[Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

PubMed

Khrustaleva, A M; Gritsenko, O F; Klovach, N V

2013-11-01

The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

PubMed Central

Watson, Claire L.; Lockwood, Diana N. J.

2009-01-01

Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

PubMed Central

Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

2015-01-01

Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

USDA-ARS?s Scientific Manuscript database

Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

PubMed Central

Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

2016-01-01

Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

PubMed Central

Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

2016-01-01

The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

PubMed

Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

2008-04-15

The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

Single nucleotide polymorphism analysis using different colored dye dimer probes

NASA Astrophysics Data System (ADS)

Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

2006-09-01

Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

[Identification of single nucleotide polymorphisms related to frailty].

PubMed

Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

2018-04-07

The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

PubMed Central

Duellman, Tyler; Warren, Christopher; Yang, Jay

2014-01-01

Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

PubMed

Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

2016-01-01

Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

[Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

PubMed

Wu, Lei; He, Yao; Zhang, Di

2015-11-01

To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

PubMed

Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

2016-02-01

The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P < 1.94 × 10(-7) (Bonferroni correction: 0.05/257,558). Tests of association revealed 2 significantly associated SNPs, one occurring in SAP30BP (rs820218; P = 3.8E-9) on chromosome 17q25 and another occurring in SASH1 (rs12527089; P = 1.9E-7) on chromosome 6q24. This study represents the first attempt to identify genetic factors influencing rotator cuff tearing by a genome-wide association study using a dense/complete set of SNPs. Two SNPs were significantly associated with rotator cuff tearing, residing in SAP30BP on chromosome 17 and SASH1 on chromosome 6. Both genes are associated with the cellular process of apoptosis. Identification of potential genes or genetic variants associated with rotator cuff tearing may help in identifying individuals at risk for the development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

PubMed Central

Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

2006-01-01

Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

USDA-ARS?s Scientific Manuscript database

Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

NASA Astrophysics Data System (ADS)

Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

2016-05-01

A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

PubMed

Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

2007-09-01

HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

PubMed

Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

2015-07-01

To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

2010-12-01

Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

PubMed Central

Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

2015-01-01

Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

PubMed

Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

2012-11-10

We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

PubMed

Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

2018-02-23

The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

PubMed

Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

2015-09-15

Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

USDA-ARS?s Scientific Manuscript database

High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

PubMed Central

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

PubMed

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

2017-01-01

RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

PubMed

Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

2010-11-26

Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

USDA-ARS?s Scientific Manuscript database

Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

NASA Astrophysics Data System (ADS)

Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

2015-11-01

Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

PubMed

Multani, Shaleen; Saranath, Dhananjaya

2016-11-01

Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

PubMed

Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

2012-09-04

A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

PubMed

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

PubMed

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

USDA-ARS?s Scientific Manuscript database

Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

Treesearch

Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

2016-01-01

Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

PubMed Central

Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

2001-01-01

For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that span the genome. Most of these markers are single nucleotide polymorphisms and sequences for these variants are provided in an accessible format. The average density of the new markers is one per 225 kb on the autosomes and one per megabase on the X chromosome. We include in this survey a set of P-element strains that provide additional use for high-resolution mapping. We show one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community. PMID:11381036

Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed

2001-04-16

For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markersmore » is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.« less

Single-feature polymorphism discovery in the barley transcriptome

PubMed Central

Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

2005-01-01

A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

A domesticated transposon mediates the effects of a single-nucleotide polymorphism responsible for enhanced muscle growth.

PubMed

Butter, Falk; Kappei, Dennis; Buchholz, Frank; Vermeulen, Michiel; Mann, Matthias

2010-04-01

Single-nucleotide polymorphisms (SNPs) in the regulatory regions of the genome can have a profound impact on phenotype. The G3072A polymorphism in intron 3 of insulin-like growth factor 2 (IGF2) is implicated in higher muscle content and reduced fat in European pigs and is bound by a putative repressor. Here, we identify this repressor--which we call muscle growth regulator (MGR)--by using a DNA protein interaction screen based on quantitative mass spectrometry. MGR has a bipartite nuclear localization signal, two BED-type zinc fingers and is highly conserved between placental mammals. Surprisingly, the gene is located in an intron and belongs to the hobo-Ac-Tam3 transposase superfamily, suggesting regulatory use of a formerly parasitic element. In transactivation assays, MGR differentially represses the expression of the two SNP variants. Knockdown of MGR in C2C12 myoblast cells upregulates Igf2 expression and mild overexpression retards growth. Thus, MGR is the repressor responsible for enhanced muscle growth in the IGF2 G3072A polymorphism in commercially bred pigs.

The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

PubMed

Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

2017-09-01

Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in

DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

PubMed

Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

2013-07-15

Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

USDA-ARS?s Scientific Manuscript database

Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

PubMed Central

Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

2013-01-01

The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

PubMed

Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

2009-06-01

The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p polymorphism in SERPINA9 was associated with incident stroke in Whites and Blacks, even after taking into account traditional risk factors. The idea that ischemic stroke and CHD may share some common genetic factors, such as variation in SERPINA9, should be investigated in other studies. Copyright 2008 S. Karger AG, Basel.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

PubMed

Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

2017-05-01

Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

PubMed Central

2012-01-01

Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron

SiNoPsis: Single Nucleotide Polymorphisms selection and promoter profiling.

PubMed

Boloc, Daniel; Rodríguez, Natalia; Gassó, Patricia; Abril, Josep F; Bernardo, Miquel; Lafuente, Amalia; Mas, Sergi

2017-09-14

The selection of a Single Nucleotide Polymorphism (SNP) using bibliographic methods can be a very time-consuming task. Moreover, a SNP selected in this way may not be easily visualized in its genomic context by a standard user hoping to correlate it with other valuable information. Here we propose a web form built on top of Circos that can assist SNP-centred screening, based on their location in the genome and the regulatory modules they can disrupt. Its use may allow researchers to prioritize SNPs in genotyping and disease studies. SiNoPsis is bundled as a web portal. It focuses on the different structures involved in the genomic expression of a gene, especially those found in the core promoter upstream region. These structures include transcription factor binding sites (for promoter and enhancer signals), histones, and promoter flanking regions. Additionally, the tool provides eQTL and linkage disequilibrium (LD) properties for a given SNP query, yielding further clues about other indirectly associated SNPs. Possible disruptions of the aforementioned structures affecting gene transcription are reported using multiple resource databases. SiNoPsis has a simple user-friendly interface, which allows single queries by gene symbol, genomic coordinates, Ensembl gene identifiers, RefSeq transcript identifiers and SNPs. It is the only portal providing useful SNP selection based on regulatory modules and LD with functional variants in both textual and graphic modes (by properly defining the arguments and parameters needed to run Circos). SiNoPsis is freely available at https://compgen.bio.ub.edu/SiNoPsis /. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

USDA-ARS?s Scientific Manuscript database

Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

PubMed

Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

2013-01-01

Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

PubMed

Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

2012-05-17

The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

PubMed

Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

2018-01-01

To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing.

PubMed

Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

2017-01-01

Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.

Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

PubMed Central

Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

2017-01-01

Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770

Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

PubMed

Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

2012-10-01

To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

PubMed

Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

2012-04-01

Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

PubMed Central

2012-01-01

Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

A single nucleotide polymorphism genotyping platform for the authentication of patient derived xenografts.

PubMed

El-Hoss, Jad; Jing, Duohui; Evans, Kathryn; Toscan, Cara; Xie, Jinhan; Lee, Hyunjoo; Taylor, Renea A; Lawrence, Mitchell G; Risbridger, Gail P; MacKenzie, Karen L; Sutton, Rosemary; Lock, Richard B

2016-09-13

Patient derived xenografts (PDXs) have become a vital, frequently used, component of anti-cancer drug development. PDXs can be serially passaged in vivo for years, and shared across laboratories. As a consequence, the potential for mis-identification and cross-contamination is possible, yet authentication of PDXs appears limited. We present a PDX Authentication System (PAS), by combining a commercially available OpenArray assay of single nucleotide polymorphisms (SNPs) with in-house R studio programs, to validate PDXs established in individual mice from acute lymphoblastic leukemia biopsies. The PAS is sufficiently robust to identify contamination at levels as low as 3%, similar to the gold standard of short tandem repeat (STR) profiling. We have surveyed a panel of PDXs established from 73 individual leukemia patients, and found that the PAS provided sufficient discriminatory power to identify each xenograft. The identified SNP-discrepant PDXs demonstrated distinct gene expression profiles, indicating a risk of contamination for PDXs at high passage number. The PAS also allows for the authentication of tumor cells with complex karyotypes from solid tumors including prostate cancer and Ewing's sarcoma. This study highlights the demands of authenticating PDXs for cancer research, and evaluates a reliable authentication platform that utilizes a commercially available and cost-effective system.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

PubMed

Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

2018-01-01

Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

PubMed

Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

2010-01-01

Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

PubMed

Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

2017-01-01

Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Reconstructing population histories from single nucleotide polymorphism data.

PubMed

Sirén, Jukka; Marttinen, Pekka; Corander, Jukka

2011-01-01

Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.

DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

PubMed

Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

2017-05-23

A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

PubMed Central

Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

2015-01-01

The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

PubMed Central

Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

2007-01-01

A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

PubMed

Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

2006-08-15

Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Toward optimal set of single nucleotide polymorphism investigation before IVF.

PubMed

Ivanov, A V; Dedul, A G; Fedotov, Y N; Komlichenko, E V

2016-10-01

At present, the patient preparation for IVF needs to undergo a series of planned tests, including the genotyping of single nucleotide polymorphism (SNP) alleles of some genes. In former USSR countries, such investigation was not included in overwhelming majority of health insurance programs and paid by patient. In common, there are prerequisites to the study of more than 50 polymorphisms. An important faced task is to determine the optimal panel for SNP genotyping in terms of price/number of SNP. During 2009-2015 in the University Hospital of St. Petersburg State University, blood samples were analyzed from 550 women with different reproductive system disorders preparing for IVF and 46 healthy women in control group. In total, 28 SNP were analyzed in the genes of thrombophilia factors, folic acid cycle, detoxification system, and the renin-angiotensin system. The method used was real-time PCR. A significant increase in the frequency of pathological alleles of some polymorphisms in patients with habitual failure of IVF was shown, compared with the control group. As a result, two options defined panels for optimal typing SNP before IVF were composed. Standard panel includes 8 SNP, 5 in thromborhilic factors, and 3 in folic acid cycle genes. They are 20210 G > A of FII gene, R506Q G > A of FV gene (mutation Leiden), -675 5G > 4G of PAI-I gene, L33P T > C of ITGB3 gene, -455 G > A of FGB gene, 667 C > T of MTHFR gene, 2756 A > G of MTR gene, and 66 A > G of MTRR gene. Extended panel of 15 SNP also includes 807 C > T of ITGA2 gene, T154M C > T of GP1BA gene, second polymorphism 1298 A > C in MTHFR gene, polymorphisms of the renin-angiotensin gene AGT M235T T > C and -1166 A > C of AGTR1 gene, polymorphisms I105V A > G and A114V C > T of detoxification system gene GSTP. The results of SNP genotyping can be adjusted for treatment tactics and IVF, and also medical support getting pregnant. The success rate of

Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

PubMed Central

Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

2015-01-01

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

PubMed

Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

2003-09-30

Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

PubMed

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

PubMed

Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

2018-03-01

Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

PubMed

Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

PubMed

Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

2017-06-01

Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

PubMed Central

Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

2017-01-01

Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

ERIC Educational Resources Information Center

Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

2017-01-01

Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

PubMed

Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

2005-05-01

Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their

SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

PubMed Central

Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

2000-01-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

PubMed

Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

2000-08-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (Pidentified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

USDA-ARS?s Scientific Manuscript database

Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

PubMed

Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

2016-04-28

The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

PubMed

Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

2017-07-01

To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

PubMed

Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

2015-09-25

ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

PubMed

Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

2015-05-01

Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology

Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

PubMed

Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

2015-01-01

Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

2008-11-01

Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

PubMed

Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

2014-06-01

Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

USDA-ARS?s Scientific Manuscript database

The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

PubMed Central

Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

2014-01-01

Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

Correlations between ACE single nucleotide polymorphisms and prognosis of patients with septic shock.

PubMed

Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min

2017-04-30

The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).

Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

PubMed

Silva-Junior, Orzenil B; Grattapaglia, Dario

2015-11-01

We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

PubMed Central

van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

2012-01-01

Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

NASA Astrophysics Data System (ADS)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

PubMed Central

Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

2015-01-01

Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

PubMed

Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

2015-07-01

The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

PubMed

Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

2017-01-01

Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors.

PubMed

Phababpha, Suphawadee; Kukongviriyapan, Upa; Pakdeechote, Poungrat; Senggunprai, Laddawan; Kukongviriyapan, Veerapol; Settasatian, Chatri; Tatsanavivat, Pyatat; Intharaphet, Phongsak; Senthong, Vichai; Komanasin, Nantarat; Settasatian, Nongnuch; Greenwald, Stephen E

2013-06-21

Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. A total of 208 Thai subjects, aged 35-75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population.

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

PubMed Central

Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

2015-01-01

Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

Single nucleotide polymorphisms of DNA repair genes as predictors of radioresponse.

PubMed

Parliament, Matthew B; Murray, David

2010-10-01

Radiation therapy is a key modality in the treatment of cancer. Substantial progress has been made in unraveling the molecular events which underpin the responses of malignant and surrounding normal tissues to ionizing radiation. An understanding of the genes involved in processes such as DNA double-strand break repair, DNA damage response, cell-cycle control, apoptosis, cellular antioxidant defenses, and cytokine production, has evolved toward examination of how genetic variants, most often, single nucleotide polymorphisms (SNPs), may influence interindividual radioresponse. Experimental approaches, such as candidate SNP-association studies, genome-wide association studies, and massively parallel sequencing are being proposed to address these questions. We present a focused review of the evidence supporting an association between SNPs in DNA repair genes and radioresponse in normal tissues and tumors. Although preliminary results indicate possible associations, there are methodological weaknesses in many of the studies, and independent validation of SNPs as biomarkers of radioresponse in much larger cohorts will likely require research cooperation through international consortia. Copyright © 2010 Elsevier Inc. All rights reserved.

Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

PubMed Central

2013-01-01

Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

PubMed

Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

2014-02-15

A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

PubMed

van Binsbergen, R; Veerkamp, R F; Calus, M P L

2012-04-01

The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms.

PubMed

Lin, Wei-Jye; Salton, Stephen R

2013-01-01

The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

PubMed

Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

2014-12-01

In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

PubMed

van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

2012-03-27

In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

PubMed

Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

2002-03-01

Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

Highlights from the functional single nucleotide polymorphisms associated with human muscle size and strength or FAMuSS study.

PubMed

Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P

2013-01-01

The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

PubMed Central

Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.

