SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.

PubMed

Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W

2016-10-20

RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Saturation analysis of ChIP-seq data for reproducible identification of binding peaks

PubMed Central

Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.

2015-01-01

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

[beta]-Glucan Synthesis in the Cotton Fiber (III. Identification of UDP-Glucose-Binding Subunits of [beta]-Glucan Synthases by Photoaffinity Labeling with [[beta]-32P]5[prime]-N3-UDP-Glucose.

PubMed Central

Li, L.; Drake, R. R.; Clement, S.; Brown, R. M.

1993-01-01

Using differential product entrapment and photolabeling under specifying conditions, we identifIed a 37-kD polypeptide as the best candidate among the UDP-glucose-binding polypeptides for the catalytic subunit of cotton (Gossypium hirsutum) cellulose synthase. This polypeptide is enriched by entrapment under conditions favoring [beta]-1,4-glucan synthesis, and it is magnesium dependent and sensitive to unlabeled UDP-glucose. A 52-kD polypeptide was identified as the most likely candidate for the catalytic subunit of [beta]-1,3-glucan synthase because this polypeptide is the most abundant protein in the entrapment fraction obtained under conditions favoring [beta]-1,3-glucan synthesis, is coincident with [beta]-1,3-glucan synthase activity, and is calcium dependent. The possible involvement of other polypeptides in the synthesis of [beta]-1,3-glucan is discussed. PMID:12231766

Elucidating the druggable interface of protein-protein interactions using fragment docking and coevolutionary analysis.

PubMed

Bai, Fang; Morcos, Faruck; Cheng, Ryan R; Jiang, Hualiang; Onuchic, José N

2016-12-13

Protein-protein interactions play a central role in cellular function. Improving the understanding of complex formation has many practical applications, including the rational design of new therapeutic agents and the mechanisms governing signal transduction networks. The generally large, flat, and relatively featureless binding sites of protein complexes pose many challenges for drug design. Fragment docking and direct coupling analysis are used in an integrated computational method to estimate druggable protein-protein interfaces. (i) This method explores the binding of fragment-sized molecular probes on the protein surface using a molecular docking-based screen. (ii) The energetically favorable binding sites of the probes, called hot spots, are spatially clustered to map out candidate binding sites on the protein surface. (iii) A coevolution-based interface interaction score is used to discriminate between different candidate binding sites, yielding potential interfacial targets for therapeutic drug design. This approach is validated for important, well-studied disease-related proteins with known pharmaceutical targets, and also identifies targets that have yet to be studied. Moreover, therapeutic agents are proposed by chemically connecting the fragments that are strongly bound to the hot spots.

Two-log increase in sensitivity for detection of Norovirus in complex samples using porcine gastric mucin capture and immunomagnetic separation

USDA-ARS?s Scientific Manuscript database

Human histo-blood group antigens (HBGA) have been identified previously as candidate receptors for human norovirus (NOR). Type A, type H1, Lewis HBGAs have been identified major HBGA for NOR binding. We have identified that pig stomach mucin (PGM) contains group A, type H1, and Lewis b type HBGAs...

Reexamine structures and relative stability of medium-sized silicon clusters: Low-lying endohedral fullerene-like clusters Si 30-Si 38

NASA Astrophysics Data System (ADS)

Yoo, Soohaeng; Shao, Nan; Zeng, X. C.

2009-10-01

We report improved results of lowest-lying silicon clusters Si 30-Si 38. A large population of low-energy clusters are collected from previous searches by several research groups and the binding energies of these clusters are computed using density-functional theory (DFT) methods. Best candidates (isomers with high binding energies) are identified from the screening calculations. Additional constrained search is then performed for the best candidates using the basin-hopping method combined with DFT geometry optimization. The obtained low-lying clusters are classified according to binding energies computed using either the Perdew-Burke-Ernzerhof (PBE) functional or the Becke exchange and Lee-Yang-Parr correlation (BLYP) functional. We propose to rank low-lying clusters according to the mean PBE/BLYP binding energies in view that the PBE functional tends to give greater binding energies for more compact clusters whereas the BLYP functional tends to give greater binding energies for less compact clusters or clusters composed of small-sized magic-number clusters. Except for Si 30, the new search confirms again that medium-size silicon clusters Si 31-Si 38 constructed with proper fullerene cage motifs are most promising to be the lowest-energy structures.

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Prediction and analysis of promiscuous T cell-epitopes derived from the vaccine candidate antigens of Leishmania donovani binding to MHC class-II alleles using in silico approach.

PubMed

Kashyap, Manju; Jaiswal, Varun; Farooq, Umar

2017-09-01

Visceral leishmaniasis is a dreadful infectious disease and caused by the intracellular protozoan parasites, Leishmania donovani and Leishmania infantum. Despite extensive efforts for developing effective prophylactic vaccine, still no vaccine is available against leishmaniasis. However, advancement in immunoinformatics methods generated new dimension in peptide based vaccine development. The present study was aimed to identify T-cell epitopes from the vaccine candidate antigens like Lipophosphogylcan-3(LPG-3) and Nucleoside hydrolase (NH) from the L. donovani using in silico methods. Available best tools were used for the identification of promiscuous peptides for MHC class-II alleles. A total of 34 promiscuous peptides from LPG-3, 3 from NH were identified on the basis of their 100% binding affinity towards all six HLA alleles, taken in this study. These peptides were further checked computationally to know their IFN-γ and IL4 inducing potential and nine peptides were identified. Peptide binding interactions with predominant HLA alleles were done by docking. Out of nine docked promiscuous peptides, only two peptides (QESRILRVIKKKLVR, RILRVIKKKLVRKTL), from LPG-3 and one peptide (FDKFWCLVIDALKRI) from NH showed lowest binding energy with all six alleles. These promiscuous T-cell epitopes were predicted on the basis of their antigenicity, hydrophobicity, potential immune response and docking scores. The immunogenicity of predicted promiscuous peptides might be used for subunit vaccine development with immune-modulating adjuvants. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutant fatty acid desaturase and methods for directed mutagenesis

DOEpatents

Shanklin, John [Shoreham, NY; Whittle, Edward J [Greenport, NY

2008-01-29

The present invention relates to methods for producing fatty acid desaturase mutants having a substantially increased activity towards substrates with fewer than 18 carbon atom chains relative to an unmutagenized precursor desaturase having an 18 carbon chain length specificity, the sequences encoding the desaturases and to the desaturases that are produced by the methods. The present invention further relates to a method for altering a function of a protein, including a fatty acid desaturase, through directed mutagenesis involving identifying candidate amino acid residues, producing a library of mutants of the protein by simultaneously randomizing all amino acid candidates, and selecting for mutants which exhibit the desired alteration of function. Candidate amino acids are identified by a combination of methods. Enzymatic, binding, structural and other functions of proteins can be altered by the method.

Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation

PubMed Central

Hung, Victoria; Lam, Stephanie S; Udeshi, Namrata D; Svinkina, Tanya; Guzman, Gaelen; Mootha, Vamsi K; Carr, Steven A; Ting, Alice Y

2017-01-01

The cytosol-facing membranes of cellular organelles contain proteins that enable signal transduction, regulation of morphology and trafficking, protein import and export, and other specialized processes. Discovery of these proteins by traditional biochemical fractionation can be plagued with contaminants and loss of key components. Using peroxidase-mediated proximity biotinylation, we captured and identified endogenous proteins on the outer mitochondrial membrane (OMM) and endoplasmic reticulum membrane (ERM) of living human fibroblasts. The proteomes of 137 and 634 proteins, respectively, are highly specific and highlight 94 potentially novel mitochondrial or ER proteins. Dataset intersection identified protein candidates potentially localized to mitochondria-ER contact sites. We found that one candidate, the tail-anchored, PDZ-domain-containing OMM protein SYNJ2BP, dramatically increases mitochondrial contacts with rough ER when overexpressed. Immunoprecipitation-mass spectrometry identified ribosome-binding protein 1 (RRBP1) as SYNJ2BP’s ERM binding partner. Our results highlight the power of proximity biotinylation to yield insights into the molecular composition and function of intracellular membranes. DOI: http://dx.doi.org/10.7554/eLife.24463.001 PMID:28441135

Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.

PubMed Central

Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N

1989-01-01

Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872

Identifying potential selective fluorescent probes for cancer-associated protein carbonic anhydrase IX using a computational approach.

PubMed

Kamstra, Rhiannon L; Floriano, Wely B

2014-11-01

Carbonic anhydrase IX (CAIX) is a biomarker for tumor hypoxia. Fluorescent inhibitors of CAIX have been used to study hypoxic tumor cell lines. However, these inhibitor-based fluorescent probes may have a therapeutic effect that is not appropriate for monitoring treatment efficacy. In the search for novel fluorescent probes that are not based on known inhibitors, a database of 20,860 fluorescent compounds was virtually screened against CAIX using hierarchical virtual ligand screening (HierVLS). The screening database contained 14,862 compounds tagged with the ATTO680 fluorophore plus an additional 5998 intrinsically fluorescent compounds. Overall ranking of compounds to identify hit molecular probe candidates utilized a principal component analysis (PCA) approach. Four potential binding sites, including the catalytic site, were identified within the structure of the protein and targeted for virtual screening. Available sequence information for 23 carbonic anhydrase isoforms was used to prioritize the four sites based on the estimated "uniqueness" of each site in CAIX relative to the other isoforms. A database of 32 known inhibitors and 478 decoy compounds was used to validate the methodology. A receiver-operating characteristic (ROC) analysis using the first principal component (PC1) as predictive score for the validation database yielded an area under the curve (AUC) of 0.92. AUC is interpreted as the probability that a binder will have a better score than a non-binder. The use of first component analysis of binding energies for multiple sites is a novel approach for hit selection. The very high prediction power for this approach increases confidence in the outcome from the fluorescent library screening. Ten of the top scoring candidates for isoform-selective putative binding sites are suggested for future testing as fluorescent molecular probe candidates. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular Gas toward the Gemini OB1 Molecular Cloud Complex. II. CO Outflow Candidates with Possible WISE Associations

NASA Astrophysics Data System (ADS)

Li, Yingjie; Li, Fa-Cheng; Xu, Ye; Wang, Chen; Du, Xin-Yu; Yang, Wenjin; Yang, Ji

2018-03-01

We present a large-scale survey of CO outflows in the Gem OB1 molecular cloud complex and its surroundings, using the Purple Mountain Observatory Delingha 13.7 m telescope. A total of 198 outflow candidates were identified over a large area (∼58.5 square degrees), of which 193 are newly detected. Approximately 68% (134/198) are associated with the Gem OB1 molecular cloud complex, including clouds GGMC 1, GGMC 2, BFS 52, GGMC 3, and GGMC 4. Other regions studied are: the Local arm (Local Lynds, West Front), Swallow, Horn, and Remote cloud. Outflow candidates in GGMC 1, BFS 52, and Swallow are mainly located at ring-like or filamentary structures. To avoid excessive uncertainty in distant regions (≳3.8 kpc), we only estimated the physical parameters for clouds in the Gem OB1 molecular cloud complex and in the Local arm. In those clouds, the total kinetic energy and the energy injection rate of the identified outflow candidates are ≲1% and ≲3% of the turbulent energy and the turbulent dissipation rate of each cloud, indicating that the identified outflow candidates cannot provide enough energy to balance turbulence of their host cloud at the scale of the entire cloud (several to dozens of parsecs). The gravitational binding energy of each cloud is ≳135 times the total kinetic energy of the identified outflow candidates within the corresponding cloud, indicating that the identified outflow candidates cannot cause major disruptions to the integrity of their host cloud at the scale of the entire cloud.

Candidate chemosensory ionotropic receptors in a Lepidoptera.

PubMed

Olivier, V; Monsempes, C; François, M-C; Poivet, E; Jacquin-Joly, E

2011-04-01

A new family of candidate chemosensory ionotropic receptors (IRs) related to ionotropic glutamate receptors (iGluRs) was recently discovered in Drosophila melanogaster. Through Blast analyses of an expressed sequenced tag library prepared from male antennae of the noctuid moth Spodoptera littoralis, we identified 12 unigenes encoding proteins related to D. melanogaster and Bombyx mori IRs. Their full length sequences were obtained and the analyses of their expression patterns suggest that they were exclusively expressed or clearly enriched in chemosensory organs. The deduced protein sequences were more similar to B. mori and D. melanogaster IRs than to iGluRs and showed considerable variations in the predicted ligand-binding domains; none have the three glutamate-interacting residues found in iGluRs, suggesting different binding specificities. Our data suggest that we identified members of the insect IR chemosensory receptor family in S. littoralis and we report here the first demonstration of IR expression in Lepidoptera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.

Design and Synthesis of a Pan-Janus Kinase Inhibitor Clinical Candidate (PF-06263276) Suitable for Inhaled and Topical Delivery for the Treatment of Inflammatory Diseases of the Lungs and Skin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jones, Peter; Storer, R. Ian; Sabnis, Yogesh A.

By use of a structure-based computational method for identification of structurally novel Janus kinase (JAK) inhibitors predicted to bind beyond the ATP binding site, a potent series of indazoles was identified as selective pan-JAK inhibitors with a type 1.5 binding mode. Optimization of the series for potency and increased duration of action commensurate with inhaled or topical delivery resulted in potent pan-JAK inhibitor 2 (PF-06263276), which was advanced into clinical studies.

The Multiple Carbohydrate Binding Specificities of Helicobacter pylori

NASA Astrophysics Data System (ADS)

Teneberg, Susann

Persistent colonization of the human stomach by Helicobacter pylori is a risk factor for the development of peptic ulcer disease and gastric cancer. Adhesion of microbes to the target tissue is an important determinant for successful initiation, establishment and maintenance of infection, and a variety of different candidate carbohydrate receptors for H. pylori have been identified. Here the different the binding specifities, and their potential role in adhesion to human gastric epithelium are described. Finally, recent findings on the roles of sialic acid binding SabA adhesin in interactions with human neutrophils and erythrocytes are discussed.

Fine-mapping of prostate cancer susceptibility loci in a large meta-analysis identifies candidate causal variants.

PubMed

Dadaev, Tokhir; Saunders, Edward J; Newcombe, Paul J; Anokian, Ezequiel; Leongamornlert, Daniel A; Brook, Mark N; Cieza-Borrella, Clara; Mijuskovic, Martina; Wakerell, Sarah; Olama, Ali Amin Al; Schumacher, Fredrick R; Berndt, Sonja I; Benlloch, Sara; Ahmed, Mahbubl; Goh, Chee; Sheng, Xin; Zhang, Zhuo; Muir, Kenneth; Govindasami, Koveela; Lophatananon, Artitaya; Stevens, Victoria L; Gapstur, Susan M; Carter, Brian D; Tangen, Catherine M; Goodman, Phyllis; Thompson, Ian M; Batra, Jyotsna; Chambers, Suzanne; Moya, Leire; Clements, Judith; Horvath, Lisa; Tilley, Wayne; Risbridger, Gail; Gronberg, Henrik; Aly, Markus; Nordström, Tobias; Pharoah, Paul; Pashayan, Nora; Schleutker, Johanna; Tammela, Teuvo L J; Sipeky, Csilla; Auvinen, Anssi; Albanes, Demetrius; Weinstein, Stephanie; Wolk, Alicja; Hakansson, Niclas; West, Catharine; Dunning, Alison M; Burnet, Neil; Mucci, Lorelei; Giovannucci, Edward; Andriole, Gerald; Cussenot, Olivier; Cancel-Tassin, Géraldine; Koutros, Stella; Freeman, Laura E Beane; Sorensen, Karina Dalsgaard; Orntoft, Torben Falck; Borre, Michael; Maehle, Lovise; Grindedal, Eli Marie; Neal, David E; Donovan, Jenny L; Hamdy, Freddie C; Martin, Richard M; Travis, Ruth C; Key, Tim J; Hamilton, Robert J; Fleshner, Neil E; Finelli, Antonio; Ingles, Sue Ann; Stern, Mariana C; Rosenstein, Barry; Kerns, Sarah; Ostrer, Harry; Lu, Yong-Jie; Zhang, Hong-Wei; Feng, Ninghan; Mao, Xueying; Guo, Xin; Wang, Guomin; Sun, Zan; Giles, Graham G; Southey, Melissa C; MacInnis, Robert J; FitzGerald, Liesel M; Kibel, Adam S; Drake, Bettina F; Vega, Ana; Gómez-Caamaño, Antonio; Fachal, Laura; Szulkin, Robert; Eklund, Martin; Kogevinas, Manolis; Llorca, Javier; Castaño-Vinyals, Gemma; Penney, Kathryn L; Stampfer, Meir; Park, Jong Y; Sellers, Thomas A; Lin, Hui-Yi; Stanford, Janet L; Cybulski, Cezary; Wokolorczyk, Dominika; Lubinski, Jan; Ostrander, Elaine A; Geybels, Milan S; Nordestgaard, Børge G; Nielsen, Sune F; Weisher, Maren; Bisbjerg, Rasmus; Røder, Martin Andreas; Iversen, Peter; Brenner, Hermann; Cuk, Katarina; Holleczek, Bernd; Maier, Christiane; Luedeke, Manuel; Schnoeller, Thomas; Kim, Jeri; Logothetis, Christopher J; John, Esther M; Teixeira, Manuel R; Paulo, Paula; Cardoso, Marta; Neuhausen, Susan L; Steele, Linda; Ding, Yuan Chun; De Ruyck, Kim; De Meerleer, Gert; Ost, Piet; Razack, Azad; Lim, Jasmine; Teo, Soo-Hwang; Lin, Daniel W; Newcomb, Lisa F; Lessel, Davor; Gamulin, Marija; Kulis, Tomislav; Kaneva, Radka; Usmani, Nawaid; Slavov, Chavdar; Mitev, Vanio; Parliament, Matthew; Singhal, Sandeep; Claessens, Frank; Joniau, Steven; Van den Broeck, Thomas; Larkin, Samantha; Townsend, Paul A; Aukim-Hastie, Claire; Gago-Dominguez, Manuela; Castelao, Jose Esteban; Martinez, Maria Elena; Roobol, Monique J; Jenster, Guido; van Schaik, Ron H N; Menegaux, Florence; Truong, Thérèse; Koudou, Yves Akoli; Xu, Jianfeng; Khaw, Kay-Tee; Cannon-Albright, Lisa; Pandha, Hardev; Michael, Agnieszka; Kierzek, Andrzej; Thibodeau, Stephen N; McDonnell, Shannon K; Schaid, Daniel J; Lindstrom, Sara; Turman, Constance; Ma, Jing; Hunter, David J; Riboli, Elio; Siddiq, Afshan; Canzian, Federico; Kolonel, Laurence N; Le Marchand, Loic; Hoover, Robert N; Machiela, Mitchell J; Kraft, Peter; Freedman, Matthew; Wiklund, Fredrik; Chanock, Stephen; Henderson, Brian E; Easton, Douglas F; Haiman, Christopher A; Eeles, Rosalind A; Conti, David V; Kote-Jarai, Zsofia

2018-06-11

Prostate cancer is a polygenic disease with a large heritable component. A number of common, low-penetrance prostate cancer risk loci have been identified through GWAS. Here we apply the Bayesian multivariate variable selection algorithm JAM to fine-map 84 prostate cancer susceptibility loci, using summary data from a large European ancestry meta-analysis. We observe evidence for multiple independent signals at 12 regions and 99 risk signals overall. Only 15 original GWAS tag SNPs remain among the catalogue of candidate variants identified; the remainder are replaced by more likely candidates. Biological annotation of our credible set of variants indicates significant enrichment within promoter and enhancer elements, and transcription factor-binding sites, including AR, ERG and FOXA1. In 40 regions at least one variant is colocalised with an eQTL in prostate cancer tissue. The refined set of candidate variants substantially increase the proportion of familial relative risk explained by these known susceptibility regions, which highlights the importance of fine-mapping studies and has implications for clinical risk profiling.

Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease

PubMed Central

Romero-Garmendia, Irati; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora

2018-01-01

The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models. PMID:29748492

Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease.

PubMed

Romero-Garmendia, Irati; Garcia-Etxebarria, Koldo; Hernandez-Vargas, Hector; Santin, Izortze; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora; Bilbao, Jose Ramon

2018-05-10

The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models.

Small-Molecule “BRCA1-Mimetics” Are Antagonists of Estrogen Receptor-α

PubMed Central

Ma, Yongxian; Tomita, York; Preet, Anju; Clarke, Robert; Englund, Erikah; Grindrod, Scott; Nathan, Shyam; De Oliveira, Eliseu; Brown, Milton L.

2014-01-01

Context: Resistance to conventional antiestrogens is a major cause of treatment failure and, ultimately, death in breast cancer. Objective: The objective of the study was to identify small-molecule estrogen receptor (ER)-α antagonists that work differently from tamoxifen and other selective estrogen receptor modulators. Design: Based on in silico screening of a pharmacophore database using a computed model of the BRCA1-ER-α complex (with ER-α liganded to 17β-estradiol), we identified a candidate group of small-molecule compounds predicted to bind to a BRCA1-binding interface separate from the ligand-binding pocket and the coactivator binding site of ER-α. Among 40 candidate compounds, six inhibited estradiol-stimulated ER-α activity by at least 50% in breast carcinoma cells, with IC50 values ranging between 3 and 50 μM. These ER-α inhibitory compounds were further studied by molecular and cell biological techniques. Results: The compounds strongly inhibited ER-α activity at concentrations that yielded little or no nonspecific toxicity, but they produced only a modest inhibition of progesterone receptor activity. Importantly, the compounds blocked proliferation and inhibited ER-α activity about equally well in antiestrogen-sensitive and antiestrogen-resistant breast cancer cells. Representative compounds disrupted the interaction of BRCA1 and ER-α in the cultured cells and blocked the interaction of ER-α with the estrogen response element. However, the compounds had no effect on the total cellular ER-α levels. Conclusions: These findings suggest that we have identified a new class of ER-α antagonists that work differently from conventional antiestrogens (eg, tamoxifen and fulvestrant). PMID:25264941

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

PubMed

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus

PubMed Central

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-01-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function. PMID:25333630

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus.

PubMed

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-09-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function.

In silico epitope mapping and experimental evaluation of the Merozoite Adhesive Erythrocytic Binding Protein (MAEBL) as a malaria vaccine candidate.

PubMed

Cravo, Pedro; Machado, Renato B; Leite, Juliana A; Leda, Taizy; Suwanarusk, Rossarin; Bittencourt, Najara; Albrecht, Letusa; Judice, Carla; Lopes, Stefanie C P; Lacerda, Marcus V G; Ferreira, Marcelo U; Soares, Irene S; Goh, Yun Shan; Bargieri, Daniel Y; Nosten, François; Russell, Bruce; Rénia, Laurent; Costa, Fabio T M

2018-01-10

Technical limitations for culturing the human malaria parasite Plasmodium vivax have impaired the discovery of vaccine candidates, challenging the malaria eradication agenda. The immunogenicity of the M2 domain of the Merozoite Adhesive Erythrocytic Binding Protein (MAEBL) antigen cloned from the Plasmodium yoelii murine parasite, has been previously demonstrated. Detailed epitope mapping of MAEBL through immunoinformatics identified several MHCI, MHCII and B cell epitopes throughout the peptide, with several of these lying in the M2 domain and being conserved between P. vivax, P. yoelii and Plasmodium falciparum, hinting that the M2-MAEBL is pan-reactive. This hypothesis was tested through functional assays, showing that P. yoelii M2-MAEBL antisera are able to recognize and inhibit erythrocyte invasion from both P. falciparum and P. vivax parasites isolated from Thai patients, in ex vivo assays. Moreover, the sequence of the M2-MAEBL is shown to be highly conserved between P. vivax isolates from the Amazon and Thailand, indicating that the MAEBL antigen may constitute a vaccine candidate outwitting strain-specific immunity. The MAEBL antigen is promising candidate towards the development of a malaria vaccine.

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones.

PubMed

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid ( Ectropis grisescens ), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E . grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E . grisescens . After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens , including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E . grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E . grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species.

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones

PubMed Central

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid (Ectropis grisescens), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E. grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E. grisescens. After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens, including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E. grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E. grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species. PMID:29209233

Investigation of the inhibitors of histone-lysine N-methyltransferase SETD2 for acute lymphoblastic leukaemia from traditional Chinese medicine.

PubMed

Chang, Y-L; Chen, H-Y; Chen, K-B; Chen, K-C; Chang, K-L; Chang, P-C; Chang, T-T; Chen, Y-C

2016-07-01

Leukaemia is the leading cause of childhood malignancies. Recent research indicates that the SETD2 gene is associated with acute lymphoblastic leukaemia. This study aims to identify potential lead compounds from traditional Chinese medicine (TCM) using virtual screening for SET domain containing 2 (SETD2) protein against acute lymphoblastic leukaemia. Docking simulation was performed to determine potential candidates which obtain suitable docking poses in the binding domain of the SETD2 protein. We also performed molecular dynamics (MD) simulation to investigate the stability of docking poses of SETD2 protein complexes with the top three TCM candidates and a control. According to the results of docking and MD simulation, coniselin and coniferyl ferulate have high binding affinity and stable interactions with the SETD2 protein. Coniselin is isolated from the alcoholic extract of Comiselinum vaginatum Thell. Coniferyl ferulate can be isolated from Angelica sinensis, Poria cocos (Schw.) Wolf, and Notopterygium forbesii. Although S-adenosyl-L-homocysteine has more stable interactions with key residues in the binding domain than coniselin and coniferyl ferulate during MD simulation, the TCM compounds coniselin and coniferyl ferulate are still potential candidates as lead compounds for further study in the drug development process with the SETD2 protein against acute lymphoblastic leukaemia.

Mutations in a CCHC zinc-binding motif of the reovirus sigma 3 protein decrease its intracellular stability.

PubMed Central

Mabrouk, T; Lemay, G

1994-01-01

It has been demonstrated that the sigma 3 protein of reovirus harbors a zinc-binding domain in its amino-terminal portion. A putative zinc finger in the CCHH form is located in this domain and was considered to be a good candidate for the zinc-binding motif. We performed site-directed mutagenesis to substitute amino acids in this region and demonstrated that many of these mutants, although expressed in COS cells, were unstable compared with the wild-type protein. Further analysis revealed that zinc-binding capability, as measured by retention on a zinc chelate affinity adsorbent, correlates with stability. These studies also allowed us to identify a CCHC box as the most probable zinc-binding motif. Images PMID:8035527

A data-mining approach to rank candidate protein-binding partners-The case of biogenesis of lysosome-related organelles complex-1 (BLOC-1).

PubMed

Rodriguez-Fernandez, I A; Dell'Angelica, E C

2009-04-01

The study of protein-protein interactions is a powerful approach to uncovering the molecular function of gene products associated with human disease. Protein-protein interaction data are accumulating at an unprecedented pace owing to interactomics projects, although it has been recognized that a significant fraction of these data likely represents false positives. During our studies of biogenesis of lysosome-related organelles complex-1 (BLOC-1), a protein complex involved in protein trafficking and containing the products of genes mutated in Hermansky-Pudlak syndrome, we faced the problem of having too many candidate binding partners to pursue experimentally. In this work, we have explored ways of efficiently gathering high-quality information about candidate binding partners and presenting the information in a visually friendly manner. We applied the approach to rank 70 candidate binding partners of human BLOC-1 and 102 candidates of its counterpart from Drosophila melanogaster. The top candidate for human BLOC-1 was the small GTPase encoded by the RAB11A gene, which is a paralogue of the Rab38 and Rab32 proteins in mammals and the lightoid gene product in flies. Interestingly, genetic analyses in D. melanogaster uncovered a synthetic sick/lethal interaction between Rab11 and lightoid. The data-mining approach described herein can be customized to study candidate binding partners for other proteins or possibly candidates derived from other types of 'omics' data.

Identification of AOSC-binding proteins in neurons

NASA Astrophysics Data System (ADS)

Liu, Ming; Nie, Qin; Xin, Xianliang; Geng, Meiyu

2008-11-01

Acidic oligosaccharide sugar chain (AOSC), a D-mannuronic acid oligosaccharide, derived from brown algae polysaccharide, has been completed Phase I clinical trial in China as an anti-Alzheimer’s Disease (AD) drug candidate. The identification of AOSC-binding protein(s) in neurons is very important for understanding its action mechanism. To determine the binding protein(s) of AOSC in neurons mediating its anti-AD activities, confocal microscopy, affinity chromatography, and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis were used. Confocal microscopy analysis shows that AOSC binds to SH-SY5Y cells in concentration-, time-, and temperature-dependent fashions. The AOSC binding proteins were purified by affinity chromatography and identified by LC-MS/MS analysis. The results showed that there are 349 proteins binding AOSC, including clathrin, adaptor protein-2 (AP-2) and amyloid precursor protein (APP). These results suggest that the binding/entrance of AOSC to neurons is probably responsible for anti-AD activities.

A novel integrated framework and improved methodology of computer-aided drug design.

PubMed

Chen, Calvin Yu-Chian

2013-01-01

Computer-aided drug design (CADD) is a critical initiating step of drug development, but a single model capable of covering all designing aspects remains to be elucidated. Hence, we developed a drug design modeling framework that integrates multiple approaches, including machine learning based quantitative structure-activity relationship (QSAR) analysis, 3D-QSAR, Bayesian network, pharmacophore modeling, and structure-based docking algorithm. Restrictions for each model were defined for improved individual and overall accuracy. An integration method was applied to join the results from each model to minimize bias and errors. In addition, the integrated model adopts both static and dynamic analysis to validate the intermolecular stabilities of the receptor-ligand conformation. The proposed protocol was applied to identifying HER2 inhibitors from traditional Chinese medicine (TCM) as an example for validating our new protocol. Eight potent leads were identified from six TCM sources. A joint validation system comprised of comparative molecular field analysis, comparative molecular similarity indices analysis, and molecular dynamics simulation further characterized the candidates into three potential binding conformations and validated the binding stability of each protein-ligand complex. The ligand pathway was also performed to predict the ligand "in" and "exit" from the binding site. In summary, we propose a novel systematic CADD methodology for the identification, analysis, and characterization of drug-like candidates.

Deciphering the pharmacological mechanism of the Chinese formula Huanglian-Jie-Du decoction in the treatment of ischemic stroke using a systems biology-based strategy

PubMed Central

Zhang, Yan-qiong; Wang, Song-song; Zhu, Wei-liang; Ma, Yan; Zhang, Fang-bo; Liang, Ri-xin; Xu, Hai-yu; Yang, Hong-jun

2015-01-01

Aim: Huanglian-Jie-Du decoction (HLJDD) is an important multiherb remedy in TCM, which is recently demonstrated to be effective to treat ischemic stroke. Here, we aimed to investigate the pharmacological mechanisms of HLJDD in the treatment of ischemic stroke using systems biology approaches. Methods: Putative targets of HLJDD were predicted using MetaDrug. An interaction network of putative HLJDD targets and known therapeutic targets for the treatment of ischemic stroke was then constructed, and candidate HLJDD targets were identified by calculating topological features, including 'Degree', 'Node-betweenness', 'Closeness', and 'K-coreness'. The binding efficiencies of the candidate HLJDD targets with the corresponding compositive compounds were further validated by a molecular docking simulation. Results: A total of 809 putative targets were obtained for 168 compositive compounds in HLJDD. Additionally, 39 putative targets were common to all four herbs of HLJDD. Next, 49 major nodes were identified as candidate HLJDD targets due to their network topological importance. The enrichment analysis based on the Gene Ontology (GO) annotation system and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway demonstrated that candidate HLJDD targets were more frequently involved in G-protein-coupled receptor signaling pathways, neuroactive ligand-receptor interactions and gap junctions, which all played important roles in the progression of ischemic stroke. Finally, the molecular docking simulation showed that 170 pairs of chemical components and candidate HLJDD targets had strong binding efficiencies. Conclusion: This study has developed for the first time a comprehensive systems approach integrating drug target prediction, network analysis and molecular docking simulation to reveal the relationships between the herbs contained in HLJDD and their putative targets and ischemic stroke-related pathways. PMID:25937634

Epigenetic functions enriched in transcription factors binding to mouse recombination hotspots.

PubMed

Wu, Min; Kwoh, Chee-Keong; Przytycka, Teresa M; Li, Jing; Zheng, Jie

2012-06-21

The regulatory mechanism of recombination is a fundamental problem in genomics, with wide applications in genome-wide association studies, birth-defect diseases, molecular evolution, cancer research, etc. In mammalian genomes, recombination events cluster into short genomic regions called "recombination hotspots". Recently, a 13-mer motif enriched in hotspots is identified as a candidate cis-regulatory element of human recombination hotspots; moreover, a zinc finger protein, PRDM9, binds to this motif and is associated with variation of recombination phenotype in human and mouse genomes, thus is a trans-acting regulator of recombination hotspots. However, this pair of cis and trans-regulators covers only a fraction of hotspots, thus other regulators of recombination hotspots remain to be discovered. In this paper, we propose an approach to predicting additional trans-regulators from DNA-binding proteins by comparing their enrichment of binding sites in hotspots. Applying this approach on newly mapped mouse hotspots genome-wide, we confirmed that PRDM9 is a major trans-regulator of hotspots. In addition, a list of top candidate trans-regulators of mouse hotspots is reported. Using GO analysis we observed that the top genes are enriched with function of histone modification, highlighting the epigenetic regulatory mechanisms of recombination hotspots.

Epigenetic functions enriched in transcription factors binding to mouse recombination hotspots

PubMed Central

2012-01-01

The regulatory mechanism of recombination is a fundamental problem in genomics, with wide applications in genome-wide association studies, birth-defect diseases, molecular evolution, cancer research, etc. In mammalian genomes, recombination events cluster into short genomic regions called "recombination hotspots". Recently, a 13-mer motif enriched in hotspots is identified as a candidate cis-regulatory element of human recombination hotspots; moreover, a zinc finger protein, PRDM9, binds to this motif and is associated with variation of recombination phenotype in human and mouse genomes, thus is a trans-acting regulator of recombination hotspots. However, this pair of cis and trans-regulators covers only a fraction of hotspots, thus other regulators of recombination hotspots remain to be discovered. In this paper, we propose an approach to predicting additional trans-regulators from DNA-binding proteins by comparing their enrichment of binding sites in hotspots. Applying this approach on newly mapped mouse hotspots genome-wide, we confirmed that PRDM9 is a major trans-regulator of hotspots. In addition, a list of top candidate trans-regulators of mouse hotspots is reported. Using GO analysis we observed that the top genes are enriched with function of histone modification, highlighting the epigenetic regulatory mechanisms of recombination hotspots. PMID:22759569

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Genomic Region Containing Toll-Like Receptor Genes Has a Major Impact on Total IgM Antibodies Including KLH-Binding IgM Natural Antibodies in Chickens

PubMed Central

Berghof, Tom V. L.; Visker, Marleen H. P. W.; Arts, Joop A. J.; Parmentier, Henk K.; van der Poel, Jan J.; Vereijken, Addie L. J.; Bovenhuis, Henk

2018-01-01

Natural antibodies (NAb) are antigen binding antibodies present in individuals without a previous exposure to this antigen. Keyhole limpet hemocyanin (KLH)-binding NAb levels were previously associated with survival in chickens. This suggests that selective breeding for KLH-binding NAb may increase survival by means of improved general disease resistance. Genome-wide association studies (GWAS) were performed to identify genes underlying genetic variation in NAb levels. The studied population consisted of 1,628 adolescent layer chickens with observations for titers of KLH-binding NAb of the isotypes IgM, IgA, IgG, the total KLH-binding (IgT) NAb titers, total antibody concentrations of the isotypes IgM, IgA, IgG, and the total antibodies concentration in plasma. GWAS were performed using 57,636 single-nucleotide polymorphisms (SNP). One chromosomal region on chromosome 4 was associated with KLH-binding IgT NAb, and total IgM concentration, and especially with KLH-binding IgM NAb. The region of interest was fine mapped by imputing the region of the study population to whole genome sequence, and subsequently performing an association study using the imputed sequence variants. 16 candidate genes were identified, of which FAM114A1, Toll-like receptor 1 family member B (TLR1B), TLR1A, Krüppel-like factor 3 (KLF3) showed the strongest associations. SNP located in coding regions of the candidate genes were checked for predicted changes in protein functioning. One SNP (at 69,965,939 base pairs) received the maximum impact score from two independent prediction tools, which makes this SNP the most likely causal variant. This SNP is located in TLR1A, which suggests a fundamental role of TLR1A on regulation of IgM levels (i.e., KLH-binding IgM NAb, and total IgM concentration), or B cells biology, or both. This study contributes to increased understanding of (genetic) regulation of KLH-binding NAb levels, and total antibody concentrations. PMID:29375555

In Silico Detection of Sequence Variations Modifying Transcriptional Regulation

PubMed Central

Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob

2008-01-01

Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319

Combining Machine Learning Systems and Multiple Docking Simulation Packages to Improve Docking Prediction Reliability for Network Pharmacology

PubMed Central

Hsin, Kun-Yi; Ghosh, Samik; Kitano, Hiroaki

2013-01-01

Increased availability of bioinformatics resources is creating opportunities for the application of network pharmacology to predict drug effects and toxicity resulting from multi-target interactions. Here we present a high-precision computational prediction approach that combines two elaborately built machine learning systems and multiple molecular docking tools to assess binding potentials of a test compound against proteins involved in a complex molecular network. One of the two machine learning systems is a re-scoring function to evaluate binding modes generated by docking tools. The second is a binding mode selection function to identify the most predictive binding mode. Results from a series of benchmark validations and a case study show that this approach surpasses the prediction reliability of other techniques and that it also identifies either primary or off-targets of kinase inhibitors. Integrating this approach with molecular network maps makes it possible to address drug safety issues by comprehensively investigating network-dependent effects of a drug or drug candidate. PMID:24391846

The mRNA-bound proteome of the early fly embryo

PubMed Central

Wessels, Hans-Hermann; Imami, Koshi; Baltz, Alexander G.; Kolinski, Marcin; Beldovskaya, Anastasia; Selbach, Matthias; Small, Stephen; Ohler, Uwe; Landthaler, Markus

2016-01-01

Early embryogenesis is characterized by the maternal to zygotic transition (MZT), in which maternally deposited messenger RNAs are degraded while zygotic transcription begins. Before the MZT, post-transcriptional gene regulation by RNA-binding proteins (RBPs) is the dominant force in embryo patterning. We used two mRNA interactome capture methods to identify RBPs bound to polyadenylated transcripts within the first 2 h of Drosophila melanogaster embryogenesis. We identified a high-confidence set of 476 putative RBPs and confirmed RNA-binding activities for most of 24 tested candidates. Most proteins in the interactome are known RBPs or harbor canonical RBP features, but 99 exhibited previously uncharacterized RNA-binding activity. mRNA-bound RBPs and TFs exhibit distinct expression dynamics, in which the newly identified RBPs dominate the first 2 h of embryonic development. Integrating our resource with in situ hybridization data from existing databases showed that mRNAs encoding RBPs are enriched in posterior regions of the early embryo, suggesting their general importance in posterior patterning and germ cell maturation. PMID:27197210

Functional Variants at the 11q13 Risk Locus for Breast Cancer Regulate Cyclin D1 Expression through Long-Range Enhancers

PubMed Central

French, Juliet D.; Ghoussaini, Maya; Edwards, Stacey L.; Meyer, Kerstin B.; Michailidou, Kyriaki; Ahmed, Shahana; Khan, Sofia; Maranian, Mel J.; O’Reilly, Martin; Hillman, Kristine M.; Betts, Joshua A.; Carroll, Thomas; Bailey, Peter J.; Dicks, Ed; Beesley, Jonathan; Tyrer, Jonathan; Maia, Ana-Teresa; Beck, Andrew; Knoblauch, Nicholas W.; Chen, Constance; Kraft, Peter; Barnes, Daniel; González-Neira, Anna; Alonso, M. Rosario; Herrero, Daniel; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Luccarini, Craig; Baynes, Caroline; Conroy, Don; Dennis, Joe; Bolla, Manjeet K.; Wang, Qin; Hopper, John L.; Southey, Melissa C.; Schmidt, Marjanka K.; Broeks, Annegien; Verhoef, Senno; Cornelissen, Sten; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A.; Loehberg, Christian R.; Ekici, Arif B.; Beckmann, Matthias W.; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Aitken, Zoe; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Milne, Roger L.; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Benitez, Javier; Anton-Culver, Hoda; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Lichtner, Peter; Schmutzler, Rita K.; Engel, Christoph; Brauch, Hiltrud; Hamann, Ute; Justenhoven, Christina; Aaltonen, Kirsimari; Heikkilä, Päivi; Aittomäki, Kristiina; Blomqvist, Carl; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Lambrechts, Diether; Peeters, Stephanie; Smeets, Ann; Floris, Giuseppe; Chang-Claude, Jenny; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Sardella, Domenico; Couch, Fergus J.; Wang, Xianshu; Pankratz, Vernon S.; Lee, Adam; Giles, Graham G.; Severi, Gianluca; Baglietto, Laura; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; Ng, Char-Hong; Vithana, Eranga Nishanthie; Kristensen, Vessela; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Devilee, Peter; Seynaeve, Caroline; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Czene, Kamila; Klevebring, Daniel; Schoof, Nils; Hooning, Maartje J.; Martens, John W.M.; Collée, J. Margriet; Tilanus-Linthorst, Madeleine; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Balasubramanian, Sabapathy P.; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Pharoah, Paul D.P.; Healey, Catherine S.; Shah, Mitul; Pooley, Karen A.; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Sng, Jen-Hwei; Sim, Xueling; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; McKay, James; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Godwin, Andrew K.; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Chen, Shou-Tung; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; Ponder, Bruce A.J.; Nevanlinna, Heli; Brown, Melissa A.; Chenevix-Trench, Georgia; Easton, Douglas F.; Dunning, Alison M.

2013-01-01

Analysis of 4,405 variants in 89,050 European subjects from 41 case-control studies identified three independent association signals for estrogen-receptor-positive tumors at 11q13. The strongest signal maps to a transcriptional enhancer element in which the G allele of the best candidate causative variant rs554219 increases risk of breast cancer, reduces both binding of ELK4 transcription factor and luciferase activity in reporter assays, and may be associated with low cyclin D1 protein levels in tumors. Another candidate variant, rs78540526, lies in the same enhancer element. Risk association signal 2, rs75915166, creates a GATA3 binding site within a silencer element. Chromatin conformation studies demonstrate that these enhancer and silencer elements interact with each other and with their likely target gene, CCND1. PMID:23540573

Preliminary selection and evaluation of the binding of aptamers against a Hantavirus antigen using fluorescence spectroscopy and modeling

NASA Astrophysics Data System (ADS)

Missailidis, Sotiris; de Oliveira, Renata Carvalho; Silva, Dilson; Cortez, Célia Martins; Guterres, Alexandro; Vicente, Luciana Helena Bassan; de Godoy, Daniela Tupy; Lemos, Elba

2015-12-01

In this study we have aimed to develop novel aptamers against the Hantavirus nucleoprotein N, a valid antigen already used in the Hantavirus reference laboratory of the Institute Oswaldo Cruz in Rio de Janeiro, Brazil. Such aptamers, if they are found to bind with high affinity and specificity for the selected hantavirus antigen, they could be translated into novel diagnostic assays with the ability to provide early detection for hantaviroses and their related disease syndromes. In a preliminary screening, we have managed to identify three aptamer species. We have analyzed a short and a long version of these aptamer using fluorescence spectroscopy and modelled their binding. We have identified Stern-Volmer constants for the selected aptamers, which have shown affinity for their target, with a different binding between the short and the long versions of them. Short aptamers have shown to have a higher Stern-Volmer constant and the ability to potentially bind to more than one binding site on the antigen. The information provided by the spectroscopic screening has been invaluable in allowing us to define candidates for further development into diagnostic assays.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

A yeast functional screen predicts new candidate ALS disease genes

PubMed Central

Couthouis, Julien; Hart, Michael P.; Shorter, James; DeJesus-Hernandez, Mariely; Erion, Renske; Oristano, Rachel; Liu, Annie X.; Ramos, Daniel; Jethava, Niti; Hosangadi, Divya; Epstein, James; Chiang, Ashley; Diaz, Zamia; Nakaya, Tadashi; Ibrahim, Fadia; Kim, Hyung-Jun; Solski, Jennifer A.; Williams, Kelly L.; Mojsilovic-Petrovic, Jelena; Ingre, Caroline; Boylan, Kevin; Graff-Radford, Neill R.; Dickson, Dennis W.; Clay-Falcone, Dana; Elman, Lauren; McCluskey, Leo; Greene, Robert; Kalb, Robert G.; Lee, Virginia M.-Y.; Trojanowski, John Q.; Ludolph, Albert; Robberecht, Wim; Andersen, Peter M.; Nicholson, Garth A.; Blair, Ian P.; King, Oliver D.; Bonini, Nancy M.; Van Deerlin, Vivianna; Rademakers, Rosa; Mourelatos, Zissimos; Gitler, Aaron D.

2011-01-01

Amyotrophic lateral sclerosis (ALS) is a devastating and universally fatal neurodegenerative disease. Mutations in two related RNA-binding proteins, TDP-43 and FUS, that harbor prion-like domains, cause some forms of ALS. There are at least 213 human proteins harboring RNA recognition motifs, including FUS and TDP-43, raising the possibility that additional RNA-binding proteins might contribute to ALS pathogenesis. We performed a systematic survey of these proteins to find additional candidates similar to TDP-43 and FUS, followed by bioinformatics to predict prion-like domains in a subset of them. We sequenced one of these genes, TAF15, in patients with ALS and identified missense variants, which were absent in a large number of healthy controls. These disease-associated variants of TAF15 caused formation of cytoplasmic foci when expressed in primary cultures of spinal cord neurons. Very similar to TDP-43 and FUS, TAF15 aggregated in vitro and conferred neurodegeneration in Drosophila, with the ALS-linked variants having a more severe effect than wild type. Immunohistochemistry of postmortem spinal cord tissue revealed mislocalization of TAF15 in motor neurons of patients with ALS. We propose that aggregation-prone RNA-binding proteins might contribute very broadly to ALS pathogenesis and the genes identified in our yeast functional screen, coupled with prion-like domain prediction analysis, now provide a powerful resource to facilitate ALS disease gene discovery. PMID:22065782

Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ

NASA Astrophysics Data System (ADS)

Bolla, Jani Reddy; Sauer, Joshua B.; Wu, Di; Mehmood, Shahid; Allison, Timothy M.; Robinson, Carol V.

2018-03-01

Translocation of lipid II across the cytoplasmic membrane is essential in peptidoglycan biogenesis. Although most steps are understood, identifying the lipid II flippase has yielded conflicting results, and the lipid II binding properties of two candidate flippases—MurJ and FtsW—remain largely unknown. Here we apply native mass spectrometry to both proteins and characterize lipid II binding. We observed lower levels of lipid II binding to FtsW compared to MurJ, consistent with MurJ having a higher affinity. Site-directed mutagenesis of MurJ suggests that mutations at A29 and D269 attenuate lipid II binding to MurJ, whereas chemical modification of A29 eliminates binding. The antibiotic ramoplanin dissociates lipid II from MurJ, whereas vancomycin binds to form a stable complex with MurJ:lipid II. Furthermore, we reveal cardiolipins associate with MurJ but not FtsW, and exogenous cardiolipins reduce lipid II binding to MurJ. These observations provide insights into determinants of lipid II binding to MurJ and suggest roles for endogenous lipids in regulating substrate binding.

Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

PubMed

Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

2017-08-01

The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

Comparative genomics of bacterial zinc regulons: enhanced ion transport, pathogenesis, and rearrangement of ribosomal proteins.

PubMed

Panina, Ekaterina M; Mironov, Andrey A; Gelfand, Mikhail S

2003-08-19

Zinc is an important component of many proteins, but in large concentrations it is poisonous to the cell. Thus its transport is regulated by zinc repressors ZUR of proteobacteria and Gram-positive bacteria from the Bacillus group and AdcR of bacteria from the Streptococcus group. Comparative computational analysis allowed us to identify binding signals of ZUR repressors GAAATGTTATANTATAACATTTC for gamma-proteobacteria, GTAATGTAATAACATTAC for the Agrobacterium group, GATATGTTATAACATATC for the Rhododoccus group, TAAATCGTAATNATTACGATTTA for Gram-positive bacteria, and TTAACYRGTTAA of the streptococcal AdcR repressor. In addition to known transporters and their paralogs, zinc regulons were predicted to contain a candidate component of the ATP binding cassette, zinT (b1995 in Escherichia coli and yrpE in Bacillus subtilis). Candidate AdcR-binding sites were identified upstream of genes encoding pneumococcal histidine triad (PHT) proteins from a number of pathogenic streptococci. Protein functional analysis of this family suggests that PHT proteins are involved in the invasion process. Finally, repression by zinc was predicted for genes encoding a variety of paralogs of ribosomal proteins. The original copies of all these proteins contain zinc-ribbon motifs and thus likely bind zinc, whereas these motifs are destroyed in zinc-regulated paralogs. We suggest that the induction of these paralogs in conditions of zinc starvation leads to their incorporation in a fraction of ribosomes instead of the original ribosomal proteins; the latter are then degraded with subsequent release of some zinc for the utilization by other proteins. Thus we predict a mechanism for maintaining zinc availability for essential enzymes.

Methods for Identifying Ligands that Target Nucleic Acid Molecules and Nucleic Acid Structural Motifs

NASA Technical Reports Server (NTRS)

Childs-Disney, Jessica L. (Inventor); Disney, Matthew D. (Inventor)

2017-01-01

Disclosed are methods for identifying a nucleic acid (e.g., RNA, DNA, etc.) motif which interacts with a ligand. The method includes providing a plurality of ligands immobilized on a support, wherein each particular ligand is immobilized at a discrete location on the support; contacting the plurality of immobilized ligands with a nucleic acid motif library under conditions effective for one or more members of the nucleic acid motif library to bind with the immobilized ligands; and identifying members of the nucleic acid motif library that are bound to a particular immobilized ligand. Also disclosed are methods for selecting, from a plurality of candidate ligands, one or more ligands that have increased likelihood of binding to a nucleic acid molecule comprising a particular nucleic acid motif, as well as methods for identifying a nucleic acid which interacts with a ligand.

Analyses of Interactions Between Heparin and the Apical Surface Proteins of Plasmodium falciparum

NASA Astrophysics Data System (ADS)

Kobayashi, Kyousuke; Takano, Ryo; Takemae, Hitoshi; Sugi, Tatsuki; Ishiwa, Akiko; Gong, Haiyan; Recuenco, Frances C.; Iwanaga, Tatsuya; Horimoto, Taisuke; Akashi, Hiroomi; Kato, Kentaro

2013-11-01

Heparin, a sulfated glycoconjugate, reportedly inhibits the blood-stage growth of the malaria parasite Plasmodium falciparum. Elucidation of the inhibitory mechanism is valuable for developing novel invasion-blocking treatments based on heparin. Merozoite surface protein 1 has been reported as a candidate target of heparin; however, to better understand the molecular mechanisms involved, we characterized the molecules that bind to heparin during merozoite invasion. Here, we show that heparin binds only at the apical tip of the merozoite surface and that multiple heparin-binding proteins localize preferentially in the apical organelles. To identify heparin-binding proteins, parasite proteins were fractionated by means of heparin affinity chromatography and subjected to immunoblot analysis with ligand-specific antibodies. All tested members of the Duffy and reticulocyte binding-like families bound to heparin with diverse affinities. These findings suggest that heparin masks the apical surface of merozoites and blocks interaction with the erythrocyte membrane after initial attachment.

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

PubMed Central

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

PubMed

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Haploinsufficiency of TAB2 Causes Congenital Heart Defects in Humans

PubMed Central

Thienpont, Bernard; Zhang, Litu; Postma, Alex V.; Breckpot, Jeroen; Tranchevent, Léon-Charles; Van Loo, Peter; Møllgård, Kjeld; Tommerup, Niels; Bache, Iben; Tümer, Zeynep; van Engelen, Klaartje; Menten, Björn; Mortier, Geert; Waggoner, Darrel; Gewillig, Marc; Moreau, Yves; Devriendt, Koen; Larsen, Lars Allan

2010-01-01

Congenital heart defects (CHDs) are the most common major developmental anomalies and the most frequent cause for perinatal mortality, but their etiology remains often obscure. We identified a locus for CHDs on 6q24-q25. Genotype-phenotype correlations in 12 patients carrying a chromosomal deletion on 6q delineated a critical 850 kb region on 6q25.1 harboring five genes. Bioinformatics prioritization of candidate genes in this locus for a role in CHDs identified the TGF-β-activated kinase 1/MAP3K7 binding protein 2 gene (TAB2) as the top-ranking candidate gene. A role for this candidate gene in cardiac development was further supported by its conserved expression in the developing human and zebrafish heart. Moreover, a critical, dosage-sensitive role during development was demonstrated by the cardiac defects observed upon titrated knockdown of tab2 expression in zebrafish embryos. To definitively confirm the role of this candidate gene in CHDs, we performed mutation analysis of TAB2 in 402 patients with a CHD, which revealed two evolutionarily conserved missense mutations. Finally, a balanced translocation was identified, cosegregating with familial CHD. Mapping of the breakpoints demonstrated that this translocation disrupts TAB2. Taken together, these data clearly demonstrate a role for TAB2 in human cardiac development. PMID:20493459

Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

PubMed Central

Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

2016-01-01

A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

Method of identity analyte-binding peptides

DOEpatents

Kauvar, Lawrence M.

1990-01-01

A method for affinity chromatography or adsorption of a designated analyte utilizes a paralog as the affinity partner. The immobilized paralog can be used in purification or analysis of the analyte; the paralog can also be used as a substitute for antibody in an immunoassay. The paralog is identified by screening candidate peptide sequences of 4-20 amino acids for specific affinity to the analyte.

Conformational stability and aggregation of therapeutic monoclonal antibodies studied with ANS and Thioflavin T binding.

PubMed

Kayser, Veysel; Chennamsetty, Naresh; Voynov, Vladimir; Helk, Bernhard; Trout, Bernhardt L

2011-01-01

Characterization of aggregation profiles of monoclonal antibodies (mAb) is gaining importance because an increasing number of mAb-based therapeutics are entering clinical studies and gaining marketing approval. To develop a successful formulation, it is imperative to identify the critical biochemical properties of each potential mAb drug candidate. We investigated the conformational change and aggregation of a human IgG1 using external dye-binding experiments with fluorescence spectroscopy and compared the aggregation profiles obtained to the results of size-exclusion chromatography. We show that using an appropriate dye at selected mAb concentration, unfolding or aggregation can be studied. In addition, dye-binding experiments may be used as conventional assays to study therapeutic mAb stability.

Identification of candidate transcription factor binding sites in the cattle genome

USDA-ARS?s Scientific Manuscript database

A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...

Computational screening of functional groups for capture of toxic industrial chemicals in porous materials.

PubMed

Kim, Ki Chul; Fairen-Jimenez, David; Snurr, Randall Q

2017-12-06

A thermodynamic analysis using quantum chemical methods was carried out to identify optimal functional group candidates that can be included in metal-organic frameworks and activated carbons for the selective capture of toxic industrial chemicals (TICs) in humid air. We calculated the binding energies of 14 critical TICs plus water with a series of 10 functional groups attached to a naphthalene ring model. Using vibrational calculations, the free energies of adsorption were calculated in addition to the binding energies. Our results show that, in these systems, the binding energies and free energies follow similar trends. We identified copper(i) carboxylate as the optimal functional group (among those studied) for the selective binding of the majority of the TICs in humid air, and this functional group exhibits especially strong binding for sulfuric acid. Further thermodynamic analysis shows that the presence of water weakens the binding strength of sulfuric acid with the copper carboxylate group. Our calculations predict that functionalization of aromatic rings would be detrimental to selective capture of COCl 2 , CO 2 , and Cl 2 under humid conditions. Finally, we found that forming an ionic complex, H 3 O + HSO 4 - , between H 2 SO 4 and H 2 O via proton transfer is not favorable on copper carboxylate.

High-Throughput Screens To Identify Autophagy Inducers That Function by Disrupting Beclin 1/Bcl-2 Binding.

PubMed

Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth

2018-06-21

Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.

High-throughput screening using the differential radial capillary action of ligand assay identifies ebselen as an inhibitor of diguanylate cyclases.

PubMed

Lieberman, Ori J; Orr, Mona W; Wang, Yan; Lee, Vincent T

2014-01-17

The rise of bacterial resistance to traditional antibiotics has motivated recent efforts to identify new drug candidates that target virulence factors or their regulatory pathways. One such antivirulence target is the cyclic-di-GMP (cdiGMP) signaling pathway, which regulates biofilm formation, motility, and pathogenesis. Pseudomonas aeruginosa is an important opportunistic pathogen that utilizes cdiGMP-regulated polysaccharides, including alginate and pellicle polysaccharide (PEL), to mediate virulence and antibiotic resistance. CdiGMP activates PEL and alginate biosynthesis by binding to specific receptors including PelD and Alg44. Mutations that abrogate cdiGMP binding to these receptors prevent polysaccharide production. Identification of small molecules that can inhibit cdiGMP binding to the allosteric sites on these proteins could mimic binding defective mutants and potentially reduce biofilm formation or alginate secretion. Here, we report the development of a rapid and quantitative high-throughput screen for inhibitors of protein-cdiGMP interactions based on the differential radial capillary action of ligand assay (DRaCALA). Using this approach, we identified ebselen as an inhibitor of cdiGMP binding to receptors containing an RxxD domain including PelD and diguanylate cyclases (DGC). Ebselen reduces diguanylate cyclase activity by covalently modifying cysteine residues. Ebselen oxide, the selenone analogue of ebselen, also inhibits cdiGMP binding through the same covalent mechanism. Ebselen and ebselen oxide inhibit cdiGMP regulation of biofilm formation and flagella-mediated motility in P. aeruginosa through inhibition of diguanylate cyclases. The identification of ebselen provides a proof-of-principle that a DRaCALA high-throughput screening approach can be used to identify bioactive agents that reverse regulation of cdiGMP signaling by targeting cdiGMP-binding domains.

Characterization of the Organic Component of Low-Molecular-Weight Chromium-Binding Substance and Its Binding of Chromium123

PubMed Central

Chen, Yuan; Watson, Heather M.; Gao, Junjie; Sinha, Sarmistha Halder; Cassady, Carolyn J.; Vincent, John B.

2011-01-01

Chromium was proposed to be an essential element over 50 y ago and was shown to have therapeutic potential in treating the symptoms of type 2 diabetes; however, its mechanism of action at a molecular level is unknown. One chromium-binding biomolecule, low-molecular weight chromium-binding substance (LMWCr or chromodulin), has been found to be biologically active in in vitro assays and proposed as a potential candidate for the in vivo biologically active form of chromium. Characterization of the organic component of LMWCr has proven difficult. Treating bovine LMWCr with trifluoroacetic acid followed by purification on a graphite powder micro-column generates a heptapeptide fragment of LMWCr. The peptide sequence of the fragment was analyzed by MS and tandem MS (MS/MS and MS/MS/MS) using collision-induced dissociation and post-source decay. Two candidate sequences, pEEEEGDD and pEEEGEDD (where pE is pyroglutamate), were identified from the MS/MS experiments; additional tandem MS suggests the sequence is pEEEEGDD. The N-terminal glutamate residues explain the inability to sequence LMWCr by the Edman method. Langmuir isotherms and Hill plots were used to analyze the binding constants of chromic ions to synthetic peptides similar in composition to apoLMWCr. The sequence pEEEEGDD was found to bind 4 chromic ions per peptide with nearly identical cooperativity and binding constants to those of apoLMWCr. This work should lead to further studies elucidating or eliminating a potential role for LMWCr in treating the symptoms of type 2 diabetes and other conditions resulting from improper carbohydrate and lipid metabolism. PMID:21593351

The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

PubMed

Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

2010-07-01

WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

Immunoinformatic Analysis of Crimean Congo Hemorrhagic Fever Virus Glycoproteins and Epitope Prediction for Synthetic Peptide Vaccine.

PubMed

Tipu, Hamid Nawaz

2016-02-01

To determine the Crimean Congo Hemorrhagic Fever (CCHF) virus M segement glycoprotein's immunoinformatic parameters, and identify Human Leukocyte Antigen (HLA) class I binders as candidates for synthetic peptide vaccines. Cross-sectional study. Combined Military Hospital, Khuzdar Cantt, in May 2015. Data acquisition, antigenicity prediction, secondary and tertiary structure prediction, residue analysis were done using immunoinformatics tools. HLAclass I binders in glycoprotein's sequence were identified at nanomer length using NetMHC 3.4 and mapped onto tertiary structure. Docking was done for strongest binder against its corresponding allele with CABS-dock. HLAA*0101, 0201, 0301, 2402, 2601 and B*0702, 0801, 2705, 3901, 4001, 5801, 1501 were analyzed against two glycoprotein components of the virus. Atotal of 35 nanomers from GP1, and 3 from GP2 were identified. HLAB*0702 bound maximum number of peptides (6), while HLAB*4001 showed strongest binding affinity. HLAspecific glycoproteins epitope prediction can help identify synthetic peptide vaccine candidates.

Antennal transcriptome analysis of the piercing moth Oraesia emarginata (Lepidoptera: Noctuidae)

PubMed Central

Feng, Bo; Guo, Qianshuang; Zheng, Kaidi; Qin, Yuanxia; Du, Yongjun

2017-01-01

The piercing fruit moth Oraesia emarginata is an economically significant pest; however, our understanding of its olfactory mechanisms in infestation is limited. The present study conducted antennal transcriptome analysis of olfactory genes using real-time quantitative reverse transcription PCR analysis (RT-qPCR). We identified a total of 104 candidate chemosensory genes from several gene families, including 35 olfactory receptors (ORs), 41 odorant-binding proteins, 20 chemosensory proteins, 6 ionotropic receptors, and 2 sensory neuron membrane proteins. Seven candidate pheromone receptors (PRs) and 3 candidate pheromone-binding proteins (PBPs) for sex pheromone recognition were found. OemaOR29 and OemaPBP1 had the highest fragments per kb per million fragments (FPKM) values in all ORs and OBPs, respectively. Eighteen olfactory genes were upregulated in females, including 5 candidate PRs, and 20 olfactory genes were upregulated in males, including 2 candidate PRs (OemaOR29 and 4) and 2 PBPs (OemaPBP1 and 3). These genes may have roles in mediating sex-specific behaviors. Most candidate olfactory genes of sex pheromone recognition (except OemaOR29 and OemaPBP3) in O. emarginata were not clustered with those of studied noctuid species (type I pheromone). In addition, OemaOR29 was belonged to cluster PRIII, which comprise proteins that recognize type II pheromones instead of type I pheromones. The structure and function of olfactory genes that encode sex pheromones in O. emarginata might thus differ from those of other studied noctuids. The findings of the present study may help explain the molecular mechanism underlying olfaction and the evolution of olfactory genes encoding sex pheromones in O. emarginata. PMID:28614384

A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

PubMed Central

Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

2017-01-01

Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

PubMed Central

Kong, Hoon Young; Byun, Jonghoe

2015-01-01

Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

Structural insight into exosite binding and discovery of novel exosite inhibitors of botulinum neurotoxin serotype A through in silico screening

NASA Astrophysics Data System (ADS)

Hu, Xin; Legler, Patricia M.; Southall, Noel; Maloney, David J.; Simeonov, Anton; Jadhav, Ajit

2014-07-01

Botulinum neurotoxin serotype A (BoNT/A) is the most lethal toxin among the Tier 1 Select Agents. Development of potent and selective small molecule inhibitors against BoNT/A zinc metalloprotease remains a challenging problem due to its exceptionally large substrate binding surface and conformational plasticity. The exosites of the catalytic domain of BoNT/A are intriguing alternative sites for small molecule intervention, but their suitability for inhibitor design remains largely unexplored. In this study, we employed two recently identified exosite inhibitors, D-chicoric acid and lomofungin, to probe the structural features of the exosites and molecular mechanisms of synergistic inhibition. The results showed that D-chicoric acid favors binding at the α-exosite, whereas lomofungin preferentially binds at the β-exosite by mimicking the substrate β-sheet binding interaction. Molecular dynamics simulations and binding interaction analysis of the exosite inhibitors with BoNT/A revealed key elements and hotspots that likely contribute to the inhibitor binding and synergistic inhibition. Finally, we performed database virtual screening for novel inhibitors of BoNT/A targeting the exosites. Hits C1 and C2 showed non-competitive inhibition and likely target the α- and β-exosites, respectively. The identified exosite inhibitors may provide novel candidates for structure-based development of therapeutics against BoNT/A intoxication.

Structural insight into exosite binding and discovery of novel exosite inhibitors of botulinum neurotoxin serotype A through in silico screening.

PubMed

Hu, Xin; Legler, Patricia M; Southall, Noel; Maloney, David J; Simeonov, Anton; Jadhav, Ajit

2014-07-01

Botulinum neurotoxin serotype A (BoNT/A) is the most lethal toxin among the Tier 1 Select Agents. Development of potent and selective small molecule inhibitors against BoNT/A zinc metalloprotease remains a challenging problem due to its exceptionally large substrate binding surface and conformational plasticity. The exosites of the catalytic domain of BoNT/A are intriguing alternative sites for small molecule intervention, but their suitability for inhibitor design remains largely unexplored. In this study, we employed two recently identified exosite inhibitors, D-chicoric acid and lomofungin, to probe the structural features of the exosites and molecular mechanisms of synergistic inhibition. The results showed that D-chicoric acid favors binding at the α-exosite, whereas lomofungin preferentially binds at the β-exosite by mimicking the substrate β-sheet binding interaction. Molecular dynamics simulations and binding interaction analysis of the exosite inhibitors with BoNT/A revealed key elements and hotspots that likely contribute to the inhibitor binding and synergistic inhibition. Finally, we performed database virtual screening for novel inhibitors of BoNT/A targeting the exosites. Hits C1 and C2 showed non-competitive inhibition and likely target the α- and β-exosites, respectively. The identified exosite inhibitors may provide novel candidates for structure-based development of therapeutics against BoNT/A intoxication.

A 115 kDa calmodulin-binding protein is located in rat liver endosome fractions.

PubMed Central

Enrich, C; Bachs, O; Evans, W H

1988-01-01

The distribution of calmodulin-binding polypeptides in various rat liver subcellular fractions was investigated. Plasma-membrane, endosome, Golgi and lysosome fractions were prepared by established procedures. The calmodulin-binding polypeptides present in the subcellular fractions were identified by using an overlay technique after transfer from gels to nitrocellulose sheets. Distinctive populations of calmodulin-binding polypeptides were present in all the fractions examined except lysosomes. A major 115 kDa calmodulin-binding polypeptide of pI 4.3 was located to the endosome subfractions, and it emerges as a candidate endosome-specific protein. Partitioning of endosome fractions between aqueous and Triton X-114 phases indicated that the calmodulin-binding polypeptide was hydrophobic. Major calmodulin-binding polypeptides of 140 and 240 kDa and minor polypeptides of 40-60 kDa were present in plasma membranes. The distribution of calmodulin in the various endosome and plasma-membrane fractions was also analysed, and the results indicated that the amounts were high compared with those in the cytosol. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3214436

Improved prediction of MHC class I and class II epitopes using a novel Gibbs sampling approach.

PubMed

Nielsen, Morten; Lundegaard, Claus; Worning, Peder; Hvid, Christina Sylvester; Lamberth, Kasper; Buus, Søren; Brunak, Søren; Lund, Ole

2004-06-12

Prediction of which peptides will bind a specific major histocompatibility complex (MHC) constitutes an important step in identifying potential T-cell epitopes suitable as vaccine candidates. MHC class II binding peptides have a broad length distribution complicating such predictions. Thus, identifying the correct alignment is a crucial part of identifying the core of an MHC class II binding motif. In this context, we wish to describe a novel Gibbs motif sampler method ideally suited for recognizing such weak sequence motifs. The method is based on the Gibbs sampling method, and it incorporates novel features optimized for the task of recognizing the binding motif of MHC classes I and II. The method locates the binding motif in a set of sequences and characterizes the motif in terms of a weight-matrix. Subsequently, the weight-matrix can be applied to identifying effectively potential MHC binding peptides and to guiding the process of rational vaccine design. We apply the motif sampler method to the complex problem of MHC class II binding. The input to the method is amino acid peptide sequences extracted from the public databases of SYFPEITHI and MHCPEP and known to bind to the MHC class II complex HLA-DR4(B1*0401). Prior identification of information-rich (anchor) positions in the binding motif is shown to improve the predictive performance of the Gibbs sampler. Similarly, a consensus solution obtained from an ensemble average over suboptimal solutions is shown to outperform the use of a single optimal solution. In a large-scale benchmark calculation, the performance is quantified using relative operating characteristics curve (ROC) plots and we make a detailed comparison of the performance with that of both the TEPITOPE method and a weight-matrix derived using the conventional alignment algorithm of ClustalW. The calculation demonstrates that the predictive performance of the Gibbs sampler is higher than that of ClustalW and in most cases also higher than that of the TEPITOPE method.

Method of identity analyte-binding peptides

DOEpatents

Kauvar, L.M.

1990-10-16

A method for affinity chromatography or adsorption of a designated analyte utilizes a paralog as the affinity partner. The immobilized paralog can be used in purification or analysis of the analyte; the paralog can also be used as a substitute for antibody in an immunoassay. The paralog is identified by screening candidate peptide sequences of 4--20 amino acids for specific affinity to the analyte. 5 figs.

Apoptosis-inducing signal sequence mutation in carbonic anhydrase IV identified in patients with the RP17 form of retinitis pigmentosa

PubMed Central

Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.

2004-01-01

Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652

Drug repurposing to target Ebola virus replication and virulence using structural systems pharmacology.

PubMed

Zhao, Zheng; Martin, Che; Fan, Raymond; Bourne, Philip E; Xie, Lei

2016-02-18

The recent outbreak of Ebola has been cited as the largest in history. Despite this global health crisis, few drugs are available to efficiently treat Ebola infections. Drug repurposing provides a potentially efficient solution to accelerating the development of therapeutic approaches in response to Ebola outbreak. To identify such candidates, we use an integrated structural systems pharmacology pipeline which combines proteome-scale ligand binding site comparison, protein-ligand docking, and Molecular Dynamics (MD) simulation. One thousand seven hundred and sixty-six FDA-approved drugs and 259 experimental drugs were screened to identify those with the potential to inhibit the replication and virulence of Ebola, and to determine the binding modes with their respective targets. Initial screening has identified a number of promising hits. Notably, Indinavir; an HIV protease inhibitor, may be effective in reducing the virulence of Ebola. Additionally, an antifungal (Sinefungin) and several anti-viral drugs (e.g. Maraviroc, Abacavir, Telbivudine, and Cidofovir) may inhibit Ebola RNA-directed RNA polymerase through targeting the MTase domain. Identification of safe drug candidates is a crucial first step toward the determination of timely and effective therapeutic approaches to address and mitigate the impact of the Ebola global crisis and future outbreaks of pathogenic diseases. Further in vitro and in vivo testing to evaluate the anti-Ebola activity of these drugs is warranted.

(CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

PubMed

Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

2005-08-01

Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers

PubMed Central

Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

2014-01-01

AIM To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA). METHODS The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their Kd values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). RESULTS During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their Kd values, DTMRSA4 presented the best binding with a Kd value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. CONCLUSION A total of four aptamers that bind to MRSA were obtained with Kd values ranking from 94 to 200 nmol/L. PMID:25436184

Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.

PubMed

Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

2013-01-01

To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.

Application of proteomics in the discovery of candidate protein biomarkers in a Diabetes Autoantibody Standardization Program (DASP) sample subset

PubMed Central

Metz, Thomas O.; Qian, Wei-Jun; Jacobs, Jon M.; Gritsenko, Marina A.; Moore, Ronald J.; Polpitiya, Ashoka D.; Monroe, Matthew E.; Camp, David G.; Mueller, Patricia W.; Smith, Richard D.

2009-01-01

Novel biomarkers of type 1 diabetes must be identified and validated in initial, exploratory studies before they can be assessed in proficiency evaluations. Currently, untargeted “-omics” approaches are under-utilized in profiling studies of clinical samples. This report describes the evaluation of capillary liquid chromatography (LC) coupled with mass spectrometry (MS) in a pilot proteomic analysis of human plasma and serum from a subset of control and type 1 diabetic individuals enrolled in the Diabetes Autoantibody Standardization Program with the goal of identifying candidate biomarkers of type 1 diabetes. Initial high-resolution capillary LC-MS/MS experiments were performed to augment an existing plasma peptide database, while subsequent LC-FTICR studies identified quantitative differences in the abundance of plasma proteins. Analysis of LC-FTICR proteomic data identified five candidate protein biomarkers of type 1 diabetes. Alpha-2-glycoprotein 1 (zinc), corticosteroid-binding globulin, and lumican were 2-fold up-regulated in type 1 diabetic samples relative to control samples, whereas clusterin and serotransferrin were 2-fold up-regulated in control samples relative to type 1 diabetic samples. Observed perturbations in the levels of all five proteins are consistent with the metabolic aberrations found in type 1 diabetes. While the discovery of these candidate protein biomarkers of type 1 diabetes is encouraging, follow up studies are required for validation in a larger population of individuals and for determination of laboratory-defined sensitivity and specificity values using blinded samples. PMID:18092746

Application of proteomics in the discovery of candidate protein biomarkers in a diabetes autoantibody standardization program sample subset.

PubMed

Metz, Thomas O; Qian, Wei-Jun; Jacobs, Jon M; Gritsenko, Marina A; Moore, Ronald J; Polpitiya, Ashoka D; Monroe, Matthew E; Camp, David G; Mueller, Patricia W; Smith, Richard D

2008-02-01

Novel biomarkers of type 1 diabetes must be identified and validated in initial, exploratory studies before they can be assessed in proficiency evaluations. Currently, untargeted "-omics" approaches are underutilized in profiling studies of clinical samples. This report describes the evaluation of capillary liquid chromatography (LC) coupled with mass spectrometry (MS) in a pilot proteomic analysis of human plasma and serum from a subset of control and type 1 diabetic individuals enrolled in the Diabetes Autoantibody Standardization Program, with the goal of identifying candidate biomarkers of type 1 diabetes. Initial high-resolution capillary LC-MS/MS experiments were performed to augment an existing plasma peptide database, while subsequent LC-FTICR studies identified quantitative differences in the abundance of plasma proteins. Analysis of LC-FTICR proteomic data identified five candidate protein biomarkers of type 1 diabetes. alpha-2-Glycoprotein 1 (zinc), corticosteroid-binding globulin, and lumican were 2-fold up-regulated in type 1 diabetic samples relative to control samples, whereas clusterin and serotransferrin were 2-fold up-regulated in control samples relative to type 1 diabetic samples. Observed perturbations in the levels of all five proteins are consistent with the metabolic aberrations found in type 1 diabetes. While the discovery of these candidate protein biomarkers of type 1 diabetes is encouraging, follow up studies are required for validation in a larger population of individuals and for determination of laboratory-defined sensitivity and specificity values using blinded samples.

Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

PubMed Central

Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

2011-01-01

SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

Progress Report for DOE DE-FG03-98ER20317 ''Regulation of the floral homeotic gene AGAMOUS'' Current and Final Funding Period: September 1, 2002, to December 31, 2002

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weigel, D.

