Identifying Developmental Zones in Maize Lateral Root Cell Length Profiles using Multiple Change-Point Models

PubMed Central

Moreno-Ortega, Beatriz; Fort, Guillaume; Muller, Bertrand; Guédon, Yann

2017-01-01

The identification of the limits between the cell division, elongation and mature zones in the root apex is still a matter of controversy when methods based on cellular features, molecular markers or kinematics are compared while methods based on cell length profiles have been comparatively underexplored. Segmentation models were developed to identify developmental zones within a root apex on the basis of epidermal cell length profiles. Heteroscedastic piecewise linear models were estimated for maize lateral roots of various lengths of both wild type and two mutants affected in auxin signaling (rtcs and rum-1). The outputs of these individual root analyses combined with morphological features (first root hair position and root diameter) were then globally analyzed using principal component analysis. Three zones corresponding to the division zone, the elongation zone and the mature zone were identified in most lateral roots while division zone and sometimes elongation zone were missing in arrested roots. Our results are consistent with an auxin-dependent coordination between cell flux, cell elongation and cell differentiation. The proposed segmentation models could extend our knowledge of developmental regulations in longitudinally organized plant organs such as roots, monocot leaves or internodes. PMID:29123533

IMMU-22. ADOPTIVE CELL THERAPY AGAINST DIPG USING DEVELOPMENTALLY REGULATED ANTIGENS

PubMed Central

Flores, Catherine; Gil, Jorge; Abraham, Rebecca; Pham, Christina; Wildes, Tyler; Moore, Ginger; Drake, Jeffrey; Dyson, Kyle; Mitchell, Duane

2017-01-01

Abstract INTRODUCTION: Diffuse intrinsic pontine glioma (DIPG) survival has remained static over decades and DIPG is now the main cause of brain tumor-related deaths in children. Immunotherapy has emerged as a treatment modality with the highest curative potential in patients with refractory malignancies. Our group has pioneered an adoptive cell therapy platform employing total tumor RNA pulsed dendritic cells to generate large amounts of polyclonal antigen-specific T cells in both human and murine systems. As DIPGs are embryonal tumors, our objective in this proposal is to identify a set of developmentally regulated antigens that are overexpressed during oncogenesis of DIPG in order to cause immunological rejection of this tumor without the need for tumor tissue. METHODS: We employ RNA-pulsed bone marrow-derived dendritic cells to ex vivo activate tumor-reactive T cells for use in adoptive cell therapy. Here we use either total RNA isolated from tumor tissue, (TTRNA) or developmental antigens (DevAg) RNA isolated from postnatal day 4 murine brain stem. Either TTRNA-T cells or DevAg-T cells were used in adoptive cell therapy against a preclinical model of DIPG. RESULTS: Pediatric brain tumors are bland relative to peripheral tumors in terms of high expression of immunogenic antigens. Since DIPG antigens remain largely uncharacterized, we used total RNA isolated from tumor cells to generate tumor-specific T cells to use for our therapeutic approach to first demonstrate that immune responses can be generated against this tumor. We also successfully generated immunity against DIPG in a preclinical model using DevAg-T cells for adoptive cell therapy. CONCLUSION: The region- and age- specific nature of DIPG suggests that the underlying pathophysiology likely involves dysregulation of a postnatal neurodevelopmental process which occurs in embryonal tumors. Here we leverage this and demonstrate that DIPG can be effectively treated using adoptive cell therapy against

An Atypical Phr Peptide Regulates the Developmental Switch Protein RapH ▿ †

PubMed Central

Mirouze, Nicolas; Parashar, Vijay; Baker, Melinda D.; Dubnau, David A.; Neiditch, Matthew B.

2011-01-01

Under conditions of nutrient limitation and high population density, the bacterium Bacillus subtilis can initiate a variety of developmental pathways. The signaling systems regulating B. subtilis differentiation are tightly controlled by switch proteins called Raps, named after the founding members of the family, which were shown to be response regulator aspartate phosphatases. A phr gene encoding a secreted pentapeptide that regulates the activity of its associated Rap protein was previously identified downstream of 8 of the chromosomally encoded rap genes. We identify and validate here the sequence of an atypical Phr peptide, PhrH, by in vivo and in vitro analyses. Using a luciferase reporter bioassay combined with in vitro experiments, we found that PhrH is a hexapeptide (TDRNTT), in contrast to the other characterized Phr pentapeptides. We also determined that phrH expression is driven by a promoter lying within rapH. Unlike the previously identified dedicated σH-driven phr promoters, it appears that phrH expression most likely requires σA. Furthermore, we show that PhrH can antagonize both of the known activities of RapH: the dephosphorylation of Spo0F and the sequestration of ComA, thus promoting the development of spores and the competent state. Finally, we propose that PhrH is the prototype of a newly identified class of Phr signaling molecules consisting of six amino acids. This class likely includes PhrI, which regulates RapI and the expression, excision, and transfer of the mobile genetic element ICEBs1. PMID:21908671

Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

PubMed

Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

2016-02-01

Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life

A Temporal Chromatin Signature in Human Embryonic Stem Cells Identifies Regulators of Cardiac Development

PubMed Central

Paige, Sharon L.; Thomas, Sean; Stoick-Cooper, Cristi L.; Wang, Hao; Maves, Lisa; Sandstrom, Richard; Pabon, Lil; Reinecke, Hans; Pratt, Gabriel; Keller, Gordon; Moon, Randall T.; Stamatoyannopoulos, John; Murry, Charles E.

2012-01-01

Summary Directed differentiation of human embryonic stem cells (ESCs) into cardiovascular cells provides a model for studying molecular mechanisms of human cardiovascular development. Though it is known that chromatin modification patterns in ESCs differ markedly from those in lineage-committed progenitors and differentiated cells, the temporal dynamics of chromatin alterations during differentiation along a defined lineage have not been studied. We show that differentiation of human ESCs into cardiovascular cells is accompanied by programmed temporal alterations in chromatin structure that distinguish key regulators of cardiovascular development from other genes. We used this temporal chromatin signature to identify regulators of cardiac development, including the homeobox gene MEIS2. We demonstrate using the zebrafish model that MEIS2 is critical for proper heart tube formation and subsequent cardiac looping. Temporal chromatin signatures should be broadly applicable to other models of stem cell differentiation to identify regulators and provide key insights into major developmental decisions. PMID:22981225

Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

PubMed Central

Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

2016-01-01

For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

Developmental regulation of fear learning and anxiety behavior by endocannabinoids

PubMed Central

Lee, Tiffany T.-Y.; Hill, Matthew N.; Lee, Francis S.

2015-01-01

The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic endocannabinoid signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that endocannabinoid signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic endocannabinoid signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the endocannabinoid system and discuss clinical and rodent models demonstrating endocannabinoid regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the endocannabinoid system in the central nervous system, and models of pharmacological augmentation of endocannabinoid signaling during development in the context of fear learning and anxiety. PMID:26419643

Developmental regulation of fear learning and anxiety behavior by endocannabinoids.

PubMed

Lee, T T-Y; Hill, M N; Lee, F S

2016-01-01

The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid (eCB) system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic eCB signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that eCB signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic eCB signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the eCB system and discuss clinical and rodent models showing eCB regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the eCB system in the central nervous system, and models of pharmacological augmentation of eCB signaling during development in the context of fear learning and anxiety. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Aspp2 negatively regulates body growth but not developmental timing by modulating IRS signaling in zebrafish embryos.

PubMed

Liu, Chengdong; Luan, Jing; Bai, Yan; Li, Yun; Lu, Ling; Liu, Yunzhang; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Duan, Cunming; Zhou, Jianfeng

2014-02-01

The growth and developmental rate of developing embryos and fetus are tightly controlled and coordinated to maintain proper body shape and size. The insulin receptor substrate (IRS) proteins, key intracellular transducers of insulin and insulin-like growth factor signaling, play essential roles in the regulation of growth and development. A short isoform of apoptosis-stimulating protein of p53 2 (ASPP2) was recently identified as a binding partner of IRS-1 and IRS-2 in mammalian cells in vitro. However, it is unclear whether ASPP2 plays any role in vertebrate embryonic growth and development. Here, we show that zebrafish Aspp2a and Aspp2b negatively regulate embryonic growth without affecting developmental rate. Human ASPP2 had similar effects on body growth in zebrafish embryos. Aspp2a and 2b inhibit Akt signaling. This inhibition was reversed by coinjection of myr-Akt1, a constitutively active form of Akt1. Zebrafish Aspp2a and Aspp2b physically bound with Irs-1, and the growth inhibitory effects of ASPP2/Aspp2 depend on the presence of their ankyrin repeats and SH3 domains. These findings uncover a novel role of Aspp2 in regulating vertebrate embryonic growth. Copyright © 2013 Elsevier Inc. All rights reserved.

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Developmental delays in emotion regulation strategies in preschoolers with autism.

PubMed

Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

2017-11-01

Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These

Developmental Origins of Infant Emotion Regulation: Mediation by Temperamental Negativity and Moderation by Maternal Sensitivity

ERIC Educational Resources Information Center

Thomas, Jenna C.; Letourneau, Nicole; Campbell, Tavis S.; Tomfohr-Madsen, Lianne; Giesbrecht, Gerald F.

2017-01-01

Emotion regulation is essential to cognitive, social, and emotional development and difficulties with emotion regulation portend future socioemotional, academic, and behavioral difficulties. There is growing awareness that many developmental outcomes previously thought to begin their development in the postnatal period have their origins in the…

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Multiple developmental mechanisms regulate species-specific jaw size

PubMed Central

Fish, Jennifer L.; Sklar, Rachel S.; Woronowicz, Katherine C.; Schneider, Richard A.

2014-01-01

Variation in jaw size during evolution has been crucial for the adaptive radiation of vertebrates, yet variation in jaw size during development is often associated with disease. To test the hypothesis that early developmental events regulating neural crest (NC) progenitors contribute to species-specific differences in size, we investigated mechanisms through which two avian species, duck and quail, achieve their remarkably different jaw size. At early stages, duck exhibit an anterior shift in brain regionalization yielding a shorter, broader, midbrain. We find no significant difference in the total number of pre-migratory NC; however, duck concentrate their pre-migratory NC in the midbrain, which contributes to an increase in size of the post-migratory NC population allocated to the mandibular arch. Subsequent differences in proliferation lead to a progressive increase in size of the duck mandibular arch relative to that of quail. To test the role of pre-migratory NC progenitor number in regulating jaw size, we reduced and augmented NC progenitors. In contrast to previous reports of regeneration by NC precursors, we find that neural fold extirpation results in a loss of NC precursors. Despite this reduction in their numbers, post-migratory NC progenitors compensate, producing a symmetric and normal-sized jaw. Our results suggest that evolutionary modification of multiple aspects of NC cell biology, including NC allocation within the jaw primordia and NC-mediated proliferation, have been important to the evolution of jaw size. Furthermore, our finding of NC post-migratory compensatory mechanisms potentially extends the developmental time frame for treatments of disease or injury associated with NC progenitor loss. PMID:24449843

miR-14 regulates autophagy during developmental cell death by targeting ip3-kinase 2.

PubMed

Nelson, Charles; Ambros, Victor; Baehrecke, Eric H

2014-11-06

Macroautophagy (autophagy) is a lysosome-dependent degradation process that has been implicated in age-associated diseases. Autophagy is involved in both cell survival and cell death, but little is known about the mechanisms that distinguish its use during these distinct cell fates. Here, we identify the microRNA miR-14 as being both necessary and sufficient for autophagy during developmentally regulated cell death in Drosophila. Loss of miR-14 prevented induction of autophagy during salivary gland cell death, but had no effect on starvation-induced autophagy in the fat body. Moreover, misexpression of miR-14 was sufficient to prematurely induce autophagy in salivary glands, but not in the fat body. Importantly, miR-14 regulates this context-specific autophagy through its target, inositol 1,4,5-trisphosphate kinase 2 (ip3k2), thereby affecting inositol 1,4,5-trisphosphate (IP3) signaling and calcium levels during salivary gland cell death. This study provides in vivo evidence of microRNA regulation of autophagy through modulation of IP3 signaling. Copyright © 2014 Elsevier Inc. All rights reserved.

Identifying developmental vascular disruptor compounds using a predictive signature and alternative toxicity models

EPA Science Inventory

Identifying Developmental Vascular Disruptor Compounds Using a Predictive Signature and Alternative Toxicity Models Presenting Author: Tamara Tal Affiliation: U.S. EPA/ORD/ISTD, RTP, NC, USA Chemically induced vascular toxicity during embryonic development can result in a wide...

Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

ERIC Educational Resources Information Center

de Oliveira, Rita F.; Wann, John P.

2011-01-01

In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

GLUCOCORTICOID RECEPTOR REGULATION IN THE RAT EMBRYO: A POTENTIAL SITE FOR DEVELOPMENTAL TOXICITY?

EPA Science Inventory

Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?

Ghosh B, Wood CR, Held GA, Abbott BD, Lau C.

National Research Council, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711, USA.

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

PubMed

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome Analysis Identified a Novel Mutation in the RBP4 Gene in a Consanguineous Pedigree with Retinal Dystrophy and Developmental Abnormalities

PubMed Central

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V.; Chavali, Venkata R. M.; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G. Bhanuprakash; Sieving, Paul A.; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism. PMID:23189188

Identifying candidate genes affecting developmental time in Drosophila melanogaster: pervasive pleiotropy and gene-by-environment interaction

PubMed Central

Mensch, Julián; Lavagnino, Nicolás; Carreira, Valeria Paula; Massaldi, Ana; Hasson, Esteban; Fanara, Juan José

2008-01-01

Background Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait. Results We analyzed 179 co-isogenic single P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25°C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17°C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes. Conclusion We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Developmental model of static allometry in holometabolous insects.

PubMed

Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W

2008-08-22

The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.

IT-25DEVELOPMENTALLY REGULATED ANTIGENS FOR IMMUNOLOGIC TARGETING OF MEDULLOBLASTOMA SUBTYPES

PubMed Central

Pham, Christina; Flores, Catherine; Pei, Yanxin; Wechsler-Reya, Robert; Mitchell, Duane

2014-01-01

INTRODUCTION: Medulloblastoma (MB) remains incurable in one third of patients despite aggressive multi-modality standard therapies. Immunotherapy presents a promising alternative by specifically targeting cancer cells. To date, there have been no successful immunologic applications targeting MB. Emerging evidence from integrated genomic studies has suggested MB variants arise from deregulation of pathways affecting proliferation of progenitor cell populations within the developing cerebellum. Using total embryonic RNA as a source of tumor rejection antigens is attractive because it can be delivered as a single vaccine, target both known and unknown fetal proteins, and can be refined to preferentially treat distinct MB subtypes. METHODS: We have created two transplantable, syngeneic animal MB models recapitulating human SHH and Group 3 variants to investigate the immunologic targeting of different MB subtypes. We generated T cells specific to the developing mouse cerebellum (P5) and tested their reactivity to target cells pulsed with total RNA from two MB subtypes and the normal brain. Immune responses were evaluated by measuring cytokine secretion following re-stimulation of activated T cells with both normal and tumor cell targets. In vivo antitumor efficacy was also tested in survival studies of intracranial tumor-bearing animals. RESULTS: We generated T cells specific to the developing cerebellum in vitro, confirming the immunogenicity of developmentally regulated antigens. Additionally, we have shown that developmental antigen-specific T cells produce high levels of Th1-type cytokines in response to tumor cells of two immunologically distinct subtypes of MB. Interestingly, developmental antigen specific T cells do not show cross reactivity with the normal brain or subsequent stages of the developing brain after P5. Targeting developmental antigens also conferred a significant survival benefit in a treatment model of Group 3 tumor bearing animals. CONCLUSIONS

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

PubMed

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes

PubMed Central

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-01-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404

Self-Regulation and Math Attitudes: Effects on Academic Performance in Developmental Math Courses at a Community College

ERIC Educational Resources Information Center

Otts, Cynthia D.