2013-01-01

The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711

Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

PubMed

Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

2016-07-25

Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

PubMed

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

Single Nucleotide Polymorphism Array Analysis of Bone Marrow Failure Patients Reveals Characteristic Patterns of Genetic Changes

PubMed Central

Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica

2013-01-01

Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929

Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

PubMed

Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

2014-01-01

The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

PubMed Central

Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

2012-01-01

Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

2012-04-01

A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors

PubMed Central

2013-01-01

Background Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. Methods A total of 208 Thai subjects, aged 35–75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Results Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Conclusions Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai

A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

PubMed

Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

2018-01-01

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity

Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

PubMed

Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

2013-03-28

Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

[Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

PubMed

Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

2008-07-01

Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

PERB11 (MIC): a polymorphic MHC gene is expressed in skin and single nucleotide polymorphisms are associated with psoriasis

PubMed Central

Tay, G K; Hui, J; Gaudieri, S; Schmitt-Egenolf, M; Martinez, O P; Leelayuwat, C; Williamson, J F; Eiermann, T H; Dawkins, R L

2000-01-01

The susceptibility genes for psoriasis remain to be identified. At least one of these must be in the major histocompatibility complex (MHC) to explain associations with alleles at human leucocyte antigen (HLA)-A, -B, -C, -DR, -DQ and C4. In fact, most of these alleles are components of just two ancestral haplotypes (AHs) designated 13.1 and 57.1. Although relevant MHC gene(s) could be within a region of at least 4 Mb, most studies have favoured the area near HLA-B and -C. This region contains a large number of non-HLA genes, many of which are duplicated and polymorphic. Members of one such gene family, PERB11.1 and PERB11.2, are expressed in the skin and are encoded in the region between tumour necrosis factor and HLA-B. To investigate the relationship of PERB11.1 alleles to psoriasis, sequence based typing was performed on 97 patients classified according to age of onset and family history. The frequency of the PERB11.1*06 allele is 44% in type I psoriasis but only 7% in controls (Pc = 0.003 by Fisher's exact test, two-tailed). The major determinant of this association is a single nucleotide polymorphism (SNP) within intron 4. In normal and affected skin, expression of PERB11 is mainly in the basal layer of the epidermis including ducts and follicles. PERB11 is also present in the upper keratin layers but there is relative deficiency in the intermediate layers. These findings suggest a possible role for PERB11 and other MHC genes in the pathogenesis of psoriasis. PMID:10691930

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

[Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

PubMed

Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

2014-07-01

The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

PubMed Central

Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

2007-01-01

Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

The Regulated Secretory Pathway and Human Disease: Insights from Gene Variants and Single Nucleotide Polymorphisms

PubMed Central

Lin, Wei-Jye; Salton, Stephen R.

2013-01-01

The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269

Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.

PubMed

Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed

2016-10-17

Preterm birth (PTB), birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 %) of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

[Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

PubMed

Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

2012-06-01

To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

PubMed

Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

2017-02-01

The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

ESR1 single nucleotide polymorphisms predict breast cancer susceptibility in the central European Caucasian population.

PubMed

Lipphardt, Mark F; Deryal, Mustafa; Ong, Mei Fang; Schmidt, Werner; Mahlknecht, Ulrich

2013-01-01

Estrogen and progesterone hormones are key regulators of a wide variety of biological processes. In addition to their influence on reproduction, cell differentiation and apoptosis, they affect inflammatory response, cell metabolism and most importantly, they regulate physiological breast tissue proliferation and differentiation as well as the development and progression of breast cancer. In order to assess whether genetic variants in the steroid hormone receptor gene ESR1 (estrogen receptor alpha) had an effect on sporadic breast cancer susceptibility, we assessed 7 ESR1 single nucleotide polymorphisms (SNPs) for associations with breast cancer susceptibility and clinical parameters in 221 breast cancer patients and 221 controls, respectively. We identified ESR1 intron SNP +2464 C/T (rs3020314) and ESR1 intron SNP -4576 A/C (rs1514348) to correlate with breast cancer susceptibility and progesterone receptor expression status. Patients genotyped CT for ESR1 intron SNP +2464 (rs3020314) (p ≤ 0.045) or genotyped AC for ESR1 intron SNP -4576 (rs1514348) (p ≤ 0.000026) were identified to carry a significant risk as to the development of breast cancer in the Central European Caucasian population (both together: p ≤ 0.000488). Our study could confirm previous associations and revealed new associations of SNP rs1514348 with susceptibility to breast cancer and clinical outcome, which might be used as new additional SNP markers.

Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

PubMed

Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

2016-06-01

Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

PubMed

Gehring, I; Geider, K

2012-07-01

Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr) in human poliovirus receptor gene.

PubMed

Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M

2016-07-01

It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

PubMed Central

Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

2015-01-01

Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

PubMed

Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

2013-12-01

Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

PubMed

Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

2015-12-01

We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

PubMed

Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

2017-05-01

The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

PubMed

Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

2015-12-01

Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

PubMed

Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

2010-05-01

Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

PubMed

Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

2015-01-01

The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

PubMed

Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

PubMed Central

Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

PubMed

Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

2018-06-01

Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

Wavelet-based identification of DNA focal genomic aberrations from single nucleotide polymorphism arrays

PubMed Central

2011-01-01

Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311

The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

PubMed

Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

2011-10-01

The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods.

PubMed

Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge

2006-12-01

The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

PubMed

Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

2007-06-01

The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

[Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

PubMed

Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

2008-08-01

To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

PubMed

Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

2010-07-01

Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

SNPHunter: a bioinformatic software for single nucleotide polymorphism data acquisition and management.

PubMed

Wang, Lin; Liu, Simin; Niu, Tianhua; Xu, Xin

2005-03-18

Single nucleotide polymorphisms (SNPs) provide an important tool in pinpointing susceptibility genes for complex diseases and in unveiling human molecular evolution. Selection and retrieval of an optimal SNP set from publicly available databases have emerged as the foremost bottlenecks in designing large-scale linkage disequilibrium studies, particularly in case-control settings. We describe the architectural structure and implementations of a novel software program, SNPHunter, which allows for both ad hoc-mode and batch-mode SNP search, automatic SNP filtering, and retrieval of SNP data, including physical position, function class, flanking sequences at user-defined lengths, and heterozygosity from NCBI dbSNP. The SNP data extracted from dbSNP via SNPHunter can be exported and saved in plain text format for further down-stream analyses. As an illustration, we applied SNPHunter for selecting SNPs for 10 major candidate genes for type 2 diabetes, including CAPN10, FABP4, IL6, NOS3, PPARG, TNF, UCP2, CRP, ESR1, and AR. SNPHunter constitutes an efficient and user-friendly tool for SNP screening, selection, and acquisition. The executable and user's manual are available at http://www.hsph.harvard.edu/ppg/software.htm

Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls

PubMed Central

Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H. M.; Gurjar, Suraj K.; Gupta, I. D.; Verma, Archana

2017-01-01

Aim: This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Materials and Methods: Genomic DNA was isolated by phenol–chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. Results: The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5’UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. Conclusion: A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible. PMID:28344410

Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

PubMed

Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

2016-06-01

Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

ERIC Educational Resources Information Center

Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

2010-01-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

Single-nucleotide polymorphisms studied for associations with urinary toxicity from (125)I prostate brachytherapy implants.

PubMed

Usmani, Nawaid; Leong, Nelson; Martell, Kevin; Lan, Lanna; Ghosh, Sunita; Pervez, Nadeem; Pedersen, John; Yee, Don; Murtha, Albert; Amanie, John; Sloboda, Ron; Murray, David; Parliament, Matthew

2014-01-01

To identify clinical, dosimetric, and genetic factors that are associated with late urinary toxicity after a (125)I prostate brachytherapy implant. Genomic DNA from 296 men treated with (125)I prostate brachytherapy monotherapy was extracted from saliva samples for this study. A retrospective database was compiled including clinical, dosimetric, and toxicity data for this cohort of patients. Fourteen candidate single-nucleotide polymorphism (SNPs) from 13 genes (TP53, ERCC2, GSTP1, NOS, TGFβ1, MSH6, RAD51, ATM, LIG4, XRCC1, XRCC3, GSTA1, and SOD2) were tested in this cohort for correlations with toxicity. This study identified 217 men with at least 2 years of followup. Of these, 39 patients developed Grade ≥2 late urinary complications with a transurethral resection of prostate, urethral stricture, gross hematuria, or a sustained increase in their International Prostate Symptom Score. The only clinical or dosimetric factor that was associated with late urinary toxicity was age (p = 0.02). None of the 14 SNPs tested in this study were associated with late urinary toxicity in the univariate analysis. This study identified age as the only variable being associated with late urinary toxicity. However, the small sample size and the candidate gene approach used in this study mean that further investigations are essential. Genome-wide association studies are emerging as the preferred approach for future radiogenomic studies to overcome the limitations from a candidate gene approach. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Exploring single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes in the jellyfish (Rhopilema esculentum) by transcriptome sequencing.

PubMed

Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo

2017-08-01

In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.

Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

PubMed

Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

2017-09-01

It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

Rapid single nucleotide polymorphism detection for personalized medicine applications using planar waveguide fluorescence sensors

NASA Astrophysics Data System (ADS)

Herron, James N.; Tolley, Samuel E.; Smith, Richard; Christensen, Douglas A.

2006-02-01

Personalized medicine is an emerging field in which clinical diagnostics information about a patient's genotype or phenotype is used to optimize his/her pharmacotherapy. This article evaluates whether planar waveguide fluorescent sensors are suitable for determining such information from patient testing in point-of-care (POC) settings. The model system was Long QT Syndrome, a congenital disease associated with single nucleotide polymorphisms (SNPs) in genes encoding for cardiac ion channels. Three different SNP assay formats were examined: DNA/DNA hybridization, DNA/PNA hybridization (PNA: "peptide nucleic acid"), and single base extension (SBEX). Although DNA/DNA hybridization produced a strong intensity-time response for both wildtype and SNP analytes in a 5-min assay at 32°C, their hybridization rates differed by only 32.7%, which was insufficient for clinical decision-making. Much better differentiation of the two rates was observed at 53°C, where the wildtype's hybridization rate was two-thirds of its maximum value, while that of the SNP was essentially zero. Such all-or-nothing resolution would be adequate for clinical decision-making; however, the elevated temperature and precise temperature control would be hard to achieve in a POC setting. Results from DNA/PNA hybridization studies were more promising. Nearly 20-fold discrimination between wildtype and SNP hybridization rates was observed in a 5-min assay at 30°C, although the low ionic strength conditions required necessitated a de-salting step between sample preparation and SNP detection. SBEX was the most promising of the three, determining the absolute identity of the suspected polymorphism in a 5-min assay at 40°C.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

A 2-Stage Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms Associated With Development of Erectile Dysfunction Following Radiation Therapy for Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Sarah L.; Departments of Pathology and Genetics, Albert Einstein College of Medicine, Bronx, New York; Stock, Richard

2013-01-01

Purpose: To identify single nucleotide polymorphisms (SNPs) associated with development of erectile dysfunction (ED) among prostate cancer patients treated with radiation therapy. Methods and Materials: A 2-stage genome-wide association study was performed. Patients were split randomly into a stage I discovery cohort (132 cases, 103 controls) and a stage II replication cohort (128 cases, 102 controls). The discovery cohort was genotyped using Affymetrix 6.0 genome-wide arrays. The 940 top ranking SNPs selected from the discovery cohort were genotyped in the replication cohort using Illumina iSelect custom SNP arrays. Results: Twelve SNPs identified in the discovery cohort and validated in themore » replication cohort were associated with development of ED following radiation therapy (Fisher combined P values 2.1 Multiplication-Sign 10{sup -5} to 6.2 Multiplication-Sign 10{sup -4}). Notably, these 12 SNPs lie in or near genes involved in erectile function or other normal cellular functions (adhesion and signaling) rather than DNA damage repair. In a multivariable model including nongenetic risk factors, the odds ratios for these SNPs ranged from 1.6 to 5.6 in the pooled cohort. There was a striking relationship between the cumulative number of SNP risk alleles an individual possessed and ED status (Sommers' D P value = 1.7 Multiplication-Sign 10{sup -29}). A 1-allele increase in cumulative SNP score increased the odds for developing ED by a factor of 2.2 (P value = 2.1 Multiplication-Sign 10{sup -19}). The cumulative SNP score model had a sensitivity of 84% and specificity of 75% for prediction of developing ED at the radiation therapy planning stage. Conclusions: This genome-wide association study identified a set of SNPs that are associated with development of ED following radiation therapy. These candidate genetic predictors warrant more definitive validation in an independent cohort.« less

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

PubMed

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

PubMed

Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

2015-11-10

Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs

Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

PubMed

Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

2014-05-09

ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

PubMed

Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

2017-03-01

The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

Gene-based meta-analysis of genome-wide association study data identifies independent single-nucleotide polymorphisms in ANXA6 as being associated with systemic lupus erythematosus in Asian populations.

PubMed

Zhang, Jing; Zhang, Lu; Zhang, Yan; Yang, Jing; Guo, Mengbiao; Sun, Liangdan; Pan, Hai-Feng; Hirankarn, Nattiya; Ying, Dingge; Zeng, Shuai; Lee, Tsz Leung; Lau, Chak Sing; Chan, Tak Mao; Leung, Alexander Moon Ho; Mok, Chi Chiu; Wong, Sik Nin; Lee, Ka Wing; Ho, Marco Hok Kung; Lee, Pamela Pui Wah; Chung, Brian Hon-Yin; Chong, Chun Yin; Wong, Raymond Woon Sing; Mok, Mo Yin; Wong, Wilfred Hing Sang; Tong, Kwok Lung; Tse, Niko Kei Chiu; Li, Xiang-Pei; Avihingsanon, Yingyos; Rianthavorn, Pornpimol; Deekajorndej, Thavatchai; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk; Ying, Shirley King Yee; Fung, Samuel Ka Shun; Lai, Wai Ming; Garcia-Barceló, Maria-Mercè; Cherny, Stacey S; Sham, Pak Chung; Cui, Yong; Yang, Sen; Ye, Dong Qing; Zhang, Xue-Jun; Lau, Yu Lung; Yang, Wanling

2015-11-01

Previous genome-wide association studies (GWAS), which were mainly based on single-variant analysis, have identified many systemic lupus erythematosus (SLE) susceptibility loci. However, the genetic architecture of this complex disease is far from being understood. The aim of this study was to investigate whether using a gene-based analysis may help to identify novel loci, by considering global evidence of association from a gene or a genomic region rather than focusing on evidence for individual variants. Based on the results of a meta-analysis of 2 GWAS of SLE conducted in 2 Asian cohorts, we performed an in-depth gene-based analysis followed by replication in a total of 4,626 patients and 7,466 control subjects of Asian ancestry. Differential allelic expression was measured by pyrosequencing. More than one-half of the reported SLE susceptibility loci showed evidence of independent effects, and this finding is important for understanding the mechanisms of association and explaining disease heritability. ANXA6 was detected as a novel SLE susceptibility gene, with several single-nucleotide polymorphisms (SNPs) contributing independently to the association with disease. The risk allele of rs11960458 correlated significantly with increased expression of ANXA6 in peripheral blood mononuclear cells from heterozygous healthy control subjects. Several other associated SNPs may also regulate ANXA6 expression, according to data obtained from public databases. Higher expression of ANXA6 in patients with SLE was also reported previously. Our study demonstrated the merit of using gene-based analysis to identify novel susceptibility loci, especially those with independent effects, and also demonstrated the widespread presence of loci with independent effects in SLE susceptibility genes. © 2015, American College of Rheumatology.

Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

PubMed Central

Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

2012-01-01

Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

PubMed

López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2012-06-01

The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

Could single nucleotide polymorphisms influence on the efficacy of platelet-rich plasma in the treatment of sport injuries?

PubMed Central

Pruna, Ricard; Til, Lluis; Artells, Rosa

2014-01-01

Summary Platelet-rich plasma (PRP) is a new powerful biological tool in sports medicine, when used to treat tendon, ligament and muscle injuries. PRP is a fraction of autologous whole blood containing an increased number of platelets and a wide variety of cytokines that can improve and accelerate the healing of various tissues. An analysis of the literature shows promising pre-clinical results for PRP treatment, but there is a lack of solid clinical proof to support its use in sports medicine, and in fact, clinical findings on individual responses to PRP treatment are contradictory. These contradictions may be due to interindividual differences in the presence of single nucleotide polymorphisms (SNPs) in genes related to PRPs and/or their receptors. These SNPs can determine a greater or lesser response to this treatment and consequently a shorter or longer recovery time. We have focused our attention in the study of genes related to PRP with the aim to develope a genetic profile that will identify the individuals and injuries most likely to benefit from PRP treatment. PMID:24932449

Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.

PubMed

Martínez-Herrero, Sonia; Martínez, Alfredo

2013-04-01

The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

PubMed

Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

2014-10-24

Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

Development of a New Molecular Subtyping Tool for Salmonella enterica Serovar Enteritidis Based on Single Nucleotide Polymorphism Genotyping Using PCR

PubMed Central

Kelly, Hilary; Dupras, Andrée Ann; Belanger, Sebastien; Devenish, John

2014-01-01

The lack of a sufficiently discriminatory molecular subtyping tool for Salmonella enterica serovar Enteritidis has hindered source attribution efforts and impeded regulatory actions required to disrupt its food-borne transmission. The underlying biological reason for the ineffectiveness of current molecular subtyping tools such as pulsed-field gel electrophoresis (PFGE) and phage typing appears to be related to the high degree of clonality of S. Enteritidis. By interrogating the organism's genome, we previously identified single nucleotide polymorphisms (SNP) distributed throughout the chromosome and have designed a highly discriminatory PCR-based SNP typing test based on 60 polymorphic loci. The application of the SNP-PCR method to DNA samples from S. Enteritidis strains (n = 55) obtained from a variety of sources has led to the differentiation and clustering of the S. Enteritidis isolates into 12 clades made up of 2 to 9 isolates per clade. Significantly, the SNP-PCR assay was able to further differentiate predominant PFGE types (e.g., XAI.0003) and phage types (e.g., phage type 8) into smaller subsets. The SNP-PCR subtyping test proved to be an accurate, precise, and quantitative tool for evaluating the relationships among the S. Enteritidis isolates tested in this study and should prove useful for clustering related S. Enteritidis isolates involved in outbreaks. PMID:25297333

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

[Relationship between single nucleotide polymorphisms in thiopurine methyltransferase gene and tolerance to thiopurines in acute leukemia].

PubMed

Ma, Xiao-li; Zhu, Ping; Wu, Min-yuan; Li, Zhi-gang; Hu, Ya-mei

2003-12-01

For the purpose of clarifying the influence of thiopurine methyltransferase (TPMT) gene single nucleotide polymorphisms (SNPs) on the efficacy of thiopurines and risk for its toxicity and therefore improving the safety and efficacy of thiopurines, the authors investigated TPMT genotype in acute leukemia in children who were intolerant to the treatment with 6-mercap topurine (6-MP). TPMT genotype was determined in an unrelated population of 250 Chinese healthy blood donors and 280 children with acute leukemia. TPMT genotyping assay was based on polymerase chain reaction (PCR), restriction digestion of PCR products, denaturing high-performance liquid chromatography (DHPLC) and direct DNA sequencing in the TPMT * 2 (G238C), TPMT * 3A (G460A, A719G) and TPMT * 3C (A719G). There were 10 TPMT * 1/TPMT * 3C heterozygotes in 280 children. The frequency of the polymorphism was 3.6%. All the involved alleles were TPMT * 3C. Of the 160 children acute leukemia evaluated, 45 (26%) were intolerant to 6-MP. Presentations included hepatotoxicity and hematological toxicity. Six out of 45 children were heterozygous, while the other 39 were wild type homozygous. Before dosage adjustments for thiopurine, the hematologic toxicity and hepatotoxicity in TPMT heterozygous individuals occurred more frequently than in homozygous. Therefore, cases of TPMT heterozygotes experienced more missed doses of 6-MP. TPMT genotype is associated with tolerance in acute leukemia in children. The heterozygote individuals have low TPMT activity. Therefore the frequencies of hemtopoietic toxicity and hepatoxicity are high after using 6-MP. Detection of SNPs in the TPMT genes is useful in identifying children before administration of 6-MP.

IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

PubMed

Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

2017-06-26

Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus.

PubMed

Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin

2014-10-01

Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.

Scanning the genome for gene single nucleotide polymorphisms involved in adaptive population differentiation in white spruce

PubMed Central

Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean

2008-01-01

Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225

Identification of Novel Single Nucleotide Polymorphisms Associated with Acute Respiratory Distress Syndrome by Exome-Seq

PubMed Central

Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.

2014-01-01

Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

Single Nucleotide Variations of the Human GR Gene Manifested as Pathologic Mutations or Polymorphisms.

PubMed

Kino, Tomoshige

2018-05-11

The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.

Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

PubMed Central

2014-01-01

Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

PubMed

Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

2012-01-01

Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms.

PubMed

Børsting, Claus; Morling, Niels

2012-02-01

In some relationship cases, the initial investigations of autosomal short tandem repeats (STRs) lead to an ambiguous conclusion and supplementary investigations become necessary. Six unusual paternity cases were previously investigated by other researchers and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. Three cases were solved by the SNP investigation without the need for any additional testing. In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. The case work examples underline the importance of performing supplementary investigations, and they advocate for the implementation of several panels that may be used in the highly unusual cases. Panels with SNPs or other markers with low mutation probabilities are preferable as supplementary markers, because the risk of detecting (additional) mutations is very low. © 2012 American Association of Blood Banks.

Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

PubMed Central

Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

2011-01-01

Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

PubMed

García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

2017-12-01

Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

PubMed

Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

2016-01-01

Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.

PubMed

Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N

2013-01-01

Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

PubMed Central

Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

2014-01-01

Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

PubMed Central

Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

2007-01-01

The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

PubMed

Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

2016-03-15

In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

PubMed

Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

2016-04-01

Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

PubMed Central

Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

2013-01-01

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to zucchini yellow mosaic virus.

PubMed

Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J

2009-12-01

Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.

Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

USDA-ARS?s Scientific Manuscript database

Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

Estimation of linkage disequilibrium and interspecific gene flow in Ficedula flycatchers by a newly developed 50k single-nucleotide polymorphism array

PubMed Central

Kawakami, Takeshi; Backström, Niclas; Burri, Reto; Husby, Arild; Olason, Pall; Rice, Amber M; Ålund, Murielle; Qvarnström, Anna; Ellegren, Hans

2014-01-01

With the access to draft genome sequence assemblies and whole-genome resequencing data from population samples, molecular ecology studies will be able to take truly genome-wide approaches. This now applies to an avian model system in ecological and evolutionary research: Old World flycatchers of the genus Ficedula, for which we recently obtained a 1.1 Gb collared flycatcher genome assembly and identified 13 million single-nucleotide polymorphism (SNP)s in population resequencing of this species and its sister species, pied flycatcher. Here, we developed a custom 50K Illumina iSelect flycatcher SNP array with markers covering 30 autosomes and the Z chromosome. Using a number of selection criteria for inclusion in the array, both genotyping success rate and polymorphism information content (mean marker heterozygosity = 0.41) were high. We used the array to assess linkage disequilibrium (LD) and hybridization in flycatchers. Linkage disequilibrium declined quickly to the background level at an average distance of 17 kb, but the extent of LD varied markedly within the genome and was more than 10-fold higher in ‘genomic islands’ of differentiation than in the rest of the genome. Genetic ancestry analysis identified 33 F1 hybrids but no later-generation hybrids from sympatric populations of collared flycatchers and pied flycatchers, contradicting earlier reports of backcrosses identified from much fewer number of markers. With an estimated divergence time as recently as <1 Ma, this suggests strong selection against F1 hybrids and unusually rapid evolution of reproductive incompatibility in an avian system. PMID:24784959

A Lactotransferrin Single Nucleotide Polymorphism Demonstrates Biological Activity That Can Reduce Susceptibility to Caries

PubMed Central

Toruner, Gokce A.; Velliyagounder, Kabilan; Sampathkumar, Vandana; Godboley, Dipti; Furgang, David

2013-01-01

Streptococcus mutans is prominently linked to dental caries. Saliva's influence on caries is incompletely understood. Our goal was to identify a salivary protein with anti-S. mutans activity, characterize its genotype, and determine genotypic variants associated with S. mutans activity and reduced caries. An S. mutans affinity column was used to isolate active moieties from saliva obtained from a subject with minimal caries. The bound and eluted protein was identified as lactotransferrin (LTF) by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis and confirmed by Western blotting with LTF antibody. A single nucleotide polymorphism (SNP) that produced a shift from arginine (R) to lysine (K) at amino acid position 47 in the LTF antimicrobial region (rs: 1126478) killed S. mutans in vitro. Saliva from a subject with moderate caries and with the LTF “wild-type” R form at position 47 had no such activity. A pilot genetic study (n = 30) showed that KK subjects were more likely to have anti-S. mutans activity than RR subjects (P = 0.001; relative risk = 3.6; 95% confidence interval [95% CI] = 1.5 to 11.13). Pretreatment of KK saliva with antibody to LTF reduced S. mutans killing in a dose-dependent manner (P = 0.02). KK subjects were less likely to have caries (P = 0.02). A synthetic 11-mer LTF/K peptide killed S. mutans and other caries-related bacteria, while the LTF/R peptide had no effect (P = 0.01). Our results provide functional evidence that the LTF/K variant results in both anti-S. mutans activity and reduced decay. We suggest that the LTF/K variant can influence oral microbial ecology in general and caries-provoking microbes specifically. PMID:23460521

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

Detection of clonal evolution in hematopoietic malignancies by combining comparative genomic hybridization and single nucleotide polymorphism arrays.

PubMed

Hartmann, Luise; Stephenson, Christine F; Verkamp, Stephanie R; Johnson, Krystal R; Burnworth, Bettina; Hammock, Kelle; Brodersen, Lisa Eidenschink; de Baca, Monica E; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K

2014-12-01

Array comparative genomic hybridization (aCGH) has become a powerful tool for analyzing hematopoietic neoplasms and identifying genome-wide copy number changes in a single assay. aCGH also has superior resolution compared with fluorescence in situ hybridization (FISH) or conventional cytogenetics. Integration of single nucleotide polymorphism (SNP) probes with microarray analysis allows additional identification of acquired uniparental disomy, a copy neutral aberration with known potential to contribute to tumor pathogenesis. However, a limitation of microarray analysis has been the inability to detect clonal heterogeneity in a sample. This study comprised 16 samples (acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, plasma cell neoplasm) with complex cytogenetic features and evidence of clonal evolution. We used an integrated manual peak reassignment approach combining analysis of aCGH and SNP microarray data for characterization of subclonal abnormalities. We compared array findings with results obtained from conventional cytogenetic and FISH studies. Clonal heterogeneity was detected in 13 of 16 samples by microarray on the basis of log2 values. Use of the manual peak reassignment analysis approach improved resolution of the sample's clonal composition and genetic heterogeneity in 10 of 13 (77%) patients. Moreover, in 3 patients, clonal disease progression was revealed by array analysis that was not evident by cytogenetic or FISH studies. Genetic abnormalities originating from separate clonal subpopulations can be identified and further characterized by combining aCGH and SNP hybridization results from 1 integrated microarray chip by use of the manual peak reassignment technique. Its clinical utility in comparison to conventional cytogenetic or FISH studies is demonstrated. © 2014 American Association for Clinical Chemistry.

p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

PubMed

Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

2017-05-01

The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16

Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

PubMed Central

Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

2015-01-01

Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

PubMed Central

Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

2001-01-01

A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppies.

PubMed

Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine

2010-03-01

Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

PubMed

Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

2016-05-01

To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

PubMed

Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

2014-11-01

Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

NASA Astrophysics Data System (ADS)

Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

2016-04-01

We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.

PubMed

Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning

2017-11-01

Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Associations between novel single nucleotide polymorphisms in the Bos taurus growth hormone gene and performance traits in Holstein-Friesian dairy cattle.

PubMed

Mullen, M P; Berry, D P; Howard, D J; Diskin, M G; Lynch, C O; Berkowicz, E W; Magee, D A; MacHugh, D E; Waters, S M

2010-12-01

Growth hormone, produced in the anterior pituitary gland, stimulates the release of insulin-like growth factor-I from the liver and is of critical importance in the control of nutrient utilization and partitioning for lactogenesis, fertility, growth, and development in cattle. The aim of this study was to discover novel polymorphisms in the bovine growth hormone gene (GH1) and to quantify their association with performance using estimates of genetic merit on 848 Holstein-Friesian AI (artificial insemination) dairy sires. Associations with previously reported polymorphisms in the bovine GH1 gene were also undertaken. A total of 38 novel single nucleotide polymorphisms (SNP) were identified across a panel of 22 beef and dairy cattle by sequence analysis of the 5' promoter, intronic, exonic, and 3' regulatory regions, encompassing approximately 7 kb of the GH1 gene. Following multiple regression analysis on all SNP, associations were identified between 11 SNP (2 novel and 9 previously identified) and milk fat and protein yield, milk composition, somatic cell score, survival, body condition score, and body size. The G allele of a previously identified SNP in exon 5 at position 2141 of the GH1 sequence, resulting in a nonsynonymous substitution, was associated with decreased milk protein yield. The C allele of a novel SNP, GH32, was associated with inferior carcass conformation. In addition, the T allele of a previously characterized SNP, GH35, was associated with decreased survival. Both GH24 (novel) and GH35 were independently associated with somatic cell count, and 3 SNP, GH21, 2291, and GH35, were independently associated with body depth. Furthermore, 2 SNP, GH24 and GH63, were independently associated with carcass fat. Results of this study further demonstrate the multifaceted influences of GH1 on milk production, fertility, and growth-related traits in cattle. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

PubMed Central

Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

2009-01-01

With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

PubMed Central

Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

2012-01-01

We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

TNF-alpha single nucleotide polymorphisms in atopic dermatitis.