2003-03-11

OAK-B135 Results obtained during this funding period: (1) Phylogenetic footprinting of AG regulatory sequences Sequences necessary and sufficient for AGAMOUS (AG) expression in the center of Arabidopsis flowers are located in the second intron, which is about 3 kb in size. This intron contains binding sites for two transcription factors, LEAFY (LFY) and WUSCHEL (WUS), which are direct activators of AG. We used the new method of phylogenetic shadowing to identify new regulatory elements. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested sixmore » of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. (2) Repression of AG by MADS box genes A candidate for repressing AG in the shoot apical meristem has been the MADS box gene FUL, since it is expressed in the shoot apical meristem and since an activated version (FUL:VP16) leads to ectopic AG expression in the shoot apical meristem. However, there is no ectopic AG expression in full single mutants. We therefore started to generate VP16 fusions of several other MADS box genes expressed in the shoot apical meristem, to determine which of these might be candidates for FUL redundant genes. We found that AGL6:VP16 has a similar phenotype as FUL:VP16, suggesting that AGL6 and FUL interact. We are now testing this hypothesis. (3) Two candidate AG regulators, WOW and ULA Because the phylogenetic footprinting project has identified several new candidate regulatory motifs, of which at least one (the CCAATCA motif) has rather strong effects, we had decided to put the analysis of WOW and ULA on hold, and to focus on using the newly identified motifs as tools. We conduct ed yeast one-hybrid screen with two of the conserved motifs, and identified several classes of transcription factors that can interact with them. One of these is encoded by the PAN gene, previously known to be expressed in a domain that overlaps the AG domain, but not known before to regulate AG. (4) New genetic modifiers of AG This part of the project was concluded in the previous funding period.« less

Identification of Small RNAs in Desulfovibrio vulgaris Hildenborough

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burns, Andrew; Joachimiak, Marcin; Deutschbauer, Adam

2010-05-17

Desulfovibrio vulgaris is an anaerobic sulfate-reducing bacterium capable of facilitating the removal of toxic metals such as uranium from contaminated sites via reduction. As such, it is essential to understand the intricate regulatory cascades involved in how D. vulgaris and its relatives respond to stressors in such sites. One approach is the identification and analysis of small non-coding RNAs (sRNAs); molecules ranging in size from 20-200 nucleotides that predominantly affect gene regulation by binding to complementary mRNA in an anti-sense fashion and therefore provide an immediate regulatory response. To identify sRNAs in D. vulgaris, a bacterium that does not possessmore » an annotated hfq gene, RNA was pooled from stationary and exponential phases, nitrate exposure, and biofilm conditions. The subsequent RNA was size fractionated, modified, and converted to cDNA for high throughput transcriptomic deep sequencing. A computational approach to identify sRNAs via the alignment of seven separate Desulfovibrio genomes was also performed. From the deep sequencing analysis, 2,296 reads between 20 and 250 nt were identified with expression above genome background. Analysis of those reads limited the number of candidates to ~;;87 intergenic, while ~;;140 appeared to be antisense to annotated open reading frames (ORFs). Further BLAST analysis of the intergenic candidates and other Desulfovibrio genomes indicated that eight candidates were likely portions of ORFs not previously annotated in the D. vulgaris genome. Comparison of the intergenic and antisense data sets to the bioinformatical predicted candidates, resulted in ~;;54 common candidates. Current approaches using Northern analysis and qRT-PCR are being used toverify expression of the candidates and to further develop the role these sRNAs play in D. vulgaris regulation.« less

Voices of Aspiring Teachers of Color: Unraveling the Double Bind in Teacher Education

ERIC Educational Resources Information Center

Gist, Conra D.

2017-01-01

This article centers and investigates the voices of teacher candidates of color to examine how double binds influence their teaching and learning experiences in teacher education programs. Interview and focus group data from teacher candidates of color at two teacher education programs are analyzed to unpack the types of personal and systemic ties…

The Molecular Chaperone TRiC/CCT Binds to the Trp-Asp 40 (WD40) Repeat Protein WDR68 and Promotes Its Folding, Protein Kinase DYRK1A Binding, and Nuclear Accumulation*

PubMed Central

Miyata, Yoshihiko; Shibata, Takeshi; Aoshima, Masato; Tsubata, Takuichi; Nishida, Eisuke

2014-01-01

Trp-Asp (WD) repeat protein 68 (WDR68) is an evolutionarily conserved WD40 repeat protein that binds to several proteins, including dual specificity tyrosine phosphorylation-regulated protein kinase (DYRK1A), MAPK/ERK kinase kinase 1 (MEKK1), and Cullin4-damage-specific DNA-binding protein 1 (CUL4-DDB1). WDR68 affects multiple and diverse physiological functions, such as controlling anthocyanin synthesis in plants, tissue growth in insects, and craniofacial development in vertebrates. However, the biochemical basis and the regulatory mechanism of WDR68 activity remain largely unknown. To better understand the cellular function of WDR68, here we have isolated and identified cellular WDR68 binding partners using a phosphoproteomic approach. More than 200 cellular proteins with wide varieties of biochemical functions were identified as WDR68-binding protein candidates. Eight T-complex protein 1 (TCP1) subunits comprising the molecular chaperone TCP1 ring complex/chaperonin-containing TCP1 (TRiC/CCT) were identified as major WDR68-binding proteins, and phosphorylation sites in both WDR68 and TRiC/CCT were identified. Co-immunoprecipitation experiments confirmed the binding between TRiC/CCT and WDR68. Computer-aided structural analysis suggested that WDR68 forms a seven-bladed β-propeller ring. Experiments with a series of deletion mutants in combination with the structural modeling showed that three of the seven β-propeller blades of WDR68 are essential and sufficient for TRiC/CCT binding. Knockdown of cellular TRiC/CCT by siRNA caused an abnormal WDR68 structure and led to reduction of its DYRK1A-binding activity. Concomitantly, nuclear accumulation of WDR68 was suppressed by the knockdown of TRiC/CCT, and WDR68 formed cellular aggregates when overexpressed in the TRiC/CCT-deficient cells. Altogether, our results demonstrate that the molecular chaperone TRiC/CCT is essential for correct protein folding, DYRK1A binding, and nuclear accumulation of WDR68. PMID:25342745

Engineering of Bispecific Affinity Proteins with High Affinity for ERBB2 and Adaptable Binding to Albumin

PubMed Central

Nilvebrant, Johan; Åstrand, Mikael; Georgieva-Kotseva, Maria; Björnmalm, Mattias; Löfblom, John; Hober, Sophia

2014-01-01

The epidermal growth factor receptor 2, ERBB2, is a well-validated target for cancer diagnostics and therapy. Recent studies suggest that the over-expression of this receptor in various cancers might also be exploited for antibody-based payload delivery, e.g. antibody drug conjugates. In such strategies, the full-length antibody format is probably not required for therapeutic effect and smaller tumor-specific affinity proteins might be an alternative. However, small proteins and peptides generally suffer from fast excretion through the kidneys, and thereby require frequent administration in order to maintain a therapeutic concentration. In an attempt aimed at combining ERBB2-targeting with antibody-like pharmacokinetic properties in a small protein format, we have engineered bispecific ERBB2-binding proteins that are based on a small albumin-binding domain. Phage display selection against ERBB2 was used for identification of a lead candidate, followed by affinity maturation using second-generation libraries. Cell surface display and flow-cytometric sorting allowed stringent selection of top candidates from pools pre-enriched by phage display. Several affinity-matured molecules were shown to bind human ERBB2 with sub-nanomolar affinity while retaining the interaction with human serum albumin. Moreover, parallel selections against ERBB2 in the presence of human serum albumin identified several amino acid substitutions that dramatically modulate the albumin affinity, which could provide a convenient means to control the pharmacokinetics. The new affinity proteins competed for ERBB2-binding with the monoclonal antibody trastuzumab and recognized the native receptor on a human cancer cell line. Hence, high affinity tumor targeting and tunable albumin binding were combined in one small adaptable protein. PMID:25089830

SOX10 Regulates Expression of the SH3-Domain Kinase Binding Protein 1 (Sh3kbp1) locus in Schwann Cells via an Alternative Promoter

PubMed Central

Hodonsky, Chani J.; Kleinbrink, Erica L.; Charney, Kira N.; Prasad, Megana; Bessling, Seneca L.; Jones, Erin A.; Srinivasan, Rajini; Svaren, John; McCallion, Andrew S.; Antonellis, Anthony

2011-01-01

The transcription factor SOX10 has essential roles in neural crest-derived cell populations, including myelinating Schwann cells—specialized glial cells responsible for ensheathing axons in the peripheral nervous system. Importantly, SOX10 directly regulates the expression of genes essential for proper myelin function. To date, only a handful of SOX10 target loci have been characterized in Schwann cells. Addressing this lack of knowledge will provide a better understanding of Schwann cell biology and candidate loci for relevant diseases such as demyelinating peripheral neuropathies. We have identified a highly-conserved SOX10 binding site within an alternative promoter at the SH3-domain kinase binding protein 1 (Sh3kbp1) locus. The genomic segment identified at Sh3kbp1 binds to SOX10 and displays strong promoter activity in Schwann cells in vitro and in vivo. Mutation of the SOX10 binding site ablates promoter activity, and ectopic expression of SOX10 in SOX10-negative cells promotes the expression of endogenous Sh3kbp1. Combined, these data reveal Sh3kbp1 as a novel target of SOX10 and raise important questions regarding the function of SH3KBP1 isoforms in Schwann cells. PMID:22037207

Identification of TTAGGG-binding proteins in Neurospora crassa, a fungus with vertebrate-like telomere repeats.

PubMed

Casas-Vila, Núria; Scheibe, Marion; Freiwald, Anja; Kappei, Dennis; Butter, Falk

2015-11-17

To date, telomere research in fungi has mainly focused on Saccharomyces cerevisiae and Schizosaccharomyces pombe, despite the fact that both yeasts have degenerated telomeric repeats in contrast to the canonical TTAGGG motif found in vertebrates and also several other fungi. Using label-free quantitative proteomics, we here investigate the telosome of Neurospora crassa, a fungus with canonical telomeric repeats. We show that at least six of the candidates detected in our screen are direct TTAGGG-repeat binding proteins. While three of the direct interactors (NCU03416 [ncTbf1], NCU01991 [ncTbf2] and NCU02182 [ncTay1]) feature the known myb/homeobox DNA interaction domain also found in the vertebrate telomeric factors, we additionally show that a zinc-finger protein (NCU07846) and two proteins without any annotated DNA-binding domain (NCU02644 and NCU05718) are also direct double-strand TTAGGG binders. We further find two single-strand binders (NCU02404 [ncGbp2] and NCU07735 [ncTcg1]). By quantitative label-free interactomics we identify TTAGGG-binding proteins in Neurospora crassa, suggesting candidates for telomeric factors that are supported by phylogenomic comparison with yeast species. Intriguingly, homologs in yeast species with degenerated telomeric repeats are also TTAGGG-binding proteins, e.g. in S. cerevisiae Tbf1 recognizes the TTAGGG motif found in its subtelomeres. However, there is also a subset of proteins that is not conserved. While a rudimentary core TTAGGG-recognition machinery may be conserved across yeast species, our data suggests Neurospora as an emerging model organism with unique features.

Functional evaluation of candidate ice structuring proteins using cell-free expression systems.

PubMed

Brödel, A K; Raymond, J A; Duman, J G; Bier, F F; Kubick, S

2013-02-10

Ice structuring proteins (ISPs) protect organisms from damage or death by freezing. They depress the non-equilibrium freezing point of water and prevent recrystallization, probably by binding to the surface of ice crystals. Many ISPs have been described and it is likely that many more exist in nature that have not yet been identified. ISPs come in many forms and thus cannot be reliably identified by their structure or consensus ice-binding motifs. Recombinant protein expression is the gold standard for proving the activity of a candidate ISP. Among existing expression systems, cell-free protein expression is the simplest and gives the fastest access to the protein of interest, but selection of the appropriate cell-free expression system is crucial for functionality. Here we describe cell-free expression methods for three ISPs that differ widely in structure and glycosylation status from three organisms: a fish (Macrozoarces americanus), an insect (Dendroides canadensis) and an alga (Chlamydomonas sp. CCMP681). We use both prokaryotic and eukaryotic expression systems for the production of ISPs. An ice recrystallization inhibition assay is used to test functionality. The techniques described here should improve the success of cell-free expression of ISPs in future applications. Copyright © 2012 Elsevier B.V. All rights reserved.

Evaluation of a functional epigenetic approach to identify promoter region methylation in phaeochromocytoma and neuroblastoma

PubMed Central

Margetts, Caroline D E; Morris, Mark; Astuti, Dewi; Gentle, Dean C; Cascon, Alberto; McRonald, Fiona E; Catchpoole, Daniel; Robledo, Mercedes; Neumann, Hartmut P H; Latif, Farida; Maher, Eamonn R

2008-01-01

The molecular genetics of inherited phaeochromocytoma have received considerable attention, but the somatic genetic and epigenetic events that characterise tumourigenesis in sporadic phaeochromocytomas are less well defined. Previously, we found considerable overlap between patterns of promoter region tumour suppressor gene (TSG) hypermethylation in two neural crest tumours, neuroblastoma and phaeochromocytoma. In order to identify candidate biomarkers and epigenetically inactivated TSGs in phaeochromocytoma and neuroblastoma, we characterised changes in gene expression in three neuroblastoma cell lines after treatment with the demethylating agent 5-azacytidine. Promoter region methylation status was then determined for 28 genes that demonstrated increased expression after demethylation. Three genes HSP47, homeobox A9 (HOXA9) and opioid binding protein (OPCML) were methylated in >10% of phaeochromocytomas (52, 17 and 12% respectively). Two of the genes, epithelial membrane protein 3 (EMP3) and HSP47, demonstrated significantly more frequent methylation in neuroblastoma than phaeochromocytoma. These findings extend epigenotype of phaeochromocytoma and identify candidate genes implicated in sporadic phaeochromocytoma tumourigenesis. PMID:18499731

Structural insights into binding of inhibitors to soluble epoxide hydrolase gained by fragment screening and X-ray crystallography.

PubMed

Amano, Yasushi; Yamaguchi, Tomohiko; Tanabe, Eiki

2014-04-15

Soluble epoxide hydrolase (sEH) is a component of the arachidonic acid cascade and is a candidate target for therapies for hypertension or inflammation. Although many sEH inhibitors are available, their scaffolds are not structurally diverse, and knowledge of their specific interactions with sEH is limited. To obtain detailed structural information about protein-ligand interactions, we conducted fragment screening of sEH, analyzed the fragments using high-throughput X-ray crystallography, and determined 126 fragment-bound structures at high resolution. Aminothiazole and benzimidazole derivatives were identified as novel scaffolds that bind to the catalytic triad of sEH with good ligand efficiency. We further identified fragment hits that bound to subpockets of sEH called the short and long branches. The water molecule conserved in the structure plays an important role in binding to the long branch, whereas Asp496 and the main chain of Phe497 form hydrogen bonds with fragment hits in the short branch. Fragment hits and their crystal structures provide structural insights into ligand binding to sEH that will facilitate the discovery of novel and potent inhibitors of sEH. Copyright © 2014 Elsevier Ltd. All rights reserved.

Urinary vitamin D-binding protein, a novel biomarker for lupus nephritis, predicts the development of proteinuric flare.

PubMed

Go, D J; Lee, J Y; Kang, M J; Lee, E Y; Lee, E B; Yi, E C; Song, Y W

2018-01-01

Lupus nephritis (LN) is a major complication of systemic lupus erythematosus (SLE). Conventional biomarkers for assessing renal disease activity are imperfect in predicting clinical outcomes associated with LN. The aim of this study is to identify urinary protein biomarkers that reliably reflect the disease activity or predict clinical outcomes. A quantitative proteomic analysis was performed to identify protein biomarker candidates that can differentiate between SLE patients with and without LN. Selected biomarker candidates were further verified by enzyme-linked immunosorbent assay using urine samples from a larger cohort of SLE patients ( n = 121) to investigate their predictive values for LN activity measure. Furthermore, the association between urinary levels of a selected panel of potential biomarkers and prognosis of LN was assessed with a four-year follow-up study of renal outcomes. Urinary vitamin D-binding protein (VDBP), transthyretin (TTR), retinol binding protein 4 (RBP4), and prostaglandin D synthase (PTGDS) were significantly elevated in SLE patients with LN, especially in patients with active LN ( n = 21). Among them, VDBP well correlated with severity of proteinuria (rho = 0.661, p < 0.001) and renal SLE Disease Activity Index (renal SLEDAI) (rho = 0.520, p < 0.001). In the four-year follow-up, VDBP was a significant risk factor (hazard ratio 9.627, 95% confidence interval 1.698 to 54.571, p = 0.011) for the development of proteinuric flare in SLE patients without proteinuria ( n = 100) after adjustments for multiple confounders. Urinary VDBP correlated with proteinuria and renal SLEDAI, and predicted the development of proteinuria.

Identification and Herc5-mediated ISGylation of novel target proteins.

PubMed

Takeuchi, Tomoharu; Inoue, Satoshi; Yokosawa, Hideyoshi

2006-09-22

ISG15, a protein containing two ubiquitin-like domains, is an interferon-stimulated gene product that functions in antiviral response and is conjugated to various cellular proteins (ISGylation) upon interferon stimulation. ISGylation occurs via a pathway similar to the pathway for ubiquitination that requires the sequential action of E1/E2/E3: the E1 (UBE1L), E2 (UbcH8), and E3 (Efp/Herc5) enzymes for ISGylation have been hitherto identified. In this study, we identified six novel candidate target proteins for ISGylation by a proteomic approach. Four candidate target proteins were demonstrated to be ISGylated in UBE1L- and UbcH8-dependent manners, and ISGylation of the respective target proteins was stimulated by Herc5. In addition, Herc5 was capable of binding with the respective target proteins. Thus, these results suggest that Herc5 functions as a general E3 ligase for protein ISGylation.

Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators

PubMed Central

Scheibe, Marion; Arnoult, Nausica; Kappei, Dennis; Buchholz, Frank; Decottignies, Anabelle; Butter, Falk; Mann, Matthias

2013-01-01

Telomeres are actively transcribed into telomeric repeat-containing RNA (TERRA), which has been implicated in the regulation of telomere length and heterochromatin formation. Here, we applied quantitative mass spectrometry (MS)–based proteomics to obtain a high-confidence interactome of TERRA. Using SILAC-labeled nuclear cell lysates in an RNA pull-down experiment and two different salt conditions, we distinguished 115 proteins binding specifically to TERRA out of a large set of background binders. While TERRA binders identified in two previous studies showed little overlap, using quantitative mass spectrometry we obtained many candidates reported in these two studies. To test whether novel candidates found here are involved in TERRA regulation, we performed an esiRNA-based interference analysis for 15 of them. Knockdown of 10 genes encoding candidate proteins significantly affected total cellular levels of TERRA, and RNAi of five candidates perturbed TERRA recruitment to telomeres. Notably, depletion of SRRT/ARS2, involved in miRNA processing, up-regulated both total and telomere-bound TERRA. Conversely, knockdown of MORF4L2, a component of the NuA4 histone acetyltransferase complex, reduced TERRA levels both globally and for telomere-bound TERRA. We thus identified new proteins involved in the homeostasis and telomeric abundance of TERRA, extending our knowledge of TERRA regulation. PMID:23921659

The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

PubMed Central

Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

2010-01-01

WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

NASA Astrophysics Data System (ADS)

Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

2017-11-01

Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

A Phenotypic Cell-Binding Screen Identifies a Novel Compound Targeting Triple-Negative Breast Cancer.

PubMed

Chen, Luxi; Long, Chao; Youn, Jonghae; Lee, Jiyong

2018-06-11

We describe a "phenotypic cell-binding screen" by which therapeutic candidate targeting cancer cells of a particular phenotype can be isolated without knowledge of drug targets. Chemical library beads are incubated with cancer cells of the phenotype of interest in the presence of cancer cells lacking the phenotype of interest, and then the beads bound to only cancer cells of the phenotype of interest are selected as hits. We have applied this screening strategy in discovering a novel compound (LC129-8) targeting triple-negative breast cancer (TNBC). LC129-8 displayed highly specific binding to TNBC in cancer cell lines and patient-derived tumor tissues. LC129-8 exerted anti-TNBC activity by inducing apoptosis, inhibiting proliferation, reversing epithelial-mesenchymal transition, downregulating cancer stem cell activity and blocking in vivo tumor growth.

Missense-depleted regions in population exomes implicate ras superfamily nucleotide-binding protein alteration in patients with brain malformation

PubMed Central

Ge, Xiaoyan; Gong, Henry; Dumas, Kevin; Litwin, Jessica; Phillips, Joanna J; Waisfisz, Quinten; Weiss, Marjan M; Hendriks, Yvonne; Stuurman, Kyra E; Nelson, Stanley F; Grody, Wayne W; Lee, Hane; Kwok, Pui-Yan; Shieh, Joseph T C

2016-01-01

Genomic sequence interpretation can miss clinically relevant missense variants for several reasons. Rare missense variants are numerous in the exome and difficult to prioritise. Affected genes may also not have existing disease association. To improve variant prioritisation, we leverage population exome data to identify intragenic missense-depleted regions (MDRs) genome-wide that may be important in disease. We then use missense depletion analyses to help prioritise undiagnosed disease exome variants. We demonstrate application of this strategy to identify a novel gene association for human brain malformation. We identified de novo missense variants that affect the GDP/GTP-binding site of ARF1 in three unrelated patients. Corresponding functional analysis suggests ARF1 GDP/GTP-activation is affected by the specific missense mutations associated with heterotopia. These findings expand the genetic pathway underpinning neurologic disease that classically includes FLNA. ARF1 along with ARFGEF2 add further evidence implicating ARF/GEFs in the brain. Using functional ontology, top MDR-containing genes were highly enriched for nucleotide-binding function, suggesting these may be candidates for human disease. Routine consideration of MDR in the interpretation of exome data for rare diseases may help identify strong genetic factors for many severe conditions, infertility/reduction in reproductive capability, and embryonic conditions contributing to preterm loss. PMID:28868155

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS).

PubMed

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS)

PubMed Central

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O.

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS. PMID:27152866

Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

PubMed

Schumann, Marcel; Armen, Roger S

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

PubMed Central

Schumann, Marcel; Armen, Roger S.

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

Design, synthesis, and functional testing of recombinant cell penetrating peptides

NASA Astrophysics Data System (ADS)

Widyaningtyas, S. T.; Soebandrio, A.; Ibrahim, F.; Bela, B.

2017-08-01

Cell penetrating peptides (CPP) are one of the most attractive DNA delivery systems currently in development. In this research, in silico CPP development was performed based on a literature study to look for peptides that induce endosome escape, have the ability to bind DNA, and pass through cell membranes and/or nuclear membranes with a final goal of creating a new CPP to be used as a DNA delivery system. We report herein the successful isolation of three candidate CPP molecules, which have all been successfully expressed and purified by NiNTA. One of the determinants of CPP success as a DNA carrier is the ability of the CPP to bind and protect DNA from the effects of nucleases. The DNA binding test results show that all three CPPs can bind to DNA and protect it from the effects of serum nucleases. These three CPP candidates designed in silico and synthesized in the prokaryote system are eligible candidates for further testing of their ability to deliver DNA in vitro and in vivo.

Quantifying protein-protein interactions in high throughput using protein domain microarrays.

PubMed

Kaushansky, Alexis; Allen, John E; Gordus, Andrew; Stiffler, Michael A; Karp, Ethan S; Chang, Bryan H; MacBeath, Gavin

2010-04-01

Protein microarrays provide an efficient way to identify and quantify protein-protein interactions in high throughput. One drawback of this technique is that proteins show a broad range of physicochemical properties and are often difficult to produce recombinantly. To circumvent these problems, we have focused on families of protein interaction domains. Here we provide protocols for constructing microarrays of protein interaction domains in individual wells of 96-well microtiter plates, and for quantifying domain-peptide interactions in high throughput using fluorescently labeled synthetic peptides. As specific examples, we will describe the construction of microarrays of virtually every human Src homology 2 (SH2) and phosphotyrosine binding (PTB) domain, as well as microarrays of mouse PDZ domains, all produced recombinantly in Escherichia coli. For domains that mediate high-affinity interactions, such as SH2 and PTB domains, equilibrium dissociation constants (K(D)s) for their peptide ligands can be measured directly on arrays by obtaining saturation binding curves. For weaker binding domains, such as PDZ domains, arrays are best used to identify candidate interactions, which are then retested and quantified by fluorescence polarization. Overall, protein domain microarrays provide the ability to rapidly identify and quantify protein-ligand interactions with minimal sample consumption. Because entire domain families can be interrogated simultaneously, they provide a powerful way to assess binding selectivity on a proteome-wide scale and provide an unbiased perspective on the connectivity of protein-protein interaction networks.

Evidence that breast cancer risk at the 2q35 locus is mediated through IGFBP5 regulation.

PubMed

Ghoussaini, Maya; Edwards, Stacey L; Michailidou, Kyriaki; Nord, Silje; Cowper-Sal Lari, Richard; Desai, Kinjal; Kar, Siddhartha; Hillman, Kristine M; Kaufmann, Susanne; Glubb, Dylan M; Beesley, Jonathan; Dennis, Joe; Bolla, Manjeet K; Wang, Qin; Dicks, Ed; Guo, Qi; Schmidt, Marjanka K; Shah, Mitul; Luben, Robert; Brown, Judith; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Klevebring, Daniel; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Lambrechts, Diether; Thienpont, Bernard; Neven, Patrick; Wildiers, Hans; Broeks, Annegien; Van't Veer, Laura J; Th Rutgers, Emiel J; Couch, Fergus J; Olson, Janet E; Hallberg, Emily; Vachon, Celine; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Peto, Julian; Dos-Santos-Silva, Isabel; Gibson, Lorna; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Benitez, Javier; Zamora, M Pilar; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Qiuyin; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Lindblom, Annika; Margolin, Sara; Teo, Soo Hwang; Yip, Cheng Har; Lee, Daphne S C; Wong, Tien Y; Hooning, Maartje J; Martens, John W M; Collée, J Margriet; van Deurzen, Carolien H M; Hopper, John L; Southey, Melissa C; Tsimiklis, Helen; Kapuscinski, Miroslav K; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Chen, Shou-Tung; Alnæs, Grethe Grenaker; Borresen-Dale, Anne-Lise; Giles, Graham G; Milne, Roger L; McLean, Catriona; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Buhari, Shaik Ahmad Bin Syed; Teo, Yik Ying; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J; Lissowska, Jolanta; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Brauch, Hiltrud; Brüning, Thomas; Koto, Yon-Dschun; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Volorio, Sara; Dörk, Thilo; Bogdanova, Natalia V; Helbig, Sonja; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Hamann, Ute; Torres, Diana; Zheng, Wei; Long, Jirong; Anton-Culver, Hoda; Neuhausen, Susan L; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Alvarez, Nuria; Herrero, Daniel; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; de Santiago, Ines; Carroll, Jason; Caldas, Carlos; Brown, Melissa A; Lupien, Mathieu; Kristensen, Vessela N; Pharoah, Paul D P; Chenevix-Trench, Georgia; French, Juliet D; Easton, Douglas F; Dunning, Alison M

2014-09-23

GWAS have identified a breast cancer susceptibility locus on 2q35. Here we report the fine mapping of this locus using data from 101,943 subjects from 50 case-control studies. We genotype 276 SNPs using the 'iCOGS' genotyping array and impute genotypes for a further 1,284 using 1000 Genomes Project data. All but two, strongly correlated SNPs (rs4442975 G/T and rs6721996 G/A) are excluded as candidate causal variants at odds against >100:1. The best functional candidate, rs4442975, is associated with oestrogen receptor positive (ER+) disease with an odds ratio (OR) in Europeans of 0.85 (95% confidence interval=0.84-0.87; P=1.7 × 10(-43)) per t-allele. This SNP flanks a transcriptional enhancer that physically interacts with the promoter of IGFBP5 (encoding insulin-like growth factor-binding protein 5) and displays allele-specific gene expression, FOXA1 binding and chromatin looping. Evidence suggests that the g-allele confers increased breast cancer susceptibility through relative downregulation of IGFBP5, a gene with known roles in breast cell biology.

Design, synthesis and evaluation of photoactivatable derivatives of microtubule (MT)-active [1,2,4]triazolo[1,5-a]pyrimidines.

PubMed

Oukoloff, Killian; Kovalevich, Jane; Cornec, Anne-Sophie; Yao, Yuemang; Owyang, Zachary A; James, Michael; Trojanowski, John Q; Lee, Virginia M-Y; Smith, Amos B; Brunden, Kurt R; Ballatore, Carlo

2018-05-05

The [1,2,4]triazolo[1,5-a]pyrimidines comprise a promising class of non-naturally occurring microtubule (MT)-active compounds. Prior studies revealed that different triazolopyrimidine substitutions can yield molecules that either promote MT stabilization or disrupt MT integrity. These differences can have important ramifications in the therapeutic applications of triazolopyrimidines and suggest that different analogues may exhibit different binding modes within the same site or possibly interact with tubulin/MTs at alternative binding sites. To help discern these possibilities, a series of photoactivatable triazolopyrimidine congeners was designed, synthesized and evaluated in cellular assays with the goal of identifying candidate probes for photoaffinity labeling experiments. These studies led to the identification of different derivatives that incorporate a diazirine ring in the amine substituent at position 7 of the triazolopyrimidine heterocycle, resulting in molecules that either promote stabilization of MTs or disrupt MT integrity. These photoactivatable candidate probes hold promise to investigate the mode of action of MT-active triazolopyrimidines. Copyright © 2018 Elsevier Ltd. All rights reserved.

Structural basis of O-GlcNAc recognition by mammalian 14-3-3 proteins.

PubMed

Toleman, Clifford A; Schumacher, Maria A; Yu, Seok-Ho; Zeng, Wenjie; Cox, Nathan J; Smith, Timothy J; Soderblom, Erik J; Wands, Amberlyn M; Kohler, Jennifer J; Boyce, Michael

2018-06-05

O-GlcNAc is an intracellular posttranslational modification that governs myriad cell biological processes and is dysregulated in human diseases. Despite this broad pathophysiological significance, the biochemical effects of most O-GlcNAcylation events remain uncharacterized. One prevalent hypothesis is that O-GlcNAc moieties may be recognized by "reader" proteins to effect downstream signaling. However, no general O-GlcNAc readers have been identified, leaving a considerable gap in the field. To elucidate O-GlcNAc signaling mechanisms, we devised a biochemical screen for candidate O-GlcNAc reader proteins. We identified several human proteins, including 14-3-3 isoforms, that bind O-GlcNAc directly and selectively. We demonstrate that 14-3-3 proteins bind O-GlcNAc moieties in human cells, and we present the structures of 14-3-3β/α and γ bound to glycopeptides, providing biophysical insights into O-GlcNAc-mediated protein-protein interactions. Because 14-3-3 proteins also bind to phospho-serine and phospho-threonine, they may integrate information from O-GlcNAc and O-phosphate signaling pathways to regulate numerous physiological functions.

Defining the interaction of human soluble lectin ZG16p and mycobacterial phosphatidylinositol mannosides

PubMed Central

Ikeda, Akemi; Kojima-Aikawa, Kyoko; Taniguchi, Naoyuki; Varón Silva, Daniel; Feizi, Ten; Seeberger, Peter H.; Yamaguchi, Yoshiki

2018-01-01

ZG16p is a soluble mammalian lectin that interacts with mannose and heparan sulfate. Here we describe detailed analyses of the interactions of human ZG16p with mycobacterial phosphatidylinositol mannosides (PIMs), using glycan microarray and NMR. Pathogen-related glycan microarray analysis identified phosphatidylinositol mono- and di-mannosides (PIM1 and PIM2) as novel ligand candidates of ZG16p. Saturation Transfer Difference (STD) NMR and transferred NOE experiments with chemically synthesized PIM glycans indicate that PIMs preferentially interacts with ZG16p using the mannose residues. Binding site of PIMs is identified by chemical shift perturbation experiments using uniformly 15N-labeled ZG16p. NMR results with docking simulations suggest a binding mode of ZG16p and PIM glycan, which would help to consider the physiological role of ZG16p. PMID:25919894

Viral receptor-binding site antibodies with diverse germline origins.

PubMed

Schmidt, Aaron G; Therkelsen, Matthew D; Stewart, Shaun; Kepler, Thomas B; Liao, Hua-Xin; Moody, M Anthony; Haynes, Barton F; Harrison, Stephen C

2015-05-21

Vaccines for rapidly evolving pathogens will confer lasting immunity if they elicit antibodies recognizing conserved epitopes, such as a receptor-binding site (RBS). From characteristics of an influenza-virus RBS-directed antibody, we devised a signature motif to search for similar antibodies. We identified, from three vaccinees, over 100 candidates encoded by 11 different VH genes. Crystal structures show that antibodies in this class engage the hemagglutinin RBS and mimic binding of the receptor, sialic acid, by supplying a critical dipeptide on their projecting, heavy-chain third complementarity determining region. They share contacts with conserved, receptor-binding residues but contact different residues on the RBS periphery, limiting the likelihood of viral escape when several such antibodies are present. These data show that related modes of RBS recognition can arise from different germline origins and mature through diverse affinity maturation pathways. Immunogens focused on an RBS-directed response will thus have a broad range of B cell targets. Copyright © 2015 Elsevier Inc. All rights reserved.

HLA-DR allele reading register shifting is associated with immunity induced by SERA peptide analogues.

PubMed

Salazar, Luz Mary; Bermúdez, Adriana; Patarroyo, Manuel E

2008-07-18

SERA protein is a leading candidate molecule to be included in an antimalarial vaccine. Conserved high activity binding peptides (HABP) binding to red blood cells (RBC) have been identified in this protein. One of them (6762) localising in the 18-kDa C-terminal fragment was used to induce protective immunity with negative result. Critical RBC binding residues (assessed by glycine-analogue scanning) were replaced by others having the same mass, volume and surface but different polarity, rendering some of them immunogenic as assessed by antibody production against the parasite or its proteins and protection-inducing against challenge with a highly infectious Aotus monkey-adapted Plasmodium falciparum strain. A shift in binding to purified HLA-DR allelic molecules from the same haplotype and in their reading register was found, suggesting that modified molecules had adopted a different (1)H NMR 3D structure allowing a better fit into the MHCII-pept-TCR complex, thereby representing a new mechanism for inducing immune protection.

The Length Distribution of Class I-Restricted T Cell Epitopes Is Determined by Both Peptide Supply and MHC Allele-Specific Binding Preference.

PubMed

Trolle, Thomas; McMurtrey, Curtis P; Sidney, John; Bardet, Wilfried; Osborn, Sean C; Kaever, Thomas; Sette, Alessandro; Hildebrand, William H; Nielsen, Morten; Peters, Bjoern

2016-02-15

HLA class I-binding predictions are widely used to identify candidate peptide targets of human CD8(+) T cell responses. Many such approaches focus exclusively on a limited range of peptide lengths, typically 9 aa and sometimes 9-10 aa, despite multiple examples of dominant epitopes of other lengths. In this study, we examined whether epitope predictions can be improved by incorporating the natural length distribution of HLA class I ligands. We found that, although different HLA alleles have diverse length-binding preferences, the length profiles of ligands that are naturally presented by these alleles are much more homogeneous. We hypothesized that this is due to a defined length profile of peptides available for HLA binding in the endoplasmic reticulum. Based on this, we created a model of HLA allele-specific ligand length profiles and demonstrate how this model, in combination with HLA-binding predictions, greatly improves comprehensive identification of CD8(+) T cell epitopes. Copyright © 2016 by The American Association of Immunologists, Inc.

Transforming fragments into candidates: small becomes big in medicinal chemistry.

PubMed

de Kloe, Gerdien E; Bailey, David; Leurs, Rob; de Esch, Iwan J P

2009-07-01

Fragment-based drug discovery (FBDD) represents a logical and efficient approach to lead discovery and optimisation. It can draw on structural, biophysical and biochemical data, incorporating a wide range of inputs, from precise mode-of-binding information on specific fragments to wider ranging pharmacophoric screening surveys using traditional HTS approaches. It is truly an enabling technology for the imaginative medicinal chemist. In this review, we analyse a representative set of 23 published FBDD studies that describe how low molecular weight fragments are being identified and efficiently transformed into higher molecular weight drug candidates. FBDD is now becoming warmly endorsed by industry as well as academia and the focus on small interacting molecules is making a big scientific impact.

Flavonol and imidazole derivatives block HPV16 E6 activities and reactivate apoptotic pathways in HPV+ cells

PubMed Central

Yuan, C-H; Filippova, M; Krstenansky, J L; Duerksen-Hughes, P J

2016-01-01

High-risk human papillomaviruses (HR-HPVs) cause nearly all cases of cervical cancer, as well as approximately 30% of head and neck cancers. HPV 16 E6, one of two major viral oncogenes, protects cells from apoptosis by binding to and accelerating the degradation of several proteins important in apoptotic signaling, including caspase 8 and p53. We proposed that blocking the interactions between HPV E6 and its partners using small molecules had the potential to re-sensitize HPV+ cells to apoptosis. To test this idea, we screened libraries of small molecules for candidates that could block E6/caspase 8 binding and identified several candidates from different chemical classes. We tested hits for dose-dependency and specificity in vitro and for toxicity in a cell-based assay and then used this information to select the two best candidates for further testing: myricetin, a flavonol, and spinacine, an imidazole amino-acid derivative of histidine. Both compounds clearly inhibited the ability of E6 to bind in vitro to both caspase 8 and E6AP, the protein that mediates p53 degradation. In addition, both compounds were able to increase the level of caspase 8 and p53 in SiHa cervical cancer cells, resulting in an increase of caspase 3/7 activity. Finally, both myricetin and spinacine sensitized HPV+ cervical and oral cancer cells, but not HPV− cervical and oral cancer cells, to apoptosis induced by the cancer-specific ligand TRAIL, as well as the chemotherapeutic agents doxorubicin and cisplatin. New therapies based on this work may improve treatment for HPV+ cancer patients. PMID:26794656

Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

PubMed

Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

2012-01-03

We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

Identification of new benzamide inhibitor against α-subunit of tryptophan synthase from Mycobacterium tuberculosis through structure-based virtual screening, anti-tuberculosis activity and molecular dynamics simulations.

PubMed

Naz, Sadia; Farooq, Umar; Ali, Sajid; Sarwar, Rizwana; Khan, Sara; Abagyan, Ruben

2018-03-13

Multi-drug-resistant tuberculosis and extensively drug-resistant tuberculosis has emerged as global health threat, causing millions of deaths worldwide. Identification of new drug candidates for tuberculosis (TB) by targeting novel and less explored protein targets will be invaluable for antituberculosis drug discovery. We performed structure-based virtual screening of eMolecules database against a homology model of relatively unexplored protein target: the α-subunit of tryptophan synthase (α-TRPS) from Mycobacterium tuberculosis essential for bacterial survival. Based on physiochemical properties analysis and molecular docking, the seven candidate compounds were selected and evaluated through whole cell-based activity against the H37Rv strain of M. tuberculosis. A new Benzamide inhibitor against α-subunit of tryptophan synthase (α-TRPS) from M. tuberculosis has been identified causing 100% growth inhibition at 25 μg/ml and visible bactericidal activity at 6 μg/ml. This benzamide inhibitor displayed a good predicted binding score (-48.24 kcal/mol) with the α-TRPS binding pocket and has logP value (2.95) comparable to Rifampicin. Further refinement of docking results and evaluation of inhibitor-protein complex stability were investigated through Molecular dynamic (MD) simulations studies. Following MD simulations, Root mean square deviation, Root mean square fluctuation and secondary structure analysis confirmed that protein did not unfold and ligand stayed inside the active pocket of protein during the explored time scale. This identified benzamide inhibitor against the α-subunit of TRPS from M. tuberculosis could be considered as candidate for drug discovery against TB and will be further evaluated for enzyme-based inhibition in future studies.

A Plasmodium falciparum copper-binding membrane protein with copper transport motifs

PubMed Central

2012-01-01

Background Copper is an essential catalytic co-factor for metabolically important cellular enzymes, such as cytochrome-c oxidase. Eukaryotic cells acquire copper through a copper transport protein and distribute intracellular copper using molecular chaperones. The copper chelator, neocuproine, inhibits Plasmodium falciparum ring-to-trophozoite transition in vitro, indicating a copper requirement for malaria parasite development. How the malaria parasite acquires or secretes copper still remains to be fully elucidated. Methods PlasmoDB was searched for sequences corresponding to candidate P. falciparum copper-requiring proteins. The amino terminal domain of a putative P. falciparum copper transport protein was cloned and expressed as a maltose binding fusion protein. The copper binding ability of this protein was examined. Copper transport protein-specific anti-peptide antibodies were generated in chickens and used to establish native protein localization in P. falciparum parasites by immunofluorescence microscopy. Results Six P. falciparum copper-requiring protein orthologs and a candidate P. falciparum copper transport protein (PF14_0369), containing characteristic copper transport protein features, were identified in PlasmoDB. The recombinant amino terminal domain of the transport protein bound reduced copper in vitro and within Escherichia coli cells during recombinant expression. Immunolocalization studies tracked the copper binding protein translocating from the erythrocyte plasma membrane in early ring stage to a parasite membrane as the parasites developed to schizonts. The protein appears to be a PEXEL-negative membrane protein. Conclusion Plasmodium falciparum parasites express a native protein with copper transporter characteristics that binds copper in vitro. Localization of the protein to the erythrocyte and parasite plasma membranes could provide a mechanism for the delivery of novel anti-malarial compounds. PMID:23190769

In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity.

PubMed

Pahil, Sapna; Taneja, Neelam; Ansari, Hifzur Rahman; Raghava, G P S

2017-01-01

Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I), a putative heat shock protein (EL PGI II), Spa32 (EL PGI III), IcsB (EL PGI IV) and a hypothetical protein (EL PGI V). These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP) and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

PubMed

Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

2018-05-16

Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

Role for a Zinc Finger Protein (Zfp111) in Transformation of 208F Rat Fibroblasts by Jaagsiekte Sheep Retrovirus Envelope Protein

PubMed Central

Hsu, Tom; Phung, An; Choe, Kevin; Kim, Jung Woo

2015-01-01

ABSTRACT The native envelope gene (env) of Jaagsiekte sheep retrovirus (JSRV) also acts as an oncogene. To investigate the mechanism of transformation, we performed yeast 2-hybrid screening for cellular proteins that interact with Env. Among several candidates, we identified mouse or rat zinc finger protein 111 (zfp111). The interaction between Env and Zfp111 was confirmed through in vivo coimmunoprecipitation assays. Knockdown of endogenous Zfp111 caused a decrease in cell transformation by JSRV Env, while overexpression of Zfp111 increased overall Env transformation, supporting a role for Zfp111 in Env transformation. Knockdown of Zfp111 had no effect on the growth rate of parental rat 208F cells, while it decreased the proliferation rate of JSRV-transformed 208F cells, suggesting that JSRV-transformed cells became dependent on Zfp111. In addition, Zfp111 preferentially bound to a higher-mobility form of JSRV Env that has not been described previously. The higher-mobility form of Env (P70env) was found exclusively in the nuclear fraction, and size of its polypeptide backbone was the same as that of the cytoplasmic Env polyprotein (Pr80env). The differences in glycosylation between the two versions of Env were characterized. These results identify a novel cellular protein, Zfp111, that binds to the JSRV Env protein, and this binding plays a role in Env transformation. These results indicate that JSRV transformation also involves proteins and interactions in the nucleus. IMPORTANCE The envelope protein (Env) of Jaagsiekte sheep retrovirus (JSRV) is an oncogene, but its mechanism of cell transformation is still unclear. Here we identified seven candidate cellular proteins that can interact with JSRV Env by yeast two-hybrid screening. This study focused on one of the seven candidates, zinc finger protein 111 (Zfp111). Zfp111 was shown to interact with JSRV Env in cells and to be involved in JSRV transformation. Moreover, coexpression of JSRV Env and Zfp111 led to the identification of a novel nuclear form of the JSRV Env protein that binds Zfp111. Nuclear Env was found to differ by glycosylation from the cytoplasmic Env precursor to the virion envelope proteins. These results suggest that JSRV Env transformation may involve nuclear events such as an alteration in transcription mediated by Env-Zfp111 interactions. PMID:26246563

Linker histone H1.0 interacts with an extensive network of proteins found in the nucleolus

PubMed Central

Kalashnikova, Anna A.; Winkler, Duane D.; McBryant, Steven J.; Henderson, Ryan K.; Herman, Jacob A.; DeLuca, Jennifer G.; Luger, Karolin; Prenni, Jessica E.; Hansen, Jeffrey C.

2013-01-01

The H1 linker histones are abundant chromatin-associated DNA-binding proteins. Recent evidence suggests that linker histones also may function through protein–protein interactions. To gain a better understanding of the scope of linker histone involvement in protein–protein interactions, we used a proteomics approach to identify H1-binding proteins in human nuclear extracts. Full-length H1.0 and H1.0 lacking its C-terminal domain (CTD) were used for protein pull-downs. A total of 107 candidate H1.0 binding proteins were identified by LC-MS/MS. About one-third of the H1.0-dependent interactions were mediated by the CTD, and two-thirds by the N-terminal domain-globular domain fragment. Many of the proteins pulled down by H1.0 were core splicing factors. Another group of H1-binding proteins functions in rRNA biogenesis. H1.0 also pulled down numerous ribosomal proteins and proteins involved in cellular transport. Strikingly, nearly all of the H1.0-binding proteins are found in the nucleolus. Quantitative biophysical studies with recombinant proteins confirmed that H1.0 directly binds to FACT and the splicing factors SF2/ASF and U2AF65. Our results demonstrate that H1.0 interacts with an extensive network of proteins that function in RNA metabolism in the nucleolus, and suggest that a new paradigm for linker histone action is in order. PMID:23435226

Olfactory Proteins Mediating Chemical Communication in the Navel Orangeworm Moth, Amyelois transitella

PubMed Central

Leal, Walter S.; Ishida, Yuko; Pelletier, Julien; Xu, Wei; Rayo, Josep; Xu, Xianzhong; Ames, James B.

2009-01-01

Background The navel orangeworm, Amyelois transitella Walker (Lepidoptera: Pyralidae), is the most serious insect pest of almonds and pistachios in California for which environmentally friendly alternative methods of control — like pheromone-based approaches — are highly desirable. Some constituents of the sex pheromone are unstable and could be replaced with parapheromones, which may be designed on the basis of molecular interaction of pheromones and pheromone-detecting olfactory proteins. Methodology By analyzing extracts from olfactory and non-olfactory tissues, we identified putative olfactory proteins, obtained their N-terminal amino acid sequences by Edman degradation, and used degenerate primers to clone the corresponding cDNAs by SMART RACE. Additionally, we used degenerate primers based on conserved sequences of known proteins to fish out other candidate olfactory genes. We expressed the gene encoding a newly identified pheromone-binding protein, which was analyzed by circular dichroism, fluorescence, and nuclear magnetic resonance, and used in a binding assay to assess affinity to pheromone components. Conclusion We have cloned nine cDNAs encoding olfactory proteins from the navel orangeworm, including two pheromone-binding proteins, two general odorant-binding proteins, one chemosensory protein, one glutathione S-transferase, one antennal binding protein X, one sensory neuron membrane protein, and one odorant receptor. Of these, AtraPBP1 is highly enriched in male antennae. Fluorescence, CD and NMR studies suggest a dramatic pH-dependent conformational change, with high affinity to pheromone constituents at neutral pH and no binding at low pH. PMID:19789654

Peptide-binding motifs of two common equine class I MHC molecules in Thoroughbred horses.

PubMed

Bergmann, Tobias; Lindvall, Mikaela; Moore, Erin; Moore, Eugene; Sidney, John; Miller, Donald; Tallmadge, Rebecca L; Myers, Paisley T; Malaker, Stacy A; Shabanowitz, Jeffrey; Osterrieder, Nikolaus; Peters, Bjoern; Hunt, Donald F; Antczak, Douglas F; Sette, Alessandro

2017-05-01

Quantitative peptide-binding motifs of MHC class I alleles provide a valuable tool to efficiently identify putative T cell epitopes. Detailed information on equine MHC class I alleles is still very limited, and to date, only a single equine MHC class I allele, Eqca-1*00101 (ELA-A3 haplotype), has been characterized. The present study extends the number of characterized ELA class I specificities in two additional haplotypes found commonly in the Thoroughbred breed. Accordingly, we here report quantitative binding motifs for the ELA-A2 allele Eqca-16*00101 and the ELA-A9 allele Eqca-1*00201. Utilizing analyses of endogenously bound and eluted ligands and the screening of positional scanning combinatorial libraries, detailed and quantitative peptide-binding motifs were derived for both alleles. Eqca-16*00101 preferentially binds peptides with aliphatic/hydrophobic residues in position 2 and at the C-terminus, and Eqca-1*00201 has a preference for peptides with arginine in position 2 and hydrophobic/aliphatic residues at the C-terminus. Interestingly, the Eqca-16*00101 motif resembles that of the human HLA A02-supertype, while the Eqca-1*00201 motif resembles that of the HLA B27-supertype and two macaque class I alleles. It is expected that the identified motifs will facilitate the selection of candidate epitopes for the study of immune responses in horses.

The Interaction of Integrin αIIbβ3 with Fibrin Occurs through Multiple Binding Sites in the αIIb β-Propeller Domain*

PubMed Central

Podolnikova, Nataly P.; Yakovlev, Sergiy; Yakubenko, Valentin P.; Wang, Xu; Gorkun, Oleg V.; Ugarova, Tatiana P.

2014-01-01

The currently available antithrombotic agents target the interaction of platelet integrin αIIbβ3 (GPIIb-IIIa) with fibrinogen during platelet aggregation. Platelets also bind fibrin formed early during thrombus growth. It was proposed that inhibition of platelet-fibrin interactions may be a necessary and important property of αIIbβ3 antagonists; however, the mechanisms by which αIIbβ3 binds fibrin are uncertain. We have previously identified the γ370–381 sequence (P3) in the γC domain of fibrinogen as the fibrin-specific binding site for αIIbβ3 involved in platelet adhesion and platelet-mediated fibrin clot retraction. In the present study, we have demonstrated that P3 can bind to several discontinuous segments within the αIIb β-propeller domain of αIIbβ3 enriched with negatively charged and aromatic residues. By screening peptide libraries spanning the sequence of the αIIb β-propeller, several sequences were identified as candidate contact sites for P3. Synthetic peptides duplicating these segments inhibited platelet adhesion and clot retraction but not platelet aggregation, supporting the role of these regions in fibrin recognition. Mutant αIIbβ3 receptors in which residues identified as critical for P3 binding were substituted for homologous residues in the I-less integrin αMβ2 exhibited reduced cell adhesion and clot retraction. These residues are different from those that are involved in the coordination of the fibrinogen γ404–411 sequence and from auxiliary sites implicated in binding of soluble fibrinogen. These results map the binding of fibrin to multiple sites in the αIIb β-propeller and further indicate that recognition specificity of αIIbβ3 for fibrin differs from that for soluble fibrinogen. PMID:24338009

Prediction of vaccine candidates against Pseudomonas aeruginosa: An integrated genomics and proteomics approach.

PubMed

Rashid, Muhammad Ibrahim; Naz, Anam; Ali, Amjad; Andleeb, Saadia

2017-07-01

Pseudomonas aeruginosa is among top critical nosocomial infectious agents due to its persistent infections and tendency for acquiring drug resistance mechanisms. To date, there is no vaccine available for this pathogen. We attempted to exploit the genomic and proteomic information of P. aeruginosa though reverse-vaccinology approaches to unveil the prospective vaccine candidates. P. aeruginosa strain PAO1 genome was subjected to sequential prioritization approach following genomic, proteomics and structural analyses. Among, the predicted vaccine candidates: surface components of antibiotic efflux pumps (Q9HY88, PA2837), chaperone-usher pathway components (CupC2, CupB3), penicillin binding protein of bacterial cell wall (PBP1a/mrcA), extracellular component of Type 3 secretory system (PscC) and three uncharacterized secretory proteins (PA0629, PA2822, PA0978) were identified as potential candidates qualifying all the set criteria. These proteins were then analyzed for potential immunogenic surface exposed epitopes. These predicted epitopes may provide a basis for development of a reliable subunit vaccine against P. aeruginosa. Copyright © 2017 Elsevier Inc. All rights reserved.

A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

PubMed

Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

2018-04-01

Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library

PubMed Central

Adler, Adam S.; Bedinger, Daniel; Adams, Matthew S.; Asensio, Michael A.; Edgar, Robert C.; Leong, Renee; Leong, Jackson; Mizrahi, Rena A.; Spindler, Matthew J.; Bandi, Srinivasa Rao; Huang, Haichun; Brams, Peter; Johnson, David S.

2018-01-01

ABSTRACT Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of “randomly paired” scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs. PMID:29376776

Biallelic missense variants in ZBTB11 can cause intellectual disability in human.

PubMed

Fattahi, Zohreh; Sheikh, Taimoor I; Musante, Luciana; Rasheed, Memoona; Taskiran, Ibrahim Ihsan; Harripaul, Ricardo; Hu, Hao; Kazeminasab, Somayeh; Alam, Muhammad Rizwan; Hosseini, Masoumeh; Larti, Farzaneh; Ghaderi, Zhila; Celik, Arzu; Ayub, Muhammad; Ansar, Muhammad; Haddadi, Mohammad; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Vincent, John B; Najmabadi, H

2018-06-08

Exploring genes and pathways underlying Intellectual Disability (ID) provides insight into brain development and function, clarifying the complex puzzle of how cognition develops. As part of ongoing systematic studies to identify candidate ID genes, linkage analysis and next generation sequencing revealed ZBTB11, as a novel candidate ID gene. ZBTB11 encodes a less-studied transcription regulator and the two identified missense variants in this study may disrupt canonical Zn2+-binding residues of its C2H2 zinc finger domain, leading to possible altered DNA binding. Using HEK293T cells transfected with wild type and mutant GFP-ZBTB11 constructs, we found the ZBTB11 mutants being excluded from the nucleolus, where the wild-type recombinant protein is predominantly localized. Pathway analysis applied to ChIP-seq data deposited in the ENCODE database supports the localization of ZBTB11 in nucleoli, highlighting associated pathways such as rRNA synthesis, ribosomal assembly, RNA modification, stress sensing and provides a direct link between subcellular ZBTB11 location and its function. Furthermore, considering the report of prominent brain and spinal cord degeneration in a zebrafish Zbtb11 mutant, we investigated ZBTB11-ortholog knockdown in Drosophila melanogaster brain by targeting RNAi using the UAS/Gal4 system. The observed approximate reduction to a third of the mushroom body size - possibly through neuronal reduction or degeneration - may affect neuronal circuits in the brain that are required for adaptive behavior, specifying the role of this gene in nervous system. In conclusion, we report two ID families segregating ZBTB11 biallelic mutations disrupting Zn2+-binding motifs, and provide functional evidence linking ZBTB11 dysfunction to this phenotype.

Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens

PubMed Central

Glinsky, Gennadi V.

2016-01-01

Abstract Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8–10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. PMID:27503290

Potential interaction between the GARS-AIRS-GART Gene and CP2/LBP-1c/LSF transcription factor in Down syndrome-related Alzheimer disease.

PubMed

Banerjee, Disha; Nandagopal, Krishnadas

2007-12-01

(1) GARS-AIRS-GART is an important candidate gene in studies of Down syndrome (DS)-related Alzheimer's disease (AD), due to its chromosomal localization (21q22.1) in the Down syndrome critical region, involvement in de novo purine biosynthesis, and over-expression in DS brain. The aim of this study was to identify factor(s) likely to enhance transcription of GARS-AIRS-GART in DS-related AD. (2) Based on a bio-informatics approach, the PromoterInspector, Promoter Scan II, and EBI toolbox CpG plot software programs were used to identify GARS-AIRS-GART sequences important for gene transcription. Transcription factor binding motifs within these regions were mapped with the help of the MatInspector and TFSEARCH programs. Factors implicated in neurodevelopment or neurodegeneration were the focus of attention, and mining of human (T1Dbase) and murine (GNF) expression databases revealed information on the regional distribution of these factors and their relative abundance vis-a-vis GARS-AIRS-GART. (3) The Leader-binding protein 1-c (LBP-1c/CP2/LSF) emerged as a promising candidate from these studies, as MatInspector and TFSEARCH analyses revealed a total of four CP2 binding sites with potential for functional interaction(s) within the promoter and CpG islands of GARS-AIRS-GART. Furthermore, two of these sites harbor sequences for methylation-sensitive restriction enzymes, which suggest that methylation status may, in part, regulate CP2-mediated transcription of GARS-AIRS-GART. A search of T1Dbase and GNF expression databases reveals co-expression of CP2 and GARS-AIRS-GART in brain regions relevant to DS-related AD. (4) The virtual screen identified CP2/LBP-1c/LSF as a factor that likely mediates enhanced transcription of GARS-AIRS-GART in DS-related AD.

EV-Associated MMP9 in High-Grade Serous Ovarian Cancer Is Preferentially Localized to Annexin V-Binding EVs.

PubMed

Reiner, Agnes T; Tan, Sisareuth; Agreiter, Christiane; Auer, Katharina; Bachmayr-Heyda, Anna; Aust, Stefanie; Pecha, Nina; Mandorfer, Mattias; Pils, Dietmar; Brisson, Alain R; Zeillinger, Robert; Lim, Sai Kiang

2017-01-01

High-grade serous ovarian cancer (HGSOC) is the most aggressive type of ovarian cancer and is responsible for most deaths caused by gynecological cancers. Numerous candidate biomarkers were identified for this disease in the last decades, but most were not sensitive or specific enough for clinical applications. Hence, new biomarkers for HGSOC are urgently required. This study aimed to identify new markers by isolating different extracellular vesicle (EV) types from the ascites of ovarian cancer patients according to their affinities for lipid-binding proteins and analyzing their protein cargo. This approach circumvents the low signal-to-noise ratio when using biological fluids for biomarker discovery and the issue of contamination by large non-EV complexes. We isolated and analyzed three distinct EV populations from the ascites of patients with ovarian cancer or cirrhosis and observed that Annexin V-binding EVs have higher levels of matrix metalloproteinase 9 in malignant compared to portal-hypertensive ascites. As this protein was not detected in other EV populations, this study validates our approach of using different EV types for optimal biomarker discovery. Furthermore, MMP9 in Annexin V-binding EVs could be a HGSOC biomarker with enhanced specificity, because its identification requires detection of two distinct components, that is, lipid and protein.

Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

PubMed Central

Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

2015-01-01

Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

Genetic Variation and Recent Positive Selection in Worldwide Human Populations: Evidence from Nearly 1 Million SNPs

PubMed Central

Theunert, Christoph; Pugach, Irina; Li, Jing; Nandineni, Madhusudan R.; Gross, Arnd; Scholz, Markus; Stoneking, Mark

2009-01-01

Background Genome-wide scans of hundreds of thousands of single-nucleotide polymorphisms (SNPs) have resulted in the identification of new susceptibility variants to common diseases and are providing new insights into the genetic structure and relationships of human populations. Moreover, genome-wide data can be used to search for signals of recent positive selection, thereby providing new insights into the genetic adaptations that occurred as modern humans spread out of Africa and around the world. Methodology We genotyped approximately 500,000 SNPs in 255 individuals (5 individuals from each of 51 worldwide populations) from the Human Genome Diversity Panel (HGDP-CEPH). When merged with non-overlapping SNPs typed previously in 250 of these same individuals, the resulting data consist of over 950,000 SNPs. We then analyzed the genetic relationships and ancestry of individuals without assigning them to populations, and we also identified candidate regions of recent positive selection at both the population and regional (continental) level. Conclusions Our analyses both confirm and extend previous studies; in particular, we highlight the impact of various dispersals, and the role of substructure in Africa, on human genetic diversity. We also identified several novel candidate regions for recent positive selection, and a gene ontology (GO) analysis identified several GO groups that were significantly enriched for such candidate genes, including immunity and defense related genes, sensory perception genes, membrane proteins, signal receptors, lipid binding/metabolism genes, and genes involved in the nervous system. Among the novel candidate genes identified are two genes involved in the thyroid hormone pathway that show signals of selection in African Pygmies that may be related to their short stature. PMID:19924308

An In-Depth Characterization of the Major Psoriasis Susceptibility Locus Identifies Candidate Susceptibility Alleles within an HLA-C Enhancer Element

PubMed Central

Clop, Alex; Bertoni, Anna; Spain, Sarah L.; Simpson, Michael A.; Pullabhatla, Venu; Tonda, Raul; Hundhausen, Christian; Di Meglio, Paola; De Jong, Pieter; Hayday, Adrian C.; Nestle, Frank O.; Barker, Jonathan N.; Bell, Robert J. A.; Capon, Francesca; Trembath, Richard C.

2013-01-01

Psoriasis is an immune-mediated skin disorder that is inherited as a complex genetic trait. Although genome-wide association scans (GWAS) have identified 36 disease susceptibility regions, more than 50% of the genetic variance can be attributed to a single Major Histocompatibility Complex (MHC) locus, known as PSORS1. Genetic studies indicate that HLA-C is the strongest PSORS1 candidate gene, since markers tagging HLA-Cw*0602 consistently generate the most significant association signals in GWAS. However, it is unclear whether HLA-Cw*0602 is itself the causal PSORS1 allele, especially as the role of SNPs that may affect its expression has not been investigated. Here, we have undertaken an in-depth molecular characterization of the PSORS1 interval, with a view to identifying regulatory variants that may contribute to disease susceptibility. By analysing high-density SNP data, we refined PSORS1 to a 179 kb region encompassing HLA-C and the neighbouring HCG27 pseudogene. We compared multiple MHC sequences spanning this refined locus and identified 144 candidate susceptibility variants, which are unique to chromosomes bearing HLA-Cw*0602. In parallel, we investigated the epigenetic profile of the critical PSORS1 interval and uncovered three enhancer elements likely to be active in T lymphocytes. Finally we showed that nine candidate susceptibility SNPs map within a HLA-C enhancer and that three of these variants co-localise with binding sites for immune-related transcription factors. These data indicate that SNPs affecting HLA-Cw*0602 expression are likely to contribute to psoriasis susceptibility and highlight the importance of integrating multiple experimental approaches in the investigation of complex genomic regions such as the MHC. PMID:23990973

A look at ligand binding thermodynamics in drug discovery.

PubMed

Claveria-Gimeno, Rafael; Vega, Sonia; Abian, Olga; Velazquez-Campoy, Adrian

2017-04-01

Drug discovery is a challenging endeavor requiring the interplay of many different research areas. Gathering information on ligand binding thermodynamics may help considerably in reducing the risk within a high uncertainty scenario, allowing early rejection of flawed compounds and pushing forward optimal candidates. In particular, the free energy, the enthalpy, and the entropy of binding provide fundamental information on the intermolecular forces driving such interaction. Areas covered: The authors review the current status and recent developments in the application of ligand binding thermodynamics in drug discovery. The thermodynamic binding profile (Gibbs energy, enthalpy, and entropy of binding) can be used for lead selection and optimization (binding enthalpy, selectivity, and adaptability). Expert opinion: Binding thermodynamics provides fundamental information on the forces driving the formation of the drug-target complex. It has been widely accepted that binding thermodynamics may be used as a decision criterion along the ligand optimization process in drug discovery and development. In particular, the binding enthalpy may be used as a guide when selecting and optimizing compounds over a set of potential candidates. However, this has been recently called into question by arguing certain difficulties and in the light of certain experimental examples.

A whole genome SNP genotyping by DNA microarray and candidate gene association study for kidney stone disease

PubMed Central

2014-01-01

Background Kidney stone disease (KSD) is a complex disorder with unknown etiology in majority of the patients. Genetic and environmental factors may cause the disease. In the present study, we used DNA microarray to genotype single nucleotide polymorphisms (SNP) and performed candidate gene association analysis to determine genetic variations associated with the disease. Methods A whole genome SNP genotyping by DNA microarray was initially conducted in 101 patients and 105 control subjects. A set of 104 candidate genes reported to be involved in KSD, gathered from public databases and candidate gene association study databases, were evaluated for their variations associated with KSD. Results Altogether 82 SNPs distributed within 22 candidate gene regions showed significant differences in SNP allele frequencies between the patient and control groups (P < 0.05). Of these, 4 genes including BGLAP, AHSG, CD44, and HAO1, encoding osteocalcin, fetuin-A, CD44-molecule and glycolate oxidase 1, respectively, were further assessed for their associations with the disease because they carried high proportion of SNPs with statistical differences of allele frequencies between the patient and control groups within the gene. The total of 26 SNPs showed significant differences of allele frequencies between the patient and control groups and haplotypes associated with disease risk were identified. The SNP rs759330 located 144 bp downstream of BGLAP where it is a predicted microRNA binding site at 3′UTR of PAQR6 – a gene encoding progestin and adipoQ receptor family member VI, was genotyped in 216 patients and 216 control subjects and found to have significant differences in its genotype and allele frequencies (P = 0.0007, OR 2.02 and P = 0.0001, OR 2.02, respectively). Conclusions Our results suggest that these candidate genes are associated with KSD and PAQR6 comes into our view as the most potent candidate since associated SNP rs759330 is located in the miRNA binding site and may affect mRNA expression level. PMID:24886237

Screening and characterization of a Annenix A2 binding aptamer that inhibits the proliferation of myeloma cells.

PubMed

Zhou, Weihua; Zhang, Yibin; Zeng, Yayue; Peng, Minyuan; Li, Hui; Sun, Shuming; Ma, Bianying; Wang, Yanpeng; Ye, Mao; Liu, Jing

2018-06-12

Multiple myeloma (MM) is a malignant plasma cell disease and is considered incurable. Annexin A2 (ANXA2) is closely related to the proliferation and adhesion of MM. Using protein-SELEX, we performed a screen for aptamers that bind GST-ANXA2 from a library, and GST protein was used for negative selection. The enrichment of the ssDNA pool was monitored by filter-binding assay during selection. After nine rounds of screening and high-throughput sequencing, we obtained six candidate aptamers that bind to the ANXA2 protein. The affinities of the candidate aptamers for ANXA2 were determined by ELONA. Binding of aptamer wh6 to the ANXA2 protein and to the MM cell was verified by aptamer pulldown experiment and flow cytometry, respectively. Aptamer wh6 binds the ANXA2 protein with good stability and has a dissociation constant in the nanomolar range. The binding specificity of aptamer wh6 was confirmed in vivo in nude mouse xenografts with MM cells and with MM bone marrow aspirates. Furthermore, aptamer wh6 can block MM cell adhesion to ANXA2 and block the proliferation of MM cells induced by ANXA2. In summary, wh6 can be considered a promising candidate tool for MM diagnosis and treatment. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Mimtags: the use of phage display technology to produce novel protein-specific probes.

PubMed

Ahmed, Nayyar; Dhanapala, Pathum; Sadli, Nadia; Barrow, Colin J; Suphioglu, Cenk

2014-03-01

In recent times the use of protein-specific probes in the field of proteomics has undergone evolutionary changes leading to the discovery of new probing techniques. Protein-specific probes serve two main purposes: epitope mapping and detection assays. One such technique is the use of phage display in the random selection of peptide mimotopes (mimtags) that can tag epitopes of proteins, replacing the use of monoclonal antibodies in detection systems. In this study, phage display technology was used to screen a random peptide library with a biologically active purified human interleukin-4 receptor (IL-4R) and interleukin-13 (IL-13) to identify mimtag candidates that interacted with these proteins. Once identified, the mimtags were commercially synthesised, biotinylated and used for in vitro immunoassays. We have used phage display to identify M13 phage clones that demonstrated specific binding to IL-4R and IL-13 cytokine. A consensus in binding sequences was observed and phage clones characterised had identical peptide sequence motifs. Only one was synthesised for use in further immunoassays, demonstrating significant binding to either IL-4R or IL-13. We have successfully shown the use of phage display to identify and characterise mimtags that specifically bind to their target epitope. Thus, this new method of probing proteins can be used in the future as a novel tool for immunoassay and detection technique, which is cheaper and more rapidly produced and therefore a better alternative to the use of monoclonal antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

Activation of Ftz-F1-Responsive Genes through Ftz/Ftz-F1 Dependent Enhancers

PubMed Central

Field, Amanda; Xiang, Jie; Anderson, W. Ray; Graham, Patricia; Pick, Leslie

2016-01-01

The orphan nuclear receptor Ftz-F1 is expressed in all somatic nuclei in Drosophila embryos, but mutations result in a pair-rule phenotype. This was explained by the interaction of Ftz-F1 with the homeodomain protein Ftz that is expressed in stripes in the primordia of segments missing in either ftz-f1 or ftz mutants. Ftz-F1 and Ftz were shown to physically interact and coordinately activate the expression of ftz itself and engrailed by synergistic binding to composite Ftz-F1/Ftz binding sites. However, attempts to identify additional target genes on the basis of Ftz-F1/ Ftz binding alone has met with only limited success. To discern rules for Ftz-F1 target site selection in vivo and to identify additional target genes, a microarray analysis was performed comparing wildtype and ftz-f1 mutant embryos. Ftz-F1-responsive genes most highly regulated included engrailed and nine additional genes expressed in patterns dependent on both ftz and ftz-f1. Candidate enhancers for these genes were identified by combining BDTNP Ftz ChIP-chip data with a computational search for Ftz-F1 binding sites. Of eight enhancer reporter genes tested in transgenic embryos, six generated expression patterns similar to the corresponding endogenous gene and expression was lost in ftz mutants. These studies identified a new set of Ftz-F1 targets, all of which are co-regulated by Ftz. Comparative analysis of enhancers containing Ftz/Ftz-F1 binding sites that were or were not bona fide targets in vivo suggested that GAF negatively regulates enhancers that contain Ftz/Ftz-F1 binding sites but are not actually utilized. These targets include other regulatory factors as well as genes involved directly in morphogenesis, providing insight into how pair-rule genes establish the body pattern. PMID:27723822

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

PubMed Central

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

2017-01-01

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

Evaluation of Selected Binding Domains for the Analysis of Ubiquitinated Proteomes

NASA Astrophysics Data System (ADS)

Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

2013-08-01

Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono- and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ~200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle.

Development of novel metabolite-responsive transcription factors via transposon-mediated protein fusion.

PubMed

Younger, Andrew K D; Su, Peter Y; Shepard, Andrea J; Udani, Shreya V; Cybulski, Thaddeus R; Tyo, Keith E J; Leonard, Joshua N

2018-02-01

Naturally evolved metabolite-responsive biosensors enable applications in metabolic engineering, ranging from screening large genetic libraries to dynamically regulating biosynthetic pathways. However, there are many metabolites for which a natural biosensor does not exist. To address this need, we developed a general method for converting metabolite-binding proteins into metabolite-responsive transcription factors-Biosensor Engineering by Random Domain Insertion (BERDI). This approach takes advantage of an in vitro transposon insertion reaction to generate all possible insertions of a DNA-binding domain into a metabolite-binding protein, followed by fluorescence activated cell sorting to isolate functional biosensors. To develop and evaluate the BERDI method, we generated a library of candidate biosensors in which a zinc finger DNA-binding domain was inserted into maltose binding protein, which served as a model well-studied metabolite-binding protein. Library diversity was characterized by several methods, a selection scheme was deployed, and ultimately several distinct and functional maltose-responsive transcriptional biosensors were identified. We hypothesize that the BERDI method comprises a generalizable strategy that may ultimately be applied to convert a wide range of metabolite-binding proteins into novel biosensors for applications in metabolic engineering and synthetic biology. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Fibrinogen-binding and platelet-aggregation activities of a Lactobacillus salivarius septicaemia isolate are mediated by a novel fibrinogen-binding protein.

PubMed

Collins, James; van Pijkeren, Jan-Peter; Svensson, Lisbeth; Claesson, Marcus J; Sturme, Mark; Li, Yin; Cooney, Jakki C; van Sinderen, Douwe; Walker, Alan W; Parkhill, Julian; Shannon, Oonagh; O'Toole, Paul W

2012-09-01

The marketplace for probiotic foods is burgeoning, measured in billions of euro per annum. It is imperative, however, that all bacterial strains are fully assessed for human safety. The ability to bind fibrinogen is considered a potential pathogenicity trait that can lead to platelet aggregation, serious medical complications, and in some instances, death. Here we examined strains from species frequently used as probiotics for their ability to bind human fibrinogen. Only one strain (CCUG 47825), a Lactobacillus salivarius isolate from a case of septicaemia, was found to strongly adhere to fibrinogen. Furthermore, this strain was found to aggregate human platelets at a level comparable to the human pathogen Staphylococcus aureus. By sequencing the genome of CCUG 47825, we were able to identify candidate genes responsible for fibrinogen binding. Complementing the genetic analysis with traditional molecular microbiological techniques enabled the identification of the novel fibrinogen receptor, CCUG_2371. Although only strain CCUG 47825 bound fibrinogen under laboratory conditions, homologues of the novel fibrinogen binding gene CCUG_2371 are widespread among L. salivarius strains, maintaining their potential to bind fibrinogen if expressed. We highlight the fact that without a full genetic analysis of strains for human consumption, potential pathogenicity traits may go undetected. © 2012 Blackwell Publishing Ltd.

Systematic analysis of copy number variation associated with congenital diaphragmatic hernia.

PubMed

Zhu, Qihui; High, Frances A; Zhang, Chengsheng; Cerveira, Eliza; Russell, Meaghan K; Longoni, Mauro; Joy, Maliackal P; Ryan, Mallory; Mil-Homens, Adam; Bellfy, Lauren; Coletti, Caroline M; Bhayani, Pooja; Hila, Regis; Wilson, Jay M; Donahoe, Patricia K; Lee, Charles

2018-05-15

Congenital diaphragmatic hernia (CDH), characterized by malformation of the diaphragm and hypoplasia of the lungs, is one of the most common and severe birth defects, and is associated with high morbidity and mortality rates. There is growing evidence demonstrating that genetic factors contribute to CDH, although the pathogenesis remains largely elusive. Single-nucleotide polymorphisms have been studied in recent whole-exome sequencing efforts, but larger copy number variants (CNVs) have not yet been studied on a large scale in a case control study. To capture CNVs within CDH candidate regions, we developed and tested a targeted array comparative genomic hybridization platform to identify CNVs within 140 regions in 196 patients and 987 healthy controls, and identified six significant CNVs that were either unique to patients or enriched in patients compared with controls. These CDH-associated CNVs reveal high-priority candidate genes including HLX , LHX1 , and HNF1B We also discuss CNVs that are present in only one patient in the cohort but have additional evidence of pathogenicity, including extremely rare large and/or de novo CNVs. The candidate genes within these predicted disease-causing CNVs form functional networks with other known CDH genes and play putative roles in DNA binding/transcription regulation and embryonic development. These data substantiate the importance of CNVs in the etiology of CDH, identify CDH candidate genes and pathways, and highlight the importance of ongoing analysis of CNVs in the study of CDH and other structural birth defects. Copyright © 2018 the Author(s). Published by PNAS.

Tracing binding modes in hit-to-lead optimization: chameleon-like poses of aspartic protease inhibitors.

