .01). At the level of individual SNPs, comparison of TEAM cases with healthy controls provided nominally significant evidence for association of SNP rs10848632 in CACNA1C with early-onset BD (P = .017), which did not remain significant after correction for multiple comparisons. These preliminary analyses suggest that previously identified BD risk loci, especially CACNA1C, have a role in early-onset BD, possibly with stronger effects than for late-onset BD. © Copyright 2017 Physicians Postgraduate Press, Inc.

Association of SNPs on Chromosome 9p21.3 with Platelet Reactivity: A Potential Mechanism for Increased Vascular Disease

PubMed Central

Musunuru, Kiran; Post, Wendy S.; Herzog, William; Shen, Haiqing; O’Connell, Jeffrey R.; McArdle, Patrick F.; Ryan, Kathleen A.; Gibson, Quince; Cheng, Yu-Ching; Clearfield, Elizabeth; Johnson, Andrew D.; Tofler, Geoffrey; Yang, Qiong; O’Donnell, Christopher J.; Becker, Diane M.; Yanek, Lisa R.; Becker, Lewis C.; Faraday, Nauder; Bielak, Lawrence F.; Peyser, Patricia A.; Shuldiner, Alan R.; Mitchell, Braxton D.

2010-01-01

Background Genome-wide association studies have identified a locus on chromosome 9p21.3 to be strongly associated with myocardial infarction/coronary artery disease (MI/CAD) and ischemic stroke. To gain insights into the mechanisms underlying these associations, we hypothesized that single nucleotide polymorphisms (SNPs) in this region would be associated with platelet reactivity across multiple populations. Methods and Results Subjects in the initial population included 1,402 asymptomatic Amish adults in whom we measured platelet reactivity (n=788) and/or coronary artery calcification (CAC) (n=939). Platelet reactivity on agonist stimulation was measured by impedence aggregometry, and CAC by electron beam computed tomography. Twenty-nine SNPs at the 9p21.3 locus were genotyped using the Affymetrix 500K array. Twelve correlated SNPs in the locus were significantly associated with platelet reactivity (all p ≤ 0.001). The SNP most strongly associated with platelet reactivity, rs10965219 (p = 0.0002) was also associated with CAC (p = 0.002), along with 9 other SNPs (all p < 0.004). Association of rs10965219 with platelet reactivity persisted after adjustment for CAC, a measure of underlying atherosclerotic burden known to affect platelet reactivity. We then tested rs10965219 for association with platelet function in 2,364 subjects from the Framingham Heart Study (FHS) and 1,169 subjects from the GeneSTAR Study. The rs10965219 G allele (frequency ~ 51% across all three populations) was significantly associated with higher platelet reactivity in FHS (p = 0.001) and trended toward higher reactivity in GeneSTAR (p = 0.087); the combined p-value for meta-analysis was 0.0002. Conclusions These results suggest that risk alleles at 9p21.3 locus may have pleiotropic effects on MI/CAD and stroke risk, possibly through their influence on platelet reactivity. PMID:20858905

Correlates between Models of Virulence for Mycobacterium tuberculosis among Isolates of the Central Asian Lineage: a Case for Lysozyme Resistance Testing?

PubMed Central

Casali, Nicola; Clark, Simon O.; Hooper, Richard; Williams, Ann; Velji, Preya; Gonzalo, Ximena

2015-01-01

Virulence factors (VFs) contribute to the emergence of new human Mycobacterium tuberculosis strains, are lineage dependent, and are relevant to the development of M. tuberculosis drugs/vaccines. VFs were sought within M. tuberculosis lineage 3, which has the Central Asian (CAS) spoligotype. Three isolates were selected from clusters previously identified as dominant in London, United Kingdom. Strain-associated virulence was studied in guinea pig, monocyte-derived macrophage, and lysozyme resistance assays. Whole-genome sequencing, single nucleotide polymorphism (SNP) analysis, and a literature review contributed to the identification of SNPs of interest. The animal model revealed borderline differences in strain-associated pathogenicity. Ex vivo, isolate C72 exhibited statistically significant differences in intracellular growth relative to C6 and C14. SNP candidates inducing lower fitness levels included 123 unique nonsynonymous SNPs, including three located in genes (lysX, caeA, and ponA2) previously identified as VFs in the laboratory-adapted reference strain H37Rv and shown to confer lysozyme resistance. C72 growth was most affected by lysozyme in vitro. A BLAST search revealed that all three SNPs of interest (C35F, P76Q, and P780R) also occurred in Tiruvallur, India, and in Uganda. Unlike C72, however, no single isolate identified through BLAST carried all three SNPs simultaneously. CAS isolates representative of three medium-sized human clusters demonstrated differential outcomes in models commonly used to estimate strain-associated virulence, supporting the idea that virulence varies within, not just across, M. tuberculosis lineages. Three VF SNPs of interest were identified in two additional locations worldwide, which suggested independent selection and supported a role for these SNPs in virulence. The relevance of lysozyme resistance to strain virulence remains to be established. PMID:25776753

The role of parasite-driven selection in shaping landscape genomic structure in red grouse (Lagopus lagopus scotica).

PubMed

Wenzel, Marius A; Douglas, Alex; James, Marianne C; Redpath, Steve M; Piertney, Stuart B

2016-01-01

Landscape genomics promises to provide novel insights into how neutral and adaptive processes shape genome-wide variation within and among populations. However, there has been little emphasis on examining whether individual-based phenotype-genotype relationships derived from approaches such as genome-wide association (GWAS) manifest themselves as a population-level signature of selection in a landscape context. The two may prove irreconcilable as individual-level patterns become diluted by high levels of gene flow and complex phenotypic or environmental heterogeneity. We illustrate this issue with a case study that examines the role of the highly prevalent gastrointestinal nematode Trichostrongylus tenuis in shaping genomic signatures of selection in red grouse (Lagopus lagopus scotica). Individual-level GWAS involving 384 SNPs has previously identified five SNPs that explain variation in T. tenuis burden. Here, we examine whether these same SNPs display population-level relationships between T. tenuis burden and genetic structure across a small-scale landscape of 21 sites with heterogeneous parasite pressure. Moreover, we identify adaptive SNPs showing signatures of directional selection using F(ST) outlier analysis and relate population- and individual-level patterns of multilocus neutral and adaptive genetic structure to T. tenuis burden. The five candidate SNPs for parasite-driven selection were neither associated with T. tenuis burden on a population level, nor under directional selection. Similarly, there was no evidence of parasite-driven selection in SNPs identified as candidates for directional selection. We discuss these results in the context of red grouse ecology and highlight the broader consequences for the utility of landscape genomics approaches for identifying signatures of selection. © 2015 John Wiley & Sons Ltd.

Comprehensive evaluation of disease- and trait-specific enrichment for eight functional elements among GWAS-identified variants.

PubMed

Markunas, Christina A; Johnson, Eric O; Hancock, Dana B

2017-07-01

Genome-wide association study (GWAS)-identified variants are enriched for functional elements. However, we have limited knowledge of how functional enrichment may differ by disease/trait and tissue type. We tested a broad set of eight functional elements for enrichment among GWAS-identified SNPs (p < 5×10 -8 ) from the NHGRI-EBI Catalog across seven disease/trait categories: cancer, cardiovascular disease, diabetes, autoimmune disease, psychiatric disease, neurological disease, and anthropometric traits. SNPs were annotated using HaploReg for the eight functional elements across any tissue: DNase sites, expression quantitative trait loci (eQTL), sequence conservation, enhancers, promoters, missense variants, sequence motifs, and protein binding sites. In addition, tissue-specific annotations were considered for brain vs. blood. Disease/trait SNPs were compared to a control set of 4809 SNPs matched to the GWAS SNPs (N = 1639) on allele frequency, gene density, distance to nearest gene, and linkage disequilibrium at ~3:1 ratio. Enrichment analyses were conducted using logistic regression, with Bonferroni correction. Overall, a significant enrichment was observed for all functional elements, except sequence motifs. Missense SNPs showed the strongest magnitude of enrichment. eQTLs were the only functional element significantly enriched across all diseases/traits. Magnitudes of enrichment were generally similar across diseases/traits, where enrichment was statistically significant. Blood vs. brain tissue effects on enrichment were dependent on disease/trait and functional element (e.g., cardiovascular disease: eQTLs P TissueDifference  = 1.28 × 10 -6 vs. enhancers P TissueDifference  = 0.94). Identifying disease/trait-relevant functional elements and tissue types could provide new insight into the underlying biology, by guiding a priori GWAS analyses (e.g., brain enhancer elements for psychiatric disease) or facilitating post hoc interpretation.

Characterization of genome-wide association-identified variants for atrial fibrillation in African Americans.

PubMed

Delaney, Jessica T; Jeff, Janina M; Brown, Nancy J; Pretorius, Mias; Okafor, Henry E; Darbar, Dawood; Roden, Dan M; Crawford, Dana C

2012-01-01

Despite a greater burden of risk factors, atrial fibrillation (AF) is less common among African Americans than European-descent populations. Genome-wide association studies (GWAS) for AF in European-descent populations have identified three predominant genomic regions associated with increased risk (1q21, 4q25, and 16q22). The contribution of these loci to AF risk in African American is unknown. We studied 73 African Americans with AF from the Vanderbilt-Meharry AF registry and 71 African American controls, with no history of AF including after cardiac surgery. Tests of association were performed for 148 SNPs across the three regions associated with AF, and 22 SNPs were significantly associated with AF (P<0.05). The SNPs with the strongest associations in African Americans were both different from the index SNPs identified in European-descent populations and independent from the index European-descent population SNPs (r(2)<0.40 in HapMap CEU): 1q21 rs4845396 (odds ratio [OR] 0.30, 95% confidence interval [CI] 0.13-0.67, P = 0.003), 4q25 rs4631108 (OR 3.43, 95% CI 1.59-7.42, P = 0.002), and 16q22 rs16971547 (OR 8.1, 95% CI 1.46-45.4, P = 0.016). Estimates of European ancestry were similar among cases (23.6%) and controls (23.8%). Accordingly, the probability of having two copies of the European derived chromosomes at each region did not differ between cases and controls. Variable European admixture at known AF loci does not explain decreased AF susceptibility in African Americans. These data support the role of 1q21, 4q25, and 16q22 variants in AF risk for African Americans, although the index SNPs differ from those identified in European-descent populations.

Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

PubMed Central

2014-01-01

Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

GENIE: a software package for gene-gene interaction analysis in genetic association studies using multiple GPU or CPU cores.

PubMed

Chikkagoudar, Satish; Wang, Kai; Li, Mingyao

2011-05-26

Gene-gene interaction in genetic association studies is computationally intensive when a large number of SNPs are involved. Most of the latest Central Processing Units (CPUs) have multiple cores, whereas Graphics Processing Units (GPUs) also have hundreds of cores and have been recently used to implement faster scientific software. However, currently there are no genetic analysis software packages that allow users to fully utilize the computing power of these multi-core devices for genetic interaction analysis for binary traits. Here we present a novel software package GENIE, which utilizes the power of multiple GPU or CPU processor cores to parallelize the interaction analysis. GENIE reads an entire genetic association study dataset into memory and partitions the dataset into fragments with non-overlapping sets of SNPs. For each fragment, GENIE analyzes: 1) the interaction of SNPs within it in parallel, and 2) the interaction between the SNPs of the current fragment and other fragments in parallel. We tested GENIE on a large-scale candidate gene study on high-density lipoprotein cholesterol. Using an NVIDIA Tesla C1060 graphics card, the GPU mode of GENIE achieves a speedup of 27 times over its single-core CPU mode run. GENIE is open-source, economical, user-friendly, and scalable. Since the computing power and memory capacity of graphics cards are increasing rapidly while their cost is going down, we anticipate that GENIE will achieve greater speedups with faster GPU cards. Documentation, source code, and precompiled binaries can be downloaded from http://www.cceb.upenn.edu/~mli/software/GENIE/.

Multiple Novel Prostate Cancer Predisposition Loci Confirmed by an International Study: The PRACTICAL Consortium

PubMed Central

Kote-Jarai, Zsofia; Easton, Douglas F.; Stanford, Janet L.; Ostrander, Elaine A.; Schleutker, Johanna; Ingles, Sue A.; Schaid, Daniel; Thibodeau, Stephen; Dörk, Thilo; Neal, David; Cox, Angela; Maier, Christiane; Vogel, Walter; Guy, Michelle; Muir, Kenneth; Lophatananon, Artitaya; Kedda, Mary-Anne; Spurdle, Amanda; Steginga, Suzanne; John, Esther M.; Giles, Graham; Hopper, John; Chappuis, Pierre O.; Hutter, Pierre; Foulkes, William D.; Hamel, Nancy; Salinas, Claudia A.; Koopmeiners, Joseph S.; Karyadi, Danielle M.; Johanneson, Bo; Wahlfors, Tiina; Tammela, Teuvo L.; Stern, Mariana C.; Corral, Roman; McDonnell, Shannon K.; Schürmann, Peter; Meyer, Andreas; Kuefer, Rainer; Leongamornlert, Daniel A.; Tymrakiewicz, Malgorzata; Liu, Jo-fen; O'Mara, Tracy; Gardiner, R.A. (Frank); Aitken, Joanne; Joshi, Amit D.; Severi, Gianluca; English, Dallas R.; Southey, Melissa; Edwards, Stephen M.; Amin Al Olama, Ali; Eeles, Rosalind A.

2009-01-01

A recent genome-wide association study found that genetic variants on chromosomes 3, 6, 7, 10, 11, 19 and X were associated with prostate cancer risk. We evaluated the most significant single-nucleotide polymorphisms (SNP) in these loci using a worldwide consortium of 13 groups (PRACTICAL). Blood DNA from 7,370 prostate cancer cases and 5,742 male controls was analyzed by genotyping assays. Odds ratios (OR) associated with each genotype were estimated using unconditional logistic regression. Six of the seven SNPs showed clear evidence of association with prostate cancer (P = 0.0007-P = 10−17). For each of these six SNPs, the estimated per-allele OR was similar to those previously reported and ranged from 1.12 to 1.29. One SNP on 3p12 (rs2660753) showed a weaker association than previously reported [per-allele OR, 1.08 (95% confidence interval, 1.00-1.16; P = 0.06) versus 1.18 (95% confidence interval, 1.06-1.31)]. The combined risks associated with each pair of SNPs were consistent with a multiplicative risk model. Under this model, and in combination with previously reported SNPs on 8q and 17q, these loci explain 16% of the familial risk of the disease, and men in the top 10% of the risk distribution have a 2.1-fold increased risk relative to general population rates. This study provides strong confirmation of these susceptibility loci in multiple populations and shows that they make an important contribution to prostate cancer risk prediction. PMID:18708398

GENIE: a software package for gene-gene interaction analysis in genetic association studies using multiple GPU or CPU cores

PubMed Central

2011-01-01

Background Gene-gene interaction in genetic association studies is computationally intensive when a large number of SNPs are involved. Most of the latest Central Processing Units (CPUs) have multiple cores, whereas Graphics Processing Units (GPUs) also have hundreds of cores and have been recently used to implement faster scientific software. However, currently there are no genetic analysis software packages that allow users to fully utilize the computing power of these multi-core devices for genetic interaction analysis for binary traits. Findings Here we present a novel software package GENIE, which utilizes the power of multiple GPU or CPU processor cores to parallelize the interaction analysis. GENIE reads an entire genetic association study dataset into memory and partitions the dataset into fragments with non-overlapping sets of SNPs. For each fragment, GENIE analyzes: 1) the interaction of SNPs within it in parallel, and 2) the interaction between the SNPs of the current fragment and other fragments in parallel. We tested GENIE on a large-scale candidate gene study on high-density lipoprotein cholesterol. Using an NVIDIA Tesla C1060 graphics card, the GPU mode of GENIE achieves a speedup of 27 times over its single-core CPU mode run. Conclusions GENIE is open-source, economical, user-friendly, and scalable. Since the computing power and memory capacity of graphics cards are increasing rapidly while their cost is going down, we anticipate that GENIE will achieve greater speedups with faster GPU cards. Documentation, source code, and precompiled binaries can be downloaded from http://www.cceb.upenn.edu/~mli/software/GENIE/. PMID:21615923

A Large-Scale Genetic Association Study Confirms IL12B and Leads to the Identification of IL23R as Psoriasis-Risk Genes

PubMed Central

Cargill, Michele ; Schrodi, Steven J. ; Chang, Monica ; Garcia, Veronica E. ; Brandon, Rhonda ; Callis, Kristina P. ; Matsunami, Nori ; Ardlie, Kristin G. ; Civello, Daniel ; Catanese, Joseph J. ; Leong, Diane U. ; Panko, Jackie M. ; McAllister, Linda B. ; Hansen, Christopher B. ; Papenfuss, Jason ; Prescott, Stephen M. ; White, Thomas J. ; Leppert, Mark F. ; Krueger, Gerald G. ; Begovich, Ann B. 

2007-01-01

We performed a multitiered, case-control association study of psoriasis in three independent sample sets of white North American individuals (1,446 cases and 1,432 controls) with 25,215 genecentric single-nucleotide polymorphisms (SNPs) and found a highly significant association with an IL12B 3′-untranslated-region SNP (rs3212227), confirming the results of a small Japanese study. This SNP was significant in all three sample sets (odds ratio [OR]common 0.64, combined P [Pcomb]=7.85×10-10). A Monte Carlo simulation to address multiple testing suggests that this association is not a type I error. The coding regions of IL12B were resequenced in 96 individuals with psoriasis, and 30 additional IL12B-region SNPs were genotyped. Haplotypes were estimated, and genotype-conditioned analyses identified a second risk allele (rs6887695) located ∼60 kb upstream of the IL12B coding region that exhibited association with psoriasis after adjustment for rs3212227. Together, these two SNPs mark a common IL12B risk haplotype (ORcommon 1.40, Pcomb=8.11×10-9) and a less frequent protective haplotype (ORcommon 0.58, Pcomb=5.65×10-12), which were statistically significant in all three studies. Since IL12B encodes the common IL-12p40 subunit of IL-12 and IL-23, we individually genotyped 17 SNPs in the genes encoding the other chains of these cytokines (IL12A and IL23A) and their receptors (IL12RB1, IL12RB2, and IL23R). Haplotype analyses identified two IL23R missense SNPs that together mark a common psoriasis-associated haplotype in all three studies (ORcommon 1.44, Pcomb=3.13×10-6). Individuals homozygous for both the IL12B and the IL23R predisposing haplotypes have an increased risk of disease (ORcommon 1.66, Pcomb=1.33×10-8). These data, and the previous observation that administration of an antibody specific for the IL-12p40 subunit to patients with psoriasis is highly efficacious, suggest that these genes play a fundamental role in psoriasis pathogenesis. PMID:17236132

Thrombomodulin gene variants are associated with increased mortality after coronary artery bypass surgery in replicated analyses.

PubMed

Lobato, Robert L; White, William D; Mathew, Joseph P; Newman, Mark F; Smith, Peter K; McCants, Charles B; Alexander, John H; Podgoreanu, Mihai V

2011-09-13

We tested the hypothesis that genetic variation in thrombotic and inflammatory pathways is independently associated with long-term mortality after coronary artery bypass graft (CABG) surgery. Two separate cohorts of patients undergoing CABG surgery at a single institution were examined, and all-cause mortality between 30 days and 5 years after the index CABG was ascertained from the National Death Index. In a discovery cohort of 1018 patients, a panel of 90 single-nucleotide polymorphisms (SNPs) in 49 candidate genes was tested with Cox proportional hazard models to identify clinical and genomic multivariate predictors of incident death. After adjustment for multiple comparisons and clinical predictors of mortality, the homozygote minor allele of a common variant in the thrombomodulin (THBD) gene (rs1042579) was independently associated with significantly increased risk of all-cause mortality (hazard ratio, 2.26; 95% CI, 1.31 to 3.92; P=0.003). Six tag SNPs in the THBD gene, 1 of which (rs3176123) in complete linkage disequilibrium with rs1042579, were then assessed in an independent validation cohort of 930 patients. After multivariate adjustment for the clinical predictors identified in the discovery cohort and multiple testing, the homozygote minor allele of rs3176123 independently predicted all-cause mortality (hazard ratio, 3.6; 95% CI, 1.67 to 7.78; P=0.001). In 2 independent cardiac surgery cohorts, linked common allelic variants in the THBD gene are independently associated with increased long-term mortality risk after CABG and significantly improve the classification ability of traditional postoperative mortality prediction models.

Tissue expression and predicted protein structures of the bovine ANGPTL3 and association of novel SNPs with growth and meat quality traits.

PubMed

Chen, N B; Ma, Y; Yang, T; Lin, F; Fu, W W; Xu, Y J; Li, F; Li, J Y; Gao, S X

2015-08-01

Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that regulates lipid, glucose and energy metabolism. This study was conducted to better understand the effect of ANGPTL3 on important economic traits in cattle. First, transcript profiles for ANGPTL3 were measured in nine different Jiaxian cattle tissues. Second, polymorphisms were identified in the complete coding region and promoter region of the bovine ANGPTL3 gene in 707 cattle samples. Finally, an association study was carried out utilizing these single nucleotide polymorphisms (SNPs) to determine the effect of these SNPs on the growth and meat quality traits. Quantitative real-time PCR analysis showed that ANGPTL3 was mainly expressed in the liver. The promoter of the bovine ANGPTL3 contained several putative transcription factor binding sites (SF1, HNF-1, LXRα, NFκβ, HNF-3 and C/EBP). In total, four SNPs of the bovine ANGPTL3 gene were identified by direct sequencing. SNP1 (rs469906272: g.-38T>C) was identified in the promoter, SNP2 (rs451104723:g.104A>T) and SNP3 (rs482516226: g.509A>G) were identified in exon 1, and SNP4 (rs477165942: g.8661T>C) was identified in exon 6. Changes in predicted protein structures due to non-synonymous SNPs were analyzed. Haplotype frequencies and linkage disequilibrium were also investigated. Analysis of four SNPs in cattle from different native Chinese breeds (Nanyang (NY) and Jiaxian (JX)) and commercial breeds (Angus (AG), Hereford (HF), Limousin (LM), Luxi (LX), Simmental (ST) and Jinnan (JN)) revealed a significant association with growth traits (including: BW and hipbone width) and meat quality traits (including: Warner-Bratzler shear force and ribeye area). Therefore, implementation of these four mutations in selection indices in the beef industry may be beneficial in selecting individuals with superior growth and meat quality traits.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

An omnibus permutation test on ensembles of two-locus analyses can detect pure epistasis and genetic heterogeneity in genome-wide association studies.