2010-01-01

The purpose of the study was to investigate the relationship among math attitudes, self-regulated learning, and course outcomes in developmental math. Math attitudes involved perceived usefulness of math and math anxiety. Self-regulated learning represented the ability of students to control cognitive, metacognitive, and behavioral aspects of…

BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

PubMed

Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

2010-08-01

Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

Onto-clust--a methodology for combining clustering analysis and ontological methods for identifying groups of comorbidities for developmental disorders.

PubMed

Peleg, Mor; Asbeh, Nuaman; Kuflik, Tsvi; Schertz, Mitchell

2009-02-01

Children with developmental disorders usually exhibit multiple developmental problems (comorbidities). Hence, such diagnosis needs to revolve on developmental disorder groups. Our objective is to systematically identify developmental disorder groups and represent them in an ontology. We developed a methodology that combines two methods (1) a literature-based ontology that we created, which represents developmental disorders and potential developmental disorder groups, and (2) clustering for detecting comorbid developmental disorders in patient data. The ontology is used to interpret and improve clustering results and the clustering results are used to validate the ontology and suggest directions for its development. We evaluated our methodology by applying it to data of 1175 patients from a child development clinic. We demonstrated that the ontology improves clustering results, bringing them closer to an expert generated gold-standard. We have shown that our methodology successfully combines an ontology with a clustering method to support systematic identification and representation of developmental disorder groups.

Evolution of developmental regulation in the vertebrate FgfD subfamily.

PubMed

Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

2010-01-15

Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

PubMed Central

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

PubMed

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-09-15

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

ERIC Educational Resources Information Center

Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

2016-01-01

The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao

PubMed Central

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-01-01

Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity.

PubMed

Terenzi, Fulvia; Ladd, Andrea N

2010-01-01

Muscleblind-like (MBNL) proteins have been shown to regulate pre-mRNA alternative splicing, and MBNL1 has been implicated in regulating fetal-to-adult transitions in alternative splicing in the heart. MBNL1 is highly conserved, exhibiting more than 95% identity at the amino acid level between birds and mammals. To investigate MBNL1 expression during embryonic heart development, we examined MBNL1 transcript and protein expression in the embryonic chicken heart from the formation of the primitive heart tube through cardiac morphogenesis (embryonic days 1.5 through 8). MBNL1 transcript levels remained steady throughout these stages, whereas MBNL1 protein levels increased and exhibited a shift in isoforms. MBNL1 has several alternatively spliced exons. Using RT-PCR, we determined that the inclusion of one of these, exon 5, decreases dramatically during cardiac morphogenesis. This developmental transition is conserved in mice. Functional analyses of MBNL1 isoforms containing or lacking exon 5-encoded sequences revealed that exon 5 is important for the regulation of the subcellular localization, RNA binding affinity, and alternative splicing activity of MBNL1 proteins. A second MBNL protein, MBNL2, is also expressed in the embryonic heart. We found that MBNL2 exon 5, which is paralogous to MBNL1 exon 5, is similarly regulated during embryonic heart development. Analysis of MBNL1 and MBNL2 transcripts in several embryonic tissues in chicken and mouse indicate that exon 5 alternative splicing is highly conserved and tissue-specific. Thus, we propose that conserved developmental stage- and tissue-specific alternative splicing of MBNL transcripts is an important mechanism by which MBNL activity is regulated during embryonic development.

Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

PubMed Central

Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

2013-01-01

Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

Neuropeptides: Developmental Signals in Placode Progenitor Formation

PubMed Central

Lleras-Forero, Laura; Tambalo, Monica; Christophorou, Nicolas; Chambers, David; Houart, Corinne; Streit, Andrea

2013-01-01

Summary Few families of signaling factors have been implicated in the control of development. Here, we identify the neuropeptides nociceptin and somatostatin, a neurotransmitter and neuroendocrine hormone, as a class of developmental signals in both chick and zebrafish. We show that signals from the anterior mesendoderm are required for the formation of anterior placode progenitors, with one of the signals being somatostatin. Somatostatin controls ectodermal expression of nociceptin, and both peptides regulate Pax6 in lens and olfactory progenitors. Consequently, loss of somatostatin and nociceptin signaling leads to severe reduction of lens formation. Our findings not only uncover these neuropeptides as developmental signals but also identify a long-sought-after mechanism that initiates Pax6 in placode progenitors and may explain the ancient evolutionary origin of neuropeptides, predating a complex nervous system. PMID:23906067

Apoplastic and intracellular plant sugars regulate developmental transitions in witches' broom disease of cacao.

PubMed

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-03-01

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Identifying Medication Management Smartphone App Features Suitable for Young Adults With Developmental Disabilities: Delphi Consensus Study

PubMed Central

Salgado, Teresa M; Fedrigon, Alexa; Riccio Omichinski, Donna; Meade, Michelle A

2018-01-01

Background Smartphone apps can be a tool to facilitate independent medication management among persons with developmental disabilities. At present, multiple medication management apps exist in the market, but only 1 has been specifically designed for persons with developmental disabilities. Before initiating further app development targeting this population, input from stakeholders including persons with developmental disabilities, caregivers, and professionals regarding the most preferred features should be obtained. Objective The aim of this study was to identify medication management app features that are suitable to promote independence in the medication management process by young adults with developmental disabilities using a Delphi consensus method. Methods A compilation of medication management app features was performed by searching the iTunes App Store, United States, in February 2016, using the following terms: adherence, medication, medication management, medication list, and medication reminder. After identifying features within the retrieved apps, a final list of 42 features grouped into 4 modules (medication list, medication reminder, medication administration record, and additional features) was included in a questionnaire for expert consensus rating. A total of 52 experts in developmental disabilities, including persons with developmental disabilities, caregivers, and professionals, were invited to participate in a 3-round Delphi technique. The purpose was to obtain consensus on features that are preferred and suitable to promote independence in the medication management process among persons with developmental disabilities. Consensus for the first, second, and third rounds was defined as ≥90%, ≥80%, and ≥75% agreement, respectively. Results A total of 75 responses were received over the 3 Delphi rounds—30 in the first round, 24 in the second round, and 21 in the third round. At the end of the third round, cumulative consensus was achieved

Analysis of a developmentally regulated nuclear localization signal in Xenopus

PubMed Central

1992-01-01

The 289 residue nuclear oncoprotein encoded by the adenovirus 5 Ela gene contains two peptide sequences that behave as nuclear localization signals (NLS). One signal, located at the carboxy terminus, is like many other known NLSs in that it consists of a short stretch of basic residues (KRPRP) and is constitutively active in cells. The second signal resides within an internal 45 residue region of E1a that contains few basic residues or sequences that resemble other known NLSs. Moreover, this internal signal functions in injected Xenopus oocytes, but not in transfected Xenopus A6 cells, suggesting that it could be regulated developmentally (Slavicek et al. 1989. J. Virol. 63:4047). In this study, we show that the activity of this signal is sensitive to ATP depletion in vivo, efficiently directs the import of a 50 kD fusion protein and can compete with the E1a carboxy-terminal NLS for nuclear import. In addition, we have delineated the precise amino acid residues that comprise the second E1a NLS, and have assessed its utilization during Xenopus embryogenesis. Using amino acid deletion and substitution analyses, we show that the signal consists of the sequence FV(X)7-20MXSLXYM(X)4MF. By expressing in Xenopus embryos a truncated E1a protein that contains only the second NLS and by monitoring its cytoplasmic/nuclear distribution during development with indirect immunofluorescence, we find that the second NLS is utilized up to the early neurula stage. In addition, there appears to be a hierarchy among the embryonic germ layers as to when the second NLS becomes nonfunctional. For this reason, we refer to this NLS as the developmentally regulated nuclear localization signal (drNLS). The implications of these findings for early development are discussed. PMID:1387407

Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

PubMed

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

76 FR 39234 - Federal Acquisition Regulation; Unique Procurement Instrument Identifier

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-05

...-AL70 Federal Acquisition Regulation; Unique Procurement Instrument Identifier AGENCIES: Department of... Acquisition Regulation (FAR) to standardize use of unique Procurement Instrument Identifiers (PIID) throughout... Acquisition Council and the Defense Acquisition Regulations Council (the Councils) reviewed the public...

Cellular manganese content is developmentally regulated in human dopaminergic neurons

NASA Astrophysics Data System (ADS)

Kumar, Kevin K.; Lowe, Edward W., Jr.; Aboud, Asad A.; Neely, M. Diana; Redha, Rey; Bauer, Joshua A.; Odak, Mihir; Weaver, C. David; Meiler, Jens; Aschner, Michael; Bowman, Aaron B.

2014-10-01

Manganese (Mn) is both an essential biological cofactor and neurotoxicant. Disruption of Mn biology in the basal ganglia has been implicated in the pathogenesis of neurodegenerative disorders, such as parkinsonism and Huntington's disease. Handling of other essential metals (e.g. iron and zinc) occurs via complex intracellular signaling networks that link metal detection and transport systems. However, beyond several non-selective transporters, little is known about the intracellular processes regulating neuronal Mn homeostasis. We hypothesized that small molecules that modulate intracellular Mn could provide insight into cell-level Mn regulatory mechanisms. We performed a high throughput screen of 40,167 small molecules for modifiers of cellular Mn content in a mouse striatal neuron cell line. Following stringent validation assays and chemical informatics, we obtained a chemical `toolbox' of 41 small molecules with diverse structure-activity relationships that can alter intracellular Mn levels under biologically relevant Mn exposures. We utilized this toolbox to test for differential regulation of Mn handling in human floor-plate lineage dopaminergic neurons, a lineage especially vulnerable to environmental Mn exposure. We report differential Mn accumulation between developmental stages and stage-specific differences in the Mn-altering activity of individual small molecules. This work demonstrates cell-level regulation of Mn content across neuronal differentiation.

Using cluster ensemble and validation to identify subtypes of pervasive developmental disorders.

PubMed

Shen, Jess J; Lee, Phil-Hyoun; Holden, Jeanette J A; Shatkay, Hagit

2007-10-11

Pervasive Developmental Disorders (PDD) are neurodevelopmental disorders characterized by impairments in social interaction, communication and behavior. Given the diversity and varying severity of PDD, diagnostic tools attempt to identify homogeneous subtypes within PDD. Identifying subtypes can lead to targeted etiology studies and to effective type-specific intervention. Cluster analysis can suggest coherent subsets in data; however, different methods and assumptions lead to different results. Several previous studies applied clustering to PDD data, varying in number and characteristics of the produced subtypes. Most studies used a relatively small dataset (fewer than 150 subjects), and all applied only a single clustering method. Here we study a relatively large dataset (358 PDD patients), using an ensemble of three clustering methods. The results are evaluated using several validation methods, and consolidated through an integration step. Four clusters are identified, analyzed and compared to subtypes previously defined by the widely used diagnostic tool DSM-IV.

Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

PubMed

Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

2016-07-01

Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

The Paradox of Regulations: A Commentary.

ERIC Educational Resources Information Center

Taylor, Steven J.

1992-01-01

This response to previous symposium papers (EC 604 155-161) concerning regulations and quality assurance in Intermediate Care Facilities for the Mentally Retarded (ICF/MR) sees regulations as the bureaucratization of values, identifies paradoxes implicit in regulatory controls, and urges reform of the current developmental disability service…

Insulin/Insulin-like growth factor signaling controls non-Dauer developmental speed in the nematode Caenorhabditis elegans.

PubMed

Ruaud, Anne-Françoise; Katic, Iskra; Bessereau, Jean-Louis

2011-01-01

Identified as a major pathway controlling entry in the facultative dauer diapause stage, the DAF-2/Insulin receptor (InsR) signaling acts in multiple developmental and physiological regulation events in Caenorhabditis elegans. Here we identified a role of the insulin-like pathway in controlling developmental speed during the C. elegans second larval stage. This role relies on the canonical DAF-16/FOXO-dependent branch of the insulin-like signaling and is largely independent of dauer formation. Our studies provide further evidence for broad conservation of insulin/insulin-like growth factor (IGF) functions in developmental speed control.

3D sorghum reconstructions from depth images identify QTL regulating shoot architecture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mccormick, Ryan F.; Truong, Sandra K.; Mullet, John E.

Dissecting the genetic basis of complex traits is aided by frequent and nondestructive measurements. Advances in range imaging technologies enable the rapid acquisition of three-dimensional (3D) data from an imaged scene. A depth camera was used to acquire images of sorghum (Sorghum bicolor), an important grain, forage, and bioenergy crop, at multiple developmental time points from a greenhouse-grown recombinant inbred line population. A semiautomated software pipeline was developed and used to generate segmented, 3D plant reconstructions from the images. Automated measurements made from 3D plant reconstructions identified quantitative trait loci for standard measures of shoot architecture, such as shoot height,more » leaf angle, and leaf length, and for novel composite traits, such as shoot compactness. The phenotypic variability associated with some of the quantitative trait loci displayed differences in temporal prevalence; for example, alleles closely linked with the sorghum Dwarf3 gene, an auxin transporter and pleiotropic regulator of both leaf inclination angle and shoot height, influence leaf angle prior to an effect on shoot height. Furthermore, variability in composite phenotypes that measure overall shoot architecture, such as shoot compactness, is regulated by loci underlying component phenotypes like leaf angle. As such, depth imaging is an economical and rapid method to acquire shoot architecture phenotypes in agriculturally important plants like sorghum to study the genetic basis of complex traits.« less

3D sorghum reconstructions from depth images identify QTL regulating shoot architecture

DOE PAGES

Mccormick, Ryan F.; Truong, Sandra K.; Mullet, John E.