PubMed

Kuhnert, Maren; Köster, Helene; Bartholomäus, Ruben; Park, Ah Young; Shahim, Amir; Heine, Andreas; Steuber, Holger; Klebe, Gerhard; Diederich, Wibke E

2015-02-23

Successful lead optimization in structure-based drug discovery depends on the correct deduction and interpretation of the underlying structure-activity relationships (SAR) to facilitate efficient decision-making on the next candidates to be synthesized. Consequently, the question arises, how frequently a binding mode (re)-validation is required, to ensure not to be misled by invalid assumptions on the binding geometry. We present an example in which minor chemical modifications within one inhibitor series lead to surprisingly different binding modes. X-ray structure determination of eight inhibitors derived from one core scaffold resulted in four different binding modes in the aspartic protease endothiapepsin, a well-established surrogate for e.g. renin and β-secretase. In addition, we suggest an empirical metrics that might serve as an indicator during lead optimization to qualify compounds as candidates for structural revalidation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

PubMed Central

2013-01-01

Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active role in its binding activity with gB. Semi flexible docking analysis of the most promising in vitro, in vivo validated anti-herpes molecules targeting the above mentioned key residues of gH-gL complex showed that all the analyzed ethno medicinal compounds have successfully docked into the proposed binding site of gH-gL glycoprotein with binding energy range between -10.4 to -6.4 K.cal./mol. Conclusions Successful repositioning of the analyzed compounds onto the proposed binding site confirms the drug targetability of gH-gL complex. Based on the free binding energy and pharmacological properties, we propose (3-chloro phenyl) methyl-3,4,5 trihydroxybenzoate as worth a small ethno medicinal lead molecule for further development as potent anti-herpes drug candidate targeting gB-gH-gL complex formation interface. PMID:23587166

Identification of Spen as a Crucial Factor for Xist Function through Forward Genetic Screening in Haploid Embryonic Stem Cells

PubMed Central

Monfort, Asun; Di Minin, Giulio; Postlmayr, Andreas; Freimann, Remo; Arieti, Fabiana; Thore, Stéphane; Wutz, Anton

2015-01-01

Summary In mammals, the noncoding Xist RNA triggers transcriptional silencing of one of the two X chromosomes in female cells. Here, we report a genetic screen for silencing factors in X chromosome inactivation using haploid mouse embryonic stem cells (ESCs) that carry an engineered selectable reporter system. This system was able to identify several candidate factors that are genetically required for chromosomal repression by Xist. Among the list of candidates, we identify the RNA-binding protein Spen, the homolog of split ends. Independent validation through gene deletion in ESCs confirms that Spen is required for gene repression by Xist. However, Spen is not required for Xist RNA localization and the recruitment of chromatin modifications, including Polycomb protein Ezh2. The identification of Spen opens avenues for further investigation into the gene-silencing pathway of Xist and shows the usefulness of haploid ESCs for genetic screening of epigenetic pathways. PMID:26190100

Recombinant expression of in silico identified Bcell epitope of epsilon toxin of Clostridium perfringens in translational fusion with a carrier protein.

PubMed

Kaushik, Himani; Deshmukh, Sachin; Mathur, Deepika Dayal; Tiwari, Archana; Garg, Lalit C

2013-01-01

Epsilon toxin secreted by Clostridium perfringens types B and D has been directly implicated as the causative agent of fatal enterotoxemia in domestic animals. The aim of the present study is to use in silico approach for identification of B-cell epitope(s) of epsilon toxin, and its expression in fusion with a carrier protein to analyze its potential as vaccine candidate(s). Using different computational analyses and bioinformatics tools, a number of antigenic determinant regions of epsilon toxin were identified. One of the B cell epitopes of epsilon toxin comprising the region (amino acids 40-62) was identified as a promising antigenic determinant. This Etx epitope (Etx40-62) was cloned and expressed as a translational fusion with B-subunit of heat labile enterotoxin (LTB) of E. coli in a secretory expression system. Similar to the native LTB, the recombinant fusion protein retained the ability to pentamerize and bind to GM1 ganglioside receptor of LTB. The rLTB.Etx40-62 could be detected both with anti-Etx and anti-LTB antisera. The rLTB.Etx40-62 fusion protein thus can be evaluated as a potential vaccine candidate against C. perfringens. aa - amino acid(s), Etx - epsilon toxin of Clostridium perfringens, LTB - B-subunit of heat labile enterotoxin of E. coli.

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Search for Rare Copy-Number Variants in Congenital Heart Defects Identifies Novel Candidate Genes and a Potential Role for FOXC1 in Patients With Coarctation of the Aorta.

PubMed

Sanchez-Castro, Marta; Eldjouzi, Hadja; Charpentier, Eric; Busson, Pierre-François; Hauet, Quentin; Lindenbaum, Pierre; Delasalle-Guyomarch, Béatrice; Baudry, Adrien; Pichon, Olivier; Pascal, Cécile; Lefort, Bruno; Bajolle, Fanny; Pezard, Philippe; Schott, Jean-Jacques; Dina, Christian; Redon, Richard; Gournay, Véronique; Bonnet, Damien; Le Caignec, Cédric

2016-02-01

Congenital heart defects are the most frequent malformations among newborns and a frequent cause of morbidity and mortality. Although genetic variation contributes to congenital heart defects, their precise molecular bases remain unknown in the majority of patients. We analyzed, by high-resolution array comparative genomic hybridization, 316 children with sporadic, nonsyndromic congenital heart defects, including 76 coarctation of the aorta, 159 transposition of the great arteries, and 81 tetralogy of Fallot, as well as their unaffected parents. We identified by array comparative genomic hybridization, and validated by quantitative real-time polymerase chain reaction, 71 rare de novo (n=8) or inherited (n=63) copy-number variants (CNVs; 50 duplications and 21 deletions) in patients. We identified 113 candidate genes for congenital heart defects within these CNVs, including BTRC, CHRNB3, CSRP2BP, ERBB2, ERMARD, GLIS3, PLN, PTPRJ, RLN3, and TCTE3. No de novo CNVs were identified in patients with transposition of the great arteries in contrast to coarctation of the aorta and tetralogy of Fallot (P=0.002; Fisher exact test). A search for transcription factor binding sites showed that 93% of the rare CNVs identified in patients with coarctation of the aorta contained at least 1 gene with FOXC1-binding sites. This significant enrichment (P<0.0001; permutation test) was not observed for the CNVs identified in patients with transposition of the great arteries and tetralogy of Fallot. We hypothesize that these CNVs may alter the expression of genes regulated by FOXC1. Foxc1 belongs to the forkhead transcription factors family, which plays a critical role in cardiovascular development in mice. These data suggest that deregulation of FOXC1 or its downstream genes play a major role in the pathogenesis of coarctation of the aorta in humans. © 2015 American Heart Association, Inc.

Proteomic analysis of cerebrospinal fluid from children with central nervous system tumors identifies candidate proteins relating to tumor metastatic spread.

PubMed

Spreafico, Filippo; Bongarzone, Italia; Pizzamiglio, Sara; Magni, Ruben; Taverna, Elena; De Bortoli, Maida; Ciniselli, Chiara M; Barzanò, Elena; Biassoni, Veronica; Luchini, Alessandra; Liotta, Lance A; Zhou, Weidong; Signore, Michele; Verderio, Paolo; Massimino, Maura

2017-07-11

Central nervous system (CNS) tumors are the most common solid tumors in childhood. Since the sensitivity of combined cerebrospinal fluid (CSF) cytology and radiological neuroimaging in detecting meningeal metastases remains relatively low, we sought to characterize the CSF proteome of patients with CSF tumors to identify biomarkers predictive of metastatic spread. CSF samples from 27 children with brain tumors and 13 controls (extra-CNS non-Hodgkin lymphoma) were processed using core-shell hydrogel nanoparticles, and analyzed with reverse-phase liquid chromatography/electrospray tandem mass spectrometry (LC-MS/MS). Candidate proteins were identified with Fisher's exact test and/or a univariate logistic regression model. Reverse phase protein array (RPPA), Western blot (WB), and ELISA were used in the training set and in an independent set of CFS samples (60 cases, 14 controls) to validate our discovery findings. Among the 558 non-redundant proteins identified by LC-MS/MS, 147 were missing from the CSF database at http://www.biosino.org. Fourteen of the 26 final top-candidate proteins were chosen for validation with WB, RPPA and ELISA methods. Six proteins (type 1 collagen, insulin-like growth factor binding protein 4, procollagen C-endopeptidase enhancer 1, glial cell-line derived neurotrophic factor receptor α2, inter-alpha-trypsin inhibitor heavy chain 4, neural proliferation and differentiation control protein-1) revealed the ability to discriminate metastatic cases from controls. Combining a unique dataset of CSFs from pediatric CNS tumors with a novel enabling nanotechnology led us to identify CSF proteins potentially related to metastatic status.

Proteomic Analysis of an α7 Nicotinic Acetylcholine Receptor Interactome

PubMed Central

Paulo, Joao A.; Brucker, William J.; Hawrot, Edward

2009-01-01

The α7 nicotinic acetylcholine receptor (nAChR) is well established as the principal high-affinity α-bungarotoxin-binding protein in the mammalian brain. We isolated carbachol-sensitive α-bungarotoxin-binding complexes from total mouse brain tissue by affinity immobilization followed by selective elution, and these proteins were fractionated by SDS-PAGE. The proteins in subdivided gel lane segments were tryptically digested, and the resulting peptides were analyzed by standard mass spectrometry. We identified 55 proteins in wild-type samples that were not present in comparable brain samples from α7 nAChR knockout mice that had been processed in a parallel fashion. Many of these 55 proteins are novel proteomic candidates for interaction partners of the α7 nAChR, and many are associated with multiple signaling pathways that may be implicated in α7 function in the central nervous system. The newly identified potential protein interactions, together with the general methodology that we introduce for α-bungarotoxin-binding protein complexes, form a new platform for many interesting follow-up studies aimed at elucidating the physiological role of neuronal α7 nAChRs. PMID:19714875

In Silico Analysis of Epitope-Based Vaccine Candidates against Hepatitis B Virus Polymerase Protein

PubMed Central

Zheng, Juzeng; Lin, Xianfan; Wang, Xiuyan; Zheng, Liyu; Lan, Songsong; Jin, Sisi; Ou, Zhanfan; Wu, Jinming

2017-01-01

Hepatitis B virus (HBV) infection has persisted as a major public health problem due to the lack of an effective treatment for those chronically infected. Therapeutic vaccination holds promise, and targeting HBV polymerase is pivotal for viral eradication. In this research, a computational approach was employed to predict suitable HBV polymerase targeting multi-peptides for vaccine candidate selection. We then performed in-depth computational analysis to evaluate the predicted epitopes’ immunogenicity, conservation, population coverage, and toxicity. Lastly, molecular docking and MHC-peptide complex stabilization assay were utilized to determine the binding energy and affinity of epitopes to the HLA-A0201 molecule. Criteria-based analysis provided four predicted epitopes, RVTGGVFLV, VSIPWTHKV, YMDDVVLGA and HLYSHPIIL. Assay results indicated the lowest binding energy and high affinity to the HLA-A0201 molecule for epitopes VSIPWTHKV and YMDDVVLGA and epitopes RVTGGVFLV and VSIPWTHKV, respectively. Regions 307 to 320 and 377 to 387 were considered to have the highest probability to be involved in B cell epitopes. The T cell and B cell epitopes identified in this study are promising targets for an epitope-focused, peptide-based HBV vaccine, and provide insight into HBV-induced immune response. PMID:28509875

Evidence that breast cancer risk at the 2q35 locus is mediated through IGFBP5 regulation

PubMed Central

Ghoussaini, Maya; Edwards, Stacey L.; Michailidou, Kyriaki; Nord, Silje; Cowper-Sal·lari, Richard; Desai, Kinjal; Kar, Siddhartha; Hillman, Kristine M.; Kaufmann, Susanne; Glubb, Dylan M.; Beesley, Jonathan; Dennis, Joe; Bolla, Manjeet K.; Wang, Qin; Dicks, Ed; Guo, Qi; Schmidt, Marjanka K.; Shah, Mitul; Luben, Robert; Brown, Judith; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Klevebring, Daniel; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Lambrechts, Diether; Thienpont, Bernard; Neven, Patrick; Wildiers, Hans; Broeks, Annegien; Van’t Veer, Laura J.; Th Rutgers, Emiel J.; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Peto, Julian; dos-Santos-Silva, Isabel; Gibson, Lorna; Nevanlinna, Heli; Muranen, Taru A.; Aittomäki, Kristiina; Blomqvist, Carl; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Benitez, Javier; Zamora, M. Pilar; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Qiuyin; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Tchatchou, Sandrine; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Lindblom, Annika; Margolin, Sara; TEO, Soo Hwang; YIP, Cheng Har; Lee, Daphne S. C.; Wong, Tien Y.; Hooning, Maartje J.; Martens, John W. M.; Collée, J. Margriet; van Deurzen, Carolien H. M.; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Kapuscinski, Miroslav K.; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Chen, Shou-Tung; Alnæs, Grethe Grenaker; Borresen-Dale, Anne-Lise; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Buhari, Shaik Ahmad Bin Syed; Teo, Yik Ying; Fasching, Peter A.; Haeberle, Lothar; Ekici, Arif B.; Beckmann, Matthias W.; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Brauch, Hiltrud; Brüning, Thomas; Koto, Yon-Dschun; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Volorio, Sara; Dörk, Thilo; Bogdanova, Natalia V.; Helbig, Sonja; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; Van Asperen, Christi J.; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Hamann, Ute; Torres, Diana; Zheng, Wei; Long, Jirong; Anton-Culver, Hoda; Neuhausen, Susan L.; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S.; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Álvarez, Nuria; Herrero, Daniel; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; de Santiago, Ines; Carroll, Jason; Caldas, Carlos; Brown, Melissa A.; Lupien, Mathieu; Kristensen, Vessela N.; Pharoah, Paul D P; Chenevix-Trench, Georgia; French, Juliet D; Easton, Douglas F.; Dunning, Alison M.; Chenevix-Trench, Georgia; Webb, Penny; Bowtell, David; De Fazio, Anna

2014-01-01

GWAS have identified a breast cancer susceptibility locus on 2q35. Here we report the fine mapping of this locus using data from 101,943 subjects from 50 case-control studies. We genotype 276 SNPs using the ‘iCOGS’ genotyping array and impute genotypes for a further 1,284 using 1000 Genomes Project data. All but two, strongly correlated SNPs (rs4442975 G/T and rs6721996 G/A) are excluded as candidate causal variants at odds against >100:1. The best functional candidate, rs4442975, is associated with oestrogen receptor positive (ER+) disease with an odds ratio (OR) in Europeans of 0.85 (95% confidence interval=0.84−0.87; P=1.7 × 10−43) per t-allele. This SNP flanks a transcriptional enhancer that physically interacts with the promoter of IGFBP5 (encoding insulin-like growth factor-binding protein 5) and displays allele-specific gene expression, FOXA1 binding and chromatin looping. Evidence suggests that the g-allele confers increased breast cancer susceptibility through relative downregulation of IGFBP5, a gene with known roles in breast cell biology. PMID:25248036

Identification and Characterization of Pheromone Receptors and Interplay between Receptors and Pheromone Binding Proteins in the Diamondback Moth, Plutella xyllostella

PubMed Central

Sun, Mengjing; Liu, Yang; Walker, William B.; Liu, Chengcheng; Lin, Kejian; Gu, Shaohua; Zhang, Yongjun; Zhou, Jingjiang; Wang, Guirong

2013-01-01

Moths depend on olfactory cues such as sex pheromones to find and recognize mating partners. Pheromone receptors (PRs) and Pheromone binding proteins (PBPs) are thought to be associated with olfactory signal transduction of pheromonal compounds in peripheral olfactory reception. Here six candidate pheromone receptor genes in the diamondback moth, Plutella xyllostella were identified and cloned. All of the six candidate PR genes display male-biased expression, which is a typical characteristic of pheromone receptors. In the Xenopus-based functional study and in situ hybridization, PxylOR4 is defined as another pheromone receptor in addition to the previously characterized PxylOR1. In the study of interaction between PRs and PBPs, PxylPBPs could increase the sensitivity of the complex expressing oocyte cells to the ligand pheromone component while decreasing the sensitivity to pheromone analogs. We deduce that activating pheromone receptors in olfactory receptor neurons requires some role of PBPs to pheromone/PBP complex. If the chemical signal is not the pheromone component, but instead, a pheromone analog with a similar structure, the complex would have a decreased ability to activate downstream pheromone receptors. PMID:23626773

Protective immunity provided by a new modified SERA protein peptide: its immunogenetic characteristics and correlation with 3D structure.

PubMed

Bermúdez, Adriana; Moreno-Vranich, Armando; Patarroyo, Manuel E

2012-07-01

The serine repeat antigen (SERA) protein is a leading candidate molecule for inclusion as a component in a multi-antigen, multi-stage, minimal subunit-based, chemically synthesised anti-malarial vaccine. Peptides having high red blood cell binding affinity (known as HABPs) have been identified in this protein. The 6733 HABP was located in the C-terminal portion of the 47-kDa fragment while HABP 6754 was located in the C-terminal region of the 56-kDa fragment. These conserved HABPs failed to induce an immune response. Critical red blood cell binding residues and/or their neighbours (assessed by glycine-analogue scanning) were replaced by others having the same mass, volume and surface but different polarity, rendering some of them highly immunogenic when assessed by antibody production against the parasite or its proteins and protection-inducers against experimental challenge with a highly infectious Aotus monkey-adapted Plasmodium falciparum strain. This manuscript presents some modified HABPs as vaccine candidate components for enriching our tailor-made anti-malarial vaccine repertoire, as well as their 3D structure obtained by 1H-NMR displaying a short-structured region, differently from the native ones having random structures.

Analysis of ligand-protein exchange by Clustering of Ligand Diffusion Coefficient Pairs (CoLD-CoP)

NASA Astrophysics Data System (ADS)

Snyder, David A.; Chantova, Mihaela; Chaudhry, Saadia

2015-06-01

NMR spectroscopy is a powerful tool in describing protein structures and protein activity for pharmaceutical and biochemical development. This study describes a method to determine weak binding ligands in biological systems by using hierarchic diffusion coefficient clustering of multidimensional data obtained with a 400 MHz Bruker NMR. Comparison of DOSY spectrums of ligands of the chemical library in the presence and absence of target proteins show translational diffusion rates for small molecules upon interaction with macromolecules. For weak binders such as compounds found in fragment libraries, changes in diffusion rates upon macromolecular binding are on the order of the precision of DOSY diffusion measurements, and identifying such subtle shifts in diffusion requires careful statistical analysis. The "CoLD-CoP" (Clustering of Ligand Diffusion Coefficient Pairs) method presented here uses SAHN clustering to identify protein-binders in a chemical library or even a not fully characterized metabolite mixture. We will show how DOSY NMR and the "CoLD-CoP" method complement each other in identifying the most suitable candidates for lysozyme and wheat germ acid phosphatase.

Identification of small molecular ligands as potent inhibitors of fatty acid metabolism in Mycobacterium tuberculosis

NASA Astrophysics Data System (ADS)

Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma

2017-12-01

Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.

Antihelminthic benzimidazoles are novel HIF activators that prevent oxidative neuronal death via binding to tubulin.

PubMed

Aleyasin, Hossein; Karuppagounder, Saravanan S; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L; Riggins, Gregory J; Gazaryan, Irina; Starkov, Anatoly A; Andersen, Julie K; Ratan, Rajiv R

2015-01-10

Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21(cip1/waf1), in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke.

Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

PubMed

Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

2017-04-17

Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

Generation of the first structure-based pharmacophore model containing a selective "zinc binding group" feature to identify potential glyoxalase-1 inhibitors.

PubMed

Al-Balas, Qosay; Hassan, Mohammad; Al-Oudat, Buthina; Alzoubi, Hassan; Mhaidat, Nizar; Almaaytah, Ammar

2012-11-22

Within this study, a unique 3D structure-based pharmacophore model of the enzyme glyoxalase-1 (Glo-1) has been revealed. Glo-1 is considered a zinc metalloenzyme in which the inhibitor binding with zinc atom at the active site is crucial. To our knowledge, this is the first pharmacophore model that has a selective feature for a "zinc binding group" which has been customized within the structure-based pharmacophore model of Glo-1 to extract ligands that possess functional groups able to bind zinc atom solely from database screening. In addition, an extensive 2D similarity search using three diverse similarity techniques (Tanimoto, Dice, Cosine) has been performed over the commercially available "Zinc Clean Drug-Like Database" that contains around 10 million compounds to help find suitable inhibitors for this enzyme based on known inhibitors from the literature. The resultant hits were mapped over the structure based pharmacophore and the successful hits were further docked using three docking programs with different pose fitting and scoring techniques (GOLD, LibDock, CDOCKER). Nine candidates were suggested to be novel Glo-1 inhibitors containing the "zinc binding group" with the highest consensus scoring from docking.

ZP Domain Proteins in the Abalone Egg Coat Include a Paralog of VERL under Positive Selection That Binds Lysin and 18-kDa Sperm Proteins

PubMed Central

Aagaard, Jan E.; Vacquier, Victor D.; MacCoss, Michael J.; Swanson, Willie J.

2010-01-01

Identifying fertilization molecules is key to our understanding of reproductive biology, yet only a few examples of interacting sperm and egg proteins are known. One of the best characterized comes from the invertebrate archeogastropod abalone (Haliotis spp.), where sperm lysin mediates passage through the protective egg vitelline envelope (VE) by binding to the VE protein vitelline envelope receptor for lysin (VERL). Rapid adaptive divergence of abalone lysin and VERL are an example of positive selection on interacting fertilization proteins contributing to reproductive isolation. Previously, we characterized a subset of the abalone VE proteins that share a structural feature, the zona pellucida (ZP) domain, which is common to VERL and the egg envelopes of vertebrates. Here, we use additional expressed sequence tag sequencing and shotgun proteomics to characterize this family of proteins in the abalone egg VE. We expand 3-fold the number of known ZP domain proteins present within the VE (now 30 in total) and identify a paralog of VERL (vitelline envelope zona pellucida domain protein [VEZP] 14) that contains a putative lysin-binding motif. We find that, like VERL, the divergence of VEZP14 among abalone species is driven by positive selection on the lysin-binding motif alone and that these paralogous egg VE proteins bind a similar set of sperm proteins including a rapidly evolving 18-kDa paralog of lysin, which may mediate sperm–egg fusion. This work identifies an egg coat paralog of VERL under positive selection and the candidate sperm proteins with which it may interact during abalone fertilization. PMID:19767347

Discovery of a Manduca sexta Allatotropin Antagonist from a Manduca sexta Allatotropin Receptor Homology Model.

PubMed

Kai, Zhen-Peng; Zhu, Jing-Jing; Deng, Xi-Le; Yang, Xin-Ling; Chen, Shan-Shan

2018-04-03

Insect G protein coupled receptors (GPCRs) have important roles in modulating biology, physiology and behavior. They have been identified as candidate targets for next-generation insecticides, yet these targets have been relatively poorly exploited for insect control. In this study, we present a pipeline of novel Manduca sexta allatotropin (Manse-AT) antagonist discovery with homology modeling, docking, molecular dynamics simulation and structure-activity relationship. A series of truncated and alanine-replacement analogs of Manse-AT were assayed for the stimulation of juvenile hormone biosynthesis. The minimum sequence required to retain potent biological activity is the C -terminal amidated octapeptide Manse-AT (6-13). We identified three residues essential for bioactivity (Thr⁴, Arg6 and Phe⁸) by assaying alanine-replacement analogs of Manse-AT (6-13). Alanine replacement of other residues resulted in reduced potency but bioactivity was retained. The 3D structure of the receptor (Manse-ATR) was built and the binding pocket was identified. The binding affinities of all the analogs were estimated by calculating the free energy of binding. The calculated binding affinities corresponded to the biological activities of the analogs, which supporting our localization of the binding pocket. Then, based on the docking and molecular dynamics studies of Manse-AT (10-13), we described it can act as a potent Manse-AT antagonist. The antagonistic effect on JH biosynthesis of Manse-AT (10-13) validated our hypothesis. The IC 50 value of antagonist Manse-AT (10-13) is 0.9 nM. The structure-activity relationship of antagonist Manse-AT (10-13) was also studied for the further purpose of investigating theoretically the structure factors influencing activity. These data will be useful for the design of new Manse-AT agonist and antagonist as potential pest control agents.

Pharmacophore-based virtual screening, biological evaluation and binding mode analysis of a novel protease-activated receptor 2 antagonist

NASA Astrophysics Data System (ADS)

Cho, Nam-Chul; Seo, Seoung-Hwan; Kim, Dohee; Shin, Ji-Sun; Ju, Jeongmin; Seong, Jihye; Seo, Seon Hee; Lee, Iiyoun; Lee, Kyung-Tae; Kim, Yun Kyung; No, Kyoung Tai; Pae, Ae Nim

2016-08-01

Protease-activated receptor 2 (PAR2) is a G protein-coupled receptor, mediating inflammation and pain signaling in neurons, thus it is considered to be a potential therapeutic target for inflammatory diseases. In this study, we performed a ligand-based virtual screening of 1.6 million compounds by employing a common-feature pharmacophore model and two-dimensional similarity search to identify a new PAR2 antagonist. The common-feature pharmacophore model was established based on the biological screening results of our in-house library. The initial virtual screening yielded a total number of 47 hits, and additional biological activity tests including PAR2 antagonism and anti-inflammatory effects resulted in a promising candidate, compound 43, which demonstrated an IC50 value of 8.22 µM against PAR2. In next step, a PAR2 homology model was constructed using the crystal structure of the PAR1 as a template to explore the binding mode of the identified ligands. A molecular docking method was optimized by comparing the binding modes of a known PAR2 agonist GB110 and antagonist GB83, and applied to predict the binding mode of our hit compound 43. In-depth docking analyses revealed that the hydrophobic interaction with Phe2435.39 is crucial for PAR2 ligands to exert antagonistic activity. MD simulation results supported the predicted docking poses that PAR2 antagonist blocked a conformational rearrangement of Na+ allosteric site in contrast to PAR2 agonist that showed Na+ relocation upon GPCR activation. In conclusion, we identified new a PAR2 antagonist together with its binding mode, which provides useful insights for the design and development of PAR2 ligands.

Using Hierarchical Virtual Screening To Combat Drug Resistance of the HIV-1 Protease.

PubMed

Li, Nan; Ainsworth, Richard I; Ding, Bo; Hou, Tingjun; Wang, Wei

2015-07-27

Human immunodeficiency virus (HIV) protease inhibitors (PIs) are important components of highly active anti-retroviral therapy (HAART) that block the catalytic site of HIV protease, thus preventing maturation of the HIV virion. However, with two decades of PI prescriptions in clinical practice, drug-resistant HIV mutants have now been found for all of the PI drugs. Therefore, the continuous development of new PI drugs is crucial both to combat the existing drug-resistant HIV strains and to provide treatments for future patients. Here we purpose an HIV PI drug design strategy to select candidate PIs with binding energy distributions dominated by interactions with conserved protease residues in both wild-type and various drug-resistant mutants. On the basis of this strategy, we have constructed a virtual screening pipeline including combinatorial library construction, combinatorial docking, MM/GBSA-based rescoring, and reranking on the basis of the binding energy distribution. We have tested our strategy on lopinavir by modifying its two functional groups. From an initial 751 689 candidate molecules, 18 candidate inhibitors were selected using the pipeline for experimental validation. IC50 measurements and drug resistance predictions successfully identified two ligands with both HIV protease inhibitor activity and an improved drug resistance profile on 2382 HIV mutants. This study provides a proof of concept for the integration of MM/GBSA energy analysis and drug resistance information at the stage of virtual screening and sheds light on future HIV drug design and the use of virtual screening to combat drug resistance.

SMOC Binds to Pro-EGF, but Does Not Induce Erk Phosphorylation via the EGFR.

PubMed

Thomas, J Terrig; Chhuy-Hy, Lina; Andrykovich, Kristin R; Moos, Malcolm

2016-01-01

In an attempt to identify the cell-associated protein(s) through which SMOC (Secreted Modular Calcium binding protein) induces mitogen-activated protein kinase (MAPK) signaling, the epidermal growth factor receptor (EGFR) became a candidate. However, although in 32D/EGFR cells, the EGFR was phosphorylated in the presence of a commercially available human SMOC-1 (hSMOC-1), only minimal phosphorylation was observed in the presence of Xenopus SMOC-1 (XSMOC-1) or human SMOC-2. Analysis of the commercial hSMOC-1 product demonstrated the presence of pro-EGF as an impurity. When the pro-EGF was removed, only minimal EGFR activation was observed, indicating that SMOC does not signal primarily through EGFR and its receptor remains unidentified. Investigation of SMOC/pro-EGF binding affinity revealed a strong interaction that does not require the C-terminal extracellular calcium-binding (EC) domain of SMOC or the EGF domain of pro-EGF. SMOC does not appear to potentiate or inhibit MAPK signaling in response to pro-EGF, but the interaction could provide a mechanism for retaining soluble pro-EGF at the cell surface.

Database of cattle candidate genes and genetic markers for milk production and mastitis

PubMed Central

Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

2009-01-01

A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

Jenner-predict server: prediction of protein vaccine candidates (PVCs) in bacteria based on host-pathogen interactions

PubMed Central

2013-01-01

Background Subunit vaccines based on recombinant proteins have been effective in preventing infectious diseases and are expected to meet the demands of future vaccine development. Computational approach, especially reverse vaccinology (RV) method has enormous potential for identification of protein vaccine candidates (PVCs) from a proteome. The existing protective antigen prediction software and web servers have low prediction accuracy leading to limited applications for vaccine development. Besides machine learning techniques, those software and web servers have considered only protein’s adhesin-likeliness as criterion for identification of PVCs. Several non-adhesin functional classes of proteins involved in host-pathogen interactions and pathogenesis are known to provide protection against bacterial infections. Therefore, knowledge of bacterial pathogenesis has potential to identify PVCs. Results A web server, Jenner-Predict, has been developed for prediction of PVCs from proteomes of bacterial pathogens. The web server targets host-pathogen interactions and pathogenesis by considering known functional domains from protein classes such as adhesin, virulence, invasin, porin, flagellin, colonization, toxin, choline-binding, penicillin-binding, transferring-binding, fibronectin-binding and solute-binding. It predicts non-cytosolic proteins containing above domains as PVCs. It also provides vaccine potential of PVCs in terms of their possible immunogenicity by comparing with experimentally known IEDB epitopes, absence of autoimmunity and conservation in different strains. Predicted PVCs are prioritized so that only few prospective PVCs could be validated experimentally. The performance of web server was evaluated against known protective antigens from diverse classes of bacteria reported in Protegen database and datasets used for VaxiJen server development. The web server efficiently predicted known vaccine candidates reported from Streptococcus pneumoniae and Escherichia coli proteomes. The Jenner-Predict server outperformed NERVE, Vaxign and VaxiJen methods. It has sensitivity of 0.774 and 0.711 for Protegen and VaxiJen dataset, respectively while specificity of 0.940 has been obtained for the latter dataset. Conclusions Better prediction accuracy of Jenner-Predict web server signifies that domains involved in host-pathogen interactions and pathogenesis are better criteria for prediction of PVCs. The web server has successfully predicted maximum known PVCs belonging to different functional classes. Jenner-Predict server is freely accessible at http://117.211.115.67/vaccine/home.html PMID:23815072

Identification of UQCRB as an oxymatrine recognizing protein using a T7 phage display screen.

PubMed

Sun, Yan-Hui; Zhang, Xiao-Yuan; Xie, Wei-Qun; Liu, Guang-Jian; He, Xi-Xin; Huang, Ya-Li; Zhang, Guang-Xian; Wang, Jian; Kuang, Zao-Yuan; Zhang, Ren

2016-12-04

Sophora flavescens Aiton (Radix Sophorae Flavescentis, Kushen) is used in traditional Chinese medicine to treat chronic hepatitis B (CHB), and has the ability to clear heat and dampness from the body. Oxymatrine is one of the major bioactive compounds extracted from Sophora flavescens Aiton and constitutes more than 90% of the oxymatrine injection commonly used for CHB treatment in clinics in China. We aim to analyze the protein binding target of oxymatrine in treating CHB by screening a T7 phage display cDNA library of human CHB and examine the biochemistry of protein-ligand binding between oxymatrine and its ligands. A T7 phage cDNA library of human CHB was biopanned by affinity selection using oxymatrine as bait. The interaction of oxymatrine with its candidate binding protein was investigated by affinity assay, molecular docking, Isothermal Titration Calorimetry (ITC) and Surface Plasmon Resonance (SPR). A library of potential oxymatrine binding peptides was generated. Ubiquinol-cytochrome c reductase binding protein (UQCRB) was one of the candidate binding proteins of oxymatrine. UQCRB-displaying T7 phage binding numbers in the oxymatrine group were significantly higher than that in the control group, biotin group, and matrine group (p<0.05 or p<0.01). Three-dimensional structure modeling of the UQCRB with oxymatrine showed that their binding interfaces matched and oxymatrine inserted into a deeper pocket of UQCRB, which mainly involved amino acid residues Tyr21, Arg33, Tyr83, Glu84, Asp86, Pro88, and Glu91. The binding affinity constant (Kb) from SPR was 4.2mM. The Kb from ITC experiment was 3.9mM and stoichiometry was fixed as 1, which fit very well with the result of SPR. The binding of oxymatrine to UQCRB was driven by strong enthalpy forces such as hydrogen bonds and polar interactions as the heat released was about 157kcal/mol and ΔG was less than zero. In this study, using the T7 phage display system, we have identified UQCRB as a direct binding protein of oxymatrine. Furthermore, the specificity and molecular interaction of oxymatrine with UQCRB were also determined. The binding of UQCRB to oxymatrine suggests that UQCRB is a potential target of oxymatrine in treating CHB. These results provide new understanding into the mechanism of oxymatrine and insights into the strategy on the treatment of CHB. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Micro-ribonucleic acid-binding site variants of type 2 diabetes candidate loci predispose to gestational diabetes mellitus in Chinese Han women.

PubMed

Wang, Xiaojing; Li, Wei; Ma, Liangkun; Ping, Fan; Liu, Juntao; Wu, Xueyan; Mao, Jiangfeng; Wang, Xi; Nie, Min

2018-01-20

Emerging evidence has suggested that the genetic background of gestational diabetes mellitus (GDM) was analogous to type 2 diabetes mellitus. In contrast to type 2 diabetes mellitus, the genetic studies for GDM were limited. Accordingly, the aim of the present study was to extensively explore the influence of micro-ribonucleic acid-binding single-nucleotide polymorphisms (SNPs) in type 2 diabetes mellitus candidate loci on GDM susceptibility in Chinese. A total of 839 GDM patients and 900 controls were enrolled. Six micro-ribonucleic acid-binding SNPs were selected from 30 type 2 diabetes mellitus susceptibility loci and genotyped using TaqMan allelic discrimination assays. The minor allele of three SNPs, PAX4 rs712699 (OR 1.366, 95% confidence interval 1.021-1.828, P = 0.036), KCNB1 rs1051295 (OR 1.579, 95% confidence interval 1.172-2.128, P = 0.003) and MFN2 rs1042842 (OR 1.398, 95% confidence interval 1.050-1.862, P = 0.022) were identified to significantly confer higher a risk of GDM in the additive model. The association between rs1051295 and increased fasting plasma glucose (b = 0.006, P = 0.008), 3-h oral glucose tolerance test plasma glucose (b = 0.058, P = 0.025) and homeostatic model assessment of insulin resistance (b = 0.065, P = 0.017) was also shown. Rs1042842 was correlated with higher 3-h oral glucose tolerance test plasma glucose (b = 0.056, P = 0.028). However, no significant correlation between the other included SNPs (LPIN1 rs1050800, VPS26A rs1802295 and NLRP3 rs10802502) and GDM susceptibility were observed. The present findings showed that micro-ribonucleic acid-binding SNPs in type 2 diabetes mellitus candidate loci were also associated with GDM susceptibility, which further highlighted the similar genetic basis underlying GDM and type 2 diabetes mellitus. © 2018 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

The Application of a Three-Step Proteome Analysis for Identification of New Biomarkers of Pancreatic Cancer

PubMed Central

Abulaizi, Mayinuer; Tomonaga, Takeshi; Satoh, Mamoru; Sogawa, Kazuyuki; Matsushita, Kazuyuki; Kodera, Yoshio; Obul, Jurat; Takano, Shigetsugu; Yoshitomi, Hideyuki; Miyazaki, Masaru; Nomura, Fumio

2011-01-01

We searched for novel tumor markers of pancreatic cancer by three-step serum proteome analysis. Twelve serum abundant proteins were depleted using immunoaffinity columns followed by fractionation by reverse-phase high-performance liquid chromatography. Proteins in each fraction were separated by two-dimensional gel electrophoresis. Then the gel was stained by Coomassie Brilliant Blue. Protein spots in which the expression levels were significantly different between cancer and normal control were identified by LC-MS/MS. One hundred and two spots were upregulated, and 84 spots were downregulated in serum samples obtained from patients with pancreatic cancers, and 58 proteins were identified by mass spectrometry. These candidate proteins were validated using western blot analysis and enzyme-linked immunosorbent assay (ELISA). As a result of these validation process, we could confirm that the serum levels of apolipoprotein A-IV, vitamin D-binding protein, plasma retinol-binding protein 4, and tetranectin were significantly decreased in patients with pancreatic cancer. PMID:22091389

Asymmetric segregation of the double-stranded RNA binding protein Staufen2 during mammalian neural stem cell divisions promotes lineage progression.

PubMed

Kusek, Gretchen; Campbell, Melissa; Doyle, Frank; Tenenbaum, Scott A; Kiebler, Michael; Temple, Sally

2012-10-05

Asymmetric cell divisions are a fundamental feature of neural development, and misregulation can lead to brain abnormalities or tumor formation. During an asymmetric cell division, molecular determinants are segregated preferentially into one daughter cell to specify its fate. An important goal is to identify the asymmetric determinants in neural progenitor cells, which could be tumor suppressors or inducers of specific neural fates. Here, we show that the double-stranded RNA-binding protein Stau2 is distributed asymmetrically during progenitor divisions in the developing mouse cortex, preferentially segregating into the Tbr2(+) neuroblast daughter, taking with it a subset of RNAs. Knockdown of Stau2 stimulates differentiation and overexpression produces periventricular neuronal masses, demonstrating its functional importance for normal cortical development. We immunoprecipitated Stau2 to examine its cargo mRNAs, and found enrichment for known asymmetric and basal cell determinants, such as Trim32, and identified candidates, including a subset involved in primary cilium function. Copyright © 2012 Elsevier Inc. All rights reserved.

Asymmetric Segregation of the Double-Stranded RNA Binding Protein Staufen2 during Mammalian Neural Stem Cell Divisions Promotes Lineage Progression

PubMed Central

Kusek, Gretchen; Campbell, Melissa; Doyle, Frank; Tenenbaum, Scott A.; Kiebler, Michael; Temple, Sally

2012-01-01

Summary Asymmetric cell divisions are a fundamental feature of neural development, and misregulation can lead to brain abnormalities or tumor formation. During an asymmetric cell division, molecular determinants are segregated preferentially into one daughter cell to specify its fate. An important goal is to identify the asymmetric determinants in neural progenitor cells, which could be tumor suppressors or inducers of specific neural fates. Here we show that the double-stranded RNA-binding protein Stau2 is distributed asymmetrically during progenitor divisions in the developing mouse cortex, preferentially segregating into the Tbr2+ neuroblast daughter, taking with it a sub-set of RNAs. Knockdown of Stau2 stimulates differentiation and over-expression produces periventricular neuronal masses, demonstrating its functional importance for normal cortical development. We immunoprecipitated Stau2 to examine its cargo mRNAs, and found enrichment for known asymmetric and basal cell determinants, such as Trim32, and identified novel candidates, including a subset involved in primary cilium function. PMID:22902295

ABCE1 Is a Highly Conserved RNA Silencing Suppressor

PubMed Central

Kärblane, Kairi; Gerassimenko, Jelena; Nigul, Lenne; Piirsoo, Alla; Smialowska, Agata; Vinkel, Kadri; Kylsten, Per; Ekwall, Karl; Swoboda, Peter; Truve, Erkki; Sarmiento, Cecilia

2015-01-01

ATP-binding cassette sub-family E member 1 (ABCE1) is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference. PMID:25659154

Identification of curcumin derivatives as human LMTK3 inhibitors for breast cancer: a docking, dynamics, and MM/PBSA approach.

PubMed

Anbarasu, K; Jayanthi, S

2018-05-01

Human lemur tyrosine kinase-3 (LMTK3) is primarily involved in regulation of estrogen receptor-α (ERα) by phosphorylation activity. LMTK3 acts as key biomarker for ERα positive breast cancer and identified as novel drug target for breast cancer. Due to the absence of experimental reports, the computational approach has been followed to screen LMTK3 inhibitors from natural product curcumin derivatives based on rational inhibitor design. The initial virtual screening and re-docking resulted in identification of top three leads with favorable binding energy and strong interactions in critical residues of ATP-binding cavity. ADME prediction confirmed the pharmacological activity of the leads with various properties. The stability and binding affinity of leads were well refined in dynamic system from 25 ns MD simulations. The behavior of protein motion towards closure of ATP-binding cavity was evaluated based on eigenvectors by PCA. In addition, MM/PBSA calculations also confirmed the relative binding free energy of LMTK3-lead complexes in favor of the effective binding. From our study, novel LMTK3 inhibitors tetrahydrocurcumin, curcumin 4,4'-diacetate, and demethoxycurcumin have been proposed with inhibition mechanism. Further experimental evaluation on reported lead candidates might prove its role in breast cancer therapeutics.

Binding of novel fullerene inhibitors to HIV-1 protease: insight through molecular dynamics and molecular mechanics Poisson-Boltzmann surface area calculations

NASA Astrophysics Data System (ADS)

Tzoupis, Haralambos; Leonis, Georgios; Durdagi, Serdar; Mouchlis, Varnavas; Mavromoustakos, Thomas; Papadopoulos, Manthos G.

2011-10-01

The objectives of this study include the design of a series of novel fullerene-based inhibitors for HIV-1 protease (HIV-1 PR), by employing two strategies that can also be applied to the design of inhibitors for any other target. Additionally, the interactions which contribute to the observed exceptionally high binding free energies were analyzed. In particular, we investigated: (1) hydrogen bonding (H-bond) interactions between specific fullerene derivatives and the protease, (2) the regions of HIV-1 PR that play a significant role in binding, (3) protease changes upon binding and (4) various contributions to the binding free energy, in order to identify the most significant of them. This study has been performed by employing a docking technique, two 3D-QSAR models, molecular dynamics (MD) simulations and the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method. Our computed binding free energies are in satisfactory agreement with the experimental results. The suitability of specific fullerene derivatives as drug candidates was further enhanced, after ADMET (absorption, distribution, metabolism, excretion and toxicity) properties have been estimated to be promising. The outcomes of this study revealed important protein-ligand interaction patterns that may lead towards the development of novel, potent HIV-1 PR inhibitors.

Protein Arms in the Kinetochore-Microtubule Interface of the Yeast DASH Complex

PubMed Central

Miranda, JJ L.; King, David S.

2007-01-01

The yeast DASH complex is a heterodecameric component of the kinetochore necessary for accurate chromosome segregation. DASH forms closed rings around microtubules with a large gap between the DASH ring and the microtubule cylinder. We characterized the microtubule-binding properties of limited proteolysis products and subcomplexes of DASH, thus identifying candidate polypeptide extensions involved in establishing the DASH-microtubule interface. The acidic C-terminal extensions of tubulin subunits are not essential for DASH binding. We also measured the molecular mass of DASH rings on microtubules with scanning transmission electron microscopy and found that approximately 25 DASH heterodecamers assemble to form each ring. Dynamic association and relocation of multiple flexible appendages of DASH may allow the kinetochore to translate along the microtubule surface. PMID:17460120

Discovery of DNA repair inhibitors by combinatorial library profiling

PubMed Central

Moeller, Benjamin J.; Sidman, Richard L.; Pasqualini, Renata; Arap, Wadih

2011-01-01

Small molecule inhibitors of DNA repair are emerging as potent and selective anti-cancer therapies, but the sheer magnitude of the protein networks involved in DNA repair processes poses obstacles to discovery of effective candidate drugs. To address this challenge, we used a subtractive combinatorial selection approach to identify a panel of peptide ligands that bind DNA repair complexes. Supporting the concept that these ligands have therapeutic potential, we show that one selected peptide specifically binds and non-competitively inactivates DNA-PKcs, a protein kinase critical in double-strand DNA break repair. In doing so, this ligand sensitizes BRCA-deficient tumor cells to genotoxic therapy. Our findings establish a platform for large-scale parallel screening for ligand-directed DNA repair inhibitors, with immediate applicability to cancer therapy. PMID:21343400

Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon

PubMed Central

Rodionov, Dmitry A.; Li, Xiaoqing; Rodionova, Irina A.; Yang, Chen; Sorci, Leonardo; Dervyn, Etienne; Martynowski, Dariusz; Zhang, Hong; Gelfand, Mikhail S.; Osterman, Andrei L.

2008-01-01

A comparative genomic approach was used to reconstruct transcriptional regulation of NAD biosynthesis in bacteria containing orthologs of Bacillus subtilis gene yrxA, a previously identified niacin-responsive repressor of NAD de novo synthesis. Members of YrxA family (re-named here NiaR) are broadly conserved in the Bacillus/Clostridium group and in the deeply branching Fusobacteria and Thermotogales lineages. We analyzed upstream regions of genes associated with NAD biosynthesis to identify candidate NiaR-binding DNA motifs and assess the NiaR regulon content in these species. Representatives of the two distinct types of candidate NiaR-binding sites, characteristic of the Firmicutes and Thermotogales, were verified by an electrophoretic mobility shift assay. In addition to transcriptional control of the nadABC genes, the NiaR regulon in some species extends to niacin salvage (the pncAB genes) and includes uncharacterized membrane proteins possibly involved in niacin transport. The involvement in niacin uptake proposed for one of these proteins (re-named NiaP), encoded by the B. subtilis gene yceI, was experimentally verified. In addition to bacteria, members of the NiaP family are conserved in multicellular eukaryotes, including human, pointing to possible NaiP involvement in niacin utilization in these organisms. Overall, the analysis of the NiaR and NrtR regulons (described in the accompanying paper) revealed mechanisms of transcriptional regulation of NAD metabolism in nearly a hundred diverse bacteria. PMID:18276644

Automatic design of decision-tree induction algorithms tailored to flexible-receptor docking data.

PubMed

Barros, Rodrigo C; Winck, Ana T; Machado, Karina S; Basgalupp, Márcio P; de Carvalho, André C P L F; Ruiz, Duncan D; de Souza, Osmar Norberto

2012-11-21

This paper addresses the prediction of the free energy of binding of a drug candidate with enzyme InhA associated with Mycobacterium tuberculosis. This problem is found within rational drug design, where interactions between drug candidates and target proteins are verified through molecular docking simulations. In this application, it is important not only to correctly predict the free energy of binding, but also to provide a comprehensible model that could be validated by a domain specialist. Decision-tree induction algorithms have been successfully used in drug-design related applications, specially considering that decision trees are simple to understand, interpret, and validate. There are several decision-tree induction algorithms available for general-use, but each one has a bias that makes it more suitable for a particular data distribution. In this article, we propose and investigate the automatic design of decision-tree induction algorithms tailored to particular drug-enzyme binding data sets. We investigate the performance of our new method for evaluating binding conformations of different drug candidates to InhA, and we analyze our findings with respect to decision tree accuracy, comprehensibility, and biological relevance. The empirical analysis indicates that our method is capable of automatically generating decision-tree induction algorithms that significantly outperform the traditional C4.5 algorithm with respect to both accuracy and comprehensibility. In addition, we provide the biological interpretation of the rules generated by our approach, reinforcing the importance of comprehensible predictive models in this particular bioinformatics application. We conclude that automatically designing a decision-tree algorithm tailored to molecular docking data is a promising alternative for the prediction of the free energy from the binding of a drug candidate with a flexible-receptor.

Automatic design of decision-tree induction algorithms tailored to flexible-receptor docking data

PubMed Central

2012-01-01

Background This paper addresses the prediction of the free energy of binding of a drug candidate with enzyme InhA associated with Mycobacterium tuberculosis. This problem is found within rational drug design, where interactions between drug candidates and target proteins are verified through molecular docking simulations. In this application, it is important not only to correctly predict the free energy of binding, but also to provide a comprehensible model that could be validated by a domain specialist. Decision-tree induction algorithms have been successfully used in drug-design related applications, specially considering that decision trees are simple to understand, interpret, and validate. There are several decision-tree induction algorithms available for general-use, but each one has a bias that makes it more suitable for a particular data distribution. In this article, we propose and investigate the automatic design of decision-tree induction algorithms tailored to particular drug-enzyme binding data sets. We investigate the performance of our new method for evaluating binding conformations of different drug candidates to InhA, and we analyze our findings with respect to decision tree accuracy, comprehensibility, and biological relevance. Results The empirical analysis indicates that our method is capable of automatically generating decision-tree induction algorithms that significantly outperform the traditional C4.5 algorithm with respect to both accuracy and comprehensibility. In addition, we provide the biological interpretation of the rules generated by our approach, reinforcing the importance of comprehensible predictive models in this particular bioinformatics application. Conclusions We conclude that automatically designing a decision-tree algorithm tailored to molecular docking data is a promising alternative for the prediction of the free energy from the binding of a drug candidate with a flexible-receptor. PMID:23171000

Analysis of Post-transcriptional Gene Regulation of Nod-Like Receptors via the 3'UTR.

PubMed

Haneklaus, Moritz

2016-01-01

Innate immune signaling is the front line of defense against pathogens, leading to an appropriate response of immune cells upon activation of their pattern recognition receptors (PRRs) by microbial products, such as Toll-like receptors (TLRs). Apart from transcriptional control, gene expression in the innate immune system is also highly regulated at the post-transcriptional level. miRNA or RNA-binding protein can bind to the 3' untranslated region (UTR) of target mRNAs and affect their mRNA stability and translation efficiency, which ultimately affects the amount of protein that is produced. In recent years, a new group of PRRs, the Nod-like receptors (NLR) have been discovered. They often cooperate with TLR signaling to induce potent inflammatory responses. Many NLRs can form inflammasomes, which facilitate the production of the potent pro-inflammatory cytokine IL-1β and other inflammatory mediators. In contrast to TLRs, the importance of post-transcriptional regulators in the context of inflammasomes has not been well defined. This chapter describes a series of experimental approaches to determine the effect of post-transcriptional regulation for a gene of interest using the best-studied NLR, NLRP3, as an example. To start investigating post-transcriptional regulation, 3'UTR luciferase experiments can be performed to test if regulatory sequences in the 3'UTR are functional. An RNA pull-down approach followed by mass spectrometry provides an unbiased assay to identify RNA-binding proteins that target the 3'UTR. Candidate binding proteins can then be further validated by RNA immunoprecipitation (RNA-IP), where the candidate protein is isolated using a specific antibody and bound mRNAs are analyzed by qPCR.

A population pharmacokinetic model of valproic acid in pediatric patients with epilepsy: a non-linear pharmacokinetic model based on protein-binding saturation.

PubMed

Ding, Junjie; Wang, Yi; Lin, Weiwei; Wang, Changlian; Zhao, Limei; Li, Xingang; Zhao, Zhigang; Miao, Liyan; Jiao, Zheng

2015-03-01

Valproic acid (VPA) follows a non-linear pharmacokinetic profile in terms of protein-binding saturation. The total daily dose regarding VPA clearance is a simple power function, which may partially explain the non-linearity of the pharmacokinetic profile; however, it may be confounded by the therapeutic drug monitoring effect. The aim of this study was to develop a population pharmacokinetic model for VPA based on protein-binding saturation in pediatric patients with epilepsy. A total of 1,107 VPA serum trough concentrations at steady state were collected from 902 epileptic pediatric patients aged from 3 weeks to 14 years at three hospitals. The population pharmacokinetic model was developed using NONMEM(®) software. The ability of three candidate models (the simple power exponent model, the dose-dependent maximum effect [DDE] model, and the protein-binding model) to describe the non-linear pharmacokinetic profile of VPA was investigated, and potential covariates were screened using a stepwise approach. Bootstrap, normalized prediction distribution errors and external evaluations from two independent studies were performed to determine the stability and predictive performance of the candidate models. The age-dependent exponent model described the effects of body weight and age on the clearance well. Co-medication with carbamazepine was identified as a significant covariate. The DDE model best fitted the aim of this study, although there were no obvious differences in the predictive performances. The condition number was less than 500, and the precision of the parameter estimates was less than 30 %, indicating stability and validity of the final model. The DDE model successfully described the non-linear pharmacokinetics of VPA. Furthermore, the proposed population pharmacokinetic model of VPA can be used to design rational dosage regimens to achieve desirable serum concentrations.

Small molecule correctors of F508del-CFTR discovered by structure-based virtual screening

NASA Astrophysics Data System (ADS)

Kalid, Ori; Mense, Martin; Fischman, Sharon; Shitrit, Alina; Bihler, Hermann; Ben-Zeev, Efrat; Schutz, Nili; Pedemonte, Nicoletta; Thomas, Philip J.; Bridges, Robert J.; Wetmore, Diana R.; Marantz, Yael; Senderowitz, Hanoch

2010-12-01

Folding correctors of F508del-CFTR were discovered by in silico structure-based screening utilizing homology models of CFTR. The intracellular segment of CFTR was modeled and three cavities were identified at inter-domain interfaces: (1) Interface between the two Nucleotide Binding Domains (NBDs); (2) Interface between NBD1 and Intracellular Loop (ICL) 4, in the region of the F508 deletion; (3) multi-domain interface between NBD1:2:ICL1:2:4. We hypothesized that compounds binding at these interfaces may improve the stability of the protein, potentially affecting the folding yield or surface stability. In silico structure-based screening was performed at the putative binding-sites and a total of 496 candidate compounds from all three sites were tested in functional assays. A total of 15 compounds, representing diverse chemotypes, were identified as F508del folding correctors. This corresponds to a 3% hit rate, tenfold higher than hit rates obtained in corresponding high-throughput screening campaigns. The same binding sites also yielded potentiators and, most notably, compounds with a dual corrector-potentiator activity (dual-acting). Compounds harboring both activity types may prove to be better leads for the development of CF therapeutics than either pure correctors or pure potentiators. To the best of our knowledge this is the first report of structure-based discovery of CFTR modulators.

Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction.

PubMed

Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H

2017-01-09

The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Key structural features of nonsteroidal ligands for binding and activation of the androgen receptor.

PubMed

Yin, Donghua; He, Yali; Perera, Minoli A; Hong, Seoung Soo; Marhefka, Craig; Stourman, Nina; Kirkovsky, Leonid; Miller, Duane D; Dalton, James T

2003-01-01

The purposes of the present studies were to examine the androgen receptor (AR) binding ability and in vitro functional activity of multiple series of nonsteroidal compounds derived from known antiandrogen pharmacophores and to investigate the structure-activity relationships (SARs) of these nonsteroidal compounds. The AR binding properties of sixty-five nonsteroidal compounds were assessed by a radioligand competitive binding assay with the use of cytosolic AR prepared from rat prostates. The AR agonist and antagonist activities of high-affinity ligands were determined by the ability of the ligand to regulate AR-mediated transcriptional activation in cultured CV-1 cells, using a cotransfection assay. Nonsteroidal compounds with diverse structural features demonstrated a wide range of binding affinity for the AR. Ten compounds, mainly from the bicalutamide-related series, showed a binding affinity superior to the structural pharmacophore from which they were derived. Several SARs regarding nonsteroidal AR binding were revealed from the binding data, including stereoisomeric conformation, steric effect, and electronic effect. The functional activity of high-affinity ligands ranged from antagonist to full agonist for the AR. Several structural features were found to be determinative of agonist and antagonist activities. The nonsteroidal AR agonists identified from the present studies provided a pool of candidates for further development of selective androgen receptor modulators (SARMs) for androgen therapy. Also, these studies uncovered or confirmed numerous important SARs governing AR binding and functional properties by nonsteroidal molecules, which would be valuable in the future structural optimization of SARMs.

Mapping the affinity landscape of Thrombin-binding aptamers on 2΄F-ANA/DNA chimeric G-Quadruplex microarrays

PubMed Central

Abou Assi, Hala; Gómez-Pinto, Irene; González, Carlos

2017-01-01

Abstract In situ fabricated nucleic acids microarrays are versatile and very high-throughput platforms for aptamer optimization and discovery, but the chemical space that can be probed against a given target has largely been confined to DNA, while RNA and non-natural nucleic acid microarrays are still an essentially uncharted territory. 2΄-Fluoroarabinonucleic acid (2΄F-ANA) is a prime candidate for such use in microarrays. Indeed, 2΄F-ANA chemistry is readily amenable to photolithographic microarray synthesis and its potential in high affinity aptamers has been recently discovered. We thus synthesized the first microarrays containing 2΄F-ANA and 2΄F-ANA/DNA chimeric sequences to fully map the binding affinity landscape of the TBA1 thrombin-binding G-quadruplex aptamer containing all 32 768 possible DNA-to-2΄F-ANA mutations. The resulting microarray was screened against thrombin to identify a series of promising 2΄F-ANA-modified aptamer candidates with Kds significantly lower than that of the unmodified control and which were found to adopt highly stable, antiparallel-folded G-quadruplex structures. The solution structure of the TBA1 aptamer modified with 2΄F-ANA at position T3 shows that fluorine substitution preorganizes the dinucleotide loop into the proper conformation for interaction with thrombin. Overall, our work strengthens the potential of 2΄F-ANA in aptamer research and further expands non-genomic applications of nucleic acids microarrays. PMID:28100695

Evaluation of selected binding domains for the analysis of ubiquitinated proteomes

PubMed Central

Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

2013-01-01

Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising, but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ∼200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle. PMID:23649778

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Estimation of affinities of ligands in mixtures via magnetic recovery of target-ligand complexes and chromatographic analyses: chemometrics and an experimental model

PubMed Central

2011-01-01

Abstract Background The combinatorial library strategy of using multiple candidate ligands in mixtures as library members is ideal in terms of cost and efficiency, but needs special screening methods to estimate the affinities of candidate ligands in such mixtures. Herein, a new method to screen candidate ligands present in unknown molar quantities in mixtures was investigated. Results The proposed method involves preparing a processed-mixture-for-screening (PMFS) with each mixture sample and an exogenous reference ligand, initiating competitive binding among ligands from the PMFS to a target immobilized on magnetic particles, recovering target-ligand complexes in equilibrium by magnetic force, extracting and concentrating bound ligands, and analyzing ligands in the PMFS and the concentrated extract by chromatography. The relative affinity of each candidate ligand to its reference ligand is estimated via an approximation equation assuming (a) the candidate ligand and its reference ligand bind to the same site(s) on the target, (b) their chromatographic peak areas are over five times their intercepts of linear response but within their linear ranges, (c) their binding ratios are below 10%. These prerequisites are met by optimizing primarily the quantity of the target used and the PMFS composition ratio. The new method was tested using the competitive binding of biotin derivatives from mixtures to streptavidin immobilized on magnetic particles as a model. Each mixture sample containing a limited number of candidate biotin derivatives with moderate differences in their molar quantities were prepared via parallel-combinatorial-synthesis (PCS) without purification, or via the pooling of individual compounds. Some purified biotin derivatives were used as reference ligands. This method showed resistance to variations in chromatographic quantification sensitivity and concentration ratios; optimized conditions to validate the approximation equation could be applied to different mixture samples. Relative affinities of candidate biotin derivatives with unknown molar quantities in each mixture sample were consistent with those estimated by a homogenous method using their purified counterparts as samples. Conclusions This new method is robust and effective for each mixture possessing a limited number of candidate ligands whose molar quantities have moderate differences, and its integration with PCS has promise to routinely practice the mixture-based library strategy. PMID:21545719

The RNA-binding protein repertoire of embryonic stem cells.

PubMed

Kwon, S Chul; Yi, Hyerim; Eichelbaum, Katrin; Föhr, Sophia; Fischer, Bernd; You, Kwon Tae; Castello, Alfredo; Krijgsveld, Jeroen; Hentze, Matthias W; Kim, V Narry

2013-09-01

RNA-binding proteins (RBPs) have essential roles in RNA-mediated gene regulation, and yet annotation of RBPs is limited mainly to those with known RNA-binding domains. To systematically identify the RBPs of embryonic stem cells (ESCs), we here employ interactome capture, which combines UV cross-linking of RBP to RNA in living cells, oligo(dT) capture and MS. From mouse ESCs (mESCs), we have defined 555 proteins constituting the mESC mRNA interactome, including 283 proteins not previously annotated as RBPs. Of these, 68 new RBP candidates are highly expressed in ESCs compared to differentiated cells, implicating a role in stem-cell physiology. Two well-known E3 ubiquitin ligases, Trim25 (also called Efp) and Trim71 (also called Lin41), are validated as RBPs, revealing a potential link between RNA biology and protein-modification pathways. Our study confirms and expands the atlas of RBPs, providing a useful resource for the study of the RNA-RBP network in stem cells.

A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

PubMed Central

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

2015-01-01

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

From Bits and Pieces to Whole Phage to Nanomachines: Pathogen Detection Using Bacteriophages.

PubMed

Anany, H; Chou, Y; Cucic, S; Derda, R; Evoy, S; Griffiths, M W

2017-02-28

The innate specificity of bacteriophages toward their hosts makes them excellent candidates for the development of detection assays. They can be used in many ways to detect pathogens, and each has its own advantages and disadvantages. Whole bacteriophages can carry reporter genes to alter the phenotype of the target. Bacteriophages can act as staining agents or the progeny of the infection process can be detected, which further increases the sensitivity of the detection assay. Compared with whole-phage particles, use of phage components as probes offers other advantages: for example, smaller probe size to enhance binding activity, phage structures that can be engineered for better affinity, as well as specificity, binding properties, and robustness. When no natural binding with the target exists, phages can be used as vehicles to identify new protein-ligand interactions necessary for diagnostics. This review comprehensively summarizes many uses of phages as detection tools and points the way toward how phage-based technologies may be improved.

Structural Insights into Ail-Mediated Adhesion in Yersinia pestis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamashita, Satoshi; Lukacik, Petra; Barnard, Travis J.

2012-01-30

Ail is an outer membrane protein from Yersinia pestis that is highly expressed in a rodent model of bubonic plague, making it a good candidate for vaccine development. Ail is important for attaching to host cells and evading host immune responses, facilitating rapid progression of a plague infection. Binding to host cells is important for injection of cytotoxic Yersinia outer proteins. To learn more about how Ail mediates adhesion, we solved two high-resolution crystal structures of Ail, with no ligand bound and in complex with a heparin analog called sucrose octasulfate. We identified multiple adhesion targets, including laminin and heparin,more » and showed that a 40 kDa domain of laminin called LG4-5 specifically binds to Ail. We also evaluated the contribution of laminin to delivery of Yops to HEp-2 cells. This work constitutes a structural description of how a bacterial outer membrane protein uses a multivalent approach to bind host cells.« less

Identification of a Novel Mucin Gene HCG22 Associated With Steroid-Induced Ocular Hypertension

PubMed Central

Jeong, Shinwu; Patel, Nitin; Edlund, Christopher K.; Hartiala, Jaana; Hazelett, Dennis J.; Itakura, Tatsuo; Wu, Pei-Chang; Avery, Robert L.; Davis, Janet L.; Flynn, Harry W.; Lalwani, Geeta; Puliafito, Carmen A.; Wafapoor, Hussein; Hijikata, Minako; Keicho, Naoto; Gao, Xiaoyi; Argüeso, Pablo; Allayee, Hooman; Coetzee, Gerhard A.; Pletcher, Mathew T.; Conti, David V.; Schwartz, Stephen G.; Eaton, Alexander M.; Fini, M. Elizabeth

2015-01-01

Purpose. The pathophysiology of ocular hypertension (OH) leading to primary open-angle glaucoma shares many features with a secondary form of OH caused by treatment with glucocorticoids, but also exhibits distinct differences. In this study, a pharmacogenomics approach was taken to discover candidate genes for this disorder. Methods. A genome-wide association study was performed, followed by an independent candidate gene study, using a cohort enrolled from patients treated with off-label intravitreal triamcinolone, and handling change in IOP as a quantitative trait. Results. An intergenic quantitative trait locus (QTL) was identified at chromosome 6p21.33 near the 5′ end of HCG22 that attained the accepted statistical threshold for genome-level significance. The HCG22 transcript, encoding a novel mucin protein, was expressed in trabecular meshwork cells, and expression was stimulated by IL-1, and inhibited by triamcinolone acetate and TGF-β. Bioinformatic analysis defined the QTL as an approximately 4 kilobase (kb) linkage disequilibrium block containing 10 common single nucleotide polymorphisms (SNPs). Four of these SNPs were identified in the National Center for Biotechnology Information (NCBI) GTEx eQTL browser as modifiers of HCG22 expression. Most are predicted to disrupt or improve motifs for transcription factor binding, the most relevant being disruption of the glucocorticoid receptor binding motif. A second QTL was identified within the predicted signal peptide of the HCG22 encoded protein that could affect its secretion. Translation, O-glycosylation, and secretion of the predicted HCG22 protein was verified in cultured trabecular meshwork cells. Conclusions. Identification of two independent QTLs that could affect expression of the HCG22 mucin gene product via two different mechanisms (transcription or secretion) is highly suggestive of a role in steroid-induced OH. PMID:25813999

Identification and mechanism of action analysis of the new PARP-1 inhibitor 2″-hydroxygenkwanol A.

PubMed

Dal Piaz, Fabrizio; Ferro, Piera; Vassallo, Antonio; Vasaturo, Michele; Forte, Giovanni; Chini, Maria Giovanna; Bifulco, Giuseppe; Tosco, Alessandra; De Tommasi, Nunziatina

2015-09-01

Poly(ADP-ribose) polymerase 1 (PARP-1) activity has been implicated in the pathogenesis of numerous diseases as cancer, inflammation, diabetes and neurodegenerative disorders, therefore the research for new PARP-1 inhibitors is still an active area. To identify new potential PARP-1 inhibitors, we performed a screening of a small-molecule library consisting of polyphenols isolated from plants used in the traditional medicine, by Surface Plasmon Resonance (SPR). Biochemical and cellular assays were performed to confirm SPR results and select the promising candidate(s). Finally, limited proteolysis and ligand docking analyses allowed defining the protein region involved in the interaction with the putative inhibitor(s). The dimeric spiro-flavonoid 2″-hydroxygenkwanol A, member of a relatively recently discovered class of flavonoids containing a spirane C-atom, has been identified as possible PARP-1 inhibitor. This compound showed a high affinity for the polymerase (KD: 0.32±0.05μM); moreover PARP-1 activity in the presence of 2″-hydroxygenkwanol A was significantly affected both when using the recombinant protein and when measuring the cellular effects. Finally, our study suggests this compound to efficiently interact with the protein catalytic domain, into the nicotine binding pocket. 2″-hydroxygenkwanol A efficiently binds and inhibits PARP-1 at submicromolar concentrations, thus representing a promising lead for the design of a new class of PARP-1 modulators, useful as therapeutic agents and/or biochemical tools. Our study has identified an additional class of plant molecules, the spiro-biflavonoids, with known beneficial pharmacological properties but with an unknown mechanism of action, as a possible novel class of PARP-1 activity inhibitors. Copyright © 2015 Elsevier B.V. All rights reserved.

Differential Recognition Preferences of the Three Src Homology 3 (SH3) Domains from the Adaptor CD2-associated Protein (CD2AP) and Direct Association with Ras and Rab Interactor 3 (RIN3)*

PubMed Central

Rouka, Evgenia; Simister, Philip C.; Janning, Melanie; Kumbrink, Joerg; Konstantinou, Tassos; Muniz, João R. C.; Joshi, Dhira; O'Reilly, Nicola; Volkmer, Rudolf; Ritter, Brigitte; Knapp, Stefan; von Delft, Frank; Kirsch, Kathrin H.; Feller, Stephan M.

2015-01-01

CD2AP is an adaptor protein involved in membrane trafficking, with essential roles in maintaining podocyte function within the kidney glomerulus. CD2AP contains three Src homology 3 (SH3) domains that mediate multiple protein-protein interactions. However, a detailed comparison of the molecular binding preferences of each SH3 remained unexplored, as well as the discovery of novel interactors. Thus, we studied the binding properties of each SH3 domain to the known interactor Casitas B-lineage lymphoma protein (c-CBL), conducted a peptide array screen based on the recognition motif PxPxPR and identified 40 known or novel candidate binding proteins, such as RIN3, a RAB5-activating guanine nucleotide exchange factor. CD2AP SH3 domains 1 and 2 generally bound with similar characteristics and specificities, whereas the SH3-3 domain bound more weakly to most peptide ligands tested yet recognized an unusually extended sequence in ALG-2-interacting protein X (ALIX). RIN3 peptide scanning arrays revealed two CD2AP binding sites, recognized by all three SH3 domains, but SH3-3 appeared non-functional in precipitation experiments. RIN3 recruited CD2AP to RAB5a-positive early endosomes via these interaction sites. Permutation arrays and isothermal titration calorimetry data showed that the preferred binding motif is Px(P/A)xPR. Two high-resolution crystal structures (1.65 and 1.11 Å) of CD2AP SH3-1 and SH3-2 solved in complex with RIN3 epitopes 1 and 2, respectively, indicated that another extended motif is relevant in epitope 2. In conclusion, we have discovered novel interaction candidates for CD2AP and characterized subtle yet significant differences in the recognition preferences of its three SH3 domains for c-CBL, ALIX, and RIN3. PMID:26296892

Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum.

PubMed

Hollin, Thomas; De Witte, Caroline; Lenne, Astrid; Pierrot, Christine; Khalife, Jamal

2016-03-17

Protein Phosphatase 1 (PP1) is an enzyme essential to cell viability in the malaria parasite Plasmodium falciparum (Pf). The activity of PP1 is regulated by the binding of regulatory subunits, of which there are up to 200 in humans, but only 3 have been so far reported for the parasite. To better understand the P. falciparum PP1 (PfPP1) regulatory network, we here report the use of three strategies to characterize the PfPP1 interactome: co-affinity purified proteins identified by mass spectrometry, yeast two-hybrid (Y2H) screening and in silico analysis of the P. falciparum predicted proteome. Co-affinity purification followed by MS analysis identified 6 PfPP1 interacting proteins (Pips) of which 3 contained the RVxF consensus binding, 2 with a Fxx[RK]x[RK] motif, also shown to be a PP1 binding motif and one with both binding motifs. The Y2H screens identified 134 proteins of which 30 present the RVxF binding motif and 20 have the Fxx[RK]x[RK] binding motif. The in silico screen of the Pf predicted proteome using a consensus RVxF motif as template revealed the presence of 55 potential Pips. As further demonstration, 35 candidate proteins were validated as PfPP1 interacting proteins in an ELISA-based assay. To the best of our knowledge, this is the first study on PfPP1 interactome. The data reports several conserved PP1 interacting proteins as well as a high number of specific interactors to PfPP1. Their analysis indicates a high diversity of biological functions for PP1 in Plasmodium. Based on the present data and on an earlier study of the Pf interactome, a potential implication of Pips in protein folding/proteolysis, transcription and pathogenicity networks is proposed. The present work provides a starting point for further studies on the structural basis of these interactions and their functions in P. falciparum.

A deep learning framework for modeling structural features of RNA-binding protein targets

PubMed Central

Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

2016-01-01

RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

HIV-1 Envelope Glycoproteins from Diverse Clades Differentiate Antibody Responses and Durability among Vaccinees

PubMed Central

2018-01-01

ABSTRACT Induction of broadly cross-reactive antiviral humoral responses with the capacity to target globally diverse circulating strains is a key goal for HIV-1 immunogen design. A major gap in the field is the identification of diverse HIV-1 envelope antigens to evaluate vaccine regimens for binding antibody breadth. In this study, we define unique antigen panels to map HIV-1 vaccine-elicited antibody breadth and durability. Diverse HIV-1 envelope glycoproteins were selected based on genetic and geographic diversity to cover the global epidemic, with a focus on sexually acquired transmitted/founder viruses with a tier 2 neutralization phenotype. Unique antigenicity was determined by nonredundancy (Spearman correlation), and antigens were clustered using partitioning around medoids (PAM) to identify antigen diversity. Cross-validation demonstrated that the PAM method was better than selection by reactivity and random selection. Analysis of vaccine-elicited V1V2 binding antibody in longitudinal samples from the RV144 clinical trial revealed the striking heterogeneity among individual vaccinees in maintaining durable responses. These data support the idea that a major goal for vaccine development is to improve antibody levels, breadth, and durability at the population level. Elucidating the level and durability of vaccine-elicited binding antibody breadth needed for protection is critical for the development of a globally efficacious HIV vaccine. IMPORTANCE The path toward an efficacious HIV-1 vaccine will require characterization of vaccine-induced immunity that can recognize and target the highly genetically diverse virus envelope glycoproteins. Antibodies that target the envelope glycoproteins, including diverse sequences within the first and second hypervariable regions (V1V2) of gp120, were identified as correlates of risk for the one partially efficacious HIV-1 vaccine. To build upon this discovery, we experimentally and computationally evaluated humoral responses to define envelope glycoproteins representative of the antigenic diversity of HIV globally. These diverse envelope antigens distinguished binding antibody breadth and durability among vaccine candidates, thus providing insights for advancing the most promising HIV-1 vaccine candidates. PMID:29386288

Filling gaps in PPAR-alpha signaling through comparative nutrigenomics analysis.

PubMed

Cavalieri, Duccio; Calura, Enrica; Romualdi, Chiara; Marchi, Emmanuela; Radonjic, Marijana; Van Ommen, Ben; Müller, Michael

2009-12-11

The application of high-throughput genomic tools in nutrition research is a widespread practice. However, it is becoming increasingly clear that the outcome of individual expression studies is insufficient for the comprehensive understanding of such a complex field. Currently, the availability of the large amounts of expression data in public repositories has opened up new challenges on microarray data analyses. We have focused on PPARalpha, a ligand-activated transcription factor functioning as fatty acid sensor controlling the gene expression regulation of a large set of genes in various metabolic organs such as liver, small intestine or heart. The function of PPARalpha is strictly connected to the function of its target genes and, although many of these have already been identified, major elements of its physiological function remain to be uncovered. To further investigate the function of PPARalpha, we have applied a cross-species meta-analysis approach to integrate sixteen microarray datasets studying high fat diet and PPARalpha signal perturbations in different organisms. We identified 164 genes (MDEGs) that were differentially expressed in a constant way in response to a high fat diet or to perturbations in PPARs signalling. In particular, we found five genes in yeast which were highly conserved and homologous of PPARalpha targets in mammals, potential candidates to be used as models for the equivalent mammalian genes. Moreover, a screening of the MDEGs for all known transcription factor binding sites and the comparison with a human genome-wide screening of Peroxisome Proliferating Response Elements (PPRE), enabled us to identify, 20 new potential candidate genes that show, both binding site, both change in expression in the condition studied. Lastly, we found a non random localization of the differentially expressed genes in the genome. The results presented are potentially of great interest to resume the currently available expression data, exploiting the power of in silico analysis filtered by evolutionary conservation. The analysis enabled us to indicate potential gene candidates that could fill in the gaps with regards to the signalling of PPARalpha and, moreover, the non-random localization of the differentially expressed genes in the genome, suggest that epigenetic mechanisms are of importance in the regulation of the transcription operated by PPARalpha.

Human adenovirus serotypes 4p and 11p are efficiently expressed in cell lines of neural tumour origin.