PubMed

Setsirichok, Damrongrit; Tienboon, Phuwadej; Jaroonruang, Nattapong; Kittichaijaroen, Somkit; Wongseree, Waranyu; Piroonratana, Theera; Usavanarong, Touchpong; Limwongse, Chanin; Aporntewan, Chatchawit; Phadoongsidhi, Marong; Chaiyaratana, Nachol

2013-01-01

This article presents the ability of an omnibus permutation test on ensembles of two-locus analyses (2LOmb) to detect pure epistasis in the presence of genetic heterogeneity. The performance of 2LOmb is evaluated in various simulation scenarios covering two independent causes of complex disease where each cause is governed by a purely epistatic interaction. Different scenarios are set up by varying the number of available single nucleotide polymorphisms (SNPs) in data, number of causative SNPs and ratio of case samples from two affected groups. The simulation results indicate that 2LOmb outperforms multifactor dimensionality reduction (MDR) and random forest (RF) techniques in terms of a low number of output SNPs and a high number of correctly-identified causative SNPs. Moreover, 2LOmb is capable of identifying the number of independent interactions in tractable computational time and can be used in genome-wide association studies. 2LOmb is subsequently applied to a type 1 diabetes mellitus (T1D) data set, which is collected from a UK population by the Wellcome Trust Case Control Consortium (WTCCC). After screening for SNPs that locate within or near genes and exhibit no marginal single-locus effects, the T1D data set is reduced to 95,991 SNPs from 12,146 genes. The 2LOmb search in the reduced T1D data set reveals that 12 SNPs, which can be divided into two independent sets, are associated with the disease. The first SNP set consists of three SNPs from MUC21 (mucin 21, cell surface associated), three SNPs from MUC22 (mucin 22), two SNPs from PSORS1C1 (psoriasis susceptibility 1 candidate 1) and one SNP from TCF19 (transcription factor 19). A four-locus interaction between these four genes is also detected. The second SNP set consists of three SNPs from ATAD1 (ATPase family, AAA domain containing 1). Overall, the findings indicate the detection of pure epistasis in the presence of genetic heterogeneity and provide an alternative explanation for the aetiology of T1D in the UK population.

Genome-Wide Association Scan in HIV-1-Infected Individuals Identifying Variants Influencing Disease Course

PubMed Central

van Manen, Daniëlle; Delaneau, Olivier; Kootstra, Neeltje A.; Boeser-Nunnink, Brigitte D.; Limou, Sophie; Bol, Sebastiaan M.; Burger, Judith A.; Zwinderman, Aeilko H.; Moerland, Perry D.; van 't Slot, Ruben; Zagury, Jean-François; van 't Wout, Angélique B.; Schuitemaker, Hanneke

2011-01-01

Background AIDS develops typically after 7–11 years of untreated HIV-1 infection, with extremes of very rapid disease progression (<2 years) and long-term non-progression (>15 years). To reveal additional host genetic factors that may impact on the clinical course of HIV-1 infection, we designed a genome-wide association study (GWAS) in 404 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS. Methods The association of SNP genotypes with the clinical course of HIV-1 infection was tested in Cox regression survival analyses using AIDS-diagnosis and AIDS-related death as endpoints. Results Multiple, not previously identified SNPs, were identified to be strongly associated with disease progression after HIV-1 infection, albeit not genome-wide significant. However, three independent SNPs in the top ten associations between SNP genotypes and time between seroconversion and AIDS-diagnosis, and one from the top ten associations between SNP genotypes and time between seroconversion and AIDS-related death, had P-values smaller than 0.05 in the French Genomics of Resistance to Immunodeficiency Virus cohort on disease progression. Conclusions Our study emphasizes that the use of different phenotypes in GWAS may be useful to unravel the full spectrum of host genetic factors that may be associated with the clinical course of HIV-1 infection. PMID:21811574

Using an Inbred Horse Breed in a High Density Genome-Wide Scan for Genetic Risk Factors of Insect Bite Hypersensitivity (IBH).

PubMed

Velie, Brandon D; Shrestha, Merina; Franҫois, Liesbeth; Schurink, Anouk; Tesfayonas, Yohannes G; Stinckens, Anneleen; Blott, Sarah; Ducro, Bart J; Mikko, Sofia; Thomas, Ruth; Swinburne, June E; Sundqvist, Marie; Eriksson, Susanne; Buys, Nadine; Lindgren, Gabriella

2016-01-01

While susceptibility to hypersensitive reactions is a common problem amongst humans and animals alike, the population structure of certain animal species and breeds provides a more advantageous route to better understanding the biology underpinning these conditions. The current study uses Exmoor ponies, a highly inbred breed of horse known to frequently suffer from insect bite hypersensitivity, to identify genomic regions associated with a type I and type IV hypersensitive reaction. A total of 110 cases and 170 controls were genotyped on the 670K Axiom Equine Genotyping Array. Quality control resulted in 452,457 SNPs and 268 individuals being tested for association. Genome-wide association analyses were performed using the GenABEL package in R and resulted in the identification of two regions of interest on Chromosome 8. The first region contained the most significant SNP identified, which was located in an intron of the DCC netrin 1 receptor gene. The second region identified contained multiple top SNPs and encompassed the PIGN, KIAA1468, TNFRSF11A, ZCCHC2, and PHLPP1 genes. Although additional studies will be needed to validate the importance of these regions in horses and the relevance of these regions in other species, the knowledge gained from the current study has the potential to be a step forward in unraveling the complex nature of hypersensitive reactions.

Neuronal nitric oxide synthase (NOS1) polymorphisms interact with financial hardship to affect depression risk.

PubMed

Sarginson, Jane E; Deakin, J F William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-11-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression.

Neuronal Nitric Oxide Synthase (NOS1) Polymorphisms Interact with Financial Hardship to Affect Depression Risk

PubMed Central

Sarginson, Jane E; Deakin, JF William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-01-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression. PMID:24917196

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Fine mapping and positional candidate studies on chromosome 5p13 identify multiple asthma susceptibility loci.

PubMed

Kurz, Thorsten; Hoffjan, Sabine; Hayes, M Geoffrey; Schneider, Dan; Nicolae, Raluca; Heinzmann, Andrea; Jerkic, Sylvija P; Parry, Rod; Cox, Nancy J; Deichmann, Klaus A; Ober, Carole

2006-08-01

Genome-wide linkage scans to identify asthma susceptibility loci have revealed many linked regions, including a broad region on chromosome 5p. To identify a 5p-linked asthma or bronchial hyperresponsiveness (BHR) locus. We performed fine mapping and positional candidate studies of this region in the Hutterites and an outbred case-control sample from Germany by genotyping 89 single nucleotide polymorphisms (SNPs) in 22 genes. SNP and haplotype analyses were performed. Three genes in a distal region (zinc finger RNA binding protein [ZFR], natriuretic peptide receptor C, and a disintegrin and metalloproteinase domain with thrombospondin type 1 motif [ADAMTS12]) were associated with BHR, whereas 4 genes in a proximal region (prolactin receptor, IL-7 receptor [IL7R], leukemia inhibitory factor receptor [LIFR], and prostaglandin E4 receptor [PTGER4]) were associated with asthma symptoms in the Hutterites. Furthermore, nearly the entire original linkage signal in the Hutterites was generated by individuals who had the risk-associated alleles in ZFR3, natriuretic peptide receptor C, ADAMTS12, LIFR, and PTGER4. Variation in ADAMTS12, IL7R, and PTGER4 were also associated with asthma in the outbred Germans, and the frequencies of long-range haplotypes composed of SNPs at ZFR, ADAMTS12, IL7R, LIFR, and PTGER4 were significantly different between both the German and Hutterite cases and controls. There is little linkage disequilbrium between alleles in these 2 regions in either population. These results suggest that a broad region on 5p, separated by >9 Mb, harbors at least 2 and possibly 5 asthma or BHR susceptibility loci. These findings are consistent with the hypothesis that regions providing evidence for linkage in multiple populations may, in fact, house more than 1 susceptibility locus, as appears to be the case for the linked region on 5p. Identifying asthma or BHR genes could lead to novel therapeutic approaches.

The ankyrin-3 gene is associated with posttraumatic stress disorder and externalizing comorbidity

PubMed Central

Logue, Mark W.; Solovieff, Nadia; Leussis, Melanie P.; Wolf, Erika J.; Melista, Efi; Baldwin, Clinton; Koenen, Karestan C.; Petryshen, Tracey; Miller, Mark W.

2013-01-01

Background The ankyrin 3 gene (ANK3) produces the ankyrin G protein that plays an integral role in regulating neuronal activity. Previous studies have linked ANK3 to bipolar disorder and schizophrenia. A recent mouse study suggests that ANK3 may regulate behavioral disinhibition and stress reactivity. This led us to hypothesize that ANK3 might also be associated with stress-related psychopathology such as posttraumatic stress disorder (PTSD), as well as disorders of the externalizing spectrum such as antisocial personality disorder and substance-related disorders that are etiologically linked to impulsivity and temperamental disinhibition. Methods We examined the possibility of association between ANK3 SNPs and both PTSD and externalizing (defined by a factor score representing a composite of adult antisociality and substance abuse) in a cohort of white non-Hispanic combat veterans and their intimate partners (N=554). Initially, we focused on rs9804190— a SNP previously reported to be associated with bipolar disorder, schizophrenia, and ankyrin G expression in brain. Then we examined 358 additional ANK3 SNPs utilizing a multiple-testing correction. Results rs9804190 was associated with both externalizing and PTSD (p=0.028 and p=0.042 respectively). Analysis of other ANK3 SNPs identified several that were more strongly associated with either trait. The most significant association with externalizing was observed at rs1049862 (p=0.00040, pcorrected=0.60). The most significant association with PTSD (p=0.00060, pcorrected=0.045) was found with three SNPs in complete linkage disequilibrium (LD)—rs28932171, rs11599164, and rs17208576. Conclusions These findings support a role of ANK3 in risk of stress-related and externalizing disorders, beyond its previous associations with bipolar disorder and schizophrenia. PMID:23796624

PVRL1 as a Candidate Gene for Nonsyndromic Cleft Lip With or Without Cleft Palate: No Evidence for the Involvement of Common or Rare Variants in Southern Han Chinese Patients

PubMed Central

Cheng, Hong-Qiu; Huang, En-Min; Xu, Ming-Yan; Shu, Shen-You

2012-01-01

The poliovirus receptor related-1 (PVRL1) gene encodes nectin-1, a cell–cell adhesion molecule (OMIM #600644), and is mutated in the cleft lip with or without cleft palate/ectodermal dysplasia-1 syndrome (CLPED1, OMIM #225000). In addition, PVRL1 mutations have been associated with nonsyndromic cleft lip with or without a cleft palate (NSCL/P) in studies of multiethnic samples. To investigate the possible involvement of this gene in southern Han Chinese NSCL/P patients, we performed (i) a case–control association study, and (ii) a resequencing study. A set of 470 patients with NSCL/P and 693 controls were recruited, and a total of 45 tagging single-nucleotide polymorphisms (SNPs) were genotyped by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In the resequencing study, the coding regions of the PVRL1 α isoform were direct sequenced in 45 trios from multiply affected families. One (rs7128327) of the 45 tested SNPs showed a trend toward statistical significance in the genotypic-level chi-square test (p=0.009567). However, this result did not withstand correction for multiple testing. Likewise, sliding window haplotype analyses consisting of two, three, or four SNPs failed to detect any positive association. Resequencing analysis also failed to identify any novel rare sequence variants. In conclusion, the present study provided no support for the hypothesis that common or rare variants in PVRL1 play a significant role in NSCL/P development in the southern Han Chinese population. This is the first study that has used tagging SNPs covering all the coding and noncoding regions to search for common NSCL/P-associated mutations of PVRL1. PMID:22455396

Genetic variants in the PIWI-piRNA pathway gene DCP1A predict melanoma disease-specific survival.

PubMed

Zhang, Weikang; Liu, Hongliang; Yin, Jieyun; Wu, Wenting; Zhu, Dakai; Amos, Christopher I; Fang, Shenying; Lee, Jeffrey E; Li, Yi; Han, Jiali; Wei, Qingyi

2016-12-15

The Piwi-piRNA pathway is important for germ cell maintenance, genome integrity, DNA methylation and retrotransposon control and thus may be involved in cancer development. In this study, we comprehensively analyzed prognostic roles of 3,116 common SNPs in PIWI-piRNA pathway genes in melanoma disease-specific survival. A published genome-wide association study (GWAS) by The University of Texas M.D. Anderson Cancer Center was used to identify associated SNPs, which were later validated by another GWAS from the Harvard Nurses' Health Study and Health Professionals Follow-up Study. After multiple testing correction, we found that there were 27 common SNPs in two genes (PIWIL4 and DCP1A) with false discovery rate < 0.2 in the discovery dataset. Three tagSNPs (i.e., rs7933369 and rs508485 in PIWIL4; rs11551405 in DCP1A) were replicated. The rs11551405 A allele, located at the 3' UTR microRNA binding site of DCP1A, was associated with an increased risk of melanoma disease-specific death in both discovery dataset [adjusted Hazards ratio (HR) = 1.66, 95% confidence interval (CI) = 1.21-2.27, p =1.50 × 10 -3 ] and validation dataset (HR = 1.55, 95% CI = 1.03-2.34, p = 0.038), compared with the C allele, and their meta-analysis showed an HR of 1.62 (95% CI, 1.26-2.08, p =1.55 × 10 -4 ). Using RNA-seq data from the 1000 Genomes Project, we found that DCP1A mRNA expression levels increased significantly with the A allele number of rs11551405. Additional large, prospective studies are needed to validate these findings. © 2016 UICC.

A Polygenic Risk Score of glutamatergic SNPs associated with schizophrenia predicts attentional behavior and related brain activity in healthy humans.

PubMed

Rampino, Antonio; Taurisano, Paolo; Fanelli, Giuseppe; Attrotto, Mariateresa; Torretta, Silvia; Antonucci, Linda Antonella; Miccolis, Grazia; Pergola, Giulio; Ursini, Gianluca; Maddalena, Giancarlo; Romano, Raffaella; Masellis, Rita; Di Carlo, Pasquale; Pignataro, Patrizia; Blasi, Giuseppe; Bertolino, Alessandro

2017-09-01

Multiple genetic variations impact on risk for schizophrenia. Recent analyses by the Psychiatric Genomics Consortium (PGC2) identified 128 SNPs genome-wide associated with the disorder. Furthermore, attention and working memory deficits are core features of schizophrenia, are heritable and have been associated with variation in glutamatergic neurotransmission. Based on this evidence, in a sample of healthy volunteers, we used SNPs associated with schizophrenia in PGC2 to construct a Polygenic-Risk-Score (PRS) reflecting the cumulative risk for schizophrenia, along with a Polygenic-Risk-Score including only SNPs related to genes implicated in glutamatergic signaling (Glu-PRS). We performed Factor Analysis for dimension reduction of indices of cognitive performance. Furthermore, both PRS and Glu-PRS were used as predictors of cognitive functioning in the domains of Attention, Speed of Processing and Working Memory. The association of the Glu-PRS on brain activity during the Variable Attention Control (VAC) task was also explored. Finally, in a second independent sample of healthy volunteers we sought to confirm the association between the Glu-PRS and both performance in the domain of Attention and brain activity during the VAC.We found that performance in Speed of Processing and Working Memory was not associated with any of the Polygenic-Risk-Scores. The Glu-PRS, but not the PRS was associated with Attention and brain activity during the VAC. The specific effects of Glu-PRS on Attention and brain activity during the VAC were also confirmed in the replication sample.Our results suggest a pathway specificity in the relationship between genetic risk for schizophrenia, the associated cognitive dysfunction and related brain processing. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

Cell cycle-related genes as modifiers of age of onset of colorectal cancer in Lynch syndrome: a large-scale study in non-Hispanic white patients.

PubMed

Chen, Jinyun; Pande, Mala; Huang, Yu-Jing; Wei, Chongjuan; Amos, Christopher I; Talseth-Palmer, Bente A; Meldrum, Cliff J; Chen, Wei V; Gorlov, Ivan P; Lynch, Patrick M; Scott, Rodney J; Frazier, Marsha L

2013-02-01

Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle-related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle-related genes and 31 DNA repair-related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan-Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P < 5 × 10(-4)). Furthermore, risk modeling using CART analysis defined combinations of genotypes for these SNPs with which subjects could be classified into low-risk, moderate-risk and high-risk groups that had median ages of colorectal cancer onset of 63, 50 and 42 years, respectively. The age-associated risk of colorectal cancer in the high-risk group was more than four times the risk in the low-risk group (hazard ratio = 4.67, 95% CI = 3.16-6.92). The additional genetic markers identified may help in refining risk groups for more tailored screening and follow-up of non-Hispanic white patients with Lynch syndrome.

Cell cycle–related genes as modifiers of age of onset of colorectal cancer in Lynch syndrome: a large-scale study in non-Hispanic white patients

PubMed Central

Chen, Jinyun; Pande, Mala

2013-01-01

Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle–related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle–related genes and 31 DNA repair–related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan–Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P < 5×10–4). Furthermore, risk modeling using CART analysis defined combinations of genotypes for these SNPs with which subjects could be classified into low-risk, moderate-risk and high-risk groups that had median ages of colorectal cancer onset of 63, 50 and 42 years, respectively. The age-associated risk of colorectal cancer in the high-risk group was more than four times the risk in the low-risk group (hazard ratio = 4.67, 95% CI = 3.16–6.92). The additional genetic markers identified may help in refining risk groups for more tailored screening and follow-up of non-Hispanic white patients with Lynch syndrome. PMID:23125224

A genetic risk score based on direct associations with coronary heart disease improves coronary heart disease risk prediction in the Atherosclerosis Risk in Communities (ARIC), but not in the Rotterdam and Framingham Offspring, Studies

PubMed Central

Brautbar, Ariel; Pompeii, Lisa A.; Dehghan, Abbas; Ngwa, Julius S.; Nambi, Vijay; Virani, Salim S.; Rivadeneira, Fernando; Uitterlinden, André G.; Hofman, Albert; Witteman, Jacqueline C.M.; Pencina, Michael J.; Folsom, Aaron R.; Cupples, L. Adrienne; Ballantyne, Christie M.; Boerwinkle, Eric

2013-01-01

Objective Multiple studies have identified single-nucleotide polymorphisms (SNPs) that are associated with coronary heart disease (CHD). We examined whether SNPs selected based on predefined criteria will improve CHD risk prediction when added to traditional risk factors (TRFs). Methods SNPs were selected from the literature based on association with CHD, lack of association with a known CHD risk factor, and successful replication. A genetic risk score (GRS) was constructed based on these SNPs. Cox proportional hazards model was used to calculate CHD risk based on the Atherosclerosis Risk in Communities (ARIC) and Framingham CHD risk scores with and without the GRS. Results The GRS was associated with risk for CHD (hazard ratio [HR] = 1.10; 95% confidence interval [CI]: 1.07–1.13). Addition of the GRS to the ARIC risk score significantly improved discrimination, reclassification, and calibration beyond that afforded by TRFs alone in non-Hispanic whites in the ARIC study. The area under the receiver operating characteristic curve (AUC) increased from 0.742 to 0.749 (Δ= 0.007; 95% CI, 0.004–0.013), and the net reclassification index (NRI) was 6.3%. Although the risk estimates for CHD in the Framingham Offspring (HR = 1.12; 95% CI: 1.10–1.14) and Rotterdam (HR = 1.08; 95% CI: 1.02–1.14) Studies were significantly improved by adding the GRS to TRFs, improvements in AUC and NRI were modest. Conclusion Addition of a GRS based on direct associations with CHD to TRFs significantly improved discrimination and reclassification in white participants of the ARIC Study, with no significant improvement in the Rotterdam and Framingham Offspring Studies. PMID:22789513

Investigation of multiple susceptibility loci for inflammatory bowel disease in an Italian cohort of patients.

PubMed

Latiano, Anna; Palmieri, Orazio; Latiano, Tiziana; Corritore, Giuseppe; Bossa, Fabrizio; Martino, Giuseppina; Biscaglia, Giuseppe; Scimeca, Daniela; Valvano, Maria Rosa; Pastore, Maria; Marseglia, Antonio; D'Incà, Renata; Andriulli, Angelo; Annese, Vito

2011-01-01

Recent GWAs and meta-analyses have outlined about 100 susceptibility genes/loci for inflammatory bowel diseases (IBD). In this study we aimed to investigate the influence of SNPs tagging the genes/loci PTGER4, TNFSF15, NKX2-3, ZNF365, IFNG, PTPN2, PSMG1, and HLA in a large pediatric- and adult-onset IBD Italian cohort. Eight SNPs were assessed in 1,070 Crohn's disease (CD), 1,213 ulcerative colitis (UC), 557 of whom being diagnosed at the age of ≤16 years, and 789 healthy controls. Correlations with sub-phenotypes and major variants of NOD2 gene were investigated. The SNPs tagging the TNFSF15, NKX2-3, ZNF365, and PTPN2 genes were associated with CD (P values ranging from 0.037 to 7×10(-6)). The SNPs tagging the PTGER4, NKX2-3, ZNF365, IFNG, PSMG1, and HLA area were associated with UC (P values 0.047 to 4×10(-5)). In the pediatric cohort the associations of TNFSF15, NKX2-3 with CD, and PTGER4, NKX2-3, ZNF365, IFNG, PSMG1 with UC, were confirmed. Association with TNFSF15 and pediatric UC was also reported. A correlation with NKX2-3 and need for surgery (P  =  0.038), and with HLA and steroid-responsiveness (P  =  0.024) in UC patients was observed. Moreover, significant association in our CD cohort with TNFSF15 SNP and colonic involvement (P  =  0.021), and with ZNF365 and ileal location (P  =  0.024) was demonstrated. We confirmed in a large Italian cohort the associations with CD and UC of newly identified genes, both in adult and pediatric cohort of patients, with some influence on sub-phenotypes.