PubMed

Behniafard, Nasrin; Gharagozlou, Mohammad; Farhadi, Elham; Khaledi, Mojdeh; Sotoudeh, Soheila; Darabi, Behzad; Fathi, Seid Mohammad; Gholizadeh Moghaddam, Zahra; Mahmoudi, Mahdi; Aghamohammadi, Asghar; Amirzargar, Ali Akbar; Rezaei, Nima

2012-01-01

Tumor necrosis factor-alpha (TNF-α) could be considered as potential biomarkers in atopic dermatitis (AD), while its level could be influenced by cytokine single gene polymorphisms (SNP). This study was performed in 89 pediatric patients with AD and 137 controls to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence-specific primers method. The highest positive allelic association that made the patients susceptible to AD was seen for TNF-α -238/G (p<0.001) and TNF-α -308/G (p = 0.003). The GG genotypes at TNF-α -238 and TNF-α -308, were both significantly higher in the patients with AD, compared to the controls (p<0.01). The GG haplotype at TNF-α (-308,-238) was seen in 92.7% of the patients, which was significantly higher than the controls (p<0.001), while a negative haplotypic association with AD was seen for TNF-α (-308, -238) AG and GA (p<0.01). This study showed that the AG genotype of TNF-α -308, associated with a high production of cytokines, was significantly decreased in patients with AD, while the low-producing GG genotype, which could lead to low production of TNF-α, was over-expressed in the atopic patients.

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

PubMed

Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

2014-07-01

Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

Study of seven single-nucleotide polymorphisms identified in East Asians for association with obesity in a Taiwanese population.

PubMed

Huang, Wei-Hsin; Hwang, Lee-Ching; Chan, Hsin-Lung; Lin, Hsiang-Yu; Lin, Yung-Hsiang

2016-08-10

This study aimed to examine single-nucleotide polymorphisms (SNPs) of seven previously reported obesity genes in East Asians and to analyse their associations and synergistic effects on obesity in the Taiwanese population. Cross-sectional study. One medical centre in northern Taiwan. A total of 323 non-obese and 264 obese participants were recruited. The threshold for obesity in this study was a body mass index of ≥27 kg/m(2), as defined by the Ministry of Health and Welfare in Taiwan. The study was performed with the approval of the institutional review board of MacKay Memorial Hospital, Taipei, Taiwan (application number 12MMHIS106). We analysed the genotype distributions of seven SNPs localising to the PPARγ2, GNB3, SDC3, ADRB2, FTO, PPARγ and ESR1 genes in obese and non-obese groups and then paired obesity-related SNPs to determine if they have synergistic effects on obesity. Analysis of the genotype distributions in obese and non-obese groups revealed only a significant positive correlation between an SNP in rs2282440-syndecan 3 (SDC3) and obesity in the Taiwanese population (p=0.006). In addition, the T/T genotype of SDC3 was significantly associated with a larger waist and hip circumference, higher body fat percentage and lower high-density lipoprotein cholesterol. Moreover, the combination of the rs2282440-SDC3T/T genotype with the rs1801282-peroxisome proliferator-activated receptor-gamma2 gene (PPARγ2) G carrier genotype was strongly associated with obesity (OR=6.77). We found that the rs2282440-SDC3T/T genotype is associated with obesity in the Taiwanese population. Furthermore, there is a synergistic effect of the high-risk alleles of the SDC3 and PPARγ2 genes on the obese phenotype in the Taiwanese population. 12MMHIS106; Results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Single Nucleotide Polymorphism (SNP)-Strings: An Alternative Method for Assessing Genetic Associations

PubMed Central

Goodin, Douglas S.; Khankhanian, Pouya

2014-01-01

Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that

Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

PubMed

Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

2008-08-19

Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

PubMed Central

Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

2008-01-01

Background Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required. PMID:18710585

GDF5 single-nucleotide polymorphism rs143383 is associated with lumbar disc degeneration in Northern European women

PubMed Central

Williams, F M K; Popham, M; Hart, D J; de Schepper, E; Bierma-Zeinstra, S; Hofman, A; Uitterlinden, A G; Arden, N K; Cooper, C; Spector, T D; Valdes, A M; van Meurs, J

2011-01-01

Objective Lumbar disc degeneration (LDD) is a serious social and medical problem which has been shown to be highly heritable. It has similarities with peripheral joint osteoarthritis (OA) in terms of both epidemiology and pathologic processes. A few known genetic variants have been identified using a candidate gene approach, but many more are thought to exist. GDF5 is a gene whose variants have been shown to play a role in skeletal height as well as predisposing to peripheral joint OA. In vitro, the gene product growth differentiation factor 5 has been shown to promote growth and repair of animal disc. This study was undertaken to investigate whether the GDF5 gene plays a role in LDD. Methods We investigated whether the 5′ upstream single-nucleotide polymorphism (SNP) variant rs143383 was associated with LDD, using plain radiography and magnetic resonance imaging to identify disc space narrowing and osteophytes, in 5 population cohorts from Northern Europe. Results An association between LDD and the SNP rs143383 was identified in women, with the same risk allele as in knee and hip OA (odds ratio 1.72 [95% confidence interval 1.15–2.57], P = 0.008). Conclusion Our findings in 5 population cohorts from Northern Europe indicate that a variant in the GDF5 gene is a risk factor for LDD in women. Many more such variants are predicted to exist, but this result highlights the growth and differentiation cellular pathway as a possible route to a better understanding of the process behind lumbar disc degeneration. PMID:21360499

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

PubMed

Shirasu, Naoto; Kuroki, Masahide

2014-01-01

We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

Single nucleotide polymorphisms of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) in Iranian patients with TB.

PubMed

Beiranvand, Elham; Abediankenari, Saeid; Valiyari, Samira; Rezaei, Mohammad Sadegh; Rostamian, Mosayeb; Beiranvand, Behnoush; Khaligh, Ali; Khani, Soghra

2016-12-01

Two important genes for controlling TB are IFNγ and IFNγR1. However, little information exists regarding genetic susceptibility of the Iranian TB population. We investigated the single nucleotide polymorphisms (SNPs) in genes of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) and serum level of IFNγ and their influence on TB in patients; 300 patients with TB and 300 healthy controls were enrolled in this study. PCR-restriction fragment length polymorphism was used to identify SNPs and serum level of IFNγ was measured by ELISA. The allelic and the genotypic form of IFNγ+874 A/T SNP of the studied population were not significant (p>0.05). Allele T frequencies of IFNγR1 -56 C/T promoter region in patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were significantly greater than allele C. The -56 TT motif of IFNγR1 is associated with both forms of TB (p<0.05). The serum level of IFNγ was significantly higher in patients with TB than in controls, but there was no significant difference between serum level of IFNγ and the studied genotypes (p>0.05). The cause of active TB in the patients seems to be due to the lack of effective IFNγ function or the lack of effective signaling connection between IFNγ and its receptor in presence of -56 C/T polymorphism in promoter region of IFNγR1 gene. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

PubMed Central

Galipeau, Jacques; Nooka, Ajay K.

2013-01-01

The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

PubMed

Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

2010-10-01

Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

PubMed

Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

2015-09-01

The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerns, Sarah L.; Ostrer, Harry; Stock, Richard

2010-12-01

Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score {<=}7) and 52 control subjects (post-treatment SHIM score {>=}16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, locatedmore » in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10{sup -8}, Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value < 10{sup -6}. Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened

Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks

NASA Astrophysics Data System (ADS)

Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.

2017-05-01

Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

PubMed Central

Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

2018-01-01

Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

PubMed Central

Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

2016-01-01

Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

PubMed

Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

2018-06-07

Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

PubMed

Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

2017-03-08

EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

Genetic homogeneity of the invasive lionfish across the Northwestern Atlantic and the Gulf of Mexico based on Single Nucleotide Polymorphisms.

PubMed

Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F

2018-03-22

Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.

Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

PubMed Central

Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

2009-01-01

The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

PubMed Central

Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

2011-01-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

PubMed

Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

2011-05-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

USDA-ARS?s Scientific Manuscript database

In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

Genetic findings and functional studies of human CYP3A5 single nucleotide polymorphisms in different ethnic groups.

PubMed

Lee, Su-Jun; Usmani, Khawja A; Chanas, Brian; Ghanayem, Burhan; Xi, Tina; Hodgson, Ernest; Mohrenweiser, Harvey W; Goldstein, Joyce A

2003-08-01

Genetic polymorphisms of cytochromes P450 (CYPs) are a principal reason for inter-individual variations in the metabolism of therapeutic drugs and environmental chemicals in humans. The present study identifies 34 single nucleotide polymorphisms (SNPs) of CYP3A5 including 27 previously unidentified SNPs by direct sequencing of the exons, intron-exon junctions and 5'-upstream region of CYP3A5 from 92 racially diverse individuals (24 Caucasians, 24 Africans, 24 Asians, and 20 individuals of unknown racial origin). Four new CYP3A5 SNPs produced coding changes: R28C, L82R, A337T, and F446S. CYP3A5 R28C occurred in African populations (allelic frequency of 4%). CYP3A5 A337T occurred in Asians (2% allelic frequency), CYP3A5 L82R (occurred in the racially unidentified group) and CYP3A5 F446S (identified in Caucasians with a 2% allelic frequency) were on an allele containing the splice change g.6986A>G known as CYP3A5*3. The newly identified allelic proteins were constructed by site-directed mutagenesis, expressed in Escherichia coli and purified. CYP3A5 L82R was expressed only as denatured CYP420, suggesting it may be unstable. CYP3A5*1 exhibited the highest maximal clearance for testosterone followed by CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5*1 exhibited a higher V(max) for nifedipine oxidation than CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5 A337T and CYP3A5 R28C exhibited a 42-64% lower V(max) for nifedipine oxidation than CYP3A5*1. CYP3A5 F446S exhibited a > 95% decrease in the intrinsic clearance for both 6beta-hydroxytestosterone and nifedipine oxidation. This study identifies four new potentially defective coding alleles. CYP3A5 F446S is predicted to be more catalytically defective than the splice change alone.

Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola.

PubMed

Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin

2017-02-01

Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.

PubMed

Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C

2008-04-01

Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (<25.0 kg/m(2), 25.0-29.9 kg/m(2), >30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.

Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

PubMed Central

Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

2014-01-01

A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

Single nucleotide polymorphism in IL1B is associated with infection risk in paediatric acute myeloid leukaemia.

PubMed

Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D

2016-06-01

We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Prenatal Diagnosis of DNA Copy Number Variations by Genomic Single-Nucleotide Polymorphism Array in Fetuses with Congenital Heart Defects.

PubMed

Tang, Shaohua; Lv, Jiaojiao; Chen, Xiangnan; Bai, Lili; Li, Huanzheng; Chen, Chong; Wang, Ping; Xu, Xueqin; Lu, Jianxin

2016-01-01

To evaluate the usefulness of single-nucleotide polymorphism (SNP) array for prenatal genetic diagnosis of congenital heart defect (CHD), we used this approach to detect clinically significant copy number variants (CNVs) in fetuses with CHDs. A HumanCytoSNP-12 array was used to detect genomic samples obtained from 39 fetuses that exhibited cardiovascular abnormalities on ultrasound and had a normal karyotype. The relationship between CNVs and CHDs was identified by using genotype-phenotype comparisons and searching of chromosomal databases. All clinically significant CNVs were confirmed by real-time PCR. CNVs were detected in 38/39 (97.4%) fetuses: variants of unknown significance were detected in 2/39 (5.1%), and clinically significant CNVs were identified in 7/39 (17.9%). In 3 of the 7 fetuses with clinically significant CNVs, 3 rare and previously undescribed CNVs were detected, and these CNVs encompassed the CHD candidate genes FLNA (Xq28 dup), BCOR (Xp11.4 dup), and RBL2 (16q12.2 del). Compared with conventional cytogenetic genomics, SNP array analysis provides significantly improved detection of submicroscopic genomic aberrations in pregnancies with CHDs. Based on these results, we propose that genomic SNP array is an effective method which could be used in the prenatal diagnostic test to assist genetic counseling for pregnancies with CHDs. © 2015 S. Karger AG, Basel.

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

PubMed

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

PubMed Central

Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

2010-01-01

Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

PubMed

Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

2017-05-01

To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

Large-Scale Development of Cost-Effective Single-Nucleotide Polymorphism Marker Assays for Genetic Mapping in Pigeonpea and Comparative Mapping in Legumes

PubMed Central

Saxena, Rachit K.; Varma Penmetsa, R.; Upadhyaya, Hari D.; Kumar, Ashish; Carrasquilla-Garcia, Noelia; Schlueter, Jessica A.; Farmer, Andrew; Whaley, Adam M.; Sarma, Birinchi K.; May, Gregory D.; Cook, Douglas R.; Varshney, Rajeev K.