PubMed

Skog, Johan; Mei, Ya-Fang; Wadell, Göran

2002-06-01

Most currently used adenovirus vectors are based upon adenovirus serotypes 2 and 5 (Ad2 and Ad5), which have limited efficiencies for gene transfer to human neural cells. Both serotypes bind to the known adenovirus receptor, CAR (coxsackievirus and adenovirus receptor), and have restricted cell tropism. The purpose of this study was to find vector candidates that are superior to Ad5 in infecting human neural tumours. Using flow cytometry, the vector candidates Ad4p, Ad11p and Ad17p were compared to the commonly used adenovirus vector Ad5v for their binding capacity to neural cell lines derived from glioblastoma, medulloblastoma and neuroblastoma cell lines. The production of viral structural proteins and the CAR-binding properties of the different serotypes were also assessed in these cells. Computer-based models of the fibre knobs of Ad4p and Ad17 were created based upon the crystallized fibre knob structure of adenoviruses and analysed for putative receptor-interacting regions that differed from the fibre knob of Ad5. The non CAR-binding vector candidate Ad11p showed clearly the best binding capacity to all of the neural cell lines, binding more than 90% of cells of all of the neural cell lines tested, in contrast to 20% or less for the commonly used vector Ad5v. Ad4p and Ad11p were also internalized and produced viral proteins more successfully than Ad5. Ad4p showed a low binding ability but a very efficient capacity for infection in cell culture. Ad17p virions neither bound or efficiently infected any of the neural cell lines studied.

Computational elucidation of potential antigenic CTL epitopes in Ebola virus.

PubMed

Dikhit, Manas R; Kumar, Santosh; Vijaymahantesh; Sahoo, Bikash R; Mansuri, Rani; Amit, Ajay; Yousuf Ansari, Md; Sahoo, Ganesh C; Bimal, Sanjiva; Das, Pradeep

2015-12-01

Cell-mediated immunity is important for the control of Ebola virus infection. We hypothesized that those HLA A0201 and HLA B40 restricted epitopes derived from Ebola virus proteins, would mount a good antigenic response. Here we employed an immunoinformatics approach to identify specific 9mer amino acid which may be capable of inducing a robust cell-mediated immune response in humans. We identified a set of 28 epitopes that had no homologs in humans. Specifically, the epitopes derived from NP, RdRp, GP and VP40 share population coverage of 93.40%, 84.15%, 74.94% and 77.12%, respectively. Based on the other HLA binding specificity and population coverage, seven novel promiscuous epitopes were identified. These 7 promiscuous epitopes from NP, RdRp and GP were found to have world-wide population coverage of more than 95% indicating their potential significance as useful candidates for vaccine design. Epitope conservancy analysis also suggested that most of the peptides are highly conserved (100%) in other virulent Ebola strain (Mayinga-76, Kikwit-95 and Makona-G3816- 2014) and can therefore be further investigated for their immunological relevance and usefulness as vaccine candidates. Copyright © 2015 Elsevier B.V. All rights reserved.

Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases

PubMed Central

Li, Yun R; Li, Jin; Zhao, Sihai D; Bradfield, Jonathan P; Mentch, Frank D; Maggadottir, S Melkorka; Hou, Cuiping; Abrams, Debra J; Chang, Diana; Gao, Feng; Guo, Yiran; Wei, Zhi; Connolly, John J; Cardinale, Christopher J; Bakay, Marina; Glessner, Joseph T; Li, Dong; Kao, Charlly; Thomas, Kelly A; Qiu, Haijun; Chiavacci, Rosetta M; Kim, Cecilia E; Wang, Fengxiang; Snyder, James; Richie, Marylyn D; Flatø, Berit; Førre, Øystein; Denson, Lee A; Thompson, Susan D; Becker, Mara L; Guthery, Stephen L; Latiano, Anna; Perez, Elena; Resnick, Elena; Russell, Richard K; Wilson, David C; Silverberg, Mark S; Annese, Vito; Lie, Benedicte A; Punaro, Marilynn; Dubinsky, Marla C; Monos, Dimitri S; Strisciuglio, Caterina; Staiano, Annamaria; Miele, Erasmo; Kugathasan, Subra; Ellis, Justine A; Munro, Jane E; Sullivan, Kathleen E; Wise, Carol A; Chapel, Helen; Cunningham-Rundles, Charlotte; Grant, Struan F A; Orange, Jordan S; Sleiman, Patrick M A; Behrens, Edward M; Griffiths, Anne M; Satsangi, Jack; Finkel, Terri H; Keinan, Alon; Prak, Eline T Luning; Polychronakos, Constantin; Baldassano, Robert N; Li, Hongzhe; Keating, Brendan J; Hakonarson, Hakon

2016-01-01

Genome-wide association studies (GWASs) have identified hundreds of susceptibility genes, including shared associations across clinically distinct autoimmune diseases. We performed an inverse χ2 meta-analysis across ten pediatric-age-of-onset autoimmune diseases (pAIDs) in a case-control study including more than 6,035 cases and 10,718 shared population-based controls. We identified 27 genome-wide significant loci associated with one or more pAIDs, mapping to in silico–replicated autoimmune-associated genes (including IL2RA) and new candidate loci with established immunoregulatory functions such as ADGRL2, TENM3, ANKRD30A, ADCY7 and CD40LG. The pAID-associated single-nucleotide polymorphisms (SNPs) were functionally enriched for deoxyribonuclease (DNase)-hypersensitivity sites, expression quantitative trait loci (eQTLs), microRNA (miRNA)-binding sites and coding variants. We also identified biologically correlated, pAID-associated candidate gene sets on the basis of immune cell expression profiling and found evidence of genetic sharing. Network and protein-interaction analyses demonstrated converging roles for the signaling pathways of type 1, 2 and 17 helper T cells (TH1, TH2 and TH17), JAK-STAT, interferon and interleukin in multiple autoimmune diseases. PMID:26301688

Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens.

PubMed

Glinsky, Gennadi V

2016-09-19

Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8-10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Antihelminthic Benzimidazoles Are Novel HIF Activators That Prevent Oxidative Neuronal Death via Binding to Tubulin

PubMed Central

Aleyasin, Hossein; Karuppagounder, Saravanan S.; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J.; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L.; Riggins, Gregory J.; Gazaryan, Irina; Starkov, Anatoly A.; Andersen, Julie K.

2015-01-01

Abstract Aims: Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Results: Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21cip1/waf1, in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. Innovation and Conclusions: These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke. Antioxid. Redox Signal. 22, 121–134. PMID:24766300

Structural insights into a secretory abundant heat-soluble protein from an anhydrobiotic tardigrade, Ramazzottius varieornatus.

PubMed

Fukuda, Yohta; Miura, Yoshimasa; Mizohata, Eiichi; Inoue, Tsuyoshi

2017-08-01

Upon stopping metabolic processes, some tardigrades can undergo anhydrobiosis. Secretory abundant heat-soluble (SAHS) proteins have been reported as candidates for anhydrobiosis-related proteins in tardigrades, which seem to protect extracellular components and/or secretory organelles. We determined structures of a SAHS protein from Ramazzottius varieornatus (RvSAHS1), which is one of the toughest tardigrades. RvSAHS1 shows a β-barrel structure similar to fatty acid-binding proteins (FABPs), in which hydrophilic residues form peculiar hydrogen bond networks, which would provide RvSAHS1 with better tolerance against dehydration. We identified two putative ligand-binding sites: one that superimposes on those of some FABPs and the other, unique to and conserved in SAHS proteins. These results indicate that SAHS proteins constitute a new FABP family. © 2017 Federation of European Biochemical Societies.

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Identification and Characterization of Odorant Binding Proteins in the Forelegs of Adelphocoris lineolatus (Goeze)

PubMed Central

Sun, Liang; Wang, Qian; Wang, Qi; Dong, Kun; Xiao, Yong; Zhang, Yong-Jun

2017-01-01

The chemosensory system is essential for insects to detect exogenous compounds, and odorant binding proteins (OBPs) play crucial roles in odorant binding and transduction. In the alfalfa plant bug Adelphocoris lineolatus, an important pest of multiple crops, our understanding of the physiological roles of antenna-biased OBPs has increased dramatically, whereas OBPs related to gustation have remained mostly unexplored. In this study, we employed RNA sequencing and RACE PCR methods to identify putative OBPs from the adult forelegs of both sexes. Eight candidate OBPs were identified, and three OBPs (AlinOBP15, 16, and 17) were novel. Full-length sequence alignment and phylogenetic analyses suggested that these three candidate OBPs had characteristics typical of the insect OBP family. AlinOBP16 and 17 displayed six highly conserved cysteines, placing them in the classic OBP subfamily, whereas AlinOBP15 resembled AlinOBP14 and clustered with the Plus-C clade. Quantitative real-time PCR (qRT-PCR) revealed distinct and significant tissue- and sex-biased expression patterns. AlinOBP15 was highly expressed in female heads, and AlinOBP16 and 17 were strongly expressed in female antennae. In particular, AlinOBP11, the most abundant OBP gene in our foreleg transcriptome dataset, was predominately expressed in adult legs. Furthermore, four types of sensilla hairs were observed on the forelegs of adult A. lineolatus, including sensilla trichodea, setae, and two types of sensilla chaetica (Sch1 and Sch2). Anti-AlinOBP11 antiserum strongly labeled the outer sensillum lymph of Sch2, implying that it has important gustatory functions in A. lineolatus. Our current findings provide evidence that OBPs can be functionally expressed in the tarsal gustatory sensilla of hemipteran mirid species, broadening our understanding of OBP chemosensory function in insects and facilitating the discovery of new functional targets for the regulation of insect host-searching behaviors. PMID:29018358

Identification and characterization of B-cell epitopes in the DBL4ε domain of VAR2CSA.

PubMed

Ditlev, Sisse B; Nielsen, Morten A; Resende, Mafalda; Agerbæk, Mette Ø; Pinto, Vera V; Andersen, Pernille H; Magistrado, Pamela; Lusingu, John; Dahlbäck, Madeleine; Theander, Thor G; Salanti, Ali

2012-01-01

Malaria during pregnancy in Plasmodium falciparum endemic regions is a major cause of mortality and severe morbidity. VAR2CSA is the parasite ligand responsible for sequestration of Plasmodium falciparum infected erythrocytes to the receptor chondroitin sulfate A (CSA) in the placenta and is the leading candidate for a placental malaria vaccine. Antibodies induced in rats against the recombinant DBL4ε domain of VAR2CSA inhibit the binding of a number of laboratory and field parasite isolates to CSA. In this study, we used a DBL4ε peptide-array to identify epitopes targeted by DBL4ε-specific antibodies that inhibit CSA-binding of infected erythrocytes. We identified three regions of overlapping peptides which were highly antigenic. One peptide region distinguished itself particularly by showing a clear difference in the binding profile of highly parasite blocking IgG compared to the IgG with low capacity to inhibit parasite adhesion to CSA. This region was further characterized and together these results suggest that even though antibodies against the synthetic peptides which cover this region did not recognize native protein, the results using the mutant domain suggest that this linear epitope might be involved in the induction of inhibitory antibodies induced by the recombinant DBL4ε domain.

Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

NASA Astrophysics Data System (ADS)

Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

2017-03-01

Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

SVM prediction of ligand-binding sites in bacterial lipoproteins employing shape and physio-chemical descriptors.

PubMed

Kadam, Kiran; Prabhakar, Prashant; Jayaraman, V K

2012-11-01

Bacterial lipoproteins play critical roles in various physiological processes including the maintenance of pathogenicity and numbers of them are being considered as potential candidates for generating novel vaccines. In this work, we put forth an algorithm to identify and predict ligand-binding sites in bacterial lipoproteins. The method uses three types of pocket descriptors, namely fpocket descriptors, 3D Zernike descriptors and shell descriptors, and combines them with Support Vector Machine (SVM) method for the classification. The three types of descriptors represent shape-based properties of the pocket as well as its local physio-chemical features. All three types of descriptors, along with their hybrid combinations are evaluated with SVM and to improve classification performance, WEKA-InfoGain feature selection is applied. Results obtained in the study show that the classifier successfully differentiates between ligand-binding and non-binding pockets. For the combination of three types of descriptors, 10 fold cross-validation accuracy of 86.83% is obtained for training while the selected model achieved test Matthews Correlation Coefficient (MCC) of 0.534. Individually or in combination with new and existing methods, our model can be a very useful tool for the prediction of potential ligand-binding sites in bacterial lipoproteins.

Computational design and experimental study of tighter binding peptides to an inactivated mutant of HIV-1 protease

PubMed Central

Altman, Michael D.; Nalivaika, Ellen A.; Prabu-Jeyabalan, Moses; Schiffer, Celia A.; Tidor, Bruce

2009-01-01

Drug resistance in HIV-1 protease, a barrier to effective treatment, is generally caused by mutations in the enzyme that disrupt inhibitor binding but still allow for substrate processing. Structural studies with mutant, inactive enzyme, have provided detailed information regarding how the substrates bind to the protease yet avoid resistance mutations; insights obtained inform the development of next generation therapeutics. Although structures have been obtained of complexes between substrate peptide and inactivated (D25N) protease, thermodynamic studies of peptide binding have been challenging due to low affinity. Peptides that bind tighter to the inactivated protease than the natural substrates would be valuable for thermodynamic studies as well as to explore whether the structural envelope observed for substrate peptides is a function of weak binding. Here, two computational methods — namely, charge optimization and protein design — were applied to identify peptide sequences predicted to have higher binding affinity to the inactivated protease, starting from an RT–RH derived substrate peptide. Of the candidate designed peptides, three were tested for binding with isothermal titration calorimetry, with one, containing a single threonine to valine substitution, measured to have more than a ten-fold improvement over the tightest binding natural substrate. Crystal structures were also obtained for the same three designed peptide complexes; they show good agreement with computational prediction. Thermodynamic studies show that binding is entropically driven, more so for designed affinity enhanced variants than for the starting substrate. Structural studies show strong similarities between natural and tighter-binding designed peptide complexes, which may have implications in understanding the molecular mechanisms of drug resistance in HIV-1 protease. PMID:17729291

Analysis of ligand-protein exchange by Clustering of Ligand Diffusion Coefficient Pairs (CoLD-CoP).

PubMed

Snyder, David A; Chantova, Mihaela; Chaudhry, Saadia

2015-06-01

NMR spectroscopy is a powerful tool in describing protein structures and protein activity for pharmaceutical and biochemical development. This study describes a method to determine weak binding ligands in biological systems by using hierarchic diffusion coefficient clustering of multidimensional data obtained with a 400 MHz Bruker NMR. Comparison of DOSY spectrums of ligands of the chemical library in the presence and absence of target proteins show translational diffusion rates for small molecules upon interaction with macromolecules. For weak binders such as compounds found in fragment libraries, changes in diffusion rates upon macromolecular binding are on the order of the precision of DOSY diffusion measurements, and identifying such subtle shifts in diffusion requires careful statistical analysis. The "CoLD-CoP" (Clustering of Ligand Diffusion Coefficient Pairs) method presented here uses SAHN clustering to identify protein-binders in a chemical library or even a not fully characterized metabolite mixture. We will show how DOSY NMR and the "CoLD-CoP" method complement each other in identifying the most suitable candidates for lysozyme and wheat germ acid phosphatase. Copyright © 2015 Elsevier Inc. All rights reserved.

Predicting bioactive conformations and binding modes of macrocycles

NASA Astrophysics Data System (ADS)

Anighoro, Andrew; de la Vega de León, Antonio; Bajorath, Jürgen

2016-10-01

Macrocyclic compounds experience increasing interest in drug discovery. It is often thought that these large and chemically complex molecules provide promising candidates to address difficult targets and interfere with protein-protein interactions. From a computational viewpoint, these molecules are difficult to treat. For example, flexible docking of macrocyclic compounds is hindered by the limited ability of current docking approaches to optimize conformations of extended ring systems for pose prediction. Herein, we report predictions of bioactive conformations of macrocycles using conformational search and binding modes using docking. Conformational ensembles generated using specialized search technique of about 70 % of the tested macrocycles contained accurate bioactive conformations. However, these conformations were difficult to identify on the basis of conformational energies. Moreover, docking calculations with limited ligand flexibility starting from individual low energy conformations rarely yielded highly accurate binding modes. In about 40 % of the test cases, binding modes were approximated with reasonable accuracy. However, when conformational ensembles were subjected to rigid body docking, an increase in meaningful binding mode predictions to more than 50 % of the test cases was observed. Electrostatic effects did not contribute to these predictions in a positive or negative manner. Rather, achieving shape complementarity at macrocycle-target interfaces was a decisive factor. In summary, a combined computational protocol using pre-computed conformational ensembles of macrocycles as a starting point for docking shows promise in modeling binding modes of macrocyclic compounds.

Phage-display screening identifies LMP1-binding peptides targeting the C-terminus region of the EBV oncoprotein.

PubMed

Ammous-Boukhris, Nihel; Mosbah, Amor; Sahli, Emna; Ayadi, Wajdi; Hadhri-Guiga, Boutheina; Chérif, Ameur; Gargouri, Ali; Mokdad-Gargouri, Raja

2016-11-01

Latent membrane protein 1 (LMP1), a major oncoprotein of Epstein Barr Virus (EBV) is responsible for transforming B lymphocytes in vitro. LMP1 is overexpressed in several EBV-associated malignancies, and different approaches have been developed to reduce its level and accordingly its oncogenic function in tumor tissues. This study aimed to use phage display peptide library to obtain peptides which could specifically bind to the cytoplasmic region of LMP1 to prevent its interaction with signaling proteins. The LMP1 C-terminus region was produced in bacterial E. coli and used as target for the phage library panning. After 3 rounds, 20 phage clones were randomly selected and 8 showed high binding affinity to the recombinant C-terminus LMP1 protein. The most interesting candidates are the FO5 "QPTKDSSPPLRV" and NO4 "STTSPPAVPHNN" peptides since both bind the C-terminus LMP1 as showed by molecular docking. Furthermore, sequence alignment revealed that the FO5 peptide shared sequence similarity with the Death Receptor 4 which belongs to the tumor necrosis factor-related apoptosis-inducing receptor which plays key role in anti-tumor immunity. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of genetic elements in metabolism by high-throughput mouse phenotyping.

PubMed

Rozman, Jan; Rathkolb, Birgit; Oestereicher, Manuela A; Schütt, Christine; Ravindranath, Aakash Chavan; Leuchtenberger, Stefanie; Sharma, Sapna; Kistler, Martin; Willershäuser, Monja; Brommage, Robert; Meehan, Terrence F; Mason, Jeremy; Haselimashhadi, Hamed; Hough, Tertius; Mallon, Ann-Marie; Wells, Sara; Santos, Luis; Lelliott, Christopher J; White, Jacqueline K; Sorg, Tania; Champy, Marie-France; Bower, Lynette R; Reynolds, Corey L; Flenniken, Ann M; Murray, Stephen A; Nutter, Lauryl M J; Svenson, Karen L; West, David; Tocchini-Valentini, Glauco P; Beaudet, Arthur L; Bosch, Fatima; Braun, Robert B; Dobbie, Michael S; Gao, Xiang; Herault, Yann; Moshiri, Ala; Moore, Bret A; Kent Lloyd, K C; McKerlie, Colin; Masuya, Hiroshi; Tanaka, Nobuhiko; Flicek, Paul; Parkinson, Helen E; Sedlacek, Radislav; Seong, Je Kyung; Wang, Chi-Kuang Leo; Moore, Mark; Brown, Steve D; Tschöp, Matthias H; Wurst, Wolfgang; Klingenspor, Martin; Wolf, Eckhard; Beckers, Johannes; Machicao, Fausto; Peter, Andreas; Staiger, Harald; Häring, Hans-Ulrich; Grallert, Harald; Campillos, Monica; Maier, Holger; Fuchs, Helmut; Gailus-Durner, Valerie; Werner, Thomas; Hrabe de Angelis, Martin

2018-01-18

Metabolic diseases are a worldwide problem but the underlying genetic factors and their relevance to metabolic disease remain incompletely understood. Genome-wide research is needed to characterize so-far unannotated mammalian metabolic genes. Here, we generate and analyze metabolic phenotypic data of 2016 knockout mouse strains under the aegis of the International Mouse Phenotyping Consortium (IMPC) and find 974 gene knockouts with strong metabolic phenotypes. 429 of those had no previous link to metabolism and 51 genes remain functionally completely unannotated. We compared human orthologues of these uncharacterized genes in five GWAS consortia and indeed 23 candidate genes are associated with metabolic disease. We further identify common regulatory elements in promoters of candidate genes. As each regulatory element is composed of several transcription factor binding sites, our data reveal an extensive metabolic phenotype-associated network of co-regulated genes. Our systematic mouse phenotype analysis thus paves the way for full functional annotation of the genome.

Role of codeposited impurities during growth. I. Explaining distinctive experimental morphology on Cu(0 0 1)

NASA Astrophysics Data System (ADS)

Hamouda, Ajmi Bh.; Sathiyanarayanan, Rajesh; Pimpinelli, Alberto; Einstein, T. L.

2011-01-01

A unified explanation of the physics underlying all the distinctive features of the growth instabilities observed on Cu vicinals has long eluded theorists. Recently, kinetic Monte Carlo studies showed that codeposition of impurities during growth could account for the key distinctive experimental observations [Hamouda , Phys. Rev. BPLRBAQ0556-280510.1103/PhysRevB.77.245430 77, 245430 (2008)]. To identify the responsible impurity atom, we compute the nearest-neighbor binding energies (ENN) and terrace diffusion barriers (Ed) for several candidate impurity atoms on Cu(0 0 1) using DFT-based VASP. Our calculations show that codeposition (with Cu) of midtransition elements, such as Fe, Mn, and W, could—in conjunction with substantial Ehrlich-Schwoebel barriers—cause the observed instabilities; when the experimental setup is considered, W emerges to be the most likely candidate. We discuss the role of impurities in nanostructuring of surfaces.

Comparative analysis of Leishmania exoproteomes: implication for host-pathogen interactions.

PubMed

Peysselon, Franck; Launay, Guillaume; Lisacek, Frédérique; Duclos, Bertrand; Ricard-Blum, Sylvie

2013-12-01

Leishmaniasis is a vector-borne disease caused by the protozoa Leishmania. We have analyzed and compared the sequences of three experimental exoproteomes of Leishmania promastigotes from different species to determine their specific features and to identify new candidate proteins involved in interactions of Leishmania with the host. The exoproteomes differ from the proteomes by a decrease in the average molecular weight per protein, in disordered amino acid residues and in basic proteins. The exoproteome of the visceral species is significantly enriched in sites predicted to be phosphorylated as well as in features frequently associated with molecular interactions (intrinsic disorder, number of disordered binding regions per protein, interaction and/or trafficking motifs) compared to the other species. The visceral species might thus have a larger interaction repertoire with the host than the other species. Less than 10% of the exoproteomes contain heparin-binding and RGD sequences, and ~30% the host targeting signal RXLXE/D/Q. These latter proteins might thus be exported inside the host cell during the intracellular stage of the infection. Furthermore we have identified nine protein families conserved in the three exoproteomes with specific combinations of Pfam domains and selected eleven proteins containing at least three interaction and/or trafficking motifs including two splicing factors, phosphomannomutase, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase, the paraflagellar rod protein-1D and a putative helicase. Their role in host-Leishmania interactions warrants further investigation but the putative ATP-dependent DEAD/H RNA helicase, which contains numerous interaction motifs, a host targeting signal and two disordered regions, is a very promising candidate. © 2013.

Molecular determinants of Cytochrome C oxidase IV mRNA axonal trafficking

PubMed Central

Kar, Amar N.; Vargas, Jose Norberto S.; Chen, Cai-Yun; Kowalak, Jeffrey A; Gioio, Anthony E.; Kaplan, Barry B.

2017-01-01

In previous studies, we identified a putative 38-nucleotide stem-loop structure (zipcode) in the 3′ untranslated region of the cytochrome c oxidase subunit IV (COXIV) mRNA that was necessary and sufficient for the axonal localization of the message in primary superior cervical ganglion (SCG) neurons. However, little is known about the proteins that interact with the COXIV-zipcode and regulate the axonal trafficking and local translation of the COXIV message. To identify proteins involved in the axonal transport of the COXIV mRNA, we used the biotinylated 38-nucleotide COXIV RNA zipcode as bait in the affinity purification of COXIV zipcode binding proteins. Gel-shift assays of the biotinylated COXIV zipcode indicated that the putative stem-loop structure functions as a nucleation site for the formation of ribonucleoprotein complexes. Mass spectrometric analysis of the COXIV zipcode ribonucleoprotein complex led to the identification of a large number RNA binding proteins, including fused in sarcoma/translated in liposarcoma (FUS/TLS), and Y-box protein 1 (YB-1). Validation experiments, using western analyses, confirmed the presence of the candidate proteins in the COXIV zipcode affinity purified complexes obtained from SCG axons. Immunohistochemical studies show that FUS, and YB-1 are present in SCG axons. Importantly, RNA immunoprecipitation studies show that FUS, and YB-1 interact with endogenous axonal COXIV transcripts. siRNA-mediated downregulation of the candidate proteins FUS and YB-1 expression in the cell-bodies diminishes the levels of COXIV mRNA in the axon, suggesting functional roles for these proteins in the axonal trafficking of COXIV mRNA. PMID:28161363

Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia.

PubMed

Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Cheong, Hyun Sub; Kim, Jeong-Hyun; Namgoong, Suhg; Kim, Ji-On; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il

2015-04-01

Schizophrenia is a serious mental disorder that is affected by genetic and environmental factors. As the disease has a high heritability rate, genetic studies identifying candidate genes for schizophrenia have been conducted in various populations. The gene for human Ran‑binding protein 9 (RANBP9) is a newly discovered candidate gene for schizophrenia. As RANBP9 is a small guanosine‑5'‑triphosphate‑binding protein that interacts with the disrupted in schizophrenia 1 protein, it is considered to be an important molecule in the pathogenesis of schizophrenia. However, to date, no study has examined the possible association between the genetic variations of RANBP9 and the risk of schizophrenia. In the present study, it was hypothesized that RANBP9 variations may influence the risk of schizophrenia. In order to investigate the association between RANBP9 polymorphisms and the risk of schizophrenia and smooth pursuit eye movement (SPEM) abnormalities, a case‑control association analysis was performed. Using a TaqMan assay, five single‑nucleotide polymorphisms and an insertion/deletion variation within the start codon region of RANBP9 were genotyped. Five major haplotypes were identified in 449 patients with schizophrenia and 393 unrelated healthy individuals as controls (total, n=842). However, the association analyses revealed no associations between all genetic variants and schizophrenia and SPEM abnormality. To the best of our knowledge, this is the first study to investigate an association between RANBP9 polymorphisms and schizophrenia and SPEM abnormality. The findings of allele frequencies and association results in this study may aid in further genetic etiological studies in schizophrenia in various populations.

A novel lectin from Agrocybe aegerita shows high binding selectivity for terminal N-acetylglucosamine

PubMed Central

Jiang, Shuai; Chen, Yijie; Wang, Man; Yin, Yalin; Pan, Yongfu; Gu, Bianli; Yu, Guojun; Li, Yamu; Wong, Barry Hon Cheung; Liang, Yi; Sun, Hui

2012-01-01

A novel lectin was isolated from the mushroom Agrocybe aegerita (designated AAL-2) by affinity chromatography with GlcNAc (N-acetylglucosamine)-coupled Sepharose 6B after ammonium sulfate precipitation. The AAL-2 coding sequence (1224 bp) was identified by performing a homologous search of the five tryptic peptides identified by MS against the translated transcriptome of A. aegerita. The molecular mass of AAL-2 was calculated to be 43.175 kDa from MS, which was consistent with the data calculated from the amino acid sequence. To analyse the carbohydrate-binding properties of AAL-2, a glycan array composed of 465 glycan candidates was employed, and the result showed that AAL-2 bound with high selectivity to terminal non-reducing GlcNAc residues, and further analysis revealed that AAL-2 bound to terminal non-reducing GlcNAc residues with higher affinity than previously well-known GlcNAc-binding lectins such as WGA (wheatgerm agglutinin) and GSL-II (Griffonia simplicifolia lectin-II). ITC (isothermal titration calorimetry) showed further that GlcNAc bound to AAL-2 in a sequential manner with moderate affinity. In the present study, we also evaluated the anti-tumour activity of AAL-2. The results showed that AAL-2 could bind to the surface of hepatoma cells, leading to induced cell apoptosis in vitro. Furthermore, AAL-2 exerted an anti-hepatoma effect via inhibition of tumour growth and prolongation of survival time of tumour-bearing mice in vivo. PMID:22268569

Search for Partner Proteins of A. thaliana Immunophilins Involved in the Control of Plant Immunity.

PubMed

Abdeeva, Inna A; Pogorelko, Gennady V; Maloshenok, Liliya G; Mokrykova, Maria V; Fursova, Oksana V; Bruskin, Sergey A

2018-04-19

The involvement of plant immunophilins in multiple essential processes such as development, various ways of adapting to biotic and abiotic stresses, and photosynthesis has already been established. Previously, research has demonstrated the involvement of three immunophilin genes ( AtCYP19-1/ROC3 , AtFKBP65/ROF2 , and AtCYP57 ) in the control of plant response to invasion by various pathogens. Current research attempts to identify host target proteins for each of the selected immunophilins. As a result, candidate interactors have been determined and confirmed using a yeast 2-hybrid (Y2H) system for protein⁻protein interaction assays. The generation of mutant isoforms of ROC3 and AtCYP57 harboring substituted amino acids in the in silico-predicted active sites became essential to achieving significant binding to its target partners. This data shows that ROF2 targets calcium-dependent lipid-binding domain-containing protein (At1g70790; AT1) and putative protein phosphatase (At2g30020; АТ2), whereas ROC3 interacts with GTP-binding protein (At1g30580; ENGD-1) and RmlC-like cupin (At5g39120). The immunophilin AtCYP57 binds to putative pyruvate decarboxylase-1 (Pdc1) and clathrin adaptor complex-related protein (At5g05010). Identified interactors confirm our previous findings that immunophilins ROC3 , ROF2 , and AtCYP57 are directly involved with stress response control. Further, these findings extend our understanding of the molecular functional pathways of these immunophilins.

Regulation of neural macroRNAs by the transcriptional repressor REST

PubMed Central

Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J.; Stanton, Lawrence W.; Lipovich, Leonard

2009-01-01

The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs (“macroRNAs”), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer. PMID:19050060

Regulation of neural macroRNAs by the transcriptional repressor REST.

PubMed

Johnson, Rory; Teh, Christina Hui-Leng; Jia, Hui; Vanisri, Ravi Raj; Pandey, Tridansh; Lu, Zhong-Hao; Buckley, Noel J; Stanton, Lawrence W; Lipovich, Leonard

2009-01-01

The essential transcriptional repressor REST (repressor element 1-silencing transcription factor) plays central roles in development and human disease by regulating a large cohort of neural genes. These have conventionally fallen into the class of known, protein-coding genes; recently, however, several noncoding microRNA genes were identified as REST targets. Given the widespread transcription of messenger RNA-like, noncoding RNAs ("macroRNAs"), some of which are functional and implicated in disease in mammalian genomes, we sought to determine whether this class of noncoding RNAs can also be regulated by REST. By applying a new, unbiased target gene annotation pipeline to computationally discovered REST binding sites, we find that 23% of mammalian REST genomic binding sites are within 10 kb of a macroRNA gene. These putative target genes were overlooked by previous studies. Focusing on a set of 18 candidate macroRNA targets from mouse, we experimentally demonstrate that two are regulated by REST in neural stem cells. Flanking protein-coding genes are, at most, weakly repressed, suggesting specific targeting of the macroRNAs by REST. Similar to the majority of known REST target genes, both of these macroRNAs are induced during nervous system development and have neurally restricted expression profiles in adult mouse. We observe a similar phenomenon in human: the DiGeorge syndrome-associated noncoding RNA, DGCR5, is repressed by REST through a proximal upstream binding site. Therefore neural macroRNAs represent an additional component of the REST regulatory network. These macroRNAs are new candidates for understanding the role of REST in neuronal development, neurodegeneration, and cancer.

Identification and Comparison of Candidate Olfactory Genes in the Olfactory and Non-Olfactory Organs of Elm Pest Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) Based on Transcriptome Analysis.

PubMed

Wang, Yinliang; Chen, Qi; Zhao, Hanbo; Ren, Bingzhong

2016-01-01

The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs), 10 chemosensory proteins (CSPs), 34 odorant receptors (ORs), 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs) and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, AquaOBP4/C5, AquaCSP7/9/10, AquaOR17/24/32 and AquaIR4 were highly expressed in the antenna of males, suggesting that these genes were related to sex-specific behaviors, and expression trends that were male specific were observed for most candidate olfactory genes, which supported the existence of a female-produced sex pheromone in A. quadriimpressum. All of these results could provide valuable information and guidance for future functional studies on these genes and provide better molecular knowledge regarding the olfactory system in A. quadriimpressum.

Genome-wide mapping and analysis of aryl hydrocarbon receptor (AHR)- and aryl hydrocarbon receptor repressor (AHRR)-binding sites in human breast cancer cells.

PubMed

Yang, Sunny Y; Ahmed, Shaimaa; Satheesh, Somisetty V; Matthews, Jason

2018-01-01

The aryl hydrocarbon receptor (AHR) mediates the toxic actions of environmental contaminants, such as 2,3,7,8-tetrachlorodibenzo-ρ-dioxin (TCDD), and also plays roles in vascular development, the immune response, and cell cycle regulation. The AHR repressor (AHRR) is an AHR-regulated gene and a negative regulator of AHR; however, the mechanisms of AHRR-dependent repression of AHR are unclear. In this study, we compared the genome-wide binding profiles of AHR and AHRR in MCF-7 human breast cancer cells treated for 24 h with TCDD using chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). We identified 3915 AHR- and 2811 AHRR-bound regions, of which 974 (35%) were common to both datasets. When these 24-h datasets were also compared with AHR-bound regions identified after 45 min of TCDD treatment, 67% (1884) of AHRR-bound regions overlapped with those of AHR. This analysis identified 994 unique AHRR-bound regions. AHRR-bound regions mapped closer to promoter regions when compared with AHR-bound regions. The AHRE was identified and overrepresented in AHR:AHRR-co-bound regions, AHR-only regions, and AHRR-only regions. Candidate unique AHR- and AHRR-bound regions were validated by ChIP-qPCR and their ability to regulate gene expression was confirmed by luciferase reporter gene assays. Overall, this study reveals that AHR and AHRR exhibit similar but also distinct genome-wide binding profiles, supporting the notion that AHRR is a context- and gene-specific repressor of AHR activity.

Overexpression of the S100A2 protein as a prognostic marker for patients with stage II and III colorectal cancer

PubMed Central

MASUDA, TAIKI; ISHIKAWA, TOSHIAKI; MOGUSHI, KAORU; OKAZAKI, SATOSHI; ISHIGURO, MEGUMI; IIDA, SATORU; MIZUSHIMA, HIROSHI; TANAKA, HIROSHI; UETAKE, HIROYUKI; SUGIHARA, KENICHI

2016-01-01

We aimed to identify a novel prognostic biomarker related to recurrence in stage II and III colorectal cancer (CRC) patients. Stage II and III CRC tissue mRNA expression was profiled using an Affymetrix Gene Chip, and copy number profiles of 125 patients were generated using an Affymetrix 250K Sty array. Genes showing both upregulated expression and copy number gains in cases involving recurrence were extracted as candidate biomarkers. The protein expression of the candidate gene was assessed using immunohistochemical staining of tissue from 161 patients. The relationship between protein expression and clinicopathological features was also examined. We identified 9 candidate genes related to recurrence of stage II and III CRC, whose mRNA expression was significantly higher in CRC than in normal tissue. Of these proteins, the S100 calcium-binding protein A2 (S100A2) has been observed in several human cancers. S100A2 protein overexpression in CRC cells was associated with significantly worse overall survival and relapse-free survival, indicating that S100A2 is an independent risk factor for stage II and III CRC recurrence. S100A2 overexpression in cancer cells could be a biomarker of poor prognosis in stage II and III CRC recurrence and a target for treatment of this disease. PMID:26783118

Environmental contaminants and microRNA regulation: Transcription factors as regulators of toxicant-altered microRNA expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sollome, James; Martin, Elizabeth

MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database,more » genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.« less

Candidate SNP markers of aggressiveness-related complications and comorbidities of genetic diseases are predicted by a significant change in the affinity of TATA-binding protein for human gene promoters.

PubMed

Chadaeva, Irina V; Ponomarenko, Mikhail P; Rasskazov, Dmitry A; Sharypova, Ekaterina B; Kashina, Elena V; Matveeva, Marina Yu; Arshinova, Tatjana V; Ponomarenko, Petr M; Arkova, Olga V; Bondar, Natalia P; Savinkova, Ludmila K; Kolchanov, Nikolay A

2016-12-28

Aggressiveness in humans is a hereditary behavioral trait that mobilizes all systems of the body-first of all, the nervous and endocrine systems, and then the respiratory, vascular, muscular, and others-e.g., for the defense of oneself, children, family, shelter, territory, and other possessions as well as personal interests. The level of aggressiveness of a person determines many other characteristics of quality of life and lifespan, acting as a stress factor. Aggressive behavior depends on many parameters such as age, gender, diseases and treatment, diet, and environmental conditions. Among them, genetic factors are believed to be the main parameters that are well-studied at the factual level, but in actuality, genome-wide studies of aggressive behavior appeared relatively recently. One of the biggest projects of the modern science-1000 Genomes-involves identification of single nucleotide polymorphisms (SNPs), i.e., differences of individual genomes from the reference genome. SNPs can be associated with hereditary diseases, their complications, comorbidities, and responses to stress or a drug. Clinical comparisons between cohorts of patients and healthy volunteers (as a control) allow for identifying SNPs whose allele frequencies significantly separate them from one another as markers of the above conditions. Computer-based preliminary analysis of millions of SNPs detected by the 1000 Genomes project can accelerate clinical search for SNP markers due to preliminary whole-genome search for the most meaningful candidate SNP markers and discarding of neutral and poorly substantiated SNPs. Here, we combine two computer-based search methods for SNPs (that alter gene expression) {i} Web service SNP_TATA_Comparator (DNA sequence analysis) and {ii} PubMed-based manual search for articles on aggressiveness using heuristic keywords. Near the known binding sites for TATA-binding protein (TBP) in human gene promoters, we found aggressiveness-related candidate SNP markers, including rs1143627 (associated with higher aggressiveness in patients undergoing cytokine immunotherapy), rs544850971 (higher aggressiveness in old women taking lipid-lowering medication), and rs10895068 (childhood aggressiveness-related obesity in adolescence with cardiovascular complications in adulthood). After validation of these candidate markers by clinical protocols, these SNPs may become useful for physicians (may help to improve treatment of patients) and for the general population (a lifestyle choice preventing aggressiveness-related complications).

MRP4/ABCC4 as a new therapeutic target: meta-analysis to determine cAMP binding sites as a tool for drug design.

PubMed

Yaneff, Agustín; Sahores, Ana; Gomez, Natalia; Carozzo, Alejandro; Shayo, Carina; Davio, Carlos

2017-12-29

MRP4 transports multiple endogenous and exogenous substances and is critical not only for detoxification but also in the homeostasis of several signaling molecules. Its dysregulation has been reported in numerous pathological disorders, thus MRP4 appears as an attractive therapeutic target. However, the efficacy of MRP4 inhibitors is still controversial. The design of specific pharmacological agents with the ability to selectively modulate the activity of this transporter or modify its affinity to certain substrates represents a challenge in current medicine and chemical biology. The first step in the long process of drug rational design is to identify the therapeutic target and characterize the mechanism by which it affects the given pathology. In order to develop a pharmacological agent with high specific activity, the second step is to systematically study the structure of the target and identify all the possible binding sites. Using available homology models and mutagenesis assays, in this review we recapitulate the up-to-date knowledge about MRP structure and aligned amino acid sequences to identify the candidate MRP4 residues where cyclic nucleotides bind. We have also listed the most relevant MRP inhibitors studied to date, considering drug safety and specificity for MRP4 in particular. This metaanalysis platform may serve as a basis for the future development of inhibitors of MRP4 cAMP specific transport. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

A Library of Plasmodium vivax Recombinant Merozoite Proteins Reveals New Vaccine Candidates and Protein-Protein Interactions

PubMed Central

Hostetler, Jessica B.; Sharma, Sumana; Bartholdson, S. Josefin; Wright, Gavin J.; Fairhurst, Rick M.; Rayner, Julian C.

2015-01-01

Background A vaccine targeting Plasmodium vivax will be an essential component of any comprehensive malaria elimination program, but major gaps in our understanding of P. vivax biology, including the protein-protein interactions that mediate merozoite invasion of reticulocytes, hinder the search for candidate antigens. Only one ligand-receptor interaction has been identified, that between P. vivax Duffy Binding Protein (PvDBP) and the erythrocyte Duffy Antigen Receptor for Chemokines (DARC), and strain-specific immune responses to PvDBP make it a complex vaccine target. To broaden the repertoire of potential P. vivax merozoite-stage vaccine targets, we exploited a recent breakthrough in expressing full-length ectodomains of Plasmodium proteins in a functionally-active form in mammalian cells and initiated a large-scale study of P. vivax merozoite proteins that are potentially involved in reticulocyte binding and invasion. Methodology/Principal Findings We selected 39 P. vivax proteins that are predicted to localize to the merozoite surface or invasive secretory organelles, some of which show homology to P. falciparum vaccine candidates. Of these, we were able to express 37 full-length protein ectodomains in a mammalian expression system, which has been previously used to express P. falciparum invasion ligands such as PfRH5. To establish whether the expressed proteins were correctly folded, we assessed whether they were recognized by antibodies from Cambodian patients with acute vivax malaria. IgG from these samples showed at least a two-fold change in reactivity over naïve controls in 27 of 34 antigens tested, and the majority showed heat-labile IgG immunoreactivity, suggesting the presence of conformation-sensitive epitopes and native tertiary protein structures. Using a method specifically designed to detect low-affinity, extracellular protein-protein interactions, we confirmed a predicted interaction between P. vivax 6-cysteine proteins P12 and P41, further suggesting that the proteins are natively folded and functional. This screen also identified two novel protein-protein interactions, between P12 and PVX_110945, and between MSP3.10 and MSP7.1, the latter of which was confirmed by surface plasmon resonance. Conclusions/Significance We produced a new library of recombinant full-length P. vivax ectodomains, established that the majority of them contain tertiary structure, and used them to identify predicted and novel protein-protein interactions. As well as identifying new interactions for further biological studies, this library will be useful in identifying P. vivax proteins with vaccine potential, and studying P. vivax malaria pathogenesis and immunity. Trial Registration ClinicalTrials.gov NCT00663546 PMID:26701602

MSC secretes at least 3 EV types each with a unique permutation of membrane lipid, protein and RNA.

PubMed

Lai, Ruenn Chai; Tan, Soon Sim; Yeo, Ronne Wee Yeh; Choo, Andre Boon Hwa; Reiner, Agnes T; Su, Yan; Shen, Yang; Fu, Zhiyan; Alexander, Lezhava; Sze, Siu Kwan; Lim, Sai Kiang

2016-01-01

Mesenchymal stem cell (MSC), a widely used adult stem cell candidate for regenerative medicine, has been shown to exert some of its therapeutic effects through the secretion of extracellular vesicles (EVs). These homogenously sized EVs of 100-150 ηm exhibited many exosome-like biophysical and biochemical properties and carry both proteins and RNAs. Recently, exosome-associated proteins in this MSC EV preparation were found to segregate primarily to those EVs that bind cholera toxin B chain (CTB), a GM1 ganglioside-specific ligand, and pulse-chase experiments demonstrated that these EVs have endosomal origin and carried many of the exosome-associated markers. Here, we report that only a fraction of the MSC EV proteome was found in CTB-bound EVs. Using Annexin V (AV) and Shiga toxin B subunit (ST) with affinities for phosphatidylserine and globotriaosylceramide, respectively, AV- and a ST-binding EV were identified. CTB-, AV- and ST-binding EVs all carried actin. However, the AV-binding EVs carried low or undetectable levels of the exosome-associated proteins. Only the ST-binding EVs carried RNA and EDA-containing fibronectin. Proteins in AV-binding EVs were also different from those released by apoptotic MSCs. CTB- and AV-binding activities were localized to the plasma membrane and cytoplasm of MSCs, while ST-binding activity was localized to the nucleus. Together, this study demonstrates that cells secrete many types of EVs. Specifically, MSCs secrete at least 3 types. They can be differentially isolated based on their affinities for membrane lipid-binding ligands. As the subcellular sites of the binding activities of these ligands and cargo load are different for each EV type, they are likely to have a different biogenesis pathway and possibly different functions.

Identification and molecular characterization of a new ovarian cancer susceptibility locus at 17q21.31

PubMed Central

Permuth-Wey, Jennifer; Lawrenson, Kate; Shen, Howard C.; Velkova, Aneliya; Tyrer, Jonathan P.; Chen, Zhihua; Lin, Hui-Yi; Chen, Y. Ann; Tsai, Ya-Yu; Qu, Xiaotao; Ramus, Susan J.; Karevan, Rod; Lee, Janet; Lee, Nathan; Larson, Melissa C.; Aben, Katja K.; Anton-Culver, Hoda; Antonenkova, Natalia; Antoniou, Antonis; Armasu, Sebastian M.; Bacot, François; Baglietto, Laura; Bandera, Elisa V.; Barnholtz-Sloan, Jill; Beckmann, Matthias W.; Birrer, Michael J.; Bloom, Greg; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Brown, Robert; Butzow, Ralf; Cai, Qiuyin; Campbell, Ian; Chang-Claude, Jenny; Chanock, Stephen; Chenevix-Trench, Georgia; Cheng, Jin Q.; Cicek, Mine S.; Coetzee, Gerhard A.; Cook, Linda S.; Couch, Fergus J.; Cramer, Daniel W.; Cunningham, Julie M.; Dansonka-Mieszkowska, Agnieszka; Despierre, Evelyn; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Dürst, Matthias; Easton, Douglas F; Eccles, Diana; Edwards, Robert; Ekici, Arif B.; Fasching, Peter A.; Fenstermacher, David A.; Flanagan, James M.; Garcia-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind M.; Gonzalez-Bosquet, Jesus; Goodman, Marc T.; Gore, Martin; Górski, Bohdan; Gronwald, Jacek; Hall, Per; Halle, Mari K.; Harter, Philipp; Heitz, Florian; Hillemanns, Peter; Hoatlin, Maureen; Høgdall, Claus K.; Høgdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Jim, Heather; Kalli, Kimberly R.; Karlan, Beth Y.; Kaye, Stanley B.; Kelemen, Linda E.; Kiemeney, Lambertus A.; Kikkawa, Fumitaka; Konecny, Gottfried E.; Krakstad, Camilla; Kjaer, Susanne Krüger; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Lancaster, Johnathan M.; Le, Nhu D.; Leminen, Arto; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lin, Jie; Lissowska, Jolanta; Lu, Karen H.; Lubiński, Jan; Lurie, Galina; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B.; Nakanishi, Toru; Narod, Steven A.; Nedergaard, Lotte; Ness, Roberta B.; Nevanlinna, Heli; Nickels, Stefan; Noushmehr, Houtan; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Raska, Paola; Renner, Stefan P.; Risch, Harvey A.; Rodriguez-Rodriguez, Lorna; Rossing, Mary Anne; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schwaab, Ira; Severi, Gianluca; Shridhar, Vijayalakshmi; Shu, Xiao-Ou; Shvetsov, Yurii B.; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Stram, Daniel; Sutphen, Rebecca; Teo, Soo-Hwang; Terry, Kathryn L.; Tessier, Daniel C.; Thompson, Pamela J.; Tworoger, Shelley S.; van Altena, Anne M.; Vergote, Ignace; Vierkant, Robert A.; Vincent, Daniel; Vitonis, Allison F.; Wang-Gohrke, Shan; Weber, Rachel Palmieri; Wentzensen, Nicolas; Whittemore, Alice S.; Wik, Elisabeth; Wilkens, Lynne R.; Winterhoff, Boris; Woo, Yin Ling; Wu, Anna H.; Xiang, Yong-Bing; Yang, Hannah P.; Zheng, Wei; Ziogas, Argyrios; Zulkifli, Famida; Phelan, Catherine M.; Iversen, Edwin; Schildkraut, Joellen M.; Berchuck, Andrew; Fridley, Brooke L.; Goode, Ellen L.; Pharoah, Paul D. P.; Monteiro, Alvaro N.A.; Sellers, Thomas A.; Gayther, Simon A.

2013-01-01

Epithelial ovarian cancer (EOC) has a heritable component that remains to be fully characterized. Most identified common susceptibility variants lie in non-protein-coding sequences. We hypothesized that variants in the 3′ untranslated region at putative microRNA (miRNA) binding sites represent functional targets that influence EOC susceptibility. Here, we evaluate the association between 767 miRNA binding site single nucleotide polymorphisms (miRSNPs) and EOC risk in 18,174 EOC cases and 26,134 controls from 43 studies genotyped through the Collaborative Oncological Gene-environment Study. We identify several miRSNPs associated with invasive serous EOC risk (OR=1.12, P=10−8) mapping to an inversion polymorphism at 17q21.31. Additional genotyping of non-miRSNPs at 17q21.31 reveals stronger signals outside the inversion (P=10−10). Variation at 17q21.31 associates with neurological diseases, and our collaboration is the first to report an association with EOC susceptibility. An integrated molecular analysis in this region provides evidence for ARHGAP27 and PLEKHM1 as candidate EOC susceptibility genes. PMID:23535648

Three dimensional model of severe acute respiratory syndrome coronavirus helicase ATPase catalytic domain and molecular design of severe acute respiratory syndrome coronavirus helicase inhibitors

NASA Astrophysics Data System (ADS)

Hoffmann, Marcin; Eitner, Krystian; von Grotthuss, Marcin; Rychlewski, Leszek; Banachowicz, Ewa; Grabarkiewicz, Tomasz; Szkoda, Tomasz; Kolinski, Andrzej

2006-05-01

The modeling of the severe acute respiratory syndrome coronavirus helicase ATPase catalytic domain was performed using the protein structure prediction Meta Server and the 3D Jury method for model selection, which resulted in the identification of 1JPR, 1UAA and 1W36 PDB structures as suitable templates for creating a full atom 3D model. This model was further utilized to design small molecules that are expected to block an ATPase catalytic pocket thus inhibit the enzymatic activity. Binding sites for various functional groups were identified in a series of molecular dynamics calculation. Their positions in the catalytic pocket were used as constraints in the Cambridge structural database search for molecules having the pharmacophores that interacted most strongly with the enzyme in a desired position. The subsequent MD simulations followed by calculations of binding energies of the designed molecules were compared to ATP identifying the most successful candidates, for likely inhibitors—molecules possessing two phosphonic acid moieties at distal ends of the molecule.

Combined serial analysis of gene expression and transcription factor binding site prediction identifies novel-candidate-target genes of Nr2e1 in neocortex development.

PubMed

Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W

2015-07-24

Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.

Characterisation of a novel, high affinity and selective αvβ6 integrin RGD-mimetic radioligand.

PubMed

Hall, Eleanor R; Bibby, Lloyd I; Slack, Robert J

2016-10-01

The alpha-v beta-6 (αvβ6) integrin has been identified as playing a key role in the activation of transforming growth factor-β (TGFβ) that is hypothesised to be pivotal in the development of cancer and fibrotic diseases. Therefore, the αvβ6 integrin is an attractive therapeutic target for these debilitating diseases and a drug discovery programme to identify small molecule αvβ6 selective arginyl-glycinyl-aspartic acid (RGD)-mimetics was initiated within GlaxoSmithKline. The primary aim of this study was to pharmacologically characterise the binding to αvβ6 of a novel clinical candidate, compound 1, using a radiolabelled form. Radioligand binding studies were completed with [(3)H]compound 1 against the human and mouse soluble protein forms of αvβ6 to determine accurate affinity estimates and binding kinetics. The selectivity of compound 1 for the RGD integrin family was also determined using saturation binding studies (αvβ1, αvβ3, αvβ5, αvβ8, α5β1 and α8β1 integrins) and fibrinogen-induced platelet aggregation (αIIbβ3 integrin). In addition, the relationship between divalent metal cation type and concentration and αvβ6 RGD site binding was also investigated. Compound 1 has been demonstrated to bind with extremely high affinity and selectivity for the αvβ6 integrin and has the potential as a clinical tool and therapeutic for investigating the role of αvβ6 in a range of disease states both pre-clinically and clinically. In addition, this is the first study that has successfully applied radioligand binding to the RGD integrin field to accurately determine the affinity and selectivity profile of a small molecule RGD-mimetic. Copyright © 2016 Elsevier Inc. All rights reserved.

Fine Specificity of Plasmodium vivax Duffy Binding Protein Binding Engagement of the Duffy Antigen on Human Erythrocytes

PubMed Central

Siddiqui, Asim A.; Xainli, Jia; Schloegel, Jesse; Carias, Lenore; Ntumngia, Francis; Shoham, Menachem; Casey, Joanne L.; Foley, Michael; Adams, John H.

2012-01-01

Plasmodium vivax invasion of human erythrocytes requires interaction of the P. vivax Duffy binding protein (PvDBP) with its host receptor, the Duffy antigen (Fy) on the erythrocyte surface. Consequently, PvDBP is a leading vaccine candidate. The binding domain of PvDBP lies in a cysteine-rich portion of the molecule called region II (PvDBPII). PvDBPII contains three distinct subdomains based upon intramolecular disulfide bonding patterns. Subdomain 2 (SD2) is highly polymorphic and is thought to contain many key residues for binding to Fy, while SD1 and SD3 are comparatively conserved and their role in Fy binding is not well understood. To examine the relative contributions of the different subdomains to binding to Fy and their abilities to elicit strain-transcending binding-inhibitory antibodies, we evaluated recombinant proteins from SD1+2, SD2, SD3, and SD3+, which includes 24 residues of SD2. All of the recombinant subdomains, except for SD2, bound variably to human erythrocytes, with constructs containing SD3 showing the best binding. Antisera raised in laboratory animals against SD3, SD3+, and SD2+3 inhibited the binding of full-length PvDBPII, which is strain transcending, whereas antisera generated to SD1+2 and SD2 failed to generate blocking antibodies. All of the murine monoclonal antibodies generated to full-length PvDBPII that had significant binding-inhibitory activity recognized only SD3. Thus, SD3 binds Fy and elicits blocking antibodies, indicating that it contains residues critical to Fy binding that could be the basis of a strain-transcending candidate vaccine against P. vivax. PMID:22615246

Fine specificity of Plasmodium vivax Duffy binding protein binding engagement of the Duffy antigen on human erythrocytes.

PubMed

Siddiqui, Asim A; Xainli, Jia; Schloegel, Jesse; Carias, Lenore; Ntumngia, Francis; Shoham, Menachem; Casey, Joanne L; Foley, Michael; Adams, John H; King, Christopher L

2012-08-01

Plasmodium vivax invasion of human erythrocytes requires interaction of the P. vivax Duffy binding protein (PvDBP) with its host receptor, the Duffy antigen (Fy) on the erythrocyte surface. Consequently, PvDBP is a leading vaccine candidate. The binding domain of PvDBP lies in a cysteine-rich portion of the molecule called region II (PvDBPII). PvDBPII contains three distinct subdomains based upon intramolecular disulfide bonding patterns. Subdomain 2 (SD2) is highly polymorphic and is thought to contain many key residues for binding to Fy, while SD1 and SD3 are comparatively conserved and their role in Fy binding is not well understood. To examine the relative contributions of the different subdomains to binding to Fy and their abilities to elicit strain-transcending binding-inhibitory antibodies, we evaluated recombinant proteins from SD1+2, SD2, SD3, and SD3+, which includes 24 residues of SD2. All of the recombinant subdomains, except for SD2, bound variably to human erythrocytes, with constructs containing SD3 showing the best binding. Antisera raised in laboratory animals against SD3, SD3+, and SD2+3 inhibited the binding of full-length PvDBPII, which is strain transcending, whereas antisera generated to SD1+2 and SD2 failed to generate blocking antibodies. All of the murine monoclonal antibodies generated to full-length PvDBPII that had significant binding-inhibitory activity recognized only SD3. Thus, SD3 binds Fy and elicits blocking antibodies, indicating that it contains residues critical to Fy binding that could be the basis of a strain-transcending candidate vaccine against P. vivax.

Development of a strategy and computational application to select candidate protein analogues with reduced HLA binding and immunogenicity.

PubMed

Dhanda, Sandeep Kumar; Grifoni, Alba; Pham, John; Vaughan, Kerrie; Sidney, John; Peters, Bjoern; Sette, Alessandro

2018-01-01

Unwanted immune responses against protein therapeutics can reduce efficacy or lead to adverse reactions. T-cell responses are key in the development of such responses, and are directed against immunodominant regions within the protein sequence, often associated with binding to several allelic variants of HLA class II molecules (promiscuous binders). Herein, we report a novel computational strategy to predict 'de-immunized' peptides, based on previous studies of erythropoietin protein immunogenicity. This algorithm (or method) first predicts promiscuous binding regions within the target protein sequence and then identifies residue substitutions predicted to reduce HLA binding. Further, this method anticipates the effect of any given substitution on flanking peptides, thereby circumventing the creation of nascent HLA-binding regions. As a proof-of-principle, the algorithm was applied to Vatreptacog α, an engineered Factor VII molecule associated with unintended immunogenicity. The algorithm correctly predicted the two immunogenic peptides containing the engineered residues. As a further validation, we selected and evaluated the immunogenicity of seven substitutions predicted to simultaneously reduce HLA binding for both peptides, five control substitutions with no predicted reduction in HLA-binding capacity, and additional flanking region controls. In vitro immunogenicity was detected in 21·4% of the cultures of peptides predicted to have reduced HLA binding and 11·4% of the flanking regions, compared with 46% for the cultures of the peptides predicted to be immunogenic. This method has been implemented as an interactive application, freely available online at http://tools.iedb.org/deimmunization/. © 2017 John Wiley & Sons Ltd.

Machine Learning Helps Identify CHRONO as a Circadian Clock Component

PubMed Central

Venkataraman, Anand; Ramanathan, Chidambaram; Kavakli, Ibrahim H.; Hughes, Michael E.; Baggs, Julie E.; Growe, Jacqueline; Liu, Andrew C.; Kim, Junhyong; Hogenesch, John B.

2014-01-01

Over the last decades, researchers have characterized a set of “clock genes” that drive daily rhythms in physiology and behavior. This arduous work has yielded results with far-reaching consequences in metabolic, psychiatric, and neoplastic disorders. Recent attempts to expand our understanding of circadian regulation have moved beyond the mutagenesis screens that identified the first clock components, employing higher throughput genomic and proteomic techniques. In order to further accelerate clock gene discovery, we utilized a computer-assisted approach to identify and prioritize candidate clock components. We used a simple form of probabilistic machine learning to integrate biologically relevant, genome-scale data and ranked genes on their similarity to known clock components. We then used a secondary experimental screen to characterize the top candidates. We found that several physically interact with known clock components in a mammalian two-hybrid screen and modulate in vitro cellular rhythms in an immortalized mouse fibroblast line (NIH 3T3). One candidate, Gene Model 129, interacts with BMAL1 and functionally represses the key driver of molecular rhythms, the BMAL1/CLOCK transcriptional complex. Given these results, we have renamed the gene CHRONO (computationally highlighted repressor of the network oscillator). Bi-molecular fluorescence complementation and co-immunoprecipitation demonstrate that CHRONO represses by abrogating the binding of BMAL1 to its transcriptional co-activator CBP. Most importantly, CHRONO knockout mice display a prolonged free-running circadian period similar to, or more drastic than, six other clock components. We conclude that CHRONO is a functional clock component providing a new layer of control on circadian molecular dynamics. PMID:24737000

More powerful virus inhibitors from structure-based analysis of HEV71 capsid-binding molecules

PubMed Central

Spyrou, John A. B.; Kelly, James; Ren, Jingshan; Grimes, Jonathan; Puerstinger, Gerhard; Stonehouse, Nicola; Walter, Thomas S.; Hu, Zhongyu; Wang, Junzhi; Li, Xuemei; Peng, Wei; Rowlands, David; Fry, Elizabeth E.; Rao, Zihe; Stuart, David I.

2014-01-01

Enterovirus 71 (HEV71) epidemics amongst children and infants result mainly in mild symptoms, however, especially in the Asia-Pacific region, infection can be fatal. At present no therapies are available. We have used structural analysis of the complete virus to guide the design of HEV71 inhibitors. Analysis of complexes with four 3-(-4-pyridyl)-2-imidazolidinone derivatives with varying anti-HEV71 activities, pinpointed key structure-activity correlates. We then identified additional potentially beneficial substitutions, developed methods to reliably triage compounds by quantum mechanics-enhanced ligand docking, and synthesized two candidates. Structural analysis and in vitro assays confirmed the predicted binding modes and their ability to block viral infection. One ligand (IC50 = 25 pM) is an order of magnitude more potent than the best previously reported inhibitor, and is also more soluble. Our approach may be useful in the design of effective drugs for enterovirus infections. PMID:24509833

A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

PubMed

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

2015-06-09

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Comprehensive predictions of target proteins based on protein-chemical interaction using virtual screening and experimental verifications.

PubMed

Kobayashi, Hiroki; Harada, Hiroko; Nakamura, Masaomi; Futamura, Yushi; Ito, Akihiro; Yoshida, Minoru; Iemura, Shun-Ichiro; Shin-Ya, Kazuo; Doi, Takayuki; Takahashi, Takashi; Natsume, Tohru; Imoto, Masaya; Sakakibara, Yasubumi

2012-04-05

Identification of the target proteins of bioactive compounds is critical for elucidating the mode of action; however, target identification has been difficult in general, mostly due to the low sensitivity of detection using affinity chromatography followed by CBB staining and MS/MS analysis. We applied our protocol of predicting target proteins combining in silico screening and experimental verification for incednine, which inhibits the anti-apoptotic function of Bcl-xL by an unknown mechanism. One hundred eighty-two target protein candidates were computationally predicted to bind to incednine by the statistical prediction method, and the predictions were verified by in vitro binding of incednine to seven proteins, whose expression can be confirmed in our cell system.As a result, 40% accuracy of the computational predictions was achieved successfully, and we newly found 3 incednine-binding proteins. This study revealed that our proposed protocol of predicting target protein combining in silico screening and experimental verification is useful, and provides new insight into a strategy for identifying target proteins of small molecules.

In Silico Identification of a Novel Hinge-Binding Scaffold for Kinase Inhibitor Discovery.

PubMed

Wang, Yanli; Sun, Yuze; Cao, Ran; Liu, Dan; Xie, Yuting; Li, Li; Qi, Xiangbing; Huang, Niu

2017-10-26

To explore novel kinase hinge-binding scaffolds, we carried out structure-based virtual screening against p38α MAPK as a model system. With the assistance of developed kinase-specific structural filters, we identify a novel lead compound that selectively inhibits a panel of kinases with threonine as the gatekeeper residue, including BTK and LCK. These kinases play important roles in lymphocyte activation, which encouraged us to design novel kinase inhibitors as drug candidates for ameliorating inflammatory diseases and cancers. Therefore, we chemically modified our substituted triazole-class lead compound to improve the binding affinity and selectivity via a "minimal decoration" strategy, which resulted in potent and selective kinase inhibitors against LCK (18 nM) and BTK (8 nM). Subsequent crystallographic experiments validated our design. These rationally designed compounds exhibit potent on-target inhibition against BTK in B cells or LCK in T cells, respectively. Our work demonstrates that structure-based virtual screening can be applied to facilitate the development of novel chemical entities in crowded chemical space in the field of kinase inhibitor discovery.

d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes

NASA Astrophysics Data System (ADS)

Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping

2018-04-01

We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.

Mixed Inhibition of cPEPCK by Genistein, Using an Extended Binding Site Located Adjacent to Its Catalytic Cleft

PubMed Central

Dhanjal, Jaspreet Kaur; Sundar, Durai

2015-01-01

Cytosolic phosphoenolpyruvate carboxykinase (cPEPCK) is a critical enzyme involved in gluconeogenesis, glyceroneogenesis and cataplerosis. cPEPCK converts oxaloacetic acid (OAA) into phosphoenol pyruvate (PEP) in the presence of GTP. cPEPCK is known to be associated with type 2 diabetes. Genistein is an isoflavone compound that shows anti-diabetic and anti-obesitic properties. Experimental studies have shown a decrease in the blood glucose level in the presence of genistein by lowering the functional activity of cPEPCK, an enzyme of gluconeogenesis. Using computational techniques such as molecular modeling, molecular docking, molecular dynamics simulation and binding free energy calculations, we identified cPEPCK as a direct target of genistein. We studied the molecular interactions of genistein with three possible conformations of cPEPCK—unbound cPEPCK (u_cPEPCK), GTP bound cPEPCK (GTP_cPEPCK) and GDP bound cPEPCK (GDP_cPEPCK). Binding of genistein was also compared with an already known cPEPCK inhibitor. We analyzed the interactions of genistein with cPEPCK enzyme and compared them with its natural substrate (OAA), product (PEP) and known inhibitor (3-MPA). Our results demonstrate that genistein uses the mechanism of mixed inhibition to block the functional activity of cPEPCK and thus can serve as a potential anti-diabetic and anti-obesity drug candidate. We also identified an extended binding site in the catalytic cleft of cPEPCK which is used by 3-MPA to inhibit cPEPCK non-competitively. We demonstrate that extended binding site of cPEPCK can further be exploited for designing new drugs against cPEPCK. PMID:26528723

Integrated In Silico-In Vitro Identification and Characterization of the SH3-Mediated Interaction between Human PTTG and its Cognate Partners in Medulloblastoma.

PubMed

Liu, Jiangang; Wang, Dapeng; Li, Yanyan; Yao, Hui; Zhang, Nan; Zhang, Xuewen; Zhong, Fangping; Huang, Yulun

2018-06-01

The human pituitary tumor-transforming gene is an oncogenic protein which serves as a central hub in the cellular signaling network of medulloblastoma. The protein contains two vicinal PxxP motifs at its C terminus that are potential binding sites of peptide-recognition SH3 domains. Here, a synthetic protocol that integrated in silico analysis and in vitro assay was described to identify the SH3-binding partners of pituitary tumor-transforming gene in the gene expression profile of medulloblastoma. In the procedure, a variety of structurally diverse, non-redundant SH3 domains with high gene expression in medulloblastoma were compiled, and their three-dimensional structures were either manually retrieved from the protein data bank database or computationally modeled through bioinformatics technique. The binding capability of these domains towards the two PxxP-containing peptides m1p: 161 LGPPSPVK 168 and m2p: 168 KMPSPPWE 175 of pituitary tumor-transforming gene were ranked by structure-based scoring and fluorescence-based assay. Consequently, a number of SH3 domains, including MAP3K and PI3K, were found to have moderate or high affinity for m1p and/or m2p. Interestingly, the two overlapping peptides exhibits a distinct binding profile to these identified domain partners, suggesting that the binding selectivity of m1p and m2p is optimized across the medulloblastoma expression spectrum by competing for domain candidates. In addition, two redesigned versions of m1p peptide ware obtained via a structure-based rational mutation approach, which exhibited an increased affinity for the domain as compared to native peptide.

Genetic architecture of wild soybean (Glycine soja) response to soybean cyst nematode (Heterodera glycines).

PubMed

Zhang, Hengyou; Song, Qijian; Griffin, Joshua D; Song, Bao-Hua

2017-12-01

The soybean cyst nematode (SCN) is one of the most destructive pathogens of soybean plants worldwide. Host-plant resistance is an environmentally friendly method to mitigate SCN damage. To date, the resistant soybean cultivars harbor limited genetic variation, and some are losing resistance. Thus, a better understanding of the genetic mechanisms of the SCN resistance, as well as developing diverse resistant soybean cultivars, is urgently needed. In this study, a genome-wide association study (GWAS) was conducted using 1032 wild soybean (Glycine soja) accessions with over 42,000 single-nucleotide polymorphisms (SNPs) to understand the genetic architecture of G. soja resistance to SCN race 1. Ten SNPs were significantly associated with the response to race 1. Three SNPs on chromosome 18 were localized within the previously identified quantitative trait loci (QTLs), and two of which were localized within a strong linkage disequilibrium block encompassing a nucleotide-binding (NB)-ARC disease resistance gene (Glyma.18G102600). Genes encoding methyltransferases, the calcium-dependent signaling protein, the leucine-rich repeat kinase family protein, and the NB-ARC disease resistance protein, were identified as promising candidate genes. The identified SNPs and candidate genes can not only shed light on the molecular mechanisms underlying SCN resistance, but also can facilitate soybean improvement employing wild genetic resources.

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

Transcript and proteomic analysis of developing white lupin (Lupinus albus L.) roots

PubMed Central

Tian, Li; Peel, Gregory J; Lei, Zhentian; Aziz, Naveed; Dai, Xinbin; He, Ji; Watson, Bonnie; Zhao, Patrick X; Sumner, Lloyd W; Dixon, Richard A

2009-01-01

Background White lupin (Lupinus albus L.) roots efficiently take up and accumulate (heavy) metals, adapt to phosphate deficiency by forming cluster roots, and secrete antimicrobial prenylated isoflavones during development. Genomic and proteomic approaches were applied to identify candidate genes and proteins involved in antimicrobial defense and (heavy) metal uptake and translocation. Results A cDNA library was constructed from roots of white lupin seedlings. Eight thousand clones were randomly sequenced and assembled into 2,455 unigenes, which were annotated based on homologous matches in the NCBInr protein database. A reference map of developing white lupin root proteins was established through 2-D gel electrophoresis and peptide mass fingerprinting. High quality peptide mass spectra were obtained for 170 proteins. Microsomal membrane proteins were separated by 1-D gel electrophoresis and identified by LC-MS/MS. A total of 74 proteins were putatively identified by the peptide mass fingerprinting and the LC-MS/MS methods. Genomic and proteomic analyses identified candidate genes and proteins encoding metal binding and/or transport proteins, transcription factors, ABC transporters and phenylpropanoid biosynthetic enzymes. Conclusion The combined EST and protein datasets will facilitate the understanding of white lupin's response to biotic and abiotic stresses and its utility for phytoremediation. The root ESTs provided 82 perfect simple sequence repeat (SSR) markers with potential utility in breeding white lupin for enhanced agronomic traits. PMID:19123941

SFRP1 is a possible candidate for epigenetic therapy in non-small cell lung cancer.

PubMed

Taguchi, Y-H; Iwadate, Mitsuo; Umeyama, Hideaki

2016-08-12

Non-small cell lung cancer (NSCLC) remains a lethal disease despite many proposed treatments. Recent studies have indicated that epigenetic therapy, which targets epigenetic effects, might be a new therapeutic methodology for NSCLC. However, it is not clear which objects (e.g., genes) this treatment specifically targets. Secreted frizzled-related proteins (SFRPs) are promising candidates for epigenetic therapy in many cancers, but there have been no reports of SFRPs targeted by epigenetic therapy for NSCLC. This study performed a meta-analysis of reprogrammed NSCLC cell lines instead of the direct examination of epigenetic therapy treatment to identify epigenetic therapy targets. In addition, mRNA expression/promoter methylation profiles were processed by recently proposed principal component analysis based unsupervised feature extraction and categorical regression analysis based feature extraction. The Wnt/β-catenin signalling pathway was extensively enriched among 32 genes identified by feature extraction. Among the genes identified, SFRP1 was specifically indicated to target β-catenin, and thus might be targeted by epigenetic therapy in NSCLC cell lines. A histone deacetylase inhibitor might reactivate SFRP1 based upon the re-analysis of a public domain data set. Numerical computation validated the binding of SFRP1 to WNT1 to suppress Wnt signalling pathway activation in NSCLC. The meta-analysis of reprogrammed NSCLC cell lines identified SFRP1 as a promising target of epigenetic therapy for NSCLC.

Identification of Sumoylated Proteins in the Silkworm Bombyx mori

PubMed Central

Tang, Xudong; Fu, Xuliang; Hao, Bifang; Zhu, Feng; Xiao, Shengyan; Xu, Li; Shen, Zhongyuan

2014-01-01

Small ubiquitin-like modifier (SUMO) modification (SUMOylation) is an important and widely used reversible modification system in eukaryotic cells. It regulates various cell processes, including protein targeting, transcriptional regulation, signal transduction, and cell division. To understand its role in the model lepidoptera insect Bombyx mori, a recombinant baculovirus was constructed to express an enhanced green fluorescent protein (eGFP)-SUMO fusion protein along with ubiquitin carrier protein 9 of Bombyx mori (BmUBC9). SUMOylation substrates from Bombyx mori cells infected with this baculovirus were isolated by immunoprecipitation and identified by LC–ESI-MS/MS. A total of 68 candidate SUMOylated proteins were identified, of which 59 proteins were functionally categorized to gene ontology (GO) terms. Analysis of kyoto encyclopedia of genes and genomes (KEGG) pathways showed that 46 of the identified proteins were involved in 76 pathways that mainly play a role in metabolism, spliceosome and ribosome functions, and in RNA transport. Furthermore, SUMOylation of four candidates (polyubiquitin-C-like isoform X1, 3-hydroxyacyl-CoA dehydrogenase, cyclin-related protein FAM58A-like and GTP-binding nuclear protein Ran) were verified by co-immunoprecipitation in Drosophila schneide 2 cells. In addition, 74% of the identified proteins were predicted to have at least one SUMOylation site. The data presented here shed light on the crucial process of protein sumoylation in Bombyx mori. PMID:25470021

Binding Modes of Ligands Using Enhanced Sampling (BLUES): Rapid Decorrelation of Ligand Binding Modes via Nonequilibrium Candidate Monte Carlo.