Genome-wide association study to identify potential genetic modifiers in a canine model for Duchenne muscular dystrophy.

PubMed

Brinkmeyer-Langford, Candice; Balog-Alvarez, Cynthia; Cai, James J; Davis, Brian W; Kornegay, Joe N

2016-08-22

Duchenne muscular dystrophy (DMD) causes progressive muscle degeneration, cardiomyopathy and respiratory failure in approximately 1/5,000 boys. Golden Retriever muscular dystrophy (GRMD) resembles DMD both clinically and pathologically. Like DMD, GRMD exhibits remarkable phenotypic variation among affected dogs, suggesting the influence of modifiers. Understanding the role(s) of genetic modifiers of GRMD may identify genes and pathways that also modify phenotypes in DMD and reveal novel therapies. Therefore, our objective in this study was to identify genetic modifiers that affect discrete GRMD phenotypes. We performed a linear mixed-model (LMM) analysis using 16 variably-affected dogs from our GRMD colony (8 dystrophic, 8 non-dystrophic). All of these dogs were either full or half-siblings, and phenotyped for 19 objective, quantitative biomarkers at ages 6 and 12 months. Each biomarker was individually assessed. Gene expression profiles of 59 possible candidate genes were generated for two muscle types: the cranial tibialis and medial head of the gastrocnemius. SNPs significantly associated with GRMD biomarkers were identified on multiple chromosomes (including the X chromosome). Gene expression levels for candidate genes located near these SNPs correlated with biomarker values, suggesting possible roles as GRMD modifiers. The results of this study enhance our understanding of GRMD pathology and represent a first step toward the characterization of GRMD modifiers that may be relevant to DMD pathology. Such modifiers are likely to be useful for DMD treatment development based on their relationships to GRMD phenotypes.

Placental genome and maternal-placental genetic interactions: a genome-wide and candidate gene association study of placental abruption.

PubMed

Denis, Marie; Enquobahrie, Daniel A; Tadesse, Mahlet G; Gelaye, Bizu; Sanchez, Sixto E; Salazar, Manuel; Ananth, Cande V; Williams, Michelle A

2014-01-01

While available evidence supports the role of genetics in the pathogenesis of placental abruption (PA), PA-related placental genome variations and maternal-placental genetic interactions have not been investigated. Maternal blood and placental samples collected from participants in the Peruvian Abruptio Placentae Epidemiology study were genotyped using Illumina's Cardio-Metabochip platform. We examined 118,782 genome-wide SNPs and 333 SNPs in 32 candidate genes from mitochondrial biogenesis and oxidative phosphorylation pathways in placental DNA from 280 PA cases and 244 controls. We assessed maternal-placental interactions in the candidate gene SNPS and two imprinted regions (IGF2/H19 and C19MC). Univariate and penalized logistic regression models were fit to estimate odds ratios. We examined the combined effect of multiple SNPs on PA risk using weighted genetic risk scores (WGRS) with repeated ten-fold cross-validations. A multinomial model was used to investigate maternal-placental genetic interactions. In placental genome-wide and candidate gene analyses, no SNP was significant after false discovery rate correction. The top genome-wide association study (GWAS) hits were rs544201, rs1484464 (CTNNA2), rs4149570 (TNFRSF1A) and rs13055470 (ZNRF3) (p-values: 1.11e-05 to 3.54e-05). The top 200 SNPs of the GWAS overrepresented genes involved in cell cycle, growth and proliferation. The top candidate gene hits were rs16949118 (COX10) and rs7609948 (THRB) (p-values: 6.00e-03 and 8.19e-03). Participants in the highest quartile of WGRS based on cross-validations using SNPs selected from the GWAS and candidate gene analyses had a 8.40-fold (95% CI: 5.8-12.56) and a 4.46-fold (95% CI: 2.94-6.72) higher odds of PA compared to participants in the lowest quartile. We found maternal-placental genetic interactions on PA risk for two SNPs in PPARG (chr3:12313450 and chr3:12412978) and maternal imprinting effects for multiple SNPs in the C19MC and IGF2/H19 regions. Variations in the placental genome and interactions between maternal-placental genetic variations may contribute to PA risk. Larger studies may help advance our understanding of PA pathogenesis.

A Genome-Wide Association Study Identifies A New Ovarian Cancer Susceptibility Locus On 9p22.2

PubMed Central

Song, Honglin; Ramus, Susan J.; Tyrer, Jonathan; Bolton, Kelly L.; Gentry-Maharaj, Aleksandra; Wozniak, Eva; Anton-Culver, Hoda; Chang-Claude, Jenny; Cramer, Daniel W.; DiCioccio, Richard; Dörk, Thilo; Goode, Ellen L.; Goodman, Marc T; Schildkraut, Joellen M; Sellers, Thomas; Baglietto, Laura; Beckmann, Matthias W.; Beesley, Jonathan; Blaakaer, Jan; Carney, Michael E; Chanock, Stephen; Chen, Zhihua; Cunningham, Julie M.; Dicks, Ed; Doherty, Jennifer A.; Dürst, Matthias; Ekici, Arif B.; Fenstermacher, David; Fridley, Brooke L.; Giles, Graham; Gore, Martin E.; De Vivo, Immaculata; Hillemanns, Peter; Hogdall, Claus; Hogdall, Estrid; Iversen, Edwin S; Jacobs, Ian J; Jakubowska, Anna; Li, Dong; Lissowska, Jolanta; Lubiński, Jan; Lurie, Galina; McGuire, Valerie; McLaughlin, John; Mędrek, Krzysztof; Moorman, Patricia G.; Moysich, Kirsten; Narod, Steven; Phelan, Catherine; Pye, Carole; Risch, Harvey; Runnebaum, Ingo B; Severi, Gianluca; Southey, Melissa; Stram, Daniel O.; Thiel, Falk C.; Terry, Kathryn L.; Tsai, Ya-Yu; Tworoger, Shelley S.; Van Den Berg, David J.; Vierkant, Robert A.; Wang-Gohrke, Shan; Webb, Penelope M.; Wilkens, Lynne R.; Wu, Anna H; Yang, Hannah; Brewster, Wendy; Ziogas, Argyrios; Houlston, Richard; Tomlinson, Ian; Whittemore, Alice S; Rossing, Mary Anne; Ponder, Bruce A.J.; Pearce, Celeste Leigh; Ness, Roberta B.; Menon, Usha; Kjaer, Susanne Krüger; Gronwald, Jacek; Garcia-Closas, Montserrat; Fasching, Peter A.; Easton, Douglas F; Chenevix-Trench, Georgia; Berchuck, Andrew; Pharoah, Paul D.P.; Gayther, Simon A.

2009-01-01

Epithelial ovarian cancer has a major heritable component, but the known susceptibility genes explain less than half the excess familial risk1. We performed a genome wide association study (GWAS) to identify common ovarian cancer susceptibility alleles. We evaluated 507,094 SNPs genotyped in 1,817 cases and 2,353 controls from the UK and ~2 million imputed SNPs. We genotyped the 22,790 top ranked SNPs in 4,274 cases and 4,809 controls of European ancestry from Europe, USA and Australia. We identified 12 SNPs at 9p22 associated with disease risk (P<10−8). The most significant SNP (rs3814113; P = 2.5 × 10−17) was genotyped in a further 2,670 ovarian cancer cases and 4,668 controls confirming its association (combined data odds ratio = 0.82 95% CI 0.79 – 0.86, P-trend = 5.1 × 10−19). The association differs by histological subtype, being strongest for serous ovarian cancers (OR 0.77 95% CI 0.73 – 0.81, Ptrend = 4.1 × 10−21). PMID:19648919

High density genotyping of STAT4 gene reveals multiple haplotypic associations with Systemic Lupus Erythematosus in different racial groups

PubMed Central

Namjou, Bahram; Sestak, Andrea L.; Armstrong, Don L.; Zidovetzki, Raphael; Kelly, Jennifer A.; Jacob, Noam; Ciobanu, Voicu; Kaufman, Kenneth M.; Ojwang, Joshua O.; Ziegler, Julie; Quismorio, Francesco; Reiff, Andreas; Myones, Barry L.; Guthridge, Joel M.; Nath, Swapan K.; Bruner, Gail R.; Mehrian-Shai, Ruth; Silverman, Earl; Klein-Gitelman, Marisa; McCurdy, Deborah; Wagner-Weiner, Linda; Nocton, James J.; Putterman, Chaim; Bae, Sang-Cheol; Kim, Yun Jung; Petri, Michelle; Reveille, John D.; Vyse, Timothy J.; Gilkeson, Gary S.; Kamen, Diane L.; Alarcón-Riquelme, Marta E.; Gaffney, Patrick M.; Moser, Kathy L; Merrill, Joan T.; Scofield, R. Hal; James, Judith A.; Langefeld, Carl D.; Harley, John B.; Jacob, Chaim O.

2009-01-01

Objective Systemic lupus erythematosus (SLE) is the prototypic systemic autoimmune disorder with complex etiology and a strong genetic component. Recently, gene products involved in the interferon pathway have been under intense investigation in SLE pathogenesis. STAT1 and STAT4 are transcription factors that play key roles in the interferon and Th1 signaling pathways, making them attractive candidates for SLE susceptibility. Methods Fifty-six single-nucleotide polymorphisms (SNPs) across STAT1 and STAT4 genes on chromosome 2 were genotyped using Illumina platform as a part of extensive association study in a large collection of 9923 lupus cases and controls from different racial groups. DNA from patients and controls was obtained from peripheral blood. Principal component analyses and population based case-control association analyses were performed and the p values, FDR q values and Odds ratios with 95% confidence intervals (95% CIs) were calculated. Results We observed strong genetic associations with SLE and multiple SNPs located within the STAT4 gene in different ethnicities (Fisher combined p= 7.02×10−25). In addition to strong confirmation of the association in the 3rd intronic region of this gene reported previously, we identified additional haplotypic association across STAT4 gene and in particular a common risk haplotype that is found in multiple racial groups. In contrast, only a relatively weak suggestive association was observed with STAT1, probably due to the proximity to STAT4. Conclusion Our findings indicate that the STAT4 gene is likely to be a crucial component in SLE pathogenesis among multiple racial groups. The functional effects of this association, when revealed, might improve our understanding of the disease and provide new therapeutic targets. PMID:19333953

Characterization of recombination features and the genetic basis in multiple cattle breeds.

PubMed

Shen, Botong; Jiang, Jicai; Seroussi, Eyal; Liu, George E; Ma, Li

2018-04-27

Crossover generated by meiotic recombination is a fundamental event that facilitates meiosis and sexual reproduction. Comparative studies have shown wide variation in recombination rate among species, but the characterization of recombination features between cattle breeds has not yet been performed. Cattle populations in North America count millions, and the dairy industry has genotyped millions of individuals with pedigree information that provide a unique opportunity to study breed-level variations in recombination. Based on large pedigrees of Jersey, Ayrshire and Brown Swiss cattle with genotype data, we identified over 3.4 million maternal and paternal crossover events from 161,309 three-generation families. We constructed six breed- and sex-specific genome-wide recombination maps using 58,982 autosomal SNPs for two sexes in the three dairy cattle breeds. A comparative analysis of the six recombination maps revealed similar global recombination patterns between cattle breeds but with significant differences between sexes. We confirmed that male recombination map is 10% longer than the female map in all three cattle breeds, consistent with previously reported results in Holstein cattle. When comparing recombination hotspot regions between cattle breeds, we found that 30% and 10% of the hotspots were shared between breeds in males and females, respectively, with each breed exhibiting some breed-specific hotspots. Finally, our multiple-breed GWAS found that SNPs in eight loci affected recombination rate and that the PRDM9 gene associated with hotspot usage in multiple cattle breeds, indicating a shared genetic basis for recombination across dairy cattle breeds. Collectively, our results generated breed- and sex-specific recombination maps for multiple cattle breeds, provided a comprehensive characterization and comparison of recombination patterns between breeds, and expanded our understanding of the breed-level variations in recombination features within an important livestock species.

The polygenic risk for bipolar disorder influences brain regional function relating to visual and default state processing of emotional information.

PubMed

Dima, Danai; de Jong, Simone; Breen, Gerome; Frangou, Sophia

2016-01-01

Genome-wise association studies have identified a number of common single-nucleotide polymorphisms (SNPs), each of small effect, associated with risk to bipolar disorder (BD). Several risk-conferring SNPs have been individually shown to influence regional brain activation thus linking genetic risk for BD to altered brain function. The current study examined whether the polygenic risk score method, which models the cumulative load of all known risk-conferring SNPs, may be useful in the identification of brain regions whose function may be related to the polygenic architecture of BD. We calculated the individual polygenic risk score for BD (PGR-BD) in forty-one patients with the disorder, twenty-five unaffected first-degree relatives and forty-six unrelated healthy controls using the most recent Psychiatric Genomics Consortium data. Functional magnetic resonance imaging was used to define task-related brain activation patterns in response to facial affect and working memory processing. We found significant effects of the PGR-BD score on task-related activation irrespective of diagnostic group. There was a negative association between the PGR-BD score and activation in the visual association cortex during facial affect processing. In contrast, the PGR-BD score was associated with failure to deactivate the ventromedial prefrontal region of the default mode network during working memory processing. These results are consistent with the threshold-liability model of BD, and demonstrate the usefulness of the PGR-BD score in identifying brain functional alternations associated with vulnerability to BD. Additionally, our findings suggest that the polygenic architecture of BD is not regionally confined but impacts on the task-dependent recruitment of multiple brain regions.

Investigation of Association Between Hip Osteoarthritis Susceptibility Loci and Radiographic Proximal Femur Shape

PubMed Central

Thiagarajah, Shankar; Wilkinson, J. Mark; Panoutsopoulou, Kalliope; Day‐Williams, Aaron G.; Cootes, Timothy F.; Wallis, Gillian A.; Loughlin, John; Arden, Nigel; Birrell, Fraser; Carr, Andrew; Chapman, Kay; Deloukas, Panos; Doherty, Michael; McCaskie, Andrew; Ollier, William E. R.; Rai, Ashok; Ralston, Stuart H.; Spector, Timothy D.; Valdes, Ana M.; Wallis, Gillian A.; Mark Wilkinson, J.; Zeggini, Eleftheria

2015-01-01

Objective To test whether previously reported hip morphology or osteoarthritis (OA) susceptibility loci are associated with proximal femur shape as represented by statistical shape model (SSM) modes and as univariate or multivariate quantitative traits. Methods We used pelvic radiographs and genotype data from 929 subjects with unilateral hip OA who had been recruited previously for the Arthritis Research UK Osteoarthritis Genetics Consortium genome‐wide association study. We built 3 SSMs capturing the shape variation of the OA‐unaffected proximal femur in the entire mixed‐sex cohort and for male/female‐stratified cohorts. We selected 41 candidate single‐nucleotide polymorphisms (SNPs) previously reported as being associated with hip morphology (for replication analysis) or OA (for discovery analysis) and for which genotype data were available. We performed 2 types of analysis for genotype–phenotype associations between these SNPs and the modes of the SSMs: 1) a univariate analysis using individual SSM modes and 2) a multivariate analysis using combinations of SSM modes. Results The univariate analysis identified association between rs4836732 (within the ASTN2 gene) and mode 5 of the female SSM (P = 0.0016) and between rs6976 (within the GLT8D1 gene) and mode 7 of the mixed‐sex SSM (P = 0.0003). The multivariate analysis identified association between rs5009270 (near the IFRD1 gene) and a combination of modes 3, 4, and 9 of the mixed‐sex SSM (P = 0.0004). Evidence of associations remained significant following adjustment for multiple testing. All 3 SNPs had previously been associated with hip OA. Conclusion These de novo findings suggest that rs4836732, rs6976, and rs5009270 may contribute to hip OA susceptibility by altering proximal femur shape. PMID:25939412

Evaluation of 19 susceptibility loci of breast cancer in women of African ancestry

PubMed Central

Huo, Dezheng; Zheng, Yonglan; Ogundiran, Temidayo O.; Adebamowo, Clement; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy R.; Simon, Michael S.; John, Esther M.; Hennis, Anselm; Nemesure, Barbara; Wu, Suh-Yuh; Leske, M.Cristina; Ambs, Stefan; Niu, Qun; Zhang, Jing; Cox, Nancy J.; Olopade, Olufunmilayo I.

2012-01-01

Multiple breast cancer susceptibility loci have been identified in genome-wide association studies (GWAS) in populations of European and Asian ancestry using array chips optimized for populations of European ancestry. It is important to examine whether these loci are associated with breast cancer risk in women of African ancestry. We evaluated 25 single nucleotide polymorphisms (SNPs) at 19 loci in a pooled case–control study of breast cancer, which included 1509 cases and 1383 controls. Cases and controls were enrolled in Nigeria, Barbados and the USA; all women were of African ancestry. We found significant associations for three SNPs, which were in the same direction and of similar magnitude as those reported in previous fine-mapping studies in women of African ancestry. The allelic odds ratios were 1.24 [95% confidence interval (CI): 1.04–1.47; P = 0.018] for the rs2981578-G allele (10q26/FGFR2), 1.34 (95% CI: 1.10–1.63; P = 0.0035) for the rs9397435-G allele (6q25) and 1.12 (95% CI: 1.00–1.25; P = 0.04) for the rs3104793-C allele (16q12). Although a significant association was observed for an additional index SNP (rs3817198), it was in the opposite direction to prior GWAS studies. In conclusion, this study highlights the complexity of applying current GWAS findings across racial/ethnic groups, as none of GWAS-identified index SNPs could be replicated in women of African ancestry. Further fine-mapping studies in women of African ancestry will be needed to reveal additional and causal variants for breast cancer. PMID:22357627

Genome-wide association studies identified multiple genetic loci for body size at four growth stages in Chinese Holstein cattle.

PubMed

Zhang, Xu; Chu, Qin; Guo, Gang; Dong, Ganghui; Li, Xizhi; Zhang, Qin; Zhang, Shengli; Zhang, Zhiwu; Wang, Yachun

2017-01-01

The growth and maturity of cattle body size affect not only feed efficiency, but also productivity and longevity. Dissecting the genetic architecture of body size is critical for cattle breeding to improve both efficiency and productivity. The volume and weight of body size are indicated by several measurements. Among them, Heart Girth (HG) and Hip Height (HH) are the most important traits. They are widely used as predictors of body weight (BW). Few association studies have been conducted for HG and HH in cattle focusing on single growth stage. In this study, we extended the Genome-wide association studies to a full spectrum of four growth stages (6-, 12-, 18-, and 24-months after birth) in Chinese Holstein heifers. The whole genomic single nucleotide polymorphisms (SNPs) were obtained from the Illumina BovineSNP50 v2 BeadChip genotyped on 3,325 individuals. Estimated breeding values (EBVs) were derived for both HG and HH at the four different ages and analyzed separately for GWAS by using the Fixed and random model Circuitous Probability Unification (FarmCPU) method. In total, 27 SNPs were identified to be significantly associated with HG and HH at different growth stages. We found 66 candidate genes located nearby the associated SNPs, including nine genes that were known as highly related to development and skeletal and muscular growth. In addition, biological function analysis was performed by Ingenuity Pathway Analysis and an interaction network related to development was obtained, which contained 16 genes out of the 66 candidates. The set of putative genes provided valuable resources and can help elucidate the genomic architecture and mechanisms underlying growth traits in dairy cattle.

SiNoPsis: Single Nucleotide Polymorphisms selection and promoter profiling.

PubMed

Boloc, Daniel; Rodríguez, Natalia; Gassó, Patricia; Abril, Josep F; Bernardo, Miquel; Lafuente, Amalia; Mas, Sergi

2017-09-14

The selection of a Single Nucleotide Polymorphism (SNP) using bibliographic methods can be a very time-consuming task. Moreover, a SNP selected in this way may not be easily visualized in its genomic context by a standard user hoping to correlate it with other valuable information. Here we propose a web form built on top of Circos that can assist SNP-centred screening, based on their location in the genome and the regulatory modules they can disrupt. Its use may allow researchers to prioritize SNPs in genotyping and disease studies. SiNoPsis is bundled as a web portal. It focuses on the different structures involved in the genomic expression of a gene, especially those found in the core promoter upstream region. These structures include transcription factor binding sites (for promoter and enhancer signals), histones, and promoter flanking regions. Additionally, the tool provides eQTL and linkage disequilibrium (LD) properties for a given SNP query, yielding further clues about other indirectly associated SNPs. Possible disruptions of the aforementioned structures affecting gene transcription are reported using multiple resource databases. SiNoPsis has a simple user-friendly interface, which allows single queries by gene symbol, genomic coordinates, Ensembl gene identifiers, RefSeq transcript identifiers and SNPs. It is the only portal providing useful SNP selection based on regulatory modules and LD with functional variants in both textual and graphic modes (by properly defining the arguments and parameters needed to run Circos). SiNoPsis is freely available at https://compgen.bio.ub.edu/SiNoPsis /. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Rare versus common variants in pharmacogenetics: SLCO1B1 variation and methotrexate disposition

PubMed Central

Ramsey, Laura B.; Bruun, Gitte H.; Yang, Wenjian; Treviño, Lisa R.; Vattathil, Selina; Scheet, Paul; Cheng, Cheng; Rosner, Gary L.; Giacomini, Kathleen M.; Fan, Yiping; Sparreboom, Alex; Mikkelsen, Torben S.; Corydon, Thomas J.; Pui, Ching-Hon; Evans, William E.; Relling, Mary V.