2012-01-01

Single-nucleotide polymorphisms (SNPs, >2000) were discovered by using RNA-seq and allele-specific sequencing approaches in pigeonpea (Cajanus cajan). For making the SNP genotyping cost-effective, successful competitive allele-specific polymerase chain reaction (KASPar) assays were developed for 1616 SNPs and referred to as PKAMs (pigeonpea KASPar assay markers). Screening of PKAMs on 24 genotypes [23 from cultivated species and 1 wild species (Cajanus scarabaeoides)] defined a set of 1154 polymorphic markers (77.4%) with a polymorphism information content (PIC) value from 0.04 to 0.38. One thousand and ninety-four PKAMs showed polymorphisms between parental lines of the reference mapping population (C. cajan ICP 28 × C. scarabaeoides ICPW 94). By using high-quality marker genotyping data on 167 F2 lines from the population, a comprehensive genetic map comprising 875 PKAMs with an average inter-marker distance of 1.11 cM was developed. Previously mapped 35 simple sequence repeat markers were integrated into the PKAM map and an integrated genetic map of 996.21 cM was constructed. Mapped PKAMs showed a higher degree of synteny with the genome of Glycine max followed by Medicago truncatula and Lotus japonicus and least with Vigna unguiculata. These PKAMs will be useful for genetics research and breeding applications in pigeonpea and for utilizing genome information from other legume species. PMID:23103470

Single-nucleotide polymorphisms in the LRWD1 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

PubMed

Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Saijo, Y; Namiki, M; Sengoku, K

2014-04-01

Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, ten novel genes involved in human spermatogenesis, including human LRWD1, have been identified by expression microarray analysis of human testictissue. The human LRWD1 protein mediates the origin recognition complex in chromatin, which is critical for the initiation of pre-replication complex assembly in G1 and chromatin organization in post-G1 cells. The Lrwd1 gene expression is specific to the testis in mice. Therefore, we hypothesized that mutation or polymorphisms of LRWD1 participate in male infertility, especially azoospermia. To investigate whether LRWD1 gene defects are associated with azoospermia caused by SCOS and meiotic arrest (MA), mutational analysis was performed in 100 and 30 Japanese patients by direct sequencing of the coding regions, respectively. Statistical analysis was performed for patients with SCOS and MA and in 100 healthy control men. No mutations were found in LRWD1; however, three coding single-nucleotide polymorphisms (SNP1-SNP3) could be detected in the patients. The genotype and allele frequencies in SNP1 and SNP2 were notably higher in the SCOS group than in the control group (P < 0.05). These results suggest the critical role of LRWD1 in human spermatogenesis. © 2013 Blackwell Verlag GmbH.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Single nucleotide polymorphism in the tumor necrosis factor-alpha gene affects inflammatory bowel diseases risk

PubMed Central

Ferguson, Lynnette R; Huebner, Claudia; Petermann, Ivonne; Gearry, Richard B; Barclay, Murray L; Demmers, Pieter; McCulloch, Alan; Han, Dug Yeo

2008-01-01

AIM: To investigate the role that single nucleotide polymorphisms (SNPs) in the promoter of the tumour necrosis factor-alpha (TNF-α) gene play in the risk of inflammatory bowel diseases (IBDs) in a New Zealand population, in the context of international studies. METHODS: DNA samples from 388 patients with Crohn’s disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis (IC) and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common polymorphisms in the TNF-α receptor: -238 G→A, -308 G→A and -857C→T, using a TaqmanR assay. A meta-analysis was performed on the data obtained on these polymorphisms combined with that from other published studies. RESULTS: Individuals carrying the -308 G/A allele had a significantly (OR = 1.91, χ2 = 17.36, P < 0.0001) increased risk of pancolitis, and a 1.57-fold increased risk (OR = 1.57, χ2 = 4.34, P = 0.037) of requiring a bowel resection in UC. Carrying the -857 C/T variant decreased the risk of ileocolonic CD (OR = 0.56, χ2 = 4.32, P = 0.037), and the need for a bowel resection (OR = 0.59, χ2 = 4.85, P = 0.028). The risk of UC was reduced in individuals who were smokers at diagnosis, (OR = 0.48, χ2 = 4.86, P = 0.028). CONCLUSION: TNF-α is a key cytokine known to play a role in inflammatory response, and the locus for the gene is found in the IBD3 region on chromosome 6p21, known to be associated with an increased risk for IBD. The -308 G/A SNP in the TNF-α promoter is functional, and may account in part for the increased UC risk associated with the IBD3 genomic region. The -857 C/T SNP may decrease IBD risk in certain groups. Pharmaco- or nutrigenomic approaches may be desirable for individuals with such affected genotypes. PMID:18698679

Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

PubMed

Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

2013-12-01

The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

PubMed Central

Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

2001-01-01

We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

Helicobacter Pylori Serology in Relation to Hepatitis C Virus Infection and IL28B Single Nucleotide Polymorphism

PubMed Central

Gutwerk, Alexander; Wex, Thomas; Stein, Kerstin; Langner, Cosima; Canbay, Ali; Malfertheiner, Peter

2018-01-01

The aim of the study was to evaluate the serological rate of Helicobacter pylori (H. pylori) infection in patients with chronic hepatitis C virus (HCV) infection and determine any correlations with liver damage and IL28B single-nucleotide polymorphism (SNP). One hundred eighty-nine patients with chronic HCV infection were included in the study, and H. pylori status was defined based on anti-H. pylori-IgG or anti-CagA-IgG antibodies using enzyme-linked immunosorbent assay (ELISA). Liver damage was assessed using histology or transient elastography. IL28B C/T polymorphism (rs12979860) was evaluated in circulating blood cells using a PCR-based restriction fragment length polymorphism assay. Overall H. pylori serology was positive in 38.1% of our HCV-infected subjects. Among those, the anti-CagA-IgG positivity rate was 43.1% and was within the range of previously described populations of the same region. Highest prevalence of H. pylori was found in patients between 31 and 40 years compared to other age subgroups. The seropositivity rate was higher in the non-cirrhotic group than the cirrhotic one (45.4% vs. 20.0%, p < 0.05). No difference was found in IL28B genotype between H. pylori-positive and -negative cohorts. However, we observed a trend for the lower anti-CagA-IgG expression level in relation to the IL28B T-allele. Our results do not support an association between HCV and H. pylori infection. Whether IL28B SNP has a functional role in modulation of serological response to H. pylori CagA needs further investigation. PMID:29510558

Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

PubMed

Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

2015-12-01

Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

A novel approach to exploring potential interactions among single-nucleotide polymorphisms of inflammation genes in gliomagenesis: an exploratory case-only study.

PubMed

Amirian, E Susan; Scheurer, Michael E; Liu, Yanhong; D'Amelio, Anthony M; Houlston, Richard S; Etzel, Carol J; Shete, Sanjay; Swerdlow, Anthony J; Schoemaker, Minouk J; McKinney, Patricia A; Fleming, Sarah J; Muir, Kenneth R; Lophatananon, Artitaya; Bondy, Melissa L

2011-08-01

Despite extensive research on the topic, glioma etiology remains largely unknown. Exploration of potential interactions between single-nucleotide polymorphisms (SNP) of immune genes is a promising new area of glioma research. The case-only study design is a powerful and efficient design for exploring possible multiplicative interactions between factors that are independent of one another. The purpose of our study was to use this exploratory design to identify potential pair wise SNP-SNP interactions from genes involved in several different immune-related pathways for investigation in future studies. The study population consisted of two case groups: 1,224 histologic confirmed, non-Hispanic white glioma cases from the United States and a validation population of 634 glioma cases from the United Kingdom. Polytomous logistic regression, in which one SNP was coded as the outcome and the other SNP was included as the exposure, was utilized to calculate the ORs of the likelihood of cases simultaneously having the variant alleles of two different SNPs. Potential interactions were examined only between SNPs located in different genes or chromosomes. Using this data mining strategy, we found 396 significant SNP-SNP interactions among polymorphisms of immune-related genes that were present in both the U.S. and U.K. study populations. This exploratory study was conducted for the purpose of hypothesis generation, and thus has provided several new hypotheses that can be tested using traditional case-control study designs to obtain estimates of risk. This is the first study, to our knowledge, to take this novel approach to identifying SNP-SNP interactions relevant to glioma etiology. ©2011 AACR.

Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

PubMed

Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

2014-07-01

Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

PubMed Central

Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

2012-01-01

Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (p<0.05) in mastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (p<0.05), whereas miR-2318 was downregulated in the mastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Clinical Significance of the Single Nucleotide Polymorphism TLR2 R753Q in Heart Transplant Recipients at Risk for Cytomegalovirus Disease

PubMed Central

Schneider, Martina; Matiqi, Teresa; Kundi, Michael; Rieder, Franz JJ; Andreas, Martin; Strassl, Robert; Zuckermann, Andreas; Jungbauer, Christof; Steininger, Christoph

2017-01-01

Background The Toll-like receptor 2 (TLR2) is a significant component of innate immunity against cytomegalovirus (CMV) infection but information on the clinical significance of the most common single nucleotide polymorphism (SNP) (R753Q) is conflicting. Objectives The inconsistent observations of the immunological and clinical significance of the TLR2 R753Q polymorphism for CMV infection indicates the influence of confounders. Study design The presence of the TLR2 polymorphism was determined by a genotyping assay of 175 HTX patients and 281 healthy blood donors and evaluated in relation to selected virological and clinical parameters. Results Relative frequency of TLR2 polymorphism was similar in HTX patients and blood donors (homozygous wild-type, 94.3% vs. 94.0%; heterozygous, 5.1% vs. 5.7%; homozygous mutated, <1%). CMV viremia was detectable in 108 (61.7%) of HTX patients. The TLR2 polymorphism was neither associated with occurrence or level of CMV infection nor with survival, graft failure or rejection, or CMV serostatus of patient before transplantation. Nevertheless, CMV viremia occurred in 83.1% of R+/D+, 77.1% of R+/D-, and 64.3% of R-/D+ patients. Time of first CMV viremia was in R-/D+ patients later than in CMV-seropositive patients (median, 182 days versus 23 days; P<0.001) corresponding to the duration of antiviral prophylaxis in R-/D+ patients. Conclusions The TLR2 R753Q polymorphism is extremely rare in the general population and HTX patients. Screening for this risk factor of CMV disease may not be cost-effective in contrast to testing for CMV viremia. PMID:27723526

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

PubMed

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

First High-Density Linkage Map and Single Nucleotide Polymorphisms Significantly Associated With Traits of Economic Importance in Yellowtail Kingfish Seriola lalandi.

PubMed

Nguyen, Nguyen H; Rastas, Pasi M A; Premachandra, H K A; Knibb, Wayne

2018-01-01

The genetic resources available for the commercially important fish species Yellowtail kingfish (YTK) ( Seriola lalandi) are relative sparse. To overcome this, we aimed (1) to develop a linkage map for this species, and (2) to identify markers/variants associated with economically important traits in kingfish (with an emphasis on body weight). Genetic and genomic analyses were conducted using 13,898 single nucleotide polymorphisms (SNPs) generated from a new high-throughput genotyping by sequencing platform, Diversity Arrays Technology (DArTseq TM ) in a pedigreed population comprising 752 animals. The linkage analysis enabled to map about 4,000 markers to 24 linkage groups (LGs), with an average density of 3.4 SNPs per cM. The linkage map was integrated into a genome-wide association study (GWAS) and identified six variants/SNPs associated with body weight ( P < 5e -8 ) when a multi-locus mixed model was used. Two out of the six significant markers were mapped to LGs 17 and 23, and collectively they explained 5.8% of the total genetic variance. It is concluded that the newly developed linkage map and the significantly associated markers with body weight provide fundamental information to characterize genetic architecture of growth-related traits in this population of YTK S. lalandi .

Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

PubMed

Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

2017-03-01

Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

PubMed Central

Lapitan Jr., Lorico D. S.; Guo, Yuan

2015-01-01

Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

PubMed Central

Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John J; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M; Asmann, Yan W; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I; Bertrand, Kimberly A; Birmann, Brenda M; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M; Brennan, Paul; Brooks-Wilson, Angela R; Cerhan, James R; Chanock, Stephen J; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J; de Sanjose, Silvia; Di Lollo, Simonetta; Diver, W Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G; Glimelius, Bengt; Habermann, Thomas M; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R; Holly, Elizabeth A; Jackson, Rebecca D; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S; Klein, Robert J; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry J; Monnereau, Alain; Morton, Lindsay M; Nieters, Alexandra; North, Kari E; Novak, Anne J; Offit, Kenneth; Purdue, Mark P; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K; Skibola, Christine F; Slager, Susan L; Smith, Alex; Smith, Martyn T; Southey, Melissa C; Staines, Anthony; Teras, Lauren R; Thompson, Carrie A; Tilly, Hervé; Tinker, Lesley F; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

2017-01-01

Objective Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL. Methods GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis. Results Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765. Conclusions These data suggest several plausible genetic links between DLBCL and SLE. PMID:29214033

Single nucleotide polymorphisms and microsatellites in the canine glutathione S-transferase pi 1 (GSTP1) gene promoter.

PubMed

Sacco, James; Mann, Sarah; Toral, Keller

2017-01-01

Genetic polymorphisms within the glutathione S-transferase P1 ( GSTP1 ) gene affect the elimination of toxic xenobiotics by the GSTP1 enzyme. In dogs, exposure to environmental chemicals that may be GSTP1 substrates is associated with cancer. The objectives of this study were to investigate the genetic variability in the GSTP1 promoter in a diverse population of 278 purebred dogs, compare the incidence of any variants found between breeds, and predict their effects on gene expression. To provide information on ancestral alleles, a number of wolves, coyotes, and foxes were also sequenced. Fifteen single nucleotide polymorphisms (SNPs) and two microsatellites were discovered. Three of these loci were only polymorphic in dogs while three other SNPs were unique to wolves and coyotes. The major allele at c.-46 is T in dogs but is C in the wild canids. The c.-185 delT variant was unique to dogs. The microsatellite located in the 5' untranslated region (5'UTR) was a highly polymorphic GCC tandem repeat, consisting of simple and compound alleles that varied in size from 10 to 22-repeat units. The most common alleles consisted of 11, 16, and 17-repeats. The 11-repeat allele was found in 10% of dogs but not in the other canids. Unequal recombination and replication slippage between similar and distinct alleles may be the mechanism for the multiple microsatellites observed. Twenty-eight haplotypes were constructed in the dog, and an additional 8 were observed in wolves and coyotes. While the most common haplotype acrossbreeds was the wild-type *1A(17), other prevalent haplotypes included *3A(11) in Greyhounds, *6A(16) in Labrador Retrievers, *9A(16) in Golden Retrievers, and *8A(19) in Standard Poodles. Boxers and Siberian Huskies exhibited minimal haplotypic diversity. Compared to the simple 16*1 allele, the compound 16*2 allele (found in 12% of dogs) may interfere with transcription factor binding and/or the stability of the GSTP1 transcript. Dogs and other canids exhibit

Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms.

PubMed

Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K

2016-10-01

Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.

Associated analysis of single nucleotide polymorphisms found on exon 3 of the IGF-1 gene with Tibetan miniature pig growth traits.