2016-08-15

Dissecting the genetic basis of complex traits is aided by frequent and nondestructive measurements. Advances in range imaging technologies enable the rapid acquisition of three-dimensional (3D) data from an imaged scene. A depth camera was used to acquire images of sorghum (Sorghum bicolor), an important grain, forage, and bioenergy crop, at multiple developmental time points from a greenhouse-grown recombinant inbred line population. A semiautomated software pipeline was developed and used to generate segmented, 3D plant reconstructions from the images. Automated measurements made from 3D plant reconstructions identified quantitative trait loci for standard measures of shoot architecture, such as shoot height,more » leaf angle, and leaf length, and for novel composite traits, such as shoot compactness. The phenotypic variability associated with some of the quantitative trait loci displayed differences in temporal prevalence; for example, alleles closely linked with the sorghum Dwarf3 gene, an auxin transporter and pleiotropic regulator of both leaf inclination angle and shoot height, influence leaf angle prior to an effect on shoot height. Furthermore, variability in composite phenotypes that measure overall shoot architecture, such as shoot compactness, is regulated by loci underlying component phenotypes like leaf angle. As such, depth imaging is an economical and rapid method to acquire shoot architecture phenotypes in agriculturally important plants like sorghum to study the genetic basis of complex traits.« less

Using Cluster Ensemble and Validation to Identify Subtypes of Pervasive Developmental Disorders

PubMed Central

Shen, Jess J.; Lee, Phil Hyoun; Holden, Jeanette J.A.; Shatkay, Hagit

2007-01-01

Pervasive Developmental Disorders (PDD) are neurodevelopmental disorders characterized by impairments in social interaction, communication and behavior.1 Given the diversity and varying severity of PDD, diagnostic tools attempt to identify homogeneous subtypes within PDD. Identifying subtypes can lead to targeted etiology studies and to effective type-specific intervention. Cluster analysis can suggest coherent subsets in data; however, different methods and assumptions lead to different results. Several previous studies applied clustering to PDD data, varying in number and characteristics of the produced subtypes19. Most studies used a relatively small dataset (fewer than 150 subjects), and all applied only a single clustering method. Here we study a relatively large dataset (358 PDD patients), using an ensemble of three clustering methods. The results are evaluated using several validation methods, and consolidated through an integration step. Four clusters are identified, analyzed and compared to subtypes previously defined by the widely used diagnostic tool DSM-IV.2 PMID:18693920

SNAT2 and LAT1 transporter abundance is developmentally regulated in skeletal muscle of neonatal pigs

USDA-ARS?s Scientific Manuscript database

Previously, we demonstrated that the insulin and amino acid–induced activation of the mammalian target of rapamycin complex 1 (mTORC1), is developmentally regulated in neonatal pigs. Recent studies have indicated an important role of the System A transporters (SNAT2 and SLC1A5) and the L transporter...

Drosophila Fragile X Mental Retardation Protein Developmentally Regulates Activity-Dependent Axon Pruning

PubMed Central

Tessier, Charles R.; Broadie, Kendal

2014-01-01

Summary Fragile X Syndrome (FraX) is a broad-spectrum neurological disorder with symptoms ranging from hyperexcitability to mental retardation and autism. Loss of the fragile X mental retardation 1 (fmr1) gene product, the mRNA-binding translational regulator FMRP, causes structural over-elaboration of dendritic and axonal processes as well as functional alterations in synaptic plasticity at maturity. It is unclear, however, whether FraX is primarily a disease of development, a disease of plasticity or both; a distinction vital for engineering intervention strategies. To address this critical issue, we have used the Drosophila FraX model to investigate the developmental roles of Drosophila FMRP (dFMRP). dFMRP expression and regulation of chickadee/profilin coincides with a transient window of late brain development. During this time, dFMRP is positively regulated by sensory input activity, and required to limit axon growth and for efficient activity-dependent pruning of axon branches in the Mushroom Body learning/memory center. These results demonstrate that dFMRP has a primary role in activity-dependent neural circuit refinement in late brain development. PMID:18321984

New Directions in Developmental Emotion Regulation Research across the Life Span: Introduction to the Special Section

ERIC Educational Resources Information Center

Zimmermann, Peter; Thompson, Ross A.

2014-01-01

Research on the development of emotion regulation has become a prominent topic in developmental science covering a broad age range from infancy to old age because of its theoretical importance and practical implications. This introductory essay of this special section includes reflections on some of the conceptual themes of this research field and…

Early developmental gene regulation in Strongylocentrotus purpuratus embryos in response to elevated CO₂ seawater conditions.

PubMed

Hammond, LaTisha M; Hofmann, Gretchen E

2012-07-15

Ocean acidification, or the increased uptake of CO(2) by the ocean due to elevated atmospheric CO(2) concentrations, may variably impact marine early life history stages, as they may be especially susceptible to changes in ocean chemistry. Investigating the regulatory mechanisms of early development in an environmental context, or ecological development, will contribute to increased understanding of potential organismal responses to such rapid, large-scale environmental changes. We examined transcript-level responses to elevated seawater CO(2) during gastrulation and the initiation of spiculogenesis, two crucial developmental processes in the purple sea urchin, Strongylocentrotus purpuratus. Embryos were reared at the current, accepted oceanic CO(2) concentration of 380 microatmospheres (μatm), and at the elevated levels of 1000 and 1350 μatm, simulating predictions for oceans and upwelling regions, respectively. The seven genes of interest comprised a subset of pathways in the primary mesenchyme cell gene regulatory network (PMC GRN) shown to be necessary for the regulation and execution of gastrulation and spiculogenesis. Of the seven genes, qPCR analysis indicated that elevated CO(2) concentrations only had a significant but subtle effect on two genes, one important for early embryo patterning, Wnt8, and the other an integral component in spiculogenesis and biomineralization, SM30b. Protein levels of another spicule matrix component, SM50, demonstrated significant variable responses to elevated CO(2). These data link the regulation of crucial early developmental processes with the environment that these embryos would be developing within, situating the study of organismal responses to ocean acidification in a developmental context.

Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

PubMed

Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

2013-09-01

Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using Formative Assessment and Self-Regulated Learning to Help Developmental Mathematics Students Achieve: A Multi-Campus Program

ERIC Educational Resources Information Center

Hudesman, John; Crosby, Sara; Ziehmke, Niesha; Everson, Howard; Issac, Sharlene; Flugman, Bert; Zimmerman, Barry; Moylan, Adam

2014-01-01

The authors describe an Enhanced Formative Assessment and Self-Regulated Learning (EFA-SRL) program designed to improve the achievement of community college students enrolled in developmental mathematics courses. Their model includes the use of specially formatted quizzes designed to assess both the students' mathematics and metacognitive skill…

Developmental stage-specific regulation of the circadian clock by temperature in zebrafish.

PubMed

Lahiri, Kajori; Froehlich, Nadine; Heyd, Andreas; Foulkes, Nicholas S; Vallone, Daniela

2014-01-01

The circadian clock enables animals to adapt their physiology and behaviour in anticipation of the day-night cycle. Light and temperature represent two key environmental timing cues (zeitgebers) able to reset this mechanism and so maintain its synchronization with the environmental cycle. One key challenge is to unravel how the regulation of the clock by zeitgebers matures during early development. The zebrafish is an ideal model for studying circadian clock ontogeny since the process of development occurs ex utero in an optically transparent chorion and many tools are available for genetic analysis. However, the role played by temperature in regulating the clock during zebrafish development is poorly understood. Here, we have established a clock-regulated luciferase reporter transgenic zebrafish line (Tg (-3.1) per1b::luc) to study the effects of temperature on clock entrainment. We reveal that under complete darkness, from an early developmental stage onwards (48 to 72 hpf), exposure to temperature cycles is a prerequisite for the establishment of self-sustaining rhythms of zfper1b, zfaanat2, and zfirbp expression and also for circadian cell cycle rhythms. Furthermore, we show that following the 5-9 somite stage, the expression of zfper1b is regulated by acute temperature shifts.

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

PubMed

Stiles, Kari A; Van Volkenburgh, Elizabeth

2002-07-01

Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

Markers of Developmentally Regulated Programmed Cell Death and Their Analysis in Cereal Seeds.

PubMed

Domínguez, Fernando; Cejudo, Francisco Javier

2018-01-01

Programmed cell death (PCD) is a key process for the development and differentiation of multicellular organisms, which is characterized by well-defined morphological and biochemical features. These include chromatin condensation, DNA degradation and nuclear fragmentation, with nucleases and proteases playing a relevant function in these processes. In this chapter we describe methods routinely used for the analysis of hallmarks of developmentally regulated PCD in cereal seed tissues, which are based on agarose and polyacrylamide gel electrophoresis, in situ staining of DNA fragmentation, and cell-free assays of relevant enzymatic activities.

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism.

PubMed

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R; Raikhel, Natasha V

2015-01-06

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.

Identifying the Physical Fitness, Anthropometric and Athletic Movement Qualities Discriminant of Developmental Level in Elite Junior Australian Football: Implications for the Development of Talent.

PubMed

Gaudion, Sarah L; Doma, Kenji; Sinclair, Wade; Banyard, Harry G; Woods, Carl T

2017-07-01

Gaudion, SL, Doma, K, Sinclair, W, Banyard, HG, and Woods, CT. Identifying the physical fitness, anthropometric and athletic movement qualities discriminant of developmental level in elite junior Australian football: implications for the development of talent. J Strength Cond Res 31(7): 1830-1839, 2017-This study aimed to identify the physical fitness, anthropometric and athletic movement qualities discriminant of developmental level in elite junior Australian football (AF). From a total of 77 players, 2 groups were defined according to their developmental level; under 16 (U16) (n = 40, 15.6 to 15.9 years), and U18 (n = 37, 17.1 to 17.9 years). Players performed a test battery consisting of 7 physical fitness assessments, 2 anthropometric measurements, and a fundamental athletic movement assessment. A multivariate analysis of variance tested the main effect of developmental level (2 levels: U16 and U18) on the assessment criterions, whilst binary logistic regression models and receiver operating characteristic (ROC) curves were built to identify the qualities most discriminant of developmental level. A significant effect of developmental level was evident on 9 of the assessments (d = 0.27-0.88; p ≤ 0.05). However, it was a combination of body mass, dynamic vertical jump height (nondominant leg), repeat sprint time, and the score on the 20-m multistage fitness test that provided the greatest association with developmental level (Akaike's information criterion = 80.84). The ROC curve was maximized with a combined score of 180.7, successfully discriminating 89 and 60% of the U18 and U16 players, respectively (area under the curve = 79.3%). These results indicate that there are distinctive physical fitness and anthropometric qualities discriminant of developmental level within the junior AF talent pathway. Coaches should consider these differences when designing training interventions at the U16 level to assist with the development of prospective U18 AF players.

Developmental Programming of Branching Morphogenesis in the Kidney

PubMed Central

Schneider, Laura; Al-Awqati, Qais

2015-01-01

The kidney developmental program encodes the intricate branching and organization of approximately 1 million functional units (nephrons). Branching regulation is poorly understood, as is the source of a 10-fold variation in nephron number. Notably, low nephron count increases the risk for developing hypertension and renal failure. To better understand the source of this variation, we analyzed the complete gestational trajectory of mouse kidney development. We constructed a computerized architectural map of the branching process throughout fetal life and found that organogenesis is composed of two distinct developmental phases, each with stage-specific rate and morphologic parameters. The early phase is characterized by a rapid acceleration in branching rate and by branching divisions that repeat with relatively reproducible morphology. The latter phase, however, is notable for a significantly decreased yet constant branching rate and the presence of nonstereotyped branching events that generate progressive variability in tree morphology until birth. Our map identifies and quantitates the contribution of four developmental mechanisms that guide organogenesis: growth, patterning, branching rate, and nephron induction. When applied to organs that developed under conditions of malnutrition or in the setting of growth factor mutation, our normative map provided an essential link between kidney architecture and the fundamental morphogenetic mechanisms that guide development. This morphogenetic map is expected to find widespread applications and help identify modifiable targets to prevent developmental programming of common diseases. PMID:25644110

The Effects of Self-Regulated Learning Training on Community College Students' Metacognition and Achievement in Developmental Math Courses

ERIC Educational Resources Information Center

Bol, Linda; Campbell, Karen D. Y.; Perez, Tony; Yen, Cherng-Jyh

2016-01-01

The effects of training in self-regulation on metacognition and math achievement were investigated. The participants were 116 community college students enrolled in developmental math courses. Students enrolled in 16 classrooms were randomly assigned to the treatment and control groups. Participants in the treatment group completed four…

Identifying the Correlates and Barriers of Future Planning among Parents of Individuals with Intellectual and Developmental Disabilities

ERIC Educational Resources Information Center

Burke, Meghan; Arnold, Catherine; Owen, Aleksa

2018-01-01

Although individuals with intellectual and developmental disabilities (IDD) are living longer lives, fewer than half of parents of individuals with IDD conduct future planning. The correlates and barriers to future planning must be identified to develop targeted interventions to facilitate future planning. In this study, 388 parents of individuals…

Parents' evaluation of developmental status: how well do parents' concerns identify children with behavioral and emotional problems?

PubMed

Glascoe, Frances Page

2003-03-01

This study was undertaken to determine which parental concerns are most associated with significant behavioral/emotional problems and the extent to which parents' concerns can be depended on in the detection of mental health problems. An additional goal is to view how well a recently published screening test relying on parents' concerns, Parents' Evaluation of Developmental Status (PEDS), detects behavioral and emotional problems. Subjects were a national sample of 472 parents and their children (21 months to 8 years old) who were participants in 1 of 2 test standardization and validation studies. Sites included various pediatric settings, public schools, and Head Start programs in 5 diverse geographic locations. Subjects were representative of U.S. demographics in terms of ethnicity, parental level of education, gender, and socioeconomic status. At each site, psychological examiners, educational diagnosticians, or school psychologists recruited families, and obtained informed consent. Examiners disseminated a demographics questionnaire (in English or Spanish) and a developmental screening test that relies on parents' concerns (PEDS). Examiners were blinded to PEDS' scoring and interpretation administered either by interview or in writing, the Eyberg Child Behavior Inventory (ECBI) or the Possible Problems Checklist (PPC), a subtest of the Child Development Inventory that includes items measuring emotional well-being and behavioral self-control. PEDS was used to sort children into risk for developmental disabilities according to various types of parental concern. Those identified as having high or moderate risk were nominated for diagnostic testing or screening followed by developmental and mental health services when indicated. Because their emotional and behavioral needs would have been identified and addressed, these groups were removed from the analysis (N = 177). Of the 295 children who would not have been nominated for further scrutiny on PEDS due to their

Identifying cooperative transcriptional regulations using protein–protein interactions

PubMed Central

Nagamine, Nobuyoshi; Kawada, Yuji; Sakakibara, Yasubumi

2005-01-01

Cooperative transcriptional activations among multiple transcription factors (TFs) are important to understand the mechanisms of complex transcriptional regulations in eukaryotes. Previous studies have attempted to find cooperative TFs based on gene expression data with gene expression profiles as a measure of similarity of gene regulations. In this paper, we use protein–protein interaction data to infer synergistic binding of cooperative TFs. Our fundamental idea is based on the assumption that genes contributing to a similar biological process are regulated under the same control mechanism. First, the protein–protein interaction networks are used to calculate the similarity of biological processes among genes. Second, we integrate this similarity and the chromatin immuno-precipitation data to identify cooperative TFs. Our computational experiments in yeast show that predictions made by our method have successfully identified eight pairs of cooperative TFs that have literature evidences but could not be identified by the previous method. Further, 12 new possible pairs have been inferred and we have examined the biological relevances for them. However, since a typical problem using protein–protein interaction data is that many false-positive data are contained, we propose a method combining various biological data to increase the prediction accuracy. PMID:16126847

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in

Assessment of Reproductive and Developmental Toxicity of Mixtures of Regulated Drinking Water Chlorination By-Products in a Multigenerational Rat Bioassay

EPA Science Inventory

Epidemiological and animal toxicity studies have raised concerns regarding possible adverse reproductive and developmental effects of disinfection by-products (DBPs) in drinking water. To address these concerns, we provided mixtures of the regulated trihalomethanes (THMs; chlorof...

Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

PubMed Central

Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

2006-01-01

Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae)

PubMed Central

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S.; Reichelt, Michael; Schranz, Michael E.

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C. Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema. Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction. PMID:28603537

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae).

PubMed

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S; Reichelt, Michael; Schranz, Michael E

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C . Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema . Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction.

Identifying genomic and developmental causes of adverse drug reactions in children

PubMed Central

Becker, Mara L; Leeder, J Steven

2011-01-01

Adverse drug reactions are a concern for all clinicians who utilize medications to treat adults and children; however, the frequency of adult and pediatric adverse drug reactions is likely to be under-reported. In this age of genomics and personalized medicine, identifying genetic variation that results in differences in drug biotransformation and response has contributed to significant advances in the utilization of several commonly used medications in adults. In order to better understand the variability of drug response in children however, we must not only consider differences in genotype, but also variation in gene expression during growth and development, namely ontogeny. In this article, recommendations for systematically approaching pharmacogenomic studies in children are discussed, and several examples of studies that investigate the genomic and developmental contribution to adverse drug reactions in children are reviewed. PMID:21121777

Identifying Gender-Specific Developmental Trajectories of Nonviolent and Violent Delinquency from Adolescence to Young Adulthood

PubMed Central

Zheng, Yao; Cleveland, H. Harrington

2013-01-01

Most research examining gender differences in developmental trajectories of antisocial behavior does not consider subtypes of antisocial behavior and is difficult to generalize due to small nonrepresentative samples. The current study investigated gender difference in developmental trajectories from adolescence to young adulthood while addressing those limitations. Analyses were limited to respondents ages 15 and 16 in wave 1 (16–17 in wave 2, and 21–22 in wave 3) of the National Longitudinal Study of Adolescent Health (n = 6244, 49.5% males). Self-report nonviolent and violent delinquencies were simultaneously entered into latent class analysis. Four latent classes were identified: low, desister, decliner, and chronic (male-only). In addition to finding a male-specific chronic class, gender differences included differences in levels of nonviolent and violent delinquency between synonymous classes of males and females, and differences in prevalence of classes across genders. Neighborhood disadvantage and family support predicted trajectories. PMID:23375843

An RNAi based screen in Drosophila larvae identifies fascin as a regulator of myoblast fusion and myotendinous junction structure.

PubMed

Camuglia, Jaclyn M; Mandigo, Torrey R; Moschella, Richard; Mark, Jenna; Hudson, Christine H; Sheen, Derek; Folker, Eric S

2018-04-06

A strength of Drosophila as a model system is its utility as a tool to screen for novel regulators of various functional and developmental processes. However, the utility of Drosophila as a screening tool is dependent on the speed and simplicity of the assay used. Here, we use larval locomotion as an assay to identify novel regulators of skeletal muscle function. We combined this assay with muscle-specific depletion of 82 genes to identify genes that impact muscle function by their expression in muscle cells. The data from the screen were supported with characterization of the muscle pattern in embryos and larvae that had disrupted expression of the strongest hit from the screen. With this assay, we showed that 12/82 tested genes regulate muscle function. Intriguingly, the disruption of five genes caused an increase in muscle function, illustrating that mechanisms that reduce muscle function exist and that the larval locomotion assay is sufficiently quantitative to identify conditions that both increase and decrease muscle function. We extended the data from this screen and tested the mechanism by which the strongest hit, fascin, impacted muscle function. Compared to controls, animals in which fascin expression was disrupted with either a mutant allele or muscle-specific expression of RNAi had fewer muscles, smaller muscles, muscles with fewer nuclei, and muscles with disrupted myotendinous junctions. However, expression of RNAi against fascin only after the muscle had finished embryonic development did not recapitulate any of these phenotypes. These data suggest that muscle function is reduced due to impaired myoblast fusion, muscle growth, and muscle attachment. Together, these data demonstrate the utility of Drosophila larval locomotion as an assay for the identification of novel regulators of muscle development and implicate fascin as necessary for embryonic muscle development.

Developmentally regulated changes in phospholipid composition in murine molar tooth.

PubMed

Dunglas, C; Septier, D; Carreau, J P; Goldberg, M

1999-08-01

In order to explore the possibility that phospholipids are differently expressed during the cascade of events leading to tooth formation, we decided to carry out simultaneous biochemical, histological and electron histochemical studies. High performance thin-layer chromatography and gas-liquid chromatography were used to compare the composition of embryonic mouse first molar tooth germs at day 18 of gestation (E18) and at birth (D1), erupting teeth at day 7 (D7) and erupted molars at day 21 (D21). For the latter, non-demineralized and EDTA-demineralized lipid extracts were analysed separately. Moreover, an ultrahistochemical study was carried out using the iodoplatinate reaction which retains and visualizes phospholipids. Developmentally regulated changes occurred and were closely correlated with an increase in cell membrane phospholipids. Gradual accumulation of phospholipids was identified in the extracellular matrix, at an early stage of tooth germ development within the basement membrane and later, as predentine/dentine and enamel components participating in mineralization processes. Matrix vesicles transiently present in dentine were partly responsible for the lipids that were detected. A first group of phospholipids including phosphatidylcholine as the major membrane-associated phospholipid and phosphatidylinositol as the intracellular second messenger increased by a factor of 2.3 between E18 and D21. This increase is probably associated with cell lengthening and was relatively modest compared with the higher increase detected for a second group of phospholipids, namely phosphatidylethanolamine (x4.8), phosphatidylserine (x 5.9) and sphingomyelin (x5.4). This second group of extracellular matrix-associated phospholipids constituted 68% of the demineralized lipid extract and, therefore, contributes to the mineralization of dental tissues.

Developmentally regulated, alternative splicing of the Rpn10 gene generates multiple forms of 26S proteasomes

PubMed Central

Kawahara, Hiroyuki; Kasahara, Masanori; Nishiyama, Atsuya; Ohsumi, Keita; Goto, Tetsuya; Kishimoto, Takeo; Saeki, Yasushi; Yokosawa, Hideyoshi; Shimbara, Naoki; Murata, Shigeo; Chiba, Tomoki; Suzuki, Koichi; Tanaka, Keiji

2000-01-01

The 26S proteasome is a multisubunit protein- destroying machinery that degrades ubiquitin-tagged proteins. To date only a single species of Rpn10, which possibly functions as a multiubiquitin chain-binding subunit, has been identified in various organisms. Here we report that mouse Rpn10 mRNAs occur in at least five distinct forms, named Rpn10a to Rpn10e, and that they are generated from a single gene by developmentally regulated, alternative splicing. Rpn10a is ubiquitously expressed, whereas Rpn10e is expressed only in embryos, with the highest levels of expression in the brain. Both forms of Rpn10 are components of the 26S proteasome, with an apparently similar affinity for multiubiquitylated [125I]lysozyme in vitro. However, they exert markedly divergent effects on the destruction of B-type cyclin in Xenopus egg extracts. Thus, the 26S proteasome occurs in at least two functionally distinct forms: one containing a ubiquitously expressed Rpn10a and the other a newly identified, embryo-specific Rpn10e. While the former is thought to perform proteolysis constitutively in a wide variety of cells, the latter may play a specialized role in early embryonic development. PMID:10921894

Mas-allatotropin in the developing antennal lobe of the sphinx moth Manduca sexta: distribution, time course, developmental regulation, and colocalization with other neuropeptides.

PubMed

Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim

2008-01-01

The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.

Integration of genetic, genomic and transcriptomic information identifies putative regulators of adventitious root formation in Populus

DOE PAGES

Ribeiro, Cintia L.; Silva, Cynthia M.; Drost, Derek R.; ...

2016-03-16

In this study, adventitious roots (AR) develop from tissues other than the primary root, in a process physiologically regulated by phytohormones. Adventitious roots provide structural support and contribute to water and nutrient absorption, and are critical for commercial vegetative propagation of several crops. Here we quantified the number of AR, root architectural traits and root biomass in cuttings from a pseudo-backcross population of Populus deltoides and Populus trichocarpa. Quantitative trait loci (QTL) mapping and whole-transcriptome analysis of individuals with alternative QTL alleles for AR number were used to identify putative regulators of AR development. As a result, parental individuals andmore » progeny showed extensive segregation for AR developmental traits. Quantitative trait loci for number of AR mapped consistently in the same interval of linkage group (LG) II and LG XIV, explaining 7–10 % of the phenotypic variation. A time series transcriptome analysis identified 26,121 genes differentially expressed during AR development, particularly during the first 24 h after cuttings were harvested. Of those, 1929 genes were differentially regulated between individuals carrying alternative alleles for the two QTL for number of AR, in one or more time point. Eighty-one of these genes were physically located within the QTL intervals for number of AR, including putative homologs of the Arabidopsis genes SUPERROOT2 (SUR2) and TRYPTOPHAN SYNTHASE ALPHA CHAIN (TSA1), both of which are involved in the auxin indole-3-acetic acid (IAA) biosynthesis pathway. In conclusion, this study suggests the involvement of two genes of the tryptophan-dependent auxin biosynthesis pathway, SUR2 and TSA1, in the regulation of a critical trait for the clonal propagation of woody species. A possible model for this regulation is that poplar individuals that have poor AR formation synthesize auxin indole-3-acetic acid (IAA) primarily through the tryptophan (Trp) pathway. Much of

Variants of the Xenopus laevis ribosomal transcription factor xUBF are developmentally regulated by differential splicing.

PubMed

Guimond, A; Moss, T

1992-07-11

XUBF is a Xenopus ribosomal transcription factor of the HMG-box family which contains five tandemly disposed homologies to the HMG1 & 2 DNA binding domains. XUBF has been isolated as a protein doublet and two cDNAs encoding the two molecular weight variants have been characterised. The major two forms of xUBF identified differ by the presence or absence of a 22 amino acid segment lying between HMG-boxes 3 and 4. Here we show that the mRNAs for these two forms of xUBF are regulated during development and differentiation over a range of nearly 20 fold. By isolating two of the xUBF genes, it was possible to show that both encoded the variable 22 amino acid segment in exon 12. Oocyte splicing assays and the sequencing of PCR-generated cDNA fragments, demonstrated that the transcripts from one of these genes were differentially spliced in a developmentally regulated manner. Transcripts from the second gene were found to be predominantly or exclusively spliced to produce the lower molecular weight form of xUBF. Expression of a high molecular weight form from yet a third gene was also detected. Although the intron-exon structures of the Xenopus and mouse UBF genes were found to be essentially identical, the differential splicing of exon 8 found in mammals, was not detected in Xenopus.

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE PAGES

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.; ...

2014-12-22

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Developmental control of hypoxia during bud burst in grapevine.

PubMed

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

Developmental Programming of Branching Morphogenesis in the Kidney.

PubMed

Sampogna, Rosemary V; Schneider, Laura; Al-Awqati, Qais

2015-10-01

The kidney developmental program encodes the intricate branching and organization of approximately 1 million functional units (nephrons). Branching regulation is poorly understood, as is the source of a 10-fold variation in nephron number. Notably, low nephron count increases the risk for developing hypertension and renal failure. To better understand the source of this variation, we analyzed the complete gestational trajectory of mouse kidney development. We constructed a computerized architectural map of the branching process throughout fetal life and found that organogenesis is composed of two distinct developmental phases, each with stage-specific rate and morphologic parameters. The early phase is characterized by a rapid acceleration in branching rate and by branching divisions that repeat with relatively reproducible morphology. The latter phase, however, is notable for a significantly decreased yet constant branching rate and the presence of nonstereotyped branching events that generate progressive variability in tree morphology until birth. Our map identifies and quantitates the contribution of four developmental mechanisms that guide organogenesis: growth, patterning, branching rate, and nephron induction. When applied to organs that developed under conditions of malnutrition or in the setting of growth factor mutation, our normative map provided an essential link between kidney architecture and the fundamental morphogenetic mechanisms that guide development. This morphogenetic map is expected to find widespread applications and help identify modifiable targets to prevent developmental programming of common diseases. Copyright © 2015 by the American Society of Nephrology.

Identifying Military and Combat-Specific Risk Factors for Child Adjustment: Comparing High and Low Risk Military Families and Civilian Families

DTIC Science & Technology

2013-06-01

families (N=200) and civilian dual parent families (N=200). The objectives of this study are to: 1) identify and measure developmentally salient skills ...identify and measure developmentally salient skills that are indicators of current adaptation among preschool and early childhood boys and girls of... Skill Achievement i. Preschool Aged children 1. Self regulation: the 36-item Early Childhood Behavior Questionnaire – Very Short Form (CBQ-VSF

Tissue-specific, nutritional, and developmental regulation of rat fatty acid elongases

PubMed Central

Wang, Yun; Botolin, Daniela; Christian, Barbara; Busik, Julia; Xu, Jinghua; Jump, Donald B.

2008-01-01

Of the six fatty acid elongase (Elovl) subtypes expressed in mammals, adult rat liver expresses four subtypes: Elovl-5 > Elovl-1 = Elovl-2 = Elovl-6. Overnight starvation and fish oil-enriched diets repressed hepatic elongase activity in livers of adult male rats. Diet-induced changes in elongase activity correlate with Elovl-5 and Elovl-6 mRNA abundance. Adult rats fed the peroxisome proliferator-activated receptor α (PPARα) agonist WY14,643 have increased hepatic elongase activity, Elovl-1, Elovl-5, Elovl-6, Δ5, Δ6, and Δ9 desaturase mRNA abundance, and mead acid (20:3,n-9) content. PPARα agonists affect both fatty acid elongation and desaturation pathways leading to changes in hepatic lipid composition. Elovl activity is low in fetal liver but increases significantly after birth. Developmental changes in hepatic elongase activity paralleled the postnatal induction of Elovl-5 mRNA and mRNAs encoding the PPARα-regulated transcripts, Δ5 and Δ6 desaturase, and cytochrome P450 4A. In contrast, Elovl-6, Δ9 desaturase, and FAS mRNA abundance paralleled changes in hepatic sterol regulatory element binding protein 1c (SREBP-1c) nuclear content. SREBP-1c is present in fetal liver nuclei, absent from nuclei immediately after birth, and reappears in nuclei at weaning, 21 days postpartum. In conclusion, changes in Elovl-5 expression may account for much of the nutritional and developmental control of fatty acid elongation activity in the rat liver. PMID:15654130

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

PubMed

Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

2015-12-22

Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.

PubMed

Card, Noel A

2017-06-01

This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.