2012-01-01

Methotrexate is used to treat autoimmune diseases and malignancies, including acute lymphoblastic leukemia (ALL). Inter-individual variation in clearance of methotrexate results in heterogeneous systemic exposure, clinical efficacy, and toxicity. In a genome-wide association study of children with ALL, we identified SLCO1B1 as harboring multiple common polymorphisms associated with methotrexate clearance. The extent of influence of rare versus common variants on pharmacogenomic phenotypes remains largely unexplored. We tested the hypothesis that rare variants in SLCO1B1 could affect methotrexate clearance and compared the influence of common versus rare variants in addition to clinical covariates on clearance. From deep resequencing of SLCO1B1 exons in 699 children, we identified 93 SNPs, 15 of which were non-synonymous (NS). Three of these NS SNPs were common, with a minor allele frequency (MAF) >5%, one had low frequency (MAF 1%–5%), and 11 were rare (MAF <1%). NS SNPs (common or rare) predicted to be functionally damaging were more likely to be found among patients with the lowest methotrexate clearance than patients with high clearance. We verified lower function in vitro of four SLCO1B1 haplotypes that were associated with reduced methotrexate clearance. In a multivariate stepwise regression analysis adjusting for other genetic and non-genetic covariates, SLCO1B1 variants accounted for 10.7% of the population variability in clearance. Of that variability, common NS variants accounted for the majority, but rare damaging NS variants constituted 17.8% of SLCO1B1's effects (1.9% of total variation) and had larger effect sizes than common NS variants. Our results show that rare variants are likely to have an important effect on pharmacogenetic phenotypes. PMID:22147369

ANGPT2 Genetic Variant Is Associated with Trauma-associated Acute Lung Injury and Altered Plasma Angiopoietin-2 Isoform Ratio

PubMed Central

Meyer, Nuala J.; Li, Mingyao; Feng, Rui; Bradfield, Jonathan; Gallop, Robert; Bellamy, Scarlett; Fuchs, Barry D.; Lanken, Paul N.; Albelda, Steven M.; Rushefski, Melanie; Aplenc, Richard; Abramova, Helen; Atochina-Vasserman, Elena N.; Beers, Michael F.; Calfee, Carolyn S.; Cohen, Mitchell J.; Pittet, Jean-Francois; Christiani, David C.; O'Keefe, Grant E.; Ware, Lorraine B.; May, Addison K.; Wurfel, Mark M.; Hakonarson, Hakon; Christie, Jason D.

2011-01-01

Rationale: Acute lung injury (ALI) acts as a complex genetic trait, yet its genetic risk factors remain incompletely understood. Large-scale genotyping has not previously been reported for ALI. Objectives: To identify ALI risk variants after major trauma using a large-scale candidate gene approach. Methods: We performed a two-stage genetic association study. We derived findings in an African American cohort (n = 222) using a cardiopulmonary disease–centric 50K single nucleotide polymorphism (SNP) array. Genotype and haplotype distributions were compared between subjects with ALI and without ALI, with adjustment for clinical factors. Top performing SNPs (P < 10−4) were tested in a multicenter European American trauma-associated ALI case-control population (n = 600 ALI; n = 2,266 population-based control subjects) for replication. The ALI-associated genomic region was sequenced, analyzed for in silico prediction of function, and plasma was assayed by ELISA and immunoblot. Measurements and Main Results: Five SNPs demonstrated a significant association with ALI after adjustment for covariates in Stage I. Two SNPs in ANGPT2 (rs1868554 and rs2442598) replicated their significant association with ALI in Stage II. rs1868554 was robust to multiple comparison correction: odds ratio 1.22 (1.06–1.40), P = 0.0047. Resequencing identified predicted novel splice sites in linkage disequilibrium with rs1868554, and immunoblots showed higher proportion of variant angiopoietin-2 (ANG2) isoform associated with rs1868554T (0.81 vs. 0.48; P = 0.038). Conclusions: An ANGPT2 region is associated with both ALI and variation in plasma angiopoietin-2 isoforms. Characterization of the variant isoform and its genetic regulation may yield important insights about ALI pathogenesis and susceptibility. PMID:21257790

Assessing variation across 8 established East Asian loci for type 2 diabetes mellitus in American Indians: Suggestive evidence for new sex-specific diabetes signals in GLIS3 and ZFAND3.

PubMed

Muller, Yunhua L; Piaggi, Paolo; Chen, Peng; Wiessner, Gregory; Okani, Chidinma; Kobes, Sayuko; Knowler, William C; Bogardus, Clifton; Hanson, Robert L; Baier, Leslie J

2017-05-01

Eight new loci for type 2 diabetes mellitus (T2DM) were identified in an East Asian genome-wide association study meta-analysis. We assess tag SNPs across these loci for associations with T2DM in American Indians. A total of 435 SNPs that tag (R 2  ≥ .85) common variation across the 8 loci were analyzed for association with T2DM (n = 7710), early onset T2DM (n = 1060), body mass index (n = 6839), insulin sensitivity (n = 555), and insulin secretion (n = 298). Tag SNPs within FITM2-R3HDML-HNF4A, GLIS3, KCNK16, and ZFAND3 associated with T2DM after accounting for locus-wide multiple testing. The T2DM association in FITM2-R3HDML-HNF4A (rs3212183; P = .0002; OR = 1.19 [1.09-1.30]) was independent from the East Asian lead SNP (rs6017317), which did not associate with T2DM in American Indians. The top signals in GLIS3 (rs7875253; P = .0004; OR = 1.23 [1.10-1.38]) and KCNK16 (rs1544050; P = .002; OR = 1.16 [1.06-1.27]) were attenuated after adjustment for the East Asian lead SNPs (rs7041847 in GLIS3; rs1535500 in KCNK16), both of which also associated with T2DM in American Indians (P = .02; OR = 1.11 [1.01-1.21]; P = .007; OR = 1.19 [1.05-1.36] respectively). The top SNP in ZFAND3 (rs9470794; P = .002; OR = 1.43 [1.14-1.80]) was the identical East Asian lead SNP. Additional SNPs in GLIS3 (rs180867004) and ZFAND3 (rs4714120 and rs9470701) had significant genotype × sex interactions (P ≤ .008). The GLIS3 SNP (rs180867004) associated with T2DM only in men (P = .00006, OR = 1.94 [1.40-2.68]). The ZFAND3 SNPs (rs4714120 and rs9470701) associated with T2DM only in women (P = .0002, OR = 1.35 [1.16-1.59]; P = .0003, OR = 1.37 [1.16-1.63] respectively). Replication of lead T2DM SNPs in GLIS3, KCNK16, and ZFAND3 was observed in American Indians. Sex-specific T2DM signals in GLIS3 and ZFAND3, which are distinct from the East Asian GWAS signals, were also identified. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Genome Wide Association Study of Sepsis in Extremely Premature Infants

PubMed Central

Srinivasan, Lakshmi; Page, Grier; Kirpalani, Haresh; Murray, Jeffrey C.; Das, Abhik; Higgins, Rosemary D.; Carlo, Waldemar A.; Bell, Edward F.; Goldberg, Ronald N.; Schibler, Kurt; Sood, Beena G.; Stevenson, David K.; Stoll, Barbara J.; Van Meurs, Krisa P.; Johnson, Karen J.; Levy, Joshua; McDonald, Scott A.; Zaterka-Baxter, Kristin M.; Kennedy, Kathleen A.; Sánchez, Pablo J.; Duara, Shahnaz; Walsh, Michele C.; Shankaran, Seetha; Wynn, James L.; Cotten, C. Michael

2017-01-01

Objective To identify genetic variants associated with sepsis (early and late-onset) using a genome wide association (GWA) analysis in a cohort of extremely premature infants. Study Design Previously generated GWA data from the Neonatal Research Network’s anonymized genomic database biorepository of extremely premature infants were used for this study. Sepsis was defined as culture-positive early-onset or late-onset sepsis or culture-proven meningitis. Genomic and whole genome amplified DNA was genotyped for 1.2 million single nucleotide polymorphisms (SNPs); 91% of SNPs were successfully genotyped. We imputed 7.2 million additional SNPs. P values and false discovery rates were calculated from multivariate logistic regression analysis adjusting for gender, gestational age and ancestry. Target statistical value was p<10−5. Secondary analyses assessed associations of SNPs with pathogen type. Pathway analyses were also run on primary and secondary end points. Results Data from 757 extremely premature infants were included: 351 infants with sepsis and 406 infants without sepsis. No SNPs reached genome-wide significance levels (5×10−8); two SNPs in proximity to FOXC2 and FOXL1 genes achieved target levels of significance. In secondary analyses, SNPs for ELMO1, IRAK2 (Gram positive sepsis), RALA, IMMP2L (Gram negative sepsis) and PIEZO2 (fungal sepsis) met target significance levels. Pathways associated with sepsis and Gram negative sepsis included gap junctions, fibroblast growth factor receptors, regulators of cell division and Interleukin-1 associated receptor kinase 2 (p values<0.001 and FDR<20%). Conclusions No SNPs met genome-wide significance in this cohort of ELBW infants; however, areas of potential association and pathways meriting further study were identified. PMID:28283553

Genome-wide association study of alcohol dependence

PubMed Central

Treutlein, Jens; Cichon, Sven; Ridinger, Monika; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Moessner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Fehr, Christoph; Scherbaum, Norbert; Steffens, Michael; Ludwig, Kerstin U.; Frank, Josef; Wichmann, H.- Erich; Schreiber, Stefan; Dragano, Nico; Sommer, Wolfgang; Leonardi-Essmann, Fernando; Lourdusamy, Anbarasu; Gebicke-Haerter, Peter; Wienker, Thomas F.; Sullivan, Patrick F.; Nöthen, Markus M.; Kiefer, Falk; Spanagel, Rainer; Mann, Karl; Rietschel, Marcella

2014-01-01

Context Identification of genes contributing to alcohol dependence will improve our understanding of the mechanisms underlying this disorder. Objective To identify susceptibility genes for alcohol dependence through a genome-wide association study (GWAS) and follow-up study in a population of German male inpatients with an early age at onset. Design The GWAS included 487 male inpatients with DSM-IV alcohol dependence with an age at onset below 28 years and 1,358 population based control individuals. The follow-up study included 1,024 male inpatients and 996 age-matched male controls. All subjects were of German descent. The GWAS tested 524,396 single nucleotide polymorphisms (SNPs). All SNPs with p<10-4 were subjected to the follow-up study. In addition, nominally significant SNPs from those genes that had also shown expression changes in rat brains after chronic alcohol consumption were selected for the follow-up step. Results The GWAS produced 121 SNPs with nominal p<10-4. These, together with 19 additional SNPs from homologs of rat genes showing differential expression, were genotyped in the follow-up sample. Fifteen SNPs showed significant association with the same allele as in the GWAS. In the combined analysis, two closely linked intergenic SNPs met genome-wide significance (rs7590720 p=9.72×10-9; rs1344694 p=1.69×10-8). They are located on chromosome 2q35, a region which has been implicated in linkage studies for alcohol phenotypes. Nine SNPs were located in genes, including CDH13 and ADH1C genes which have been reported to be associated with alcohol dependence. Conclusion This is the first GWAS and follow-up study to identify a genome-wide significant association in alcohol dependence. Further independent studies are required to confirm these findings. PMID:19581569

Is there a genetic cause for cancer cachexia? – a clinical validation study in 1797 patients

PubMed Central

Solheim, T S; Fayers, P M; Fladvad, T; Tan, B; Skorpen, F; Fearon, K; Baracos, V E; Klepstad, P; Strasser, F; Kaasa, S

2011-01-01

Background: Cachexia has major impact on cancer patients' morbidity and mortality. Future development of cachexia treatment needs methods for early identification of patients at risk. The aim of the study was to validate nine single-nucleotide polymorphisms (SNPs) previously associated with cachexia, and to explore 182 other candidate SNPs with the potential to be involved in the pathophysiology. Method: A total of 1797 cancer patients, classified as either having severe cachexia, mild cachexia or no cachexia, were genotyped. Results: After allowing for multiple testing, there was no statistically significant association between any of the SNPs analysed and the cachexia groups. However, consistent with prior reports, two SNPs from the acylpeptide hydrolase (APEH) gene showed suggestive statistical significance (P=0.02; OR, 0.78). Conclusion: This study failed to detect any significant association between any of the SNPs analysed and cachexia; although two SNPs from the APEH gene had a trend towards significance. The APEH gene encodes the enzyme APEH, postulated to be important in the endpoint of the ubiquitin system and thus the breakdown of proteins into free amino acids. In cachexia, there is an extensive breakdown of muscle proteins and an increase in the production of acute phase proteins in the liver. PMID:21934689

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Development of a Medium Density Combined-Species SNP Array for Pacific and European Oysters (Crassostrea gigas and Ostrea edulis).

PubMed

Gutierrez, Alejandro P; Turner, Frances; Gharbi, Karim; Talbot, Richard; Lowe, Natalie R; Peñaloza, Carolina; McCullough, Mark; Prodöhl, Paulo A; Bean, Tim P; Houston, Ross D

2017-07-05

SNP arrays are enabling tools for high-resolution studies of the genetic basis of complex traits in farmed and wild animals. Oysters are of critical importance in many regions from both an ecological and economic perspective, and oyster aquaculture forms a key component of global food security. The aim of our study was to design a combined-species, medium density SNP array for Pacific oyster ( Crassostrea gigas ) and European flat oyster ( Ostrea edulis ), and to test the performance of this array on farmed and wild populations from multiple locations, with a focus on European populations. SNP discovery was carried out by whole-genome sequencing (WGS) of pooled genomic DNA samples from eight C. gigas populations, and restriction site-associated DNA sequencing (RAD-Seq) of 11 geographically diverse O. edulis populations. Nearly 12 million candidate SNPs were discovered and filtered based on several criteria, including preference for SNPs segregating in multiple populations and SNPs with monomorphic flanking regions. An Affymetrix Axiom Custom Array was created and tested on a diverse set of samples ( n = 219) showing ∼27 K high quality SNPs for C. gigas and ∼11 K high quality SNPs for O. edulis segregating in these populations. A high proportion of SNPs were segregating in each of the populations, and the array was used to detect population structure and levels of linkage disequilibrium (LD). Further testing of the array on three C. gigas nuclear families ( n = 165) revealed that the array can be used to clearly distinguish between both families based on identity-by-state (IBS) clustering parental assignment software. This medium density, combined-species array will be publicly available through Affymetrix, and will be applied for genome-wide association and evolutionary genetic studies, and for genomic selection in oyster breeding programs. Copyright © 2017 Gutierrez et al.

Genotyping of 75 SNPs using arrays for individual identification in five population groups.

PubMed

Hwa, Hsiao-Lin; Wu, Lawrence Shih Hsin; Lin, Chun-Yen; Huang, Tsun-Ying; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

2016-01-01

Single nucleotide polymorphism (SNP) typing offers promise to forensic genetics. Various strategies and panels for analyzing SNP markers for individual identification have been published. However, the best panels with fewer identity SNPs for all major population groups are still under discussion. This study aimed to find more autosomal SNPs with high heterozygosity for individual identification among Asian populations. Ninety-six autosomal SNPs of 502 DNA samples from unrelated individuals of five population groups (208 Taiwanese Han, 83 Filipinos, 62 Thais, 69 Indonesians, and 80 individuals with European, Near Eastern, or South Asian ancestry) were analyzed using arrays in an initial screening, and 75 SNPs (group A, 46 newly selected SNPs; groups B, 29 SNPs based on a previous SNP panel) were selected for further statistical analyses. Some SNPs with high heterozygosity from Asian populations were identified. The combined random match probability of the best 40 and 45 SNPs was between 3.16 × 10(-17) and 7.75 × 10(-17) and between 2.33 × 10(-19) and 7.00 × 10(-19), respectively, in all five populations. These loci offer comparable power to short tandem repeats (STRs) for routine forensic profiling. In this study, we demonstrated the population genetic characteristics and forensic parameters of 75 SNPs with high heterozygosity from five population groups. This SNPs panel can provide valuable genotypic information and can be helpful in forensic casework for individual identification among these populations.

A genome-wide association search for type 2 diabetes genes in African Americans.

PubMed

Palmer, Nicholette D; McDonough, Caitrin W; Hicks, Pamela J; Roh, Bong H; Wing, Maria R; An, S Sandy; Hester, Jessica M; Cooke, Jessica N; Bostrom, Meredith A; Rudock, Megan E; Talbert, Matthew E; Lewis, Joshua P; Ferrara, Assiamira; Lu, Lingyi; Ziegler, Julie T; Sale, Michele M; Divers, Jasmin; Shriner, Daniel; Adeyemo, Adebowale; Rotimi, Charles N; Ng, Maggie C Y; Langefeld, Carl D; Freedman, Barry I; Bowden, Donald W; Voight, Benjamin F; Scott, Laura J; Steinthorsdottir, Valgerdur; Morris, Andrew P; Dina, Christian; Welch, Ryan P; Zeggini, Eleftheria; Huth, Cornelia; Aulchenko, Yurii S; Thorleifsson, Gudmar; McCulloch, Laura J; Ferreira, Teresa; Grallert, Harald; Amin, Najaf; Wu, Guanming; Willer, Cristen J; Raychaudhuri, Soumya; McCarroll, Steve A; Langenberg, Claudia; Hofmann, Oliver M; Dupuis, Josée; Qi, Lu; Segrè, Ayellet V; van Hoek, Mandy; Navarro, Pau; Ardlie, Kristin; Balkau, Beverley; Benediktsson, Rafn; Bennett, Amanda J; Blagieva, Roza; Boerwinkle, Eric; Bonnycastle, Lori L; Boström, Kristina Bengtsson; Bravenboer, Bert; Bumpstead, Suzannah; Burtt, Noël P; Charpentier, Guillaume; Chines, Peter S; Cornelis, Marilyn; Couper, David J; Crawford, Gabe; Doney, Alex S F; Elliott, Katherine S; Elliott, Amanda L; Erdos, Michael R; Fox, Caroline S; Franklin, Christopher S; Ganser, Martha; Gieger, Christian; Grarup, Niels; Green, Todd; Griffin, Simon; Groves, Christopher J; Guiducci, Candace; Hadjadj, Samy; Hassanali, Neelam; Herder, Christian; Isomaa, Bo; Jackson, Anne U; Johnson, Paul R V; Jørgensen, Torben; Kao, Wen H L; Klopp, Norman; Kong, Augustine; Kraft, Peter; Kuusisto, Johanna; Lauritzen, Torsten; Li, Man; Lieverse, Aloysius; Lindgren, Cecilia M; Lyssenko, Valeriya; Marre, Michel; Meitinger, Thomas; Midthjell, Kristian; Morken, Mario A; Narisu, Narisu; Nilsson, Peter; Owen, Katharine R; Payne, Felicity; Perry, John R B; Petersen, Ann-Kristin; Platou, Carl; Proença, Christine; Prokopenko, Inga; Rathmann, Wolfgang; Rayner, N William; Robertson, Neil R; Rocheleau, Ghislain; Roden, Michael; Sampson, Michael J; Saxena, Richa; Shields, Beverley M; Shrader, Peter; Sigurdsson, Gunnar; Sparsø, Thomas; Strassburger, Klaus; Stringham, Heather M; Sun, Qi; Swift, Amy J; Thorand, Barbara; Tichet, Jean; Tuomi, Tiinamaija; van Dam, Rob M; van Haeften, Timon W; van Herpt, Thijs; van Vliet-Ostaptchouk, Jana V; Walters, G Bragi; Weedon, Michael N; Wijmenga, Cisca; Witteman, Jacqueline; Bergman, Richard N; Cauchi, Stephane; Collins, Francis S; Gloyn, Anna L; Gyllensten, Ulf; Hansen, Torben; Hide, Winston A; Hitman, Graham A; Hofman, Albert; Hunter, David J; Hveem, Kristian; Laakso, Markku; Mohlke, Karen L; Morris, Andrew D; Palmer, Colin N A; Pramstaller, Peter P; Rudan, Igor; Sijbrands, Eric; Stein, Lincoln D; Tuomilehto, Jaakko; Uitterlinden, Andre; Walker, Mark; Wareham, Nicholas J; Watanabe, Richard M; Abecasis, Goncalo R; Boehm, Bernhard O; Campbell, Harry; Daly, Mark J; Hattersley, Andrew T; Hu, Frank B; Meigs, James B; Pankow, James S; Pedersen, Oluf; Wichmann, H-Erich; Barroso, Inês; Florez, Jose C; Frayling, Timothy M; Groop, Leif; Sladek, Rob; Thorsteinsdottir, Unnur; Wilson, James F; Illig, Thomas; Froguel, Philippe; van Duijn, Cornelia M; Stefansson, Kari; Altshuler, David; Boehnke, Michael; McCarthy, Mark I; Soranzo, Nicole; Wheeler, Eleanor; Glazer, Nicole L; Bouatia-Naji, Nabila; Mägi, Reedik; Randall, Joshua; Johnson, Toby; Elliott, Paul; Rybin, Denis; Henneman, Peter; Dehghan, Abbas; Hottenga, Jouke Jan; Song, Kijoung; Goel, Anuj; Egan, Josephine M; Lajunen, Taina; Doney, Alex; Kanoni, Stavroula; Cavalcanti-Proença, Christine; Kumari, Meena; Timpson, Nicholas J; Zabena, Carina; Ingelsson, Erik; An, Ping; O'Connell, Jeffrey; Luan, Jian'an; Elliott, Amanda; McCarroll, Steven A; Roccasecca, Rosa Maria; Pattou, François; Sethupathy, Praveen; Ariyurek, Yavuz; Barter, Philip; Beilby, John P; Ben-Shlomo, Yoav; Bergmann, Sven; Bochud, Murielle; Bonnefond, Amélie; Borch-Johnsen, Knut; Böttcher, Yvonne; Brunner, Eric; Bumpstead, Suzannah J; Chen, Yii-Der Ida; Chines, Peter; Clarke, Robert; Coin, Lachlan J M; Cooper, Matthew N; Crisponi, Laura; Day, Ian N M; de Geus, Eco J C; Delplanque, Jerome; Fedson, Annette C; Fischer-Rosinsky, Antje; Forouhi, Nita G; Frants, Rune; Franzosi, Maria Grazia; Galan, Pilar; Goodarzi, Mark O; Graessler, Jürgen; Grundy, Scott; Gwilliam, Rhian; Hallmans, Göran; Hammond, Naomi; Han, Xijing; Hartikainen, Anna-Liisa; Hayward, Caroline; Heath, Simon C; Hercberg, Serge; Hicks, Andrew A; Hillman, David R; Hingorani, Aroon D; Hui, Jennie; Hung, Joe; Jula, Antti; Kaakinen, Marika; Kaprio, Jaakko; Kesaniemi, Y Antero; Kivimaki, Mika; Knight, Beatrice; Koskinen, Seppo; Kovacs, Peter; Kyvik, Kirsten Ohm; Lathrop, G Mark; Lawlor, Debbie A; Le Bacquer, Olivier; Lecoeur, Cécile; Li, Yun; Mahley, Robert; Mangino, Massimo; Manning, Alisa K; Martínez-Larrad, María Teresa; McAteer, Jarred B; McPherson, Ruth; Meisinger, Christa; Melzer, David; Meyre, David; Mitchell, Braxton D; Mukherjee, Sutapa; Naitza, Silvia; Neville, Matthew J; Oostra, Ben A; Orrù, Marco; Pakyz, Ruth; Paolisso, Giuseppe; Pattaro, Cristian; Pearson, Daniel; Peden, John F; Pedersen, Nancy L; Perola, Markus; Pfeiffer, Andreas F H; Pichler, Irene; Polasek, Ozren; Posthuma, Danielle; Potter, Simon C; Pouta, Anneli; Province, Michael A; Psaty, Bruce M; Rayner, Nigel W; Rice, Kenneth; Ripatti, Samuli; Rivadeneira, Fernando; Rolandsson, Olov; Sandbaek, Annelli; Sandhu, Manjinder; Sanna, Serena; Sayer, Avan Aihie; Scheet, Paul; Seedorf, Udo; Sharp, Stephen J; Shields, Beverley; Sijbrands, Eric J G; Silveira, Angela; Simpson, Laila; Singleton, Andrew; Smith, Nicholas L; Sovio, Ulla; Swift, Amy; Syddall, Holly; Syvänen, Ann-Christine; Tanaka, Toshiko; Tönjes, Anke; Uitterlinden, André G; van Dijk, Ko Willems; Varma, Dhiraj; Visvikis-Siest, Sophie; Vitart, Veronique; Vogelzangs, Nicole; Waeber, Gérard; Wagner, Peter J; Walley, Andrew; Ward, Kim L; Watkins, Hugh; Wild, Sarah H; Willemsen, Gonneke; Witteman, Jaqueline C M; Yarnell, John W G; Zelenika, Diana; Zethelius, Björn; Zhai, Guangju; Zhao, Jing Hua; Zillikens, M Carola; Borecki, Ingrid B; Loos, Ruth J F; Meneton, Pierre; Magnusson, Patrik K E; Nathan, David M; Williams, Gordon H; Silander, Kaisa; Salomaa, Veikko; Smith, George Davey; Bornstein, Stefan R; Schwarz, Peter; Spranger, Joachim; Karpe, Fredrik; Shuldiner, Alan R; Cooper, Cyrus; Dedoussis, George V; Serrano-Ríos, Manuel; Lind, Lars; Palmer, Lyle J; Franks, Paul W; Ebrahim, Shah; Marmot, Michael; Kao, W H Linda; Pramstaller, Peter Paul; Wright, Alan F; Stumvoll, Michael; Hamsten, Anders; Buchanan, Thomas A; Valle, Timo T; Rotter, Jerome I; Siscovick, David S; Penninx, Brenda W J H; Boomsma, Dorret I; Deloukas, Panos; Spector, Timothy D; Ferrucci, Luigi; Cao, Antonio; Scuteri, Angelo; Schlessinger, David; Uda, Manuela; Ruokonen, Aimo; Jarvelin, Marjo-Riitta; Waterworth, Dawn M; Vollenweider, Peter; Peltonen, Leena; Mooser, Vincent; Sladek, Robert