PubMed

Yue, M; Tian, Y G; Wang, Y J; Gu, Y; Bayaer, N; Hu, Q; Gu, W W

2014-02-27

The IGF-1 gene is an important regulating factor that has a growth-promoting effect on growth hormone. The IGF-1 gene promotes muscle cell differentiation in the muscle cell formation process. The IGF-1 gene also regulates the growth of skeletal muscle during skeletal muscle growth. In addition, the IGF-1 gene plays an important role in the formation of mammals and poultry embryos, and the process of postnatal growth. The IGF-1 gene has been implicated as a candidate gene for the regulation of pig growth traits. We analyzed exon 3 of the IGF-1 gene polymorphism in Tibetan miniature pigs (N = 128) by polymerase chain reaction-single-strand conformation polymorphism and DNA sequencing. One single nucleotide polymorphism (T40C) was found on exon 3 of the IGF-1 gene. Statistical analysis of genotype frequencies revealed that the T allele was dominant in Tibetan miniature pigs at the T40C locus. The association analysis showed that the IGF-1 mutation had an effect on the body weight, body length, and chest circumference of pigs aged 6-8 months. In addition, the IGF-1 mutation had an effect on body weight in pigs aged 9-11 months (P < 0.05). We speculated that the pigs with the TT genotype grow more rapidly compared to those with the TC genotype. The TC genotype of the Tibetan miniature pig has a smaller body type. This information provides a theoretical basis for the genetic background of Tibetan miniature pigs.

A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

PubMed Central

Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

2010-01-01

Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

Single-Nucleotide Polymorphism Markers from De-Novo Assembly of the Pomegranate Transcriptome Reveal Germplasm Genetic Diversity

PubMed Central

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature. PMID:24558460

Single-nucleotide polymorphism markers from de-novo assembly of the pomegranate transcriptome reveal germplasm genetic diversity.

PubMed

Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

2014-01-01

Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature.

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

PubMed Central

Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

2013-01-01

Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

PubMed

Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

2014-11-01

Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Analysis of glutathione S-transferase Pi isoform (GSTP1) single-nucleotide polymorphisms and macular telangiectasia type 2.

PubMed

Szental, Joshua A; Baird, Paul N; Richardson, Andrea J; Islam, F M Amirul; Scholl, Hendrik P N; Charbel Issa, Peter; Holz, Frank G; Gillies, Mark; Guymer, Robyn H

2010-12-01

Recent imaging studies have suggested that macular pigment is decreased centrally in macular telangiectasia type 2 (MT2). The uptake of xanthophyll pigment into the macula is thought to be facilitated by a xanthophyll-binding protein (XBP). The Pi isoform of glutathione S-transferase (GSTP1) represents one such XBP with high binding affinity. This case-control study aimed to determine whether two common single-nucleotide polymorphisms (SNPs) of GSTP1 were associated with MT2. DNA samples from 39 cases and 21 controls were collected. Two polymorphic sites of Ile105Val and Ala114Val in exons 5 and 6 respectively, of the GSTP1 gene were analysed. Comparison of alleles and genotypes between cases and controls indicated that there were no statistically significant differences for either the Ile105Val SNP (P=0.43) or the Ala114Val SNP (P=0.85), or for any combinations; however, the homozygous at-risk genotype (GG) of the Ile105Val SNP was present in 8% of cases but absent in controls. This study found no statistically significant association between two common GSTP1 SNPs and MT2; however, a trend towards a greater frequency of the GG genotype of the Ile105Val SNP in cases is of great interest. The biological plausibility of disturbed macular pigment uptake in MT2 makes GSTP1 an excellent candidate gene. Further investigation is warranted in future studies of MT2.

Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

PubMed

Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

2008-08-01

Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

Replication of endometriosis-associated single-nucleotide polymorphisms from genome-wide association studies in a Caucasian population.

PubMed

Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H

2013-03-01

Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation

Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

PubMed

Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

2015-05-01

Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Single nucleotide polymorphisms typing of Mycobacterium leprae reveals focal transmission of leprosy in high endemic regions of India.

PubMed

Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U

2013-11-01

Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology

PubMed Central

Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N.; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

2016-01-01

Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

PubMed

Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

2016-01-01

Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

Association study of two functional single nucleotide polymorphisms of neuropeptide y gene with multiple sclerosis.

PubMed

Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad

2016-12-01

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genome-wide single nucleotide polymorphism scan suggests adaptation to urbanization in an important pollinator, the red-tailed bumblebee (Bombus lapidarius L.).

PubMed

Theodorou, Panagiotis; Radzevičiūtė, Rita; Kahnt, Belinda; Soro, Antonella; Grosse, Ivo; Paxton, Robert J

2018-04-25

Urbanization is considered a global threat to biodiversity; the growth of cities results in an increase in impervious surfaces, soil and air pollution, fragmentation of natural vegetation and invasion of non-native species, along with numerous environmental changes, including the heat island phenomenon. The combination of these effects constitutes a challenge for both the survival and persistence of many native species, while also imposing altered selective regimes. Here, using 110 314 single nucleotide polymorphisms generated by restriction-site-associated DNA sequencing, we investigated the genome-wide effects of urbanization on putative neutral and adaptive genomic diversity in a major insect pollinator, Bombus lapidarius , collected from nine German cities and nine paired rural sites. Overall, genetic differentiation among sites was low and there was no obvious genome-wide genetic structuring, suggesting the absence of strong effects of urbanization on gene flow. We nevertheless identified several loci under directional selection, a subset of which was associated with urban land use, including the percentage of impervious surface surrounding each sampling site. Overall, our results provide evidence of local adaptation to urbanization in the face of gene flow in a highly mobile insect pollinator. © 2018 The Author(s).

Signatures of selection in the Iberian honey bee (Apis mellifera iberiensis) revealed by a genome scan analysis of single nucleotide polymorphisms.

PubMed

Chávez-Galarza, Julio; Henriques, Dora; Johnston, J Spencer; Azevedo, João C; Patton, John C; Muñoz, Irene; De la Rúa, Pilar; Pinto, M Alice

2013-12-01

Understanding the genetic mechanisms of adaptive population divergence is one of the most fundamental endeavours in evolutionary biology and is becoming increasingly important as it will allow predictions about how organisms will respond to global environmental crisis. This is particularly important for the honey bee, a species of unquestionable ecological and economical importance that has been exposed to increasing human-mediated selection pressures. Here, we conducted a single nucleotide polymorphism (SNP)-based genome scan in honey bees collected across an environmental gradient in Iberia and used four FST -based outlier tests to identify genomic regions exhibiting signatures of selection. Additionally, we analysed associations between genetic and environmental data for the identification of factors that might be correlated or act as selective pressures. With these approaches, 4.4% (17 of 383) of outlier loci were cross-validated by four FST -based methods, and 8.9% (34 of 383) were cross-validated by at least three methods. Of the 34 outliers, 15 were found to be strongly associated with one or more environmental variables. Further support for selection, provided by functional genomic information, was particularly compelling for SNP outliers mapped to different genes putatively involved in the same function such as vision, xenobiotic detoxification and innate immune response. This study enabled a more rigorous consideration of selection as the underlying cause of diversity patterns in Iberian honey bees, representing an important first step towards the identification of polymorphisms implicated in local adaptation and possibly in response to recent human-mediated environmental changes. © 2013 John Wiley & Sons Ltd.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

PubMed

Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

2003-10-01

Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

Population Genetics of Verticillium dahliae in Iran Based on Microsatellite and Single Nucleotide Polymorphism Markers.

PubMed

Rafiei, Vahideh; Banihashemi, Ziaeddin; Bautista-Jalon, Laura S; Del Mar Jiménez-Gasco, Maria; Turgeon, B Gillian; Milgroom, Michael G

2018-06-01

Verticillium dahliae is a plant pathogenic fungus that reproduces asexually and its population structure is highly clonal. In the present study, 78 V. dahliae isolates from Iran were genotyped for mating type, single nucleotide polymorphisms (SNPs), and microsatellites to assign them to clonal lineages and to determine population genetic structure in Iran. The mating type of all isolates was MAT1-2. Based on neighbor-joining analysis and minimum spanning networks constructed from SNPs and microsatellite genotypes, respectively, all but four isolates were assigned to lineage 2B 824 ; four isolates were assigned to lineage 4B. The inferred coalescent genealogy of isolates in lineage 2B 824 showed a clear divergence into two clades that corresponded to geographic origin and host. Haplotypes of cotton and pistachio isolates sampled from central Iran were in one clade, and those of isolates from Prunus spp. sampled from northwestern Iran were in the other. The strong divergence in haplotypes between the two clades suggests that there were at least two separate introductions of lineage 2B 824 to different parts of Iran. Given the history of cotton and pistachio cultivation and Verticillium wilt in Iran, these results are consistent with the hypothesis that cotton was historically a likely source inoculum causing Verticillium wilt in pistachio.

Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.

PubMed

Anderson, Eric C; Ng, Thomas C

2016-02-01

We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

PubMed

Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

2010-10-01

The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

PubMed

Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

2013-12-04

Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

PubMed Central

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

PubMed Central

Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

2015-01-01

Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

Relationships between Podolic cattle breeds assessed by single nucleotide polymorphisms (SNPs) genotyping.

PubMed

Pariset, L; Mariotti, M; Nardone, A; Soysal, M I; Ozkan, E; Williams, J L; Dunner, S; Leveziel, H; Maróti-Agóts, A; Bodò, I; Valentini, A

2010-12-01

Italian Maremmana, Turkish Grey and Hungarian Grey breeds belong to the same Podolic group of cattle, have a similar conformation and recently experienced a similar demographic reduction. The aim of this study was to assess the relationship among the analysed Podolic breeds and to verify whether their genetic state reflects their history. To do so, approximately 100 single nucleotide polymorphisms (SNPs) were genotyped on individuals belonging to these breeds and compared to genotypes of individuals of two Italian beef breeds, Marchigiana and Piemontese, which underwent different selection and migration histories. Population genetic parameters such as allelic frequencies and heterozygosity values were assessed, genetic distances calculated and assignment test performed to evaluate the possibility of recent admixture between the populations. The data show that the physical similarity among the Podolic breeds examined, and particularly between Hungarian Grey and Maremmana cattle that experienced admixture in the recent past, is mainly morphological. The assignment of individuals from genotype data was achieved using Bayesian inference, confirming that the set of chosen SNPs is able to distinguish among the breeds and that the breeds are genetically distinct. Individuals of Turkish Grey breed were clearly assigned to their breed of origin for all clustering alternatives, showing that this breed can be differentiated from the others on the basis of the allelic frequencies. Remarkably, in the Turkish Grey there were differences observed between the population of Enez district, where in situ conservation studies are practised, and that of Bandirma district of Balikesir, where ex situ conservation studies are practised out of the original raising area. In conclusion, this study demonstrates that molecular data could be used to reveal an unbiased view of past events and provide the basis for a rational exploitation of livestock, suggesting appropriate cross-breeding plans

EnsembleGASVR: a novel ensemble method for classifying missense single nucleotide polymorphisms.

PubMed

Rapakoulia, Trisevgeni; Theofilatos, Konstantinos; Kleftogiannis, Dimitrios; Likothanasis, Spiros; Tsakalidis, Athanasios; Mavroudi, Seferina

2014-08-15

Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem of missing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a two-step algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. Datasets and codes are freely available on the Web at http://prlab.ceid.upatras.gr/EnsembleGASVR/dataset-codes.zip. All the required information about the article is available through http

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

PubMed

Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

2013-09-01

Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

PubMed

Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

2016-08-01

Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

Single nucleotide polymorphisms in Plasmodium falciparum V type H(+) pyrophosphatase gene (pfvp2) and their associations with pfcrt and pfmdr1 polymorphisms.

PubMed

Jovel, Irina Tatiana; Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Malmberg, Maja; Mårtensson, Andreas; Kaneko, Akira; Zakeri, Sedigheh; Murillo, Claribel; Nosten, Francois; Björkman, Anders; Ursing, Johan

2014-06-01

Chloroquine resistance in Plasmodium falciparum malaria has been associated with pfcrt 76T (chloroquine resistance transporter gene) and pfmdr1 86Y (multidrug resistance gene 1) alleles. Pfcrt 76T enables transport of protonated chloroquine out of the parasites digestive vacuole resulting in a loss of hydrogen ions (H(+)). V type H(+) pyrophosphatase (PfVP2) is thought to pump H(+) into the digestive vacuole. This study aimed to describe the geographic distribution of single nucleotide polymorphisms in pfvp2 and their possible associations with pfcrt and pfmdr1 polymorphisms. Blood samples from 384 patients collected (1981-2009) in Honduras (n=35), Colombia (n=50), Liberia (n=50), Guinea Bissau (n=50), Tanzania (n=50), Iran (n=50), Thailand (n=49) and Vanuatu (n=50) were analysed. The pfcrt 72-76 haplotype, pfmdr1 copy numbers, pfmdr1 N86Y and pfvp2 V405I, K582R and P711S alleles were identified using PCR based methods. Pfvp2 was amplified in 344 samples. The pfvp2 allele proportions were V405 (97%), 405I (3%), K582 (99%), 582R (1%), P711 (97%) and 711S (3%). The number of patients with any of pfvp2 405I, 582R and/or 711S were as follows: Honduras (2/30), Colombia (0/46), Liberia (7/48), Guinea-Bissau (4/50), Tanzania (3/48), Iran (3/50), Thailand (1/49) and Vanuatu (0/31). The alleles were most common in Liberia (P=0.01) and Liberia+Guinea-Bissau (P=0.01). The VKP haplotype was found in 189/194 (97%) and 131/145 (90%) samples harbouring pfcrt 76T and pfcrt K76 respectively (P=0.007). The VKP haplotype was dominant. Most pfvp2 405I, 582R and 711S SNPs were seen where CQ resistance was not highly prevalent at the time of blood sampling possibly due to greater genetic variation prior to the bottle neck event of spreading CQ resistance. The association between the pfvp2 VKP haplotype and pfcrt 76T, which may indicate that pfvp2 is involved in CQ resistance, should therefore be interpreted with caution. Copyright © 2014 Elsevier B.V. All rights reserved.

Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

PubMed

Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

2016-07-01

A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

PubMed Central

2012-01-01

Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were

Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

PubMed Central

Thomas, Laurent F.; Sætrom, Pål

2012-01-01

Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians.