PubMed

Gill, Samuel C; Lim, Nathan M; Grinaway, Patrick B; Rustenburg, Ariën S; Fass, Josh; Ross, Gregory A; Chodera, John D; Mobley, David L

2018-05-31

Accurately predicting protein-ligand binding affinities and binding modes is a major goal in computational chemistry, but even the prediction of ligand binding modes in proteins poses major challenges. Here, we focus on solving the binding mode prediction problem for rigid fragments. That is, we focus on computing the dominant placement, conformation, and orientations of a relatively rigid, fragment-like ligand in a receptor, and the populations of the multiple binding modes which may be relevant. This problem is important in its own right, but is even more timely given the recent success of alchemical free energy calculations. Alchemical calculations are increasingly used to predict binding free energies of ligands to receptors. However, the accuracy of these calculations is dependent on proper sampling of the relevant ligand binding modes. Unfortunately, ligand binding modes may often be uncertain, hard to predict, and/or slow to interconvert on simulation time scales, so proper sampling with current techniques can require prohibitively long simulations. We need new methods which dramatically improve sampling of ligand binding modes. Here, we develop and apply a nonequilibrium candidate Monte Carlo (NCMC) method to improve sampling of ligand binding modes. In this technique, the ligand is rotated and subsequently allowed to relax in its new position through alchemical perturbation before accepting or rejecting the rotation and relaxation as a nonequilibrium Monte Carlo move. When applied to a T4 lysozyme model binding system, this NCMC method shows over 2 orders of magnitude improvement in binding mode sampling efficiency compared to a brute force molecular dynamics simulation. This is a first step toward applying this methodology to pharmaceutically relevant binding of fragments and, eventually, drug-like molecules. We are making this approach available via our new Binding modes of ligands using enhanced sampling (BLUES) package which is freely available on GitHub.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

PharmMapper server: a web server for potential drug target identification using pharmacophore mapping approach

PubMed Central

Liu, Xiaofeng; Ouyang, Sisheng; Yu, Biao; Liu, Yabo; Huang, Kai; Gong, Jiayu; Zheng, Siyuan; Li, Zhihua; Li, Honglin; Jiang, Hualiang

2010-01-01

In silico drug target identification, which includes many distinct algorithms for finding disease genes and proteins, is the first step in the drug discovery pipeline. When the 3D structures of the targets are available, the problem of target identification is usually converted to finding the best interaction mode between the potential target candidates and small molecule probes. Pharmacophore, which is the spatial arrangement of features essential for a molecule to interact with a specific target receptor, is an alternative method for achieving this goal apart from molecular docking method. PharmMapper server is a freely accessed web server designed to identify potential target candidates for the given small molecules (drugs, natural products or other newly discovered compounds with unidentified binding targets) using pharmacophore mapping approach. PharmMapper hosts a large, in-house repertoire of pharmacophore database (namely PharmTargetDB) annotated from all the targets information in TargetBank, BindingDB, DrugBank and potential drug target database, including over 7000 receptor-based pharmacophore models (covering over 1500 drug targets information). PharmMapper automatically finds the best mapping poses of the query molecule against all the pharmacophore models in PharmTargetDB and lists the top N best-fitted hits with appropriate target annotations, as well as respective molecule’s aligned poses are presented. Benefited from the highly efficient and robust triangle hashing mapping method, PharmMapper bears high throughput ability and only costs 1 h averagely to screen the whole PharmTargetDB. The protocol was successful in finding the proper targets among the top 300 pharmacophore candidates in the retrospective benchmarking test of tamoxifen. PharmMapper is available at http://59.78.96.61/pharmmapper. PMID:20430828

Crystal structure of the adenosine A 2A receptor bound to an antagonist reveals a potential allosteric pocket

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Bingfa; Bachhawat, Priti; Chu, Matthew Ling-Hon

The adenosine A2A receptor (A2AR) has long been implicated in cardiovascular disorders. As more selective A2AR ligands are being identified, its roles in other disorders, such as Parkinson’s disease, are starting to emerge, and A2AR antagonists are important drug candidates for nondopaminergic anti-Parkinson treatment. Here we report the crystal structure of A2A receptor bound to compound 1 (Cmpd-1), a novel A2AR/N-methyl D-aspartate receptor subtype 2B (NR2B) dual antagonist and potential anti-Parkinson candidate compound, at 3.5 Å resolution. The A2A receptor with a cytochrome b562-RIL (BRIL) fusion (A2AR–BRIL) in the intracellular loop 3 (ICL3) was crystallized in detergent micelles using vapor-phasemore » diffusion. Whereas A2AR–BRIL bound to the antagonist ZM241385 has previously been crystallized in lipidic cubic phase (LCP), structural differences in the Cmpd-1–bound A2AR–BRIL prevented formation of the lattice observed with the ZM241385–bound receptor. The crystals grew with a type II crystal lattice in contrast to the typical type I packing seen from membrane protein structures crystallized in LCP. Cmpd-1 binds in a position that overlaps with the native ligand adenosine, but its methoxyphenyl group extends to an exosite not previously observed in other A2AR structures. Structural analysis revealed that Cmpd-1 binding results in the unique conformations of two tyrosine residues, Tyr91.35 and Tyr2717.36, which are critical for the formation of the exosite. The structure reveals insights into antagonist binding that are not observed in other A2AR structures, highlighting flexibility in the binding pocket that may facilitate the development of A2AR-selective compounds for the treatment of Parkinson’s disease.« less

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

A novel assessment of nefazodone-induced hERG inhibition by electrophysiological and stereochemical method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Dae-Seop; Park, Myoung Joo; Lee, Hyang-Ae

2014-02-01

Nefazodone was used widely as an antidepressant until it was withdrawn from the U.S. market in 2004 due to hepatotoxicity. We have investigated methods to predict various toxic effects of drug candidates to reduce the failure rate of drug discovery. An electrophysiological method was used to assess the cardiotoxicity of drug candidates. Small molecules, including withdrawn drugs, were evaluated using a patch-clamp method to establish a database of hERG inhibition. Nefazodone inhibited hERG channel activity in our system. However, nefazodone-induced hERG inhibition indicated only a theoretical risk of cardiotoxicity. Nefazodone inhibited the hERG channel in a concentration-dependent manner with anmore » IC{sub 50} of 45.3 nM in HEK-293 cells. Nefazodone accelerated both the recovery from inactivation and its onset. Nefazodone also accelerated steady-state inactivation, although it did not modify the voltage-dependent character. Alanine mutants of hERG S6 and pore region residues were used to identify the nefazodone-binding site on hERG. The hERG S6 point mutants Y652A and F656A largely abolished the inhibition by nefazodone. The pore region mutant S624A mildly reduced the inhibition by nefazodone but T623A had little effect. A docking study showed that the aromatic rings of nefazodone interact with Y652 and F656 via π–π interactions, while an amine interacted with the S624 residue in the pore region. In conclusion, Y652 and F656 in the S6 domain play critical roles in nefazodone binding. - Highlights: • Nefazodone inhibits hERG channels with an IC{sub 50} of 45.3 nM in HEK-293 cells. • Nefazodone blocks hERG channels by binding to the open channels. • Y652 and F656 are important for binding of nefazodone. • The aromatic rings of nefazodone interact with Y652 and F656 via π–π interactions.« less

Phloem proteomics reveals new lipid-binding proteins with a putative role in lipid-mediated signaling

DOE PAGES

Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica; ...

2016-04-28

Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less

Identification of cancer specific ligands from one-bead one compound combinatorial libraries to develop theranostics agents against oral squamous cell carcinoma

NASA Astrophysics Data System (ADS)

Yang, Frances Fan

Background: Oral squamous cell carcinoma (OSCC) is one of the most prevalent disease worldwide. One-bead one-compound (OBOC) combinatorial technology is a powerful method to identify peptidomimetic ligands against a variety of receptors on cell surfaces. We therefore hypothesized that cancer specific ligands against OSCC might be identified and can be conjugated to optical dyes or nanocarriers to develop theranostic agents against OSCC. Material and methods: Different OSCC cell lines were incubated with OBOC libraries and beads with cell binding were sorted and then screened with normal human cells to identify peptide-beads binding to different OSCC cell lines but not binding to normal human cells. The molecular probes of OSCC were developed by biotinylating the carboxyl end of the ligands. OSCC theranostic agents were developed by decorating LLY13 with NPs and evaluated by using orthotopic bioluminescent oral cancer model. Results: Six OSCC specific ligands were discovered. Initial peptide-histochemistry study indicated that LLY12 and LLY13 were able to specifically detect OSCC cells grown on chamber slides at the concentration of 1 muM. In addition, LLY13 was found to penetrate into the OSCC cells and accumulate in the cytoplasm, and nucleus. After screened with a panel of integrin antibodies, only anti-alpha3 antibody was able to block most of OSCC cells binding to the LLY13 beads. OSCC theranostic agents developed using targeting LLY13 micelles (25+/- 4nm in diameter) were more efficient in binding to HSC-3 cancer cells compared to non-targeting micelles. Ex vivo images demonstrated that xenografts from the mice with targeting micelles appeared to have higher signals than the non-targeting groups. Conclusion: LLY13 has promising in vitro and in vivo targeting activity against OSCC. In addition, LLY13 is also able to penetrate into cancer cells via endocytosis. Initial study indicated that alpha3 integrin might partially be the corresponding receptor involved for LLY13's binding to oral cancer cells. OSCC ligands developed from this study may become potential candidates for the development of OSCC targeted theranostic agents.

Phloem proteomics reveals new lipid-binding proteins with a putative role in lipid-mediated signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica

Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less

Absence of Capsule Reveals Glycan-Mediated Binding and Recognition of Salivary Mucin MUC7 by Streptococcus pneumoniae

PubMed Central

Thamadilok, Supaporn; Roche-Håkansson, Hazeline; Håkansson, Anders P.; Ruhl, Stefan

2015-01-01

SUMMARY Salivary proteins modulate bacterial colonization in the oral cavity and interact with systemic pathogens that pass through the oropharynx. An interesting example is the opportunistic respiratory pathogen Streptococcus pneumoniae that normally resides in the nasopharynx, but belongs to the greater Mitis group of streptococci, most of which colonize the oral cavity. S. pneumoniae also expresses a serine-rich repeat (SRR) adhesin, PsrP, that is a homologue to oral Mitis group SRR adhesins, such as Hsa of S. gordonii and SrpA of S. sanguinis. Since the latter bind to salivary glycoproteins through recognition of terminal sialic acids, we wanted to determine whether S. pneumoniae also binds to salivary proteins through possibly the same mechanism. We found that only a capsule-free mutant of S. pneumoniae TIGR4 binds to salivary proteins, most prominently to mucin MUC7, but that this binding was not mediated through PsrP or recognition of sialic acid. We also found, however, that PsrP is involved in agglutination of human red blood cells (RBCs). After removal of PsrP, an additional previously masked lectin-like adhesin activity mediating agglutination of sialidase-treated RBCs becomes revealed. Using a custom-spotted glycoprotein and neoglycoprotein dot blot array, we identify candidate glycan motifs recognized by PsrP and by the putative S. pneumoniae adhesin that could perhaps be responsible for pneumococcal binding to salivary MUC7 and glycoproteins on RBCs. PMID:26172471

Analysis of Qa-1bPeptide Binding Specificity and the Capacity of Cd94/Nkg2a to Discriminate between Qa-1–Peptide Complexes

PubMed Central

Kraft, Jennifer R.; Vance, Russell E.; Pohl, Jan; Martin, Amy M.; Raulet, David H.; Jensen, Peter E.

2000-01-01

The major histocompatibility complex class Ib protein, Qa-1b, serves as a ligand for murine CD94/NKG2A natural killer (NK) cell inhibitory receptors. The Qa-1b peptide-binding site is predominantly occupied by a single nonameric peptide, Qa-1 determinant modifier (Qdm), derived from the leader sequence of H-2D and L molecules. Five anchor residues were identified in this study by measuring the peptide-binding affinities of substituted Qdm peptides in experiments with purified recombinant Qa-1b. A candidate peptide-binding motif was determined by sequence analysis of peptides eluted from Qa-1 that had been folded in the presence of random peptide libraries or pools of Qdm derivatives randomized at specific anchor positions. The results indicate that Qa-1b can bind a diverse repertoire of peptides but that Qdm has an optimal primary structure for binding Qa-1b. Flow cytometry experiments with Qa-1b tetramers and NK target cell lysis assays demonstrated that CD94/NKG2A discriminates between Qa-1b complexes containing peptides with substitutions at nonanchor positions P4, P5, or P8. Our findings suggest that it may be difficult for viruses to generate decoy peptides that mimic Qdm and raise the possibility that competitive replacement of Qdm with other peptides may provide a novel mechanism for activation of NK cells. PMID:10974028

De novo design of RNA-binding proteins with a prion-like domain related to ALS/FTD proteinopathies.

PubMed

Mitsuhashi, Kana; Ito, Daisuke; Mashima, Kyoko; Oyama, Munenori; Takahashi, Shinichi; Suzuki, Norihiro

2017-12-04

Aberrant RNA-binding proteins form the core of the neurodegeneration cascade in spectrums of disease, such as amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD). Six ALS-related molecules, TDP-43, FUS, TAF15, EWSR1, heterogeneous nuclear (hn)RNPA1 and hnRNPA2 are RNA-binding proteins containing candidate mutations identified in ALS patients and those share several common features, including harboring an aggregation-prone prion-like domain (PrLD) containing a glycine/serine-tyrosine-glycine/serine (G/S-Y-G/S)-motif-enriched low-complexity sequence and rich in glutamine and/or asparagine. Additinally, these six molecules are components of RNA granules involved in RNA quality control and become mislocated from the nucleus to form cytoplasmic inclusion bodies (IBs) in the ALS/FTD-affected brain. To reveal the essential mechanisms involved in ALS/FTD-related cytotoxicity associated with RNA-binding proteins containing PrLDs, we designed artificial RNA-binding proteins harboring G/S-Y-G/S-motif repeats with and without enriched glutamine residues and nuclear-import/export-signal sequences and examined their cytotoxicity in vitro. These proteins recapitulated features of ALS-linked molecules, including insoluble aggregation, formation of cytoplasmic IBs and components of RNA granules, and cytotoxicity instigation. These findings indicated that these artificial RNA-binding proteins mimicked features of ALS-linked molecules and allowed the study of mechanisms associated with gain of toxic functions related to ALS/FTD pathogenesis.

Efficient Identification of Novel Hla-A*0201–Presented Cytotoxic T Lymphocyte Epitopes in the Widely Expressed Tumor Antigen Prame by Proteasome-Mediated Digestion Analysis

PubMed Central

Kessler, Jan H.; Beekman, Nico J.; Bres-Vloemans, Sandra A.; Verdijk, Pauline; van Veelen, Peter A.; Kloosterman-Joosten, Antoinette M.; Vissers, Debby C.J.; ten Bosch, George J.A.; Kester, Michel G.D.; Sijts, Alice; Drijfhout, Jan Wouter; Ossendorp, Ferry; Offringa, Rienk; Melief, Cornelis J.M.

2001-01-01

We report the efficient identification of four human histocompatibility leukocyte antigen (HLA)-A*0201–presented cytotoxic T lymphocyte (CTL) epitopes in the tumor-associated antigen PRAME using an improved “reverse immunology” strategy. Next to motif-based HLA-A*0201 binding prediction and actual binding and stability assays, analysis of in vitro proteasome-mediated digestions of polypeptides encompassing candidate epitopes was incorporated in the epitope prediction procedure. Proteasome cleavage pattern analysis, in particular determination of correct COOH-terminal cleavage of the putative epitope, allows a far more accurate and selective prediction of CTL epitopes. Only 4 of 19 high affinity HLA-A*0201 binding peptides (21%) were found to be efficiently generated by the proteasome in vitro. This approach avoids laborious CTL response inductions against high affinity binding peptides that are not processed and limits the number of peptides to be assayed for binding. CTL clones induced against the four identified epitopes (VLDGLDVLL, PRA100–108; SLYSFPEPEA, PRA142–151; ALYVDSLFFL, PRA300–309; and SLLQHLIGL, PRA425–433) lysed melanoma, renal cell carcinoma, lung carcinoma, and mammary carcinoma cell lines expressing PRAME and HLA-A*0201. This indicates that these epitopes are expressed on cancer cells of diverse histologic origin, making them attractive targets for immunotherapy of cancer. PMID:11136822

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.).

PubMed

Taylor, Candy M; Jost, Ricarda; Erskine, William; Nelson, Matthew N

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future.

Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L.)

PubMed Central

Erskine, William; Nelson, Matthew N.

2016-01-01

Quantitative Reverse Transcription PCR (qRT-PCR) is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop) using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC), Helicase (HEL), and Polypyrimidine tract-binding protein (PTB)] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots) encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other potentially more suitable reference genes will be identified for this species in future. PMID:26872362

Selection, Characterization and Application of Nucleic Acid Aptamers for the Capture and Detection of Human Norovirus Strains

PubMed Central

Escudero-Abarca, Blanca I.; Suh, Soo Hwan; Moore, Matthew D.; Dwivedi, Hari P.; Jaykus, Lee-Ann

2014-01-01

Human noroviruses (HuNoV) are the leading cause of acute viral gastroenteritis and an important cause of foodborne disease. Despite their public health significance, routine detection of HuNoV in community settings, or food and environmental samples, is limited, and there is a need to develop alternative HuNoV diagnostic reagents to complement existing ones. The purpose of this study was to select and characterize single-stranded (ss)DNA aptamers with binding affinity to HuNoV. The utility of these aptamers was demonstrated in their use for capture and detection of HuNoV in outbreak-derived fecal samples and a representative food matrix. SELEX (Systematic Evolution of Ligands by EXponential enrichment) was used to isolate ssDNA aptamer sequences with broad reactivity to the prototype GII.2 HuNoV strain, Snow Mountain Virus (SMV). Four aptamer candidates (designated 19, 21, 25 and 26) were identified and screened for binding affinity to 14 different virus-like particles (VLPs) corresponding to various GI and GII HuNoV strains using an Enzyme-Linked Aptamer Sorbant Assay (ELASA). Collectively, aptamers 21 and 25 showed affinity to 13 of the 14 VLPs tested, with strongest binding to GII.2 (SMV) and GII.4 VLPs. Aptamer 25 was chosen for further study. Its binding affinity to SMV-VLPs was equivalent to that of a commercial antibody within a range of 1 to 5 µg/ml. Aptamer 25 also showed binding to representative HuNoV strains present in stool specimens obtained from naturally infected individuals. Lastly, an aptamer magnetic capture (AMC) method using aptamer 25 coupled with RT-qPCR was developed for recovery and detection of HuNoV in artificially contaminated lettuce. The capture efficiency of the AMC was 2.5–36% with an assay detection limit of 10 RNA copies per lettuce sample. These ssDNA aptamer candidates show promise as broadly reactive reagents for use in HuNoV capture and detection assays in various sample types. PMID:25192421

Plasma membrane proteome analysis identifies a role of barley membrane steroid binding protein in root architecture response to salinity.

PubMed

Witzel, Katja; Matros, Andrea; Møller, Anders L B; Ramireddy, Eswarayya; Finnie, Christine; Peukert, Manuela; Rutten, Twan; Herzog, Andreas; Kunze, Gotthard; Melzer, Michael; Kaspar-Schoenefeld, Stephanie; Schmülling, Thomas; Svensson, Birte; Mock, Hans-Peter

2018-06-01

Although the physiological consequences of plant growth under saline conditions have been well described, understanding the core mechanisms conferring plant salt adaptation has only started. We target the root plasma membrane proteomes of two barley varieties, cvs. Steptoe and Morex, with contrasting salinity tolerance. In total, 588 plasma membrane proteins were identified by mass spectrometry, of which 182 were either cultivar or salinity stress responsive. Three candidate proteins with increased abundance in the tolerant cv. Morex were involved either in sterol binding (a GTPase-activating protein for the adenosine diphosphate ribosylation factor [ZIGA2], and a membrane steroid binding protein [MSBP]) or in phospholipid synthesis (phosphoethanolamine methyltransferase [PEAMT]). Overexpression of barley MSBP conferred salinity tolerance to yeast cells, whereas the knock-out of the heterologous AtMSBP1 increased salt sensitivity in Arabidopsis. Atmsbp1 plants showed a reduced number of lateral roots under salinity, and root-tip-specific expression of barley MSBP in Atmsbp1 complemented this phenotype. In barley, an increased abundance of MSBP correlates with reduced root length and lateral root formation as well as increased levels of auxin under salinity being stronger in the tolerant cv. Morex. Hence, we concluded the involvement of MSBP in phytohormone-directed adaptation of root architecture in response to salinity. © 2018 John Wiley & Sons Ltd.

Filling gaps in PPAR-alpha signaling through comparative nutrigenomics analysis

PubMed Central

2009-01-01

Background The application of high-throughput genomic tools in nutrition research is a widespread practice. However, it is becoming increasingly clear that the outcome of individual expression studies is insufficient for the comprehensive understanding of such a complex field. Currently, the availability of the large amounts of expression data in public repositories has opened up new challenges on microarray data analyses. We have focused on PPARα, a ligand-activated transcription factor functioning as fatty acid sensor controlling the gene expression regulation of a large set of genes in various metabolic organs such as liver, small intestine or heart. The function of PPARα is strictly connected to the function of its target genes and, although many of these have already been identified, major elements of its physiological function remain to be uncovered. To further investigate the function of PPARα, we have applied a cross-species meta-analysis approach to integrate sixteen microarray datasets studying high fat diet and PPARα signal perturbations in different organisms. Results We identified 164 genes (MDEGs) that were differentially expressed in a constant way in response to a high fat diet or to perturbations in PPARs signalling. In particular, we found five genes in yeast which were highly conserved and homologous of PPARα targets in mammals, potential candidates to be used as models for the equivalent mammalian genes. Moreover, a screening of the MDEGs for all known transcription factor binding sites and the comparison with a human genome-wide screening of Peroxisome Proliferating Response Elements (PPRE), enabled us to identify, 20 new potential candidate genes that show, both binding site, both change in expression in the condition studied. Lastly, we found a non random localization of the differentially expressed genes in the genome. Conclusion The results presented are potentially of great interest to resume the currently available expression data, exploiting the power of in silico analysis filtered by evolutionary conservation. The analysis enabled us to indicate potential gene candidates that could fill in the gaps with regards to the signalling of PPARα and, moreover, the non-random localization of the differentially expressed genes in the genome, suggest that epigenetic mechanisms are of importance in the regulation of the transcription operated by PPARα. PMID:20003344

Comparative Studies of the Proteome, Glycoproteome, and N-Glycome of Clear Cell Renal Cell Carcinoma Plasma before and after Curative Nephrectomy

PubMed Central

2015-01-01

Clear cell renal cell carcinoma is the most prevalent of all reported kidney cancer cases, and currently there are no markers for early diagnosis. This has stimulated great research interest recently because early detection of the disease can significantly improve the low survival rate. Combining the proteome, glycoproteome, and N-glycome data from clear cell renal cell carcinoma plasma has the potential of identifying candidate markers for early diagnosis and prognosis and/or to monitor disease recurrence. Here, we report on the utilization of a multi-dimensional fractionation approach (12P-M-LAC) and LC–MS/MS to comprehensively investigate clear cell renal cell carcinoma plasma collected before (disease) and after (non-disease) curative nephrectomy (n = 40). Proteins detected in the subproteomes were investigated via label-free quantification. Protein abundance analysis revealed a number of low-level proteins with significant differential expression levels in disease samples, including HSPG2, CD146, ECM1, SELL, SYNE1, and VCAM1. Importantly, we observed a strong correlation between differentially expressed proteins and clinical status of the patient. Investigation of the glycoproteome returned 13 candidate glycoproteins with significant differential M-LAC column binding. Qualitative analysis indicated that 62% of selected candidate glycoproteins showed higher levels (upregulation) in M-LAC bound fraction of disease samples. This observation was further confirmed by released N-glycans data in which 53% of identified N-glycans were present at different levels in plasma in the disease vs non-disease samples. This striking result demonstrates the potential for significant protein glycosylation alterations in clear cell renal cell carcinoma cancer plasma. With future validation in a larger cohort, information derived from this study may lead to the development of clear cell renal cell carcinoma candidate biomarkers. PMID:25184692

Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

PubMed

Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

2015-07-01

The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

Functional analysis of the plant disease resistance gene Pto using DNA shuffling.

PubMed

Bernal, Adriana J; Pan, Qilin; Pollack, Jeff; Rose, Laura; Kozik, Alexander; Willits, Neil; Luo, Yao; Guittet, Muriel; Kochetkova, Elena; Michelmore, Richard W

2005-06-17

Pto is a serine/threonine kinase that mediates resistance in tomato to strains of Pseudomonas syringae pv. tomato expressing the (a)virulence proteins AvrPto or AvrPtoB. DNA shuffling was used as a combinatorial in vitro genetic approach to dissect the functional regions of Pto. The Pto gene was shuffled with four of its paralogs from a resistant haplotype to create a library of recombinant products that was screened for interaction with AvrPto in yeast. All interacting clones and a representative sample of noninteracting clones were sequenced, and their ability to signal downstream was tested by the elicitation of a hypersensitive response in an AvrPto-dependent or -independent manner in planta. Eight candidate regions important for binding to AvrPto or for downstream signaling were identified by statistical correlations between individual amino acid positions and phenotype. A subset of the regions had previously been identified as important for recognition, confirming the validity of the shuffling approach. Three novel regions important for Pto function were validated by site-directed mutagenesis. Several chimeras and point mutants exhibited a differential interaction with (a)virulence proteins in the AvrPto and VirPphA family, demonstrating distinct binding requirements for different ligands. Additionally, the identification of chimeras that are both constitutively active as well as capable of binding AvrPto indicates that elicitation of downstream signaling does not involve a conformational change that precludes binding of AvrPto, as previously hypothesized. The correlations between phenotypes and variation generated by DNA shuffling paralleled natural variation observed between orthologs of Pto from Lycopersicon spp.

Characterization of a novel androgen receptor (AR) coregulator RIPK1 and related chemicals that suppress AR-mediated prostate cancer growth via peptide and chemical screening.

PubMed

Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, Ting-Wei; Chang, Ying-Hsu; Kuo, Yung-Chia; Lin, An-Chi; Ting, Huei-Ju; Pang, See-Tong; Lee, Li-Yu; Ma, Wen-Lung; Lin, Chun-Cheng; Wu, Wen-Guey

2017-09-19

Using bicalutamide-androgen receptor (AR) DNA binding domain-ligand binding domain as bait, we observed enrichment of FxxFY motif-containing peptides. Protein database searches revealed the presence of receptor-interacting protein kinase 1 (RIPK1) harboring one FxxFY motif. RIPK1 interacted directly with AR and suppressed AR transactivation in a dose-dependent manner. Domain mapping experiments showed that the FxxFY motif in RIPK1 is critical for interactions with AR and the death domain of RIPK1 plays a crucial role in its inhibitory effect on transactivation. In terms of tissue expression, RIPK1 levels were markedly higher in benign prostate hyperplasia and non-cancerous tissue regions relative to the tumor area. With the aid of computer modeling for screening of chemicals targeting activation function 2 (AF-2) of AR, we identified oxadiazole derivatives as good candidates and subsequently generated a small library of these compounds. A number of candidates could effectively suppress AR transactivation and AR-related functions in vitro and in vivo with tolerable toxicity via inhibiting AR-peptide, AR-coregulator and AR N-C interactions. Combination of these chemicals with antiandrogen had an additive suppressive effect on AR transcriptional activity. Our collective findings may pave the way in creating new strategies for the development and design of anti-AR drugs.

Lsa63, a newly identified surface protein of Leptospira interrogans binds laminin and collagen IV.

PubMed

Vieira, Monica L; de Morais, Zenaide M; Gonçales, Amane P; Romero, Eliete C; Vasconcellos, Silvio A; Nascimento, Ana L T O

2010-01-01

Leptospira interrogans is the etiological agent of leptospirosis, a zoonotic disease that affects populations worldwide. We have identified in proteomic studies a protein that is encoded by the gene LIC10314 and expressed in virulent strain of L. interrogans serovar Pomona. This protein was predicted to be surface exposed by PSORT program and contains a p83/100 domain identified by BLAST analysis that is conserved in protein antigens of several strains of Borrelia and Treponema spp. The proteins containing this domain have been claimed antigen candidates for serodiagnosis of Lyme borreliosis. Thus, we have cloned the LIC10314 and expressed the protein in Escherichia coli BL21-SI strain by using the expression vector pAE. The recombinant protein tagged with N-terminal hexahistidine was purified by metal-charged chromatography and characterized by circular dichroism spectroscopy. This protein is conserved among several species of pathogenic Leptospira and absent in the saprophytic strain L. biflexa. We confirm by liquid-phase immunofluorescence assays with living organisms that this protein is most likely a new surface leptospiral protein. The ability of the protein to mediate attachment to ECM components was evaluated by binding assays. The leptospiral protein encoded by LIC10314, named Lsa63 (Leptospiral surface adhesin of 63kDa), binds strongly to laminin and collagen IV in a dose-dependent and saturable fashion. In addition, Lsa63 is probably expressed during infection since it was recognized by antibodies of serum samples of confirmed-leptospirosis patients in convalescent phase of the disease. Altogether, the data suggests that this novel identified surface protein may be involved in leptospiral pathogenesis. 2009 The British Infection Society. Published by Elsevier Ltd. All rights reserved.

Characterization of two new putative adhesins of Leptospira interrogans.

PubMed

Figueredo, Jupciana M; Siqueira, Gabriela H; de Souza, Gisele O; Heinemann, Marcos B; Vasconcellos, Silvio A; Chapola, Erica G B; Nascimento, Ana L T O

2017-01-01

We here report the characterization of two novel proteins encoded by the genes LIC11122 and LIC12287, identified in the genome sequences of Leptospira interrogans, annotated, respectively, as a putative sigma factor and a hypothetical protein. The CDSs LIC11122 and LIC12287 have signal peptide SPII and SPI and are predicted to be located mainly at the cytoplasmic membrane of the bacteria. The genes were cloned and the proteins expressed using Escherichia coli. Proteinase K digestion showed that both proteins are surface exposed. Evaluation of interaction of recombinant proteins with extracellular matrix components revealed that they are laminin binding and they were called Lsa19 (LIC11122) and Lsa14 (LIC12287), for Leptospiral-surface adhesin of 19 and 14 kDa, respectively. The bindings were dose-dependent on protein concentration, reaching saturation, fulfilling the ligand-binding criteria. Reactivity of the recombinant proteins with leptospirosis human sera has shown that Lsa19 and, to a lesser extent, Lsa14, are recognized by antibodies, suggesting that, most probably, Lsa19 is expressed during infection. The proteins interact with plasminogen and generate plasmin in the presence of urokinase-type plasminogen activator. Plasmin generation in Leptospira has been associated with tissue penetration and immune evasion strategies. The presence of a sigma factor on the cell surface playing a secondary role, probably mediating host -pathogen interaction, suggests that LIC11122 is a moonlighting protein candidate. Although the biological significance of these putative adhesins will require the generation of mutants, our data suggest that Lsa19 is a potential candidate for future evaluation of its role in adhesion/colonization activities during L. interrogans infection.

Evaluation of the Schistosoma mansoni Y-box-binding protein (SMYB1) potential as a vaccine candidate against schistosomiasis.

PubMed

Dias, Sílvia R C; Boroni, Mariana; Rocha, Elizângela A; Dias, Thomaz L; de Laet Souza, Daniela; Oliveira, Fabrício M S; Bitar, Mainá; Macedo, Andrea M; Machado, Carlos R; Caliari, Marcelo V; Franco, Glória R

2014-01-01

Schistosomiasis is a neglected tropical disease, and after malaria, is the second most important tropical disease in public health. A vaccine that reduces parasitemia is desirable to achieve mass treatment with a low cost. Although potential antigens have been identified and tested in clinical trials, no effective vaccine against schistosomiasis is available. Y-box-binding proteins (YBPs) regulate gene expression and participate in a variety of cellular processes, including transcriptional and translational regulation, DNA repair, cellular proliferation, drug resistance, and stress responses. The Schistosoma mansoni ortholog of the human YB-1, SMYB1, is expressed in all stages of the parasite life cycle. Although SMYB1 binds to DNA or RNA oligonucleotides, immunohistochemistry assays demonstrated that it is primarily localized in the cytoplasm of parasite cells. In addition, SMYB1 interacts with a protein involved in mRNA processing, suggesting that SMYB1 functions in the turnover, transport, and/or stabilization of RNA molecules during post-transcriptional gene regulation. Here we report the potential of SMYB1 as a vaccine candidate. We demonstrate that recombinant SMYB1 stimulates the production of high levels of specific IgG1 antibodies in a mouse model. The observed levels of specific IgG1 and IgG2a antibodies indicate an actual protection against cercariae challenge. Animals immunized with rSMYB1 exhibited a 26% reduction in adult worm burden and a 28% reduction in eggs retained in the liver. Although proteins from the worm tegument are considered optimal targets for vaccine development, this study demonstrates that unexposed cytoplasmic proteins can reduce the load of intestinal worms and the number of eggs retained in the liver.

Systems-level analysis of cell-specific AQP2 gene expression in renal collecting duct.

PubMed

Yu, Ming-Jiun; Miller, R Lance; Uawithya, Panapat; Rinschen, Markus M; Khositseth, Sookkasem; Braucht, Drew W W; Chou, Chung-Lin; Pisitkun, Trairak; Nelson, Raoul D; Knepper, Mark A

2009-02-17

We used a systems biology-based approach to investigate the basis of cell-specific expression of the water channel aquaporin-2 (AQP2) in the renal collecting duct. Computational analysis of the 5'-flanking region of the AQP2 gene (Genomatix) revealed 2 conserved clusters of putative transcriptional regulator (TR) binding elements (BEs) centered at -513 bp (corresponding to the SF1, NFAT, and FKHD TR families) and -224 bp (corresponding to the AP2, SRF, CREB, GATA, and HOX TR families). Three other conserved motifs corresponded to the ETS, EBOX, and RXR TR families. To identify TRs that potentially bind to these BEs, we carried out mRNA profiling (Affymetrix) in mouse mpkCCDc14 collecting duct cells, revealing expression of 25 TRs that are also expressed in native inner medullary collecting duct. One showed a significant positive correlation with AQP2 mRNA abundance among mpkCCD subclones (Ets1), and 2 showed a significant negative correlation (Elf1 and an orphan nuclear receptor Nr1h2). Transcriptomic profiling in native proximal tubules (PT), medullary thick ascending limbs (MTAL), and IMCDs from kidney identified 14 TRs (including Ets1 and HoxD3) expressed in the IMCD but not PT or MTAL (candidate AQP2 enhancer roles), and 5 TRs (including HoxA5, HoxA9 and HoxA10) expressed in PT and MTAL but not in IMCD (candidate AQP2 repressor roles). In luciferase reporter assays, overexpression of 3 ETS family TRs transactivated the mouse proximal AQP2 promoter. The results implicate ETS family TRs in cell-specific expression of AQP2 and point to HOX, RXR, CREB and GATA family TRs as playing likely additional roles.

[Rbf1 (RPG-box binding factor), a transcription factor involved in yeast-hyphal transition of Candida albicans].

PubMed

Aoki, Y; Ishii, N; Watanabe, M; Yoshihara, F; Arisawa, M

1998-01-01

The major fungal pathogen for fungal diseases which have become a major medical problem in the last few years is Candida albicans, which can grow both in yeast and hyphae forms. This ability of C. albicans is thought to contribute to its colonization and dissemination within host tissues. In a recent few years, accompanying the introduction of molecular biological tools into C. albicans organism, several factors involved in the signal transduction pathway for yeast-hyphal transition have been identified. One MAP kinase pathway in C. albicans, similar to that leading to STE12 activation in Saccharomyces cerevisiae, has been reported. C. albicans strains mutant in these genes show retarded filamentous growth on a solid media but no impairment of filamentous growth in mice. These results suggest two scenarios that a kinase signaling cascade plays a part in stimulating the morphological transition in C. albicans, and that there would be another signaling pathway effective in animals. In this latter true hyphal pathway, although some candidate proteins, such as Efg1 (transcription factor), Int1 (integrin-like membrane protein), or Phr1 (pH-regulated membrane protein), have been identified, it is still too early to say that we understand the whole picture of that cascade. We have cloned a C. albicans gene encoding a novel DNA binding protein, Rbf1, that predominantly localizes in the nucleus, and shows transcriptional activation capability. Disruption of the functional RBF1 genes of C. albicans induced the filamentous growth on all solid and liquid media tested, suggesting that Rbf1 might be another candidate for the true hyphal pathway. Relationships with other factors described above, and the target (regulated) genes of Rbf1 is under investigation.

Comparative Genomics of Regulation of Fatty Acid and Branched-chain Amino Acid Utilization in Proteobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kazakov, Alexey E.; Rodionov, Dmitry A.; Arkin, Adam Paul

2008-10-31

Bacteria can use branched-chain amino acids (ILV, i.e. isoleucine, leucine, valine) and fatty acids (FA) as sole carbon and energy sources convering ILV into acetyl-CoA, propanoyl-CoA and propionyl-CoA, respectively. In this work, we used the comparative genomic approach to identify candidate transcriptional factors and DNA motifs that control ILV and FA utilization pathways in proteobacteria. The metabolic regulons were characterized based on the identification and comparison of candidate transcription factor binding sites in groups of phylogenetically related genomes. The reconstructed ILV/FA regulatory network demonstrates considerable variability and involves six transcriptional factors from the MerR, TetR and GntR families binding tomore » eleven distinct DNA motifs. The ILV degradation genes in gamma- and beta-proteobacteria are mainly regulated by anovel regulator from the MerR family (e.g., LiuR in Pseudomonas aeruginosa) (40 species), in addition, the TetR-type regulator LiuQ was identified in some beta-proteobacteria (8 species). Besides the core set of ILV utilization genes, the LiuR regulon in some lineages is expanded to include genes from other metabolic pathways, such as the glyoxylate shunt and glutamate synthase in the Shewanella species. The FA degradation genes are controlled by four regulators including FadR in gamma-proteobacteria (34 species), PsrA in gamma- and beta-proteobacteria (45 species), FadP in beta-proteobacteria (14 species), and LiuR orthologs in alpha-proteobacteria (22 species). The remarkable variability of the regulatory systems associated with the FA degradation pathway is discussed from the functional and evolutionary points of view.« less

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

PubMed Central

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

GalaxyDock BP2 score: a hybrid scoring function for accurate protein-ligand docking

NASA Astrophysics Data System (ADS)

Baek, Minkyung; Shin, Woong-Hee; Chung, Hwan Won; Seok, Chaok

2017-07-01

Protein-ligand docking is a useful tool for providing atomic-level understanding of protein functions in nature and design principles for artificial ligands or proteins with desired properties. The ability to identify the true binding pose of a ligand to a target protein among numerous possible candidate poses is an essential requirement for successful protein-ligand docking. Many previously developed docking scoring functions were trained to reproduce experimental binding affinities and were also used for scoring binding poses. However, in this study, we developed a new docking scoring function, called GalaxyDock BP2 Score, by directly training the scoring power of binding poses. This function is a hybrid of physics-based, empirical, and knowledge-based score terms that are balanced to strengthen the advantages of each component. The performance of the new scoring function exhibits significant improvement over existing scoring functions in decoy pose discrimination tests. In addition, when the score is used with the GalaxyDock2 protein-ligand docking program, it outperformed other state-of-the-art docking programs in docking tests on the Astex diverse set, the Cross2009 benchmark set, and the Astex non-native set. GalaxyDock BP2 Score and GalaxyDock2 with this score are freely available at http://galaxy.seoklab.org/softwares/galaxydock.html.

Identifying gene coexpression networks underlying the dynamic regulation of wood-forming tissues in Populus under diverse environmental conditions.

PubMed

Zinkgraf, Matthew; Liu, Lijun; Groover, Andrew; Filkov, Vladimir

2017-06-01

Trees modify wood formation through integration of environmental and developmental signals in complex but poorly defined transcriptional networks, allowing trees to produce woody tissues appropriate to diverse environmental conditions. In order to identify relationships among genes expressed during wood formation, we integrated data from new and publically available datasets in Populus. These datasets were generated from woody tissue and include transcriptome profiling, transcription factor binding, DNA accessibility and genome-wide association mapping experiments. Coexpression modules were calculated, each of which contains genes showing similar expression patterns across experimental conditions, genotypes and treatments. Conserved gene coexpression modules (four modules totaling 8398 genes) were identified that were highly preserved across diverse environmental conditions and genetic backgrounds. Functional annotations as well as correlations with specific experimental treatments associated individual conserved modules with distinct biological processes underlying wood formation, such as cell-wall biosynthesis, meristem development and epigenetic pathways. Module genes were also enriched for DNase I hypersensitivity footprints and binding from four transcription factors associated with wood formation. The conserved modules are excellent candidates for modeling core developmental pathways common to wood formation in diverse environments and genotypes, and serve as testbeds for hypothesis generation and testing for future studies. No claim to original US government works. New Phytologist © 2017 New Phytologist Trust.

Trans-ancestry Fine Mapping and Molecular Assays Identify Regulatory Variants at the ANGPTL8 HDL-C GWAS Locus

PubMed Central

Cannon, Maren E.; Duan, Qing; Wu, Ying; Zeynalzadeh, Monica; Xu, Zheng; Kangas, Antti J.; Soininen, Pasi; Ala-Korpela, Mika; Civelek, Mete; Lusis, Aldons J.; Kuusisto, Johanna; Collins, Francis S.; Boehnke, Michael; Tang, Hua; Laakso, Markku; Li, Yun; Mohlke, Karen L.

2017-01-01

Recent genome-wide association studies (GWAS) have identified variants associated with high-density lipoprotein cholesterol (HDL-C) located in or near the ANGPTL8 gene. Given the extensive sharing of GWAS loci across populations, we hypothesized that at least one shared variant at this locus affects HDL-C. The HDL-C–associated variants are coincident with expression quantitative trait loci for ANGPTL8 and DOCK6 in subcutaneous adipose tissue; however, only ANGPTL8 expression levels are associated with HDL-C levels. We identified a 400-bp promoter region of ANGPTL8 and enhancer regions within 5 kb that contribute to regulating expression in liver and adipose. To identify variants functionally responsible for the HDL-C association, we performed fine-mapping analyses and selected 13 candidate variants that overlap putative regulatory regions to test for allelic differences in regulatory function. Of these variants, rs12463177-G increased transcriptional activity (1.5-fold, P = 0.004) and showed differential protein binding. Six additional variants (rs17699089, rs200788077, rs56322906, rs3760782, rs737337, and rs3745683) showed evidence of allelic differences in transcriptional activity and/or protein binding. Taken together, these data suggest a regulatory mechanism at the ANGPTL8 HDL-C GWAS locus involving tissue-selective expression and at least one functional variant. PMID:28754724

Genome-wide association study to identify candidate loci and genes for Mn toxicity tolerance in rice

PubMed Central

Shrestha, Asis; Dziwornu, Ambrose Kwaku; Ueda, Yoshiaki; Wu, Lin-Bo; Mathew, Boby

2018-01-01

Manganese (Mn) is an essential micro-nutrient for plants, but flooded rice fields can accumulate high levels of Mn2+ leading to Mn toxicity. Here, we present a genome-wide association study (GWAS) to identify candidate loci conferring Mn toxicity tolerance in rice (Oryza sativa L.). A diversity panel of 288 genotypes was grown in hydroponic solutions in a greenhouse under optimal and toxic Mn concentrations. We applied a Mn toxicity treatment (5 ppm Mn2+, 3 weeks) at twelve days after transplanting. Mn toxicity caused moderate damage in rice in terms of biomass loss and symptom formation despite extremely high shoot Mn concentrations ranging from 2.4 to 17.4 mg g-1. The tropical japonica subpopulation was more sensitive to Mn toxicity than other subpopulations. Leaf damage symptoms were significantly correlated with Mn uptake into shoots. Association mapping was conducted for seven traits using 416741 single nucleotide polymorphism (SNP) markers using a mixed linear model, and detected six significant associations for the traits shoot manganese concentration and relative shoot length. Candidate regions contained genes coding for a heavy metal transporter, peroxidase precursor and Mn2+ ion binding proteins. The significant marker SNP-2.22465867 caused an amino acid change in a gene (LOC_Os02g37170) with unknown function. This study demonstrated significant natural variation in rice for Mn toxicity tolerance and the possibility of using GWAS to unravel genetic factors responsible for such complex traits. PMID:29425206

Genome-wide association study to identify candidate loci and genes for Mn toxicity tolerance in rice.

PubMed

Shrestha, Asis; Dziwornu, Ambrose Kwaku; Ueda, Yoshiaki; Wu, Lin-Bo; Mathew, Boby; Frei, Michael

2018-01-01

Manganese (Mn) is an essential micro-nutrient for plants, but flooded rice fields can accumulate high levels of Mn2+ leading to Mn toxicity. Here, we present a genome-wide association study (GWAS) to identify candidate loci conferring Mn toxicity tolerance in rice (Oryza sativa L.). A diversity panel of 288 genotypes was grown in hydroponic solutions in a greenhouse under optimal and toxic Mn concentrations. We applied a Mn toxicity treatment (5 ppm Mn2+, 3 weeks) at twelve days after transplanting. Mn toxicity caused moderate damage in rice in terms of biomass loss and symptom formation despite extremely high shoot Mn concentrations ranging from 2.4 to 17.4 mg g-1. The tropical japonica subpopulation was more sensitive to Mn toxicity than other subpopulations. Leaf damage symptoms were significantly correlated with Mn uptake into shoots. Association mapping was conducted for seven traits using 416741 single nucleotide polymorphism (SNP) markers using a mixed linear model, and detected six significant associations for the traits shoot manganese concentration and relative shoot length. Candidate regions contained genes coding for a heavy metal transporter, peroxidase precursor and Mn2+ ion binding proteins. The significant marker SNP-2.22465867 caused an amino acid change in a gene (LOC_Os02g37170) with unknown function. This study demonstrated significant natural variation in rice for Mn toxicity tolerance and the possibility of using GWAS to unravel genetic factors responsible for such complex traits.

In silico design of fragment-based drug targeting host processing α-glucosidase i for dengue fever

NASA Astrophysics Data System (ADS)

Toepak, E. P.; Tambunan, U. S. F.

2017-02-01

Dengue is a major health problem in the tropical and sub-tropical regions. The development of antiviral that targeting dengue’s host enzyme can be more effective and efficient treatment than the viral enzyme. Host enzyme processing α-glucosidase I has an important role in the maturation process of dengue virus envelope glycoprotein. The inhibition of processing α-glucosidase I can become a promising target for dengue fever treatment. The antiviral approach using in silico fragment-based drug design can generate drug candidates with high binding affinity. In this research, 198.621 compounds were obtained from ZINC15 Biogenic Database. These compounds were screened to find the favorable fragments according to Rules of Three and pharmacological properties. The screening fragments were docked into the active site of processing α-glucosidase I. The potential fragment candidates from the molecular docking simulation were linked with castanospermine (CAST) to generate ligands with a better binding affinity. The Analysis of ligand - enzyme interaction showed ligands with code LRS 22, 28, and 47 have the better binding free energy than the standard ligand. Ligand LRS 28 (N-2-4-methyl-5-((1S,3S,6S,7R,8R,8aR)-1,6,7,8-tetrahydroxyoctahydroindolizin-3-yl) pentyl) indolin-1-yl) propionamide) itself among the other ligands has the lowest binding free energy. Pharmacological properties prediction also showed the ligands LRS 22, 28, and 47 can be promising as the dengue fever drug candidates.

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae

PubMed Central

Zhao, Can; Abdelgaffar, Heba M.; Pan, Hongyu; Song, Fuping

2015-01-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with 125I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. PMID:25795679

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae.

PubMed

Zhao, Can; Jurat-Fuentes, Juan Luis; Abdelgaffar, Heba M; Pan, Hongyu; Song, Fuping; Zhang, Jie

2015-06-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with (125)I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Effects of Lectins on initial attachment of cariogenic Streptococcus mutans.

PubMed

Ito, Takashi; Yoshida, Yasuhiro; Shiota, Yasuyoshi; Ito, Yuki; Yamamoto, Tadashi; Takashiba, Shogo

2018-02-01

Oral bacteria initiate biofilm formation by attaching to tooth surfaces via an interaction of a lectin-like bacterial protein with carbohydrate chains on the pellicle. This study aimed to find naturally derived lectins that inhibit the initial attachment of a cariogenic bacterial species, Streptococcus mutans (S. mutans), to carbohydrate chains in saliva in vitro. Seventy kinds of lectins were screened for candidate motifs that inhibit the attachment of S. mutans ATCC 25175 to a saliva-coated culture plate. The inhibitory effect of the lectins on attachment of the S. mutans to the plates was quantified by crystal violet staining, and the biofilm was observed under a scanning electron microscope (SEM). Surface plasmon resonance (SPR) analysis was performed to examine the binding of S. mutans to carbohydrate chains and the binding of candidate lectins to carbohydrate chains, respectively. Moreover, binding assay between the biotinylated-lectins and the saliva components was conducted to measure the lectin binding. Lectins recognizing a salivary carbohydrate chain, Galβ1-3GalNAc, inhibited the binding of S. mutans to the plate. In particular, Agaricus bisporus agglutinin (ABA) markedly inhibited the binding. This inhibition was confirmed by SEM observation. SPR analysis indicated that S. mutans strongly binds to Galβ1-3GalNAc, and ABA binds to Galβ1-3GalNAc. Finally, the biotinylated Galβ1-3GalNAc-binding lectins including ABA demonstrated marked binding to the saliva components. These results suggest that ABA lectin inhibited the attachment of S. mutans to Galβ1-3GalNAc in saliva and ABA can be useful as a potent inhibitor for initial attachment of oral bacteria and biofilm formation.

Natural genetic variation of freezing tolerance in Arabidopsis.

PubMed

Hannah, Matthew A; Wiese, Dana; Freund, Susanne; Fiehn, Oliver; Heyer, Arnd G; Hincha, Dirk K

2006-09-01

Low temperature is a primary determinant of plant growth and survival. Using accessions of Arabidopsis (Arabidopsis thaliana) originating from Scandinavia to the Cape Verde Islands, we show that freezing tolerance of natural accessions correlates with habitat winter temperatures, identifying low temperature as an important selective pressure for Arabidopsis. Combined metabolite and transcript profiling show that during cold exposure, global changes of transcripts, but not of metabolites, correlate with the ability of Arabidopsis to cold acclimate. There are, however, metabolites and transcripts, including several transcription factors, that correlate with freezing tolerance, indicating regulatory pathways that may be of primary importance for this trait. These data identify that enhanced freezing tolerance is associated with the down-regulation of photosynthesis and hormonal responses and the induction of flavonoid metabolism, provide evidence for naturally increased nonacclimated freezing tolerance due to the constitutive activation of the C-repeat binding factors pathway, and identify candidate transcriptional regulators that correlate with freezing tolerance.

Computational Design of Metal Ion Sequestering Agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hay, Benjamin P.; Rapko, Brian M.

Organic ligands that exhibit a high degree of metal ion recognition are essential precursors for developing separation processes and sensors for metal ions. Since the beginning of the nuclear era, much research has focused on discovering ligands that target specific radionuclides. Members of the Group 1A and 2A cations (e.g., Cs, Sr, Ra) and the f-block metals (actinides and lanthanides) are of primary concern to DOE. Although there has been some success in identifying ligand architectures that exhibit a degree of metal ion recognition, the ability to control binding affinity and selectivity remains a significant challenge. The traditional approach formore » discovering such ligands has involved lengthy programs of organic synthesis and testing that, in the absence of reliable methods for screening compounds before synthesis, have resulted in much wasted research effort. This project seeks to enhance and strengthen the traditional approach through computer-aided design of new and improved host molecules. Accurate electronic structure calculations are coupled with experimental data to provide fundamental information about ligand structure and the nature of metal-donor group interactions (design criteria). This fundamental information then is used in a molecular mechanics model (MM) that helps us rapidly screen proposed ligand architectures and select the best members from a set of potential candidates. By using combinatorial methods, molecule building software has been developed that generates large numbers of candidate architectures for a given set of donor groups. The specific goals of this project are: • further understand the structural and energetic aspects of individual donor group- metal ion interactions and incorporate this information within the MM framework • further develop and evaluate approaches for correlating ligand structure with reactivity toward metal ions, in other words, screening capability • use molecule structure building software to generate large numbers of candidate ligand architectures for given sets of donor groups • screen candidates and identify ligand architectures that will exhibit enhanced metal ion recognition. These new capabilities are being applied to ligand systems identified under other DOEsponsored projects where studies have suggested that modifying existing architectures will lead to dramatic enhancements in metal ion binding affinity and selectivity. With this in mind, we are collaborating with Professors R. T. Paine (University of New Mexico), K. N. Raymond (University of California, Berkeley), and J. E. Hutchison (University of Oregon), and Dr. B. A. Moyer (Oak Ridge National Laboratory) to obtain experimental validation of the predicted new ligand structures. Successful completion of this study will yield molecular-level insight into the role that ligand architecture plays in controlling metal ion complexation and will provide a computational approach to ligand design.« less

Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

PubMed Central

van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

2012-01-01

Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

Integrated genomic approaches to identification of candidate genes underlying metabolic and cardiovascular phenotypes in the spontaneously hypertensive rat.

PubMed

Morrissey, Catherine; Grieve, Ian C; Heinig, Matthias; Atanur, Santosh; Petretto, Enrico; Pravenec, Michal; Hubner, Norbert; Aitman, Timothy J

2011-11-07

The spontaneously hypertensive rat (SHR) is a widely used rodent model of hypertension and metabolic syndrome. Previously we identified thousands of cis-regulated expression quantitative trait loci (eQTLs) across multiple tissues using a panel of rat recombinant inbred (RI) strains derived from Brown Norway and SHR progenitors. These cis-eQTLs represent potential susceptibility loci underlying physiological and pathophysiological traits manifested in SHR. We have prioritized 60 cis-eQTLs and confirmed differential expression between the parental strains by quantitative PCR in 43 (72%) of the eQTL transcripts. Quantitative trait transcript (QTT) analysis in the RI strains showed highly significant correlation between cis-eQTL transcript abundance and clinically relevant traits such as systolic blood pressure and blood glucose, with the physical location of a subset of the cis-eQTLs colocalizing with "physiological" QTLs (pQTLs) for these same traits. These colocalizing correlated cis-eQTLs (c3-eQTLs) are highly attractive as primary susceptibility loci for the colocalizing pQTLs. Furthermore, sequence analysis of the c3-eQTL genes identified single nucleotide polymorphisms (SNPs) that are predicted to affect transcription factor binding affinity, splicing and protein function. These SNPs, which potentially alter transcript abundance and stability, represent strong candidate factors underlying not just eQTL expression phenotypes, but also the correlated metabolic and physiological traits. In conclusion, by integration of genomic sequence, eQTL and QTT datasets we have identified several genes that are strong positional candidates for pathophysiological traits observed in the SHR strain. These findings provide a basis for the functional testing and ultimate elucidation of the molecular basis of these metabolic and cardiovascular phenotypes.

Targeting the atypical chemokine receptor ACKR3/CXCR7 for the treatment of cancer and other diseases

NASA Astrophysics Data System (ADS)

Vestal, Richard D., Jr.

One of the greatest challenges in fighting cancer is cell targeting and biomarker selection. The Atypical Chemokine Receptor ACKR3/CXCR7 is expressed on many cancer cell types, including breast cancer and glioblastoma, and binds the endogenous ligands SDF1/CXCL12 and ITAC/CXCL11. A 20 amino acid region of the ACKR3/CXCR7 N-terminus was synthesized and targeted with the NEB PhD-7 Phage Display Peptide Library. Twenty-nine phages were isolated and heptapeptide inserts sequenced; of these, 23 sequences were unique. A 3D molecular model was created for the ACKR3/CXCR7 N-terminus by mutating the corresponding region of the crystal structure of CXCR4 with bound SDF1/CXCL12. A ClustalW alignment was performed on each peptide sequence using the entire SDF1/CXCL12 sequence as the template. The 23-peptide sequences showed similarity to three distinct regions of the SDF1/CXCL12 molecule. A 3D molecular model was made for each of the phage peptide inserts to visually identify potential areas of steric interference of peptides that simulated CXCL12 regions not in contact with the receptor's N-terminus. An ELISA analysis of the relative binding affinity between the peptides identified 9 peptides with statistically significant results. The candidate pool of 9 peptides was further reduced to 3 peptides based on their affinity for the targeted N-terminus region peptide versus no target peptide present or a scrambled negative control peptide. The results clearly show the Phage Display protocol can be used to target a synthesized region of the ACKR3/CXCR7 N-terminus. The 3 peptides chosen, P20, P3, and P9, showed no effect on the viability or proliferation upon exposure to MCF-7 and U87-MG cells. Membrane binding, colocalization, and cellular uptake were confirmed by whole-cell ELISA and confocal microscopy. The recovered peptides did not activate the receptor as confirmed by a Beta-Arrestin recruitment assay. The data shows that the peptide sequences recovered from the phage display protocol are viable candidates for targeting cancer cells and delivering material to them.

Accelerated Evolution in Distinctive Species Reveals Candidate Elements for Clinically Relevant Traits, Including Mutation and Cancer Resistance.

PubMed

Ferris, Elliott; Abegglen, Lisa M; Schiffman, Joshua D; Gregg, Christopher

2018-03-06

The identity of most functional elements in the mammalian genome and the phenotypes they impact are unclear. Here, we perform a genome-wide comparative analysis of patterns of accelerated evolution in species with highly distinctive traits to discover candidate functional elements for clinically important phenotypes. We identify accelerated regions (ARs) in the elephant, hibernating bat, orca, dolphin, naked mole rat, and thirteen-lined ground squirrel lineages in mammalian conserved regions, uncovering ∼33,000 elements that bind hundreds of different regulatory proteins in humans and mice. ARs in the elephant, the largest land mammal, are uniquely enriched near elephant DNA damage response genes. The genomic hotspot for elephant ARs is the E3 ligase subunit of the Fanconi anemia complex, a master regulator of DNA repair. Additionally, ARs in the six species are associated with specific human clinical phenotypes that have apparent concordance with overt traits in each species. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Identification of a duplication within the GDF9 gene and novel candidate genes for primary ovarian insufficiency (POI) by a customized high-resolution array comparative genomic hybridization platform.

PubMed

Norling, A; Hirschberg, A L; Rodriguez-Wallberg, K A; Iwarsson, E; Wedell, A; Barbaro, M

2014-08-01

Can high-resolution array comparative genomic hybridization (CGH) analysis of DNA samples from women with primary ovarian insufficiency (POI) improve the diagnosis of the condition and identify novel candidate genes for POI? A mutation affecting the regulatory region of growth differentiation factor 9 (GDF9) was identified for the first time together with several novel candidate genes for POI. Most patients with POI do not receive a molecular diagnosis despite a significant genetic component in the pathogenesis. We performed a case-control study. Twenty-six patients were analyzed by array CGH for identification of copy number variants. Novel changes were investigated in 95 controls and in a separate population of 28 additional patients with POI. The experimental procedures were performed during a 1-year period. DNA samples from 26 patients with POI were analyzed by a customized 1M array-CGH platform with whole genome coverage and probe enrichment targeting 78 genes in sex development. By PCR amplification and sequencing, the breakpoint of an identified partial GDF9 gene duplication was characterized. A multiplex ligation-dependent probe amplification (MLPA) probe set for specific identification of deletions/duplications affecting GDF9 was developed. An MLPA probe set for the identification of additional cases or controls carrying novel candidate regions identified by array-CGH was developed. Sequencing of three candidate genes was performed. Eleven unique copy number changes were identified in a total of 11 patients, including a tandem duplication of 475 bp, containing part of the GDF9 gene promoter region. The duplicated region contains three NOBOX-binding elements and an E-box, important for GDF9 gene regulation. This aberration is likely causative of POI. Fifty-four patients were investigated for copy number changes within GDF9, but no additional cases were found. Ten aberrations constituting novel candidate regions were detected, including a second DNAH6 deletion in a patient with POI. Other identified candidate genes were TSPYL6, SMARCC1, CSPG5 and ZFR2. This is a descriptive study and no functional experiments were performed. The study illustrates the importance of analyzing small copy number changes in addition to sequence alterations in the genetic investigation of patients with POI. Also, promoter regions should be included in the investigation. The study was supported by grants from the Swedish Research council (project no 12198 to A.W. and project no 20324 to A.L.H.), Stockholm County Council (E.I., A.W. and K.R.W.), Foundation Frimurare Barnhuset (A.N., A.W. and M.B.), Karolinska Institutet (A.N., A.L.H., E.I., A.W. and M.B.), Novo Nordic Foundation (A.W.) and Svenska Läkaresällskapet (M.B.). The funding sources had no involvement in the design or analysis of the study. The authors have no competing interests to declare. Not applicable. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

The feasibility of an efficient drug design method with high-performance computers.

PubMed

Yamashita, Takefumi; Ueda, Akihiko; Mitsui, Takashi; Tomonaga, Atsushi; Matsumoto, Shunji; Kodama, Tatsuhiko; Fujitani, Hideaki

2015-01-01

In this study, we propose a supercomputer-assisted drug design approach involving all-atom molecular dynamics (MD)-based binding free energy prediction after the traditional design/selection step. Because this prediction is more accurate than the empirical binding affinity scoring of the traditional approach, the compounds selected by the MD-based prediction should be better drug candidates. In this study, we discuss the applicability of the new approach using two examples. Although the MD-based binding free energy prediction has a huge computational cost, it is feasible with the latest 10 petaflop-scale computer. The supercomputer-assisted drug design approach also involves two important feedback procedures: The first feedback is generated from the MD-based binding free energy prediction step to the drug design step. While the experimental feedback usually provides binding affinities of tens of compounds at one time, the supercomputer allows us to simultaneously obtain the binding free energies of hundreds of compounds. Because the number of calculated binding free energies is sufficiently large, the compounds can be classified into different categories whose properties will aid in the design of the next generation of drug candidates. The second feedback, which occurs from the experiments to the MD simulations, is important to validate the simulation parameters. To demonstrate this, we compare the binding free energies calculated with various force fields to the experimental ones. The results indicate that the prediction will not be very successful, if we use an inaccurate force field. By improving/validating such simulation parameters, the next prediction can be made more accurate.

Co-expression of tetanus toxin fragment C in Escherichia coli with thioredoxin and its evaluation as an effective subunit vaccine candidate.

PubMed

Yu, Yun-Zhou; Gong, Zheng-Wei; Ma, Yao; Zhang, Shu-Ming; Zhu, Heng-Qi; Wang, Wen-Bing; Du, Yun; Wang, Shuang; Yu, Wei-Yuan; Sun, Zhi-Wei

2011-08-11

The receptor-binding domain of tetanus toxin (THc), which mediates the binding of the toxin to the nerve cells, is a candidate subunit vaccine against tetanus. In this study one synthetic gene encoding the THc was constructed and highly expressed in Escherichia coli by co-expression with thioredoxin (Trx). The purified THc-vaccinated mice were completely protected against an active toxin challenge in mouse models of disease and the potency of two doses of THc was comparable to that of three doses of toxoid vaccine. And a solid-phase assay showed that the anti-THc sera inhibited the binding of THc or toxoid to the ganglioside GT1b as the anti-tetanus toxoid sera. Furthermore, mice were vaccinated once or twice at four different dosages of THc and a dose-response was observed in both the antibody titer and protective efficacy with increasing dosage of THc and number of vaccinations. The data presented in the report showed that the recombinant THc expressed in E. coli is efficacious in protecting mice against challenge with tetanus toxin suggesting that the THc protein may be developed into a human subunit vaccine candidate designed for the prevention of tetanus. Copyright © 2011 Elsevier Ltd. All rights reserved.

In silico strategies for the selection of chelating compounds with potential application in metal-promoted neurodegenerative diseases

NASA Astrophysics Data System (ADS)

Rodríguez-Rodríguez, Cristina; Rimola, Albert; Alí-Torres, Jorge; Sodupe, Mariona; González-Duarte, Pilar

2011-01-01

The development of new strategies to find commercial molecules with promising biochemical features is a main target in the field of biomedicine chemistry. In this work we present an in silico-based protocol that allows identifying commercial compounds with suitable metal coordinating and pharmacokinetic properties to act as metal-ion chelators in metal-promoted neurodegenerative diseases (MpND). Selection of the chelating ligands is done by combining quantum chemical calculations with the search of commercial compounds on different databases via virtual screening. Starting from different designed molecular frameworks, which mainly constitute the binding site, the virtual screening on databases facilitates the identification of different commercial molecules that enclose such scaffolds and, by imposing a set of chemical and pharmacokinetic filters, obey some drug-like requirements mandatory to deal with MpND. The quantum mechanical calculations are useful to gauge the chelating properties of the selected candidate molecules by determining the structure of metal complexes and evaluating their stability constants. With the proposed strategy, commercial compounds containing N and S donor atoms in the binding sites and capable to cross the BBB have been identified and their chelating properties analyzed.

Exploring and Expanding the Fatty-Acid-Binding Protein Superfamily in Fasciola Species.

PubMed

Morphew, Russell M; Wilkinson, Toby J; Mackintosh, Neil; Jahndel, Veronika; Paterson, Steve; McVeigh, Paul; Abbas Abidi, Syed M; Saifullah, Khalid; Raman, Muthusamy; Ravikumar, Gopalakrishnan; LaCourse, James; Maule, Aaron; Brophy, Peter M

2016-09-02

The liver flukes Fasciola hepatica and F. gigantica infect livestock worldwide and threaten food security with climate change and problematic control measures spreading disease. Fascioliasis is also a foodborne disease with up to 17 million humans infected. In the absence of vaccines, treatment depends on triclabendazole (TCBZ), and overuse has led to widespread resistance, compromising future TCBZ control. Reductionist biology from many laboratories has predicted new therapeutic targets. To this end, the fatty-acid-binding protein (FABP) superfamily has proposed multifunctional roles, including functions intersecting vaccine and drug therapy, such as immune modulation and anthelmintic sequestration. Research is hindered by a lack of understanding of the full FABP superfamily complement. Although discovery studies predicted FABPs as promising vaccine candidates, it is unclear if uncharacterized FABPs are more relevant for vaccine formulations. We have coupled genome, transcriptome, and EST data mining with proteomics and phylogenetics to reveal a liver fluke FABP superfamily of seven clades: previously identified clades I-III and newly identified clades IV-VII. All new clade FABPs were analyzed using bioinformatics and cloned from both liver flukes. The extended FABP data set will provide new study tools to research the role of FABPs in parasite biology and as therapy targets.

Insights into the structural/conformational requirements of cytotoxic oxadiazoles as potential chemotherapeutic target binding agents

NASA Astrophysics Data System (ADS)

Alikhani, Radin; Razzaghi-Asl, Nima; Ramazani, Ali; Hosseinzadeh, Zahra

2018-07-01

A few novel previously synthesized 2,5-disubstituted 1,3,4-oxadiazoles with cytotoxic activity (1-17) were subjected to combined docking/quantum mechanical studies against chemotherapeutic targets. Selected macromolecular targets were those that were previously known to be inhibited by 1,3,4-oxadiazoles. Within this work, favorable binding modes/affinities of the oxadiazoles toward validated cancer targets were elucidated. Some oxadiazole structures exhibited ΔGbs comparable to or stronger than crystallographic ligands that were previously demonstrated to inhibit such targets. On the basis of obtained results, a general structure activity/binding relationship (SAR/SBR) was developed and a few 2,5-disubstituted 1,3,4-oxadiazole structures were proposed and virtually validated as potential cytotoxic candidates. To get more insight into structure binding relationship of candidate molecules within best correlated targets, docked conformation of the best in silico in vitro correlated oxadiazole structure was analyzed in terms of intermolecular binding energy components by functional B3LYP in association with split valence basis set using polarization functions (Def2-SVP). We believe that such modeling studies may be complementary to our previous results on the synthesis and cytotoxicity assessment of novel 1,3,4-oxadiazole derivatives through extending the scope of privileged structures toward designing new potential anti-tumor compounds.

Colorectal mucus binds DC-SIGN and inhibits HIV-1 trans-infection of CD4+ T-lymphocytes.

PubMed

Stax, Martijn J; Mouser, Emily E I M; van Montfort, Thijs; Sanders, Rogier W; de Vries, Henry J C; Dekker, Henk L; Herrera, Carolina; Speijer, Dave; Pollakis, Georgios; Paxton, William A

2015-01-01

Bodily secretions, including breast milk and semen, contain factors that modulate HIV-1 infection. Since anal intercourse caries one of the highest risks for HIV-1 transmission, our aim was to determine whether colorectal mucus (CM) also contains factors interfering with HIV-1 infection and replication. CM from a number of individuals was collected and tested for the capacity to bind DC-SIGN and inhibit HIV-1 cis- or trans-infection of CD4+ T-lymphocytes. To this end, a DC-SIGN binding ELISA, a gp140 trimer competition ELISA and HIV-1 capture/ transfer assays were utilized. Subsequently we aimed to identify the DC-SIGN binding component through biochemical characterization and mass spectrometry analysis. CM was shown to bind DC-SIGN and competes with HIV-1 gp140 trimer for binding. Pre-incubation of Raji-DC-SIGN cells or immature dendritic cells (iDCs) with CM potently inhibits DC-SIGN mediated trans-infection of CD4+ T-lymphocytes with CCR5 and CXCR4 using HIV-1 strains, while no effect on direct infection is observed. Preliminary biochemical characterization demonstrates that the component seems to be large (>100kDa), heat and proteinase K resistant, binds in a α1-3 mannose independent manner and is highly variant between individuals. Immunoprecipitation using DC-SIGN-Fc coated agarose beads followed by mass spectrometry indicated lactoferrin (fragments) and its receptor (intelectin-1) as candidates. Using ELISA we showed that lactoferrin levels within CM correlate with DC-SIGN binding capacity. In conclusion, CM can bind the C-type lectin DC-SIGN and block HIV-1 trans-infection of both CCR5 and CXCR4 using HIV-1 strains. Furthermore, our data indicate that lactoferrin is a DC-SIGN binding component of CM. These results indicate that CM has the potential to interfere with pathogen transmission and modulate immune responses at the colorectal mucosa.

The cell-penetrating peptide domain from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) has anti-inflammatory activity in vitro and in vivo.

PubMed

Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung

2012-03-23

A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells. Copyright © 2012 Elsevier Inc. All rights reserved.

Rational Design of Highly Potent and Slow-Binding Cytochrome bc1 Inhibitor as Fungicide by Computational Substitution Optimization

PubMed Central

Hao, Ge-Fei; Yang, Sheng-Gang; Huang, Wei; Wang, Le; Shen, Yan-Qing; Tu, Wen-Long; Li, Hui; Huang, Li-Shar; Wu, Jia-Wei; Berry, Edward A.; Yang, Guang-Fu

2015-01-01

Hit to lead (H2L) optimization is a key step for drug and agrochemical discovery. A critical challenge for H2L optimization is the low efficiency due to the lack of predictive method with high accuracy. We described a new computational method called Computational Substitution Optimization (CSO) that has allowed us to rapidly identify compounds with cytochrome bc1 complex inhibitory activity in the nanomolar and subnanomolar range. The comprehensively optimized candidate has proved to be a slow binding inhibitor of bc1 complex, ~73-fold more potent (Ki = 4.1 nM) than the best commercial fungicide azoxystrobin (AZ; Ki = 297.6 nM) and shows excellent in vivo fungicidal activity against downy mildew and powdery mildew disease. The excellent correlation between experimental and calculated binding free-energy shifts together with further crystallographic analysis confirmed the prediction accuracy of CSO method. To the best of our knowledge, CSO is a new computational approach to substitution-scanning mutagenesis of ligand and could be used as a general strategy of H2L optimisation in drug and agrochemical design.

Mycobacterium tuberculosis surface protein Rv0227c contains high activity binding peptides which inhibit cell invasion.

PubMed

Rodríguez, Diana Marcela; Ocampo, Marisol; Curtidor, Hernando; Vanegas, Magnolia; Patarroyo, Manuel Elkin; Patarroyo, Manuel Alfonso

2012-12-01

Mycobacterium tuberculosis surface proteins involved in target cell invasion may be identified as a strategy for developing subunit-based, chemically-synthesized vaccines. The Rv0227c protein was thus selected to assess its role in the invasion and infection of Mycobacterium tuberculosis target cells. Results revealed Rv0227c localization on mycobacterial surface by immunoelectron microscopy and Western blot. Receptor-ligand assays using 20-mer, non-overlapping peptides covering the complete Rv0227c protein sequence revealed three high activity binding peptides for U937 phagocytic cells and seven for A549 cells. Peptide 16944 significantly inhibited mycobacterial entry to both cell lines while 16943 and 16949 only managed to inhibit entrance to U937 cells and 16951 to A549 cells. The Jnet bioinformatics tool predicted secondary structure elements for the complete protein, agreeing with elements determined for such chemically-synthesized peptides. It was thus concluded that high activity binding peptides which were able to inhibit mycobacterial entry to target cells are of great importance when selecting peptide candidates for inclusion in an anti-tuberculosis vaccine. Copyright © 2012 Elsevier Inc. All rights reserved.

Epigenetic profiling of growth plate chondrocytes sheds insight into regulatory genetic variation influencing height.

PubMed

Guo, Michael; Liu, Zun; Willen, Jessie; Shaw, Cameron P; Richard, Daniel; Jagoda, Evelyn; Doxey, Andrew C; Hirschhorn, Joel; Capellini, Terence D

2017-12-05

GWAS have identified hundreds of height-associated loci. However, determining causal mechanisms is challenging, especially since height-relevant tissues (e.g. growth plates) are difficult to study. To uncover mechanisms by which height GWAS variants function, we performed epigenetic profiling of murine femoral growth plates. The profiled open chromatin regions recapitulate known chondrocyte and skeletal biology, are enriched at height GWAS loci, particularly near differentially expressed growth plate genes, and enriched for binding motifs of transcription factors with roles in chondrocyte biology. At specific loci, our analyses identified compelling mechanisms for GWAS variants. For example, at CHSY1 , we identified a candidate causal variant (rs9920291) overlapping an open chromatin region. Reporter assays demonstrated that rs9920291 shows allelic regulatory activity, and CRISPR/Cas9 targeting of human chondrocytes demonstrates that the region regulates CHSY1 expression. Thus, integrating biologically relevant epigenetic information (here, from growth plates) with genetic association results can identify biological mechanisms important for human growth.

Identification of novel monoamine oxidase B inhibitors by structure-based virtual screening.

PubMed

Geldenhuys, Werner J; Darvesh, Altaf S; Funk, Max O; Van der Schyf, Cornelis J; Carroll, Richard T

2010-09-01

Parkinson's disease is a severe debilitating neurodegenerative disorder. Recently, it was shown that the peroxisome proliferating-activator receptor-gamma agonist pioglitazone protected mice from 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine neurotoxicity due to its ability to inhibit monoamine oxidase B (MAO-B). Docking studies were initiated to investigate pioglitazone's interactions within the substrate cavity of MAO-B. Modeling studies indicated that the thiazolidinedione (TZD) moiety was a likely candidate for its specificity to MAO-B. To explore this potential novel MAO-B scaffold, we performed a structure-based virtual screen to identify additional MAO-B inhibitors. Our search identified eight novel compounds containing the TZD-moiety that allowed for a limited study to identify structural requirements for binding to MAO-B. Inhibition assays identified two TZDs (A6355 and L136662) which were found to inhibit recombinant human MAO-B with IC(50) values of 82 and 195 nM, respectively. Copyright 2010 Elsevier Ltd. All rights reserved.

Binding Site Concentration Explains the Differential Susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-Producing Rice

PubMed Central

Han, Chao; Liu, Zewen; Chen, Fajun; Hou, Maolin; Peng, Yufa

2014-01-01

Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. PMID:24928872

Pharmacological lineage analysis revealed the binding affinity of broad-spectrum substance P antagonists to receptors for gonadotropin-releasing peptide.

PubMed

Arai, Kazune; Kashiwazaki, Aki; Fujiwara, Yoko; Tsuchiya, Hiroyoshi; Sakai, Nobuya; Shibata, Katsushi; Koshimizu, Taka-aki

2015-02-15

A group of synthetic substance P (SP) antagonists, such as [Arg(6),D-Trp(7,9),N(Me)Phe(8)]-substance P(6-11) and [D-Arg(1),D-Phe(5),D-Trp(7,9),Leu(11)]-substance P, bind to a range of distinct G-protein-coupled receptor (GPCR) family members, including V1a vasopressin receptors, and they competitively inhibit agonist binding. This extended accessibility enabled us to identify a GPCR subset with a partially conserved binding site structure. By combining pharmacological data and amino acid sequence homology matrices, a pharmacological lineage of GPCRs that are sensitive to these two SP antagonists was constructed. We found that sensitivity to the SP antagonists was not limited to the Gq-protein-coupled V1a and V1b receptors; Gs-coupled V2 receptors and oxytocin receptors, which couple with both Gq and Gi, also demonstrated sensitivity. Unexpectedly, a dendrogram based on the amino acid sequences of 222 known GPCRs showed that a group of receptors sensitive to the SP antagonists are located in close proximity to vasopressin/oxytocin receptors. Gonadotropin-releasing peptide receptors, located near the vasopressin receptors in the dendrogram, were also sensitive to the SP analogs, whereas α1B adrenergic receptors, located more distantly from the vasopressin receptors, were not sensitive. Our finding suggests that pharmacological lineage analysis is useful in selecting subsets of candidate receptors that contain a conserved binding site for a ligand with broad-spectrum binding abilities. The knowledge that the binding site of the two broad-spectrum SP analogs partially overlaps with that of distinct peptide agonists is valuable for understanding the specificity/broadness of peptide ligands. Copyright © 2015 Elsevier B.V. All rights reserved.