2012-01-01

African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS) using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD) and 1029 population-based controls. The most significant SNPs (n = 550 independent loci) were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci) were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071), were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05). Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10(-8)). SNP rs7560163 (P = 7.0×10(-9), OR (95% CI) = 0.75 (0.67-0.84)) is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217) were associated with T2DM (P<0.05) and reached more nominal levels of significance (P<2.5×10(-5)) in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations.

Sequence variants in oxytocin pathway genes and preterm birth: a candidate gene association study

PubMed Central

2013-01-01

Background Preterm birth (PTB) is a complex disorder associated with significant neonatal mortality and morbidity and long-term adverse health consequences. Multiple lines of evidence suggest that genetic factors play an important role in its etiology. This study was designed to identify genetic variation associated with PTB in oxytocin pathway genes whose role in parturition is well known. Methods To identify common genetic variants predisposing to PTB, we genotyped 16 single nucleotide polymorphisms (SNPs) in the oxytocin (OXT), oxytocin receptor (OXTR), and leucyl/cystinyl aminopeptidase (LNPEP) genes in 651 case infants from the U.S. and one or both of their parents. In addition, we examined the role of rare genetic variation in susceptibility to PTB by conducting direct sequence analysis of OXTR in 1394 cases and 1112 controls from the U.S., Argentina, Denmark, and Finland. This study was further extended to maternal triads (maternal grandparents-mother of a case infant, N=309). We also performed in vitro analysis of selected rare OXTR missense variants to evaluate their functional importance. Results Maternal genetic effect analysis of the SNP genotype data revealed four SNPs in LNPEP that show significant association with prematurity. In our case–control sequence analysis, we detected fourteen coding variants in exon 3 of OXTR, all but four of which were found in cases only. Of the fourteen variants, three were previously unreported novel rare variants. When the sequence data from the maternal triads were analyzed using the transmission disequilibrium test, two common missense SNPs (rs4686302 and rs237902) in OXTR showed suggestive association for three gestational age subgroups. In vitro functional assays showed a significant difference in ligand binding between wild-type and two mutant receptors. Conclusions Our study suggests an association between maternal common polymorphisms in LNPEP and susceptibility to PTB. Maternal OXTR missense SNPs rs4686302 and rs237902 may have gestational age-dependent effects on prematurity. Most of the OXTR rare variants identified do not appear to significantly contribute to the risk of PTB, but those shown to affect receptor function in our in vitro study warrant further investigation. Future studies with larger sample sizes are needed to confirm the findings of this study. PMID:23889750

Analysis of Major Genome Loci Underlying Artemisinin Resistance and pfmdr1 Copy Number in pre- and post-ACTs in Western Kenya

PubMed Central

Ngalah, Bidii S.; Ingasia, Luiser A.; Cheruiyot, Agnes C.; Chebon, Lorna J.; Juma, Dennis W.; Muiruri, Peninah; Onyango, Irene; Ogony, Jack; Yeda, Redemptah A.; Cheruiyot, Jelagat; Mbuba, Emmanuel; Mwangoka, Grace; Achieng, Angela O.; Ng'ang'a, Zipporah; Andagalu, Ben; Akala, Hoseah M.; Kamau, Edwin

2015-01-01

Genetic analysis of molecular markers is critical in tracking the emergence and/or spread of artemisinin resistant parasites. Clinical isolates collected in western Kenya pre- and post- introduction of artemisinin combination therapies (ACTs) were genotyped at SNP positions in regions of strong selection signatures on chromosome 13 and 14, as described in Southeast Asia (SEA). Twenty five SNPs were genotyped using Sequenom MassArray and pfmdr1 gene copy number by real-time PCR. Parasite clearance half-life and in vitro drug sensitivity testing were performed using standard methods. One hundred twenty nine isolates were successfully analyzed. Fifteen SNPs were present in pre-ACTs isolates and six in post-ACTs. None of the SNPs showed association with parasite clearance half-life. Post-ACTs parasites had significantly higher pfmdr1 copy number compared to pre-ACTs. Seven of eight parasites with multiple pfmdr1 were post-ACTs. When in vitro IC50s were compared for parasites with single vs. multiple gene copies, only amodiaquine and piperaquine reached statistical significance. Data showed SNPs on chromosome 13 and 14 had different frequency and trend in western Kenya parasites compared SEA. Increase in pfmdr1 gene copy is consistent with recent studies in African parasites. Data suggests genetic signature of artemisinin resistance in Africa might be different from SEA. PMID:25655315

Using ancestry-informative markers to identify fine structure across 15 populations of European origin.

PubMed

Huckins, Laura M; Boraska, Vesna; Franklin, Christopher S; Floyd, James A B; Southam, Lorraine; Sullivan, Patrick F; Bulik, Cynthia M; Collier, David A; Tyler-Smith, Chris; Zeggini, Eleftheria; Tachmazidou, Ioanna

2014-10-01

The Wellcome Trust Case Control Consortium 3 anorexia nervosa genome-wide association scan includes 2907 cases from 15 different populations of European origin genotyped on the Illumina 670K chip. We compared methods for identifying population stratification, and suggest list of markers that may help to counter this problem. It is usual to identify population structure in such studies using only common variants with minor allele frequency (MAF) >5%; we find that this may result in highly informative SNPs being discarded, and suggest that instead all SNPs with MAF >1% may be used. We established informative axes of variation identified via principal component analysis and highlight important features of the genetic structure of diverse European-descent populations, some studied for the first time at this scale. Finally, we investigated the substructure within each of these 15 populations and identified SNPs that help capture hidden stratification. This work can provide information regarding the designing and interpretation of association results in the International Consortia.

Genome-wide genetic variation and comparison of fruit-associated traits between kumquat (Citrus japonica) and Clementine mandarin (Citrus clementina).

PubMed

Liu, Tian-Jia; Li, Yong-Ping; Zhou, Jing-Jing; Hu, Chun-Gen; Zhang, Jin-Zhi

2018-03-01

The comprehensive genetic variation of two citrus species were analyzed at genome and transcriptome level. A total of 1090 differentially expressed genes were found during fruit development by RNA-sequencing. Fruit size (fruit equatorial diameter) and weight (fresh weight) are the two most important components determining yield and consumer acceptability for many horticultural crops. However, little is known about the genetic control of these traits. Here, we performed whole-genome resequencing to reveal the comprehensive genetic variation of the fruit development between kumquat (Citrus japonica) and Clementine mandarin (Citrus clementina). In total, 5,865,235 single-nucleotide polymorphisms (SNPs) and 414,447 insertions/deletions (InDels) were identified in the two citrus species. Based on integrative analysis of genome and transcriptome of fruit, 640,801 SNPs and 20,733 InDels were identified. The features, genomic distribution, functional effect, and other characteristics of these genetic variations were explored. RNA-sequencing identified 1090 differentially expressed genes (DEGs) during fruit development of kumquat and Clementine mandarin. Gene Ontology revealed that these genes were involved in various molecular functional and biological processes. In addition, the genetic variation of 939 DEGs and 74 multiple fruit development pathway genes from previous reports were also identified. A global survey identified 24,237 specific alternative splicing events in the two citrus species and showed that intron retention is the most prevalent pattern of alternative splicing. These genome variation data provide a foundation for further exploration of citrus diversity and gene-phenotype relationships and for future research on molecular breeding to improve kumquat, Clementine mandarin and related species.

Common variants identified in genome-wide association studies of testicular germ cell tumour: an update, biological insights and clinical application.

PubMed

Litchfield, K; Shipley, J; Turnbull, C

2015-01-01

Testicular germ cell tumour (TGCT) is the most common cause of cancer in young men (aged 15-45 years) in many populations. Multiple genome-wide association studies (GWAS) of TGCT have now been conducted, yielding over 25 disease-associated single-nucleotide polymorphism (SNP)s at 19 independent loci. The genes at these loci have provided rich biological and genetic insight into possible mechanisms underlying testicular germ cell oncogenesis. In this review, we summarize these mechanisms which can be grouped into five distinct categories: KIT/KITLG signalling, other pathways of male germ cell development/differentiation, telomerase function, microtubule assembly and DNA damage repair. The TGCT risk markers identified through GWAS include individual SNPs carrying per allele odds ratios (OR) in excess of 2.5. These ORs are among the highest reported in GWAS of any cancer type, hence suggesting a potential clinical utility in risk determination. Here, we present analysis of such an approach, using polygenic risk scores to calculate the combined effect of all risk loci on overall TGCT risk and discuss how a potential screening strategy may fit within a broader clinical context. © 2015 American Society of Andrology and European Academy of Andrology.

Immunochip Analysis Identifies Multiple Susceptibility Loci for Systemic Sclerosis

PubMed Central

Mayes, Maureen D.; Bossini-Castillo, Lara; Gorlova, Olga; Martin, José Ezequiel; Zhou, Xiaodong; Chen, Wei V.; Assassi, Shervin; Ying, Jun; Tan, Filemon K.; Arnett, Frank C.; Reveille, John D.; Guerra, Sandra; Teruel, María; Carmona, Francisco David; Gregersen, Peter K.; Lee, Annette T.; López-Isac, Elena; Ochoa, Eguzkine; Carreira, Patricia; Simeón, Carmen Pilar; Castellví, Iván; González-Gay, Miguel Ángel; Ortego-Centeno, Norberto; Ríos, Raquel; Callejas, José Luis; Navarrete, Nuria; García Portales, Rosa; Camps, María Teresa; Fernández-Nebro, Antonio; González-Escribano, María F.; Sánchez-Román, Julio; García-Hernández, Francisco José; Castillo, María Jesús; Aguirre, María Ángeles; Gómez-Gracia, Inmaculada; Fernández-Gutiérrez, Benjamín; Rodríguez-Rodríguez, Luis; Vicente, Esther; Andreu, José Luis; Fernández de Castro, Mónica; García de la Peña, Paloma; López-Longo, Francisco Javier; Martínez, Lina; Fonollosa, Vicente; Espinosa, Gerard; Tolosa, Carlos; Pros, Anna; Rodríguez Carballeira, Mónica; Narváez, Francisco Javier; Rubio Rivas, Manel; Ortiz Santamaría, Vera; Díaz, Bernardino; Trapiella, Luis; Freire, María del Carmen; Sousa, Adrián; Egurbide, María Victoria; Fanlo Mateo, Patricia; Sáez-Comet, Luis; Díaz, Federico; Hernández, Vanesa; Beltrán, Emma; Román-Ivorra, José Andrés; Grau, Elena; Alegre Sancho, Juan José; Blanco García, Francisco J.; Oreiro, Natividad; Fernández Sueiro, Luis; Zhernakova, Alexandra; Padyukov, Leonid; Alarcón-Riquelme, Marta; Wijmenga, Cisca; Brown, Matthew; Beretta, Lorenzo; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg H.W.; Voskuyl, Alexandre E.; Schuerwegh, Annemie J.; Hesselstrand, Roger; Nordin, Annika; Airó, Paolo; Lunardi, Claudio; Shiels, Paul; van Laar, Jacob M.; Herrick, Ariane; Worthington, Jane; Denton, Christopher; Wigley, Fredrick M.; Hummers, Laura K.; Varga, John; Hinchcliff, Monique E.; Baron, Murray; Hudson, Marie; Pope, Janet E.; Furst, Daniel E.; Khanna, Dinesh; Phillips, Kristin; Schiopu, Elena; Segal, Barbara M.; Molitor, Jerry A.; Silver, Richard M.; Steen, Virginia D.; Simms, Robert W.; Lafyatis, Robert A.; Fessler, Barri J.; Frech, Tracy M.; AlKassab, Firas; Docherty, Peter; Kaminska, Elzbieta; Khalidi, Nader; Jones, Henry Niall; Markland, Janet; Robinson, David; Broen, Jasper; Radstake, Timothy R.D.J.; Fonseca, Carmen; Koeleman, Bobby P.; Martin, Javier

2014-01-01

In this study, 1,833 systemic sclerosis (SSc) cases and 3,466 controls were genotyped with the Immunochip array. Classical alleles, amino acid residues, and SNPs across the human leukocyte antigen (HLA) region were imputed and tested. These analyses resulted in a model composed of six polymorphic amino acid positions and seven SNPs that explained the observed significant associations in the region. In addition, a replication step comprising 4,017 SSc cases and 5,935 controls was carried out for several selected non-HLA variants, reaching a total of 5,850 cases and 9,401 controls of European ancestry. Following this strategy, we identified and validated three SSc risk loci, including DNASE1L3 at 3p14, the SCHIP1-IL12A locus at 3q25, and ATG5 at 6q21, as well as a suggested association of the TREH-DDX6 locus at 11q23. The associations of several previously reported SSc risk loci were validated and further refined, and the observed peak of association in PXK was related to DNASE1L3. Our study has increased the number of known genetic associations with SSc, provided further insight into the pleiotropic effects of shared autoimmune risk factors, and highlighted the power of dense mapping for detecting previously overlooked susceptibility loci. PMID:24387989

An APOE-independent cis-eSNP on chromosome 19q13.32 influences tau levels and late-onset Alzheimer's disease risk.

PubMed

Rao, Shuquan; Ghani, Mahdi; Guo, Zhiyun; Deming, Yuetiva; Wang, Kesheng; Sims, Rebecca; Mao, Canquan; Yao, Yao; Cruchaga, Carlos; Stephan, Dietrich A; Rogaeva, Ekaterina

2018-06-01

Although multiple susceptibility loci for late-onset Alzheimer's disease (LOAD) have been identified, a large portion of the genetic risk for this disease remains unexplained. LOAD risk may be associated with single-nucleotide polymorphisms responsible for changes in gene expression (eSNPs). To detect eSNPs associated with LOAD, we integrated data from LOAD genome-wide association studies and expression quantitative trait loci using Sherlock (a Bayesian statistical method). We identified a cis-regulatory eSNP (rs2927438) located on chromosome 19q13.32, for which subsequent analyses confirmed the association with both LOAD risk and the expression level of several nearby genes. Importantly, rs2927438 may represent an APOE-independent LOAD eSNP according to the weak linkage disequilibrium of rs2927438 with the 2 polymorphisms (rs7412 and rs429358) defining the APOE-ε2, -ε3, and -ε4 alleles. Furthermore, rs2927438 does not influence chromatin interaction events at the APOE locus or cis-regulation of APOE expression. Further exploratory analysis revealed that rs2927438 is significantly associated with tau levels in the cerebrospinal fluid. Our findings suggest that rs2927438 may confer APOE-independent risk for LOAD. Copyright © 2017 Elsevier Inc. All rights reserved.

Limitations of variable number of tandem repeat typing identified through whole genome sequencing of Mycobacterium avium subsp. paratuberculosis on a national and herd level.

PubMed

Ahlstrom, Christina; Barkema, Herman W; Stevenson, Karen; Zadoks, Ruth N; Biek, Roman; Kao, Rowland; Trewby, Hannah; Haupstein, Deb; Kelton, David F; Fecteau, Gilles; Labrecque, Olivia; Keefe, Greg P; McKenna, Shawn L B; De Buck, Jeroen

2015-03-08

Mycobacterium avium subsp. paratuberculosis (MAP), the causative bacterium of Johne's disease in dairy cattle, is widespread in the Canadian dairy industry and has significant economic and animal welfare implications. An understanding of the population dynamics of MAP can be used to identify introduction events, improve control efforts and target transmission pathways, although this requires an adequate understanding of MAP diversity and distribution between herds and across the country. Whole genome sequencing (WGS) offers a detailed assessment of the SNP-level diversity and genetic relationship of isolates, whereas several molecular typing techniques used to investigate the molecular epidemiology of MAP, such as variable number of tandem repeat (VNTR) typing, target relatively unstable repetitive elements in the genome that may be too unpredictable to draw accurate conclusions. The objective of this study was to evaluate the diversity of bovine MAP isolates in Canadian dairy herds using WGS and then determine if VNTR typing can distinguish truly related and unrelated isolates. Phylogenetic analysis based on 3,039 SNPs identified through WGS of 124 MAP isolates identified eight genetically distinct subtypes in dairy herds from seven Canadian provinces, with the dominant type including over 80% of MAP isolates. VNTR typing of 527 MAP isolates identified 12 types, including "bison type" isolates, from seven different herds. At a national level, MAP isolates differed from each other by 1-2 to 239-240 SNPs, regardless of whether they belonged to the same or different VNTR types. A herd-level analysis of MAP isolates demonstrated that VNTR typing may both over-estimate and under-estimate the relatedness of MAP isolates found within a single herd. The presence of multiple MAP subtypes in Canada suggests multiple introductions into the country including what has now become one dominant type, an important finding for Johne's disease control. VNTR typing often failed to identify closely and distantly related isolates, limiting the applicability of using this typing scheme to study the molecular epidemiology of MAP at a national and herd-level.

Identification of genetic variants predictive of early onset pancreatic cancer through a population science analysis of functional genomic datasets

PubMed Central

Chen, Jinyun; Wu, Xifeng; Huang, Yujing; Chen, Wei; Brand, Randall E.; Killary, Ann M.; Sen, Subrata; Frazier, Marsha L.