Interpersonal Stress Regulation and the Development of Anxiety Disorders: An Attachment-Based Developmental Framework

PubMed Central

Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick

2011-01-01

Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID

ETOILE Regulates Developmental Patterning in the Filamentous Brown Alga Ectocarpus siliculosus[W

PubMed Central

Le Bail, Aude; Billoud, Bernard; Le Panse, Sophie; Chenivesse, Sabine; Charrier, Bénédicte

2011-01-01

Brown algae are multicellular marine organisms evolutionarily distant from both metazoans and land plants. The molecular or cellular mechanisms that govern the developmental patterning in brown algae are poorly characterized. Here, we report the first morphogenetic mutant, étoile (etl), produced in the brown algal model Ectocarpus siliculosus. Genetic, cellular, and morphometric analyses showed that a single recessive locus, ETL, regulates cell differentiation: etl cells display thickening of the extracellular matrix (ECM), and the elongated, apical, and actively dividing E cells are underrepresented. As a result of this defect, the overrepresentation of round, branch-initiating R cells in the etl mutant leads to the rapid induction of the branching process at the expense of the uniaxial growth in the primary filament. Computational modeling allowed the simulation of the etl mutant phenotype by including a modified response to the neighborhood information in the division rules used to specify wild-type development. Microarray experiments supported the hypothesis of a defect in cell–cell communication, as primarily Lin-Notch-domain transmembrane proteins, which share similarities with metazoan Notch proteins involved in binary cell differentiation were repressed in etl. Thus, our study highlights the role of the ECM and of novel transmembrane proteins in cell–cell communication during the establishment of the developmental pattern in this brown alga. PMID:21478443

Gene expression in bovine rumen epithelium during weaning identifies molecular regulators of rumen development and growth.

PubMed

Connor, Erin E; Baldwin, Ransom L; Li, Cong-jun; Li, Robert W; Chung, Hoyoung

2013-03-01

During weaning, epithelial cell function in the rumen transitions in response to conversion from a pre-ruminant to a true ruminant environment to ensure efficient nutrient absorption and metabolism. To identify gene networks affected by weaning in bovine rumen, Holstein bull calves were fed commercial milk replacer only (MRO) until 42 days of age, then were provided diets of either milk + orchardgrass hay (MH) or milk + grain-based calf starter (MG). Rumen epithelial RNA was extracted from calves sacrificed at four time points: day 14 (n = 3) and day 42 (n = 3) of age while fed the MRO diet and day 56 (n = 3/diet) and day 70 (n = 3/diet) while fed the MH and MG diets for transcript profiling by microarray hybridization. Five two-group comparisons were made using Permutation Analysis of Differential Expression® to identify differentially expressed genes over time and developmental stage between days 14 and 42 within the MRO diet, between day 42 on the MRO diet and day 56 on the MG or MH diets, and between the MG and MH diets at days 56 and 70. Ingenuity Pathway Analysis (IPA) of differentially expressed genes during weaning indicated the top 5 gene networks involving molecules participating in lipid metabolism, cell morphology and death, cellular growth and proliferation, molecular transport, and the cell cycle. Putative genes functioning in the establishment of the rumen microbial population and associated rumen epithelial inflammation during weaning were identified. Activation of transcription factor PPAR-α was identified by IPA software as an important regulator of molecular changes in rumen epithelium that function in papillary development and fatty acid oxidation during the transition from pre-rumination to rumination. Thus, molecular markers of rumen development and gene networks regulating differentiation and growth of rumen epithelium were identified for selecting targets and methods for improving and assessing rumen development and

Developmental Regulation of NO-Mediated VEGF-Induced Effects in the Lung

PubMed Central

Bhandari, Vineet; Choo-Wing, Rayman; Lee, Chun G.; Yusuf, Kamran; Nedrelow, Jonathan H.; Ambalavanan, Namasivayam; Malkus, Herbert; Homer, Robert J.; Elias, Jack A.

2008-01-01

Vascular endothelial growth factor (VEGF) is known to have a pivotal role in lung development and in a variety of pathologic conditions in the adult lung. Our earlier studies have shown that NO is a critical mediator of VEGF-induced vascular and extravascular effects in the adult murine lung. As significant differences have been reported in the cytokine responses in the adult versus the neonatal lung, we hypothesized that there may be significant differences in VEGF-induced alterations in the developing as opposed to the mature lung. Furthermore, nitric oxide (NO) mediation of these VEGF-induced effects may be developmentally regulated. Using a novel externally regulatable lung-targeted transgenic murine model, we found that VEGF-induced pulmonary hemorrhage was mediated by NO-dependent mechanisms in adults and newborns. VEGF enhanced surfactant production in adults as well as increased surfactant and lung development in newborns, via an NO-independent mechanism. While the enhanced survival in hyperoxia in the adult was partly NO-dependent, there was enhanced hyperoxia-induced lung injury in the newborn. In addition, human amniotic fluid VEGF levels correlated positively with surfactant phospholipids. Tracheal aspirate VEGF levels had an initial spike, followed by a decline, and then a subsequent rise, in human neonates with an outcome of bronchopulmonary dysplasia or death. Our data show that VEGF can have injurious as well as potentially beneficial developmental effects, of which some are NO dependent, others NO independent. This opens up the possibility of selective manipulation of any VEGF-based intervention using NO inhibitors for maximal potential clinical benefit. PMID:18441284

Developmental regulation of NO-mediated VEGF-induced effects in the lung.

PubMed

Bhandari, Vineet; Choo-Wing, Rayman; Lee, Chun G; Yusuf, Kamran; Nedrelow, Jonathan H; Ambalavanan, Namasivayam; Malkus, Herbert; Homer, Robert J; Elias, Jack A

2008-10-01

Vascular endothelial growth factor (VEGF) is known to have a pivotal role in lung development and in a variety of pathologic conditions in the adult lung. Our earlier studies have shown that NO is a critical mediator of VEGF-induced vascular and extravascular effects in the adult murine lung. As significant differences have been reported in the cytokine responses in the adult versus the neonatal lung, we hypothesized that there may be significant differences in VEGF-induced alterations in the developing as opposed to the mature lung. Furthermore, nitric oxide (NO) mediation of these VEGF-induced effects may be developmentally regulated. Using a novel externally regulatable lung-targeted transgenic murine model, we found that VEGF-induced pulmonary hemorrhage was mediated by NO-dependent mechanisms in adults and newborns. VEGF enhanced surfactant production in adults as well as increased surfactant and lung development in newborns, via an NO-independent mechanism. While the enhanced survival in hyperoxia in the adult was partly NO-dependent, there was enhanced hyperoxia-induced lung injury in the newborn. In addition, human amniotic fluid VEGF levels correlated positively with surfactant phospholipids. Tracheal aspirate VEGF levels had an initial spike, followed by a decline, and then a subsequent rise, in human neonates with an outcome of bronchopulmonary dysplasia or death. Our data show that VEGF can have injurious as well as potentially beneficial developmental effects, of which some are NO dependent, others NO independent. This opens up the possibility of selective manipulation of any VEGF-based intervention using NO inhibitors for maximal potential clinical benefit.

Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

PubMed

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the

Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

PubMed Central

Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

2014-01-01

Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the

29 CFR 1952.384 - Completed developmental steps.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completed developmental steps. 1952.384 Section 1952.384 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION....384 Completed developmental steps. (a) In accordance with the requirements of § 1952.10, Puerto Rico's...

Developmental toxicology: adequacy of current methods.

PubMed

Peters, P W

1998-01-01

Toxicology embraces several disciplines such as carcinogenicity, mutagenicity and reproductive toxicity. Reproductive toxicology is concerned with possible effects of substances on the reproductive process, i.e. on sexual organs and their functions, endocrine regulation, fertilization, transport of the fertilized ovum, implantation, and embryonic, fetal and postnatal development, until the end-differentiation of the organs is achieved. Reproductive toxicology is divided into areas related to male and female fertility, and developmental toxicology. Developmental toxicology can be further broken down into prenatal and postnatal toxicology. Today, much new information is available about the origins of developmental disorders resulting from chemical exposure. While these findings seem to promise important new developments in methodology and research, there is a danger of losing sight of the precepts and principles established in the light of existing knowledge. There is also a danger that we may fail to correct shortcomings in our existing procedures and practice. The aim of this presentation is to emphasize the importance of testing substances for their impact in advance of their use and to underline that we must use the best existing tools for carrying out risk assessments. Moreover, it needs to be stressed that there are many substances that are never assessed with respect to reproductive and developmental toxicity. Similarly, our programmes for post-marketing surveillance with respect to developmental toxicology are grossly inadequate. Our ability to identify risks to normal development and reproduction would be much improved, first if a number of straightforward precepts were always followed and second, if we had a clearer understanding of what we mean by risk and acceptable levels of risk in the context of development. Other aims of this paper are: to stress the complexity of the different stages of normal prenatal development; to note the principles that are

Spatial mapping and quantification of developmental branching morphogenesis.

PubMed

Short, Kieran; Hodson, Mark; Smyth, Ian

2013-01-15

Branching morphogenesis is a fundamental developmental mechanism that shapes the formation of many organs. The complex three-dimensional shapes derived by this process reflect equally complex genetic interactions between branching epithelia and their surrounding mesenchyme. Despite the importance of this process to normal adult organ function, analysis of branching has been stymied by the absence of a bespoke method to quantify accurately the complex spatial datasets that describe it. As a consequence, although many developmentally important genes are proposed to influence branching morphogenesis, we have no way of objectively assessing their individual contributions to this process. We report the development of a method for accurately quantifying many aspects of branching morphogenesis and we demonstrate its application to the study of organ development. As proof of principle we have employed this approach to analyse the developing mouse lung and kidney, describing the spatial characteristics of the branching ureteric bud and pulmonary epithelia. To demonstrate further its capacity to profile unrecognised genetic contributions to organ development, we examine Tgfb2 mutant kidneys, identifying elements of both developmental delay and specific spatial dysmorphology caused by haplo-insufficiency for this gene. This technical advance provides a crucial resource that will enable rigorous characterisation of the genetic and environmental factors that regulate this essential and evolutionarily conserved developmental mechanism.

Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport

PubMed Central

Sanders, Anna A. W. M.; Li, Chunmei; Kennedy, Julie; Cai, Jerry; Scheidel, Noemie; Kennedy, Breandán N.; Morin, Ryan D.; Leroux, Michel R.; Blacque, Oliver E.

2016-01-01

Primary cilia are specialised sensory and developmental signalling devices extending from the surface of most eukaryotic cells. Defects in these organelles cause inherited human disorders (ciliopathies) such as retinitis pigmentosa and Bardet-Biedl syndrome (BBS), frequently affecting many physiological and developmental processes across multiple organs. Cilium formation, maintenance and function depend on intracellular transport systems such as intraflagellar transport (IFT), which is driven by kinesin-2 and IFT-dynein motors and regulated by the Bardet-Biedl syndrome (BBS) cargo-adaptor protein complex, or BBSome. To identify new cilium-associated genes, we employed the nematode C. elegans, where ciliogenesis occurs within a short timespan during late embryogenesis when most sensory neurons differentiate. Using whole-organism RNA-Seq libraries, we discovered a signature expression profile highly enriched for transcripts of known ciliary proteins, including FAM-161 (FAM161A orthologue), CCDC-104 (CCDC104), and RPI-1 (RP1/RP1L1), which we confirm are cilium-localised in worms. From a list of 185 candidate ciliary genes, we uncover orthologues of human MAP9, YAP, CCDC149, and RAB28 as conserved cilium-associated components. Further analyses of C. elegans RAB-28, recently associated with autosomal-recessive cone-rod dystrophy, reveal that this small GTPase is exclusively expressed in ciliated neurons where it dynamically associates with IFT trains. Whereas inactive GDP-bound RAB-28 displays no IFT movement and diffuse localisation, GTP-bound (activated) RAB-28 concentrates at the periciliary membrane in a BBSome-dependent manner and undergoes bidirectional IFT. Functional analyses reveal that whilst cilium structure, sensory function and IFT are seemingly normal in a rab-28 null allele, overexpression of predicted GDP or GTP locked variants of RAB-28 perturbs cilium and sensory pore morphogenesis and function. Collectively, our findings present a new approach for

Whole-Organism Developmental Expression Profiling Identifies RAB-28 as a Novel Ciliary GTPase Associated with the BBSome and Intraflagellar Transport.

PubMed

Jensen, Victor L; Carter, Stephen; Sanders, Anna A W M; Li, Chunmei; Kennedy, Julie; Timbers, Tiffany A; Cai, Jerry; Scheidel, Noemie; Kennedy, Breandán N; Morin, Ryan D; Leroux, Michel R; Blacque, Oliver E

2016-12-01

Primary cilia are specialised sensory and developmental signalling devices extending from the surface of most eukaryotic cells. Defects in these organelles cause inherited human disorders (ciliopathies) such as retinitis pigmentosa and Bardet-Biedl syndrome (BBS), frequently affecting many physiological and developmental processes across multiple organs. Cilium formation, maintenance and function depend on intracellular transport systems such as intraflagellar transport (IFT), which is driven by kinesin-2 and IFT-dynein motors and regulated by the Bardet-Biedl syndrome (BBS) cargo-adaptor protein complex, or BBSome. To identify new cilium-associated genes, we employed the nematode C. elegans, where ciliogenesis occurs within a short timespan during late embryogenesis when most sensory neurons differentiate. Using whole-organism RNA-Seq libraries, we discovered a signature expression profile highly enriched for transcripts of known ciliary proteins, including FAM-161 (FAM161A orthologue), CCDC-104 (CCDC104), and RPI-1 (RP1/RP1L1), which we confirm are cilium-localised in worms. From a list of 185 candidate ciliary genes, we uncover orthologues of human MAP9, YAP, CCDC149, and RAB28 as conserved cilium-associated components. Further analyses of C. elegans RAB-28, recently associated with autosomal-recessive cone-rod dystrophy, reveal that this small GTPase is exclusively expressed in ciliated neurons where it dynamically associates with IFT trains. Whereas inactive GDP-bound RAB-28 displays no IFT movement and diffuse localisation, GTP-bound (activated) RAB-28 concentrates at the periciliary membrane in a BBSome-dependent manner and undergoes bidirectional IFT. Functional analyses reveal that whilst cilium structure, sensory function and IFT are seemingly normal in a rab-28 null allele, overexpression of predicted GDP or GTP locked variants of RAB-28 perturbs cilium and sensory pore morphogenesis and function. Collectively, our findings present a new approach for

Abundance of amino acid transporters involved in mTORC1 activation in skeletal muscle of neonatal pigs is developmentally regulated

USDA-ARS?s Scientific Manuscript database

Previously we demonstrated that the insulinand amino acid-induced activation of the mammalian target of rapamycin complex 1 (mTORC1) is developmentally regulated in neonatal pigs. Recent studies have indicated that members of the System A transporter (SNAT2), the System N transporter (SNAT3), the Sy...

[Diagnostic evaluation of the developmental level in children identified at risk of delay through the Child Development Evaluation Test].