Chemical Composition of Pinus roxburghii Bark Volatile Oil and Validation of Its Anti-Inflammatory Activity Using Molecular Modelling and Bleomycin-Induced Inflammation in Albino Mice.

PubMed

Labib, Rola M; Youssef, Fadia S; Ashour, Mohamed L; Abdel-Daim, Mohamed M; Ross, Samir A

2017-08-29

The chemical composition of Pinus roxburghii bark essential oil (PRO) was qualitatively and quantitatively determined using GC/FID and GC/MS. The anti-inflammatory activity was assessed in vitro by evaluating the binding percentages on the cannabinoids and opioids receptors. Bleomycin (BLM)-induced pulmonary inflammation in albino mice was adopted to assess PRO anti-inflammatory efficacy in vivo. In silico molecular modelling of its major components was performed on human glucocorticoids receptor (GR). Seventy-five components were identified in which longifolene (33.13%) and palmitic acid (9.34%) constituted the predominant components. No binding was observed on cannabinoid receptor type 1 (CB1), whereas mild binding was observed on cannabinoid receptor type 2 (CB2), delta , kappa , and mu receptors accounting for 2.9%, 6.9%, 10.9% and 22% binding. A significant in vivo activity was evidenced by reduction of the elevated malondialdehyde (MDA), nitric oxide (NO), myeloperoxidase (MPO), interleukin-6 (IL-6), and tumor necrosis factor- α (TNF- α ) levels by 55.56%, 55.66%, 64.64%, 58.85% and 77.78% with concomitant elevation of superoxide dismutase (SOD) and catalase (CAT) activities comparable to BLM-treated group at 100 mg/kg body weight. In silico studies showed that palmitic acid exerted the fittest binding. PRO could serve as a potent anti-inflammatory natural candidate that should be supported by further clinical trials.

Crystal Structures of An F420-Dependent Glucose-6-Phosphate Dehydrogenase Fgd1 Involved in the Activation of the Anti-Tb Drug Candidate Pa-824 Reveal the Basis of Coenzyme And Substrate Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bashiri, G.; Squire, C.J.; Moreland, N.J.

2009-05-11

The modified flavin coenzyme F{sub 420} is found in a restricted number of microorganisms. It is widely distributed in mycobacteria, however, where it is important in energy metabolism, and in Mycobacterium tuberculosis (Mtb) is implicated in redox processes related to non-replicating persistence. In Mtb, the F{sub 420}-dependent glucose-6-phosphate dehydrogenase FGD1 provides reduced F{sub 420} for the in vivo activation of the nitroimidazopyran prodrug PA-824, currently being developed for anti-tuberculosis therapy against both replicating and persistent bacteria. The structure of M. tuberculosis FGD1 has been determined by x-ray crystallography both in its apo state and in complex with F{sub 420} andmore » citrate at resolutions of 1.90 and 1.95{angstrom}, respectively. The structure reveals a highly specific F{sub 420} binding mode, which is shared with several other F{sub 420}-dependent enzymes. Citrate occupies the substrate binding pocket adjacent to F{sub 420} and is shown to be a competitive inhibitor (IC{sub 50} 43 {micro}m). Modeling of the binding of the glucose 6-phosphate (G6P) substrate identifies a positively charged phosphate binding pocket and shows that G6P, like citrate, packs against the isoalloxazine moiety of F{sub 420} and helps promote a butterfly bend conformation that facilitates F{sub 420} reduction and catalysis.« less

Metatranscriptomic analysis of lignocellulolytic microbial communities involved in high-solids decomposition of rice straw

DOE PAGES

Simmons, Christopher W.; Reddy, Amitha P.; D’haeseleer, Patrik; ...

2014-12-31

New lignocellulolytic enzymes are needed that maintain optimal activity under the harsh conditions present during industrial enzymatic deconstruction of biomass, including high temperatures, the absence of free water, and the presence of inhibitors from the biomass. Enriching lignocellulolytic microbial communities under these conditions provides a source of microorganisms that may yield robust lignocellulolytic enzymes tolerant to the extreme conditions needed to improve the throughput and efficiency of biomass enzymatic deconstruction. Identification of promising enzymes from these systems is challenging due to complex substrate-enzyme interactions and requirements to assay for activity. In this study, metatranscriptomes from compost-derived microbial communities enriched onmore » rice straw under thermophilic and mesophilic conditions were sequenced and analyzed to identify lignocellulolytic enzymes overexpressed under thermophilic conditions. To determine differential gene expression across mesophilic and thermophilic treatments, a method was developed which pooled gene expression by functional category, as indicated by Pfam annotations, since microbial communities performing similar tasks are likely to have overlapping functions even if they share no specific genes. Differential expression analysis identified enzymes from glycoside hydrolase family 48, carbohydrate binding module family 2, and carbohydrate binding module family 33 domains as significantly overexpressed in the thermophilic community. Overexpression of these protein families in the thermophilic community resulted from expression of a small number of genes not currently represented in any protein database. Genes in overexpressed protein families were predominantly expressed by a single Actinobacteria genus, Micromonospora. In conclusion, coupling measurements of deconstructive activity with comparative analyses to identify overexpressed enzymes in lignocellulolytic communities provides a targeted approach for discovery of candidate enzymes for more efficient biomass deconstruction. Furthermore, glycoside hydrolase family 48 cellulases and carbohydrate binding module family 33 polysaccharide monooxygenases with carbohydrate binding module family 2 domains may improve saccharification of lignocellulosic biomass under high-temperature and low moisture conditions relevant to industrial biofuel production.« less

Metatranscriptomic analysis of lignocellulolytic microbial communities involved in high-solids decomposition of rice straw

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, Christopher W.; Reddy, Amitha P.; D’haeseleer, Patrik

New lignocellulolytic enzymes are needed that maintain optimal activity under the harsh conditions present during industrial enzymatic deconstruction of biomass, including high temperatures, the absence of free water, and the presence of inhibitors from the biomass. Enriching lignocellulolytic microbial communities under these conditions provides a source of microorganisms that may yield robust lignocellulolytic enzymes tolerant to the extreme conditions needed to improve the throughput and efficiency of biomass enzymatic deconstruction. Identification of promising enzymes from these systems is challenging due to complex substrate-enzyme interactions and requirements to assay for activity. In this study, metatranscriptomes from compost-derived microbial communities enriched onmore » rice straw under thermophilic and mesophilic conditions were sequenced and analyzed to identify lignocellulolytic enzymes overexpressed under thermophilic conditions. To determine differential gene expression across mesophilic and thermophilic treatments, a method was developed which pooled gene expression by functional category, as indicated by Pfam annotations, since microbial communities performing similar tasks are likely to have overlapping functions even if they share no specific genes. Differential expression analysis identified enzymes from glycoside hydrolase family 48, carbohydrate binding module family 2, and carbohydrate binding module family 33 domains as significantly overexpressed in the thermophilic community. Overexpression of these protein families in the thermophilic community resulted from expression of a small number of genes not currently represented in any protein database. Genes in overexpressed protein families were predominantly expressed by a single Actinobacteria genus, Micromonospora. In conclusion, coupling measurements of deconstructive activity with comparative analyses to identify overexpressed enzymes in lignocellulolytic communities provides a targeted approach for discovery of candidate enzymes for more efficient biomass deconstruction. Furthermore, glycoside hydrolase family 48 cellulases and carbohydrate binding module family 33 polysaccharide monooxygenases with carbohydrate binding module family 2 domains may improve saccharification of lignocellulosic biomass under high-temperature and low moisture conditions relevant to industrial biofuel production.« less

Integrated microarray and ChIP analysis identifies multiple Foxa2 dependent target genes in the notochord.

PubMed

Tamplin, Owen J; Cox, Brian J; Rossant, Janet

2011-12-15

The node and notochord are key tissues required for patterning of the vertebrate body plan. Understanding the gene regulatory network that drives their formation and function is therefore important. Foxa2 is a key transcription factor at the top of this genetic hierarchy and finding its targets will help us to better understand node and notochord development. We performed an extensive microarray-based gene expression screen using sorted embryonic notochord cells to identify early notochord-enriched genes. We validated their specificity to the node and notochord by whole mount in situ hybridization. This provides the largest available resource of notochord-expressed genes, and therefore candidate Foxa2 target genes in the notochord. Using existing Foxa2 ChIP-seq data from adult liver, we were able to identify a set of genes expressed in the notochord that had associated regions of Foxa2-bound chromatin. Given that Foxa2 is a pioneer transcription factor, we reasoned that these sites might represent notochord-specific enhancers. Candidate Foxa2-bound regions were tested for notochord specific enhancer function in a zebrafish reporter assay and 7 novel notochord enhancers were identified. Importantly, sequence conservation or predictive models could not have readily identified these regions. Mutation of putative Foxa2 binding elements in two of these novel enhancers abrogated reporter expression and confirmed their Foxa2 dependence. The combination of highly specific gene expression profiling and genome-wide ChIP analysis is a powerful means of understanding developmental pathways, even for small cell populations such as the notochord. Copyright © 2011 Elsevier Inc. All rights reserved.

Structure-based screening and molecular dynamics simulations offer novel natural compounds as potential inhibitors of Mycobacterium tuberculosis isocitrate lyase.

PubMed

Shukla, Rohit; Shukla, Harish; Sonkar, Amit; Pandey, Tripti; Tripathi, Timir

2018-06-01

Mycobacterium tuberculosis is the etiological agent of tuberculosis in humans and is responsible for more than two million deaths annually. M. tuberculosis isocitrate lyase (MtbICL) catalyzes the first step in the glyoxylate cycle, plays a pivotal role in the persistence of M. tuberculosis, which acts as a potential target for an anti-tubercular drug. To identify the potential anti-tuberculosis compound, we conducted a structure-based virtual screening of natural compounds from the ZINC database (n = 1,67,748) against the MtbICL structure. The ligands were docked against MtbICL in three sequential docking modes that resulted in 340 ligands having better docking score. These compounds were evaluated for Lipinski and ADMET prediction, and 27 compounds were found to fit well with re-docking studies. After refinement by molecular docking and drug-likeness analyses, three potential inhibitors (ZINC1306071, ZINC2111081, and ZINC2134917) were identified. These three ligands and the reference compounds were further subjected to molecular dynamics simulation and binding energy analyses to compare the dynamic structure of protein after ligand binding and the stability of the MtbICL and bound complexes. The binding free energy analyses were calculated to validate and capture the intermolecular interactions. The results suggested that the three compounds had a negative binding energy with -96.462, -143.549, and -122.526 kJ mol -1 for compounds with IDs ZINC1306071, ZINC2111081, and ZINC2134917, respectively. These lead compounds displayed substantial pharmacological and structural properties to be drug candidates. We concluded that ZINC2111081 has a great potential to inhibit MtbICL and would add to the drug discovery process against tuberculosis.

R-Ras Regulates Migration through an Interaction with Filamin A in Melanoma Cells

PubMed Central

Gawecka, Joanna E.; Griffiths, Genevieve S.; Ek-Rylander, Barbro; Ramos, Joe W.; Matter, Michelle L.

2010-01-01

Background Changes in cell adhesion and migration in the tumor microenvironment are key in the initiation and progression of metastasis. R-Ras is one of several small GTPases that regulate cell adhesion and migration on the extracellular matrix, however the mechanism has not been completely elucidated. Using a yeast two-hybrid approach we sought to identify novel R-Ras binding proteins that might mediate its effects on integrins. Methods and Findings We identified Filamin A (FLNa) as a candidate interacting protein. FLNa is an actin-binding scaffold protein that also binds to integrin β1, β2 and β7 tails and is associated with diverse cell processes including cell migration. Indeed, M2 melanoma cells require FLNa for motility. We further show that R-Ras and FLNa interact in co-immunoprecipitations and pull-down assays. Deletion of FLNa repeat 3 (FLNaΔ3) abrogated this interaction. In M2 melanoma cells active R-Ras co-localized with FLNa but did not co-localize with FLNa lacking repeat 3. Thus, activated R-Ras binds repeat 3 of FLNa. The functional consequence of this interaction was that active R-Ras and FLNa coordinately increased cell migration. In contrast, co-expression of R-Ras and FLNaΔ3 had a significantly reduced effect on migration. While there was enhancement of integrin activation and fibronectin matrix assembly, cell adhesion was not altered. Finally, siRNA knockdown of endogenous R-Ras impaired FLNa-dependent fibronectin matrix assembly. Conclusions These data support a model in which R-Ras functionally associates with FLNa and thereby regulates integrin-dependent migration. Thus in melanoma cells R-Ras and FLNa may cooperatively promote metastasis by enhancing cell migration. PMID:20585650

Finding the sweet spots of inhibition: understanding the targets of a functional antibody against Plasmodium vivax Duffy binding protein

PubMed Central

Ntumngia, Francis B.; King, Christopher L.; Adams, John H.

2014-01-01

Plasmodium vivax Duffy binding protein region II (DBPII) is an essential ligand for reticulocyte invasion, thereby making this molecule an attractive vaccine candidate against asexual blood-stage P. vivax. Similar to other Plasmodium blood-stage vaccine candidates, strain-specific immunity due to DBPII allelic variation may complicate vaccine efficacy. Targeting immune responses to more conserved epitopes that are potential targets of strain-transcending neutralizing immunity is necessary to avoid induction of strain-specific responses to dominant variant epitopes. In this article, we focus on different approaches to optimize the design of DBP immunogenicity to target conserved epitopes, which is important for developing a broadly effective vaccine against P. vivax. PMID:23068913

Computational Chemistry-Based Identification of Ultra-Low Temperature Water-Gas-Shift Catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manos Mavrikakis

2008-08-31

The current work seeks to identify novel, catalytically-active, stable, poison-resistant LWGS catalysts that retain the superior activity typical of conventional Cu catalysts but can be operated at similar or lower temperatures. A database for the Binding Energies (BEs) of the LWGS relevant species, namely CO, O and OH on the most-stable, close-packed facets of a set of 17 catalytically relevant transition metals was established. This BE data and a database of previously established segregation energies was utilized to predict the stability of bimetallic NSAs that could be synthesized by combinations of the 17 parent transition metals. NSAs that were potentiallymore » stable both in vacuo and under the influence of strong-binding WGS intermediates were then selected for adsorption studies. A set of 40 NSAs were identified that satisfied all three screener criteria and the binding energies of CO, O and OH were calculated on a set of 66, 43 and 79 NSA candidates respectively. Several NSAs were found that bound intermediates weaker than the monometallic catalysts and were thus potentially poison-resistant. Finally, kinetic studies were performed and resulted in the discovery of a specific NSA-based bimetallic catalyst Cu/Pt that is potentially a promising LWGS catalyst. This stable Cu/Pt subsurface alloy is expected to provide facile H{sub 2}O activation and remain relatively resistant from the poisoning by CO, S and formate intermediates.« less

Identification of proteins of Propionibacterium acnes for use as vaccine candidates to prevent infection by the pig pathogen Actinobacillus pleuropneumoniae.

PubMed

Li, Linxi; Sun, Changjiang; Yang, Feng; Yang, Shuxin; Feng, Xin; Gu, Jingmin; Han, Wenyu; Langford, Paul R; Lei, Liancheng

2013-10-25

Actinobacillus pleuropneumoniae is the causative agent of acute and chronic pleuroneumonia that is responsible for substantial morbidity and mortality in the pig industry. New improved vaccines that can protect against all serotypes and prevent colonization are required. In a previous study we showed that whole cells of Propionibacterium acnes protected pigs from A. pleuropneumoniae serotype 1 and 5 and, therefore, the basis for a promising heterologous vaccine. The aim of this study was to identify those protein antigens of P. acnes responsible for protection against A. pleuropneumoniae infection. Six P. acnes protein antigens that were recognized by sera raised against A. pleuropneumoniae were identified by 2-DE and immunoblotting. Recombinant versions of all P. acnes proteins gave partial protection (10-80%) against A. pleuropneumoniae serotype 1 and/or 5 infection in a mouse challenge model. The best protection (80% serotype 1; 60% serotype 5) was obtained using recombinant P. acnes single-stranded DNA-binding protein. In part, protection against A. pleuropneumoniae infection may be mediated by small peptide sequences present in P. acnes single-stranded DNA-binding protein that are cross-reactive with those present in the A. pleuropneumoniae-specific RTX toxin ApxIV and the zinc-binding protein ZnuA. The results suggest that P. acnes may be a useful vaccine to protect against different serotypes of A. pleuropneumoniae. Copyright © 2013 Elsevier Ltd. All rights reserved.

Mechanism of artemisinin resistance for malaria PfATP6 L263 mutations and discovering potential antimalarials: An integrated computational approach

NASA Astrophysics Data System (ADS)

Nagasundaram, N.; George Priya Doss, C.; Chakraborty, Chiranjib; Karthick, V.; Thirumal Kumar, D.; Balaji, V.; Siva, R.; Lu, Aiping; Ge, Zhang; Zhu, Hailong

2016-07-01

Artemisinin resistance in Plasmodium falciparum threatens global efforts in the elimination or eradication of malaria. Several studies have associated mutations in the PfATP6 gene in conjunction with artemisinin resistance, but the underlying molecular mechanism of the resistance remains unexplored. Associated mutations act as a biomarker to measure the artemisinin efficacy. In the proposed work, we have analyzed the binding affinity and efficacy between PfATP6 and artemisinin in the presence of L263D, L263E and L263K mutations. Furthermore, we performed virtual screening to identify potential compounds to inhibit the PfATP6 mutant proteins. In this study, we observed that artemisinin binding affinity with PfATP6 gets affected by L263D, L263E and L263K mutations. This in silico elucidation of artemisinin resistance enhanced the identification of novel compounds (CID: 10595058 and 10625452) which showed good binding affinity and efficacy with L263D, L263E and L263K mutant proteins in molecular docking and molecular dynamics simulations studies. Owing to the high propensity of the parasite to drug resistance the need for new antimalarial drugs will persist until the malarial parasites are eventually eradicated. The two compounds identified in this study can be tested in in vitro and in vivo experiments as possible candidates for the designing of new potential antimalarial drugs.

Imbalance in chemical space: How to facilitate the identification of protein-protein interaction inhibitors.

PubMed

Kuenemann, Mélaine A; Labbé, Céline M; Cerdan, Adrien H; Sperandio, Olivier

2016-04-01

Protein-protein interactions (PPIs) play vital roles in life and provide new opportunities for therapeutic interventions. In this large data analysis, 3,300 inhibitors of PPIs (iPPIs) were compared to 17 reference datasets of collectively ~566,000 compounds (including natural compounds, existing drugs, active compounds on conventional targets, etc.) using a chemoinformatics approach. Using this procedure, we showed that comparable classes of PPI targets can be formed using either the similarity of their ligands or the shared properties of their binding cavities, constituting a proof-of-concept that not only can binding pockets be used to group PPI targets, but that these pockets certainly condition the properties of their corresponding ligands. These results demonstrate that matching regions in both chemical space and target space can be found. Such identified classes of targets could lead to the design of PPI-class-specific chemical libraries and therefore facilitate the development of iPPIs to the stage of drug candidates.

The rise of fragment-based drug discovery.

PubMed

Murray, Christopher W; Rees, David C

2009-06-01

The search for new drugs is plagued by high attrition rates at all stages in research and development. Chemists have an opportunity to tackle this problem because attrition can be traced back, in part, to the quality of the chemical leads. Fragment-based drug discovery (FBDD) is a new approach, increasingly used in the pharmaceutical industry, for reducing attrition and providing leads for previously intractable biological targets. FBDD identifies low-molecular-weight ligands (∼150 Da) that bind to biologically important macromolecules. The three-dimensional experimental binding mode of these fragments is determined using X-ray crystallography or NMR spectroscopy, and is used to facilitate their optimization into potent molecules with drug-like properties. Compared with high-throughput-screening, the fragment approach requires fewer compounds to be screened, and, despite the lower initial potency of the screening hits, offers more efficient and fruitful optimization campaigns. Here, we review the rise of FBDD, including its application to discovering clinical candidates against targets for which other chemistry approaches have struggled.

Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb development.

PubMed

Tucker, A S; Al Khamis, A; Ferguson, C A; Bach, I; Rosenfeld, M G; Sharpe, P T

1999-01-01

Clim-2 (NLI, Lbd1) is one of two related mouse proteins that interact with Lim-domain homeoproteins. In the mouse, embryonic expression of Clim-2 is particularly pronounced in facial ectomesenchyme and limb bud mesenchyme in association with Lim genes, Lhx-6 and Lmx-1 respectively. We show that in common with both these Lim genes, Clim-2 expression is regulated by signals from overlying epithelium. In both the developing face and the limb buds we identify Fgf-8 as the likely candidate signalling molecule that regulates Clim-2 expression. We show that in the mandibular arch, as in the limb, Fgf-8 functions in combination with CD44, a cell surface binding protein, and that blocking CD44 binding results in inhibition of Fgf8-induced expression of Clim-2 and Lhx-6. Regulation of gene expression by Fgf8 in association with CD44 is thus conserved between limb and mandibular arch development.

Characterization of Bufo arenarum oocyte plasma membrane proteins that interact with sperm.

PubMed

Coux, Gabriela; Cabada, Marcelo O

2006-04-28

Sperm-oocyte plasma membrane interaction is an essential step in fertilization. In amphibians, the molecules involved have not been identified. Our aim was to detect and characterize oocyte molecules with binding affinity for sperm. We isolated plasma membranes free from vitelline envelope and yolk proteins from surface-biotinylated Bufo arenarum oocytes. Using binding assays we detected a biotinylated 100 kDa plasma membrane protein that consistently bound to sperm. Chromatographic studies confirmed the 100 kDa protein and detected two additional oocyte molecules of 30 and 70 kDa with affinity for sperm. Competition studies with an integrin-interacting peptide and cross-reaction with an anti-HSP70 antibody suggested that the 100 and 70 kDa proteins are members of the integrin family and HSP70, respectively. MS/MS analysis suggested extra candidates for a role in this step of fertilization. In conclusion, we provide evidence for the involvement of several proteins, including integrins and HSP70, in B. arenarum sperm-oocyte plasma membrane interactions.

Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

NASA Technical Reports Server (NTRS)

Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

2002-01-01

This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

PSBinder: A Web Service for Predicting Polystyrene Surface-Binding Peptides.

PubMed

Li, Ning; Kang, Juanjuan; Jiang, Lixu; He, Bifang; Lin, Hao; Huang, Jian

2017-01-01

Polystyrene surface-binding peptides (PSBPs) are useful as affinity tags to build a highly effective ELISA system. However, they are also a quite common type of target-unrelated peptides (TUPs) in the panning of phage-displayed random peptide library. As TUP, PSBP will mislead the analysis of panning results if not identified. Therefore, it is necessary to find a way to quickly and easily foretell if a peptide is likely to be a PSBP or not. In this paper, we describe PSBinder, a predictor based on SVM. To our knowledge, it is the first web server for predicting PSBP. The SVM model was built with the feature of optimized dipeptide composition and 87.02% (MCC = 0.74; AUC = 0.91) of peptides were correctly classified by fivefold cross-validation. PSBinder can be used to exclude highly possible PSBP from biopanning results or to find novel candidates for polystyrene affinity tags. Either way, it is valuable for biotechnology community.

A fully human monoclonal antibody with novel binding epitope and excellent neutralizing activity to multiple human IFN-α subtypes: A candidate therapy for systemic lupus erythematosus.

PubMed

Du, Peng; Xu, Lei; Qiu, Weiyi; Zeng, Dadi; Yue, Junjie; Wang, Shuang; Huang, Peitang; Sun, Zhiwei

2015-01-01

Systemic lupus erythematosus (SLE) is a chronic, heterogeneous autoimmune disease short of effective therapeutic agents. A multitude of studies of SLE in the last decade have accentuated a central role of the interferon alpha (IFN-α) pathway in SLE pathogenesis. We report here a candidate therapeutic neutralizing antibody, AIA22, with a different binding epitope and discrepant neutralizing profile from the anti-multiple IFN-α subtype antibodies currently in clinical trials. AIA22 specifically interacts with multiple IFN-α subtypes, binds to the type I IFN receptor 2 (IFNAR2) recognition region of IFN-α (considered a novel antigen epitope), and effectively neutralizes the activity of almost all of the IFN-α subtypes (with the exception of IFN-α7) both in vitro and in vivo. Concurrently, structural modeling and computational design yielded a mutational antibody of AIA22, AIAmut, which exhibited substantially improved neutralizing activity to multiple IFN-α subtypes.

Does CTCF mediate between nuclear organization and gene expression?

PubMed

Ohlsson, Rolf; Lobanenkov, Victor; Klenova, Elena

2010-01-01

The multifunctional zinc-finger protein CCCTC-binding factor (CTCF) is a very strong candidate for the role of coordinating the expression level of coding sequences with their three-dimensional position in the nucleus, apparently responding to a "code" in the DNA itself. Dynamic interactions between chromatin fibers in the context of nuclear architecture have been implicated in various aspects of genome functions. However, the molecular basis of these interactions still remains elusive and is a subject of intense debate. Here we discuss the nature of CTCF-DNA interactions, the CTCF-binding specificity to its binding sites and the relationship between CTCF and chromatin, and we examine data linking CTCF with gene regulation in the three-dimensional nuclear space. We discuss why these features render CTCF a very strong candidate for the role and propose a unifying model, the "CTCF code," explaining the mechanistic basis of how the information encrypted in DNA may be interpreted by CTCF into diverse nuclear functions.

Machine learning in computational docking.

PubMed

Khamis, Mohamed A; Gomaa, Walid; Ahmed, Walaa F

2015-03-01

The objective of this paper is to highlight the state-of-the-art machine learning (ML) techniques in computational docking. The use of smart computational methods in the life cycle of drug design is relatively a recent development that has gained much popularity and interest over the last few years. Central to this methodology is the notion of computational docking which is the process of predicting the best pose (orientation + conformation) of a small molecule (drug candidate) when bound to a target larger receptor molecule (protein) in order to form a stable complex molecule. In computational docking, a large number of binding poses are evaluated and ranked using a scoring function. The scoring function is a mathematical predictive model that produces a score that represents the binding free energy, and hence the stability, of the resulting complex molecule. Generally, such a function should produce a set of plausible ligands ranked according to their binding stability along with their binding poses. In more practical terms, an effective scoring function should produce promising drug candidates which can then be synthesized and physically screened using high throughput screening process. Therefore, the key to computer-aided drug design is the design of an efficient highly accurate scoring function (using ML techniques). The methods presented in this paper are specifically based on ML techniques. Despite many traditional techniques have been proposed, the performance was generally poor. Only in the last few years started the application of the ML technology in the design of scoring functions; and the results have been very promising. The ML-based techniques are based on various molecular features extracted from the abundance of protein-ligand information in the public molecular databases, e.g., protein data bank bind (PDBbind). In this paper, we present this paradigm shift elaborating on the main constituent elements of the ML approach to molecular docking along with the state-of-the-art research in this area. For instance, the best random forest (RF)-based scoring function on PDBbind v2007 achieves a Pearson correlation coefficient between the predicted and experimentally determined binding affinities of 0.803 while the best conventional scoring function achieves 0.644. The best RF-based ranking power ranks the ligands correctly based on their experimentally determined binding affinities with accuracy 62.5% and identifies the top binding ligand with accuracy 78.1%. We conclude with open questions and potential future research directions that can be pursued in smart computational docking; using molecular features of different nature (geometrical, energy terms, pharmacophore), advanced ML techniques (e.g., deep learning), combining more than one ML models. Copyright © 2015 Elsevier B.V. All rights reserved.

Studies on medicinal herbs for cognitive enhancement based on the text mining of Dongeuibogam and preliminary evaluation of its effects.

PubMed

Pak, Malk Eun; Kim, Yu Ri; Kim, Ha Neui; Ahn, Sung Min; Shin, Hwa Kyoung; Baek, Jin Ung; Choi, Byung Tae

2016-02-17

In literature on Korean medicine, Dongeuibogam (Treasured Mirror of Eastern Medicine), published in 1613, represents the overall results of the traditional medicines of North-East Asia based on prior medicinal literature of this region. We utilized this medicinal literature by text mining to establish a list of candidate herbs for cognitive enhancement in the elderly and then performed an evaluation of their effects. Text mining was performed for selection of candidate herbs. Cell viability was determined in HT22 hippocampal cells and immunohistochemistry and behavioral analysis was performed in a kainic acid (KA) mice model in order to observe alterations of hippocampal cells and cognition. Twenty four herbs for cognitive enhancement in the elderly were selected by text mining of Dongeuibogam. In HT22 cells, pretreatment with 3 candidate herbs resulted in significantly reduced glutamate-induced cell death. Panax ginseng was the most neuroprotective herb against glutamate-induced cell death. In the hippocampus of a KA mice model, pretreatment with 11 candidate herbs resulted in suppression of caspase-3 expression. Treatment with 7 candidate herbs resulted in significantly enhanced expression levels of phosphorylated cAMP response element binding protein. Number of proliferated cells indicated by BrdU labeling was increased by treatment with 10 candidate herbs. Schisandra chinensis was the most effective herb against cell death and proliferation of progenitor cells and Rehmannia glutinosa in neuroprotection in the hippocampus of a KA mice model. In a KA mice model, we confirmed improved spatial and short memory by treatment with the 3 most effective candidate herbs and these recovered functions were involved in a higher number of newly formed neurons from progenitor cells in the hippocampus. These established herbs and their combinations identified by text-mining technique and evaluation for effectiveness may have value in further experimental and clinical applications for cognitive enhancement in the elderly. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Reliable Prescreening of Candidate NerveAgent Prophylaxes via 3D QSAR

DTIC Science & Technology

2005-12-31

recognize and predict prospective toxicity among covalent -binding AChE inhibitors of potential application to nerve agent prophylaxis and...is below since many authors do not follow the 200 word limit 14. SUBJECT TERMS nerve agents , acetylcholinesterase, prophylaxis, QSAR, virtual...Report: Reliable Prescreening of Candidate NerveAgent Prophylaxes via 3D QSAR Report Title ABSTRACT Organophosphorus (OP) nerve agents are among the

Fragment-based drug discovery using rational design.

PubMed

Jhoti, H

2007-01-01

Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

Definition of the HLA-A29 peptide ligand motif allows prediction of potential T-cell epitopes from the retinal soluble antigen, a candidate autoantigen in birdshot retinopathy.

PubMed Central

Boisgerault, F; Khalil, I; Tieng, V; Connan, F; Tabary, T; Cohen, J H; Choppin, J; Charron, D; Toubert, A

1996-01-01

The peptide-binding motif of HLA-A29, the predisposing allele for birdshot retinopathy, was determined after acid-elution of endogenous peptides from purified HLA-A29 molecules. Individual and pooled HPLC fractions were sequenced by Edman degradation. Major anchor residues could be defined as glutamate at the second position of the peptide and as tyrosine at the carboxyl terminus. In vitro binding of polyglycine synthetic peptides to purified HLA-A29 molecules also revealed the need for an auxiliary anchor residue at the third position, preferably phenylalanine. By using this motif, we synthesized six peptides from the retinal soluble antigen, a candidate autoantigen in autoimmune uveoretinitis. Their in vitro binding was tested on HLA-A29 and also on HLA-B44 and HLA-B61, two alleles sharing close peptide-binding motifs. Two peptides derived from the carboxyl-terminal sequence of the human retinal soluble antigen bound efficiently to HLA-A29. This study could contribute to the prediction of T-cell epitopes from retinal autoantigens implicated in birdshot retinopathy. PMID:8622959

A Common Variant at the 14q32 Endometrial Cancer Risk Locus Activates AKT1 through YY1 Binding.

PubMed

Painter, Jodie N; Kaufmann, Susanne; O'Mara, Tracy A; Hillman, Kristine M; Sivakumaran, Haran; Darabi, Hatef; Cheng, Timothy H T; Pearson, John; Kazakoff, Stephen; Waddell, Nicola; Hoivik, Erling A; Goode, Ellen L; Scott, Rodney J; Tomlinson, Ian; Dunning, Alison M; Easton, Douglas F; French, Juliet D; Salvesen, Helga B; Pollock, Pamela M; Thompson, Deborah J; Spurdle, Amanda B; Edwards, Stacey L

2016-06-02

A recent meta-analysis of multiple genome-wide association and follow-up endometrial cancer case-control datasets identified a novel genetic risk locus for this disease at chromosome 14q32.33. To prioritize the functional SNP(s) and target gene(s) at this locus, we employed an in silico fine-mapping approach using genotyped and imputed SNP data for 6,608 endometrial cancer cases and 37,925 controls of European ancestry. Association and functional analyses provide evidence that the best candidate causal SNP is rs2494737. Multiple experimental analyses show that SNP rs2494737 maps to a silencer element located within AKT1, a member of the PI3K/AKT/MTOR intracellular signaling pathway activated in endometrial tumors. The rs2494737 risk A allele creates a YY1 transcription factor-binding site and abrogates the silencer activity in luciferase assays, an effect mimicked by transfection of YY1 siRNA. Our findings suggest YY1 is a positive regulator of AKT1, mediating the stimulatory effects of rs2494737 increasing endometrial cancer risk. Identification of an endometrial cancer risk allele within a member of the PI3K/AKT signaling pathway, more commonly activated in tumors by somatic alterations, raises the possibility that well tolerated inhibitors targeting this pathway could be candidates for evaluation as chemopreventive agents in individuals at high risk of developing endometrial cancer. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Many human accelerated regions are developmental enhancers

PubMed Central

Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

2013-01-01

The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

Inhibitor candidates's identification of HCV's RNA polymerase NS5B using virtual screening against iPPI-library

NASA Astrophysics Data System (ADS)

Sulistyawati, Indah; Sulistyo Dwi K., P.; Ichsan, Mochammad

2016-03-01

Hepatitis C is one of the major causes of chronic liver failure that caused by Hepatitis C Virus (HCV). Preventing the progression of HCV's replication through the inhibition of The RNA polymerase NS5B of Hepatitis C virus (NS5B) can be achieved via 4 binding regions: Site I (Thumb I), Site II (Thumb II), Site III (Palm I), and Site IV (Palm II). The aim of this research is to identify a candidate of NS5B inhibitor as an alternative for Hepatitis C treatment. An NS5B's 3D structure (PDB ID = 3D5M) used in this study has met some criteria of a good model to be used in virtual screening againts iPPI-lib using MTiOpenScreen webserver. The top two natural compounds resulted here then docked using Pyrix 0.8 and discovered trans-6-Benzamido-2-methyldecahydroisoquinoline (-9,1kcal/mol) and 2,4-dichloro-5-[4-(2 methoxyphenyl) piperazine-1-carbonyl]-N-[3-(trifluoromethyl)phenyl] benzenesulfonamide (9,4 kcal/mol) can bind to Tyr448 similar with all three established inhibitors, such as setrobuvir (-11,4 kcal/mol; site 3 inhibitor), CHEMBL379677 (-9,1 kcal/mol; site 1 inhibitor), and nesbuvir (-7,7 kcal/mol; site 4 inhibitor). The results of this study are relatively still needs to be tested, both in vitro and in vivo, in order to obtain more comprehensive knowledges as a follow-up of this predictive study.

Structure of malaria invasion protein RH5 with erythrocyte basigin and blocking antibodies.

PubMed

Wright, Katherine E; Hjerrild, Kathryn A; Bartlett, Jonathan; Douglas, Alexander D; Jin, Jing; Brown, Rebecca E; Illingworth, Joseph J; Ashfield, Rebecca; Clemmensen, Stine B; de Jongh, Willem A; Draper, Simon J; Higgins, Matthew K

2014-11-20

Invasion of host erythrocytes is essential to the life cycle of Plasmodium parasites and development of the pathology of malaria. The stages of erythrocyte invasion, including initial contact, apical reorientation, junction formation, and active invagination, are directed by coordinated release of specialized apical organelles and their parasite protein contents. Among these proteins, and central to invasion by all species, are two parasite protein families, the reticulocyte-binding protein homologue (RH) and erythrocyte-binding like proteins, which mediate host-parasite interactions. RH5 from Plasmodium falciparum (PfRH5) is the only member of either family demonstrated to be necessary for erythrocyte invasion in all tested strains, through its interaction with the erythrocyte surface protein basigin (also known as CD147 and EMMPRIN). Antibodies targeting PfRH5 or basigin efficiently block parasite invasion in vitro, making PfRH5 an excellent vaccine candidate. Here we present crystal structures of PfRH5 in complex with basigin and two distinct inhibitory antibodies. PfRH5 adopts a novel fold in which two three-helical bundles come together in a kite-like architecture, presenting binding sites for basigin and inhibitory antibodies at one tip. This provides the first structural insight into erythrocyte binding by the Plasmodium RH protein family and identifies novel inhibitory epitopes to guide design of a new generation of vaccines against the blood-stage parasite.

Screening and investigation of triplex DNA binders from Stephania tetrandra S. Moore by a combination of peak area-fading UHPLC with orbitrap MS and optical spectroscopies.

PubMed

Yang, Hongmei; Wang, Yihan; Yu, Wenjing; Shi, Lei; Wang, Hongfeng; Su, Rui; Chen, Changbao; Liu, Shuying

2018-05-15

The identification and screening of triplex DNA binders are important because these compounds, in many cases, are potential anticancer agents as well as promising drug candidates. Therefore, the ability to screen for these compounds in a high-throughput mode could dramatically improve the drug screening process. A method involving a combination of 96-well plate format and peak area-fading ultra high performance liquid chromatography coupled with Orbitrap mass spectrometry was employed for screening bioactive compounds binding to the triplex DNA from the extracts of Stephania tetrandra S. Moore. Two compounds were screened out and identified as fangchinoline and tetrandrine, based on the comparison of retention time and MS 2 data with those of standards. The binding mechanisms of fangchinoline and tetrandrine at the molecular level were explored using MS 2 , fluorescence spectroscopy, ultraviolet-visible spectroscopy, and circular dichroism. Collision-induced dissociation experiments showed that the complexes with fangchinoline and tetrandrine were dissociated by ligand elimination. According to these measurements, an intercalating binding is the most appropriate binding mode of these two alkaloids to the triplex DNA. The current work provides not only deep insight into alkaloid-triplex DNA complexes but also useful guidelines for the design of efficient anticancer agents. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Miscellaneous vitreous-derived IgM antibodies target numerous retinal proteins in equine recurrent uveitis.

PubMed

Zipplies, Johanna K; Hauck, Stefanie M; Eberhardt, Christina; Hirmer, Sieglinde; Amann, Barbara; Stangassinger, Manfred; Ueffing, Marius; Deeg, Cornelia A

2012-09-01

In equine recurrent uveitis (ERU), immune reactions are directed toward known antigens like S-antigen, interphotoreceptor retinoid-binding protein, and cellular retinalaldehyde-binding protein, and anti-retinal antibodies were detected in vitreous samples. The aim of this study was the investigation of intraocular immunoglobulin M (IgM) reactivities to retinal proteome. Retina was separated by one- and two-dimensional gel electrophoresis and blotted semidry on PVDF membranes. To identify intraocular IgM antibody responses to retinal tissue, blots were incubated with vitreous samples of ERU-diseased horses (n = 50) and healthy controls (n = 30), followed by an HRP-labeled secondary antibody specific for equine IgM. Noticeable 2D western blot signals were aligned on a 2D gel of retinal proteome, excised, and subsequently identified by tandem mass spectrometry. Interestingly, frequent and very miscellaneous IgM response patterns to the retinal proteome in 68% of ERU vitreous samples were detected. Binding of IgM antibodies was localized at 17 different molecular weights. The most frequently detected signal, in 21 of the 50 samples, was located at 49 kDa. Comparing the samples interindividually between one and up to nine different signals in one sample could be observed. All healthy vitreous samples were devoid of IgM antibodies. Analysis of targeted spots with mass spectrometry led to the clear identification of 11 different proteins (corresponding to 16 different spots). One candidate could not be discovered so far. The considerable IgM response to retinal proteins demonstrates an ongoing immune response, which might contribute to the remitting relapsing character of ERU. Novel identified target proteins point to a diverse response pattern of individual ERU cases. © 2012 American College of Veterinary Ophthalmologists.

Development and application of hybrid structure based method for efficient screening of ligands binding to G-protein coupled receptors

NASA Astrophysics Data System (ADS)

Kortagere, Sandhya; Welsh, William J.

2006-12-01

G-protein coupled receptors (GPCRs) comprise a large superfamily of proteins that are targets for nearly 50% of drugs in clinical use today. In the past, the use of structure-based drug design strategies to develop better drug candidates has been severely hampered due to the absence of the receptor's three-dimensional structure. However, with recent advances in molecular modeling techniques and better computing power, atomic level details of these receptors can be derived from computationally derived molecular models. Using information from these models coupled with experimental evidence, it has become feasible to build receptor pharmacophores. In this study, we demonstrate the use of the Hybrid Structure Based (HSB) method that can be used effectively to screen and identify prospective ligands that bind to GPCRs. Essentially; this multi-step method combines ligand-based methods for building enriched libraries of small molecules and structure-based methods for screening molecules against the GPCR target. The HSB method was validated to identify retinal and its analogues from a random dataset of ˜300,000 molecules. The results from this study showed that the 9 top-ranking molecules are indeed analogues of retinal. The method was also tested to identify analogues of dopamine binding to the dopamine D2 receptor. Six of the ten top-ranking molecules are known analogues of dopamine including a prodrug, while the other thirty-four molecules are currently being tested for their activity against all dopamine receptors. The results from both these test cases have proved that the HSB method provides a realistic solution to bridge the gap between the ever-increasing demand for new drugs to treat psychiatric disorders and the lack of efficient screening methods for GPCRs.

Evidence for Globally Shared, Cross-Reacting Polymorphic Epitopes in the Pregnancy-Associated Malaria Vaccine Candidate VAR2CSA▿

PubMed Central

Avril, Marion; Kulasekara, Bridget R.; Gose, Severin O.; Rowe, Chris; Dahlbäck, Madeleine; Duffy, Patrick E.; Fried, Michal; Salanti, Ali; Misher, Lynda; Narum, David L.; Smith, Joseph D.

2008-01-01

Pregnancy-associated malaria (PAM) is characterized by the placental sequestration of Plasmodium falciparum-infected erythrocytes (IEs) with the ability to bind to chondroitin sulfate A (CSA). VAR2CSA is a leading candidate for a pregnancy malaria vaccine, but its large size (∼350 kDa) and extensive polymorphism may pose a challenge to vaccine development. In this study, rabbits were immunized with individual VAR2CSA Duffy binding-like (DBL) domains expressed in Pichia pastoris or var2csa plasmid DNA and sera were screened on different CSA-binding parasite lines. Rabbit antibodies to three recombinant proteins (DBL1, DBL3, and DBL6) and four plasmid DNAs (DBL1, DBL3, DBL5, and DBL6) reacted with homologous FCR3-CSA IEs. By comparison, antibodies to the DBL4 domain were unable to react with native VAR2CSA protein unless it was first partially proteolyzed with trypsin or chymotrypsin. To investigate the antigenic relationship of geographically diverse CSA-binding isolates, rabbit immune sera were screened on four heterologous CSA-binding lines from different continental origins. Antibodies did not target conserved epitopes exposed in all VAR2CSA alleles; however, antisera to several DBL domains cross-reacted on parasite isolates that had polymorphic loops in common with the homologous immunogen. This study demonstrates that VAR2CSA contains common polymorphic epitopes that are shared between geographically diverse CSA-binding lines. PMID:18250177

Evidence for globally shared, cross-reacting polymorphic epitopes in the pregnancy-associated malaria vaccine candidate VAR2CSA.

PubMed

Avril, Marion; Kulasekara, Bridget R; Gose, Severin O; Rowe, Chris; Dahlbäck, Madeleine; Duffy, Patrick E; Fried, Michal; Salanti, Ali; Misher, Lynda; Narum, David L; Smith, Joseph D

2008-04-01

Pregnancy-associated malaria (PAM) is characterized by the placental sequestration of Plasmodium falciparum-infected erythrocytes (IEs) with the ability to bind to chondroitin sulfate A (CSA). VAR2CSA is a leading candidate for a pregnancy malaria vaccine, but its large size ( approximately 350 kDa) and extensive polymorphism may pose a challenge to vaccine development. In this study, rabbits were immunized with individual VAR2CSA Duffy binding-like (DBL) domains expressed in Pichia pastoris or var2csa plasmid DNA and sera were screened on different CSA-binding parasite lines. Rabbit antibodies to three recombinant proteins (DBL1, DBL3, and DBL6) and four plasmid DNAs (DBL1, DBL3, DBL5, and DBL6) reacted with homologous FCR3-CSA IEs. By comparison, antibodies to the DBL4 domain were unable to react with native VAR2CSA protein unless it was first partially proteolyzed with trypsin or chymotrypsin. To investigate the antigenic relationship of geographically diverse CSA-binding isolates, rabbit immune sera were screened on four heterologous CSA-binding lines from different continental origins. Antibodies did not target conserved epitopes exposed in all VAR2CSA alleles; however, antisera to several DBL domains cross-reacted on parasite isolates that had polymorphic loops in common with the homologous immunogen. This study demonstrates that VAR2CSA contains common polymorphic epitopes that are shared between geographically diverse CSA-binding lines.

Identification of human microRNA targets from isolated argonaute protein complexes.

PubMed

Beitzinger, Michaela; Peters, Lasse; Zhu, Jia Yun; Kremmer, Elisabeth; Meister, Gunter

2007-06-01

MicroRNAs (miRNAs) constitute a class of small non-coding RNAs that regulate gene expression on the level of translation and/or mRNA stability. Mammalian miRNAs associate with members of the Argonaute (Ago) protein family and bind to partially complementary sequences in the 3' untranslated region (UTR) of specific target mRNAs. Computer algorithms based on factors such as free binding energy or sequence conservation have been used to predict miRNA target mRNAs. Based on such predictions, up to one third of all mammalian mRNAs seem to be under miRNA regulation. However, due to the low degree of complementarity between the miRNA and its target, such computer programs are often imprecise and therefore not very reliable. Here we report the first biochemical identification approach of miRNA targets from human cells. Using highly specific monoclonal antibodies against members of the Ago protein family, we co-immunoprecipitate Ago-bound mRNAs and identify them by cloning. Interestingly, most of the identified targets are also predicted by different computer programs. Moreover, we randomly analyzed six different target candidates and were able to experimentally validate five as miRNA targets. Our data clearly indicate that miRNA targets can be experimentally identified from Ago complexes and therefore provide a new tool to directly analyze miRNA function.

Large-Scale Conformational Changes of Trypanosoma cruzi Proline Racemase Predicted by Accelerated Molecular Dynamics Simulation

PubMed Central

McCammon, J. Andrew

2011-01-01

Chagas' disease, caused by the protozoan parasite Trypanosoma cruzi (T. cruzi), is a life-threatening illness affecting 11–18 million people. Currently available treatments are limited, with unacceptable efficacy and safety profiles. Recent studies have revealed an essential T. cruzi proline racemase enzyme (TcPR) as an attractive candidate for improved chemotherapeutic intervention. Conformational changes associated with substrate binding to TcPR are believed to expose critical residues that elicit a host mitogenic B-cell response, a process contributing to parasite persistence and immune system evasion. Characterization of the conformational states of TcPR requires access to long-time-scale motions that are currently inaccessible by standard molecular dynamics simulations. Here we describe advanced accelerated molecular dynamics that extend the effective simulation time and capture large-scale motions of functional relevance. Conservation and fragment mapping analyses identified potential conformational epitopes located in the vicinity of newly identified transient binding pockets. The newly identified open TcPR conformations revealed by this study along with knowledge of the closed to open interconversion mechanism advances our understanding of TcPR function. The results and the strategy adopted in this work constitute an important step toward the rationalization of the molecular basis behind the mitogenic B-cell response of TcPR and provide new insights for future structure-based drug discovery. PMID:22022240

Large-scale conformational changes of Trypanosoma cruzi proline racemase predicted by accelerated molecular dynamics simulation.

PubMed

de Oliveira, César Augusto F; Grant, Barry J; Zhou, Michelle; McCammon, J Andrew

2011-10-01

Chagas' disease, caused by the protozoan parasite Trypanosoma cruzi (T. cruzi), is a life-threatening illness affecting 11-18 million people. Currently available treatments are limited, with unacceptable efficacy and safety profiles. Recent studies have revealed an essential T. cruzi proline racemase enzyme (TcPR) as an attractive candidate for improved chemotherapeutic intervention. Conformational changes associated with substrate binding to TcPR are believed to expose critical residues that elicit a host mitogenic B-cell response, a process contributing to parasite persistence and immune system evasion. Characterization of the conformational states of TcPR requires access to long-time-scale motions that are currently inaccessible by standard molecular dynamics simulations. Here we describe advanced accelerated molecular dynamics that extend the effective simulation time and capture large-scale motions of functional relevance. Conservation and fragment mapping analyses identified potential conformational epitopes located in the vicinity of newly identified transient binding pockets. The newly identified open TcPR conformations revealed by this study along with knowledge of the closed to open interconversion mechanism advances our understanding of TcPR function. The results and the strategy adopted in this work constitute an important step toward the rationalization of the molecular basis behind the mitogenic B-cell response of TcPR and provide new insights for future structure-based drug discovery.

Proteomic analysis identifies insulin-like growth factor-binding protein-related protein-1 as a podocyte product.

PubMed

Matsumoto, Takayuki; Hess, Sonja; Kajiyama, Hiroshi; Sakairi, Toru; Saleem, Moin A; Mathieson, Peter W; Nojima, Yoshihisa; Kopp, Jeffrey B

2010-10-01

The podocyte secretory proteome may influence the phenotype of adjacent podocytes, endothelial cells, parietal epithelial cells, and tubular epithelial cells but has not been systematically characterized. We have initiated studies to characterize this proteome, with the goal of further understanding the podocyte cell biology. We cultured differentiated conditionally immortalized human podocytes and subjected the proteins in conditioned medium to mass spectrometry. At a false discovery rate of <3%, we identified 111 candidates from conditioned medium, including 44 proteins that have signal peptides or are described as secreted proteins in the UniProt database. As validation, we confirmed that one of these proteins, insulin-like growth factor-binding protein-related protein-1 (IGFBP-rP1), was expressed in mRNA and protein of cultured podocytes. In addition, transforming growth factor-β1 stimulation increased IGFBP-rP1 in conditioned medium. We analyzed IGFBP-rP1 glomerular expression in a mouse model of human immunodeficiency virus-associated nephropathy. IGFBP-rP1 was absent from podocytes of normal mice and was expressed in podocytes and pseudocrescents of transgenic mice, where it was coexpressed with desmin, a podocyte injury marker. We conclude that IGFBP-rP1 may be a product of injured podocytes. Further analysis of the podocyte secretory proteome may identify biomarkers of podocyte injury.

Comparative Analysis of the Complete Genome of Lactobacillus plantarum GB-LP2 and Potential Candidate Genes for Host Immune System Enhancement.

PubMed

Kwak, Woori; Kim, Kwondo; Lee, Chul; Lee, Chanho; Kang, Jungsun; Cho, Kyungjin; Yoon, Sook Hee; Kang, Dae-Kyung; Kim, Heebal; Heo, Jaeyoung; Cho, Seoae

2016-04-28

Acute respiratory virus infectious diseases are a growing health problem, particularly among children and the elderly. Much effort has been made to develop probiotics that prevent influenza virus infections by enhancing innate immunity in the respiratory tract until vaccines are available. Lactobacillus plantarum GB-LP2, isolated from a traditional Korean fermented vegetable, has exhibited preventive effects on influenza virus infection in mice. To identify the molecular basis of this strain, we conducted a whole-genome assembly study. The single circular DNA chromosome of 3,284,304 bp was completely assembled and 3,250 proteinencoding genes were predicted. Evolutionarily accelerated genes related to the phenotypic trait of anti-infective activities for influenza virus were identified. These genes encode three integral membrane proteins, a teichoic acid export ATP-binding protein and a glucosamine - fructose-6-phosphate aminotransferase involved in host innate immunity, the nonspecific DNA-binding protein Dps, which protects bacteria from oxidative damage, and the response regulator of the three-component quorum-sensing regulatory system, which is related to the capacity of adhesion to the surface of the respiratory tract and competition with pathogens. This is the first study to identify the genetic backgrounds of the antiviral activity in L. plantarum strains. These findings provide insight into the anti-infective activities of L. plantarum and the development of preventive probiotics.

Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

PubMed

Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

2015-07-02

Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Identifying Candidate Chemical-Disease Linkages ...

EPA Pesticide Factsheets

Presentation at meeting on Environmental and Epigenetic Determinants of IBD in New York, NY on identifying candidate chemical-disease linkages by using AOPs to identify molecular initiating events and using relevant high throughput assays to screen for candidate chemicals. This hazard information is combined with exposure models to inform risk assessment. Presentation at meeting on Environmental and Epigenetic Determinants of IBD in New York, NY on identifying candidate chemical-disease linkages by using AOPs to identify molecular initiating events and using relevant high throughput assays to screen for candidate chemicals. This hazard information is combined with exposure models to inform risk assessment.

Interaction with epsin 1 regulates the constitutive clathrin-dependent internalization of ErbB3.

PubMed

Szymanska, Monika; Fosdahl, Anne Marthe; Raiborg, Camilla; Dietrich, Markus; Liestøl, Knut; Stang, Espen; Bertelsen, Vibeke

2016-06-01

In contrast to other members of the EGF receptor family, ErbB3 is constitutively internalized in a clathrin-dependent manner. Previous studies have shown that ErbB3 does not interact with the coated pit localized adaptor complex 2 (AP-2), and that ErbB3 lacks two AP-2 interacting internalization signals identified in the EGF receptor. Several other clathrin-associated sorting proteins which may recruit cargo into coated pits have, however, been identified, and the study was performed to identify adaptors needed for constitutive internalization of ErbB3. A high-throughput siRNA screen was used to identify adaptor proteins needed for internalization of ErbB3. Upon knock-down of candidate proteins internalization of ErbB3 was identified using an antibody-based internalization assay combined with automatic fluorescence microscopy. Among 29 candidates only knock-down of epsin 1 turned out to inhibit ErbB3. Epsin 1 has ubiquitin interacting motifs (UIMs) and we show that ErbB3 interacts with an epsin 1 deletion mutant containing these UIMs. In support of an ErbB3-epsin 1 UIM dependent interaction, we show that ErbB3 is constitutively ubiquitinated, but that both ubiquitination and the ErbB3-epsin 1 interaction increase upon ligand binding. Altogether the results are consistent with a model whereby both constitutive and ligand-induced internalization of ErbB3 are regulated through interaction with epsin 1. Internalization is an important regulator of growth factor receptor mediated signaling and the current study identify mechanisms regulating plasma membrane turnover of ErbB3. Copyright © 2016 Elsevier B.V. All rights reserved.

A new candidate of calcium channel blocker in silico from Tectona grandis for treatment of gestational hypertension

NASA Astrophysics Data System (ADS)

Azizah, A.; Suselo, Y. H.; Muthmainah, M.; Indarto, D.

2018-05-01

Gestational Hypertension is one of the three main causes of maternal mortality in Indonesia. Nifedipine which blockes the Cav1.2 calcium channel has frequently been used to treat gestational hypertension. However the efficacy of nifedipine has not been established yet and the prevalence of gestational hypertension is still high (27.1 %). Indonesian herbal plants have potential to be developed as natural drugs. Molecular docking, a computational method, is very often used to depict interaction between molecules and target receptor This study was therefore to identify Indonesian herbal plants that could inhibit the calcium channel in silico. This was a bioinformatics study with molecular docking approach. Three-dimensional structure of human calcium channel Cav1.2 was determined by modelling with rabbit calcium channel (ID:5GJW) as template and using the SWISS MODEL software. Nifedipine was used as a standard ligand and obtained from ZINC database with the access code ZINC19594578. Active compounds of Indonesian herbal plants were registered in HerbalDB database and their molecular structure was obtained from PubChem. Binding affinity of human Cav1.2 model-ligand complexes were assesed using AutoDock Vina 1.1.2 software and visualization of molecular conformation used Chimera 1.10 and PyMol 1.3 softwares. The Lipinsky’s rules of five were used to determine active compounds which fullfilled drug criteria. The human Cav1-2 model had 72.35% sequence identity with rabbit Cav1.1. Nifedipine bound to the human Cav1.2 model with -2.1 kcal/mol binding affinity and had binding sites at Gln1060, Phe1129, Ser1132, and Ile1173 residues. A lower binding affinity was observed in 8 phytochemicals but only obtusifolin 2-glucoside (-2.2 kcal/mol) had similar binding sites as nifedipin did. In addition, obtusifolin 2-glucoside met the Lipinsky criteria and the molecule conformation was similar with nifedipine. From the HerbalDB database, obtusifolin 2-glucoside is found in Tectona grandis. Obtusifolin 2-glucoside computationally becomes a potensial candidate of calcium channel blocker. In vitro assays should be performed to evaluate the antagonist effect of obtusifolin 2-glucoside on calcium channel Cav1.2.

Human IgG subclass cross-species reactivity to mouse and cynomolgus monkey Fcγ receptors.

PubMed

Derebe, Mehabaw G; Nanjunda, Rupesh K; Gilliland, Gary L; Lacy, Eilyn R; Chiu, Mark L

2018-05-01

In therapeutic antibody discovery and early development, mice and cynomolgus monkey are used as animal models to assess toxicity, efficacy and other properties of candidate molecules. As more candidate antibodies are based on human immunoglobulin (IgG) subclasses, many strategies are pursued to simulate the human system in the test animal. However, translation rate from a successful preclinical trial to an approved drug is extremely low. This may partly be due to differences in interaction of human IgG based candidate molecules to endogenous Fcγ receptors of model animals in comparison to those of human Fcγ receptors. In this study, we compare binding characteristics of human IgG subclasses commonly used in drug development (IgG1, IgG2, IgG4) and their respective Fc silent versions (IgG1σ, IgG2σ, IgG4 PAA) to human, mouse, and cynomolgus monkey Fcγ receptors. To control interactions between Fab and Fc domains, the test IgGs all have the same variable region sequences. We found distinct variations of interaction of human IgG subclasses to model animal Fcγ receptors in comparison to their human counterparts. Particularly, cynomolgus monkey Fcγ receptors showed consistently tighter binding to human IgGs than human Fcγ receptors. Moreover, the presumably Fc silent human IgG4 PAA framework bound to cynomolgus monkey FcγRI with nanomolar affinity while only very weak binding was observed for the human FcγRI. Our results highlighted the need for a thorough in vitro affinity characterization of candidate IgGs against model animal Fcγ receptors and careful design of preclinical studies. Copyright © 2018. Published by Elsevier B.V.

Rapid discovery of peptide capture candidates with demonstrated specificity for structurally similar toxins

NASA Astrophysics Data System (ADS)

Sarkes, Deborah A.; Hurley, Margaret M.; Coppock, Matthew B.; Farrell, Mikella E.; Pellegrino, Paul M.; Stratis-Cullum, Dimitra N.

2016-05-01

Peptides have emerged as viable alternatives to antibodies for molecular-based sensing due to their similarity in recognition ability despite their relative structural simplicity. Various methods for peptide capture reagent discovery exist, including phage display, yeast display, and bacterial display. One of the primary advantages of peptide discovery by bacterial display technology is the speed to candidate peptide capture agent, due to both rapid growth of bacteria and direct utilization of the sorted cells displaying each individual peptide for the subsequent round of biopanning. We have previously isolated peptide affinity reagents towards protective antigen of Bacillus anthracis using a commercially available automated magnetic sorting platform with improved enrichment as compared to manual magnetic sorting. In this work, we focus on adapting our automated biopanning method to a more challenging sort, to demonstrate the specificity possible with peptide capture agents. This was achieved using non-toxic, recombinant variants of ricin and abrin, RiVax and abrax, respectively, which are structurally similar Type II ribosomal inactivating proteins with significant sequence homology. After only two rounds of biopanning, enrichment of peptide capture candidates binding abrax but not RiVax was achieved as demonstrated by Fluorescence Activated Cell Sorting (FACS) studies. Further sorting optimization included negative sorting against RiVax, proper selection of autoMACS programs for specific sorting rounds, and using freshly made buffer and freshly thawed protein target for each round of biopanning for continued enrichment over all four rounds. Most of the resulting candidates from biopanning for abrax binding peptides were able to bind abrax but not RiVax, demonstrating that short peptide sequences can be highly specific even at this early discovery stage.

GH10 XynA is the main xylanase identified in the crude enzymatic extract of Paenibacillus sp. A59 when grown on xylan or lignocellulosic biomass.

PubMed

Ghio, Silvina; Insani, Ester M; Piccinni, Florencia E; Talia, Paola M; Grasso, Daniel H; Campos, Eleonora

2016-01-01

A novel bacterial isolate with polysaccharides degrading activity was identified as Paenibacillus sp., and named Paenibacillus sp. A59. Even though it is a strict mesophile, optimal xylanase activity of the crude enzymatic extract was achieved between 50°C and 70°C and more than 60% of the activity was retained after incubation for 48h at 50°C, indicating thermotolerance of the enzymes involved. The extract was also active on pre-treated sugarcane residue (SCR) and wheat straw, releasing xylobiose and xylose as the main products, therefore confirming its predominantly xylanolytic activity. By zymograms and mass spectrometry of crude enzymatic extracts of xylan or SCR cultures, a 32kDa GH10 beta- 1,4- endoxylanase with xylanase and no CMCase activity was identified. We named this enzyme XynA and it was the only xylanase identified under both conditions assayed, suggesting that it is a good candidate for recombinant expression and evaluation in hemicelluloses deconstruction applications. Also, a protein with two S-layer homology domains (SLH) and a large uncharacterized C-terminal domain as well as an ABC substrate binding protein were identified in crude extracts of SCR cultures. We propose that Paenibacillus sp. A59 uses a system similar to anaerobic and other Gram positive bacteria, with SLH-domain proteins anchoring polysaccharide-degrading enzymes close to the membrane and the substrate binding protein assisting translocation of simple sugars to the cell interior. Copyright © 2016 Elsevier GmbH. All rights reserved.

Thermodynamically accessible titanium clusters TiN, N = 2-32.

PubMed

Lazauskas, Tomas; Sokol, Alexey A; Buckeridge, John; Catlow, C Richard A; Escher, Susanne G E T; Farrow, Matthew R; Mora-Fonz, David; Blum, Volker W; Phaahla, Tshegofatso M; Chauke, Hasani R; Ngoepe, Phuti E; Woodley, Scott M

2018-05-10

We have performed a genetic algorithm search on the tight-binding interatomic potential energy surface (PES) for small TiN (N = 2-32) clusters. The low energy candidate clusters were further refined using density functional theory (DFT) calculations with the PBEsol exchange-correlation functional and evaluated with the PBEsol0 hybrid functional. The resulting clusters were analysed in terms of their structural features, growth mechanism and surface area. The results suggest a growth mechanism that is based on forming coordination centres by interpenetrating icosahedra, icositetrahedra and Frank-Kasper polyhedra. We identify centres of coordination, which act as centres of bulk nucleation in medium sized clusters and determine the morphological features of the cluster.

Pilot study on the use of data mining to identify cochlear implant candidates.

PubMed

Grisel, Jedidiah J; Schafer, Erin; Lam, Anne; Griffin, Terry

2018-05-01

The goal of this pilot study was to determine the clinical utility of data-mining software that screens for cochlear implant (CI) candidacy. The Auditory Implant Initiative developed a software module that screens for CI candidates via integration with a software system (Noah 4) that serves as a depository for hearing test data. To identify candidates, patient audiograms from one practice were exported into the screening module. Candidates were tracked to determine if any eventually underwent implantation. After loading 4836 audiograms from the Noah 4 system, the screening module identified 558 potential CI candidates. After reviewing the data for the potential candidates, 117 were targeted and invited to an educational event. Following the event, a total of six candidates were evaluated, and two were implanted. This objective approach to identifying candidates has the potential to address the gross underutilization of CIs by removing any bias or lack of knowledge regarding the management of severe to profound sensorineural hearing loss with CIs. The screening module was an effective tool for identifying potential CI candidates at one ENT practice. On a larger scale, the screening module has the potential to impact thousands of CI candidates worldwide.

The evolutionary duplication and probable demise of an endodermal GATA factor in Caenorhabditis elegans.

PubMed

Fukushige, Tetsunari; Goszczynski, Barbara; Tian, Helen; McGhee, James D

2003-10-01

We describe the elt-4 gene from the nematode Caenorhabditis elegans. elt-4 is predicted to encode a very small (72 residues, 8.1 kD) GATA-type zinc finger transcription factor. The elt-4 gene is located approximately 5 kb upstream of the C. elegans elt-2 gene, which also encodes a GATA-type transcription factor; the zinc finger DNA-binding domains are highly conserved (24/25 residues) between the two proteins. The elt-2 gene is expressed only in the intestine and is essential for normal intestinal development. This article explores whether elt-4 also has a role in intestinal development. Reporter fusions to the elt-4 promoter or reporter insertions into the elt-4 coding regions show that elt-4 is indeed expressed in the intestine, beginning at the 1.5-fold stage of embryogenesis and continuing into adulthood. elt-4 reporter fusions are also expressed in nine cells of the posterior pharynx. Ectopic expression of elt-4 cDNA within the embryo does not cause detectable ectopic expression of biochemical markers of gut differentiation; furthermore, ectopic elt-4 expression neither inhibits nor enhances the ectopic marker expression caused by ectopic elt-2 expression. A deletion allele of elt-4 was isolated but no obvious phenotype could be detected, either in the gut or elsewhere; brood sizes, hatching efficiencies, and growth rates were indistinguishable from wild type. We found no evidence that elt-4 provided backup functions for elt-2. We used microarray analysis to search for genes that might be differentially expressed between L1 larvae of the elt-4 deletion strain and wild-type worms. Paired hybridizations were repeated seven times, allowing us to conclude, with some confidence, that no candidate target transcript could be identified as significantly up- or downregulated by loss of elt-4 function. In vitro binding experiments could not detect specific binding of ELT-4 protein to candidate binding sites (double-stranded oligonucleotides containing single or multiple WGATAR sequences); ELT-4 protein neither enhanced nor inhibited the strong sequence-specific binding of the ELT-2 protein. Whereas ELT-2 protein is a strong transcriptional activator in yeast, ELT-4 protein has no such activity under similar conditions, nor does it influence the transcriptional activity of coexpressed ELT-2 protein. Although an elt-2 homolog was easily identified in the genomic sequence of the related nematode C. briggsae, no elt-4 homolog could be identified. Analysis of the changes in silent third codon positions within the DNA-binding domains indicates that elt-4 arose as a duplication of elt-2, some 25-55 MYA. Thus, elt-4 has survived far longer than the average duplicated gene in C. elegans, even though no obvious biological function could be detected. elt-4 provides an interesting example of a tandemly duplicated gene that may originally have been the same size as elt-2 but has gradually been whittled down to its present size of little more than a zinc finger. Although elt-4 must confer (or must have conferred) some selective advantage to C. elegans, we suggest that its ultimate evolutionary fate will be disappearance from the C. elegans genome.

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

Examining the neural correlates of active and passive forms of verbal-spatial binding in working memory.

PubMed

Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David

2018-05-23

We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.

Finding the sweet spots of inhibition: understanding the targets of a functional antibody against Plasmodium vivax Duffy binding protein.

PubMed

Ntumngia, Francis B; King, Christopher L; Adams, John H

2012-11-01

Plasmodium vivax Duffy binding protein region II (DBPII) is an essential ligand for reticulocyte invasion, thereby making this molecule an attractive vaccine candidate against asexual blood-stage P. vivax. Similar to other Plasmodium blood-stage vaccine candidates, strain-specific immunity due to DBPII allelic variation may complicate vaccine efficacy. Targeting immune responses to more conserved epitopes that are potential targets of strain-transcending neutralising immunity is necessary to avoid induction of strain-specific responses to dominant variant epitopes. In this article, we focus on different approaches to optimise the design of DBP immunogenicity to target conserved epitopes, which is important for developing a broadly effective vaccine against P. vivax. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathiyamoorthy, Karthik; Jiang, Jiansen; Mohl, Britta S.

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. Furthermore, these data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathiyamoorthy, Karthik; Jiang, Jiansen; Möhl, Britta S.

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. These data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

Inhibition of EBV-mediated membrane fusion by anti-gHgL antibodies

DOE PAGES

Sathiyamoorthy, Karthik; Jiang, Jiansen; Mohl, Britta S.; ...

2017-09-22

Herpesvirus entry into cells requires the coordinated action of multiple virus envelope glycoproteins, including gH, gL, and gB. For EBV, the gp42 protein assembles into complexes with gHgL heterodimers and binds HLA class II to activate gB-mediated membrane fusion with B cells. EBV tropism is dictated by gp42 levels in the virion, as it inhibits entry into epithelial cells while promoting entry into B cells. The gHgL and gB proteins are targets of neutralizing antibodies and potential candidates for subunit vaccine development, but our understanding of their neutralizing epitopes and the mechanisms of inhibition remain relatively unexplored. Here we studiedmore » the structures and mechanisms of two anti-gHgL antibodies, CL40 and CL59, that block membrane fusion with both B cells and epithelial cells. We determined the structures of the CL40 and CL59 complexes with gHgL using X-ray crystallography and EM to identify their epitope locations. CL59 binds to the C-terminal domain IV of gH, while CL40 binds to a site occupied by the gp42 receptor binding domain. CL40 binding to gHgL/gp42 complexes is not blocked by gp42 and does not interfere with gp42 binding to HLA class II, indicating that its ability to block membrane fusion with B cells represents a defect in gB activation. Furthermore, these data indicate that anti-gHgL neutralizing antibodies can block gHgL-mediated activation of gB through different surface epitopes and mechanisms.« less

Cross-talk between the ligand- and DNA-binding domains of estrogen receptor.

PubMed

Huang, Wei; Greene, Geoffrey L; Ravikumar, Krishnakumar M; Yang, Sichun

2013-11-01

Estrogen receptor alpha (ERα) is a hormone-responsive transcription factor that contains several discrete functional domains, including a ligand-binding domain (LBD) and a DNA-binding domain (DBD). Despite a wealth of knowledge about the behaviors of individual domains, the molecular mechanisms of cross-talk between LBD and DBD during signal transduction from hormone to DNA-binding of ERα remain elusive. Here, we apply a multiscale approach combining coarse-grained (CG) and atomistically detailed simulations to characterize this cross-talk mechanism via an investigation of the ERα conformational landscape. First, a CG model of ERα is built based on crystal structures of individual LBDs and DBDs, with more emphasis on their interdomain interactions. Second, molecular dynamics simulations are implemented and enhanced sampling is achieved via the "push-pull-release" strategy in the search for different LBD-DBD orientations. Third, multiple energetically stable ERα conformations are identified on the landscape. A key finding is that estradiol-bound LBDs utilize the well-described activation helix H12 to pack and stabilize LBD-DBD interactions. Our results suggest that the estradiol-bound LBDs can serve as a scaffold to position and stabilize the DBD-DNA complex, consistent with experimental observations of enhanced DNA binding with the LBD. Final assessment using atomic-level simulations shows that these CG-predicted models are significantly stable within a 15-ns simulation window and that specific pairs of lysine residues in close proximity at the domain interfaces could serve as candidate sites for chemical cross-linking studies. Together, these simulation results provide a molecular view of the role of ERα domain interactions in response to hormone binding. Copyright © 2013 Wiley Periodicals, Inc.

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean.

PubMed

Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza

2015-01-01

Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.

Candidate Gene Identification with SNP Marker-Based Fine Mapping of Anthracnose Resistance Gene Co-4 in Common Bean

PubMed Central

Burt, Andrew J.; William, H. Manilal; Perry, Gregory; Khanal, Raja; Pauls, K. Peter; Kelly, James D.; Navabi, Alireza

2015-01-01

Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co–4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co–4 is localized. Three SCAR markers with known linkage to Co–4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK–4 loci found in previous studies. It is possible that the Co–4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases. PMID:26431031

Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

PubMed Central

Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

2015-01-01

Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

Use of Chimeras, Point Mutants, and Molecular Modeling to Map the Antagonist-binding Site of 4,4′,4″,4‴-(Carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic Acid (NF449) at P2X1 Receptors for ATP*

PubMed Central

Farmer, Louise K.; Schmid, Ralf; Evans, Richard J.

2015-01-01

P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. PMID:25425641

Use of chimeras, point mutants, and molecular modeling to map the antagonist-binding site of 4,4',4″,4‴-(carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic acid (NF449) at P2X1 receptors for ATP.

PubMed

Farmer, Louise K; Schmid, Ralf; Evans, Richard J

2015-01-16

P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Proteome-wide inference of human endophilin 1-binding peptides.

PubMed

Wu, Gang; Zhang, Zeng-Li; Fu, Chun-Jiang; Lv, Feng-Lin; Tian, Fei-Fei

2012-10-01

Human endophilin 1 (hEndo1) is a multifunctional protein that was found to bind a wide spectrum of prolinerich endocytic proteins through its Src homology 3 (SH3) domain. In order to elucidate the unknown biological functions of hEndo1, it is essential to find out the cytoplasmic components that hEndo1 recognizes and binds. However, it is too time-consuming and expensive to synthesize all peptide candidates found in the human proteome and to perform hEndo1 SH3-peptide affinity assay to identify the hEndo1-binding partners. In the present work, we describe a structure/ sequence-hybrid approach to perform proteome-wide inference of human hEndo1-binding peptides using the information gained from both the primary sequence of affinity-known peptides and the interaction profile involved in hEndo1 SH3-peptide complex three-dimensional structures. Modeling results show that (i) different residue positions contribute distinctly to peptide affinity and specificity; P-1, P2 and P4 are most important, P1 and P3 are also effective, and P-3, P-2, P0, P5 and P6 are relatively insignificant, (ii) the consensus core PXXP motif is necessary but not sufficient for determining high affinity of peptides, and some other positions must be also essential in the hEndo1 SH3-peptide binding, and (iii) the alternating arrangement of polar and nonpolar amino acids along peptide sequence is critical for the high specificity of peptide recognition by hEndo1 SH3 domain. In addition, we also find that the residue type at a specific position of hEndo1-binding peptides is not stringently invariable; amino acids that possess similar polarity could replace each other without substantial influence on peptide affinity. In this way, hEndo1 presents a broad specificity in the peptide ligands that it binds.

De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

PubMed Central

Liu, Chuan-He; Fan, Chao

2016-01-01

A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene expression profiling results. Ethephon-mediated induction likely mimics the process of vernalization in the floral transition in pineapple by increasing LTI, FT, and VRN1 expression and promoting the up-regulation of floral meristem identity genes involved in flower development. The candidate genes screened can be used in investigations of the molecular mechanisms of the flowering pathway and of various other biological mechanisms in pineapple. PMID:26955375

Schistosoma mansoni venom allergen-like protein 4 (SmVAL4) is a novel lipid-binding SCP/TAPS protein that lacks the prototypical CAP motifs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelleher, Alan; Darwiche, Rabih; Rezende, Wanderson C.