PubMed

Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

2017-06-01

Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

Genome wide analysis reveals single nucleotide polymorphisms associated with fatness and putative novel copy number variants in three pig breeds

PubMed Central

2013-01-01

Background Obesity, excess fat tissue in the body, can underlie a variety of medical complaints including heart disease, stroke and cancer. The pig is an excellent model organism for the study of various human disorders, including obesity, as well as being the foremost agricultural species. In order to identify genetic variants associated with fatness, we used a selective genomic approach sampling DNA from animals at the extreme ends of the fat and lean spectrum using estimated breeding values derived from a total population size of over 70,000 animals. DNA from 3 breeds (Sire Line Large White, Duroc and a white Pietrain composite line (Titan)) was used to interrogate the Illumina Porcine SNP60 Genotyping Beadchip in order to identify significant associations in terms of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs). Results By sampling animals at each end of the fat/lean EBV (estimate breeding value) spectrum the whole population could be assessed using less than 300 animals, without losing statistical power. Indeed, several significant SNPs (at the 5% genome wide significance level) were discovered, 4 of these linked to genes with ontologies that had previously been correlated with fatness (NTS, FABP6, SST and NR3C2). Quantitative analysis of the data identified putative CNV regions containing genes whose ontology suggested fatness related functions (MCHR1, PPARα, SLC5A1 and SLC5A4). Conclusions Selective genotyping of EBVs at either end of the phenotypic spectrum proved to be a cost effective means of identifying SNPs and CNVs associated with fatness and with estimated major effects in a large population of animals. PMID:24225222

Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

USDA-ARS?s Scientific Manuscript database

The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction.

PubMed

Bond, C; LaForge, K S; Tian, M; Melia, D; Zhang, S; Borg, L; Gong, J; Schluger, J; Strong, J A; Leal, S M; Tischfield, J A; Kreek, M J; Yu, L

1998-08-04

Opioid drugs play important roles in the clinical management of pain, as well as in the development and treatment of drug abuse. The mu opioid receptor is the primary site of action for the most commonly used opioids, including morphine, heroin, fentanyl, and methadone. By sequencing DNA from 113 former heroin addicts in methadone maintenance and 39 individuals with no history of drug or alcohol abuse or dependence, we have identified five different single-nucleotide polymorphisms (SNPs) in the coding region of the mu opioid receptor gene. The most prevalent SNP is a nucleotide substitution at position 118 (A118G), predicting an amino acid change at a putative N-glycosylation site. This SNP displays an allelic frequency of approximately 10% in our study population. Significant differences in allele distribution were observed among ethnic groups studied. The variant receptor resulting from the A118G SNP did not show altered binding affinities for most opioid peptides and alkaloids tested. However, the A118G variant receptor binds beta-endorphin, an endogenous opioid that activates the mu opioid receptor, approximately three times more tightly than the most common allelic form of the receptor. Furthermore, beta-endorphin is approximately three times more potent at the A118G variant receptor than at the most common allelic form in agonist-induced activation of G protein-coupled potassium channels. These results show that SNPs in the mu opioid receptor gene can alter binding and signal transduction in the resulting receptor and may have implications for normal physiology, therapeutics, and vulnerability to develop or protection from diverse diseases including the addictive diseases.

A Caenorhabditis elegans Wild Type Defies the Temperature–Size Rule Owing to a Single Nucleotide Polymorphism in tra-3

PubMed Central

Kammenga, Jan E; Doroszuk, Agnieszka; Riksen, Joost A. G; Hazendonk, Esther; Spiridon, Laurentiu; Petrescu, Andrei-Jose; Tijsterman, Marcel; Plasterk, Ronald H. A; Bakker, Jaap

2007-01-01

Ectotherms rely for their body heat on surrounding temperatures. A key question in biology is why most ectotherms mature at a larger size at lower temperatures, a phenomenon known as the temperature–size rule. Since temperature affects virtually all processes in a living organism, current theories to explain this phenomenon are diverse and complex and assert often from opposing assumptions. Although widely studied, the molecular genetic control of the temperature–size rule is unknown. We found that the Caenorhabditis elegans wild-type N2 complied with the temperature–size rule, whereas wild-type CB4856 defied it. Using a candidate gene approach based on an N2 × CB4856 recombinant inbred panel in combination with mutant analysis, complementation, and transgenic studies, we show that a single nucleotide polymorphism in tra-3 leads to mutation F96L in the encoded calpain-like protease. This mutation attenuates the ability of CB4856 to grow larger at low temperature. Homology modelling predicts that F96L reduces TRA-3 activity by destabilizing the DII-A domain. The data show that size adaptation of ectotherms to temperature changes may be less complex than previously thought because a subtle wild-type polymorphism modulates the temperature responsiveness of body size. These findings provide a novel step toward the molecular understanding of the temperature–size rule, which has puzzled biologists for decades. PMID:17335351

Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

PubMed

Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

2010-09-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

[Efficiency of 27-plex single nucleotide polymorphism multiplex system for ancestry inference in different populations].

PubMed

Feng, Xing-Ling; Sun, Qi-Fan; Liu, Hong; Wei, Yi-Liang; DU, Wei-An; Li, Cai-Xia; Chen, Ling; Liu, Chao

2016-04-20

To validate the efficiency of 27-plex single nucleotide polymorphism (SNP) multiplex system for ancestry inference. The 27-plex SNP system was validated for its sensitivity and species specificity. A total of 533 samples were collected from African, Southern Chinese Han, China's ethic minorities (Yi, Hui, Miao, Tibet, and Uygur), European, Central Asian, Western Asian, Southern Asian, Southeast Asian and South American populations for clustering analysis of the genotypes by citing 3 representative continental ancestral groups [East Asia (CHB), Europe (CEU), and Africa (YRI)] from HapMap database. The system sensitivity is 0.125 ng. Twenty and six genotypes were detected in chimpanzee and monkeys, respectively. Except in rs10496971, no more products were found in other animals. The system was capable of differentiating intercontinental populations but not of distinguishing between East Asian and Southeast Asian population or between Southern Chinese Han population and Chinese Ethnic populations (Hui, Miao, Yi and Tibet). This system achieved a 100% accuracy for intercontinental population source inference for 46 blind test samples. 27-plex SNPs multiplex system has a high sensitivity and species specificity and can correctly differentiate the ancestry origins of individuals from African, European and East Asian for criminal case investigation. But this system is not capable of distinguishing subpopulation groups and more specific ancestry-informative markers are needed to improve its recognition of Southeast Asian and Chinese ethnic populations.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

PubMed

Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-11-01

Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

PubMed Central

Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-01-01

Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

PubMed

Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

2010-08-02

To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

PubMed

Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

2013-11-01

Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

Association of the widespread A149P hereditary fructose intolerance mutation with newly identified sequence polymorphisms in the aldolase B gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brooks, C.C.; Tolan, D.R.

1993-04-01

Hereditary fructose intolerance (HFI) is a potentially fatal autosomal recessive disease resulting from the catalytic deficiency of fructose 1-phosphate aldolase (aldolase B) in fructose-metabolizing tissues. The A149P mutation in exon 5 of the aldolase B gene, located on chromosome 9q2l.3-q22.2, is widespread and the most common HFI mutation, accounting for 57% of HFI chromosomes. The possible origin of this mutation was studied by linkage to polymorphisms within the aldolase B gene. DNA fragments of the aldolase B gene containing the polymorphic marker loci from HFI patients homozygous for the A149P allele were amplified by PCR. Absolute linkage to a commonmore » Pvull RFLP allele was observed in 10 A149P homozygotes. In a more informative study, highly heterozygous polymorphisms were detected by direct sequence determination of a PCR-amplified aldolase B gene fragment. Two two-allele, single-base-pair polymorphisms, themselves in absolute linkage disequilibrium, in intron 8 (C at nucleotide 84 and A at nucleotide 105, or T at 84 and G at 105) of the aldolase B gene were identified. Mendelian segregation of these polymorphisms was confirmed in three families. Allele-specific oligonucleotide (ASO) hybridizations with probes for both sequence polymorphisms showed that 47% of 32 unrelated individuals were heterozygous at these loci; the calculated PIC value was .37. Finally, ASO hybridizations of PCR-amplified DNA from 15 HFI patients homozygous for the A149P allele with probes for these sequence polymorphisms revealed absolute linkage disequilibrium between the A149P mutation and the 84T/105G allele. These results are consistent with a single origin of the A149P allele and subsequent spread by genetic drift. 32 refs., 4 figs., 3 tabs.« less

How Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Act on Prosociality: The Mediation Role of Moral Evaluation.

PubMed

Shang, Siyuan; Wu, Nan; Su, Yanjie

2017-01-01

Prosociality is related to numerous positive outcomes, and mechanisms underlying individual differences in prosociality have been widely discussed. Recently, research has found converging evidence on the influence of the oxytocin receptor ( OXTR ) gene on prosociality. Meanwhile, moral reasoning, a key precursor for social behavior, has also been associated with variability in OXTR gene, thus the relationship between OXTR and prosociality is assumed to be mediated by moral evaluation. The current study examines the relationship in question, and includes gender as a potential moderator. Self-reported prosociality on Prosocial Tendencies Measure and evaluation on the moral acceptability of behaviors in stories from 790 Chinese adolescents (32.4% boys) were analyzed for the influence of their OXTR single nucleotide polymorphisms (SNPs). Results showed that SNP at site rs2254298 was indirectly associated with prosocial behaviors via moral evaluation of behaviors, and this effect was moderated by gender. Our findings suggest an indirect association between genetic variations in OXTR and prosociality through moral evaluation, indicating the potential pathway from genetic variability to prosociality through level of moral development. We also provide some evidence that the role of oxytocin system may to some extent depend on gender. These findings may promote our understanding of the genetic and biological roots of prosociality and morality.

Rapid Identification of Echinococcus granulosus and E. canadensis Using High-Resolution Melting (HRM) Analysis by Focusing on a Single Nucleotide Polymorphism.

PubMed

Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader

2016-07-22

High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.

Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

PubMed Central

Chao, Shiaoman; Singh, Ravi P.; Sorrells, Mark E.

2017-01-01

Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS) for identifying loci associated with the Ug99 stem rust resistance (SR) in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT). Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP) chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR) assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat. PMID:28241006

Comparative Analyses of Single-Nucleotide Polymorphisms in the TNF Promoter Region Provide Further Validation for the Vervet Monkey Model of Obesity

PubMed Central

Gray, Stanton B; Howard, Timothy D; Langefeld, Carl D; Hawkins, Gregory A; Diallo, Abdoulaye F; Wagner, Janice D

2009-01-01

Tumor necrosis factor is a cytokine that plays critical roles in inflammation, the innate immune response, and a variety of other physiologic and pathophysiologic processes. In addition, TNF has recently been shown to mediate an intersection of chronic, low-grade inflammation and concurrent metabolic dysregulation associated with obesity and its comorbidities. As part of an ongoing initiative to further characterize vervet monkeys originating from St Kitts as an animal model of obesity and inflammation, we sequenced and genotyped the human ortholog vervet TNF gene and approximately 1 kb of the flanking 3′ and 5′ regions from 265 monkeys in a closed, pedigreed colony. This process revealed a total of 11 single-nucleotide polymorphisms (SNPs) and a single 4-bp insertion–deletion, with minor allele frequencies of 0.08 to 0.39. Many of these polymorphisms were in strong or complete linkage disequilibrium with each other, and all but 1 were contained within a single haplotype block, comprising 5 haplotypes with frequencies of 0.075 to 0.298. Using sequences from humans, chimpanzees, vervets, baboons, and rhesus macaques, phylogenetic shadowing of the TNF promoter region revealed that vervet SNPs, like the SNPs in related species, were clustered nonrandomly and nonuniformly around conserved transcription factor binding sites. These data, combined with previously defined heritable phenotypes, permit future association analyses in this nonhuman primate model and have great potential to help dissect the genetic and nongenetic contributions to complex diseases like obesity. More broadly, the sequence data and comparative analyses reported herein facilitates study of the evolution of regulatory sequences of inflammatory and immune-related genes. PMID:20034434

Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

PubMed

Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

2010-08-01

Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on

High-Throughput Genotyping of Single Nucleotide Polymorphisms in the Plasmodium falciparum dhfr Gene by Asymmetric PCR and Melt-Curve Analysis▿

PubMed Central

Cruz, Rochelle E.; Shokoples, Sandra E.; Manage, Dammika P.; Yanow, Stephanie K.

2010-01-01

Mutations within the Plasmodium falciparum dihydrofolate reductase gene (Pfdhfr) contribute to resistance to antimalarials such as sulfadoxine-pyrimethamine (SP). Of particular importance are the single nucleotide polymorphisms (SNPs) within codons 51, 59, 108, and 164 in the Pfdhfr gene that are associated with SP treatment failure. Given that traditional genotyping methods are time-consuming and laborious, we developed an assay that provides the rapid, high-throughput analysis of parasite DNA isolated from clinical samples. This assay is based on asymmetric real-time PCR and melt-curve analysis (MCA) performed on the LightCycler platform. Unlabeled probes specific to each SNP are included in the reaction mixture and hybridize differentially to the mutant and wild-type sequences within the amplicon, generating distinct melting curves. Since the probe is present throughout PCR and MCA, the assay proceeds seamlessly with no further addition of reagents. This assay was validated for analytical sensitivity and specificity using plasmids, purified genomic DNA from reference strains, and parasite cultures. For all four SNPs, correct genotypes were identified with 100 copies of the template. The performance of the assay was evaluated with a blind panel of clinical isolates from travelers with low-level parasitemia. The concordance between our assay and DNA sequencing ranged from 84 to 100% depending on the SNP. We also directly compared our MCA assay to a published TaqMan real-time PCR assay and identified major issues with the specificity of the TaqMan probes. Our assay provides a number of technical improvements that facilitate the high-throughput screening of patient samples to identify SP-resistant malaria. PMID:20631115

Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

PubMed

Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

2014-06-01

Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

ERIC Educational Resources Information Center

Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

2010-01-01

The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

RNA sequencing to study gene expression and single nucleotide polymorphism variation associated with citrate content in cow milk.

PubMed

Cánovas, A; Rincón, G; Islas-Trejo, A; Jimenez-Flores, R; Laubscher, A; Medrano, J F

2013-04-01

The technological properties of milk have significant importance for the dairy industry. Citrate, a normal constituent of milk, forms one of the main buffer systems that regulate the equilibrium between Ca(2+) and H(+) ions. Higher-than-normal citrate content is associated with poor coagulation properties of milk. To identify the genes responsible for the variation of citrate content in milk in dairy cattle, the metabolic steps involved in citrate and fatty acid synthesis pathways in ruminant mammary tissue using RNA sequencing were studied. Genetic markers that could influence milk citrate content in Holstein cows were used in a marker-trait association study to establish the relationship between 74 single nucleotide polymorphisms (SNP) in 20 candidate genes and citrate content in 250 Holstein cows. This analysis revealed 6 SNP in key metabolic pathway genes [isocitrate dehydrogenase 1 (NADP+), soluble (IDH1); pyruvate dehydrogenase (lipoamide) β (PDHB); pyruvate kinase (PKM2); and solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1)] significantly associated with increased milk citrate content. The amount of the phenotypic variation explained by the 6 SNP ranged from 10.1 to 13.7%. Also, genotype-combination analysis revealed the highest phenotypic variation was explained combining IDH1_23211, PDHB_5562, and SLC25A1_4446 genotypes. This specific genotype combination explained 21.3% of the phenotypic variation. The largest citrate associated effect was in the 3' untranslated region of the SLC25A1 gene, which is responsible for the transport of citrate across the mitochondrial inner membrane. This study provides an approach using RNA sequencing, metabolic pathway analysis, and association studies to identify genetic variation in functional target genes determining complex trait phenotypes. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

PubMed Central

Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

2015-01-01

Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

Novel single-nucleotide polymorphism markers confirm successful spawning of endangered pallid sturgeon in the upper Missouri River Basin

USGS Publications Warehouse

Eichelberger, Jennifer S.; Braaten, P. J.; Fuller, D. B.; Krampe, Matthew S.; Heist, Edward J.