PubMed

Rizzoli-Córdoba, Antonio; Campos-Maldonado, Martha Carmen; Vélez-Andrade, Víctor Hugo; Delgado-Ginebra, Ismael; Baqueiro-Hernández, César Iván; Villasís-Keever, Miguel Ángel; Reyes-Morales, Hortensia; Ojeda-Lara, Lucía; Davis-Martínez, Erika Berenice; O'Shea-Cuevas, Gabriel; Aceves-Villagrán, Daniel; Carrasco-Mendoza, Joaquín; Villagrán-Muñoz, Víctor Manuel; Halley-Castillo, Elizabeth; Sidonio-Aguayo, Beatriz; Palma-Tavera, Josuha Alexander; Muñoz-Hernández, Onofre

The Child Development Evaluation (or CDE Test) was developed in Mexico as a screening tool for child developmental problems. It yields three possible results: normal, slow development or risk of delay. The modified version was elaborated using the information obtained during the validation study but its properties according to the base population are not known. The objective of this work was to establish diagnostic confirmation of developmental delay in children 16- to 59-months of age previously identified as having risk of delay through the CDE Test in primary care facilities. A population-based cross-sectional study was conducted in one Mexican state. CDE test was administered to 11,455 children 16- to 59-months of age from December/2013 to March/2014. The eligible population represented the 6.2% of the children (n=714) who were identified at risk of delay through the CDE Test. For inclusion in the study, a block randomization stratified by sex and age group was performed. Each participant included in the study had a diagnostic evaluation using the Battelle Development Inventory, 2 nd edition. From the 355 participants included with risk of delay, 65.9% were male and 80.2% were from rural areas; 6.5% were false positives (Total Development Quotient ˃90) and 6.8% did not have any domain with delay (Domain Developmental Quotient <80). The proportion of delay for each domain was as follows: communication 82.5%; cognitive 80.8%; social-personal 33.8%; motor 55.5%; and adaptive 41.7%. There were significant differences in the percentages of delay both by age and by domain/subdomain evaluated. In 93.2% of the participants, developmental delay was corroborated in at least one domain evaluated. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

45 CFR 1385.2 - Purpose of the regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

Identifying Structural Alerts Based on Zebrafish Developmental Morphological Toxicity (TDS)

EPA Science Inventory

Zebrafish constitute a powerful alternative animal model for chemical hazard evaluation. To provide an in vivo complement to high-throughput screening data from the ToxCast program, zebrafish developmental toxicity screens were conducted on the ToxCast Phase I (Padilla et al., 20...

The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

PubMed Central

Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

2015-01-01

While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

PubMed

Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

PubMed Central

Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

Meeting report: alternatives for developmental neurotoxicity testing.

PubMed

Lein, Pamela; Locke, Paul; Goldberg, Alan

2007-05-01

Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternatives to current animal testing protocols and guidelines. To address this need, the Johns Hopkins Center for Alternatives to Animal Testing (CAAT), the U.S. Environmental Protection Agency, and the National Toxicology Program are collaborating in a program called TestSmart DNT, the goals of which are to: (a) develop alternative methodologies for identifying and prioritizing chemicals and exposures that may cause developmental neurotoxicity in humans; (b) develop the policies for incorporating DNT alternatives into regulatory decision making; and (c) identify opportunities for reducing, refining, or replacing the use of animals in DNT. The first TestSmart DNT workshop was an open registration meeting held 13-15 March 2006 in Reston, Virginia. The primary objective was to bring together stakeholders (test developers, test users, regulators, and advocates for children's health, animal welfare, and environmental health) and individuals representing diverse disciplines (developmental neurobiology, toxicology, policy, and regulatory science) from around the world to share information and concerns relating to the science and policy of DNT. Individual presentations are available at the CAAT TestSmart website. This report provides a synthesis of workgroup discussions and recommendations for future directions and priorities, which include initiating a systematic evaluation of alternative models and technologies, developing a framework for the creation of an open database to catalog DNT data, and devising a strategy for harmonizing the validation process across international jurisdictional borders.

Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

2013-10-01

The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells.

PubMed

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A; Engel, Felix B; Yamashita, Jun K

2013-12-01

The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provides therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells. The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse pluripotent stem cell-derived cardiomyocytes and identified 4 chemical compound groups: inhibitors of glycogen synthase kinase-3, p38 mitogen-activated protein kinase, and Ca(2+)/calmodulin-dependent protein kinase II, and activators of extracellular signal-regulated kinase. Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human pluripotent stem cells, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas extracellular signal-regulated kinase activators and Ca(2+)/calmodulin-dependent protein kinase II inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, glycogen synthase kinase-3 and p38 mitogen-activated protein kinase inhibitors substantially and synergistically induced re-entry and progression of cell cycle in neonatal but also as well as adult cardiomyocytes. Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered pluripotent stem cell-derived cardiomyocytes

Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

PubMed

Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

2008-04-01

The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

NASA Astrophysics Data System (ADS)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

Developmentally defined forebrain circuits regulate appetitive and aversive olfactory learning.

PubMed

Muthusamy, Nagendran; Zhang, Xuying; Johnson, Caroline A; Yadav, Prem N; Ghashghaei, H Troy

2017-01-01

Postnatal and adult neurogenesis are region- and modality-specific, but the significance of developmentally distinct neuronal populations remains unclear. We demonstrate that chemogenetic inactivation of a subset of forebrain and olfactory neurons generated at birth disrupts responses to an aversive odor. In contrast, novel appetitive odor learning is sensitive to inactivation of adult-born neurons, revealing that developmentally defined sets of neurons may differentially participate in hedonic aspects of sensory learning.

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

Werner's Relevance for Contemporary Developmental Psychology.

ERIC Educational Resources Information Center

Glick, Joseph A.

1992-01-01

Considers the contributions of Heinz Werner to developmental psychology and identifies the tensions between Werner's theory and the practices of contemporary developmental psychology. Core issues of Werner's psychology concern: (1) development as heuristic, rather than phenomenon; (2) developmental process analysis; and (3) conceptions of the…

MicroRNAs: New Players in Anesthetic-Induced Developmental Neurotoxicity

PubMed Central

Twaroski, Danielle; Bosnjak, Zeljko J.; Bai, Xiaowen

2015-01-01

Growing evidence demonstrates that prolonged exposure to general anesthetics during brain development induces widespread neuronal cell death followed by long-term memory and learning disabilities in animal models. These studies have raised serious concerns about the safety of anesthetic use in pregnant women and young children. However, the underlying mechanisms of anesthetic-induced neurotoxicity are complex and are not well understood. MicroRNAs are endogenous, small, non-coding RNAs that have been implicated to play important roles in many different disease processes by negatively regulating target gene expression. A possible role for microRNAs in anesthetic-induced developmental neurotoxicity has recently been identified, suggesting that microRNA-based signaling might be a novel target for preventing the neurotoxicity. Here we provide an overview of anesthetic-induced developmental neurotoxicity and focus on the role of microRNAs in the neurotoxicity observed in both human stem cell-derived neuron and animal models. Aberrant expression of some microRNAs has been shown to be involved in anesthetic-induced developmental neurotoxicity, revealing the potential of microRNAs as therapeutic or preventive targets against the toxicity. PMID:26146587

SUMOylation is developmentally regulated and required for cell pairing during conjugation in Tetrahymena thermophila.

PubMed

Nasir, Amjad M; Yang, Qianyi; Chalker, Douglas L; Forney, James D

2015-02-01

The covalent attachment of small ubiquitin-like modifier (SUMO) to target proteins regulates numerous nuclear events in eukaryotes, including transcription, mitosis and meiosis, and DNA repair. Despite extensive interest in nuclear pathways within the field of ciliate molecular biology, there have been no investigations of the SUMO pathway in Tetrahymena. The developmental program of sexual reproduction of this organism includes cell pairing, micronuclear meiosis, and the formation of a new somatic macronucleus. We identified the Tetrahymena thermophila SMT3 (SUMO) and UBA2 (SUMO-activating enzyme) genes and demonstrated that the corresponding green fluorescent protein (GFP) tagged gene products are found predominantly in the somatic macronucleus during vegetative growth. Use of an anti-Smt3p antibody to perform immunoblot assays with whole-cell lysates during conjugation revealed a large increase in SUMOylation that peaked during formation of the new macronucleus. Immunofluorescence using the same antibody showed that the increase was localized primarily within the new macronucleus. To initiate functional analysis of the SUMO pathway, we created germ line knockout cell lines for both the SMT3 and UBA2 genes and found both are essential for cell viability. Conditional Smt3p and Uba2p cell lines were constructed by incorporation of the cadmium-inducible metallothionein promoter. Withdrawal of cadmium resulted in reduced cell growth and increased sensitivity to DNA-damaging agents. Interestingly, Smt3p and Uba2p conditional cell lines were unable to pair during sexual reproduction in the absence of cadmium, consistent with a function early in conjugation. Our studies are consistent with multiple roles for SUMOylation in Tetrahymena, including a dynamic regulation associated with the sexual life cycle. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Developmental Rainbow: Early Childhood Development Profile.

ERIC Educational Resources Information Center

Mahoney, Gerald; Mahoney, Frida

One of the most important skills of professionals who work with young children is the ability to assess developmental functioning through informal observation. This skill serves as the foundation for screening or identifying children in need of developmental services, conducting play-based developmental assessments, and helping parents to…

De novo sequencing and analysis of the cranberry fruit transcriptome to identify putative genes involved in flavonoid biosynthesis, transport and regulation.

PubMed

Sun, Haiyue; Liu, Yushan; Gai, Yuzhuo; Geng, Jinman; Chen, Li; Liu, Hongdi; Kang, Limin; Tian, Youwen; Li, Yadong

2015-09-02

Cranberries (Vaccinium macrocarpon Ait.), renowned for their excellent health benefits, are an important berry crop. Here, we performed transcriptome sequencing of one cranberry cultivar, from fruits at two different developmental stages, on the Illumina HiSeq 2000 platform. Our main goals were to identify putative genes for major metabolic pathways of bioactive compounds and compare the expression patterns between white fruit (W) and red fruit (R) in cranberry. In this study, two cDNA libraries of W and R were constructed. Approximately 119 million raw sequencing reads were generated and assembled de novo, yielding 57,331 high quality unigenes with an average length of 739 bp. Using BLASTx, 38,460 unigenes were identified as putative homologs of annotated sequences in public protein databases, including NCBI NR, NT, Swiss-Prot, KEGG, COG and GO. Of these, 21,898 unigenes mapped to 128 KEGG pathways, with the metabolic pathways, secondary metabolites, glycerophospholipid metabolism, ether lipid metabolism, starch and sucrose metabolism, purine metabolism, and pyrimidine metabolism being well represented. Among them, many candidate genes were involved in flavonoid biosynthesis, transport and regulation. Furthermore, digital gene expression (DEG) analysis identified 3,257 unigenes that were differentially expressed between the two fruit developmental stages. In addition, 14,473 simple sequence repeats (SSRs) were detected. Our results present comprehensive gene expression information about the cranberry fruit transcriptome that could facilitate our understanding of the molecular mechanisms of fruit development in cranberries. Although it will be necessary to validate the functions carried out by these genes, these results could be used to improve the quality of breeding programs for the cranberry and related species.

Initiating a Developmental Motor Skills Program for Identified Primary Students.

ERIC Educational Resources Information Center

Harville, Valerie Terrill

A physical education specialist at an elementary school in one of the fastest growing sections of the country developed and implemented a developmental motor skills program for primary school students. The program focused on: (1) developing a method of referring students for testing; (2) providing a specialized motor diagnostic test; (3) improving…

Oxidative Stress, Unfolded Protein Response, and Apoptosis in Developmental Toxicity

PubMed Central

Kupsco, Allison; Schlenk, Daniel

2016-01-01

Physiological development requires precise spatiotemporal regulation of cellular and molecular processes. Disruption of these key events can generate developmental toxicity in the form of teratogenesis or mortality. The mechanism behind many developmental toxicants remains unknown. While recent work has focused on the unfolded protein response (UPR), oxidative stress, and apoptosis in the pathogenesis of disease, few studies have addressed their relationship in developmental toxicity. Redox regulation, UPR, and apoptosis are essential for physiological development and can be disturbed by a variety of endogenous and exogenous toxicants to generate lethality and diverse malformations. This review examines the current knowledge of the role of oxidative stress, UPR, and apoptosis in physiological development as well as in developmental toxicity, focusing on studies and advances in vertebrates model systems. PMID:26008783

Expression profiling identifies novel Hh/Gli regulated genes in developing zebrafish embryos.

PubMed Central

Bergeron, Sadie A.; Milla, Luis A.; Villegas, Rosario; Shen, Meng-Chieh; Burgess, Shawn M.; Allende, Miguel L.; Karlstrom, Rolf O.; Palma, Verónica

2008-01-01

The Hedgehog (Hh) signaling pathway plays critical instructional roles during embryonic development. Mis-regulation of Hh/Gli signaling is a major causative factor in human congenital disorders and in a variety of cancers. The zebrafish is a powerful genetic model for the study of Hh signaling during embryogenesis, as a large number of mutants have been identified affecting different components of the Hh/Gli signaling system. By performing global profiling of gene expression in different Hh/Gli gain- and loss-of-function scenarios we identified several known (e.g. ptc1 and nkx2.2a) as well as a large number of novel Hh regulated genes that are differentially expressed in embryos with altered Hh/Gli signaling function. By uncovering changes in tissue specific gene expression, we revealed new embryological processes that are influenced by Hh signaling. We thus provide a comprehensive survey of Hh/Gli regulated genes during embryogenesis and we identify new Hh-regulated genes that may be targets of mis-regulation during tumorogenesis. PMID:18055165

Cyber "Pokes": Motivational Antidote for Developmental College Readers

ERIC Educational Resources Information Center

Bowers-Campbell, Joy

2008-01-01

Difficulties characterizing developmental college students are reviewed within the context of motivational theories of learning. The author highlights problems of low self-efficacy and inadequate self-regulated learning for developmental college students. The author argues that the use of Facebook, a widely-used social networking technology, may…

Meeting Report: Alternatives for Developmental Neurotoxicity Testing

PubMed Central

Lein, Pamela; Locke, Paul; Goldberg, Alan

2007-01-01

Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternatives to current animal testing protocols and guidelines. To address this need, the Johns Hopkins Center for Alternatives to Animal Testing (CAAT), the U.S. Environmental Protection Agency, and the National Toxicology Program are collaborating in a program called TestSmart DNT, the goals of which are to: (a) develop alternative methodologies for identifying and prioritizing chemicals and exposures that may cause developmental neurotoxicity in humans; (b) develop the policies for incorporating DNT alternatives into regulatory decision making; and (c) identify opportunities for reducing, refining, or replacing the use of animals in DNT. The first TestSmart DNT workshop was an open registration meeting held 13–15 March 2006 in Reston, Virginia. The primary objective was to bring together stakeholders (test developers, test users, regulators, and advocates for children’s health, animal welfare, and environmental health) and individuals representing diverse disciplines (developmental neurobiology, toxicology, policy, and regulatory science) from around the world to share information and concerns relating to the science and policy of DNT. Individual presentations are available at the CAAT TestSmart website. This report provides a synthesis of workgroup discussions and recommendations for future directions and priorities, which include initiating a systematic evaluation of alternative models and technologies, developing a framework for the creation of an open database to catalog DNT data, and devising a strategy for harmonizing the validation process across international jurisdictional borders. PMID:17520065

Systems theory and cascades in developmental psychopathology.