2014-08-01

The first structure of an S. mansoni venom allergen-like protein is presented. Schistosomiasis is a parasitic disease that affects over 200 million people. Vaccine candidates have been identified, including Schistosoma mansoni venom allergen-like proteins (SmVALs) from the SCP/TAPS (sperm-coating protein/Tpx/antigen 5/pathogenesis related-1/Sc7) superfamily. The first SmVAL structure, SmVAL4, was refined to a resolution limit of 2.16 Å. SmVAL4 has a unique structure that could not be predicted from homologous structures, with longer loops and an unusual C-terminal extension. SmVAL4 has the characteristic α/β-sandwich and central SCP/TAPS cavity. Furthermore, SmVAL4 has only one of the signature CAP cavity tetrad amino-acid residuesmore » and is missing the histidines that coordinate divalent cations such as Zn{sup 2+} in other SCP/TAPS proteins. SmVAL4 has a cavity between α-helices 1 and 4 that was observed to bind lipids in tablysin-15, suggesting the ability to bind lipids. Subsequently, SmVAL4 was shown to bind cholesterol in vitro. Additionally, SmVAL4 was shown to complement the in vivo sterol-export phenotype of yeast mutants lacking their endogenous CAP proteins. Expression of SmVAL4 in yeast cells lacking endogenous CAP function restores the block in sterol export. These studies suggest an evolutionarily conserved lipid-binding function shared by CAP proteins such as SmVAL4 and yeast CAP proteins such as Pry1.« less

Allosteric regulation of focal adhesion kinase by PIP₂ and ATP.

PubMed

Zhou, Jing; Bronowska, Agnieszka; Le Coq, Johanne; Lietha, Daniel; Gräter, Frauke

2015-02-03

Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase that regulates cell signaling, proliferation, migration, and development. A major mechanism of regulation of FAK activity is an intramolecular autoinhibitory interaction between two of its domains--the catalytic and FERM domains. Upon cell adhesion to the extracellular matrix, FAK is being translocated toward focal adhesion sites and activated. Interactions of FAK with phosphoinositide phosphatidylinsositol-4,5-bis-phosphate (PIP₂) are required to activate FAK. However, the molecular mechanism of the activation remains poorly understood. Recent fluorescence resonance energy transfer experiments revealed a closure of the FERM-kinase interface upon ATP binding, which is reversed upon additional binding of PIP₂. Here, we addressed the allosteric regulation of FAK by performing all-atom molecular-dynamics simulations of a FAK fragment containing the catalytic and FERM domains, and comparing the dynamics in the absence or presence of ATP and PIP₂. As a major conformational change, we observe a closing and opening motion upon ATP and additional PIP₂ binding, respectively, in good agreement with the fluorescence resonance energy transfer experiments. To reveal how the binding of the regulatory PIP₂ to the FERM F2 lobe is transduced to the very distant F1/N-lobe interface, we employed force distribution analysis. We identified a network of mainly charged residue-residue interactions spanning from the PIP₂ binding site to the distant interface between the kinase and FERM domains, comprising candidate residues for mutagenesis to validate the predicted mechanism of FAK activation. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

LINKIN, a new transmembrane protein necessary for cell adhesion

PubMed Central

Kato, Mihoko; Chou, Tsui-Fen; Yu, Collin Z; DeModena, John; Sternberg, Paul W

2014-01-01

In epithelial collective migration, leader and follower cells migrate while maintaining cell–cell adhesion and tissue polarity. We have identified a conserved protein and interactors required for maintaining cell adhesion during a simple collective migration in the developing C. elegans male gonad. LINKIN is a previously uncharacterized, transmembrane protein conserved throughout Metazoa. We identified seven atypical FG–GAP domains in the extracellular domain, which potentially folds into a β-propeller structure resembling the α-integrin ligand-binding domain. C. elegans LNKN-1 localizes to the plasma membrane of all gonadal cells, with apical and lateral bias. We identified the LINKIN interactors RUVBL1, RUVBL2, and α-tubulin by using SILAC mass spectrometry on human HEK 293T cells and testing candidates for lnkn-1-like function in C. elegans male gonad. We propose that LINKIN promotes adhesion between neighboring cells through its extracellular domain and regulates microtubule dynamics through RUVBL proteins at its intracellular domain. DOI: http://dx.doi.org/10.7554/eLife.04449.001 PMID:25437307

Identification and characterization of a type III secretion-associated chaperone in the type III secretion system 1 of Vibrio parahaemolyticus.

PubMed

Akeda, Yukihiro; Okayama, Kanna; Kimura, Tomomi; Dryselius, Rikard; Kodama, Toshio; Oishi, Kazunori; Iida, Tetsuya; Honda, Takeshi

2009-07-01

Vibrio parahaemolyticus causes human gastroenteritis. Genomic sequencing of this organism has revealed that it has two sets of type III secretion systems, T3SS1 and T3SS2, both of which are important for its pathogenicity. However, the mechanism of protein secretion via T3SSs is unknown. A characteristic of many effectors is that they require specific chaperones for efficient delivery via T3SSs; however, no chaperone has been experimentally identified in the T3SSs of V. parahaemolyticus. In this study, we identified candidate T3SS1-associated chaperones from genomic sequence data and examined their roles in effector secretion/translocation and binding to their cognate substrates. From these experiments, we concluded that there is a T3S-associated chaperone, VecA, for a cytotoxic T3SS1-dependent effector, VepA. Further analysis using pulldown and secretion assays characterized the chaperone-binding domain encompassing the first 30-100 amino acids and an amino terminal secretion signal encompassing the first 5-20 amino acids on VepA. These findings will provide a strategy to clarify how the T3SS1 of V. parahaemolyticus secretes its specific effectors.

Mimotopes identify conformational epitopes on parvalbumin, the major fish allergen.

PubMed

Untersmayr, Eva; Szalai, Krisztina; Riemer, Angelika B; Hemmer, Wolfgang; Swoboda, Ines; Hantusch, Brigitte; Schöll, Isabella; Spitzauer, Susanne; Scheiner, Otto; Jarisch, Reinhart; Boltz-Nitulescu, George; Jensen-Jarolim, Erika

2006-03-01

Parvalbumin, the major fish allergen, is recognized by allergen-specific IgE of more than 90% of all fish-allergic patients. A detailed knowledge of allergenic structures is crucial for developing a vaccine inducing blocking antibodies specifically directed towards the IgE binding epitopes. In the present study we aimed to use the phage display technique to generate mimotopes, which mimic epitopes on parvalbumin. Parvalbumin-specific IgE was purified from sera of fish-allergic patients and used for screening of a constrained decamer phage library. After four rounds of biopanning using parvalbumin-specific IgE, five phage clones were selected which were specifically recognized by parvalbumin-specific IgE as well as IgG. DNA sequencing and peptide alignment revealed a high degree of sequence similarities between the mimotopes. Interestingly, on the surface of natural parvalbumin three regions could be defined by computational mimotope matching. In accordance, previously defined allergenic peptides of cod parvalbumin highlighted areas in close proximity or overlapping with the mimotope matching sites. From the presented data we conclude that our approach identified conformational epitopes of parvalbumin relevant for IgE and IgG binding. We suggest that these mimotopes are suitable candidates for an epitope-specific immunotherapy of fish-allergic patients.

Cyclosporin A and its analogs inhibit hepatitis B virus entry into cultured hepatocytes through targeting a membrane transporter, sodium taurocholate cotransporting polypeptide (NTCP)

PubMed Central

Watashi, Koichi; Sluder, Ann; Daito, Takuji; Matsunaga, Satoko; Ryo, Akihide; Nagamori, Shushi; Iwamoto, Masashi; Nakajima, Syo; Tsukuda, Senko; Borroto-Esoda, Katyna; Sugiyama, Masaya; Tanaka, Yasuhito; Kanai, Yoshikatsu; Kusuhara, Hiroyuki; Mizokami, Masashi; Wakita, Takaji

2014-01-01

Chronic hepatitis B virus (HBV) infection is a major public health problem worldwide. Although nucleos(t)ide analogs inhibiting viral reverse transcriptase are clinically available as anti-HBV agents, emergence of drug-resistant viruses highlights the need for new anti-HBV agents interfering with other targets. Here we report that cyclosporin A (CsA) can inhibit HBV entry into cultured hepatocytes. The anti-HBV effect of CsA was independent of binding to cyclophilin and calcineurin. Rather, blockade of HBV infection correlated with the ability to inhibit the transporter activity of sodium taurocholate cotransporting polypeptide (NTCP). We also found that HBV infection-susceptible cells, differentiated HepaRG cells and primary human hepatocytes expressed NTCP, while nonsusceptible cell lines did not. A series of compounds targeting NTCP could inhibit HBV infection. CsA inhibited the binding between NTCP and large envelope protein in vitro. Evaluation of CsA analogs identified a compound with higher anti-HBV potency, having a median inhibitory concentration <0.2 μM. Conclusion: This study provides a proof of concept for the novel strategy to identify anti-HBV agents by targeting the candidate HBV receptor, NTCP, using CsA as a structural platform. (Hepatology 2014;59:1726–1737) PMID:24375637

Plasminogen binding inhibitors demonstrate unwanted activities on GABAA and glycine receptors in human iPSC derived neurons.

PubMed

Kristensson, Lisbeth; Lundin, Anders; Gustafsson, David; Fryklund, Jan; Fex, Tomas; Louise, Delsing; Ryberg, Erik

2018-05-11

Plasminogen binding inhibitors (PBIs) reduce the risk of bleeding in hemorrhagic conditions. However, generic PBIs are also associated with an increased risk of seizures, an adverse effect linked to unwanted activities towards inhibitory neuronal receptors. Development of novel PBIs serve to remove compounds with such properties, but progress is limited by a lack of higher throughput methods with human translatability. Herein we apply human induced pluripotent stem cell (hiPSC) derived neurons in combination with dynamic mass redistribution (DMR) technology to demonstrate robust and reproducible modulation of both GABA A and glycine receptors. These cells respond to GABA (EC 50 0.33 ± 0.18 μM), glycine (EC 50 11.0 ± 3.7 μM) and additional ligands in line with previous reports from patch clamp technologies. Additionally, we identify and characterize a competitive antagonistic behavior of the prototype inhibitor and drug tranexamic acid (TXA). Finally, we demonstrate proof of concept for effective counter-screening of lead series compounds towards unwanted GABA A receptor activities. No activity was observed for a previously identified PBI candidate drug, AZD6564, whereas a discontinued analog, AZ13267257, could be characterized as a potent GABA A receptor agonist. Copyright © 2018. Published by Elsevier B.V.

Intracellular targeting of annexin A2 inhibits tumor cell adhesion, migration, and in vivo grafting.

PubMed

Staquicini, Daniela I; Rangel, Roberto; Guzman-Rojas, Liliana; Staquicini, Fernanda I; Dobroff, Andrey S; Tarleton, Christy A; Ozbun, Michelle A; Kolonin, Mikhail G; Gelovani, Juri G; Marchiò, Serena; Sidman, Richard L; Hajjar, Katherine A; Arap, Wadih; Pasqualini, Renata

2017-06-26

Cytoskeletal-associated proteins play an active role in coordinating the adhesion and migration machinery in cancer progression. To identify functional protein networks and potential inhibitors, we screened an internalizing phage (iPhage) display library in tumor cells, and selected LGRFYAASG as a cytosol-targeting peptide. By affinity purification and mass spectrometry, intracellular annexin A2 was identified as the corresponding binding protein. Consistently, annexin A2 and a cell-internalizing, penetratin-fused version of the selected peptide (LGRFYAASG-pen) co-localized and specifically accumulated in the cytoplasm at the cell edges and cell-cell contacts. Functionally, tumor cells incubated with LGRFYAASG-pen showed disruption of filamentous actin, focal adhesions and caveolae-mediated membrane trafficking, resulting in impaired cell adhesion and migration in vitro. These effects were paralleled by a decrease in the phosphorylation of both focal adhesion kinase (Fak) and protein kinase B (Akt). Likewise, tumor cells pretreated with LGRFYAASG-pen exhibited an impaired capacity to colonize the lungs in vivo in several mouse models. Together, our findings demonstrate an unrecognized functional link between intracellular annexin A2 and tumor cell adhesion, migration and in vivo grafting. Moreover, this work uncovers a new peptide motif that binds to and inhibits intracellular annexin A2 as a candidate therapeutic lead for potential translation into clinical applications.

Garcinol from Garcinia indica Downregulates Cancer Stem-like Cell Biomarker ALDH1A1 in Nonsmall Cell Lung Cancer A549 Cells through DDIT3 Activation.

PubMed

Wang, Jinhan; Wang, Liwen; Ho, Chi-Tang; Zhang, Kunsheng; Liu, Qiang; Zhao, Hui

2017-05-10

Nonsmall cell lung cancer (NSCLC) is the predominant type of lung cancer. Patients with NSCLC show high mortality rates because of failure to clean up cancer stem cells (CSCs). The anticancer activity of phytochemical garcinol has been identified in various cancer cell models. However, the effect of garcinol on NSCLC cell lines is still lacking. Of the NSCLC cell lines we tested, A549 cells were the most sensitive to garcinol. Interestingly, Aldehyde Dehydrogenase 1 Family Member A1 (ALDH1A1) was preferentially expressed in A549 cells and downregulated by the addition of garcinol. We also found that garcinol enriched DNA damage-inducible transcript 3 (DDIT3) and then altered DDIT3-CCAAT-enhancer-binding proteins beta (C/EBPβ) interaction resulting in a decreased binding of C/EBPβ to the endogenous ALDH1A1 promoter. Furthermore, garcinol's inhibition of ALDH1A1 was identified in a xenograft mice model. Garcinol repressed ALDH1A1 transcription in A549 cells through alterations in the interaction between DDIT3 and C/EBPβ. Garcinol could be a potential dietary phytochemical candidate for NSCLCs patients whose tumors harbored high ALDH1A1 expression.

Analysis of the saliva proteome from patients with head and neck squamous cell carcinoma reveals differences in abundance levels of proteins associated with tumour progression and metastasis.

PubMed

Dowling, Paul; Wormald, Robert; Meleady, Paula; Henry, Michael; Curran, Aongus; Clynes, Martin

2008-07-21

The objective of this study was to identify differentially expressed proteins in saliva from HNSCC patients compared to a control group. Saliva samples from eight individuals with non-malignant conditions of the head and neck region were employed as a control group and compared to saliva from eight patients with HNSCC using 2D DIGE analysis and subsequent mass spectrometry identification of candidate proteins. Beta fibrin (+2.77-fold), S100 calcium binding protein (+5.35-fold), transferrin (+3.37-fold), immunoglobulin heavy chain constant region gamma (+3.28) and cofilin-1 (+6.42) were all found to be significantly increased in the saliva from HNSCC samples compared to the control group whereas transthyretin (-2.92-fold) was significantly decreased. The increased abundance of one of the proteins identified (S100 calcium binding protein) was confirmed by immunoblot analysis. Many of these proteins are involved in tumour progression, metastasis and angiogenesis. The proximity of saliva to the developing tumour is undoubtedly a major factor in facilitating detection of these proteins and such a strategy may lead to the development of a panel of biomarkers useful for therapeutic monitoring and for early detection of HNSCC.

Identification of candidate diagnostic serum biomarkers for Kawasaki disease using proteomic analysis

PubMed Central

Kimura, Yayoi; Yanagimachi, Masakatsu; Ino, Yoko; Aketagawa, Mao; Matsuo, Michie; Okayama, Akiko; Shimizu, Hiroyuki; Oba, Kunihiro; Morioka, Ichiro; Imagawa, Tomoyuki; Kaneko, Tetsuji; Yokota, Shumpei; Hirano, Hisashi; Mori, Masaaki

2017-01-01

Kawasaki disease (KD) is a systemic vasculitis and childhood febrile disease that can lead to cardiovascular complications. The diagnosis of KD depends on its clinical features, and thus it is sometimes difficult to make a definitive diagnosis. In order to identify diagnostic serum biomarkers for KD, we explored serum KD-related proteins, which differentially expressed during the acute and recovery phases of two patients by mass spectrometry (MS). We identified a total of 1,879 proteins by MS-based proteomic analysis. The levels of three of these proteins, namely lipopolysaccharide-binding protein (LBP), leucine-rich alpha-2-glycoprotein (LRG1), and angiotensinogen (AGT), were higher in acute phase patients. In contrast, the level of retinol-binding protein 4 (RBP4) was decreased. To confirm the usefulness of these proteins as biomarkers, we analyzed a total of 270 samples, including those collected from 55 patients with acute phase KD, by using western blot analysis and microarray enzyme-linked immunosorbent assays (ELISAs). Over the course of this experiment, we determined that the expression level of these proteins changes specifically in the acute phase of KD, rather than the recovery phase of KD or other febrile illness. Thus, LRG1 could be used as biomarkers to facilitate KD diagnosis based on clinical features. PMID:28262744

regSNPs: a strategy for prioritizing regulatory single nucleotide substitutions

PubMed Central

Teng, Mingxiang; Ichikawa, Shoji; Padgett, Leah R.; Wang, Yadong; Mort, Matthew; Cooper, David N.; Koller, Daniel L.; Foroud, Tatiana; Edenberg, Howard J.; Econs, Michael J.; Liu, Yunlong

2012-01-01

Motivation: One of the fundamental questions in genetics study is to identify functional DNA variants that are responsible to a disease or phenotype of interest. Results from large-scale genetics studies, such as genome-wide association studies (GWAS), and the availability of high-throughput sequencing technologies provide opportunities in identifying causal variants. Despite the technical advances, informatics methodologies need to be developed to prioritize thousands of variants for potential causative effects. Results: We present regSNPs, an informatics strategy that integrates several established bioinformatics tools, for prioritizing regulatory SNPs, i.e. the SNPs in the promoter regions that potentially affect phenotype through changing transcription of downstream genes. Comparing to existing tools, regSNPs has two distinct features. It considers degenerative features of binding motifs by calculating the differences on the binding affinity caused by the candidate variants and integrates potential phenotypic effects of various transcription factors. When tested by using the disease-causing variants documented in the Human Gene Mutation Database, regSNPs showed mixed performance on various diseases. regSNPs predicted three SNPs that can potentially affect bone density in a region detected in an earlier linkage study. Potential effects of one of the variants were validated using luciferase reporter assay. Contact: yunliu@iupui.edu Supplementary information: Supplementary data are available at Bioinformatics online PMID:22611130

Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

PubMed

Han, Xinxin; Yin, Linlin; Xue, Hongwei

2012-07-01

Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

Genome-Wide Prediction and Validation of Peptides That Bind Human Prosurvival Bcl-2 Proteins

PubMed Central

DeBartolo, Joe; Taipale, Mikko; Keating, Amy E.

2014-01-01

Programmed cell death is regulated by interactions between pro-apoptotic and prosurvival members of the Bcl-2 family. Pro-apoptotic family members contain a weakly conserved BH3 motif that can adopt an alpha-helical structure and bind to a groove on prosurvival partners Bcl-xL, Bcl-w, Bcl-2, Mcl-1 and Bfl-1. Peptides corresponding to roughly 13 reported BH3 motifs have been verified to bind in this manner. Due to their short lengths and low sequence conservation, BH3 motifs are not detected using standard sequence-based bioinformatics approaches. Thus, it is possible that many additional proteins harbor BH3-like sequences that can mediate interactions with the Bcl-2 family. In this work, we used structure-based and data-based Bcl-2 interaction models to find new BH3-like peptides in the human proteome. We used peptide SPOT arrays to test candidate peptides for interaction with one or more of the prosurvival proteins Bcl-xL, Bcl-w, Bcl-2, Mcl-1 and Bfl-1. For the 36 most promising array candidates, we quantified binding to all five human receptors using direct and competition binding assays in solution. All 36 peptides showed evidence of interaction with at least one prosurvival protein, and 22 peptides bound at least one prosurvival protein with a dissociation constant between 1 and 500 nM; many peptides had specificity profiles not previously observed. We also screened the full-length parent proteins of a subset of array-tested peptides for binding to Bcl-xL and Mcl-1. Finally, we used the peptide binding data, in conjunction with previously reported interactions, to assess the affinity and specificity prediction performance of different models. PMID:24967846

Common variants at the CHEK2 gene locus and risk of epithelial ovarian cancer

PubMed Central

Lawrenson, Kate; Iversen, Edwin S.; Tyrer, Jonathan; Weber, Rachel Palmieri; Concannon, Patrick; Hazelett, Dennis J.; Li, Qiyuan; Marks, Jeffrey R.; Berchuck, Andrew; Lee, Janet M.; Aben, Katja K.H.; Anton-Culver, Hoda; Antonenkova, Natalia; Bandera, Elisa V.; Bean, Yukie; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Chen, Ann; Chen, Zhihua; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Plisiecka-Halasa, Joanna; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; du Bois, Andreas; Eccles, Diana; Easton, Douglas T.; Edwards, Robert P.; Eilber, Ursula; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goode, Ellen L.; Goodman, Marc T.; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Jakubowska, Anna; Paul, James; Jensen, Allan; Karlan, Beth Y.; Kjaer, Susanne Kruger; Kelemen, Linda E.; Kellar, Melissa; Kelley, Joseph L.; Kiemeney, Lambertus A.; Krakstad, Camilla; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Cannioto, Rikki; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; Nevanlinna, Heli; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B.; Narod, Steven A.; Nedergaard, Lotte; Ness, Roberta B.; Noor Azmi, Mat Adenan; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Permuth-Wey, Jennifer; Phelan, Catherine M.; Pike, Malcolm C.; Poole, Elizabeth M.; Ramus, Susan J.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Budzilowska, Agnieszka; Sellers, Thomas A.; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Sucheston, Lara; Tangen, Ingvild L.; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Timorek, Agnieszka; Tworoger, Shelley S.; Nieuwenhuysen, Els Van; Vergote, Ignace; Vierkant, Robert A.; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H.; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Coetzee, Gerhard A.; Freedman, Matthew L.; Monteiro, Alvaro N.A.; Moes-Sosnowska, Joanna; Kupryjanczyk, Jolanta; Pharoah, Paul D.; Gayther, Simon A.; Schildkraut, Joellen M.

2015-01-01

Genome-wide association studies have identified 20 genomic regions associated with risk of epithelial ovarian cancer (EOC), but many additional risk variants may exist. Here, we evaluated associations between common genetic variants [single nucleotide polymorphisms (SNPs) and indels] in DNA repair genes and EOC risk. We genotyped 2896 common variants at 143 gene loci in DNA samples from 15 397 patients with invasive EOC and controls. We found evidence of associations with EOC risk for variants at FANCA, EXO1, E2F4, E2F2, CREB5 and CHEK2 genes (P ≤ 0.001). The strongest risk association was for CHEK2 SNP rs17507066 with serous EOC (P = 4.74 x 10–7). Additional genotyping and imputation of genotypes from the 1000 genomes project identified a slightly more significant association for CHEK2 SNP rs6005807 (r 2 with rs17507066 = 0.84, odds ratio (OR) 1.17, 95% CI 1.11–1.24, P = 1.1×10−7). We identified 293 variants in the region with likelihood ratios of less than 1:100 for representing the causal variant. Functional annotation identified 25 candidate SNPs that alter transcription factor binding sites within regulatory elements active in EOC precursor tissues. In The Cancer Genome Atlas dataset, CHEK2 gene expression was significantly higher in primary EOCs compared to normal fallopian tube tissues (P = 3.72×10−8). We also identified an association between genotypes of the candidate causal SNP rs12166475 (r 2 = 0.99 with rs6005807) and CHEK2 expression (P = 2.70×10-8). These data suggest that common variants at 22q12.1 are associated with risk of serous EOC and CHEK2 as a plausible target susceptibility gene. PMID:26424751

Chemical screening identifies filastatin, a small molecule inhibitor of Candida albicans adhesion, morphogenesis, and pathogenesis.

PubMed

Fazly, Ahmed; Jain, Charu; Dehner, Amie C; Issi, Luca; Lilly, Elizabeth A; Ali, Akbar; Cao, Hong; Fidel, Paul L; Rao, Reeta P; Kaufman, Paul D

2013-08-13

Infection by pathogenic fungi, such as Candida albicans, begins with adhesion to host cells or implanted medical devices followed by biofilm formation. By high-throughput phenotypic screening of small molecules, we identified compounds that inhibit adhesion of C. albicans to polystyrene. Our lead candidate compound also inhibits binding of C. albicans to cultured human epithelial cells, the yeast-to-hyphal morphological transition, induction of the hyphal-specific HWP1 promoter, biofilm formation on silicone elastomers, and pathogenesis in a nematode infection model as well as alters fungal morphology in a mouse mucosal infection assay. We term this compound filastatin based on its strong inhibition of filamentation, and we use chemical genetic experiments to show that it acts downstream of multiple signaling pathways. These studies show that high-throughput functional assays targeting fungal adhesion can provide chemical probes for study of multiple aspects of fungal pathogenesis.

Chemical screening identifies filastatin, a small molecule inhibitor of Candida albicans adhesion, morphogenesis, and pathogenesis

PubMed Central

Fazly, Ahmed; Jain, Charu; Dehner, Amie C.; Issi, Luca; Lilly, Elizabeth A.; Ali, Akbar; Cao, Hong; Fidel, Paul L.; P. Rao, Reeta; Kaufman, Paul D.

2013-01-01

Infection by pathogenic fungi, such as Candida albicans, begins with adhesion to host cells or implanted medical devices followed by biofilm formation. By high-throughput phenotypic screening of small molecules, we identified compounds that inhibit adhesion of C. albicans to polystyrene. Our lead candidate compound also inhibits binding of C. albicans to cultured human epithelial cells, the yeast-to-hyphal morphological transition, induction of the hyphal-specific HWP1 promoter, biofilm formation on silicone elastomers, and pathogenesis in a nematode infection model as well as alters fungal morphology in a mouse mucosal infection assay. We term this compound filastatin based on its strong inhibition of filamentation, and we use chemical genetic experiments to show that it acts downstream of multiple signaling pathways. These studies show that high-throughput functional assays targeting fungal adhesion can provide chemical probes for study of multiple aspects of fungal pathogenesis. PMID:23904484

Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease

PubMed Central

Beilina, Alexandria; Rudenko, Iakov N.; Kaganovich, Alice; Civiero, Laura; Chau, Hien; Kalia, Suneil K.; Kalia, Lorraine V.; Lobbestael, Evy; Chia, Ruth; Ndukwe, Kelechi; Ding, Jinhui; Nalls, Mike A.; Olszewski, Maciej; Hauser, David N.; Kumaran, Ravindran; Lozano, Andres M.; Baekelandt, Veerle; Greene, Lois E.; Taymans, Jean-Marc; Greggio, Elisa; Cookson, Mark R.; Nalls, Mike A.; Plagnol, Vincent; Martinez, Maria; Hernandez, Dena G; Sharma, Manu; Sheerin, Una-Marie; Saad, Mohamad; Simón-Sánchez, Javier; Schulte, Claudia; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Arepalli, Sampath; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M A; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M; Brockmann, Kathrin; Brooks, Janet; Burn, David J; Charlesworth, Gavin; Chen, Honglei; Chong, Sean; Clarke, Carl E; Cookson, Mark R; Cooper, J Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T; van Dijk, Karin D; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R; Foltynie, Thomas; Gao, Jianjun; Gardner, Michelle; Gibbs, J Raphael; Goate, Alison; Gray, Emma; Guerreiro, Rita; Gústafsson, Ómar; Harris, Clare; van Hilten, Jacobus J; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Huber, Heiko; Hudson, Gavin; Hunt, Sarah E; Huttenlocher, Johanna; Illig, Thomas; München, Helmholtz Zentrum; Jónsson, Pálmi V; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; München, Helmholtz Zentrum; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R; Morrison, Karen E; Mudanohwo, Ese; O’Sullivan, Sean S; Pearson, Justin; Perlmutter, Joel S; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C A; Stefánsson, Hreinn; Steinberg, Stacy; Stockton, Joanna D; Strange, Amy; Talbot, Kevin; Tanner, Carlie M; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J; Uitterlinden, André G; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Heutink, Peter; Brice, Alexis; Gasser, Thomas; Singleton, Andrew B; Wood, Nicholas W; Chinnery, Patrick F; Arepalli, Sampath; Cookson, Mark R; Dillman, Allissa; Ferrucci, Luigi; Gibbs, J Raphael; Hernandez, Dena G; Johnson, Robert; Longo, Dan L; Majounie, Elisa; Nalls, Michael A; O’Brien, Richard; Singleton, Andrew B; Traynor, Bryan J; Troncoso, Juan; van der Brug, Marcel; Zielke, H Ronald; Zonderman, Alan B

2014-01-01

Mutations in leucine-rich repeat kinase 2 (LRRK2) cause inherited Parkinson disease (PD), and common variants around LRRK2 are a risk factor for sporadic PD. Using protein–protein interaction arrays, we identified BCL2-associated athanogene 5, Rab7L1 (RAB7, member RAS oncogene family-like 1), and Cyclin-G–associated kinase as binding partners of LRRK2. The latter two genes are candidate genes for risk for sporadic PD identified by genome-wide association studies. These proteins form a complex that promotes clearance of Golgi-derived vesicles through the autophagy–lysosome system both in vitro and in vivo. We propose that three different genes for PD have a common biological function. More generally, data integration from multiple unbiased screens can provide insight into human disease mechanisms. PMID:24510904

Identification of immunodominant proteins from Mannheimia haemolytica and Histophilus somni by an immunoproteomic approach.

PubMed

Alvarez, Angel H; Gutiérrez-Ortega, Abel; Hernández-Gutiérrez, Rodolfo

2015-10-01

Mannheimia haemolytica and Histophilus somni are frequently isolated from diseased cattle with bovine respiratory disease (BRD). They compromise animal lung function and the immune responses generated are not sufficient to limit infection. Identification of specific immunogenic antigens for vaccine development represents a great challenge. Immunogenic proteins were identified by immunoproteomic approach with sera from cattle immunized with a commercial cellular vaccine of M. haemolytica and H. somni. Proteins of M. haemolytica were identified as solute ABC transporter, iron-binding protein, and hypothetical protein of capsular biosynthesis. Histophilus somni proteins correspond to porin, amino acid ABC transporter, hypothetical outer membrane protein, cysteine synthase, and outer membrane protein P6. Although these antigens share strong similarities with other proteins from animal pathogens, the ABC system proteins have been associated with virulence and these proteins could be considered as potential vaccine candidates for BRD.

Identification of immunodominant proteins from Mannheimia haemolytica and Histophilus somni by an immunoproteomic approach

PubMed Central

Alvarez, Angel H.; Gutiérrez-Ortega, Abel; Hernández-Gutiérrez, Rodolfo

2015-01-01

Mannheimia haemolytica and Histophilus somni are frequently isolated from diseased cattle with bovine respiratory disease (BRD). They compromise animal lung function and the immune responses generated are not sufficient to limit infection. Identification of specific immunogenic antigens for vaccine development represents a great challenge. Immunogenic proteins were identified by immunoproteomic approach with sera from cattle immunized with a commercial cellular vaccine of M. haemolytica and H. somni. Proteins of M. haemolytica were identified as solute ABC transporter, iron-binding protein, and hypothetical protein of capsular biosynthesis. Histophilus somni proteins correspond to porin, amino acid ABC transporter, hypothetical outer membrane protein, cysteine synthase, and outer membrane protein P6. Although these antigens share strong similarities with other proteins from animal pathogens, the ABC system proteins have been associated with virulence and these proteins could be considered as potential vaccine candidates for BRD. PMID:26424916

"Drug" Discovery with the Help of Organic Chemistry.

PubMed

Itoh, Yukihiro; Suzuki, Takayoshi

2017-01-01

The first step in "drug" discovery is to find compounds binding to a potential drug target. In modern medicinal chemistry, the screening of a chemical library, structure-based drug design, and ligand-based drug design, or a combination of these methods, are generally used for identifying the desired compounds. However, they do not necessarily lead to success and there is no infallible method for drug discovery. Therefore, it is important to explore medicinal chemistry based on not only the conventional methods but also new ideas. So far, we have found various compounds as drug candidates. In these studies, some strategies based on organic chemistry have allowed us to find drug candidates, through 1) construction of a focused library using organic reactions and 2) rational design of enzyme inhibitors based on chemical reactions catalyzed by the target enzyme. Medicinal chemistry based on organic chemical reactions could be expected to supplement the conventional methods. In this review, we present drug discovery with the help of organic chemistry showing examples of our explorative studies on histone deacetylase inhibitors and lysine-specific demethylase 1 inhibitors.

Rational design of therapeutic mAbs against aggregation through protein engineering and incorporation of glycosylation motifs applied to bevacizumab.

PubMed

Courtois, Fabienne; Agrawal, Neeraj J; Lauer, Timothy M; Trout, Bernhardt L

2016-01-01

The aggregation of biotherapeutics is a major hindrance to the development of successful drug candidates; however, the propensity to aggregate is often identified too late in the development phase to permit modification to the protein's sequence. Incorporating rational design for the stability of proteins in early discovery has numerous benefits. We engineered out aggregation-prone regions on the Fab domain of a therapeutic monoclonal antibody, bevacizumab, to rationally design a biobetter drug candidate. With the purpose of stabilizing bevacizumab with respect to aggregation, 2 strategies were undertaken: single point mutations of aggregation-prone residues and engineering a glycosylation site near aggregation-prone residues to mask these residues with a carbohydrate moiety. Both of these approaches lead to comparable decreases in aggregation, with an up to 4-fold reduction in monomer loss. These single mutations and the new glycosylation pattern of the Fab domain do not modify binding to the target. Biobetters with increased stability against aggregation can therefore be generated in a rational manner, by either removing or masking the aggregation-prone region or crowding out protein-protein interactions.

Molecular Characterization of the Lipid Genome-Wide Association Study Signal on Chromosome 18q11.2 Implicates HNF4A-Mediated Regulation of the TMEM241 Gene.

PubMed

Rodríguez, Alejandra; Gonzalez, Luis; Ko, Arthur; Alvarez, Marcus; Miao, Zong; Bhagat, Yash; Nikkola, Elina; Cruz-Bautista, Ivette; Arellano-Campos, Olimpia; Muñoz-Hernández, Linda L; Ordóñez-Sánchez, Maria-Luisa; Rodriguez-Guillen, Rosario; Mohlke, Karen L; Laakso, Markku; Tusie-Luna, Teresa; Aguilar-Salinas, Carlos A; Pajukanta, Päivi

2016-07-01

We recently identified a locus on chromosome 18q11.2 for high serum triglycerides in Mexicans. We hypothesize that the lead genome-wide association study single-nucleotide polymorphism rs9949617, or its linkage disequilibrium proxies, regulates 1 of the 5 genes in the triglyceride-associated region. We performed a linkage disequilibrium analysis and found 9 additional variants in linkage disequilibrium (r(2)>0.7) with the lead single-nucleotide polymorphism. To select the variants for functional analyses, we annotated the 10 variants using DNase I hypersensitive sites, transcription factor and chromatin states and identified rs17259126 as the lead candidate variant for functional in vitro validation. Using luciferase transcriptional reporter assay in liver HepG2 cells, we found that the G allele exhibits a significantly lower effect on transcription (P<0.05). The electrophoretic mobility shift and ChIPqPCR (chromatin immunoprecipitation coupled with quantitative polymerase chain reaction) assays confirmed that the minor G allele of rs17259126 disrupts an hepatocyte nuclear factor 4 α-binding site. To find the regional candidate gene, we performed a local expression quantitative trait locus analysis and found that rs17259126 and its linkage disequilibrium proxies alter expression of the regional transmembrane protein 241 (TMEM241) gene in 795 adipose RNAs from the Metabolic Syndrome In Men (METSIM) cohort (P=6.11×10(-07)-5.80×10(-04)). These results were replicated in expression profiles of TMEM241 from the Multiple Tissue Human Expression Resource (MuTHER; n=856). The Mexican genome-wide association study signal for high serum triglycerides on chromosome 18q11.2 harbors a regulatory single-nucleotide polymorphism, rs17259126, which disrupts normal hepatocyte nuclear factor 4 α binding and decreases the expression of the regional TMEM241 gene. Our data suggest that decreased transcript levels of TMEM241 contribute to increased triglyceride levels in Mexicans. © 2016 American Heart Association, Inc.

Identification of candidate genes in osteoporosis by integrated microarray analysis.

PubMed

Li, J J; Wang, B Q; Fei, Q; Yang, Y; Li, D

2016-12-01

In order to screen the altered gene expression profile in peripheral blood mononuclear cells of patients with osteoporosis, we performed an integrated analysis of the online microarray studies of osteoporosis. We searched the Gene Expression Omnibus (GEO) database for microarray studies of peripheral blood mononuclear cells in patients with osteoporosis. Subsequently, we integrated gene expression data sets from multiple microarray studies to obtain differentially expressed genes (DEGs) between patients with osteoporosis and normal controls. Gene function analysis was performed to uncover the functions of identified DEGs. A total of three microarray studies were selected for integrated analysis. In all, 1125 genes were found to be significantly differentially expressed between osteoporosis patients and normal controls, with 373 upregulated and 752 downregulated genes. Positive regulation of the cellular amino metabolic process (gene ontology (GO): 0033240, false discovery rate (FDR) = 1.00E + 00) was significantly enriched under the GO category for biological processes, while for molecular functions, flavin adenine dinucleotide binding (GO: 0050660, FDR = 3.66E-01) and androgen receptor binding (GO: 0050681, FDR = 6.35E-01) were significantly enriched. DEGs were enriched in many osteoporosis-related signalling pathways, including those of mitogen-activated protein kinase (MAPK) and calcium. Protein-protein interaction (PPI) network analysis showed that the significant hub proteins contained ubiquitin specific peptidase 9, X-linked (Degree = 99), ubiquitin specific peptidase 19 (Degree = 57) and ubiquitin conjugating enzyme E2 B (Degree = 57). Analysis of gene function of identified differentially expressed genes may expand our understanding of fundamental mechanisms leading to osteoporosis. Moreover, significantly enriched pathways, such as MAPK and calcium, may involve in osteoporosis through osteoblastic differentiation and bone formation.Cite this article: J. J. Li, B. Q. Wang, Q. Fei, Y. Yang, D. Li. Identification of candidate genes in osteoporosis by integrated microarray analysis. Bone Joint Res 2016;5:594-601. DOI: 10.1302/2046-3758.512.BJR-2016-0073.R1. © 2016 Fei et al.

Lectin-dependent enhancement of Ebola virus infection via soluble and transmembrane C-type lectin receptors.

PubMed

Brudner, Matthew; Karpel, Marshall; Lear, Calli; Chen, Li; Yantosca, L Michael; Scully, Corinne; Sarraju, Ashish; Sokolovska, Anna; Zariffard, M Reza; Eisen, Damon P; Mungall, Bruce A; Kotton, Darrell N; Omari, Amel; Huang, I-Chueh; Farzan, Michael; Takahashi, Kazue; Stuart, Lynda; Stahl, Gregory L; Ezekowitz, Alan B; Spear, Gregory T; Olinger, Gene G; Schmidt, Emmett V; Michelow, Ian C

2013-01-01

Mannose-binding lectin (MBL) is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV) glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR) as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A) as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion during active infections. Our findings confirm our hypothesis that the pressure of infectious diseases may have contributed in part to evolutionary selection of MBL mutant haplotypes.

Lectin-Dependent Enhancement of Ebola Virus Infection via Soluble and Transmembrane C-type Lectin Receptors

PubMed Central

Lear, Calli; Chen, Li; Yantosca, L. Michael; Scully, Corinne; Sarraju, Ashish; Sokolovska, Anna; Zariffard, M. Reza; Eisen, Damon P.; Mungall, Bruce A.; Kotton, Darrell N.; Omari, Amel; Huang, I-Chueh; Farzan, Michael; Takahashi, Kazue; Stuart, Lynda; Stahl, Gregory L.; Ezekowitz, Alan B.; Spear, Gregory T.; Olinger, Gene G.; Schmidt, Emmett V.; Michelow, Ian C.

2013-01-01

Mannose-binding lectin (MBL) is a key soluble effector of the innate immune system that recognizes pathogen-specific surface glycans. Surprisingly, low-producing MBL genetic variants that may predispose children and immunocompromised individuals to infectious diseases are more common than would be expected in human populations. Since certain immune defense molecules, such as immunoglobulins, can be exploited by invasive pathogens, we hypothesized that MBL might also enhance infections in some circumstances. Consequently, the low and intermediate MBL levels commonly found in human populations might be the result of balancing selection. Using model infection systems with pseudotyped and authentic glycosylated viruses, we demonstrated that MBL indeed enhances infection of Ebola, Hendra, Nipah and West Nile viruses in low complement conditions. Mechanistic studies with Ebola virus (EBOV) glycoprotein pseudotyped lentiviruses confirmed that MBL binds to N-linked glycan epitopes on viral surfaces in a specific manner via the MBL carbohydrate recognition domain, which is necessary for enhanced infection. MBL mediates lipid-raft-dependent macropinocytosis of EBOV via a pathway that appears to require less actin or early endosomal processing compared with the filovirus canonical endocytic pathway. Using a validated RNA interference screen, we identified C1QBP (gC1qR) as a candidate surface receptor that mediates MBL-dependent enhancement of EBOV infection. We also identified dectin-2 (CLEC6A) as a potentially novel candidate attachment factor for EBOV. Our findings support the concept of an innate immune haplotype that represents critical interactions between MBL and complement component C4 genes and that may modify susceptibility or resistance to certain glycosylated pathogens. Therefore, higher levels of native or exogenous MBL could be deleterious in the setting of relative hypocomplementemia which can occur genetically or because of immunodepletion during active infections. Our findings confirm our hypothesis that the pressure of infectious diseases may have contributed in part to evolutionary selection of MBL mutant haplotypes. PMID:23573288

batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

PubMed

Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

2003-02-01

Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

Sequence Alignment to Predict Across Species Susceptibility ...

EPA Pesticide Factsheets

Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev

Rapid and accurate prediction and scoring of water molecules in protein binding sites.

PubMed

Ross, Gregory A; Morris, Garrett M; Biggin, Philip C

2012-01-01

Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

Potential Dual Role of Eugenol in Inhibiting Advanced Glycation End Products in Diabetes: Proteomic and Mechanistic Insights

PubMed Central

Singh, Priyanka; Jayaramaiah, Ramesha H.; Agawane, Sachin B.; Vannuruswamy, Garikapati; Korwar, Arvind M.; Anand, Atul; Dhaygude, Vitthal S.; Shaikh, Mahemud L.; Joshi, Rakesh S.; Boppana, Ramanamurthy; Kulkarni, Mahesh J.; Thulasiram, Hirekodathakallu V.; Giri, Ashok P.

2016-01-01

Medicinally important genus Ocimum harbors a vast pool of chemically diverse metabolites. Current study aims at identifying anti-diabetic candidate compounds from Ocimum species. Major metabolites in O. kilimandscharicum, O. tenuiflorum, O. gratissimum were purified, characterized and evaluated for anti-glycation activity. In vitro inhibition of advanced glycation end products (AGEs) by eugenol was found to be highest. Preliminary biophysical analysis and blind docking studies to understand eugenol-albumin interaction indicated eugenol to possess strong binding affinity for surface exposed lysines. However, binding of eugenol to bovine serum albumin (BSA) did not result in significant change in secondary structure of protein. In vivo diabetic mice model studies with eugenol showed reduction in blood glucose levels by 38% likely due to inhibition of α-glucosidase while insulin and glycated hemoglobin levels remain unchanged. Western blotting using anti-AGE antibody and mass spectrometry detected notably fewer AGE modified peptides upon eugenol treatment both in vivo and in vitro. Histopathological examination revealed comparatively lesser lesions in eugenol-treated mice. Thus, we propose eugenol has dual mode of action in combating diabetes; it lowers blood glucose by inhibiting α-glucosidase and prevents AGE formation by binding to ε-amine group on lysine, protecting it from glycation, offering potential use in diabetic management. PMID:26739611

batman Interacts with Polycomb and trithorax Group Genes and Encodes a BTB/POZ Protein That Is Included in a Complex Containing GAGA Factor

PubMed Central

Faucheux, M.; Roignant, J.-Y.; Netter, S.; Charollais, J.; Antoniewski, C.; Théodore, L.

2003-01-01

Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes. PMID:12556479

Computer-aided identification of potential TYK2 inhibitors from drug database

NASA Astrophysics Data System (ADS)

Zhang, Wei; Li, Jianzong; Huang, Zhixin; Wang, Haiyang; Luo, Hao; Wang, Xin; Zhou, Nan; Wu, Chuanfang; Bao, Jinku

2016-10-01

TYK2 is a member of JAKs family protein tyrosine kinase activated in response to various cytokines. It plays a crucial role in transducing signals downstream of various cytokine receptors, which are involved in proinflammatory responses associated with immunological diseases. Thus, the study of selective TYK2 inhibitors is one of the most popular fields in anti-inflammation drug development. Herein, we adopted molecular docking, molecular dynamics simulation and MM-PBSA binding free energy calculation to screen potential TYK2-selective inhibitors from ZINC Drug Database. Finally, three small molecule drugs ZINC12503271 (Gemifloxacin), ZINC05844792 (Nebivolol) and ZINC00537805 (Glyburide) were selected as potential TYK2-selective inhibitors. Compared to known inhibitor 2,6-dichloro-N-{2-[(cyclopropylcarbonyl)amino]pyridin-4-yl}benzamide, these three candidates had better Grid score and Amber score from molecular docking and preferable results from binding free energy calculation as well. What's more, the ATP-binding site and A-loop motif had been identified to play key roles in TYK2-targeted inhibitor discovery. It is expected that our study will pave the way for the design of potent TYK2 inhibitors of new drugs to treat a wide variety of immunological diseases such as inflammatory diseases, multiple sclerosis, psoriasis inflammatory bowel disease (IBD) and so on.

Potential Dual Role of Eugenol in Inhibiting Advanced Glycation End Products in Diabetes: Proteomic and Mechanistic Insights.

PubMed

Singh, Priyanka; Jayaramaiah, Ramesha H; Agawane, Sachin B; Vannuruswamy, Garikapati; Korwar, Arvind M; Anand, Atul; Dhaygude, Vitthal S; Shaikh, Mahemud L; Joshi, Rakesh S; Boppana, Ramanamurthy; Kulkarni, Mahesh J; Thulasiram, Hirekodathakallu V; Giri, Ashok P

2016-01-07

Medicinally important genus Ocimum harbors a vast pool of chemically diverse metabolites. Current study aims at identifying anti-diabetic candidate compounds from Ocimum species. Major metabolites in O. kilimandscharicum, O. tenuiflorum, O. gratissimum were purified, characterized and evaluated for anti-glycation activity. In vitro inhibition of advanced glycation end products (AGEs) by eugenol was found to be highest. Preliminary biophysical analysis and blind docking studies to understand eugenol-albumin interaction indicated eugenol to possess strong binding affinity for surface exposed lysines. However, binding of eugenol to bovine serum albumin (BSA) did not result in significant change in secondary structure of protein. In vivo diabetic mice model studies with eugenol showed reduction in blood glucose levels by 38% likely due to inhibition of α-glucosidase while insulin and glycated hemoglobin levels remain unchanged. Western blotting using anti-AGE antibody and mass spectrometry detected notably fewer AGE modified peptides upon eugenol treatment both in vivo and in vitro. Histopathological examination revealed comparatively lesser lesions in eugenol-treated mice. Thus, we propose eugenol has dual mode of action in combating diabetes; it lowers blood glucose by inhibiting α-glucosidase and prevents AGE formation by binding to ε-amine group on lysine, protecting it from glycation, offering potential use in diabetic management.

Native Human Monoclonal Antibodies with Potent Cross-Lineage Neutralization of Influenza B Viruses

PubMed Central

Vigil, Adam; Estélles, Angeles; Kauvar, Lawrence M.; Johnson, Scott K.

2018-01-01

ABSTRACT Although antibodies that effectively neutralize a broad set of influenza viruses exist in the human antibody repertoire, they are rare. We used a single-cell screening technology to identify rare monoclonal antibodies (MAbs) that recognized a broad set of influenza B viruses (IBV). The screen yielded 23 MAbs with diverse germ line origins that recognized hemagglutinins (HAs) derived from influenza strains of both the Yamagata and Victoria lineages of IBV. Of the 23 MAbs, 3 exhibited low expression in a transient-transfection system, 4 were neutralizers that bound to the HA head region, 11 were stalk-binding nonneutralizers, and 5 were stalk-binding neutralizers, with 4 of these 5 having unique antibody sequences. Of these four unique stalk-binding neutralizing MAbs, all were broadly reactive and neutralizing against a panel of multiple strains spanning both IBV lineages as well as highly effective in treating lethal IBV infections in mice at both 24 and 72 h postinfection. The MAbs in this group were thermostable and bound different epitopes in the highly conserved HA stalk region. These characteristics suggest that these MAbs are suitable for consideration as candidates for clinical studies to address their effectiveness in the treatment of IBV-infected patients. PMID:29507069

Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein

DOE PAGES

Chen, Edwin; Salinas, Nichole D.; Huang, Yining; ...

2016-05-18

Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less

Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Edwin; Salinas, Nichole D.; Huang, Yining

Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less

The adsorption of preferential binding peptides to apatite-based materials

PubMed Central

Segvich, Sharon J.; Smith, Hayes C.; Kohn, David H.

2009-01-01

The objective of this work was to identify peptide sequences with high affinity to bone-like mineral (BLM) to provide alternative design methods for functional bone regeneration peptides. Adsorption of preferential binding peptide sequences on four apatite-based substrates [BLM and three sintered apatite disks pressed from powders containing 0% CO32− (HA), 5.6% CO32− (CA5), 10.5% CO32− (CA10)] with varied compositions and morphologies was investigated. A combination of phage display, ELISA, and computational modeling was used to elucidate three 12-mer peptide sequences APWHLSSQYSRT (A), STLPI-PHEFSRE (S), and VTKHLNQISQSY (V), from 243 candidates with preferential adsorption on BLM and HA. Overall, peptides S and V have a significantly higher adsorption to the apatite-based materials in comparison to peptide A (for S vs. A, BLM p = 0.001, CA5 p < 0.001, CA10 p < 0.001, HA p = 0.038; for V vs. A, BLM p = 0.006, CA5 p = 0.033, CA10 p = 0.029). FT-IR analysis displayed carbonate levels in CA5 and CA10 dropped to approximately 1.1–2.2% after sintering, whereas SEM imaging displayed CA5 and CA10 possess distinct morphologies. Adsorption results normalized to surface area indicate that small changes in carbonate percentage at a similar morphological scale did not provide enough carbonate incorporation to show statistical differences in peptide adsorption. Because the identified peptides (S and V) have preferential binding to apatite, their use can now be investigated in bone and dentin tissue engineering, tendon and ligament repair, and enamel formation. PMID:19095299

Whole-exome sequencing reveals novel mutations and epigenetic regulation in hypopharyngeal carcinoma

PubMed Central

Wu, Ping; Wu, Honglong; Tang, Yaoyun; Luo, Shi; Fang, Xing; Xie, Chubo; He, Jian; Zhao, Suping; Wang, Xiaofeng; Xu, Jiajia; Chen, Xi; Li, Dongfang; Yang, Huanming; Wang, Jian

2017-01-01

Hypopharyngeal cancer (HPC) frequently presents at an advanced stage, resulting in poor prognosis. Although combined surgical therapy and chemoradiotherapy have improved the survival for patients with HPC over the past 3 decades, the mortality rate in late-stage diagnosis of HPC is unsatisfactory. In this study, we performed whole-exome sequencing (WES) of 23 hypopharyngeal tumor and paired adjacent normal tissue to identify novel candidate driver genes associated with hypopharyngeal carcinoma. We identified several copy number variants (CNVs) and 15 somatic mutation genes that were associated with hypopharyngeal carcinoma. Mutations in nine new genes (PRB4, NSD1, REC8, ZNF772, ZNF69, EI24, CYFIP2, NEFH, KRTAP4-5) were also indentified. PRB4 and NSD1 expression were significantly upregulated in hypopharyngeal carcinoma, which was confirmed in an independent cohort using IHC. There was a positive relationship between PRB4 and NSD1. Downregulation of PRB4 by siRNA could inhibit cell growth, colony formation and cell invasion. Notably, we here demonstrate that NSD1 could bind to the promoter regions of PRB4 and activate promoter activity by reducing the binding of H3K27me2 and increasing the binding of H3K36me2 on PRB4 promoter. In summary, we pinpoint the predominant mutations in hypopharyngeal carcinoma by WES, highlighting the substantial genetic alterations contributing to hypopharyngeal carcinoma tumorigenesis. We also indentify a novel epigenetically regulatory between PRB4 and NSD1 that contribute to hypopharyngeal carcinoma tumorigenesis. They may become potential prognostic biomarkers and therapeutic target for hypopharyngeal carcinoma treatment. PMID:29156722

In silico characterization of a novel pathogenic deletion mutation identified in XPA gene in a Pakistani family with severe xeroderma pigmentosum.

PubMed

Nasir, Muhammad; Ahmad, Nafees; Sieber, Christian M K; Latif, Amir; Malik, Salman Akbar; Hameed, Abdul

2013-09-24

Xeroderma Pigmentosum (XP) is a rare skin disorder characterized by skin hypersensitivity to sunlight and abnormal pigmentation. The aim of this study was to investigate the genetic cause of a severe XP phenotype in a consanguineous Pakistani family and in silico characterization of any identified disease-associated mutation. The XP complementation group was assigned by genotyping of family for known XP loci. Genotyping data mapped the family to complementation group A locus, involving XPA gene. Mutation analysis of the candidate XP gene by DNA sequencing revealed a novel deletion mutation (c.654del A) in exon 5 of XPA gene. The c.654del A, causes frameshift, which pre-maturely terminates protein and result into a truncated product of 222 amino acid (aa) residues instead of 273 (p.Lys218AsnfsX5). In silico tools were applied to study the likelihood of changes in structural motifs and thus interaction of mutated protein with binding partners. In silico analysis of mutant protein sequence, predicted to affect the aa residue which attains coiled coil structure. The coiled coil structure has an important role in key cellular interactions, especially with DNA damage-binding protein 2 (DDB2), which has important role in DDB-mediated nucleotide excision repair (NER) system. Our findings support the fact of genetic and clinical heterogeneity in XP. The study also predicts the critical role of DDB2 binding region of XPA protein in NER pathway and opens an avenue for further research to study the functional role of the mutated protein domain.

Characterization of Interactions between Heparin/Glycosaminoglycan and Adeno-associated Virus

PubMed Central

Zhang, Fuming; Aguilera, Javier; Beaudet, Julie M.; Xie, Qing; Lerch, Thomas F.; Davulcu, Omar; Colón, Wilfredo; Chapman, Michael S.; Linhardt, Robert J.

2013-01-01

Adeno-associated virus (AAV) is a key candidate in the development of gene therapy. In this report, we used surface plasmon resonance spectroscopy to study the interaction between AAV and heparin and other glycosaminoglycans. Surface plasmon resonance results revealed that heparin binds to AAV with extremely high affinity. Solution competition studies shows that AAV binding to heparin is chain length dependent. AAV prefers to bind full chain heparin. All sulfo groups (especially N-sulfo and 6-O-sulfo groups) on heparin are important for the AAV- heparin interaction. Higher levels of sulfo group substitution in GAGs enhance their binding affinities. Atomic force microscopy was also performed to image AAV-2 complexed with heparin. PMID:23952613

Candidate genes on murine chromosome 8 are associated with susceptibility to Staphylococcus aureus infection in mice and are involved with Staphylococcus aureus septicemia in humans

PubMed Central

Yan, Qin; Ahn, Sun Hee; Medie, Felix Mba; Park, Lawrence P.; Scott, William K.; Deshmukh, Hitesh; Cyr, Derek D.; Woods, Christopher W.; Yu, Chen-Hsin Albert; Adams, Carlton; Hansen, Brenda; Fowler, Vance G.

2017-01-01

We previously showed that chromosome 8 of A/J mice was associated with susceptibility to S. aureus infection. However, the specific genes responsible for this susceptibility are unknown. Chromosome substitution strain 8 (CSS8) mice, which have chromosome 8 from A/J but an otherwise C57BL/6J genome, were used to identify the genetic determinants of susceptibility to S. aureus on chromosome 8. Quantitative trait loci (QTL) mapping of S. aureus-infected N2 backcross mice (F1 [C8A] × C57BL/6J) identified a locus 83180780–88103009 (GRCm38/mm10) on A/J chromosome 8 that was linked to S. aureus susceptibility. All genes on the QTL (n~ 102) were further analyzed by three different strategies: 1) different expression in susceptible (A/J) and resistant (C57BL/6J) mice only in response to S. aureus, 2) consistently different expression in both uninfected and infected states between the two strains, and 3) damaging non-synonymous SNPs in either strain. Eleven candidate genes from the QTL region were significantly differently expressed in patients with S. aureus infection vs healthy human subjects. Four of these 11 genes also exhibited significantly different expression in S. aureus-challenged human neutrophils: Ier2, Crif1, Cd97 and Lyl1. CD97 ligand binding was evaluated within peritoneal neutrophils from A/J and C57BL/6J. CD97 from A/J had stronger CD55 but weaker integrin α5β1 ligand binding as compared with C57BL/6J. Because CD55/CD97 binding regulates immune cell activation and cytokine production, and integrin α5β1 is a membrane receptor for fibronectin, which is also bound by S. aureus, strain-specific differences could contribute to susceptibility to S. aureus. Down-regulation of Crif1 with siRNA was associated with increased host cell apoptosis among both naïve and S. aureus-infected bone marrow-derived macrophages. Specific genes in A/J chromosome 8, including Cd97 and Crif1, may play important roles in host defense against S. aureus. PMID:28594911

Identification of Inhibitors against Metastasis Protein “Survivin:” In silico Discovery Using Virtual Screening and Molecular Docking Studies

PubMed Central

Mishra, Swechha; Singh, Sangeeta

2017-01-01

Background: In experimental therapy of cancer, survivin is considered to be one of the well-established targets. Studies have found that it is overexpression in most of the human tumors, but it is rarely found in normal tissues. It is having varied structural and functional role. It controls cell division and cellular stress response and also regulates metastasis and migration of cancerous cells. It has also been recognized as a biomarker which makes it unconventional drug target. In spite of being one of the centrally active components in metastasis and invasion, their clinical use is minimal. To increase the therapeutic efficiency of cancer and its various stages, it is important to survey novel reagents targeting the pathways and mechanism involving survivin. Objective: The aim of this study was to identify novel survivin inhibitor candidates using in silico screening. Materials and Methods: In this course of work, virtual screening on a dataset of natural compounds retrieved from ZINC and other libraries were performed. Comparative analysis of the protein was done by studying the binding affinity of inhibitors that are already available. The best interacting complex was set for molecular dynamics simulation for 25 ns to validate the stability of system. These molecules were checked for their toxicity and absorption, distribution, metabolism, excretion, and toxicity (ADMET) properties using OSIRIS and pre-ADMET tools. Results: We discovered ten such candidates with better binding efficiency with survivin in comparison to marketed chemical against the same. Furthermore, these inhibitor candidates did not induce cell toxicity. Binding affinity of reference molecules was varied from −6.8 to −8.5 kcal/mol while that of top scoring compound ZINC00689728 is −9.3 kcal/mol binding energy. Good placement and strong bond formation of selected molecule was observed during course of work. It is also having permissible ADMET property. Conclusion: Considering all the parameters, the screened molecule can be considered as a potential lead compound for designing new drug against survivin. Further investigation and testing will be required to make it to the final stage. SUMMARY Survivin is one of the important protein of metastasis. Inhibiting survivin might led to the increased therapeutic efficiency of cancer. In this work we are screening library of natural compounds in view of finding some potent inhibitor against survivin. Abbreviations used: MD: Molecular dynamics, LogS: Aqueous solubility, Acceptor HB: Hydrogen bond acceptor, Donor HB: Donor hydrogen bond donor, ADMET: Absorption, distribution, metabolism, excretion, and toxicity, RCSB: Research Collaboratory for Structural Bioinformatics, OPLS: Optimized potentials for liquid simulations, RMSD: Root-mean-square deviation. PMID:29491627

The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

PubMed Central

Middendorf, Thomas R.

2017-01-01

A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

Identification of Novel Seroreactive Antigens in Johne's Disease Cattle by Using the Mycobacterium tuberculosis Protein Array

PubMed Central

Campo, Joseph J.; Li, Lingling; Randall, Arlo; Pablo, Jozelyn; Praul, Craig A.; Raygoza Garay, Juan Antonio; Stabel, Judith R.

2017-01-01

ABSTRACT Johne's disease, a chronic gastrointestinal inflammatory disease caused by Mycobacterium avium subspecies paratuberculosis, is endemic in dairy cattle and other ruminants worldwide and remains a challenge to diagnose using traditional serological methods. Given the close phylogenetic relationship between M. avium subsp. paratuberculosis and the human pathogen Mycobacterium tuberculosis, here, we applied a whole-proteome M. tuberculosis protein array to identify seroreactive and diagnostic M. avium subsp. paratuberculosis antigens. A genome-scale pairwise analysis of amino acid identity levels between orthologous proteins in M. avium subsp. paratuberculosis and M. tuberculosis showed an average of 62% identity, with more than half the orthologous proteins sharing >75% identity. Analysis of the M. tuberculosis protein array probed with sera from M. avium subsp. paratuberculosis-infected cattle showed antibody binding to 729 M. tuberculosis proteins, with 58% of them having ≥70% identity to M. avium subsp. paratuberculosis orthologs. The results showed that only 4 of the top 40 seroreactive M. tuberculosis antigens were orthologs of previously reported M. avium subsp. paratuberculosis antigens, revealing the existence of a large number of previously unrecognized candidate diagnostic antigens. Enzyme-linked immunosorbent assay (ELISA) testing of 20 M. avium subsp. paratuberculosis recombinant proteins, representing reactive and nonreactive M. tuberculosis orthologs, further confirmed that the M. tuberculosis array has utility as a screening tool for identifying candidate antigens for Johne's disease diagnostics. Additional ELISA testing of field serum samples collected from dairy herds around the United States revealed that MAP2942c had the strongest seroreactivity with Johne's disease-positive samples. Collectively, our studies have considerably expanded the number of candidate M. avium subsp. paratuberculosis proteins with potential utility in the next generation of rationally designed Johne's disease diagnostic assays. PMID:28515134

Identification of Novel Seroreactive Antigens in Johne's Disease Cattle by Using the Mycobacterium tuberculosis Protein Array.

PubMed

Bannantine, John P; Campo, Joseph J; Li, Lingling; Randall, Arlo; Pablo, Jozelyn; Praul, Craig A; Raygoza Garay, Juan Antonio; Stabel, Judith R; Kapur, Vivek

2017-07-01

Johne's disease, a chronic gastrointestinal inflammatory disease caused by Mycobacterium avium subspecies paratuberculosis , is endemic in dairy cattle and other ruminants worldwide and remains a challenge to diagnose using traditional serological methods. Given the close phylogenetic relationship between M. avium subsp. paratuberculosis and the human pathogen Mycobacterium tuberculosis , here, we applied a whole-proteome M. tuberculosis protein array to identify seroreactive and diagnostic M. avium subsp. paratuberculosis antigens. A genome-scale pairwise analysis of amino acid identity levels between orthologous proteins in M. avium subsp. paratuberculosis and M. tuberculosis showed an average of 62% identity, with more than half the orthologous proteins sharing >75% identity. Analysis of the M. tuberculosis protein array probed with sera from M. avium subsp. paratuberculosis -infected cattle showed antibody binding to 729 M. tuberculosis proteins, with 58% of them having ≥70% identity to M. avium subsp. paratuberculosis orthologs. The results showed that only 4 of the top 40 seroreactive M. tuberculosis antigens were orthologs of previously reported M. avium subsp. paratuberculosis antigens, revealing the existence of a large number of previously unrecognized candidate diagnostic antigens. Enzyme-linked immunosorbent assay (ELISA) testing of 20 M. avium subsp. paratuberculosis recombinant proteins, representing reactive and nonreactive M. tuberculosis orthologs, further confirmed that the M. tuberculosis array has utility as a screening tool for identifying candidate antigens for Johne's disease diagnostics. Additional ELISA testing of field serum samples collected from dairy herds around the United States revealed that MAP2942c had the strongest seroreactivity with Johne's disease-positive samples. Collectively, our studies have considerably expanded the number of candidate M. avium subsp. paratuberculosis proteins with potential utility in the next generation of rationally designed Johne's disease diagnostic assays. Copyright © 2017 American Society for Microbiology.

Parallel SCF Adaptor Capture Proteomics Reveals a Role for SCFFBXL17 in NRF2 Activation via BACH1 Repressor Turnover

PubMed Central

Tan, Meng-Kwang Marcus; Lim, Hui-Jun; Bennett, Eric J.; Shi, Yang; Harper, J. Wade

2014-01-01

Modular Cullin-RING E3 ubiquitin ligases (CRLs) use substrate binding adaptor proteins to specify target ubiquitylation. Many of the ~200 human CRL adaptor proteins remain poorly studied due to a shortage of efficient methods to identify biologically relevant substrates. Here, we report the development of Parallel Adaptor Capture (PAC) proteomics, and its use to systematically identify candidate targets for the leucine-rich repeat family of F-box proteins (FBXLs) that function with SKP1-CUL1-F-box protein (SCF) E3s. In validation experiments, we identify the unstudied F-box protein FBXL17 as a regulator of the NFR2 oxidative stress pathway. We demonstrate that FBXL17 controls the transcription of the NRF2 target HMOX1 via turnover of the transcriptional repressor BACH1 in the absence or presence of extrinsic oxidative stress. This work identifies a role for SCFFBXL17 in controlling the threshold for NRF2-dependent gene activation and provides a framework for elucidating the functions of CRL adaptor proteins. PMID:24035498

Parallel SCF adaptor capture proteomics reveals a role for SCFFBXL17 in NRF2 activation via BACH1 repressor turnover.

PubMed

Tan, Meng-Kwang Marcus; Lim, Hui-Jun; Bennett, Eric J; Shi, Yang; Harper, J Wade

2013-10-10

Modular cullin-RING E3 ubiquitin ligases (CRLs) use substrate binding adaptor proteins to specify target ubiquitylation. Many of the ~200 human CRL adaptor proteins remain poorly studied due to a shortage of efficient methods to identify biologically relevant substrates. Here, we report the development of parallel adaptor capture (PAC) proteomics and its use to systematically identify candidate targets for the leucine-rich repeat family of F-box proteins (FBXLs) that function with SKP1-CUL1-F-box protein (SCF) E3s. In validation experiments, we identify the unstudied F-box protein FBXL17 as a regulator of the NFR2 oxidative stress pathway. We demonstrate that FBXL17 controls the transcription of the NRF2 target HMOX1 via turnover of the transcriptional repressor BACH1 in the absence or presence of extrinsic oxidative stress. This work identifies a role for SCF(FBXL17) in controlling the threshold for NRF2-dependent gene activation and provides a framework for elucidating the functions of CRL adaptor proteins. Copyright © 2013 Elsevier Inc. All rights reserved.

Microarray analysis of gene expression patterns in the leaf during potato tuberization in the potato somatic hybrid Solanum tuberosum and Solanum etuberosum.

PubMed

Tiwari, Jagesh Kumar; Devi, Sapna; Sundaresha, S; Chandel, Poonam; Ali, Nilofer; Singh, Brajesh; Bhardwaj, Vinay; Singh, Bir Pal

2015-06-01

Genes involved in photoassimilate partitioning and changes in hormonal balance are important for potato tuberization. In the present study, we investigated gene expression patterns in the tuber-bearing potato somatic hybrid (E1-3) and control non-tuberous wild species Solanum etuberosum (Etb) by microarray. Plants were grown under controlled conditions and leaves were collected at eight tuber developmental stages for microarray analysis. A t-test analysis identified a total of 468 genes (94 up-regulated and 374 down-regulated) that were statistically significant (p ≤ 0.05) and differentially expressed in E1-3 and Etb. Gene Ontology (GO) characterization of the 468 genes revealed that 145 were annotated and 323 were of unknown function. Further, these 145 genes were grouped based on GO biological processes followed by molecular function and (or) PGSC description into 15 gene sets, namely (1) transport, (2) metabolic process, (3) biological process, (4) photosynthesis, (5) oxidation-reduction, (6) transcription, (7) translation, (8) binding, (9) protein phosphorylation, (10) protein folding, (11) ubiquitin-dependent protein catabolic process, (12) RNA processing, (13) negative regulation of protein, (14) methylation, and (15) mitosis. RT-PCR analysis of 10 selected highly significant genes (p ≤ 0.01) confirmed the microarray results. Overall, we show that candidate genes induced in leaves of E1-3 were implicated in tuberization processes such as transport, carbohydrate metabolism, phytohormones, and transcription/translation/binding functions. Hence, our results provide an insight into the candidate genes induced in leaf tissues during tuberization in E1-3.

Development of new antiatherosclerotic and antithrombotic drugs utilizing F11 receptor (F11R/JAM-A) peptides.

PubMed

Babinska, A; Clement, C C; Swiatkowska, M; Szymanski, J; Shon, A; Ehrlich, Y H; Kornecki, E; Salifu, M O

2014-07-01

Peptides with enhanced resistance to proteolysis, based on the amino acid sequence of the F11 receptor molecule (F11R, aka JAM-A/Junctional adhesion molecule-A), were designed, prepared, and examined as potential candidates for the development of anti-atherosclerotic and anti-thrombotic therapeutic drugs. A sequence at the N-terminal of F11R together with another sequence located in the first Ig-loop of this protein, were identified to form a steric active-site operating in the F11R-dependent adhesion between cells that express F11R molecules on their external surface. In silico modeling of the complex between two polypeptide chains with the sequences positioned in the active-site was used to generate peptide-candidates designed to inhibit homophilic interactions between surface-located F11R molecules. The two lead F11R peptides were modified with D-Arg and D-Lys at selective sites, for attaining higher stability to proteolysis in vivo. Using molecular docking experiments we tested different conformational states and the putative binding affinity between two selected D-Arg and D-Lys-modified F11R peptides and the proposed binding pocket. The inhibitory effects of the F11R peptide 2HN-(dK)-SVT-(dR)-EDTGTYTC-CONH2 on antibody-induced platelet aggregation and on the adhesion of platelets to cytokine-inflammed endothelial cells are reported in detail, and the results point out the significant potential utilization of F11R peptides for the prevention and treatment of atherosclerotic plaques and associated thrombotic events. © 2014 Wiley Periodicals, Inc.

Identifying Candidate Chemical-Disease Linkages (Environmental and Epigenetic Determinants of IBD)

EPA Science Inventory

Presentation at meeting on Environmental and Epigenetic Determinants of IBD in New York, NY on identifying candidate chemical-disease linkages by using AOPs to identify molecular initiating events and using relevant high throughput assays to screen for candidate chemicals. This h...

The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes.

PubMed

Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

2016-07-01

The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat.

The wheat R2R3-MYB transcription factor TaRIM1 participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes

PubMed Central

Shan, Tianlei; Rong, Wei; Xu, Huijun; Du, Lipu; Liu, Xin; Zhang, Zengyan

2016-01-01

The necrotrophic fungus Rhizoctonia cerealis is a major pathogen of sharp eyespot that is a devastating disease of wheat (Triticum aestivum). Little is known about roles of MYB genes in wheat defense response to R. cerealis. In this study, TaRIM1, a R. cerealis-induced wheat MYB gene, was identified by transcriptome analysis, then cloned from resistant wheat CI12633, and its function and preliminary mechanism were studied. Sequence analysis showed that TaRIM1 encodes a R2R3-MYB transcription factor with transcription-activation activity. The molecular-biological assays revealed that the TaRIM1 protein localizes to nuclear and can bind to five MYB-binding site cis-elements. Functional dissection results showed that following R. cerealis inoculation, TaRIM1 silencing impaired the resistance of wheat CI12633, whereas TaRIM1 overexpression significantly increased resistance of transgenic wheat compared with susceptible recipient. TaRIM1 positively regulated the expression of five defense genes (Defensin, PR10, PR17c, nsLTP1, and chitinase1) possibly through binding to MYB-binding sites in their promoters. These results suggest that the R2R3-MYB transcription factor TaRIM1 positively regulates resistance response to R. cerealis infection through modulating the expression of a range of defense genes, and that TaRIM1 is a candidate gene to improve sharp eyespot resistance in wheat. PMID:27364458

Structural Basis of HCV Neutralization by Human Monoclonal Antibodies Resistant to Viral Neutralization Escape

PubMed Central

Krey, Thomas; Meola, Annalisa; Keck, Zhen-yong; Damier-Piolle, Laurence; Foung, Steven K. H.; Rey, Felix A.

2013-01-01

The high mutation rate of hepatitis C virus allows it to rapidly evade the humoral immune response. However, certain epitopes in the envelope glycoproteins cannot vary without compromising virus viability. Antibodies targeting these epitopes are resistant to viral escape from neutralization and understanding their binding-mode is important for vaccine design. Human monoclonal antibodies HC84-1 and HC84-27 target conformational epitopes overlapping the CD81 receptor-binding site, formed by segments aa434–446 and aa610–619 within the major HCV glycoprotein E2. No neutralization escape was yet observed for these antibodies. We report here the crystal structures of their Fab fragments in complex with a synthetic peptide comprising aa434–446. The structures show that the peptide adopts an α-helical conformation with the main contact residues F442 and Y443 forming a hydrophobic protrusion. The peptide retained its conformation in both complexes, independently of crystal packing, indicating that it reflects a surface feature of the folded glycoprotein that is exposed similarly on the virion. The same residues of E2 are also involved in interaction with CD81, suggesting that the cellular receptor binds the same surface feature and potential escape mutants critically compromise receptor binding. In summary, our results identify a critical structural motif at the E2 surface, which is essential for virus propagation and therefore represents an ideal candidate for structure-based immunogen design for vaccine development. PMID:23696737

High-Throughput Screening of Small Molecules Identifies Hepcidin Antagonists

PubMed Central

Fung, Eileen; Sugianto, Priscilla; Hsu, Jason; Damoiseaux, Robert; Ganz, Tomas

2013-01-01

Anemia of inflammation (AI) is common in patients with infection, autoimmune diseases, cancer, and chronic kidney disease. Unless the underlying condition can be reversed, treatment options are limited to erythropoiesis-stimulating agents with or without intravenous iron therapy, modalities that are not always effective and can cause serious adverse effects. Hepcidin, the iron regulatory hormone, has been identified as a pathogenic factor in the development of AI. To explore new therapeutic options for AI and other iron-related disorders caused by hepcidin excess, we developed a cell-based screen to identify hepcidin antagonists. Of the 70,000 small molecules in the library, we identified 14 compounds that antagonized the hepcidin effect on ferroportin. One of these was fursultiamine, a Food and Drug Administration (FDA)–approved thiamine derivative. Fursultiamine directly interfered with hepcidin binding to its receptor, ferroportin, by blocking ferroportin C326 thiol residue essential for hepcidin binding. Consequently, fursultiamine prevented hepcidin-induced ferroportin ubiquitination, endocytosis, and degradation in vitro and allowed continuous cellular iron export despite the presence of hepcidin, with IC50 in the submicromolar range. Thiamine, the fursultiamine metabolite, and benfotiamine, another thiamine derivative, did not interfere with the effect of hepcidin on ferroportin. Other FDA-approved thiol-reactive compounds were at least 1000-fold less potent than fursultiamine in antagonizing hepcidin. In vivo, fursultiamine did not reproducibly antagonize the effect of hepcidin on serum iron, likely because of its rapid conversion to inactive metabolites. Fursultiamine is a unique antagonist of hepcidin in vitro that could serve as a template for the development of drug candidates that inhibit the hepcidin-ferroportin interaction. PMID:23292796

Phage diabody repertoires for selection of large numbers of bispecific antibody fragments.