2016-01-01

Biomarkers are critically needed for the early detection of pancreatic cancer (PC) are urgently needed. Our purpose was to identify a panel of genetic variants that, combined, can predict increased risk for early-onset PC and thereby identify individuals who should begin screening at an early age. Previously, we identified genes using a functional genomic approach that were aberrantly expressed in early pathways to PC tumorigenesis. We now report the discovery of single nucleotide polymorphisms (SNPs) in these genes associated with early age at diagnosis of PC using a two-phase study design. In silico and bioinformatics tools were used to examine functional relevance of the identified SNPs. Eight SNPs were consistently associated with age at diagnosis in the discovery phase, validation phase and pooled analysis. Further analysis of the joint effects of these 8 SNPs showed that, compared to participants carrying none of these unfavorable genotypes (median age at PC diagnosis 70 years), those carrying 1–2, 3–4, or 5 or more unfavorable genotypes had median ages at diagnosis of 64, 63, and 62 years, respectively (P = 3.0E–04). A gene-dosage effect was observed, with age at diagnosis inversely related to number of unfavorable genotypes (Ptrend = 1.0E–04). Using bioinformatics tools, we found that all of the 8 SNPs were predicted to play functional roles in the disruption of transcription factor and/or enhancer binding sites and most of them were expression quantitative trait loci (eQTL) of the target genes. The panel of genetic markers identified may serve as susceptibility markers for earlier PC diagnosis. PMID:27486767

Matrix metalloproteinases and educational attainment in refractive error: evidence of gene-environment interactions in the AREDS study

PubMed Central

Wojciechowski, Robert; Yee, Stephanie S.; Simpson, Claire L.; Bailey-Wilson, Joan E.; Stambolian, Dwight

2012-01-01

Purpose A previous study of Old Order Amish families has shown association of ocular refraction with markers proximal to matrix metalloproteinase (MMP) genes MMP1 and MMP10 and intragenic to MMP2. We conducted a candidate gene replication study of association between refraction and single nucleotide polymorphisms (SNPs) within these genomic regions. Design Candidate gene genetic association study. Participants 2,000 participants drawn from the Age Related Eye Disease Study (AREDS) were chosen for genotyping. After quality control filtering, 1912 individuals were available for analysis. Methods Microarray genotyping was performed using the HumanOmni 2.5 bead array. SNPs originally typed in the previous Amish association study were extracted for analysis. In addition, haplotype tagging SNPs were genotyped using TaqMan assays. Quantitative trait association analyses of mean spherical equivalent refraction (MSE) were performed on 30 markers using linear regression models and an additive genetic risk model, while adjusting for age, sex, education, and population substructure. Post-hoc analyses were performed after stratifying on a dichotomous education variable. Pointwise (P-emp) and multiple-test study-wise (P-multi) significance levels were calculated empirically through permutation. Main outcome measures MSE was used as a quantitative measure of ocular refraction. Results The mean age and ocular refraction were 68 years (SD=4.7) and +0.55 D (SD=2.14), respectively. Pointwise statistical significance was obtained for rs1939008 (P-emp=0.0326). No SNP attained statistical significance after correcting for multiple testing. In stratified analyses, multiple SNPs reached pointwise significance in the lower-education group: 2 of these were statistically significant after multiple testing correction. The two highest-ranking SNPs in Amish families (rs1939008 and rs9928731) showed pointwise P-emp<0.01 in the lower-education stratum of AREDS participants. Conclusions We show suggestive evidence of replication of an association signal for ocular refraction to a marker between MMP1 and MMP10. We also provide evidence of a gene-environment interaction between previously-reported markers and education on refractive error. Variants in MMP1- MMP10 and MMP2 regions appear to affect population variation in ocular refraction in environmental conditions less favorable for myopia development. PMID:23098370

Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

PubMed

Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

2015-12-01

Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three thermotolerance traits. In conclusion, specific genetic markers responsible for genetic variation in thermoregulation during heat stress in Holsteins were identified. These markers may prove useful in genetic selection for heat tolerance in Holstein cattle. © 2015 Blackwell Verlag GmbH.

Development and preliminary evaluation of a 90 K Axiom® SNP array for the allo-octoploid cultivated strawberry Fragaria × ananassa.

PubMed

Bassil, Nahla V; Davis, Thomas M; Zhang, Hailong; Ficklin, Stephen; Mittmann, Mike; Webster, Teresa; Mahoney, Lise; Wood, David; Alperin, Elisabeth S; Rosyara, Umesh R; Koehorst-Vanc Putten, Herma; Monfort, Amparo; Sargent, Daniel J; Amaya, Iraida; Denoyes, Beatrice; Bianco, Luca; van Dijk, Thijs; Pirani, Ali; Iezzoni, Amy; Main, Dorrie; Peace, Cameron; Yang, Yilong; Whitaker, Vance; Verma, Sujeet; Bellon, Laurent; Brew, Fiona; Herrera, Raul; van de Weg, Eric

2015-03-07

A high-throughput genotyping platform is needed to enable marker-assisted breeding in the allo-octoploid cultivated strawberry Fragaria × ananassa. Short-read sequences from one diploid and 19 octoploid accessions were aligned to the diploid Fragaria vesca 'Hawaii 4' reference genome to identify single nucleotide polymorphisms (SNPs) and indels for incorporation into a 90 K Affymetrix® Axiom® array. We report the development and preliminary evaluation of this array. About 36 million sequence variants were identified in a 19 member, octoploid germplasm panel. Strategies and filtering pipelines were developed to identify and incorporate markers of several types: di-allelic SNPs (66.6%), multi-allelic SNPs (1.8%), indels (10.1%), and ploidy-reducing "haploSNPs" (11.7%). The remaining SNPs included those discovered in the diploid progenitor F. iinumae (3.9%), and speculative "codon-based" SNPs (5.9%). In genotyping 306 octoploid accessions, SNPs were assigned to six classes with Affymetrix's "SNPolisher" R package. The highest quality classes, PolyHigh Resolution (PHR), No Minor Homozygote (NMH), and Off-Target Variant (OTV) comprised 25%, 38%, and 1% of array markers, respectively. These markers were suitable for genetic studies as demonstrated in the full-sib family 'Holiday' × 'Korona' with the generation of a genetic linkage map consisting of 6,594 PHR SNPs evenly distributed across 28 chromosomes with an average density of approximately one marker per 0.5 cM, thus exceeding our goal of one marker per cM. The Affymetrix IStraw90 Axiom array is the first high-throughput genotyping platform for cultivated strawberry and is commercially available to the worldwide scientific community. The array's high success rate is likely driven by the presence of naturally occurring variation in ploidy level within the nominally octoploid genome, and by effectiveness of the employed array design and ploidy-reducing strategies. This array enables genetic analyses including generation of high-density linkage maps, identification of quantitative trait loci for economically important traits, and genome-wide association studies, thus providing a basis for marker-assisted breeding in this high value crop.

Screening large-scale association study data: exploiting interactions using random forests.

PubMed

Lunetta, Kathryn L; Hayward, L Brooke; Segal, Jonathan; Van Eerdewegh, Paul

2004-12-10

Genome-wide association studies for complex diseases will produce genotypes on hundreds of thousands of single nucleotide polymorphisms (SNPs). A logical first approach to dealing with massive numbers of SNPs is to use some test to screen the SNPs, retaining only those that meet some criterion for further study. For example, SNPs can be ranked by p-value, and those with the lowest p-values retained. When SNPs have large interaction effects but small marginal effects in a population, they are unlikely to be retained when univariate tests are used for screening. However, model-based screens that pre-specify interactions are impractical for data sets with thousands of SNPs. Random forest analysis is an alternative method that produces a single measure of importance for each predictor variable that takes into account interactions among variables without requiring model specification. Interactions increase the importance for the individual interacting variables, making them more likely to be given high importance relative to other variables. We test the performance of random forests as a screening procedure to identify small numbers of risk-associated SNPs from among large numbers of unassociated SNPs using complex disease models with up to 32 loci, incorporating both genetic heterogeneity and multi-locus interaction. Keeping other factors constant, if risk SNPs interact, the random forest importance measure significantly outperforms the Fisher Exact test as a screening tool. As the number of interacting SNPs increases, the improvement in performance of random forest analysis relative to Fisher Exact test for screening also increases. Random forests perform similarly to the univariate Fisher Exact test as a screening tool when SNPs in the analysis do not interact. In the context of large-scale genetic association studies where unknown interactions exist among true risk-associated SNPs or SNPs and environmental covariates, screening SNPs using random forest analyses can significantly reduce the number of SNPs that need to be retained for further study compared to standard univariate screening methods.

Functional evaluation of genetic variants associated with endometriosis near GREB1.

PubMed

Fung, Jenny N; Holdsworth-Carson, Sarah J; Sapkota, Yadav; Zhao, Zhen Zhen; Jones, Lincoln; Girling, Jane E; Paiva, Premila; Healey, Martin; Nyholt, Dale R; Rogers, Peter A W; Montgomery, Grant W

2015-05-01

Do DNA variants in the growth regulation by estrogen in breast cancer 1 (GREB1) region regulate endometrial GREB1 expression and increase the risk of developing endometriosis in women? We identified new single nucleotide polymorphisms (SNPs) with strong association with endometriosis at the GREB1 locus although we did not detect altered GREB1 expression in endometriosis patients with defined genotypes. Genome-wide association studies have identified the GREB1 region on chromosome 2p25.1 for increasing endometriosis risk. The differential expression of GREB1 has also been reported by others in association with endometriosis disease phenotype. Fine mapping studies comprehensively evaluated SNPs within the GREB1 region in a large-scale data set (>2500 cases and >4000 controls). Publicly available bioinformatics tools were employed to functionally annotate SNPs showing the strongest association signal with endometriosis risk. Endometrial GREB1 mRNA and protein expression was studied with respect to phases of the menstrual cycle (n = 2-45 per cycle stage) and expression quantitative trait loci (eQTL) analysis for significant SNPs were undertaken for GREB1 [mRNA (n = 94) and protein (n = 44) in endometrium]. Participants in this study are females who provided blood and/or endometrial tissue samples in a hospital setting. The key SNPs were genotyped using Sequenom MassARRAY. The functional roles and regulatory annotations for identified SNPs are predicted by various publicly available bioinformatics tools. Endometrial GREB1 expression work employed qRT-PCR, western blotting and immunohistochemistry studies. Fine mapping results identified a number of SNPs showing stronger association (0.004 < P < 0.032) with endometriosis risk than the original GWAS SNP (rs13394619) (P = 0.034). Some of these SNPs were predicted to have functional roles, for example, interaction with transcription factor motifs. The haplotype (a combination of alleles) formed by the risk alleles from two common SNPs showed significant association (P = 0.026) with endometriosis and epistasis analysis showed no evidence for interaction between the two SNPs, suggesting an additive effect of SNPs on endometriosis risk. In normal human endometrium, GREB1 protein expression was altered depending on the cycle stage (significantly different in late proliferative versus late secretory, P < 0.05) and cell type (glandular epithelium, not stromal cells). However, GREB1 expression in endometriosis cases versus controls and eQTL analyses did not reveal any significant changes. In silico prediction tools are generally based on cell lines different to our tissue and disease of interest. Functional annotations drawn from these analyses should be considered with this limitation in mind. We identified cell-specific and hormone-specific changes in GREB1 protein expression. The lack of a significant difference observed following our GREB1 expression studies may be the result of moderate power on mixed cell populations in the endometrial tissue samples. This study further implicates the GREB1 region on chromosome 2p25.1 and the GREB1 gene with involvement in endometriosis risk. More detailed functional studies are required to determine the role of the novel GREB1 transcripts in endometriosis pathophysiology. Funding for this work was provided by NHMRC Project Grants APP1012245, APP1026033, APP1049472 and APP1046880. There are no competing interests. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Role of genetic & environment risk factors in the aetiology of colorectal cancer in Malaysia

PubMed Central

Ramzi, Nurul Hanis; Chahil, Jagdish Kaur; Lye, Say Hean; Munretnam, Khamsigan; Sahadevappa, Kavitha Itagi; Velapasamy, Sharmila; Hashim, Nikman Adli Nor; Cheah, Soon Keat; Lim, Gerard Chin Chye; Hussein, Heselynn; Haron, Mohd Roslan; Alex, Livy; Ler, Lian Wee

2014-01-01

Background & objectives: Colorectal cancer (CRC) is second only to breast cancer as the leading cause of cancer-related deaths in Malaysia. In the Asia–Pacific area, it is the highest emerging gastrointestinal cancer. The aim of this study was to identify single nucleotide polymorphisms (SNPs) and environmental factors associated with CRC risk in Malaysia from a panel of cancer associated SNPs. Methods: In this case-control study, 160 Malaysian subjects were recruited, including both with CRC and controls. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. Genotyping was carried out using Illumina's BeadArray platform. Information on blood group, occupation, medical history, family history of cancer, intake of red meat and vegetables, exposure to radiation, smoking and drinking habits, etc was collected. Odds ratio (OR), 95% confidence interval (CI) were calculated. Results: A panel of 23 SNPs significantly associated with colorectal cancer risk was identified (P<0.01). Of these, 12 SNPs increased the risk of CRC and 11 reduced the risk. Among the environmental risk factors investigated, high intake of red meat (more than 50% daily proportion) was found to be significantly associated with increased risk of CRC (OR=6.52, 95% CI :1.93 - 2.04, P=0.003). Two SNPs including rs2069521 and rs10046 in genes of cytochrome P450 (CYP) superfamily were found significantly associated with CRC risk. For gene-environment analysis, the A allele of rs2069521 showed a significant association with CRC risk when stratified by red meat intake. Interpretation & conclusions: In this preliminary study, a panel of SNPs found to be significantly associated with CRC in Malaysian population, was identified. Also, red meat consumption and lack of physical exercise were risk factors for CRC, while consumption of fruits and vegetables served as protective factor. PMID:25109722

Resequencing of IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children

PubMed Central

Voruganti, V. Saroja; Cole, Shelley A.; Haack, Karin; Comuzzie, Anthony G.; Muzny, Donna M.; Wheeler, David A.; Chang, Kyle; Hawes, Alicia; Gibbs, Richard A.

2011-01-01

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5′ and 3′ flanking regions of IRS2 (∼14.5 kb), were bidirectionally sequenced for single nucleotide polymorphism (SNP) discovery in 934 Hispanic children using 3730XL DNA Sequencers. Additionally, 15 SNPs derived from Illumina HumanOmni1-Quad BeadChips were analyzed. Measured genotype analysis tested associations between SNPs and obesity and diabetes-related traits. Bayesian quantitative trait nucleotide analysis was used to statistically infer the most likely functional polymorphisms. A total of 140 SNPs were identified with minor allele frequencies (MAF) ranging from 0.001 to 0.47. Forty-two of the 70 coding SNPs result in nonsynonymous amino acid substitutions relative to the consensus sequence; 28 SNPs were detected in the promoter, 12 in introns, 28 in the 3′-UTR, and 2 in the 5′-UTR. Two insertion/deletions (indels) were detected. Ten independent rare SNPs (MAF = 0.001–0.009) were associated with obesity-related traits (P = 0.01–0.00002). SNP 10510452_139 in the promoter region was shown to have a high posterior probability (P = 0.77–0.86) of influencing BMI, fat mass, and waist circumference in Hispanic children. SNP 10510452_139 contributed between 2 and 4% of the population variance in body weight and composition. None of the SNPs or indels were associated with diabetes-related traits or accounted for a previously identified quantitative trait locus on chromosome 13 for fasting serum glucose. Rare but not common IRS2 variants may play a role in the regulation of body weight but not an essential role in fasting glucose homeostasis in Hispanic children. PMID:21771880

Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents.

PubMed

Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z

2014-03-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29-97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents.

Genomic variation at the tips of the adaptive radiation of Darwin's finches.

PubMed

Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C

2016-11-01

Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

Genome-wide association and pathway analysis of feed efficiency in pigs reveal candidate genes and pathways for residual feed intake

PubMed Central

Do, Duy N.; Strathe, Anders B.; Ostersen, Tage; Pant, Sameer D.; Kadarmideen, Haja N.

2014-01-01

Residual feed intake (RFI) is a complex trait that is economically important for livestock production; however, the genetic and biological mechanisms regulating RFI are largely unknown in pigs. Therefore, the study aimed to identify single nucleotide polymorphisms (SNPs), candidate genes and biological pathways involved in regulating RFI using Genome-wide association (GWA) and pathway analyses. A total of 596 Yorkshire boars with phenotypes for two different measures of RFI (RFI1 and 2) and 60k genotypic data was used. GWA analysis was performed using a univariate mixed model and 12 and 7 SNPs were found to be significantly associated with RFI1 and RFI2, respectively. Several genes such as xin actin-binding repeat-containing protein 2 (XIRP2),tetratricopeptide repeat domain 29 (TTC29),suppressor of glucose, autophagy associated 1 (SOGA1),MAS1,G-protein-coupled receptor (GPCR) kinase 5 (GRK5),prospero-homeobox protein 1 (PROX1),GPCR 155 (GPR155), and FYVE domain containing the 26 (ZFYVE26) were identified as putative candidates for RFI based on their genomic location in the vicinity of these SNPs. Genes located within 50 kbp of SNPs significantly associated with RFI and RFI2 (q-value ≤ 0.2) were subsequently used for pathway analyses. These analyses were performed by assigning genes to biological pathways and then testing the association of individual pathways with RFI using a Fisher’s exact test. Metabolic pathway was significantly associated with both RFIs. Other biological pathways regulating phagosome, tight junctions, olfactory transduction, and insulin secretion were significantly associated with both RFI traits when relaxed threshold for cut-off p-value was used (p ≤ 0.05). These results implied porcine RFI is regulated by multiple biological mechanisms, although the metabolic processes might be the most important. Olfactory transduction pathway controlling the perception of feed via smell, insulin pathway controlling food intake might be important pathways for RFI. Furthermore, our study revealed key genes and genetic variants that control feed efficiency that could potentially be useful for genetic selection of more feed efficient pigs. PMID:25250046

Dementia revealed: novel chromosome 6 locus for late-onset Alzheimer disease provides genetic evidence for folate-pathway abnormalities.

PubMed

Naj, Adam C; Beecham, Gary W; Martin, Eden R; Gallins, Paul J; Powell, Eric H; Konidari, Ioanna; Whitehead, Patrice L; Cai, Guiqing; Haroutunian, Vahram; Scott, William K; Vance, Jeffery M; Slifer, Michael A; Gwirtsman, Harry E; Gilbert, John R; Haines, Jonathan L; Buxbaum, Joseph D; Pericak-Vance, Margaret A

2010-09-23

Genome-wide association studies (GWAS) of late-onset Alzheimer disease (LOAD) have consistently observed strong evidence of association with polymorphisms in APOE. However, until recently, variants at few other loci with statistically significant associations have replicated across studies. The present study combines data on 483,399 single nucleotide polymorphisms (SNPs) from a previously reported GWAS of 492 LOAD cases and 496 controls and from an independent set of 439 LOAD cases and 608 controls to strengthen power to identify novel genetic association signals. Associations exceeding the experiment-wide significance threshold (alpha=1.03x10(-7)) were replicated in an additional 1,338 cases and 2,003 controls. As expected, these analyses unequivocally confirmed APOE's risk effect (rs2075650, P=1.9x10(-36)). Additionally, the SNP rs11754661 at 151.2 Mb of chromosome 6q25.1 in the gene MTHFD1L (which encodes the methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like protein) was significantly associated with LOAD (P=4.70x10(-8); Bonferroni-corrected P=0.022). Subsequent genotyping of SNPs in high linkage disequilibrium (r2>0.8) with rs11754661 identified statistically significant associations in multiple SNPs (rs803424, P=0.016; rs2073067, P=0.03; rs2072064, P=0.035), reducing the likelihood of association due to genotyping error. In the replication case-control set, we observed an association of rs11754661 in the same direction as the previous association at P=0.002 (P=1.90x10(-10) in combined analysis of discovery and replication sets), with associations of similar statistical significance at several adjacent SNPs (rs17349743, P=0.005; rs803422, P=0.004). In summary, we observed and replicated a novel statistically significant association in MTHFD1L, a gene involved in the tetrahydrofolate synthesis pathway. This finding is noteworthy, as MTHFD1L may play a role in the generation of methionine from homocysteine and influence homocysteine-related pathways and as levels of homocysteine are a significant risk factor for LOAD development.

Association of SNPs in exon 2 of the MHC B-F gene with immune traits in two distinct chicken populations: Chinese Beijing-You and White Leghorn.

PubMed

Liu, L B; Wu, C M; Wen, J; Chen, J L; Zheng, M Q; Zhao, G P

2009-03-01

Antibody titers raised for vaccinations against avian influenza (AI) and Newcastle disease (ND) were higher in Chinese Beijing-You (BJY) than in White Leghorn (WL) ( P < 0.001), but there was no breed difference in titers for sheep red blood cells (SRBC). Genotyping by PCR-SSCP identified seven haplotypes in WL and 17 in BJY. After sequencing PCR products (35 and 85, respectively), 43 (WL) and 47 (BJY) single nucleotide polymorphisms (SNPs) were found in the 264 bp of exon 2. In WL chickens, significant associations were found with antibody responses to AI (two SNPs), ND (six SNPs), and SRBC (one SNP), while in BJY there was association with responses to ND (two SNPs) and SRBC (two SNPs), but none with AI. These results indicate that the genomic region bearing exon 2 of the major histocompatibility complex B-F gene has significant effects on antibody responses to SRBC and vaccination against AI and ND. Different SNPs affected antibody titers for each of the antigens and they differed between these very distinct breeds.

Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites

PubMed Central

Bu, Huajie; Narisu, Narisu; Schlick, Bettina; Rainer, Johannes; Manke, Thomas; Schäfer, Georg; Pasqualini, Lorenza; Chines, Peter; Schweiger, Michal R.; Fuchsberger, Christian

2015-01-01

ABSTRACT Genome‐wide association studies have identified genomic loci, whose single‐nucleotide polymorphisms (SNPs) predispose to prostate cancer (PCa). However, the mechanisms of most of these variants are largely unknown. We integrated chromatin‐immunoprecipitation‐coupled sequencing and microarray expression profiling in TMPRSS2‐ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor‐binding sites (ARBSs). Among the 48 GWAS index risk SNPs and 3,917 linked SNPs, 80 were found located in ARBSs. Of these, rs11891426:T>G in an intron of the melanophilin gene (MLPH) was within a novel putative auxiliary AR‐binding motif, which is enriched in the neighborhood of canonical androgen‐responsive elements. T→G exchange attenuated the transcriptional activity of the ARBS in an AR reporter gene assay. The expression of MLPH in primary prostate tumors was significantly lower in those with the G compared with the T allele and correlated significantly with AR protein. Higher melanophilin level in prostate tissue of patients with a favorable PCa risk profile points out a tumor‐suppressive effect. These results unravel a hidden link between AR and a functional putative PCa risk SNP, whose allele alteration affects androgen regulation of its host gene MLPH. PMID:26411452

Diacylglycerol kinase κ (DGKK) variants and hypospadias in Han Chinese: association and meta-analysis.