PubMed

Cox, Martha J; Mills-Koonce, Roger; Propper, Cathi; Gariépy, Jean-Louis

2010-08-01

In the wake of prominent theoreticians in developmental science, whose contributions we review in this article, many developmental psychologists came to endorse a systems approach to understanding how the individual, as it develops, establishes functional relationships to social ecological contexts that from birth to school entry rapidly increase in complexity. The concept of developmental cascade has been introduced in this context to describe lawful processes by which antecedent conditions may be related with varying probabilities to specified outcomes. These are understood as processes by which function at one level or in one domain of behavior affect the organization of competency in later developing domains of general adaptation. Here we propose a developmental sequence by which the developing child acquires regulative capacities that are key to adjustment to a society that demands considerable control of emotional and cognitive functions early in life. We report empirical evidence showing that the acquisition of regulative capacities may be understood as a cascade of shifts in control parameters induced by the progressive integration of biological, transactional, and socioaffective systems over development. We conclude by suggesting how the developmental process may be accessed for effective intervention in populations deemed "at risk" for later problems of psychosocial adjustment.

On the Developmental and Environmental Regulation of Secondary Metabolism in Vaccinium spp. Berries

PubMed Central

Karppinen, Katja; Zoratti, Laura; Nguyenquynh, Nga; Häggman, Hely; Jaakola, Laura

2016-01-01

Secondary metabolites have important defense and signaling roles, and they contribute to the overall quality of developing and ripening fruits. Blueberries, bilberries, cranberries, and other Vaccinium berries are fleshy berry fruits recognized for the high levels of bioactive compounds, especially anthocyanin pigments. Besides anthocyanins and other products of the phenylpropanoid and flavonoid pathways, these berries also contain other metabolites of interest, such as carotenoid derivatives, vitamins and flavor compounds. Recently, new information has been achieved on the mechanisms related with developmental, environmental, and genetic factors involved in the regulation of secondary metabolism in Vaccinium fruits. Especially light conditions and temperature are demonstrated to have a prominent role on the composition of phenolic compounds. The present review focuses on the studies on mechanisms associated with the regulation of key secondary metabolites, mainly phenolic compounds, in Vaccinium berries. The advances in the research concerning biosynthesis of phenolic compounds in Vaccinium species, including specific studies with mutant genotypes in addition to controlled and field experiments on the genotype × environment (G×E) interaction, are discussed. The recently published Vaccinium transcriptome and genome databases provide new tools for the studies on the metabolic routes. PMID:27242856

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

Identifying state resources and support programs on e-government websites for persons with intellectual and developmental disabilities.

PubMed

Fisher, Kathleen M; Peterson, Justin D; Albert, Jon D

2015-01-01

This descriptive cross-sectional study identified resources and programs that are available nationwide on the Internet to support individuals and families with intellectual and developmental disabilities (I/DD), with a focus on intellectual disability. This evaluation included easily identifiable information on specific resources and highlighted unique programs found in individual states that were linked from e-government websites. Researchers documented the ease of access and available information for all 50 states and the District of Columbia. A number of disparities and areas for improvement were recorded for states and I/DD websites. The researchers conclude that a number of additional health and support services will be needed to address the growing needs of this vulnerable population.

Using passive sampling and zebrafish to identify developmental toxicants in complex mixtures.

PubMed

Bergmann, Alan J; Tanguay, Robert L; Anderson, Kim A

2017-09-01

Using effects-directed analysis, we investigated associations previously observed between polycyclic aromatic hydrocarbons (PAHs) and embryotoxicity in field-deployed low-density polyethylene (LDPE). We conducted effects-directed analysis using a zebrafish embryo assay and iterative fractionation of extracts of LDPE that were deployed in the Portland Harbor superfund megasite, Oregon (USA). Whole extracts induced toxicity including mortality, edema, and notochord distortion at 20% effect concentration (EC20) values of approximately 100, 100, and 10 mg LDPE/mL, respectively. Through fractionation, we determined that PAHs at concentrations similar to previous research did not contribute markedly to toxicity. We also eliminated pesticides, phthalates, musks, and other substances identified in toxic fractions by testing surrogate mixtures. We identified free fatty acids as lethal components of LDPE extracts and confirmed their toxicity with authentic standards. We found chromatographic evidence that dithiocarbamates are responsible for notochord and other sublethal effects, although exact matches were not obtained. Fatty acids and dithiocarbamates were previously unrecorded components of LDPE extracts and likely contribute to the toxicity of the whole mixture. The present study demonstrates the success of effects-directed analysis in nontargeted hazard identification using the zebrafish embryo test as a self-contained battery of bioassays that allows identification of multiple chemicals with different modes of action. This is the first effects-directed analysis to combine LDPE and zebrafish, approaches that are widely applicable to identifying developmental hazards in the bioavailable fraction of hydrophobic organic compounds. Environ Toxicol Chem 2017;36:2290-2298. © 2017 SETAC. © 2017 SETAC.

Developmental origins of infant emotion regulation: Mediation by temperamental negativity and moderation by maternal sensitivity.

PubMed

Thomas, Jenna C; Letourneau, Nicole; Campbell, Tavis S; Tomfohr-Madsen, Lianne; Giesbrecht, Gerald F

2017-04-01

Emotion regulation is essential to cognitive, social, and emotional development and difficulties with emotion regulation portend future socioemotional, academic, and behavioral difficulties. There is growing awareness that many developmental outcomes previously thought to begin their development in the postnatal period have their origins in the prenatal period. Thus, there is a need to integrate evidence of prenatal influences within established postnatal factors, such as infant temperament and maternal sensitivity. In the current study, prenatal depression, pregnancy anxiety, and diurnal cortisol patterns (i.e., the cortisol awakening response (CAR) and diurnal slope) were assessed in 254 relatively low-risk mother-infant pairs (primarily White, middle-class) in early (M = 15 weeks) and late pregnancy (M = 33 weeks). Mothers reported on infant temperamental negativity (Infant Behavior Questionnaire-Revised) at 3 months. At 6 months, maternal sensitivity (Parent Child Interaction Teaching Scale) and infant emotion regulation behavior (Laboratory Temperament Assessment Battery) were assessed. Greater pregnancy anxiety in early pregnancy and a blunted CAR in late pregnancy predicted higher infant temperamental negativity at 3 months, and those infants with higher temperamental negativity used fewer attentional regulation strategies and more avoidance (i.e., escape behavior) at 6 months. Furthermore, this indirect effect was moderated by maternal sensitivity whereby infants with elevated negativity demonstrated maladaptive emotion regulation at below average levels of maternal sensitivity. These findings suggest that the development of infant emotion regulation is influenced by the ways that prenatal exposures shape infant temperament and is further modified by postnatal caregiving. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Communication-based assessment of developmental age for young children with developmental disabilities.

PubMed

DeVeney, Shari L; Hoffman, Lesa; Cress, Cynthia J

2012-06-01

In this study, the authors compared a multiple-domain strategy for assessing developmental age of young children with developmental disabilities who were at risk for long-term reliance on augmentative and alternative communication (AAC) with a communication-based strategy composed of receptive language and communication indices that may be less affected by physically challenging tasks than traditional developmental age scores. Participants were 42 children (age 9-27 months) with developmental disabilities and who were at risk for long-term reliance on AAC. Children were assessed longitudinally in their homes at 3 occasions over 18 months using multiple-domain and communication-based measures. Confirmatory factor analysis examined dimensionality across the measures, and age-equivalence scores under each strategy were compared, where possible. The communication-based latent factor of developmental age demonstrated good reliability and was almost perfectly correlated with the multiple-domain latent factor. However, the mean age-equivalence score of the communication-based assessment significantly exceeded that of the multiple-domain assessment by 5.3 months across ages. Clinicians working with young children with developmental disabilities should consider a communication-based approach as an alternative developmental age assessment strategy for characterizing children's capabilities, identifying challenges, and developing interventions. A communication-based developmental age estimation is sufficiently reliable and may result in more valid inferences about developmental age for children whose developmental or cognitive age scores may otherwise be limited by their physical capabilities.

New insights into the mechanism of phthalate-induced developmental effects.

PubMed

Mu, Xiyan; Huang, Ying; Li, Jia; Yang, Ke; Yang, Wenbo; Shen, Gongming; Li, Xuxing; Lei, Yunlei; Pang, Sen; Wang, Chengju; Li, Xuefeng; Li, Yingren

2018-06-11

To investigate the biological pathways involved in phthalate-induced developmental effects, zebrafish embryos were exposed to different concentrations of di-(2-ethylhexyl) (DEHP) and di-butyl phthalate (DBP) for 96 h. Embryonic exposure to DEHP and DBP induced body length decrease, yolk sac abnormities, and immune responses (up-regulation of immune proteins and genes). The lipidomic results showed that at a concentration of 50 μg/L, DEHP and DBP significantly reduced the levels of fatty acids, triglycerides, diacylglycerol, and cholesterol. These effects are partly explained by biological pathway enrichment based on data from the transcriptional and proteomic profiles. Co-exposure to DBP and ER antagonist did not significantly relieve the toxic symptoms compared with exposure to DBP alone. This indicates that phthalate-induced developmental abnormities in zebrafish might not be mediated by the ER pathway. In conclusion, we identified the possible biological pathways that mediate phthalate-induced developmental effects and found that these effects may not be driven by estrogenic activation. Copyright © 2018 Elsevier Ltd. All rights reserved.

Developmental Regulation of Effector and Resident Memory T Cell Generation during Pediatric Viral Respiratory Tract Infection.

PubMed

Connors, Thomas J; Baird, J Scott; Yopes, Margot C; Zens, Kyra D; Pethe, Kalpana; Ravindranath, Thyyar M; Ho, Siu-Hong; Farber, Donna L

2018-05-30

Viral respiratory tract infections (VRTI) remain a leading cause of morbidity and mortality among infants and young children. In mice, optimal protection to VRTI is mediated by recruitment of effector T cells to the lungs and respiratory tract, and subsequent establishment of tissue resident memory T cells (Trm), which provide long-term protection. These critical processes of T cell recruitment to the respiratory tract, their role in disease pathogenesis, and establishment of local protective immunity remain undefined in pediatric VRTI. In this study, we investigated T cell responses in the upper respiratory tract (URT) and lower respiratory tract (LRT) of infants and young children with VRTI, revealing developmental regulation of T cell differentiation and Trm generation in situ. We show a direct concurrence between T cell responses in the URT and LRT, including a preponderance of effector CD8 + T cells that was associated with disease severity. During infant VRTI, there was an accumulation of terminally differentiated effector cells (effector memory RA + T cells) in the URT and LRT with reduced Trm in the early neonatal period, and decreased effector memory RA + T cell and increased Trm formation with age during the early years of childhood. Moreover, human infant T cells exhibit increased expression of the transcription factor T-bet compared with adult T cells, suggesting a mechanism for preferential generation of effector over Trm. The developmental regulation of respiratory T cell responses as revealed in the present study is important for diagnosing, monitoring, and treating VRTI in the critical early life stages. Copyright © 2018 by The American Association of Immunologists, Inc.

Defining the developmental parameters of temper loss in early childhood: implications for developmental psychopathology

PubMed Central

Wakschlag, Lauren S.; Choi, Seung W.; Carter, Alice S.; Hullsiek, Heide; Burns, James; McCarthy, Kimberly; Leibenluft, Ellen; Briggs-Gowan, Margaret J.

2013-01-01

Background Temper modulation problems are both a hallmark of early childhood and a common mental health concern. Thus, characterizing specific behavioral manifestations of temper loss along a dimension from normative misbehaviors to clinically significant problems is an important step toward identifying clinical thresholds. Methods Parent-reported patterns of temper loss were delineated in a diverse community sample of preschoolers (n = 1,490). A developmentally sensitive questionnaire, the Multidimensional Assessment of Preschool Disruptive Behavior (MAP-DB), was used to assess temper loss in terms of tantrum features and anger regulation. Specific aims were: (a) document the normative distribution of temper loss in preschoolers from normative misbehaviors to clinically concerning temper loss behaviors, and test for sociodemographic differences; (b) use Item Response Theory (IRT) to model a Temper Loss dimension; and (c) examine associations of temper loss and concurrent emotional and behavioral problems. Results Across sociodemographic subgroups, a unidimensional Temper Loss model fit the data well. Nearly all (83.7%) preschoolers had tantrums sometimes but only 8.6% had daily tantrums. Normative misbehaviors occurred more frequently than clinically concerning temper loss behaviors. Milder behaviors tended to reflect frustration in expectable contexts, whereas clinically concerning problem indicators were unpredictable, prolonged, and/or destructive. In multivariate models, Temper Loss was associated with emotional and behavioral problems. Conclusions Parent reports on a developmentally informed questionnaire, administered to a large and diverse sample, distinguished normative and problematic manifestations of preschool temper loss. A developmental, dimensional approach shows promise for elucidating the boundaries between normative early childhood temper loss and emergent psychopathology. PMID:22928674

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored

A whole organism screen identifies novel regulators of fat storage

PubMed Central

Lemieux, George A.; Liu, Jason; Mayer, Nasima; Bainton, Roland J.; Ashrafi, Kaveh; Werb, Zena

2011-01-01

The regulation of energy homeostasis integrates diverse biological processes ranging from behavior to metabolism and is linked fundamentally to numerous disease states. To identify new molecules that can bypass homeostatic compensatory mechanisms of energy balance in intact animals, we screened for small molecule modulators of C. elegans fat content. We report on several molecules that modulate fat storage without obvious deleterious effects on feeding, growth, and reproduction. A subset of these compounds also altered fat storage in mammalian and insect cell culture. We found that one of the newly identified compounds exerts its effects in C. elegans through a pathway that requires novel functions of an AMP-activated kinase catalytic subunit and a transcription factor previously unassociated with fat regulation. Thus, our strategy identifies small molecules that are effective within the context of intact animals and reveals relationships between new pathways that operate across phyla to influence energy homeostasis. PMID:21390037

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Abscisic acid induction of vacuolar H+-ATPase activity in mesembryanthemum crystallinum is developmentally regulated

PubMed

Barkla; Vera-Estrella; Maldonado-Gama; Pantoja

1999-07-01

Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways.

Young Children with Developmental Delays as Young Adults: Predicting Developmental and Personal-Social Outcomes

ERIC Educational Resources Information Center

Bernheimer, Lucinda P.; Keogh, Barbara K.; Guthrie, Donald

2006-01-01

We report on a 20-year follow-up of 30 children with developmental delays identified at age 3. Our purpose was to assess the relationship of early indicators of delay to cognitive and personal-social status in young adulthood. Predictors were Developmental and Personal-Social factors derived from standardized tests and parent questionnaires…

TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

PubMed Central

Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.