2014-01-01

Spawning of the federally endangered Pallid Sturgeon Scaphirhynchus albus is known to occur in the upper Missouri River basin, but progeny from natural reproductive events have not been observed and recruitment to juvenile or adult life stages has not been documented in recent decades. Identification of Pallid Sturgeon progeny is confounded by the fact that Shovelnose Sturgeon S. platorynchus occurs throughout the entire range of Pallid Sturgeon and the two species are essentially indistinguishable (morphometrically and meristically) during early life stages. Moreover, free embryos of sympatric Paddlefish Polyodon spathula are very similar to the two sturgeon species. In this study, three single-nucleotide polymorphism (SNP) assays were employed to screen acipenseriform free embryos and larvae collected from the upper Missouri River basin in 2011, 2012, and 2013. A mitochondrial DNA SNP discriminates Paddlefish from sturgeon, and specific multilocus genotypes at two nuclear DNA SNPs occurred in 98.9% of wild adult Pallid Sturgeon but only in 3% of Shovelnose Sturgeon sampled in the upper Missouri River. Individuals identified as potential Pallid Sturgeon based on SNP genotypes were further analyzed at 19 microsatellite loci for species discrimination. Out of 1,423 free embryos collected over 3 years of sampling, 971 Paddlefish, 446 Shovelnose Sturgeon, and 6 Pallid Sturgeon were identified. Additionally, 249 Scaphirhynchus spp. benthic larvae were screened, but no Pallid Sturgeon were detected. These SNP markers provide an efficient method of screening acipenseriform early life stages for the presence of Pallid Sturgeon in the Missouri River basin. Detection of wild Pallid Sturgeon free embryos in the upper Missouri and Yellowstone rivers supports the hypothesis that the failure of wild Pallid Sturgeon to recruit to the juvenile life stage in the upper Missouri River basin is caused by early life stage mortality rather than by lack of successful spawning.

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

PubMed

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

PubMed

Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

2013-01-01

To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

Single-nucleotide polymorphism discovery in Leptographium longiclavatum, a mountain pine beetle-associated symbiotic fungus, using whole-genome resequencing.

PubMed

Ojeda, Dario I; Dhillon, Braham; Tsui, Clement K M; Hamelin, Richard C

2014-03-01

Single-nucleotide polymorphisms (SNPs) are rapidly becoming the standard markers in population genomics studies; however, their use in nonmodel organisms is limited due to the lack of cost-effective approaches to uncover genome-wide variation, and the large number of individuals needed in the screening process to reduce ascertainment bias. To discover SNPs for population genomics studies in the fungal symbionts of the mountain pine beetle (MPB), we developed a road map to discover SNPs and to produce a genotyping platform. We undertook a whole-genome sequencing approach of Leptographium longiclavatum in combination with available genomics resources of another MPB symbiont, Grosmannia clavigera. We sequenced 71 individuals pooled into four groups using the Illumina sequencing technology. We generated between 27 and 30 million reads of 75 bp that resulted in a total of 1, 181 contigs longer than 2 kb and an assembled genome size of 28.9 Mb (N50 = 48 kb, average depth = 125x). A total of 9052 proteins were annotated, and between 9531 and 17,266 SNPs were identified in the four pools. A subset of 206 genes (containing 574 SNPs, 11% false positives) was used to develop a genotyping platform for this species. Using this roadmap, we developed a genotyping assay with a total of 147 SNPs located in 121 genes using the Illumina(®) Sequenom iPLEX Gold. Our preliminary genotyping (success rate = 85%) of 304 individuals from 36 populations supports the utility of this approach for population genomics studies in other MPB fungal symbionts and other fungal nonmodel species. © 2013 John Wiley & Sons Ltd.

Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

PubMed

Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

2017-08-01

Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

Association of ABCB1 and ABCG2 single nucleotide polymorphisms with clinical findings and response to chemotherapy treatments in Kurdish patients with breast cancer.

PubMed

Ghafouri, Houshiyar; Ghaderi, Bayazid; Amini, Sabrieh; Nikkhoo, Bahram; Abdi, Mohammad; Hoseini, Abdolhakim

2016-06-01

The possible interaction between gene polymorphisms and risk of cancer progression is very interesting. Polymorphisms in multi-drug resistance genes have an important role in response to anti-cancer drugs. The present study was aimed to evaluate the possible effects of ABCB1 C3435T and ABCG2 C421A single nucleotide polymorphisms on clinical and pathological outcomes of Kurdish patients with breast cancer. One hundred breast cancer patients and 200 healthy controls were enrolled in this case-control study. Clinical and pathological findings of all individuals were reported, and immunohistochemistry staining was used to assess the tissue expression of specific breast cancer proteins. The ABCB1 C3435T and ABCG2 C421 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). The distribution of different genotypes between patient and control groups was only significant for ABCG2 C421A. A allele of ABCG2 C421A polymorphisms were significantly higher in patients than in controls. Patients with AA genotype of ABCG2 C421A were at higher risk of progressing breast cancer. Patients with A allele of ABCG2 had complete response to chemotherapeutic agents. There was no statistically significant association between ABCB1 C3435T and ABCG2 C421A polymorphisms and tissue expression of ER, PR, Her2/neu, and Ki67. The ABCB1 C3435T has no correlation with clinical findings and treatment with chemotherapy drugs. The A allele of ABCG2 C421A may be a risk factor for progression of breast cancer in Kurdish patients. In addition, breast cancer patients with C allele of this polymorphism have weaker response to treatments with anthracyclines and Paclitaxol.

Association between the TRAIL single nucleotide polymorphism rs1131580 and type 2 diabetes mellitus in a Han Chinese population.

PubMed

Yu, M Y; Zhao, P Q; Yan, X H; Liu, B; Zhang, Q Q; Wang, R; Ma, C H; Liang, X H; Zhu, F L; Gao, L F

2013-09-10

Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is expressed in different tissues and cells, including the pancreas and lymphocytes, and it can selectively induce apoptosis in tumor cells but not in most normal cells. TRAIL plays critical roles in type 1 diabetes mellitus, and is involved in type 2 diabetes mellitus (T2DM). We recently discovered the association of nonalcoholic fatty liver disease, a risk factor for T2DM, with a single nucleotide polymorphism (SNP) in the TRAIL (TNFSF10) gene at site 1595C/T (rs1131580), indicating the possible association of T2DM with this TRAIL polymorphism. The aim of this study was to investigate the relationship of the TRAIL SNP at site 1595C/T (rs1131580) with T2DM susceptibility and the biometabolic parameters of T2DM in a Han Chinese population. The polymerase chain reaction-restriction fragment length polymorphism method was used to genotype SNP rs1131580 in 292 patients with T2DM and 266 healthy controls. We found that the frequency of the CC genotype and that of the C allele of rs1131580 were significantly higher in T2DM patients than in the control group. Additionally, the triglyceride and serum creatinine levels of T2DM patients with the CC genotype were significantly higher than those of patients with the TT genotype. Thus, the CC genotype of the TRAIL SNP at 1595C/T (rs1131580) confers increased susceptible to T2DM in a Han Chinese population from Shandong Province. These data suggest that the CC genotype at this SNP is related to diabetic severity and it might be a candidate for the prognostic assessment of T2DM.

Single nucleotide polymorphisms of ABCC2 modulate renal secretion of endogenous organic anions.

PubMed

Muhrez, Kienana; Largeau, Bérenger; Emond, Patrick; Montigny, Frédéric; Halimi, Jean-Michel; Trouillas, Patrick; Barin-Le Guellec, Chantal

2017-09-15

The ATP-binding cassette family transporter MRP2 (multidrug resistance-associated protein 2), encoded by the ABCC2 gene, is involved in the renal excretion of numerous xenobiotics and it is likely that it also transports many endogenous molecules arising from not only normal essential metabolic processes but also from environmental toxins or food intake. We used a targeted gas chromatography-mass spectrometry metabolomics analysis to study whether endogenous organic anions are differentially excreted in urines of healthy volunteers according to their genotype for three functional single nucleotide polymorphisms (SNPs) in ABCC2. This was the case for 35 of the 108 metabolites analyzed. Eight of them are most likely substrates of MRP2 since they are the most contributive to the difference between carriers of a decreasing function allele vs those carrying an increasing function one. Seven out of 8 metabolites are fatty acids (dodecanoic acid; 3-hydroxypropanoic acid) or metabolites of polyphenols (caffeine; resorcinol; caffeic acid; 2-(3,4-dihydroxyphenyl) acetic acid; and 4-hydroxyhippuric acid). Most of them were structurally similar to a series of substances previously shown to interact with MRP2 function in vitro. Interestingly, coproporphyrin isomer I, a prototypical substrate of MRP2, also belonged to our final list although it was not significantly discriminant on its own. This suggests that the simultaneous measurement of a set of endogenous metabolites in urine, rather than that of unique metabolites, has the potential to provide a phenotypic measure of MRP2 function in vivo. This would represent an innovative tool to study the variability of the transport activity of MRP2 under a physiological or pathological condition, especially in pharmacokinetic studies of its substrates. Copyright © 2017 Elsevier Inc. All rights reserved.

MIG-seq: an effective PCR-based method for genome-wide single-nucleotide polymorphism genotyping using the next-generation sequencing platform

PubMed Central

Suyama, Yoshihisa; Matsuki, Yu

2015-01-01

Restriction-enzyme (RE)-based next-generation sequencing methods have revolutionized marker-assisted genetic studies; however, the use of REs has limited their widespread adoption, especially in field samples with low-quality DNA and/or small quantities of DNA. Here, we developed a PCR-based procedure to construct reduced representation libraries without RE digestion steps, representing de novo single-nucleotide polymorphism discovery, and its genotyping using next-generation sequencing. Using multiplexed inter-simple sequence repeat (ISSR) primers, thousands of genome-wide regions were amplified effectively from a wide variety of genomes, without prior genetic information. We demonstrated: 1) Mendelian gametic segregation of the discovered variants; 2) reproducibility of genotyping by checking its applicability for individual identification; and 3) applicability in a wide variety of species by checking standard population genetic analysis. This approach, called multiplexed ISSR genotyping by sequencing, should be applicable to many marker-assisted genetic studies with a wide range of DNA qualities and quantities. PMID:26593239

Functional effects of single nucleotide polymorphisms in the coding region of human N-acetyltransferase 1

PubMed Central

Zhu, Yuanqi; Hein, David W.

2007-01-01

Genetic variants of human N-acetyltransferase 1 (NAT1) are associated with cancer and birth defects. N- and O-acetyltransferase catalytic activities, Michaelis-Menten kinetic constants (Km & Vmax), and steady state expression levels of NAT1-specific mRNA and protein were determined for the reference NAT1*4 and variant human NAT1 haplotypes possessing single nucleotide polymorphisms (SNPs) in the open reading frame. Although none of the SNPs caused a significant effect on steady state levels of NAT1-specific mRNA, C97T(R33stop), C190T(R64W), C559T (R187stop) and A752T(D251V) each reduced NAT1 protein level and/or N- and O-acetyltransferase catalytic activities to levels below detection. G560A(R187Q) substantially reduced NAT1 protein level and catalytic activities and increased substrate Km. The G445A(V149I), G459A(synonymous) and T640G(S214A) haplotype present in NAT1*11 significantly (p<0.05) increased NAT1 protein level and catalytic activity. Neither T21G(synonymous), T402C(synonymous), A613G(M205V), T777C(synonymous), G781A(E261K), or A787G(I263V) significantly affected Km, catalytic activity, mRNA or protein level. These results suggest heterogeneity among slow NAT1 acetylator phenotypes. PMID:17909564

Donor single nucleotide polymorphism in the CCR9 gene affects the incidence of skin GVHD.

PubMed

Inamoto, Y; Murata, M; Katsumi, A; Kuwatsuka, Y; Tsujimura, A; Ishikawa, Y; Sugimoto, K; Onizuka, M; Terakura, S; Nishida, T; Kanie, T; Taji, H; Iida, H; Suzuki, R; Abe, A; Kiyoi, H; Matsushita, T; Miyamura, K; Kodera, Y; Naoe, T

2010-02-01

The interactions between chemokines and their receptors may have an important role in initiating GVHD after allogeneic hematopoietic SCT (allo-HSCT). CCL25 and CCR9 are unique because they are exclusively expressed in epithelial cells and in Peyer's patches of the small intestine. We focused on rs12721497 (G926A), one of the non-synonymous single nucleotide polymorphisms (SNPs) in the CCR9 gene, and analyzed the SNP of donors in 167 consecutive patients who received allo-HSCT from an HLA-identical sibling donor. Genotypes were tested for associations with acute and chronic GVHD in each organ and transplant outcome. Multivariate analyses showed that the genotype 926AG was significantly associated with the incidence of acute stage > or =2 skin GVHD (hazard ratio: 3.2; 95% confidence interval (95% CI): 1.1-9.1; P=0.032) and chronic skin GVHD (hazard ratio: 4.1; 95% CI: 1.1-15; P=0.036), but not with GVHD in other organs or with relapse, non-relapse mortality or OS. To clarify the functional differences between genotypes, each SNP in retroviral vectors was transfected into Jurkat cells. In chemotaxis assays, the 926G transfectant showed greater response to CCL25 than the 926A transfectant. In conclusion, more active homing of CCR9-926AG T cells to Peyer's patches may produce changes in Ag presentation and result in increased incidence of skin GVHD.

Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations.

PubMed

Kawasaki, Eiji; Awata, Takuya; Ikegami, Hiroshi; Kobayashi, Tetsuro; Maruyama, Taro; Nakanishi, Koji; Shimada, Akira; Uga, Miho; Uga, Mho; Kurihara, Susumu; Kawabata, Yumiko; Tanaka, Shoichiro; Kanazawa, Yasuhiko; Lee, Inkyu; Eguchi, Katsumi

2006-03-15