PubMed

Ma, Qichao; Tang, Yunman; Lin, Houwei; Xu, Maosheng; Xu, Guofeng; Fang, Xiaoliang; Chen, Jianhua; Song, Zhijian; Li, Zhiqiang; Shi, Yongyong; Geng, Hongquan

2015-10-01

To investigate whether diacylglycerol kinase κ (DGKK) is a susceptibility gene for hypospadias in the Han Chinese population as has been suggested by previous publications. A case-control study involving 466 patients with hypospadias and 402 healthy subjects was conducted to assess the relationship between DGKK single nucleotide polymorphisms (SNPs) and hypospadias risk in the Han Chinese population. The 466 hypospadias patients were further divided into mild, moderate and severe subgroups for analysis. Six SNPs (rs1934179, rs4143304, rs9969978, rs1934188, rs4826632 and rs4599945) were marginally associated with mild and moderate hypospadias [odds ratios (ORs) > 1, P = 0.05 to P < 0.1), whereas no significant relationship was seen with the severe cases (ORs >1, P > 0.1). After correcting for multiple testing, it was determined that neither individual SNPs nor individual haplotypes were associated with hypospadias. To evaluate this relationship in multiple populations, we performed a meta-analysis on six SNPs, using combined data from our present results and those of previous studies of different races (including 1966 patients and 2492 controls). Six SNPs (rs1934179, rs4143304, rs9969978, rs1934188, rs7063116 and rs1934190) were significantly associated with mild/moderate hypospadias (ORs >1, P < 0.05), and rs1934179 was significantly associated with severe hypospadias (OR > 1, P < 0.05). DGKK gene variants do not appear to play a major role in hypospadias susceptibility in the Chinese Han population. Our meta-analysis supports the hypothesis that DGKK is a common risk gene for hypospadias, particularly in cases of mild or moderate hypospadias in Caucasian populations. © 2014 The Authors BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.

Massively parallel sequencing of 124 SNPs included in the precision ID identity panel in three East Asian minority ethnicities.

PubMed

Liu, Jing; Wang, Zheng; He, Guanglin; Zhao, Xueying; Wang, Mengge; Luo, Tao; Li, Chengtao; Hou, Yiping

2018-07-01

Massively parallel sequencing (MPS) technologies can sequence many targeted regions of multiple samples simultaneously and are gaining great interest in the forensic community. The Precision ID Identity Panel contains 90 autosomal SNPs and 34 upper Y-Clade SNPs, which was designed with small amplicons and optimized for forensic degraded or challenging samples. Here, 184 unrelated individuals from three East Asian minority ethnicities (Tibetan, Uygur and Hui) were analyzed using the Precision ID Identity Panel and the Ion PGM System. The sequencing performance and corresponding forensic statistical parameters of this MPS-SNP panel were investigated. The inter-population relationships and substructures among three investigated populations and 30 worldwide populations were further investigated using PCA, MDS, cladogram and STRUCTURE. No significant deviation from Hardy-Weinberg equilibrium (HWE) and Linkage Disequilibrium (LD) tests was observed across all 90 autosomal SNPs. The combined matching probability (CMP) for Tibetan, Uygur and Hui were 2.5880 × 10 -33 , 1.7480 × 10 -35 and 4.6326 × 10 -34 respectively, and the combined power of exclusion (CPE) were 0.999999386152271, 0.999999607712827 and 0.999999696360182 respectively. For 34 Y-SNPs, only 16 haplogroups were obtained, but the haplogroup distributions differ among the three populations. Tibetans from the Sino-Tibetan population and Hui with multiple ethnicities with an admixture population have genetic affinity with East Asian populations, while Uygurs of a Eurasian admixture population have similar genetic components to the South Asian populations and are distributed between East Asian and European populations. The aforementioned results suggest that the Precision ID Identity Panel is informative and polymorphic in three investigated populations and could be used as an effective tool for human forensics. Copyright © 2018 Elsevier B.V. All rights reserved.

Considering interactive effects in the identification of influential regions with extremely rare variants via fixed bin approach

PubMed Central

2014-01-01

In this study, we analyze the Genetic Analysis Workshop 18 (GAW18) data to identify regions of single-nucleotide polymorphisms (SNPs), which significantly influence hypertension status among individuals. We have studied the marginal impact of these regions on disease status in the past, but we extend the method to deal with environmental factors present in data collected over several exam periods. We consider the respective interactions between such traits as smoking status and age with the genetic information and hope to augment those genetic regions deemed influential marginally with those that contribute via an interactive effect. In particular, we focus only on rare variants and apply a procedure to combine signal among rare variants in a number of "fixed bins" along the chromosome. We extend the procedure in Agne et al [1] to incorporate environmental factors by dichotomizing subjects via traits such as smoking status and age, running the marginal procedure among each respective category (i.e., smokers or nonsmokers), and then combining their scores into a score for interaction. To avoid overlap of subjects, we examine each exam period individually. Out of a possible 629 fixed-bin regions in chromosome 3, we observe that 11 show up in multiple exam periods for gene-smoking score. Fifteen regions exhibit significance for multiple exam periods for gene-age score, with 4 regions deemed significant for all 3 exam periods. The procedure pinpoints SNPs in 8 "answer" genes, with 5 of these showing up as significant in multiple testing schemes (Gene-Smoking, Gene-Age for Exams 1, 2, and 3). PMID:25519400

Genetic modification of the association between peripubertal dioxin exposure and pubertal onset in a cohort of Russian boys.

PubMed

Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ

2013-01-01

Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.

Planar cell polarity pathway genes and risk for spina bifida.

PubMed

Wen, Shu; Zhu, Huiping; Lu, Wei; Mitchell, Laura E; Shaw, Gary M; Lammer, Edward J; Finnell, Richard H

2010-02-01

Spina bifida, a neural tube closure defect (NTD) involving the posterior portion of what will ultimately give rise to the spinal cord, is one of the most common and serious birth defects. The etiology of spina bifida is thought to be multi-factorial and involve multiple interacting genes and environmental factors. The causes of this congenital malformation remain largely unknown. However, several candidate genes for spina bifida have been identified in lower vertebrates, including the planar cell polarity (PCP) genes. We used data from a case-control study conducted in California to evaluate the association between variation within several key PCP genes and the risk of spina bifida. The PCP genes included in this study were the human homologs of the Xenopus genes Flamingo, Strabismus, Prickle, Dishevelled, and Scrib, two of the homologs of Xenopus Wnt genes, WNT5A and WNT11, and two of the homologs of Xenopus Frizzled, FZD3 and FZD6. None of the 172 SNPs that were evaluated were significantly associated with spina bifida in any racial/ethnic group after correction for multiple testing. However, several SNPs in the PRICKLE2 gene had unadjusted P-value <0.01. In conclusion, our results, though largely negative, suggest that the PRICKLE2 gene may potentially modify the risk of spina bifida and deserves further investigation. Copyright 2010 Wiley-Liss, Inc.

Association of genetic variations in the serotonin and dopamine systems with aggressive behavior in the Chinese adolescent population: Single- and multiple-risk genetic variants.

PubMed

Chang, Hongjuan; Yan, Qiuge; Tang, Lina; Huang, Juan; Ma, Yuqiao; Ye, Xiaozhou; Wu, Chunxia; Wu, Linguo; Yu, Yizhen

2018-01-01

Genetic predisposition is an important factor leading to aggressive behavior. However, the relationship between genetic polymorphisms and aggressive behavior has not been elucidated. We identified candidate genes located in the dopaminergic and serotonin system (DRD3, DRD4, and FEV) that had been previously reported to be associated with aggressive behavior. We investigated 14 tag single-nucleotide polymorphisms (SNPs) using a multi-analytic strategy combining logistic regression (LR) and classification and regression tree (CART) to explore higher-order interactions between these SNPs and aggressive behavior in 318 patients and 558 controls. Both LR and CART analyses suggested that the rs16859448 polymorphism is the strongest individual factor associated with aggressive behavior risk. In CART analysis, individuals carrying the combined genotypes of rs16859448TT/GT-rs11246228CT/TT-rs3773679TT had the highest risk, while rs16859448GG-rs2134655CT had the lowest risk (OR = 5.25, 95% CI: 2.53-10.86). This study adds to the growing evidence on the association of single- and multiple-risk variants in DRD3, DRD4, and FEV with aggressive behavior in Chinese adolescents. However, the aggressive behavior scale used to diagnose aggression in this study did not account for comorbid conditions; therefore, further studies are needed to confirm our observations. Copyright © 2017 Elsevier B.V. All rights reserved.

Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

PubMed Central

Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

2017-01-01

The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

The search for loci under selection: trends, biases and progress.

PubMed

Ahrens, Collin W; Rymer, Paul D; Stow, Adam; Bragg, Jason; Dillon, Shannon; Umbers, Kate D L; Dudaniec, Rachael Y

2018-03-01

Detecting genetic variants under selection using F ST outlier analysis (OA) and environmental association analyses (EAAs) are popular approaches that provide insight into the genetic basis of local adaptation. Despite the frequent use of OA and EAA approaches and their increasing attractiveness for detecting signatures of selection, their application to field-based empirical data have not been synthesized. Here, we review 66 empirical studies that use Single Nucleotide Polymorphisms (SNPs) in OA and EAA. We report trends and biases across biological systems, sequencing methods, approaches, parameters, environmental variables and their influence on detecting signatures of selection. We found striking variability in both the use and reporting of environmental data and statistical parameters. For example, linkage disequilibrium among SNPs and numbers of unique SNP associations identified with EAA were rarely reported. The proportion of putatively adaptive SNPs detected varied widely among studies, and decreased with the number of SNPs analysed. We found that genomic sampling effort had a greater impact than biological sampling effort on the proportion of identified SNPs under selection. OA identified a higher proportion of outliers when more individuals were sampled, but this was not the case for EAA. To facilitate repeatability, interpretation and synthesis of studies detecting selection, we recommend that future studies consistently report geographical coordinates, environmental data, model parameters, linkage disequilibrium, and measures of genetic structure. Identifying standards for how OA and EAA studies are designed and reported will aid future transparency and comparability of SNP-based selection studies and help to progress landscape and evolutionary genomics. © 2018 John Wiley & Sons Ltd.

Employing genome-wide SNP discovery and genotyping strategy to extrapolate the natural allelic diversity and domestication patterns in chickpea

PubMed Central

Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93–96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13–89%)/functional allelic diversity (18–77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54–0.68) and extended LD decay (400–500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically regulating important complex quantitative agronomic traits in chickpea. The numerous informative genome-wide SNPs, natural allelic diversity-led domestication pattern, and LD-based information generated in our study have got multidimensional applicability with respect to chickpea genomics-assisted breeding. PMID:25873920

Novel approach identifies SNPs in SLC2A10 and KCNK9 with evidence for parent-of-origin effect on body mass index.

PubMed

Hoggart, Clive J; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M; Hayward, Caroline; Lopez, Mary F; Franke, Lude; Russo, Alessia; Heid, Iris M; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E; Boerwinkle, Eric; Chambers, John C; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P; Lammers, Gert J; Aubert, Vincent; Heim, Markus H; Martin, Nicholas G; Montgomery, Grant W; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O; Scott, Robert A; Spector, Tim D; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J; Yuan, Wei; Bell, Jordana T; Chakravarti, Aravinda; Kooner, Jaspal S; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S; Tafti, Mehdi; Hastie, Nicholas D; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B; Rousson, Valentin; Hirschhorn, Joel N; Rivolta, Carlo; Loos, Ruth J F; Kutalik, Zoltán

2014-07-01

The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity.

Novel Approach Identifies SNPs in SLC2A10 and KCNK9 with Evidence for Parent-of-Origin Effect on Body Mass Index

PubMed Central

Hoggart, Clive J.; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W.; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B.; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M.; Hayward, Caroline; Lopez, Mary F.; Franke, Lude; Russo, Alessia; Heid, Iris M.; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E.; Boerwinkle, Eric; Chambers, John C.; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E.; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P.; Lammers, Gert J.; Aubert, Vincent; Heim, Markus H.; Martin, Nicholas G.; Montgomery, Grant W.; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O.; Scott, Robert A.; Spector, Tim D.; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J.; Yuan, Wei; Bell, Jordana T.; Chakravarti, Aravinda; Kooner, Jaspal S.; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B.; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S.; Tafti, Mehdi; Hastie, Nicholas D.; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M.; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B.; Rousson, Valentin; Hirschhorn, Joel N.; Rivolta, Carlo; Loos, Ruth J. F.; Kutalik, Zoltán

2014-01-01

The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity. PMID:25078964

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

Linkage Disequilibrium Mapping in Domestic Dog Breeds Narrows the Progressive Rod-Cone Degeneration (prcd) Interval and Identifies Ancestral Disease Transmitting Chromosome

PubMed Central

Goldstein, Orly; Zangerl, Barbara; Pearce-Kelling, Sue; Sidjanin, Duska J.; Kijas, James W.; Felix, Jeanette; Acland, Gregory M; Aguirre, Gustavo D.

2014-01-01

Canine progressive rod-cone degeneration (prcd) is a retinal disease previously mapped to a broad, gene-rich centromeric region of canine chromosome 9. As allelic disorders are present in multiple breeds, we used linkage disequilibrium (LD) to narrow the ∼6.4 Mb interval candidate region. Multiple dog breeds, each representing genetically isolated populations, were typed for SNPs and other polymorphisms identified from BACs. The candidate region was initially localized to a 1.5 Mb zero recombination interval between growth factor receptor-bound protein 2 (GRB2) and SEC14-like 1 (SEC14L). A fine-scale haplotype of the region was developed which reduced the LD interval to 106 Kb, and identified a conserved haplotype of 98 polymorphisms present in all prcd-affected chromosomes from 14 different dog breeds. The findings strongly suggest that a common ancestor transmitted the prcd disease allele to many of the modern dog breeds, and demonstrate the power of LD approach in the canine model. PMID:16859891

Could age modify the effect of genetic variants in IL6 and TNF-α genes in multiple myeloma?

PubMed

Martino, Alessandro; Buda, Gabriele; Maggini, Valentina; Lapi, Francesco; Lupia, Antonella; Di Bello, Domenica; Orciuolo, Enrico; Galimberti, Sara; Barale, Roberto; Petrini, Mario; Rossi, Anna Maria

2012-05-01

Cytokines play a central role in multiple myeloma (MM) pathogenesis thus genetic variations within cytokines coding genes could influence MM susceptibility and therapy outcome. We investigated the impact of 8 SNPs in these genes in 202 MM cases and 235 controls also evaluating their impact on therapy outcome in a subset of 91 patients. Despite the overall negative findings, we found a significant age-modified effect of IL6 and TNF-α SNPs, on MM risk and therapy outcome, respectively. Therefore, this observation suggests that genetic variation in inflammation-related genes could be an important mediator of the complex interplay between ageing and cancer. Copyright © 2012 Elsevier Ltd. All rights reserved.

Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome sequence

PubMed Central

2011-01-01

Background Many plants have large and complex genomes with an abundance of repeated sequences. Many plants are also polyploid. Both of these attributes typify the genome architecture in the tribe Triticeae, whose members include economically important wheat, rye and barley. Large genome sizes, an abundance of repeated sequences, and polyploidy present challenges to genome-wide SNP discovery using next-generation sequencing (NGS) of total genomic DNA by making alignment and clustering of short reads generated by the NGS platforms difficult, particularly in the absence of a reference genome sequence. Results An annotation-based, genome-wide SNP discovery pipeline is reported using NGS data for large and complex genomes without a reference genome sequence. Roche 454 shotgun reads with low genome coverage of one genotype are annotated in order to distinguish single-copy sequences and repeat junctions from repetitive sequences and sequences shared by paralogous genes. Multiple genome equivalents of shotgun reads of another genotype generated with SOLiD or Solexa are then mapped to the annotated Roche 454 reads to identify putative SNPs. A pipeline program package, AGSNP, was developed and used for genome-wide SNP discovery in Aegilops tauschii-the diploid source of the wheat D genome, and with a genome size of 4.02 Gb, of which 90% is repetitive sequences. Genomic DNA of Ae. tauschii accession AL8/78 was sequenced with the Roche 454 NGS platform. Genomic DNA and cDNA of Ae. tauschii accession AS75 was sequenced primarily with SOLiD, although some Solexa and Roche 454 genomic sequences were also generated. A total of 195,631 putative SNPs were discovered in gene sequences, 155,580 putative SNPs were discovered in uncharacterized single-copy regions, and another 145,907 putative SNPs were discovered in repeat junctions. These SNPs were dispersed across the entire Ae. tauschii genome. To assess the false positive SNP discovery rate, DNA containing putative SNPs was amplified by PCR from AL8/78 and AS75 and resequenced with the ABI 3730 xl. In a sample of 302 randomly selected putative SNPs, 84.0% in gene regions, 88.0% in repeat junctions, and 81.3% in uncharacterized regions were validated. Conclusion An annotation-based genome-wide SNP discovery pipeline for NGS platforms was developed. The pipeline is suitable for SNP discovery in genomic libraries of complex genomes and does not require a reference genome sequence. The pipeline is applicable to all current NGS platforms, provided that at least one such platform generates relatively long reads. The pipeline package, AGSNP, and the discovered 497,118 Ae. tauschii SNPs can be accessed at (http://avena.pw.usda.gov/wheatD/agsnp.shtml). PMID:21266061

A genome-wide association study reveals novel genomic regions and positional candidate genes for fat deposition in broiler chickens.

PubMed

Moreira, Gabriel Costa Monteiro; Boschiero, Clarissa; Cesar, Aline Silva Mello; Reecy, James M; Godoy, Thaís Fernanda; Trevisoli, Priscila Anchieta; Cantão, Maurício E; Ledur, Mônica Corrêa; Ibelli, Adriana Mércia Guaratini; Peixoto, Jane de Oliveira; Moura, Ana Silvia Alves Meira Tavares; Garrick, Dorian; Coutinho, Luiz Lehmann

2018-05-21

Excess fat content in chickens has a negative impact on poultry production. The discovery of QTL associated with fat deposition in the carcass allows the identification of positional candidate genes (PCGs) that might regulate fat deposition and be useful for selection against excess fat content in chicken's carcass. This study aimed to estimate genomic heritability coefficients and to identify QTLs and PCGs for abdominal fat (ABF) and skin (SKIN) traits in a broiler chicken population, originated from the White Plymouth Rock and White Cornish breeds. ABF and SKIN are moderately heritable traits in our broiler population with estimates ranging from 0.23 to 0.33. Using a high density SNP panel (355,027 informative SNPs), we detected nine unique QTLs that were associated with these fat traits. Among these, four QTL were novel, while five have been previously reported in the literature. Thirteen PCGs were identified that might regulate fat deposition in these QTL regions: JDP2, PLCG1, HNF4A, FITM2, ADIPOR1, PTPN11, MVK, APOA1, APOA4, APOA5, ENSGALG00000000477, ENSGALG00000000483, and ENSGALG00000005043. We used sequence information from founder animals to detect 4843 SNPs in the 13 PCGs. Among those, two were classified as potentially deleterious and two as high impact SNPs. This study generated novel results that can contribute to a better understanding of fat deposition in chickens. The use of high density array of SNPs increases genome coverage and improves QTL resolution than would have been achieved with low density. The identified PCGs were involved in many biological processes that regulate lipid storage. The SNPs identified in the PCGs, especially those predicted as potentially deleterious and high impact, may affect fat deposition. Validation should be undertaken before using these SNPs for selection against carcass fat accumulation and to improve feed efficiency in broiler chicken production.

Characterization of Genome-Wide Association-Identified Variants for Atrial Fibrillation in African Americans

PubMed Central

Delaney, Jessica T.; Jeff, Janina M.; Brown, Nancy J.; Pretorius, Mias; Okafor, Henry E.; Darbar, Dawood; Roden, Dan M.; Crawford, Dana C.

2012-01-01

Background Despite a greater burden of risk factors, atrial fibrillation (AF) is less common among African Americans than European-descent populations. Genome-wide association studies (GWAS) for AF in European-descent populations have identified three predominant genomic regions associated with increased risk (1q21, 4q25, and 16q22). The contribution of these loci to AF risk in African American is unknown. Methodology/Principal Findings We studied 73 African Americans with AF from the Vanderbilt-Meharry AF registry and 71 African American controls, with no history of AF including after cardiac surgery. Tests of association were performed for 148 SNPs across the three regions associated with AF, and 22 SNPs were significantly associated with AF (P<0.05). The SNPs with the strongest associations in African Americans were both different from the index SNPs identified in European-descent populations and independent from the index European-descent population SNPs (r2<0.40 in HapMap CEU): 1q21 rs4845396 (odds ratio [OR] 0.30, 95% confidence interval [CI] 0.13–0.67, P = 0.003), 4q25 rs4631108 (OR 3.43, 95% CI 1.59–7.42, P = 0.002), and 16q22 rs16971547 (OR 8.1, 95% CI 1.46–45.4, P = 0.016). Estimates of European ancestry were similar among cases (23.6%) and controls (23.8%). Accordingly, the probability of having two copies of the European derived chromosomes at each region did not differ between cases and controls. Conclusions/Significance Variable European admixture at known AF loci does not explain decreased AF susceptibility in African Americans. These data support the role of 1q21, 4q25, and 16q22 variants in AF risk for African Americans, although the index SNPs differ from those identified in European-descent populations. PMID:22384221

Weak independent association signals between IDE polymorphisms, Alzheimer's disease and cognitive measures.