PubMed

McGuinness, B T; Walter, G; FitzGerald, K; Schuler, P; Mahoney, W; Duncan, A R; Hoogenboom, H R

1996-09-01

Methods for the generation of large numbers of different bispecific antibodies are presented. Cloning strategies are detailed to create repertoires of bispecific diabody molecules with variability on one or both of the antigen binding sites. This diabody format, when combined with the power of phage display technology, allows the generation and analysis of thousands of different bispecific molecules. Selection for binding presumably also selects for more stable diabodies. Phage diabody libraries enable screening or selection of the best combination bispecific molecule with regards to affinity of binding, epitope recognition and pairing before manufacture of the best candidate.

Association weight matrix for the genetic dissection of puberty in beef cattle.

PubMed

Fortes, Marina R S; Reverter, Antonio; Zhang, Yuandan; Collis, Eliza; Nagaraj, Shivashankar H; Jonsson, Nick N; Prayaga, Kishore C; Barris, Wes; Hawken, Rachel J

2010-08-03

We describe a systems biology approach for the genetic dissection of complex traits based on applying gene network theory to the results from genome-wide associations. The associations of single-nucleotide polymorphisms (SNP) that were individually associated with a primary phenotype of interest, age at puberty in our study, were explored across 22 related traits. Genomic regions were surveyed for genes harboring the selected SNP. As a result, an association weight matrix (AWM) was constructed with as many rows as genes and as many columns as traits. Each {i, j} cell value in the AWM corresponds to the z-score normalized additive effect of the ith gene (via its neighboring SNP) on the jth trait. Columnwise, the AWM recovered the genetic correlations estimated via pedigree-based restricted maximum-likelihood methods. Rowwise, a combination of hierarchical clustering, gene network, and pathway analyses identified genetic drivers that would have been missed by standard genome-wide association studies. Finally, the promoter regions of the AWM-predicted targets of three key transcription factors (TFs), estrogen-related receptor gamma (ESRRG), Pal3 motif, bound by a PPAR-gamma homodimer, IR3 sites (PPARG), and Prophet of Pit 1, PROP paired-like homeobox 1 (PROP1), were surveyed to identify binding sites corresponding to those TFs. Applied to our case, the AWM results recapitulate the known biology of puberty, captured experimentally validated binding sites, and identified candidate genes and gene-gene interactions for further investigation.

Multiple ABC transporters are involved in the acquisition of petrobactin in Bacillus anthracis

PubMed Central

Dixon, Shandee D.; Janes, Brian K.; Bourgis, Alexandra; Carlson, Paul E.; Hanna, Philip C.

2012-01-01

Summary In Bacillus anthracis the siderophore petrobactin is vital for iron acquisition and virulence. The petrobactin-binding receptor FpuA is required for these processes. Here additional components of petrobactin reacquisition are described. To identify these proteins, mutants of candidate permease and ATPase genes were generated allowing for characterization of multiple petrobactin ATP-binding cassette (ABC)-import systems. Either of two distinct permeases, FpuB or FatCD, are required for iron acquisition and play redundant roles in petrobactin transport. A mutant strain lacking both permeases, ΔfpuBΔfatCD, was incapable of using petrobactin as an iron source and exhibited attenuated virulence in a murine model of inhalational anthrax infection. ATPase mutants were generated in either of the permease mutant backgrounds to identify the ATPase(s) interacting with each individual permease channel. Mutants lacking the FpuB permease and FatE ATPase (ΔfpuBΔfatE) and a mutant lacking the distinct ATPases FpuC and FpuD generated in the ΔfatCD background (ΔfatCDΔfpuCΔfpuD) displayed phenotypic characteristics of a mutant deficient in petrobactin import. A mutant lacking all three of the identified ATPases (ΔfatEΔfpuCΔfpuD) exhibited the same growth defect in iron-depleted conditions. Taken together, these results provide the first description of the permease and ATPase proteins required for the import of petrobactin in B. anthracis. PMID:22429808

A large scale analysis of genetic variants within putative miRNA binding sites in prostate cancer

PubMed Central

Stegeman, Shane; Amankwah, Ernest; Klein, Kerenaftali; O’Mara, Tracy A.; Kim, Donghwa; Lin, Hui-Yi; Permuth-Wey, Jennifer; Sellers, Thomas A.; Srinivasan, Srilakshmi; Eeles, Rosalind; Easton, Doug; Kote-Jarai, Zsofia; Olama, Ali Amin Al; Benlloch, Sara; Muir, Kenneth; Giles, Graham G.; Wiklund, Fredrik; Gronberg, Henrik; Haiman, Christopher A.; Schleutker, Johanna; Nordestgaard, Børge G.; Travis, Ruth C.; Neal, David; Pharoah, Paul; Khaw, Kay-Tee; Stanford, Janet L.; Blot, William J.; Thibodeau, Stephen; Maier, Christiane; Kibel, Adam S.; Cybulski, Cezary; Cannon-Albright, Lisa; Brenner, Hermann; Kaneva, Radka; Teixeira, Manuel R.; Consortium, PRACTICAL; Spurdle, Amanda B.; Clements, Judith A.; Park, Jong Y.; Batra, Jyotsna

2015-01-01

Prostate cancer is the second most common malignancy among men worldwide. Genome-wide association studies (GWAS) have identified 100 risk variants for prostate cancer, which can explain ~33% of the familial risk of the disease. We hypothesized that a comprehensive analysis of genetic variations found within the 3′ UTR of genes predicted to affect miRNA binding (miRSNPs) can identify additional prostate cancer risk variants. We investigated the association between 2,169 miRSNPs and prostate cancer risk in a large-scale analysis of 22,301 cases and 22,320 controls of European ancestry from 23 participating studies. Twenty-two miRSNPs were associated (p<2.3×10−5) with risk of prostate cancer, 10 of which were within the 7 genes previously not mapped by GWASs. Further, using miRNA mimics and reporter gene assays, we showed that miR-3162-5p has specific affinity for the KLK3 rs1058205 miRSNP T-allele whilst miR-370 has greater affinity for the VAMP8 rs1010 miRSNP A-allele, validating their functional role. Significance Findings from this large association study suggest that a focus on miRSNPs, including functional evaluation, can identify candidate risk loci below currently accepted statistical levels of genome-wide significance. Studies of miRNAs and their interactions with SNPs could provide further insights into the mechanisms of prostate cancer risk. PMID:25691096

Association weight matrix for the genetic dissection of puberty in beef cattle

PubMed Central

Fortes, Marina R. S.; Reverter, Antonio; Zhang, Yuandan; Collis, Eliza; Nagaraj, Shivashankar H.; Jonsson, Nick N.; Prayaga, Kishore C.; Barris, Wes; Hawken, Rachel J.

2010-01-01

We describe a systems biology approach for the genetic dissection of complex traits based on applying gene network theory to the results from genome-wide associations. The associations of single-nucleotide polymorphisms (SNP) that were individually associated with a primary phenotype of interest, age at puberty in our study, were explored across 22 related traits. Genomic regions were surveyed for genes harboring the selected SNP. As a result, an association weight matrix (AWM) was constructed with as many rows as genes and as many columns as traits. Each {i, j} cell value in the AWM corresponds to the z-score normalized additive effect of the ith gene (via its neighboring SNP) on the jth trait. Columnwise, the AWM recovered the genetic correlations estimated via pedigree-based restricted maximum-likelihood methods. Rowwise, a combination of hierarchical clustering, gene network, and pathway analyses identified genetic drivers that would have been missed by standard genome-wide association studies. Finally, the promoter regions of the AWM-predicted targets of three key transcription factors (TFs), estrogen-related receptor γ (ESRRG), Pal3 motif, bound by a PPAR-γ homodimer, IR3 sites (PPARG), and Prophet of Pit 1, PROP paired-like homeobox 1 (PROP1), were surveyed to identify binding sites corresponding to those TFs. Applied to our case, the AWM results recapitulate the known biology of puberty, captured experimentally validated binding sites, and identified candidate genes and gene–gene interactions for further investigation. PMID:20643938

Modeling, molecular docking, probing catalytic binding mode of acetyl-CoA malate synthase G in Brucella melitensis 16M.

PubMed

Adi, Pradeepkiran Jangampalli; Yellapu, Nanda Kumar; Matcha, Bhaskar

2016-12-01

There are enormous evidences and previous reports standpoint that the enzyme of glyoxylate pathway malate synthase G (MSG) is a potential virulence factor in several pathogenic organisms, including Brucella melitensis 16M. Where the lack of crystal structures for best candidate proteins like MSG of B. melitensis 16M creates big lacuna to understand the molecular pathogenesis of brucellosis. In the present study, we have constructed a 3-D structure of MSG of Brucella melitensis 16M in MODELLER with the help of crystal structure of Mycobacterium tuberculosis malate synthase (PDB ID: 2GQ3) as template. The stereo chemical quality of the restrained model was evaluated by SAVES server; remarkably we identified the catalytic functional core domain located at 4 th cleft with conserved catalytic amino acids, start at ILE 59 to VAL 586 manifest the function of the protein. Furthermore, virtual screening and docking results reveals that best leadmolecules binds at the core domain pocket of MSG catalytic residues and these ligand leads could be the best prospective inhibitors to treat brucellosis.

The role of Cas8 in type I CRISPR interference.

PubMed

Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

2015-05-05

CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

Synthesis and biological evaluation of novel selective androgen receptor modulators (SARMs) Part III: Discovery of 4-(5-oxopyrrolidine-1-yl)benzonitrile derivative 2f as a clinical candidate.

PubMed

Aikawa, Katsuji; Asano, Moriteru; Ono, Koji; Habuka, Noriyuki; Yano, Jason; Wilson, Keith; Fujita, Hisashi; Kandori, Hitoshi; Hara, Takahito; Morimoto, Megumi; Santou, Takashi; Yamaoka, Masuo; Nakayama, Masaharu; Hasuoka, Atsushi

2017-07-01

We previously reported that 4-(pyrrolidin-1-yl)benzonitrile derivative 1b was a selective androgen receptor modulator (SARM) that exhibited anabolic effects on organs such as muscles and the central nervous system (CNS), but neutral effects on the prostate. From further modification, we identified that 4-(5-oxopyrrolidine-1-yl)benzonitrile derivative 2a showed strong AR binding affinity with improved metabolic stabilities. Based on these results, we tried to enhance the AR agonistic activities by modifying the substituents of the 5-oxopyrrolidine ring. As a consequence, we found that 4-[(2S,3S)-2-ethyl-3-hydroxy-5-oxopyrrolidin-1-yl]-2-(trifluoromethyl)benzonitrile (2f) had ideal SARM profiles in Hershberger assay and sexual behavior induction assay. Furthermore, 2f showed good pharmacokinetic profiles in rats, dogs, monkeys, excellent nuclear selectivity and acceptable toxicological profiles. We also determined its binding mode by obtaining the co-crystal structures with AR. Copyright © 2017 Elsevier Ltd. All rights reserved.

PQBP1 Is a Proximal Sensor of the cGAS-Dependent Innate Response to HIV-1.

PubMed

Yoh, Sunnie M; Schneider, Monika; Seifried, Janna; Soonthornvacharin, Stephen; Akleh, Rana E; Olivieri, Kevin C; De Jesus, Paul D; Ruan, Chunhai; de Castro, Elisa; Ruiz, Pedro A; Germanaud, David; des Portes, Vincent; García-Sastre, Adolfo; König, Renate; Chanda, Sumit K

2015-06-04

Dendritic cells (DCs) play a critical role in the immune response to viral infection through the facilitation of cell-intrinsic antiviral activity and the activation of adaptive immunity. HIV-1 infection of DCs triggers an IRF3-dependent innate immune response, which requires the activity of cyclic GAMP synthase (cGAS). We report the results of a targeted RNAi screen utilizing primary human monocyte-derived DCs (MDDCs) to identify immune regulators that directly interface with HIV-1-encoded features to initiate this innate response. Polyglutamine binding protein 1 (PQBP1) emerged as a strong candidate through this analysis. We found that PQBP1 directly binds to reverse-transcribed HIV-1 DNA and interacts with cGAS to initiate an IRF3-dependent innate response. MDDCs derived from Renpenning syndrome patients, who harbor mutations in the PQBP1 locus, possess a severely attenuated innate immune response to HIV-1 challenge, underscoring the role of PQBP1 as a proximal innate sensor of a HIV-1 infection. Copyright © 2015 Elsevier Inc. All rights reserved.

Brigatinib combined with anti-EGFR antibody overcomes osimertinib resistance in EGFR-mutated non-small-cell lung cancer

PubMed Central

Uchibori, Ken; Inase, Naohiko; Araki, Mitsugu; Kamada, Mayumi; Sato, Shigeo; Okuno, Yasushi; Fujita, Naoya; Katayama, Ryohei

2017-01-01

Osimertinib has been demonstrated to overcome the epidermal growth factor receptor (EGFR)-T790M, the most relevant acquired resistance to first-generation EGFR–tyrosine kinase inhibitors (EGFR–TKIs). However, the C797S mutation, which impairs the covalent binding between the cysteine residue at position 797 of EGFR and osimertinib, induces resistance to osimertinib. Currently, there are no effective therapeutic strategies to overcome the C797S/T790M/activating-mutation (triple-mutation)-mediated EGFR–TKI resistance. In the present study, we identify brigatinib to be effective against triple-mutation-harbouring cells in vitro and in vivo. Our original computational simulation demonstrates that brigatinib fits into the ATP-binding pocket of triple-mutant EGFR. The structure–activity relationship analysis reveals the key component in brigatinib to inhibit the triple-mutant EGFR. The efficacy of brigatinib is enhanced markedly by combination with anti-EGFR antibody because of the decrease of surface and total EGFR expression. Thus, the combination therapy of brigatinib with anti-EGFR antibody is a powerful candidate to overcome triple-mutant EGFR. PMID:28287083

Brigatinib combined with anti-EGFR antibody overcomes osimertinib resistance in EGFR-mutated non-small-cell lung cancer

NASA Astrophysics Data System (ADS)

Uchibori, Ken; Inase, Naohiko; Araki, Mitsugu; Kamada, Mayumi; Sato, Shigeo; Okuno, Yasushi; Fujita, Naoya; Katayama, Ryohei

2017-03-01

Osimertinib has been demonstrated to overcome the epidermal growth factor receptor (EGFR)-T790M, the most relevant acquired resistance to first-generation EGFR-tyrosine kinase inhibitors (EGFR-TKIs). However, the C797S mutation, which impairs the covalent binding between the cysteine residue at position 797 of EGFR and osimertinib, induces resistance to osimertinib. Currently, there are no effective therapeutic strategies to overcome the C797S/T790M/activating-mutation (triple-mutation)-mediated EGFR-TKI resistance. In the present study, we identify brigatinib to be effective against triple-mutation-harbouring cells in vitro and in vivo. Our original computational simulation demonstrates that brigatinib fits into the ATP-binding pocket of triple-mutant EGFR. The structure-activity relationship analysis reveals the key component in brigatinib to inhibit the triple-mutant EGFR. The efficacy of brigatinib is enhanced markedly by combination with anti-EGFR antibody because of the decrease of surface and total EGFR expression. Thus, the combination therapy of brigatinib with anti-EGFR antibody is a powerful candidate to overcome triple-mutant EGFR.

Gene Identification of Pheromone Gland Genes Involved in Type II Sex Pheromone Biosynthesis and Transportation in Female Tea Pest Ectropis grisescens

PubMed Central

Li, Zhao-Qun; Ma, Long; Yin, Qian; Cai, Xiao-Ming; Luo, Zong-Xiu; Bian, Lei; Xin, Zhao-Jun; He, Peng; Chen, Zong-Mao

2018-01-01

Moths can biosynthesize sex pheromones in the female sex pheromone glands (PGs) and can distinguish species-specific sex pheromones using their antennae. However, the biosynthesis and transportation mechanism for Type II sex pheromone components has rarely been documented in moths. In this study, we constructed a massive PG transcriptome database (14.72 Gb) from a moth species, Ectropis grisescens, which uses type II sex pheromones and is a major tea pest in China. We further identified putative sex pheromone biosynthesis and transportation-related unigenes: 111 cytochrome P450 monooxygenases (CYPs), 25 odorant-binding proteins (OBPs), and 20 chemosensory proteins (CSPs). Tissue expression and phylogenetic tree analyses showed that one CYP (EgriCYP341-fragment3), one OBP (EgriOBP4), and one CSP (EgriCSP10) gene displayed an enriched expression in the PGs, and that EgriOBP2, 3, and 25 are clustered in the moth pheromone-binding protein clade. We considered these our candidate genes. Our results yielded large-scale PG sequence information for further functional studies. PMID:29317471

Characterization of the branched antimicrobial peptide M6 by analyzing its mechanism of action and in vivo toxicity.

PubMed

Pini, Alessandro; Giuliani, Andrea; Falciani, Chiara; Fabbrini, Monica; Pileri, Silvia; Lelli, Barbara; Bracci, Luisa

2007-06-01

We analyzed functional activity of the antimicrobial peptide M6 in vitro and in vivo. The peptide was identified by our group by phage library selection, rational modification and synthesis in a tetrabranched form (Pini et al., Antimicrob. Agents Chemother. 2005; 49: 2665-72). We found that it binds lipopolysaccharide, causes perforation of cell membranes without destroying external cell morphology and strongly binds DNA. The latter feature suggests that it could inhibit metabolic pathways, blocking DNA replication and/or transcription. We also observed that M6 does not stimulate humoral immune response when repeatedly administered to animals. We also analyzed M6 toxicity when administered to animals by intraperitoneal or by intravenous injection, determining a preliminary LD50 (125 and 37.5 mg/kg, respectively), which suggested that M6 could be used in vivo. These features make the antimicrobial branched peptide M6 a promising candidate for the development of a new antibacterial drug. Copyright (c) 2007 European Peptide Society and John Wiley & Sons, Ltd.

Molecular basis of Williams-Beuren syndrome: TFII-I regulated targets involved in craniofacial development.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2011-01-01

The aim of this study is to identify gene targets of TFII-I transcription factors involved in craniofacial development. Recent findings in individuals with Williams-Beuren syndrome who show facial dysmorphism and cognitive defects have pointed to TFII-I genes (GTF2I and GTF2IRD1) as the prime candidates responsible for these clinical features. However, TFII-I proteins are multifunctional transcriptional factors regulating a number of genes during development, and how their haploinsufficiency leads to the Williams-Beuren syndrome phenotype is currently unknown. Here we report the identification of three genes with a well-established relevance to craniofacial development as direct TFII-I targets. These genes, craniofacial development protein 1 (Cfdp1), Sec23 homolog A (Sec23a), and nuclear receptor binding SET domain protein 1 (Nsd1), contain consensus TFII-I binding sites in their proximal promoters; the chromatin immunoprecipitation analysis showed that TFII-I transcription factors are recruited to these sites in vivo. The results suggest that transcriptional regulation of these genes by TFII-I proteins could provide a possible genotype-phenotype link in Williams-Beuren syndrome.

Discovery of Nanomolar Desmuramylpeptide Agonists of the Innate Immune Receptor Nucleotide-Binding Oligomerization Domain-Containing Protein 2 (NOD2) Possessing Immunostimulatory Properties.

PubMed

Gobec, Martina; Tomašič, Tihomir; Štimac, Adela; Frkanec, Ruža; Trontelj, Jurij; Anderluh, Marko; Mlinarič-Raščan, Irena; Jakopin, Žiga

2018-04-12

Muramyl dipeptide (MDP), a fragment of bacterial peptidoglycan, has long been known as the smallest fragment possessing adjuvant activity, on the basis of its agonistic action on the nucleotide-binding oligomerization domain-containing protein 2 (NOD2). There is a pressing need for novel adjuvants, and NOD2 agonists provide an untapped source of potential candidates. Here, we report the design, synthesis, and characterization of a series of novel acyl tripeptides. A pivotal structural element for molecular recognition by NOD2 has been identified, culminating in the discovery of compound 9, the most potent desmuramylpeptide NOD2 agonist to date. Compound 9 augmented pro-inflammatory cytokine release from human peripheral blood mononuclear cells in synergy with lipopolysaccharide. Furthermore, it was able to induce ovalbumin-specific IgG titers in a mouse model of adjuvancy. These findings provide deeper insights into the structural requirements of desmuramylpeptides for NOD2-activation and highlight the potential use of NOD2 agonists as adjuvants for vaccines.

Identification of biosynthetic intermediates of teaghrelins and teaghrelin-like compounds in oolong teas, and their molecular docking to the ghrelin receptor.

PubMed

Hsieh, Sheng-Kuo; Lo, Yuan-Hao; Wu, Chia-Chang; Chung, Tse-Yu; Tzen, Jason T C

2015-12-01

Teaghrelins are unique acylated flavonoid tetraglycosides found in Chin-shin oolong tea, and have been demonstrated to be promising oral ghrelin analogues. The biosynthetic pathway of teaghrelins from quercetin-3-O-rutinoside (rutin) or kaempferol-3-O-rutinoside (nicotiflorin) was proposed to comprise three enzymatic steps according to the identification of putative intermediates in Chin-shin oolong tea. In addition to the two known teaghrelins in Chin-shin oolong tea, four teaghrelin-like compounds with different attachments of glycosides were identified in various oolong teas. Molecular modeling and docking were used to evaluate theoretically whether the putative biosynthetic intermediates of teaghrelins and the four teaghrelin-like compounds could be potential candidates of ghrelin analogues. The results showed that the attachment of a coumaroyl group was crucial for these tea compounds to bind to the ghrelin receptor. However, the additional attachment of a rhamnosyl glycoside to the flavonoid backbone of teaghrelin-like compounds at C-7 significantly reduced their binding affinity with the ghrelin receptor. Copyright © 2015. Published by Elsevier B.V.

ST7612AA1, a thioacetate-ω(γ-lactam carboxamide) derivative selected from a novel generation of oral HDAC inhibitors.

PubMed

Giannini, Giuseppe; Vesci, Loredana; Battistuzzi, Gianfranco; Vignola, Davide; Milazzo, Ferdinando M; Guglielmi, Mario Berardino; Barbarino, Marcella; Santaniello, Mosè; Fantò, Nicola; Mor, Marco; Rivara, Silvia; Pala, Daniele; Taddei, Maurizio; Pisano, Claudio; Cabri, Walter

2014-10-23

A systematic study of medicinal chemistry aimed at identifying a new generation of HDAC inhibitors, through the introduction of a thiol zinc-binding group (ZBG) and of an amide-lactam in the ω-position of the polyethylene chain of the vorinostat scaffold, allowed the selection of a new class of potent pan-HDAC inhibitors (pan-HDACis). Simple, highly versatile, and efficient synthetic approaches were used to synthesize a library of these new derivatives, which were then submitted to a screening for HDAC inhibition as well as to a preliminary in vitro assessment of their antiproliferative activity. Molecular docking into HDAC crystal structures suggested a binding mode for these thiol derivatives consistent with the stereoselectivity observed upon insertion of amide-lactam substituents in the ω-position. ST7612AA1 (117), selected as a drug candidate for further development, showed an in vitro activity in the nanomolar range associated with a remarkable in vivo antitumor activity, highly competitive with the most potent HDAC inhibitors, currently under clinical trials. A preliminary study of PK and metabolism is also illustrated.

Discovery of HIV Type 1 Aspartic Protease Hit Compounds through Combined Computational Approaches.

PubMed

Xanthopoulos, Dimitrios; Kritsi, Eftichia; Supuran, Claudiu T; Papadopoulos, Manthos G; Leonis, Georgios; Zoumpoulakis, Panagiotis

2016-08-05

A combination of computational techniques and inhibition assay experiments was employed to identify hit compounds from commercial libraries with enhanced inhibitory potency against HIV type 1 aspartic protease (HIV PR). Extensive virtual screening with the aid of reliable pharmacophore models yielded five candidate protease inhibitors. Subsequent molecular dynamics and molecular mechanics Poisson-Boltzmann surface area free-energy calculations for the five ligand-HIV PR complexes suggested a high stability of the systems through hydrogen-bond interactions between the ligands and the protease's flaps (Ile50/50'), as well as interactions with residues of the active site (Asp25/25'/29/29'/30/30'). Binding-energy calculations for the three most promising compounds yielded values between -5 and -10 kcal mol(-1) and suggested that van der Waals interactions contribute most favorably to the total energy. The predicted binding-energy values were verified by in vitro inhibition assays, which showed promising results in the high nanomolar range. These results provide structural considerations that may guide further hit-to-lead optimization toward improved anti-HIV drugs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Insulin-like growth factor binding protein-2: contributions of the C-terminal domain to insulin-like growth factor-1 binding.

PubMed

Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A

2006-03-01

Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.

Alzheimer's Therapeutics Targeting Amyloid Beta 1–42 Oligomers I: Abeta 42 Oligomer Binding to Specific Neuronal Receptors Is Displaced by Drug Candidates That Improve Cognitive Deficits

PubMed Central

Izzo, Nicholas J.; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F.; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M.

2014-01-01

Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1–42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors - i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics. PMID:25390368

Alzheimer's therapeutics targeting amyloid beta 1-42 oligomers I: Abeta 42 oligomer binding to specific neuronal receptors is displaced by drug candidates that improve cognitive deficits.

PubMed

Izzo, Nicholas J; Staniszewski, Agnes; To, Lillian; Fa, Mauro; Teich, Andrew F; Saeed, Faisal; Wostein, Harrison; Walko, Thomas; Vaswani, Anisha; Wardius, Meghan; Syed, Zanobia; Ravenscroft, Jessica; Mozzoni, Kelsie; Silky, Colleen; Rehak, Courtney; Yurko, Raymond; Finn, Patricia; Look, Gary; Rishton, Gilbert; Safferstein, Hank; Miller, Miles; Johanson, Conrad; Stopa, Edward; Windisch, Manfred; Hutter-Paier, Birgit; Shamloo, Mehrdad; Arancio, Ottavio; LeVine, Harry; Catalano, Susan M

2014-01-01

Synaptic dysfunction and loss caused by age-dependent accumulation of synaptotoxic beta amyloid (Abeta) 1-42 oligomers is proposed to underlie cognitive decline in Alzheimer's disease (AD). Alterations in membrane trafficking induced by Abeta oligomers mediates reduction in neuronal surface receptor expression that is the basis for inhibition of electrophysiological measures of synaptic plasticity and thus learning and memory. We have utilized phenotypic screens in mature, in vitro cultures of rat brain cells to identify small molecules which block or prevent the binding and effects of Abeta oligomers. Synthetic Abeta oligomers bind saturably to a single site on neuronal synapses and induce deficits in membrane trafficking in neuronal cultures with an EC50 that corresponds to its binding affinity. The therapeutic lead compounds we have found are pharmacological antagonists of Abeta oligomers, reducing the binding of Abeta oligomers to neurons in vitro, preventing spine loss in neurons and preventing and treating oligomer-induced deficits in membrane trafficking. These molecules are highly brain penetrant and prevent and restore cognitive deficits in mouse models of Alzheimer's disease. Counter-screening these compounds against a broad panel of potential CNS targets revealed they are highly potent and specific ligands of the sigma-2/PGRMC1 receptor. Brain concentrations of the compounds corresponding to greater than 80% receptor occupancy at the sigma-2/PGRMC1 receptor restore cognitive function in transgenic hAPP Swe/Ldn mice. These studies demonstrate that synthetic and human-derived Abeta oligomers act as pharmacologically-behaved ligands at neuronal receptors--i.e. they exhibit saturable binding to a target, they exert a functional effect related to their binding and their displacement by small molecule antagonists blocks their functional effect. The first-in-class small molecule receptor antagonists described here restore memory to normal in multiple AD models and sustain improvement long-term, representing a novel mechanism of action for disease-modifying Alzheimer's therapeutics.

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

Binding site concentration explains the differential susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-producing rice.

PubMed

Han, Lanzhi; Han, Chao; Liu, Zewen; Chen, Fajun; Jurat-Fuentes, Juan Luis; Hou, Maolin; Peng, Yufa

2014-08-01

Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Identification of novel candidate maternal serum protein markers for Down syndrome by integrated proteomic and bioinformatic analysis.

PubMed

Kang, Yuan; Dong, Xinran; Zhou, Qiongjie; Zhang, Ying; Cheng, Yan; Hu, Rong; Su, Cuihong; Jin, Hong; Liu, Xiaohui; Ma, Duan; Tian, Weidong; Li, Xiaotian

2012-03-01

This study aimed to identify candidate protein biomarkers from maternal serum for Down syndrome (DS) by integrated proteomic and bioinformatics analysis. A pregnancy DS group of 18 women and a control group with the same number were prepared, and the maternal serum proteins were analyzed by isobaric tags for relative and absolute quantitation and mass spectrometry, to identify DS differentially expressed maternal serum proteins (DS-DEMSPs). Comprehensive bioinformatics analysis was then employed to analyze DS-DEMSPs both in this paper and seven related publications. Down syndrome differentially expressed maternal serum proteins from different studies are significantly enriched with common Gene Ontology functions, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, transcription factor binding sites, and Pfam protein domains, However, the DS-DEMSPs are less functionally related to known DS-related genes. These evidences suggest that common molecular mechanisms induced by secondary effects may be present upon DS carrying. A simple scoring scheme revealed Alpha-2-macroglobulin, Apolipoprotein A1, Apolipoprotein E, Complement C1s subcomponent, Complement component 5, Complement component 8, alpha polypeptide, Complement component 8, beta polypeptide and Fibronectin as potential DS biomarkers. The integration of proteomics and bioinformatics studies provides a novel approach to develop new prenatal screening methods for noninvasive yet accurate diagnosis of DS. Copyright © 2012 John Wiley & Sons, Ltd.

Novel interactive partners of neuroligin 3: new aspects for pathogenesis of autism.

PubMed

Shen, Chen; Huo, Li-rong; Zhao, Xin-liang; Wang, Pei-rong; Zhong, Nanbert

2015-05-01

Autism is a neurodevelopmental disorder with a strong genetic predisposition. Neurolign 3 (NLGN3) as a postsynaptic transmembrane protein, functions in both neuron synaptogenesis and glia-neuron communications. Previously, a gain of function mutation (R451C) in NLGN3 was identified in autistic patients, which illustrates the involvement of NLGN3 in autism pathogenesis. As proper synaptic targeting and functioning are controlled by intracellular protein interactions, in the current study, we tried to discover the intracellular regulation network in which NLGN3 might be involved by a yeast two-hybrid-based interactor identification. Fifty-one protein candidate partners were identified after screening a human fetal complementary DNA (cDNA) library with an intracellular fragment of NLGN3. The interactions of NLGN3 with a subset of candidates, including EEF1A1, FLNA, ITPRIP, CYP11A1, MT-CO2, GPR175, ACOT2, and QPRT, were further validated in human neuroblastoma cells or brain tissues. Furthermore, our study suggested that NLGN3 was functioning in cytosolic calcium balance and participating in calcium-regulated cellular processes. Our findings of novel NLGN3 binding partners provide evidences of involvement of NLGN3 in multiple biological pathways, especially calcium regulating and mitochondrial function, thus suggesting further significance. This new data not only leads to a better understanding of the physiological functions of NLGN3, but also provide new aspects for pathogenesis of autism.

Trypanosoma equiperdum Low Molecular Weight Proteins As Candidates for Specific Serological Diagnosis of Dourine

PubMed Central

Luciani, Mirella; Di Febo, Tiziana; Orsini, Massimiliano; Krasteva, Ivanka; Cattaneo, Angela; Podaliri Vulpiani, Michele; Di Pancrazio, Chiara; Bachi, Angela; Tittarelli, Manuela

2018-01-01

The diagnosis of dourine can be difficult because the clinical signs of this disease in horses are similar to those of surra, caused by Trypanosoma evansi. Moreover, T. equiperdum and T. evansi are closely related and, so far, they cannot be distinguished using serological tests. In a previous work, the T. equiperdum protein pattern recognized by antibodies from dourine-infected horses and the humoral immune response kinetics were investigated by immunoblotting assay; a total of 20 sera from naturally and experimentally infected horses and from healthy animals were tested. Immunoblotting analysis showed that antibodies from infected horses specifically bind T. equiperdum low molecular weight proteins (from 16 to 35 kDa), which are not recognized by antibodies from uninfected horses. In this work, we tested other 615 sera (7 from naturally infected horses and 608 sera from healthy horses and donkeys): results confirmed the data obtained previously. In addition, six SDS-PAGE bands with molecular weight ranging from 10 to 37 kDa were analyzed by mass spectrometry, in order to identify immunogenic proteins that could be used as biomarkers for the diagnosis of dourine. A total of 167 proteins were identified. Among them, 37 were found unique for T. equiperdum. Twenty-four of them could represent possible candidate diagnostic antigens for the development of serological tests specific for T. equiperdum. PMID:29556505

Subsurface metagenomes uncover a vast repertoire of hypervariable proteins encoded by genetic elements in uncultivated organisms and viruses

NASA Astrophysics Data System (ADS)

Paul, B. G.; Burstein, D.; Castelle, C. J.; Banfield, J. F.; Valentine, D. L.; Miller, J. F.; Ghosh, P.; Handa, S.; Arambula, D.; Czornyj, E.; Thomas, B. C.

2016-12-01

Uncultivated microorganisms primarily account for the remarkable diversity harbored in subsurface environments and represent an expansive subset of the current Tree of Life. Recent metagenomic efforts to investigate subsurface biomes have unveiled an array of bacterial and archaeal candidate phyla, whose members have minimal genomes and an apparent host-dependent existence. Still, little is known about the adaptive strategies that mediate host interactions in these organisms or their viruses. Genomic features known as diversity-generating retroelements (DGRs), which guide variability into targeted genes, were recently discovered in two single-cell genomes of uncultivated nanoarchaea, and independently in the genome of a marine virus from methane seep sediments. These prodigious drivers of protein hypervariability were first identified as the key force behind phage tail fiber diversification for binding different host receptors. Since their discovery, approximately 500 new DGRs have been found across a wide range of bacterial genomes representing various niches. We identified an unexpected 1136 distinct diversifiers from a single groundwater environment in reconstructed microbial genomes and genome fragments. The newly detected DGRs - predominantly linked to members of the candidate phyla radiation (CPR) - appear to target genes associated with cell-cell attachment, signaling, and transcription regulation. These findings suggest that targeted protein diversification may have an important role in regulating symbiotic or parasitic associations in groundwater microbiomes.

High-throughput screening of hybridoma supernatants using multiplexed fluorescent cell barcoding on live cells.

PubMed

Lu, Mei; Chan, Brian M; Schow, Peter W; Chang, Wesley S; King, Chadwick T

2017-12-01

With current available assay formats using either immobilized protein (ELISA, enzyme-linked immunosorbent assay) or immunostaining of fixed cells for primary monoclonal antibody (mAb) screening, researchers often fail to identify and characterize antibodies that recognize the native conformation of cell-surface antigens. Therefore, screening using live cells has become an integral and important step contributing to the successful identification of therapeutic antibody candidates. Thus the need for developing high-throughput screening (HTS) technologies using live cells has become a major priority for therapeutic mAb discovery and development. We have developed a novel technique called Multiplexed Fluorescent Cell Barcoding (MFCB), a flow cytometry-based method based upon the Fluorescent Cell Barcoding (FCB) technique and the Luminex fluorescent bead array system, but is applicable to high-through mAb screens on live cells. Using this technique in our system, we can simultaneously identify or characterize the antibody-antigen binding of up to nine unique fluorescent labeled cell populations in the time that it would normally take to process a single population. This has significantly reduced the amount of time needed for the identification of potential lead candidates. This new technology enables investigators to conduct large-scale primary hybridoma screens using flow cytometry. This in turn has allowed us to screen antibodies more efficiently than before and streamline identification and characterization of lead molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

A Screen for Novel Phosphoinositide 3-kinase Effector Proteins*

PubMed Central

Dixon, Miles J.; Gray, Alexander; Boisvert, François-Michel; Agacan, Mark; Morrice, Nicholas A.; Gourlay, Robert; Leslie, Nicholas R.; Downes, C. Peter; Batty, Ian H.

2011-01-01

Class I phosphoinositide 3-kinases exert important cellular effects through their two primary lipid products, phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2). As few molecular targets for PtdIns(3,4)P2 have yet been identified, a screen for PI 3-kinase-responsive proteins that is selective for these is described. This features a tertiary approach incorporating a unique, primary recruitment of target proteins in intact cells to membranes selectively enriched in PtdIns(3,4)P2. A secondary purification of these proteins, optimized using tandem pleckstrin homology domain containing protein-1 (TAPP-1), an established PtdIns(3,4)P2 selective ligand, yields a fraction enriched in proteins of potentially similar lipid binding character that are identified by liquid chromatography-tandem MS. Thirdly, this approach is coupled to stable isotope labeling with amino acids in cell culture using differential isotope labeling of cells stimulated in the absence and presence of the PI 3-kinase inhibitor wortmannin. This provides a ratio-metric readout that distinguishes authentically responsive components from copurifying background proteins. Enriched fractions thus obtained from astrocytoma cells revealed a subset of proteins that exhibited ratios indicative of their initial, cellular responsiveness to PI 3-kinase activation. The inclusion among these of tandem pleckstrin homology domain containing protein-1, three isoforms of Akt, switch associated protein-70, early endosome antigen-1 and of additional proteins expressing recognized lipid binding domains demonstrates the utility of this strategy and lends credibility to the novel candidate proteins identified. The latter encompass a broad set of proteins that include the gene product of TBC1D2A, a putative Rab guanine nucleotide triphosphatase activating protein (GAP) and IQ motif containing GAP1, a potential tumor promoter. A sequence comparison of the former protein indicates the presence of a pleckstrin homology domain whose lipid binding character remains to be established. IQ motif containing GAP1 lacks known lipid interacting components and a preliminary analysis here indicates that this may exemplify a novel class of atypical phosphoinositide (aPI) binding domain. PMID:21263009

Wide screening of phage-displayed libraries identifies immune targets in planta.

PubMed

Rioja, Cristina; Van Wees, Saskia C; Charlton, Keith A; Pieterse, Corné M J; Lorenzo, Oscar; García-Sánchez, Susana

2013-01-01

Microbe-Associated Molecular Patterns and virulence effectors are recognized by plants as a first step to mount a defence response against potential pathogens. This recognition involves a large family of extracellular membrane receptors and other immune proteins located in different sub-cellular compartments. We have used phage-display technology to express and select for Arabidopsis proteins able to bind bacterial pathogens. To rapidly identify microbe-bound phage, we developed a monitoring method based on microarrays. This combined strategy allowed for a genome-wide screening of plant proteins involved in pathogen perception. Two phage libraries for high-throughput selection were constructed from cDNA of plants infected with Pseudomonas aeruginosa PA14, or from combined samples of the virulent isolate DC3000 of Pseudomonas syringae pv. tomato and its avirulent variant avrRpt2. These three pathosystems represent different degrees in the specificity of plant-microbe interactions. Libraries cover up to 2 × 10(7) different plant transcripts that can be displayed as functional proteins on the surface of T7 bacteriophage. A number of these were selected in a bio-panning assay for binding to Pseudomonas cells. Among the selected clones we isolated the ethylene response factor ATERF-1, which was able to bind the three bacterial strains in competition assays. ATERF-1 was rapidly exported from the nucleus upon infiltration of either alive or heat-killed Pseudomonas. Moreover, aterf-1 mutants exhibited enhanced susceptibility to infection. These findings suggest that ATERF-1 contains a microbe-recognition domain with a role in plant defence. To identify other putative pathogen-binding proteins on a genome-wide scale, the copy number of selected-vs.-total clones was compared by hybridizing phage cDNAs with Arabidopsis microarrays. Microarray analysis revealed a set of 472 candidates with significant fold change. Within this set defence-related genes, including well-known targets of bacterial effectors, are over-represented. Other genes non-previously related to defence can be associated through this study with general or strain-specific recognition of Pseudomonas.

Using a New Crustal Thickness Model to Test Previous Candidate Lunar Basins and to Search for New Candidates

NASA Technical Reports Server (NTRS)

Meyer, H. M.; Frey, H. V.

2012-01-01

A new crustal thickness model was used to test the viability of 110 candidate large lunar basins previously identified using older topographic and crustal thickness data as well as photogeologic data. The new model was also used to search for new candidate lunar basins greater than 300 km in diameter. We eliminated 11 of 27 candidates previously identified in the older crustal thickness model, and found strong evidence for at least 8 new candidates.

Inhibition of glycosylation on a camelid antibody uniquely affects its FcγRI binding activity.

PubMed

Krahn, Natalie; Spearman, Maureen; Meier, Markus; Dorion-Thibaudeau, July; McDougall, Matthew; Patel, Trushar R; De Crescenzo, Gregory; Durocher, Yves; Stetefeld, Jörg; Butler, Michael

2017-01-01

Glycoengineering of mAbs has become common practice in attempts to generate the ideal mAb candidate for a wide range of therapeutic applications. The effects of these glycan modifications on the binding affinity of IgG mAbs for FcγRIIIa and their cytotoxicity are well known. However, little is understood about the effect that these modifications have on binding to the high affinity FcγRI receptor. This study analyzed the effect of variable N-glycosylation on a human-llama hybrid mAb (EG2-hFc, 80kDa) binding to FcγRI including a comparison to a full-sized IgG1 (DP-12, 150kDa). This was achieved by the addition of three glycosylation inhibitors (swainsonine, castanospermine, and kifunensine) independently to Chinese hamster ovary (CHO) cell cultures to generate hybrid and high mannose glycan structures. Biophysical analysis by circular dichroism, dynamic light scattering and analytical ultra-centrifugation confirmed that the solution-behaviour of the mAbs remained constant over multiple concentrations and glycan treatments. However, changes were observed when studying the interaction of FcγRI with variously glycosylated mAbs. Both mAbs were observed to have a decreased binding affinity upon treatment with swainsonine which produced hybrid glycans. Following de-glycosylation the binding affinity for EG2-hFc was only marginally reduced (6-fold) compared to a drastic (118-fold) decrease for DP-12. In summary, our data suggest that the relatively low molecular weight of chimeric EG2-hFc may contribute to its enhanced stability against glycan changes making it a highly suitable mAb candidate for therapeutic applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification and prioritization of NUAK1 and PPP1CC as positional candidate loci for skeletal muscle strength phenotypes

PubMed Central

Windelinckx, An; De Mars, Gunther; Huygens, Wim; Peeters, Maarten W.; Vincent, Barbara; Wijmenga, Cisca; Lambrechts, Diether; Aerssens, Jeroen; Vlietinck, Robert; Beunen, Gaston

2011-01-01

Muscle strength is an important determinant in elite sports performance as well as in the activities of daily living. Muscle metabolism also plays a role in the genesis, and therefore prevention, of common pathological conditions and chronic diseases. Even though heritability estimates between 31 and 78% suggest a significant genetic component in muscle strength, only a limited number of genes influencing muscle strength have been identified. This study aimed to identify and prioritize positional candidate genes within a skeletal muscle strength quantitative trait locus on chromosome 12q22-23 for follow-up. A two-staged gene-centered fine-mapping approach using 122 single nucleotide polymorphisms (SNPs) in stage 1 identified a familybased association (n = 500) between several tagSNPs located in the ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 (ATP2A2; rs3026468), the NUAK family, SNF1-like kinase, 1 (NUAK1; rs10861553 and rs3741886), and the protein phosphatase 1, catalytic subunit, gamma isoform (PPP1CC; rs1050587 and rs7901769) genes and knee torque production (P values up to 0.00092). In stage 2, family-based association tests on additional putatively functional SNPs (e.g., exonic SNPs, SNPs in transcription factor binding sites or in conserved regions) in an enlarged sample (n = 536; 464 individuals overlap with stage 1) did not identify additional associations with muscle strength characteristics. Further in-depth analyses will be necessary to elucidate the exact role of ATP2A2, PPP1CC, and NUAK1 in muscle strength and to find out which functional polymorphisms are at the base of the interindividual strength differences. PMID:21750233

Ammonia binding to the oxygen-evolving complex of photosystem II identifies the solvent-exchangeable oxygen bridge (μ-oxo) of the manganese tetramer

PubMed Central

Pérez Navarro, Montserrat; Ames, William M.; Nilsson, Håkan; Lohmiller, Thomas; Pantazis, Dimitrios A.; Rapatskiy, Leonid; Nowaczyk, Marc M.; Neese, Frank; Boussac, Alain; Messinger, Johannes; Lubitz, Wolfgang; Cox, Nicholas

2013-01-01

The assignment of the two substrate water sites of the tetra-manganese penta-oxygen calcium (Mn4O5Ca) cluster of photosystem II is essential for the elucidation of the mechanism of biological O-O bond formation and the subsequent design of bio-inspired water-splitting catalysts. We recently demonstrated using pulsed EPR spectroscopy that one of the five oxygen bridges (μ-oxo) exchanges unusually rapidly with bulk water and is thus a likely candidate for one of the substrates. Ammonia, a water analog, was previously shown to bind to the Mn4O5Ca cluster, potentially displacing a water/substrate ligand [Britt RD, et al. (1989) J Am Chem Soc 111(10):3522–3532]. Here we show by a combination of EPR and time-resolved membrane inlet mass spectrometry that the binding of ammonia perturbs the exchangeable μ-oxo bridge without drastically altering the binding/exchange kinetics of the two substrates. In combination with broken-symmetry density functional theory, our results show that (i) the exchangable μ-oxo bridge is O5 {using the labeling of the current crystal structure [Umena Y, et al. (2011) Nature 473(7345):55–60]}; (ii) ammonia displaces a water ligand to the outer manganese (MnA4-W1); and (iii) as W1 is trans to O5, ammonia binding elongates the MnA4-O5 bond, leading to the perturbation of the μ-oxo bridge resonance and to a small change in the water exchange rates. These experimental results support O-O bond formation between O5 and possibly an oxyl radical as proposed by Siegbahn and exclude W1 as the second substrate water. PMID:24023065

p19-targeted ABD-derived protein variants inhibit IL-23 binding and exert suppressive control over IL-23-stimulated expansion of primary human IL-17+ T-cells.

PubMed

Křížová, Lucie; Kuchař, Milan; Petroková, Hana; Osička, Radim; Hlavničková, Marie; Pelák, Ondřej; Černý, Jiří; Kalina, Tomáš; Malý, Petr

2017-03-01

Interleukin-23 (IL-23), a heterodimeric cytokine of covalently bound p19 and p40 proteins, has recently been closely associated with development of several chronic autoimmune diseases such as psoriasis, psoriatic arthritis or inflammatory bowel disease. Released by activated dendritic cells, IL-23 interacts with IL-23 receptor (IL-23R) on Th17 cells, thus promoting intracellular signaling, a pivotal step in Th17-driven pro-inflammatory axis. Here, we aimed to block the binding of IL-23 cytokine to its cell-surface receptor by novel inhibitory protein binders targeted to the p19 subunit of human IL-23. To this goal, we used a combinatorial library derived from a scaffold of albumin-binding domain (ABD) of streptococcal protein G, and ribosome display selection, to yield a collection of ABD-derived p19-targeted variants, called ILP binders. From 214 clones analyzed by ELISA, Western blot and DNA sequencing, 53 provided 35 different sequence variants that were further characterized. Using in silico docking in combination with cell-surface competition binding assay, we identified a group of inhibitory candidates that substantially diminished binding of recombinant p19 to the IL-23R on human monocytic THP-1 cells. Of these best p19-blockers, ILP030, ILP317 and ILP323 inhibited IL-23-driven expansion of IL-17-producing primary human CD4 +  T-cells. Thus, these novel binders represent unique IL-23-targeted probes useful for IL-23/IL-23R epitope mapping studies and could be used for designing novel p19/IL-23-targeted anti-inflammatory biologics.

Human Leukocyte Antigen (HLA) B27 Allotype-Specific Binding and Candidate Arthritogenic Peptides Revealed through Heuristic Clustering of Data-independent Acquisition Mass Spectrometry (DIA-MS) Data*

PubMed Central

Schittenhelm, Ralf B.; Sivaneswaran, Saranjah; Lim Kam Sian, Terry C. C.; Croft, Nathan P.; Purcell, Anthony W.

2016-01-01

Expression of HLA-B27 is strongly associated with ankylosing spondylitis (AS) and other spondyloarthropathies. While this is true for the majority of HLA-B27 allotypes, HLA-B*27:06 and HLA-B*27:09 are not associated with AS. These two subtypes contain polymorphisms that are ideally positioned to influence the bound peptide repertoire. The existence of disease-inducing peptides (so-called arthritogenic peptides) has therefore been proposed that are exclusively presented by disease-associated HLA-B27 allotypes. However, we have recently demonstrated that this segregation of allotype-bound peptides is not the case and that many peptides that display sequence features predicted to favor binding to disease-associated subtypes are also capable of being presented naturally by protective alleles. To further probe more subtle quantitative changes in peptide presentation, we have used a combination of data-independent acquisition (DIA) and multiple reaction monitoring (MRM) mass spectrometry to quantify the abundance of 1646 HLA-B27 restricted peptides across the eight most frequent HLA-B27 allotypes (HLA-B*27:02-HLA-B*27:09). We utilized K means cluster analysis to group peptides with similar allelic binding preferences across the eight HLA-B27 allotypes, which enabled us to identify the most-stringent binding characteristics for each HLA-B27 allotype and further refined their existing consensus-binding motifs. Moreover, a thorough analysis of this quantitative dataset led to the identification of 26 peptides, which are presented in lower abundance by HLA-B*27:06 and HLA-B*27:09 compared with disease-associated HLA-B27 subtypes. Although these differences were observed to be very subtle, these 26 peptides might encompass the sought-after arthritogenic peptide(s). PMID:26929215

Middle-Down and Chemical Proteomic Approaches to Reveal Histone H4 Modification Dynamics in Cell Cycle: Label-Free Semi-Quantification of Histone Tail Peptide Modifications Including Phosphorylation and Highly Sensitive Capture of Histone PTM Binding Proteins Using Photo-Reactive Crosslinkers

PubMed Central

Yamamoto, Kazuki; Chikaoka, Yoko; Hayashi, Gosuke; Sakamoto, Ryosuke; Yamamoto, Ryuji; Sugiyama, Akira; Kodama, Tatsuhiko; Okamoto, Akimitsu; Kawamura, Takeshi

2015-01-01

Mass spectrometric proteomics is an effective approach for identifying and quantifying histone post-translational modifications (PTMs) and their binding proteins, especially in the cases of methylation and acetylation. However, another vital PTM, phosphorylation, tends to be poorly quantified because it is easily lost and inefficiently ionized. In addition, PTM binding proteins for phosphorylation are sometimes resistant to identification because of their variable binding affinities. Here, we present our efforts to improve the sensitivity of detection of histone H4 tail peptide phosphorylated at serine 1 (H4S1ph) and our successful identification of an H4S1ph binder candidate by means of a chemical proteomics approach. Our nanoLC-MS/MS system permitted semi-quantitative label-free analysis of histone H4 PTM dynamics of cell cycle-synchronized HeLa S3 cells, including phosphorylation, methylation, and acetylation. We show that H4S1ph abundance on nascent histone H4 unmethylated at lysine 20 (H4K20me0) peaks from late S-phase to M-phase. We also attempted to characterize effects of phosphorylation at H4S1 on protein–protein interactions. Specially synthesized photoaffinity bait peptides specifically captured 14-3-3 proteins as novel H4S1ph binding partners, whose interaction was otherwise undetectable by conventional peptide pull-down experiments. This is the first report that analyzes dynamics of PTM pattern on the whole histone H4 tail during cell cycle and enables the identification of PTM binders with low affinities using high-resolution mass spectrometry and photo-affinity bait peptides. PMID:26819910

Gene-set analysis based on the pharmacological profiles of drugs to identify repurposing opportunities in schizophrenia.

PubMed

de Jong, Simone; Vidler, Lewis R; Mokrab, Younes; Collier, David A; Breen, Gerome

2016-08-01

Genome-wide association studies (GWAS) have identified thousands of novel genetic associations for complex genetic disorders, leading to the identification of potential pharmacological targets for novel drug development. In schizophrenia, 108 conservatively defined loci that meet genome-wide significance have been identified and hundreds of additional sub-threshold associations harbour information on the genetic aetiology of the disorder. In the present study, we used gene-set analysis based on the known binding targets of chemical compounds to identify the 'drug pathways' most strongly associated with schizophrenia-associated genes, with the aim of identifying potential drug repositioning opportunities and clues for novel treatment paradigms, especially in multi-target drug development. We compiled 9389 gene sets (2496 with unique gene content) and interrogated gene-based p-values from the PGC2-SCZ analysis. Although no single drug exceeded experiment wide significance (corrected p<0.05), highly ranked gene-sets reaching suggestive significance including the dopamine receptor antagonists metoclopramide and trifluoperazine and the tyrosine kinase inhibitor neratinib. This is a proof of principle analysis showing the potential utility of GWAS data of schizophrenia for the direct identification of candidate drugs and molecules that show polypharmacy. © The Author(s) 2016.

Anti-CDR3 Therapy for B-Cell Malignancies

DTIC Science & Technology

2013-10-01

1-5 in the report). The "Tomlinson" human antibody phage library will be used to pan for antibodies that bind these target CDR3s and not the parent...selection of phage to a test antigen. Successful expression will lead directly to the selection of CDR3-specific antibody-encoding phage : from which we... phage that bind to the purified candidate antibody and not to irrelevant antibodies. Phage are from single chain Fv library. Sequence phage that

F199E substitution reduced toxicity of Clostridium perfringens epsilon toxin by depriving the receptor binding capability.

PubMed

Kang, Jingjing; Gao, Jie; Yao, Wenwu; Kang, Lin; Gao, Shan; Yang, Hao; Ji, Bin; Li, Ping; Liu, Jing; Yao, Jiahao; Xin, Wenwen; Zhao, Baohua; Wang, Jinglin

2017-07-03

Epsilon toxin (ETX), a potent toxin, is produced by types B and D strains of Clostridium perfringens, which could cause severe diseases in humans and domestic animals. Mutant rETX F199E was previously demonstrated to be a good vaccine candidate. However, the mechanism concerned remains unknown. To clarify how F199E substitution reduced ETX toxicity, we performed a series of experiments. The results showed that the cell-binding and pore-forming ability of rETX F199E was almost abolished. We speculated that F199E substitution reduced toxicity by depriving the receptor binding capability of ETX, which contributed to the hypothesis that domain I of ETX is responsible for cell binding. In addition, our data suggested that ETX could cause Ca 2+ release from intracellular Ca 2+ stores, which may underlie an alternate pathway leading to cell death. Furthermore, ETX induced crenation of the MDCK cells was observed, with sags and crests first appearing on the surface of condensed MDCK cells, according to scanning electron microscopy. The data also demonstrated the safety and potentiality of rETX F199E as a vaccine candidate for humans. In summary, findings of this work potentially contribute to a better understanding of the pathogenic mechanism of ETX and the development of vaccine against diseases caused by ETX, using mutant proteins.

F199E substitution reduced toxicity of Clostridium perfringens epsilon toxin by depriving the receptor binding capability

PubMed Central

Kang, Jingjing; Gao, Jie; Yao, Wenwu; Kang, Lin; Gao, Shan; Yang, Hao; Ji, Bin; Li, Ping; Liu, Jing; Yao, Jiahao; Xin, Wenwen; Zhao, Baohua; Wang, Jinglin

2017-01-01

ABSTRACT Epsilon toxin (ETX), a potent toxin, is produced by types B and D strains of Clostridium perfringens, which could cause severe diseases in humans and domestic animals. Mutant rETXF199E was previously demonstrated to be a good vaccine candidate. However, the mechanism concerned remains unknown. To clarify how F199E substitution reduced ETX toxicity, we performed a series of experiments. The results showed that the cell-binding and pore-forming ability of rETXF199E was almost abolished. We speculated that F199E substitution reduced toxicity by depriving the receptor binding capability of ETX, which contributed to the hypothesis that domain I of ETX is responsible for cell binding. In addition, our data suggested that ETX could cause Ca2+ release from intracellular Ca2+ stores, which may underlie an alternate pathway leading to cell death. Furthermore, ETX induced crenation of the MDCK cells was observed, with sags and crests first appearing on the surface of condensed MDCK cells, according to scanning electron microscopy. The data also demonstrated the safety and potentiality of rETXF199E as a vaccine candidate for humans. In summary, findings of this work potentially contribute to a better understanding of the pathogenic mechanism of ETX and the development of vaccine against diseases caused by ETX, using mutant proteins. PMID:28304231

3D-QSAR pharmacophore-based virtual screening, molecular docking and molecular dynamics simulation toward identifying lead compounds for NS2B-NS3 protease inhibitors.

PubMed

Luo, Pei H; Zhang, Xuan R; Huang, Lan; Yuan, Lun; Zhou, Xang Z; Gao, X; Li, Ling S

2017-10-01

NS2B-NS3 protease has been identified to serve as lead drug design target due to its significant role in West Nile viral (WNV) and dengue virus (DENV) reproduction and replication. There are currently no approved chemotherapeutic drugs and effective vaccines to inhibit DENV and WNV infections. In this work, 3D-QSAR pharmacophore model has been developed to discover potential inhibitory candidates. Validation through Fischer's model and decoy test indicate that the developed 3D pharmacophore model is highly predictive for DENV inhibitors, which was then employed to screen ZINC chemical library to obtain reasonable hits. Following ADMET filtering, 15 hits were subjected to further filter through molecular docking and CoMFA modeling. Finally, top three hits were identified as lead compounds or potential inhibitory candidates with IC 50 values of ∼0.4637 µM and fitness of ∼57.73. It is implied from CoMFA modeling that substituents at the side site of benzotriazole such as a p-nitro group (e.g. biphenyl head) and a carbonyl (e.g. carboxylate function) at the side site of furan or amino group may improve bioactivity of ZINC85645245, respectively. Molecular dynamics simulations (MDS) were performed to discover new interactions and reinforce the binding modes from docking for the hits also. The QSAR and MDS results obtained from this work should be useful in determining structural requirements for inhibitor development as well as in designing more potential inhibitors for NS2B-NS3 protease.

Global Microarray Analysis of Carbohydrate Use in Alkaliphilic Hemicellulolytic Bacterium Bacillus sp. N16-5

PubMed Central

Song, Yajian; Xue, Yanfen; Ma, Yanhe

2013-01-01

The alkaliphilic hemicellulolytic bacterium Bacillus sp. N16-5 has a broad substrate spectrum and exhibits the capacity to utilize complex carbohydrates such as galactomannan, xylan, and pectin. In the monosaccharide mixture, sequential utilization by Bacillus sp. N16-5 was observed. Glucose appeared to be its preferential monosaccharide, followed by fructose, mannose, arabinose, xylose, and galactose. Global transcription profiles of the strain were determined separately for growth on six monosaccharides (glucose, fructose, mannose, galactose, arabinose, and xylose) and four polysaccharides (galactomannan, xylan, pectin, and sodium carboxymethylcellulose) using one-color microarrays. Numerous genes potentially related to polysaccharide degradation, sugar transport, and monosaccharide metabolism were found to respond to a specific substrate. Putative gene clusters for different carbohydrates were identified according to transcriptional patterns and genome annotation. Identification and analysis of these gene clusters contributed to pathway reconstruction for carbohydrate utilization in Bacillus sp. N16-5. Several genes encoding putative sugar transporters were highly expressed during growth on specific sugars, suggesting their functional roles. Two phosphoenolpyruvate-dependent phosphotransferase systems were identified as candidate transporters for mannose and fructose, and a major facilitator superfamily transporter was identified as a candidate transporter for arabinose and xylose. Five carbohydrate uptake transporter 1 family ATP-binding cassette transporters were predicted to participate in the uptake of hemicellulose and pectin degradation products. Collectively, microarray data improved the pathway reconstruction involved in carbohydrate utilization of Bacillus sp. N16-5 and revealed that the organism precisely regulates gene transcription in response to fluctuations in energy resources. PMID:23326578

Small Molecule Screen for Candidate Antimalarials Targeting Plasmodium Kinesin-5*

PubMed Central

Liu, Liqiong; Richard, Jessica; Kim, Sunyoung; Wojcik, Edward J.

2014-01-01

Plasmodium falciparum and vivax are responsible for the majority of malaria infections worldwide, resulting in over a million deaths annually. Malaria parasites now show measured resistance to all currently utilized drugs. Novel antimalarial drugs are urgently needed. The Plasmodium Kinesin-5 mechanoenzyme is a suitable “next generation” target. Discovered via small molecule screen experiments, the human Kinesin-5 has multiple allosteric sites that are “druggable.” One site in particular, unique in its sequence divergence across all homologs in the superfamily and even within the same family, exhibits exquisite drug specificity. We propose that Plasmodium Kinesin-5 shares this allosteric site and likewise can be targeted to uncover inhibitors with high specificity. To test this idea, we performed a screen for inhibitors selective for Plasmodium Kinesin-5 ATPase activity in parallel with human Kinesin-5. Our screen of nearly 2000 compounds successfully identified compounds that selectively inhibit both P. vivax and falciparum Kinesin-5 motor domains but, as anticipated, do not impact human Kinesin-5 activity. Of note is a candidate drug that did not biochemically compete with the ATP substrate for the conserved active site or disrupt the microtubule-binding site. Together, our experiments identified MMV666693 as a selective allosteric inhibitor of Plasmodium Kinesin-5; this is the first identified protein target for the Medicines of Malaria Venture validated collection of parasite proliferation inhibitors. This work demonstrates that chemical screens against human kinesins are adaptable to homologs in disease organisms and, as such, extendable to strategies to combat infectious disease. PMID:24737313

Towards Rational Design of a Toxoid Vaccine against the Heat-Stable Toxin of Escherichia coli

PubMed Central

Taxt, Arne M.; Diaz, Yuleima; Aasland, Rein; Clements, John D.; Nataro, James P.; Sommerfelt, Halvor

2016-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrheal disease and death in children <5 years old. ETEC strains that express the heat-stable toxin (ST), with or without the heat-labile toxin, are among the four most important diarrhea-causing pathogens. This makes ST an attractive target for an ETEC vaccine. An ST vaccine should be nontoxic and elicit an immune response that neutralizes native ST without cross-reacting with the human endogenous guanylate cyclase C receptor ligands. To identify variants of ST with no or low toxicity, we screened a library of all 361 possible single-amino-acid mutant forms of ST by using the T84 cell assay. Moreover, we identified mutant variants with intact epitopes by screening for the ability to bind neutralizing anti-ST antibodies. ST mutant forms with no or low toxicity and intact epitopes are termed toxoid candidates, and the top 30 candidates all had mutations of residues A14, N12, and L9. The identification of nontoxic variants of L9 strongly suggests that it is a novel receptor-interacting residue, in addition to the previously identified N12, P13, and A14 residues. The screens also allowed us to map the epitopes of three neutralizing monoclonal antibodies, one of which cross-reacts with the human ligand uroguanylin. The common dominant epitope residue for all non-cross-reacting antibodies was Y19. Our results suggest that it should be possible to rationally design ST toxoids that elicit neutralizing immune responses against ST with minimal risk of immunological cross-reactivity. PMID:26883587

Microfluidic Devices for Automation of Assays on Drosophila Melanogaster for Applications in Drug Discovery and Biological Studies.

PubMed

Ghaemi, Reza; Selvaganapathy, Ponnambalam R

Drug discovery is a long and expensive process, which usually takes 12-15 years and could cost up to ~$1 billion. Conventional drug discovery process starts with high throughput screening and selection of drug candidates that bind to specific target associated with a disease condition. However, this process does not consider whether the chosen candidate is optimal not only for binding but also for ease of administration, distribution in the body, effect of metabolism and associated toxicity if any. A holistic approach, using model organisms early in the drug discovery process to select drug candidates that are optimal not only in binding but also suitable for administration, distribution and are not toxic is now considered as a viable way for lowering the cost and time associated with the drug discovery process. However, the conventional drug discovery assays using Drosophila are manual and required skill operator, which makes them expensive and not suitable for high-throughput screening. Recently, microfluidics has been used to automate many of the operations (e.g. sorting, positioning, drug delivery) associated with the Drosophila drug discovery assays and thereby increase their throughput. This review highlights recent microfluidic devices that have been developed for Drosophila assays with primary application towards drug discovery for human diseases. The microfluidic devices that have been reviewed in this paper are categorized based on the stage of the Drosophila that have been used. In each category, the microfluidic technologies behind each device are described and their potential biological applications are discussed.

Conserved and Variant Epitopes of Plasmodium vivax Duffy Binding Protein as Targets of Inhibitory Monoclonal Antibodies

PubMed Central

Ntumngia, Francis B.; Schloegel, Jesse; Barnes, Samantha J.; McHenry, Amy M.; Singh, Sanjay; King, Christopher L.

2012-01-01

The Duffy binding protein (DBP) is a vital ligand for Plasmodium vivax blood-stage merozoite invasion, making the molecule an attractive vaccine candidate against vivax malaria. Similar to other blood-stage vaccine candidates, DBP allelic variation eliciting a strain-specific immunity may be a major challenge for development of a broadly effective vaccine against vivax malaria. To understand whether conserved epitopes can be the target of neutralizing anti-DBP inhibition, we generated a set of monoclonal antibodies to DBP and functionally analyzed their reactivity to a panel of allelic variants. Quantitative analysis by enzyme-linked immunosorbent assay (ELISA) determined that some monoclonal antibodies reacted strongly with epitopes conserved on all DBP variants tested, while reactivity of others was allele specific. Qualitative analysis characterized by anti-DBP functional inhibition using an in vitro erythrocyte binding inhibition assay indicated that there was no consistent correlation between the endpoint titers and functional inhibition. Some monoclonal antibodies were broadly inhibitory while inhibition of others varied significantly by target allele. These data demonstrate a potential for vaccine-elicited immunization to target conserved epitopes but optimization of DBP epitope target specificity and immunogenicity may be necessary for protection against diverse P. vivax strains. PMID:22215740

Conserved and variant epitopes of Plasmodium vivax Duffy binding protein as targets of inhibitory monoclonal antibodies.

PubMed

Ntumngia, Francis B; Schloegel, Jesse; Barnes, Samantha J; McHenry, Amy M; Singh, Sanjay; King, Christopher L; Adams, John H

2012-03-01

The Duffy binding protein (DBP) is a vital ligand for Plasmodium vivax blood-stage merozoite invasion, making the molecule an attractive vaccine candidate against vivax malaria. Similar to other blood-stage vaccine candidates, DBP allelic variation eliciting a strain-specific immunity may be a major challenge for development of a broadly effective vaccine against vivax malaria. To understand whether conserved epitopes can be the target of neutralizing anti-DBP inhibition, we generated a set of monoclonal antibodies to DBP and functionally analyzed their reactivity to a panel of allelic variants. Quantitative analysis by enzyme-linked immunosorbent assay (ELISA) determined that some monoclonal antibodies reacted strongly with epitopes conserved on all DBP variants tested, while reactivity of others was allele specific. Qualitative analysis characterized by anti-DBP functional inhibition using an in vitro erythrocyte binding inhibition assay indicated that there was no consistent correlation between the endpoint titers and functional inhibition. Some monoclonal antibodies were broadly inhibitory while inhibition of others varied significantly by target allele. These data demonstrate a potential for vaccine-elicited immunization to target conserved epitopes but optimization of DBP epitope target specificity and immunogenicity may be necessary for protection against diverse P. vivax strains.

An engineered vaccine of the Plasmodium vivax Duffy binding protein enhances induction of broadly neutralizing antibodies.

PubMed

Ntumngia, Francis B; Pires, Camilla V; Barnes, Samantha J; George, Miriam T; Thomson-Luque, Richard; Kano, Flora S; Alves, Jessica R S; Urusova, Darya; Pereira, Dhelio B; Tolia, Niraj H; King, Christopher L; Carvalho, Luzia H; Adams, John H

2017-10-23

Plasmodium vivax invasion into human reticulocytes is a complex process. The Duffy binding protein (DBP) dimerization with its cognate receptor is vital for junction formation in the invasion process. Due to its functional importance, DBP is considered a prime vaccine candidate, but variation in B-cell epitopes at the dimer interface of DBP leads to induction of strain-limited immunity. We believe that the polymorphic residues tend to divert immune responses away from functionally conserved epitopes important for receptor binding or DBP dimerization. As a proof of concept, we engineered the vaccine DEKnull to ablate the dominant Bc epitope to partially overcome strain-specific immune antibody responses. Additional surface engineering on the next generation immunogen, DEKnull-2, provides an immunogenicity breakthrough to conserved protective epitopes. DEKnull-2 elicits a stronger broadly neutralizing response and reactivity with long-term persistent antibody responses of acquired natural immunity. By using novel engineered DBP immunogens, we validate that the prime targets of protective immunity are conformational epitopes at the dimer interface. These successful results indicate a potential approach that can be used generally to improve efficacy of other malaria vaccine candidates.

Discovery of DNA dyes Hoechst 34580 and 33342 as good candidates for inhibiting amyloid beta formation: in silico and in vitro study

NASA Astrophysics Data System (ADS)

Thai, Nguyen Quoc; Tseng, Ning-Hsuan; Vu, Mui Thi; Nguyen, Tin Trung; Linh, Huynh Quang; Hu, Chin-Kun; Chen, Yun-Ru; Li, Mai Suan

2016-08-01

Combining Lipinski's rule with the docking and steered molecular dynamics simulations and using the PubChem data base of about 1.4 million compounds, we have obtained DNA dyes Hoechst 34580 and Hoechst 33342 as top-leads for the Alzheimer's disease. The binding properties of these ligands to amyloid beta (Aβ) fibril were thoroughly studied by in silico and in vitro experiments. Hoechst 34580 and Hoechst 33342 prefer to locate near hydrophobic regions with binding affinity mainly governed by the van der Waals interaction. By the Thioflavin T assay, it was found that the inhibition constant IC50 ≈ 0.86 and 0.68 μM for Hoechst 34580 and Hoechst 33342, respectively. This result qualitatively agrees with the binding free energy estimated using the molecular mechanic-Poisson Boltzmann surface area method and all-atom simulations with the AMBER-f99SB-ILDN force field and water model TIP3P. In addition, DNA dyes have the high capability to cross the blood brain barrier. Thus, both in silico and in vitro experiments have shown that Hoechst 34580 and 33342 are good candidates for treating the Alzheimer's disease by inhibiting Aβ formation.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

PubMed

Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

2016-01-01

The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies

PubMed Central

Rickert, Keith W.; Grinberg, Luba; Woods, Robert M.; Wilson, Susan; Bowen, Michael A.; Baca, Manuel

2016-01-01

ABSTRACT The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3–5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

Overcoming Antigenic Diversity by Enhancing the Immunogenicity of Conserved Epitopes on the Malaria Vaccine Candidate Apical Membrane Antigen-1

PubMed Central

Dutta, Sheetij; Dlugosz, Lisa S.; Drew, Damien R.; Ge, Xiopeng; Ababacar, Diouf; Rovira, Yazmin I.; Moch, J. Kathleen; Shi, Meng; Long, Carole A.; Foley, Michael; Beeson, James G.; Anders, Robin F.; Miura, Kazutoyo; Haynes, J. David; Batchelor, Adrian H.

2013-01-01

Malaria vaccine candidate Apical Membrane Antigen-1 (AMA1) induces protection, but only against parasite strains that are closely related to the vaccine. Overcoming the AMA1 diversity problem will require an understanding of the structural basis of cross-strain invasion inhibition. A vaccine containing four diverse allelic proteins 3D7, FVO, HB3 and W2mef (AMA1 Quadvax or QV) elicited polyclonal rabbit antibodies that similarly inhibited the invasion of four vaccine and 22 non-vaccine strains of P. falciparum. Comparing polyclonal anti-QV with antibodies against a strain-specific, monovalent, 3D7 AMA1 vaccine revealed that QV induced higher levels of broadly inhibitory antibodies which were associated with increased conserved face and domain-3 responses and reduced domain-2 response. Inhibitory monoclonal antibodies (mAb) raised against the QV reacted with a novel cross-reactive epitope at the rim of the hydrophobic trough on domain-1; this epitope mapped to the conserved face of AMA1 and it encompassed the 1e-loop. MAbs binding to the 1e-loop region (1B10, 4E8 and 4E11) were ∼10-fold more potent than previously characterized AMA1-inhibitory mAbs and a mode of action of these 1e-loop mAbs was the inhibition of AMA1 binding to its ligand RON2. Unlike the epitope of a previously characterized 3D7-specific mAb, 1F9, the 1e-loop inhibitory epitope was partially conserved across strains. Another novel mAb, 1E10, which bound to domain-3, was broadly inhibitory and it blocked the proteolytic processing of AMA1. By itself mAb 1E10 was weakly inhibitory but it synergized with a previously characterized, strain-transcending mAb, 4G2, which binds close to the hydrophobic trough on the conserved face and inhibits RON2 binding to AMA1. Novel inhibition susceptible regions and epitopes, identified here, can form the basis for improving the antigenic breadth and inhibitory response of AMA1 vaccines. Vaccination with a few diverse antigenic proteins could provide universal coverage by redirecting the immune response towards conserved epitopes. PMID:24385910

Cardio-vascular safety beyond hERG: in silico modelling of a guinea pig right atrium assay

NASA Astrophysics Data System (ADS)

Fenu, Luca A.; Teisman, Ard; De Buck, Stefan S.; Sinha, Vikash K.; Gilissen, Ron A. H. J.; Nijsen, Marjoleen J. M. A.; Mackie, Claire E.; Sanderson, Wendy E.

2009-12-01

As chemists can easily produce large numbers of new potential drug candidates, there is growing demand for high capacity models that can help in driving the chemistry towards efficacious and safe candidates before progressing towards more complex models. Traditionally, the cardiovascular (CV) safety domain plays an important role in this process, as many preclinical CV biomarkers seem to have high prognostic value for the clinical outcome. Throughout the industry, traditional ion channel binding data are generated to drive the early selection process. Although this assay can generate data at high capacity, it has the disadvantage of producing high numbers of false negatives. Therefore, our company applies the isolated guinea pig right atrium (GPRA) assay early-on in discovery. This functional multi-channel/multi-receptor model seems much more predictive in identifying potential CV liabilities. Unfortunately however, its capacity is limited, and there is no room for full automation. We assessed the correlation between ion channel binding and the GPRA's Rate of Contraction (RC), Contractile Force (CF), and effective refractory frequency (ERF) measures assay using over six thousand different data points. Furthermore, the existing experimental knowledge base was used to develop a set of in silico classification models attempting to mimic the GPRA inhibitory activity. The Naïve Bayesian classifier was used to built several models, using the ion channel binding data or in silico computed properties and structural fingerprints as descriptors. The models were validated on an independent and diverse test set of 200 reference compounds. Performances were assessed on the bases of their overall accuracy, sensitivity and specificity in detecting both active and inactive molecules. Our data show that all in silico models are highly predictive of actual GPRA data, at a level equivalent or superior to the ion channel binding assays. Furthermore, the models were interpreted in terms of the descriptors used to highlight the undesirable areas in the explored chemical space, specifically regions of low polarity, high lipophilicity and high molecular weight. In conclusion, we developed a predictive in silico model of a complex physiological assay based on a large and high quality set of experimental data. This model allows high throughput in silico safety screening based on chemical structure within a given chemical space.