PubMed

Mueller, Jakob C; Riemenschneider, Matthias; Schoepfer-Wendels, Andreas; Gohlke, Henning; Konta, Lidija; Friedrich, Patricia; Illig, Thomas; Laws, Simon M; Förstl, Hans; Kurz, Alexander

2007-05-01

Functional and genetic studies suggest that insulin-degrading enzyme (IDE) may be a strong functional and positional candidate. As there is a lack of consensus in regards to the level and location of IDE association signals we aimed to clarify these discrepancies through genotyping 28 SNPs in a large case-control collective together with quantitative measures of cognitive ability (MMSE). Four SNPs (rs11187007, rs2149632_ide12, rs11187033, rs11187040) were found to be associated with AD (nominal p<0.01). Tests with MMSE scores adjusted for disease duration identified associations, with the most significant result for rs1999763 (nominal p=0.008). Similarly, different reconstructed IDE haplotypes were associated with AD and higher MMSE scores. The association signals are only borderline significant after adjustment for multiple testing, but add further evidence to previous published results on the association between IDE and AD or MMSE. A subgroup analysis indicated more prominent associations with AD in younger, and with MMSE in older patients. There may be two independent effects mediated by IDE variants, risk for AD and modification of disease progression.

Genetic architecture of plant stress resistance: multi-trait genome-wide association mapping.

PubMed

Thoen, Manus P M; Davila Olivas, Nelson H; Kloth, Karen J; Coolen, Silvia; Huang, Ping-Ping; Aarts, Mark G M; Bac-Molenaar, Johanna A; Bakker, Jaap; Bouwmeester, Harro J; Broekgaarden, Colette; Bucher, Johan; Busscher-Lange, Jacqueline; Cheng, Xi; Fradin, Emilie F; Jongsma, Maarten A; Julkowska, Magdalena M; Keurentjes, Joost J B; Ligterink, Wilco; Pieterse, Corné M J; Ruyter-Spira, Carolien; Smant, Geert; Testerink, Christa; Usadel, Björn; van Loon, Joop J A; van Pelt, Johan A; van Schaik, Casper C; van Wees, Saskia C M; Visser, Richard G F; Voorrips, Roeland; Vosman, Ben; Vreugdenhil, Dick; Warmerdam, Sonja; Wiegers, Gerrie L; van Heerwaarden, Joost; Kruijer, Willem; van Eeuwijk, Fred A; Dicke, Marcel

2017-02-01

Plants are exposed to combinations of various biotic and abiotic stresses, but stress responses are usually investigated for single stresses only. Here, we investigated the genetic architecture underlying plant responses to 11 single stresses and several of their combinations by phenotyping 350 Arabidopsis thaliana accessions. A set of 214 000 single nucleotide polymorphisms (SNPs) was screened for marker-trait associations in genome-wide association (GWA) analyses using tailored multi-trait mixed models. Stress responses that share phytohormonal signaling pathways also share genetic architecture underlying these responses. After removing the effects of general robustness, for the 30 most significant SNPs, average quantitative trait locus (QTL) effect sizes were larger for dual stresses than for single stresses. Plants appear to deploy broad-spectrum defensive mechanisms influencing multiple traits in response to combined stresses. Association analyses identified QTLs with contrasting and with similar responses to biotic vs abiotic stresses, and below-ground vs above-ground stresses. Our approach allowed for an unprecedented comprehensive genetic analysis of how plants deal with a wide spectrum of stress conditions. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Novel Genetic Loci Associated with the Plasma Triglyceride Response to an Omega-3 Fatty Acid Supplementation.

PubMed

Vallée Marcotte, Bastien; Cormier, Hubert; Guénard, Frédéric; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2016-01-01

A recent genome-wide association study (GWAS) by our group identified 13 loci associated with the plasma triglyceride (TG) response to omega-3 (n-3) fatty acid (FA) supplementation. This study aimed to test whether single-nucleotide polymorphisms (SNPs) within the IQCJ, NXPH1, PHF17 and MYB genes are associated with the plasma TG response to an n-3 FA supplementation. A total of 208 subjects followed a 6-week n-3 FA supplementation of 5 g/day of fish oil (1.9-2.2 g of eicosapentaenoic acid and 1.1 g of docosahexaenoic acid). Measurements of plasma lipids were made before and after the supplementation. Sixty-seven tagged SNPs were selected to increase the density of markers near GWAS hits. In a repeated model, independent effects of the genotype and the gene-supplementation interaction were associated with plasma TG. Genotype effects were observed with two SNPs of NXPH1, and gene-diet interactions were observed with ten SNPs of IQCJ, four SNPs of NXPH1 and three SNPs of MYB. Positive and negative responders showed different genotype frequencies with nine SNPs of IQCJ, two SNPs of NXPH1 and two SNPs of MYB. Fine mapping in GWAS-associated loci allowed the identification of SNPs partly explaining the large interindividual variability observed in plasma TG levels in response to an n-3 FA supplementation. © 2016 S. Karger AG, Basel.

Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

PubMed

Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

2012-01-01

Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

Large-scale enrichment and discovery of gene-associated SNPs

USDA-ARS?s Scientific Manuscript database

With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

Replicability and Robustness of GWAS for Behavioral Traits

PubMed Central

Rietveld, Cornelius A.; Conley, Dalton; Eriksson, Nicholas; Esko, Tõnu; Medland, Sarah E.; Vinkhuyzen, Anna A.E.; Yang, Jian; Boardman, Jason D.; Chabris, Christopher F.; Dawes, Christopher T.; Domingue, Benjamin W.; Hinds, David A.; Johannesson, Magnus; Kiefer, Amy K.; Laibson, David; Magnusson, Patrik K. E.; Mountain, Joanna L.; Oskarsson, Sven; Rostapshova, Olga; Teumer, Alexander; Tung, Joyce Y.; Visscher, Peter M.; Benjamin, Daniel J.; Cesarini, David; Koellinger, Philipp D.

2015-01-01

A recent genome-wide association study (GWAS) of educational attainment identified three single-nucleotide polymorphisms (SNPs) that, despite their small effect sizes (each R2 ≈ 0.02%), reached genome-wide significance (p < 5×10−8) in a large discovery sample and replicated in an independent sample (p < 0.05). The study also reported associations between educational attainment and indices of SNPs called “polygenic scores.” We evaluate the robustness of these findings. Study 1 finds that all three SNPs replicate in another large (N = 34,428) independent sample. We also find that the scores remain predictive (R2 ≈ 2%) with stringent controls for stratification (Study 2) and in new within-family analyses (Study 3). Our results show that large and therefore well-powered GWASs can identify replicable genetic associations with behavioral traits. The small effect sizes of individual SNPs are likely to be a major contributing explanation for the striking contrast between our results and the disappointing replication record of most candidate gene studies. PMID:25287667

No association between oxytocin or prolactin gene variants and childhood-onset mood disorders

PubMed Central

Strauss, John S.; Freeman, Natalie L.; Shaikh, Sajid A.; Vetró, Ágnes; Kiss, Enikő; Kapornai, Krisztina; Daróczi, Gabriella; Rimay, Timea; Kothencné, Viola Osváth; Dombovári, Edit; Kaczvinszk, Emília; Tamás, Zsuzsa; Baji, Ildikó; Besny, Márta; Gádoros, Julia; DeLuca, Vincenzo; George, Charles J.; Dempster, Emma; Barr, Cathy L.; Kovacs, Maria; Kennedy, James L.

2010-01-01

Background Oxytocin (OXT) and prolactin (PRL) are neuropeptide hormones that interact with the serotonin system and are involved in the stress response and social affiliation. In human studies, serum OXT and PRL levels have been associated with depression and related phenotypes. Our purpose was to determine if single nucleotide polymorphisms (SNPs) at the loci for OXT, PRL and their receptors, OXTR and PRLR, were associated with childhood-onset mood disorders (COMD). Methods Using 678 families in a family-based association design, we genotyped sixteen SNPs at OXT, PRL, OXTR and PRLR to test for association with COMD. Results No significant associations were found for SNPs in the OXTR, PRL, or PRLR genes. Two of three SNPs 3' of the OXT gene were associated with COMD (p ≤ 0.02), significant after spectral decomposition, but were not significant after additionally correcting for the number of genes tested. Supplementary analyses of parent-of-origin and proband sex effects for OXT SNPs by Fisher’s Exact test were not significant after Bonferroni correction. Conclusions We have examined sixteen OXT and PRL system gene variants, with no evidence of statistically significant association after correction for multiple tests. PMID:20547007

Transferability of genome-wide associated loci for asthma in African Americans.

PubMed

Faruque, Mezbah U; Chen, Guanjie; Doumatey, Ayo P; Zhou, Jie; Huang, Hanxia; Shriner, Daniel; Adeyemo, Adebowale A; Rotimi, Charles N; Dunston, Georgia M

2017-01-02

Transferability of significantly associated loci or GWAS "hits" adds credibility to genotype-disease associations and provides evidence for generalizability across different ancestral populations. We sought evidence of association of known asthma-associated single nucleotide polymorphisms (SNPs) in an African American population. Subjects comprised 661 participants (261 asthma cases and 400 controls) from the Howard University Family Study. Forty-eight SNPs previously reported to be associated with asthma by GWAS were selected for testing. We adopted a combined strategy by first adopting an "exact" approach where we looked-up only the reported index SNP. For those index SNPs missing form our dataset, we used a "local" approach that examined all the regional SNPs in LD with the index SNP. Out of the 48 SNPs, our cohort had genotype data available for 27, which were examined for exact replication. Of these, two SNPs were found positively associated with asthma. These included: rs10508372 (OR = 1.567 [95%CI, 1.133-2.167], P = 0.0066) and rs2378383 (OR = 2.147 [95%CI, 1.149-4.013], P = 0.0166), located on chromosomal bands 10p14 and 9q21.31, respectively. Local replication of the remaining 21 loci showed association at two chromosomal loci (9p24.1-rs2381413 and 6p21.32-rs3132947; Bonferroni-corrected P values: 0.0033 and 0.0197, respectively). Of note, multiple SNPs in LD with rs2381413 located upstream of IL33 were significantly associated with asthma. This study has successfully transferred four reported asthma-associated loci in an independent African American population. Identification of several asthma-associated SNPs in the upstream of the IL33, a gene previously implicated in allergic inflammation of asthmatic airway, supports the generalizability of this finding.

Identification of Prostate Cancer Predisposition Genes on the Y Chromosome

DTIC Science & Technology

2017-10-01

sequencing was submitted. We used available Utah data for ~1,000 Y chromosome SNPs on 80 high risk Y chromosomes and 150 low risk Y chromosomes with some Y...chromosome genotype data available . The set of ~1,000 SNPs was used to perform a phylogenetic analysis of the high vs low r isk Y chromosomes; some...SNPs on a set of 80 high risk Y chromosomes and a set of 150 low risk Y chromosomes with some Y chromosome genotype data available . We identified

Genome-wide association analysis of ischemic stroke in young adults.

PubMed

Cheng, Yu-Ching; O'Connell, Jeffrey R; Cole, John W; Stine, O Colin; Dueker, Nicole; McArdle, Patrick F; Sparks, Mary J; Shen, Jess; Laurie, Cathy C; Nelson, Sarah; Doheny, Kimberly F; Ling, Hua; Pugh, Elizabeth W; Brott, Thomas G; Brown, Robert D; Meschia, James F; Nalls, Michael; Rich, Stephen S; Worrall, Bradford; Anderson, Christopher D; Biffi, Alessandro; Cortellini, Lynelle; Furie, Karen L; Rost, Natalia S; Rosand, Jonathan; Manolio, Teri A; Kittner, Steven J; Mitchell, Braxton D

2011-11-01

Ischemic stroke (IS) is among the leading causes of death in Western countries. There is a significant genetic component to IS susceptibility, especially among young adults. To date, research to identify genetic loci predisposing to stroke has met only with limited success. We performed a genome-wide association (GWA) analysis of early-onset IS to identify potential stroke susceptibility loci. The GWA analysis was conducted by genotyping 1 million SNPs in a biracial population of 889 IS cases and 927 controls, ages 15-49 years. Genotypes were imputed using the HapMap3 reference panel to provide 1.4 million SNPs for analysis. Logistic regression models adjusting for age, recruitment stages, and population structure were used to determine the association of IS with individual SNPs. Although no single SNP reached genome-wide significance (P < 5 × 10(-8)), we identified two SNPs in chromosome 2q23.3, rs2304556 (in FMNL2; P = 1.2 × 10(-7)) and rs1986743 (in ARL6IP6; P = 2.7 × 10(-7)), strongly associated with early-onset stroke. These data suggest that a novel locus on human chromosome 2q23.3 may be associated with IS susceptibility among young adults.

Genome-wide association studies to identify rice salt-tolerance markers.

PubMed

Patishtan, Juan; Hartley, Tom N; Fonseca de Carvalho, Raquel; Maathuis, Frans J M

2018-05-01

Salinity is an ever increasing menace that affects agriculture worldwide. Crops such as rice are salt sensitive, but its degree of susceptibility varies widely between cultivars pointing to extensive genetic diversity that can be exploited to identify genes and proteins that are relevant in the response of rice to salt stress. We used a diversity panel of 306 rice accessions and collected phenotypic data after short (6 h), medium (7 d) and long (30 d) salinity treatment (50 mm NaCl). A genome-wide association study (GWAS) was subsequently performed, which identified around 1200 candidate genes from many functional categories, but this was treatment period dependent. Further analysis showed the presence of cation transporters and transcription factors with a known role in salinity tolerance and those that hitherto were not known to be involved in salt stress. Localization analysis of single nucleotide polymorphisms (SNPs) showed the presence of several hundred non-synonymous SNPs (nsSNPs) in coding regions and earmarked specific genomic regions with increased numbers of nsSNPs. It points to components of the ubiquitination pathway as important sources of genetic diversity that could underpin phenotypic variation in stress tolerance. © 2017 John Wiley & Sons Ltd.

Genome Wide Analysis of Fertility and Production Traits in Italian Holstein Cattle

PubMed Central

Stella, Alessandra; Biffani, Stefano; Negrini, Riccardo; Lazzari, Barbara; Ajmone-Marsan, Paolo; Williams, John L .

2013-01-01

A genome wide scan was performed on a total of 2093 Italian Holstein proven bulls genotyped with 50K single nucleotide polymorphisms (SNPs), with the objective of identifying loci associated with fertility related traits and to test their effects on milk production traits. The analysis was carried out using estimated breeding values for the aggregate fertility index and for each trait contributing to the index: angularity, calving interval, non-return rate at 56 days, days to first service, and 305 day first parity lactation. In addition, two production traits not included in the aggregate fertility index were analysed: fat yield and protein yield. Analyses were carried out using all SNPs treated separately, further the most significant marker on BTA14 associated to milk quality located in the DGAT1 region was treated as fixed effect. Genome wide association analysis identified 61 significant SNPs and 75 significant marker-trait associations. Eight additional SNP associations were detected when SNP located near DGAT1 was included as a fixed effect. As there were no obvious common SNPs between the traits analyzed independently in this study, a network analysis was carried out to identify unforeseen relationships that may link production and fertility traits. PMID:24265800

Genome-wide Association Study Identifies African-Specific Susceptibility Loci in African Americans with Inflammatory Bowel Disease

PubMed Central

Brant, Steven R.; Okou, David T.; Simpson, Claire L.; Cutler, David J.; Haritunians, Talin; Bradfield, Jonathan P.; Chopra, Pankaj; Prince, Jarod; Begum, Ferdouse; Kumar, Archana; Huang, Chengrui; Venkateswaran, Suresh; Datta, Lisa W.; Wei, Zhi; Thomas, Kelly; Herrinton, Lisa J.; Klapproth, Jan-Micheal A.; Quiros, Antonio J.; Seminerio, Jenifer; Liu, Zhenqiu; Alexander, Jonathan S.; Baldassano, Robert N.; Dudley-Brown, Sharon; Cross, Raymond K.; Dassopoulos, Themistocles; Denson, Lee A.; Dhere, Tanvi A.; Dryden, Gerald W.; Hanson, John S.; Hou, Jason K.; Hussain, Sunny Z.; Hyams, Jeffrey S.; Isaacs, Kim L.; Kader, Howard; Kappelman, Michael D.; Katz, Jeffry; Kellermayer, Richard; Kirschner, Barbara S.; Kuemmerle, John F.; Kwon, John H.; Lazarev, Mark; Li, Ellen; Mack, David; Mannon, Peter; Moulton, Dedrick E.; Newberry, Rodney D.; Osuntokun, Bankole O.; Patel, Ashish S.; Saeed, Shehzad A.; Targan, Stephan R.; Valentine, John F.; Wang, Ming-Hsi; Zonca, Martin; Rioux, John D.; Duerr, Richard H.; Silverberg, Mark S.; Cho, Judy H.; Hakonarson, Hakon; Zwick, Michael E.; McGovern, Dermot P.B.; Kugathasan, Subra

2016-01-01

Background & Aims The inflammatory bowel diseases (IBD) ulcerative colitis (UC) and Crohn’s disease (CD) cause significant morbidity and are increasing in prevalence among all populations, including African Americans. More than 200 susceptibility loci have been identified in populations of predominantly European ancestry, but few loci have been associated with IBD in other ethnicities. Methods We performed 2 high-density, genome-wide scans comprising 2345 cases of African Americans with IBD (1646 with CD, 583 with UC, and 116 inflammatory bowel disease unclassified [IBD-U]) and 5002 individuals without IBD (controls, identified from the Health Retirement Study and Kaiser Permanente database). Single-nucleotide polymorphisms (SNPs) associated at P<5.0×10−8 in meta-analysis with a nominal evidence (P<.05) in each scan were considered to have genome-wide significance. Results We detected SNPs at HLA-DRB1, and African-specific SNPs at ZNF649 and LSAMP, with associations of genome-wide significance for UC. We detected SNPs at USP25 with associations of genome-wide significance associations for IBD. No associations of genome-wide significance were detected for CD. In addition, 9 genes previously associated with IBD contained SNPs with significant evidence for replication (P<1.6×10−6): ADCY3, CXCR6, HLA-DRB1 to HLA-DQA1 (genome-wide significance on conditioning), IL12B, PTGER4, and TNC for IBD; IL23R, PTGER4, and SNX20 (in strong linkage disequilibrium with NOD2) for CD; and KCNQ2 (near TNFRSF6B) for UC. Several of these genes, such as TNC (near TNFSF15), CXCR6, and genes associated with IBD at the HLA locus, contained SNPs with unique association patterns with African-specific alleles. Conclusions We performed a genome-wide association study of African Americans with IBD and identified loci associated with CD and UC in only this population; we also replicated loci identified in European populations. The detection of variants associated with IBD risk in only people of African descent demonstrates the importance of studying the genetics of IBD and other complex diseases in populations beyond those of European ancestry. PMID:27693347

Genetic variation in peroxisome proliferator-activated receptor gamma, soy, and mammographic density in Singapore Chinese women.

PubMed

Lee, Eunjung; Hsu, Chris; Van den Berg, David; Ursin, Giske; Koh, Woon-Puay; Yuan, Jian-Min; Stram, Daniel O; Yu, Mimi C; Wu, Anna H

2012-04-01

PPARγ is a transcription factor important for adipogenesis and adipocyte differentiation. Data from animal studies suggest that PPARγ may be involved in breast tumorigenesis, but results from epidemiologic studies on the association between PPARγ variation and breast cancer risk have been mixed. Recent data suggest that soy isoflavones can activate PPARγ. We investigated the interrelations of soy, PPARγ, and mammographic density, a biomarker of breast cancer risk in a cross-sectional study of 2,038 women who were members of the population-based Singapore Chinese Health Study Cohort. We assessed mammographic density using a computer-assisted method. We used linear regression to examine the association between 26 tagging single-nucleotide polymorphisms (SNP) of PPARγ and their interaction with soy intake and mammographic density. To correct for multiple testing, we calculated P values adjusted for multiple correlated tests (P(ACT)). Out of the 26 tested SNPs in the PPARγ, seven SNPs were individually shown to be statistically significantly associated with mammographic density (P(ACT) = 0.008-0.049). A stepwise regression procedure identified that only rs880663 was independently associated with mammographic density which decreased by 1.89% per-minor allele (P(ACT) = 0.008). This association was significantly stronger in high-soy consumers as mammographic density decreased by 3.97% per-minor allele of rs880663 in high-soy consumers (P(ACT) = 0.006; P for interaction with lower soy intake = 0.017). Our data support that PPARγ genetic variation may be important in determining mammographic density, particularly in high-soy consumers. Our findings may help to identify molecular targets and lifestyle intervention for future prevention research. ©2012 AACR.

A selective sweep of >8 Mb on chromosome 26 in the Boxer genome.

PubMed

Quilez, Javier; Short, Andrea D; Martínez, Verónica; Kennedy, Lorna J; Ollier, William; Sanchez, Armand; Altet, Laura; Francino, Olga

2011-07-01

Modern dog breeds display traits that are either breed-specific or shared by a few breeds as a result of genetic bottlenecks during the breed creation process and artificial selection for breed standards. Selective sweeps in the genome result from strong selection and can be detected as a reduction or elimination of polymorphism in a given region of the genome. Extended regions of homozygosity, indicative of selective sweeps, were identified in a genome-wide scan dataset of 25 Boxers from the United Kingdom genotyped at ~20,000 single-nucleotide polymorphisms (SNPs). These regions were further examined in a second dataset of Boxers collected from a different geographical location and genotyped using higher density SNP arrays (~170,000 SNPs). A selective sweep previously associated with canine brachycephaly was detected on chromosome 1. A novel selective sweep of over 8 Mb was observed on chromosome 26 in Boxer and for a shorter region in English and French bulldogs. It was absent in 171 samples from eight other dog breeds and 7 Iberian wolf samples. A region of extended increased heterozygosity on chromosome 9 overlapped with a previously reported copy number variant (CNV) which was polymorphic in multiple dog breeds. A selective sweep of more than 8 Mb on chromosome 26 was identified in the Boxer genome. This sweep is likely caused by strong artificial selection for a trait of interest and could have inadvertently led to undesired health implications for this breed. Furthermore, we provide supporting evidence for two previously described regions: a selective sweep on chromosome 1 associated with canine brachycephaly and a CNV on chromosome 9 polymorphic in multiple dog breeds.