2015-01-01

Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

Identifying Gender-Specific Developmental Trajectories of Nonviolent and Violent Delinquency from Adolescence to Young Adulthood

ERIC Educational Resources Information Center

Zheng, Yao; Cleveland, H. Harrington

2013-01-01

Most research examining gender differences in developmental trajectories of antisocial behavior does not consider subtypes of antisocial behavior and is difficult to generalize due to small non-representative samples. The current study investigated gender difference in developmental trajectories from adolescence to young adulthood while addressing…

FKBPL Is a Critical Antiangiogenic Regulator of Developmental and Pathological Angiogenesis

PubMed Central

Yakkundi, Anita; Bennett, Rachel; Hernández-Negrete, Ivette; Delalande, Jean-Marie; Hanna, Mary; Lyubomska, Oksana; Arthur, Kenneth; Short, Amy; McKeen, Hayley; Nelson, Laura; McCrudden, Cian M.; McNally, Ross; McClements, Lana; McCarthy, Helen O.; Burns, Alan J.; Bicknell, Roy; Kissenpfennig, Adrien

2015-01-01

Objective— The antitumor effects of FK506-binding protein like (FKBPL) and its extracellular role in angiogenesis are well characterized; however, its role in physiological/developmental angiogenesis and the effect of FKBPL ablation has not been evaluated. This is important as effects of some angiogenic proteins are dosage dependent. Here we evaluate the regulation of FKBPL secretion under angiogenic stimuli, as well as the effect of FKBPL ablation in angiogenesis using mouse and zebrafish models. Approach and Results— FKBPL is secreted maximally by human microvascular endothelial cells and fibroblasts, and this was specifically downregulated by proangiogenic hypoxic signals, but not by the angiogenic cytokines, VEGF or IL8. FKBPL’s critical role in angiogenesis was supported by our inability to generate an Fkbpl knockout mouse, with embryonic lethality occurring before E8.5. However, whilst Fkbpl heterozygotic embryos showed some vasculature irregularities, the mice developed normally. In murine angiogenesis models, including the ex vivo aortic ring assay, in vivo sponge assay, and tumor growth assay, Fkbpl+/− mice exhibited increased sprouting, enhanced vessel recruitment, and faster tumor growth, respectively, supporting the antiangiogenic function of FKBPL. In zebrafish, knockdown of zFkbpl using morpholinos disrupted the vasculature, and the phenotype was rescued with hFKBPL. Interestingly, this vessel disruption was ineffective when zcd44 was knocked-down, supporting the dependency of zFkbpl on zCd44 in zebrafish. Conclusions— FKBPL is an important regulator of angiogenesis, having an essential role in murine and zebrafish blood vessel development. Mouse models of angiogenesis demonstrated a proangiogenic phenotype in Fkbpl heterozygotes. PMID:25767277

Developmental Assets and the Middle School Counselor

ERIC Educational Resources Information Center

Scales, Peter C.

2005-01-01

Search Institute has identified 40 Developmental Assets[TM] that are building blocks of healthy development and success for children and adolescents. Young people's experience of most of these developmental assets declines over the middle school years. In this article, research is described showing the prevalence and impact of developmental assets…

Developmental effects on ureide levels are mediated by tissue-specific regulation of allantoinase in Phaseolus vulgaris L.

PubMed

Díaz-Leal, Juan Luis; Gálvez-Valdivieso, Gregorio; Fernández, Javier; Pineda, Manuel; Alamillo, Josefa M

2012-06-01

The ureides allantoin and allantoate are key molecules in the transport and storage of nitrogen in ureide legumes. In shoots and leaves from Phaseolus vulgaris plants using symbiotically fixed nitrogen as the sole nitrogen source, ureide levels were roughly equivalent to those of nitrate-supported plants during the whole vegetative stage, but they exhibited a sudden increase at the onset of flowering. This rise in the level of ureides, mainly in the form of allantoate, was accompanied by increases in allantoinase gene expression and enzyme activity, consistent with developmental regulation of ureide levels mainly through the tissue-specific induction of allantoate synthesis catalysed by allantoinase. Moreover, surprisingly high levels of ureides were also found in non-nodulated plants fertilized with nitrate, at both early and late developmental stages. The results suggest that remobilized N from lower leaves is probably involved in the sharp rise in ureides in shoots and leaves during early pod filling in N(2)-fixing plants and in the significant amounts of ureides observed in non-nodulated plants.

Risk Factors of Children Who Exited from an Early Intervention Program without an Identified Disability and Returned with a Developmental Disability

ERIC Educational Resources Information Center

Giannoni, Peggy P.; Kass, Philip H.

2010-01-01

A retrospective cohort study was undertaken to identify risk factors for children at greatest risk of delayed diagnosis of developmental disability. Two thousand four hundred and thirty-nine children were selected for this study due to their participation in the California Early Start (ES) Program in 1998. Comparisons were made among children that…

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Developmental Regulation of Diacylglycerol Acyltransferase Family Gene Expression in Tung Tree Tissues

PubMed Central

Cao, Heping; Shockey, Jay M.; Klasson, K. Thomas; Chapital, Dorselyn C.; Mason, Catherine B.; Scheffler, Brian E.

2013-01-01

Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms. PMID:24146944

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention

PubMed Central

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V.

2012-01-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3′-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context. PMID:22661231

Coordinated regulation of neuronal mRNA steady-state levels through developmentally controlled intron retention.

PubMed

Yap, Karen; Lim, Zhao Qin; Khandelia, Piyush; Friedman, Brad; Makeyev, Eugene V

2012-06-01

Differentiated cells acquire unique structural and functional traits through coordinated expression of lineage-specific genes. An extensive battery of genes encoding components of the synaptic transmission machinery and specialized cytoskeletal proteins is activated during neurogenesis, but the underlying regulation is not well understood. Here we show that genes encoding critical presynaptic proteins are transcribed at a detectable level in both neurons and nonneuronal cells. However, in nonneuronal cells, the splicing of 3'-terminal introns within these genes is repressed by the polypyrimidine tract-binding protein (Ptbp1). This inhibits the export of incompletely spliced mRNAs to the cytoplasm and triggers their nuclear degradation. Clearance of these intron-containing transcripts occurs independently of the nonsense-mediated decay (NMD) pathway but requires components of the nuclear RNA surveillance machinery, including the nuclear pore-associated protein Tpr and the exosome complex. When Ptbp1 expression decreases during neuronal differentiation, the regulated introns are spliced out, thus allowing the accumulation of translation-competent mRNAs in the cytoplasm. We propose that this mechanism counters ectopic and precocious expression of functionally linked neuron-specific genes and ensures their coherent activation in the appropriate developmental context.

Identification of Late Larval Stage Developmental Checkpoints in Caenorhabditis elegans Regulated by Insulin/IGF and Steroid Hormone Signaling Pathways

PubMed Central

Schindler, Adam J.; Baugh, L. Ryan; Sherwood, David R.

2014-01-01

Organisms in the wild develop with varying food availability. During periods of nutritional scarcity, development may slow or arrest until conditions improve. The ability to modulate developmental programs in response to poor nutritional conditions requires a means of sensing the changing nutritional environment and limiting tissue growth. The mechanisms by which organisms accomplish this adaptation are not well understood. We sought to study this question by examining the effects of nutrient deprivation on Caenorhabditis elegans development during the late larval stages, L3 and L4, a period of extensive tissue growth and morphogenesis. By removing animals from food at different times, we show here that specific checkpoints exist in the early L3 and early L4 stages that systemically arrest the development of diverse tissues and cellular processes. These checkpoints occur once in each larval stage after molting and prior to initiation of the subsequent molting cycle. DAF-2, the insulin/insulin-like growth factor receptor, regulates passage through the L3 and L4 checkpoints in response to nutrition. The FOXO transcription factor DAF-16, a major target of insulin-like signaling, functions cell-nonautonomously in the hypodermis (skin) to arrest developmental upon nutrient removal. The effects of DAF-16 on progression through the L3 and L4 stages are mediated by DAF-9, a cytochrome P450 ortholog involved in the production of C. elegans steroid hormones. Our results identify a novel mode of C. elegans growth in which development progresses from one checkpoint to the next. At each checkpoint, nutritional conditions determine whether animals remain arrested or continue development to the next checkpoint. PMID:24945623

Identifying microRNAs that Regulate Neuroblastoma Cell Differentiation

DTIC Science & Technology

2015-10-01

Award Number: W81XWH-13-1-0241 TITLE: Identifying that Regulate Neuroblastoma Cell Differentiation PRINCIPAL INVESTIGATOR: Dr. Liqin Du...inducing miRNA, miR- 449a. We examined the differentiation-inducing function of miR-449a in multiple neuroblastoma cell lines. We have demonstrated that...miR-449a functions as an inducer of cell differentiation in neuroblastoma cell lines with distinct genetic backgrounds, including the MYCN

Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni

PubMed Central

Isokpehi, Raphael D.; Mahmud, Ousman; Mbah, Andreas N.; Simmons, Shaneka S.; Avelar, Lívia; Rajnarayanan, Rajendram V.; Udensi, Udensi K.; Ayensu, Wellington K.; Cohly, Hari H.; Brown, Shyretha D.; Dates, Centdrika R.; Hentz, Sonya D.; Hughes, Shawntae J.; Smith-McInnis, Dominique R.; Patterson, Carvey O.; Sims, Jennifer N.; Turner, Kelisha T.; Williams, Baraka S.; Johnson, Matilda O.; Adubi, Taiwo; Mbuh, Judith V.; Anumudu, Chiaka I.; Adeoye, Grace O.; Thomas, Bolaji N.; Nashiru, Oyekanmi; Oliveira, Guilherme

2011-01-01

The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the

Lipid phosphate phosphatase 3 regulates adipocyte sphingolipid synthesis, but not developmental adipogenesis or diet-induced obesity in mice.

PubMed

Federico, Lorenzo; Yang, Liping; Brandon, Jason; Panchatcharam, Manikandan; Ren, Hongmei; Mueller, Paul; Sunkara, Manjula; Escalante-Alcalde, Diana; Morris, Andrew J; Smyth, Susan S

2018-01-01

Dephosphorylation of phosphatidic acid (PA) is the penultimate step in triglyceride synthesis. Adipocytes express soluble intracellular PA-specific phosphatases (Lipins) and broader specificity membrane-associated lipid phosphate phosphatases (LPPs) that can also dephosphorylate PA. Inactivation of lipin1 causes lipodystrophy in mice due to defective developmental adipogenesis. Triglyceride synthesis is diminished but not ablated by inactivation of lipin1 in differentiated adipocytes implicating other PA phosphatases in this process. To investigate the possible role of LPPs in adipocyte lipid metabolism and signaling we made mice with adipocyte-targeted inactivation of LPP3 encoded by the Plpp3(Ppap2b) gene. Adipocyte LPP3 deficiency resulted in blunted ceramide and sphingomyelin accumulation during diet-induced adipose tissue expansion, accumulation of the LPP3 substrate sphingosine 1- phosphate, and reduced expression of serine palmitoyl transferase. However, adiposity was unaffected by LPP3 deficiency on standard, high fat diet or Western diets, although Western diet-fed mice with adipocyte LPP3 deficiency exhibited improved glucose tolerance. Our results demonstrate functional compartmentalization of lipid phosphatase activity in adipocytes and identify an unexpected role for LPP3 in the regulation of diet-dependent sphingolipid synthesis that may impact on insulin signaling.

Human genetics as a tool to identify progranulin regulators.

PubMed

Nicholson, Alexandra M; Finch, NiCole A; Rademakers, Rosa

2011-11-01

Frontotemporal lobar degeneration (FTLD) is a common neurodegenerative disorder that predominantly affects individuals under the age of 65. It is known that the most common pathological subtype is FTLD with TAR DNA-binding protein 43 inclusions (FTLD-TDP). FTLD has a strong genetic component with about 50% of cases having a positive family history. Mutations identified in the progranulin gene (GRN) have been shown to cause FTLD-TDP as a result of progranulin haploinsufficiency. These findings suggest a progranulin-dependent mechanism in this pathological FTLD subtype. Thus, identifying regulators of progranulin levels is essential for new therapies and treatments for FTLD and related disorders. In this review, we discuss the role of genetic studies in identifying progranulin regulators, beginning with the discovery of pathogenic GRN mutations and additional GRN risk variants. We also cover more recent genetic advances, including the detection of variants in the transmembrane protein 106 B gene that increase FTLD-TDP risk presumably by modulating progranulin levels and the identification of a potential progranulin receptor, sortilin. This review highlights the importance of genetic studies in the context of FTLD and further emphasizes the need for future genetic and cell biology research to continue the effort in finding a cure for progranulin-related diseases.

HUMAN GENETICS AS A TOOL TO IDENTIFY PROGRANULIN REGULATORS

PubMed Central

Nicholson, Alexandra M.; Finch, NiCole A.; Rademakers, Rosa

2012-01-01

Frontotemporal lobar degeneration (FTLD) is a common neurodegenerative disorder that predominantly affects individuals under the age of 65. It is known that the most common pathological subtype is FTLD with TAR DNA-binding protein 43 inclusions (FTLD-TDP). FTLD has a strong genetic component with about 50% of cases having a positive family history. Mutations identified in the progranulin gene (GRN) have been shown to cause FTLD-TDP as a result of progranulin haploinsufficiency. These findings suggest a progranulin-dependent mechanism in this pathological FTLD subtype. Thus, identifying regulators of progranulin levels is essential for new therapies and treatments for FTLD and related disorders. In this review, we discuss the role of genetic studies in identifying progranulin regulators, beginning with the discovery of pathogenic GRN mutations and additional GRN risk variants. We also cover more recent genetic advances, including the detection of variants in the transmembrane protein 106 B gene that increase FTLD-TDP risk presumably by modulating progranulin levels and the identification of a potential progranulin receptor, sortilin. This review highlights the importance of genetic studies in the context of FTLD and further emphasizes the need for future genetic and cell biology research to continue the effort in finding a cure for progranulin-related diseases. PMID:21626010

Evolutionary and Developmental Modules

PubMed Central

Lacquaniti, Francesco; Ivanenko, Yuri P.; d’Avella, Andrea; Zelik, Karl E.; Zago, Myrka

2013-01-01

The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates. PMID:23730285

Evolutionary and developmental modules.

PubMed

Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka

2013-01-01

The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Identification of Chemicals Inducing Cardiomyocyte Proliferation in Developmental Stage-Specific Manner with Pluripotent Stem Cells

PubMed Central

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A.; Engel, Felix B.; Yamashita, Jun K.

2013-01-01

Background The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provide therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells (PSCs). The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. Methods and Results To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse PSC-derived cardiomyocytes and identified 4 chemical compound groups - inhibitors of glycogen synthase kinase-3 (GSK3), p38 mitogen-activated protein kinase (MAPK) and Ca2+/calmodulin-dependent protein kinase II (CaMKII), and activators of extracellular signal-regulated kinase (ERK). Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human PSCs, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas ERK activators and CaMKII inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, GSK3 and p38 MAPK inhibitors substantially and synergistically induced reentry and progression of cell cycle in not only neonatal but also adult cardiomyocytes. Conclusions Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered PSC-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies. PMID:24141057

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

PubMed

Kishi, Shuji

2011-09-01

regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.

Mechanisms regulating nutrition-dependent developmental plasticity through organ-specific effects in insects

PubMed Central

Koyama, Takashi; Mendes, Cláudia C.; Mirth, Christen K.

2013-01-01

Nutrition, via the insulin/insulin-like growth factor (IIS)/Target of Rapamycin (TOR) signaling pathway, can provide a strong molding force for determining animal size and shape. For instance, nutrition induces a disproportionate increase in the size of male horns in dung and rhinoceros beetles, or mandibles in staghorn or horned flour beetles, relative to body size. In these species, well-fed male larvae produce adults with greatly enlarged horns or mandibles, whereas males that are starved or poorly fed as larvae bear much more modest appendages. Changes in IIS/TOR signaling plays a key role in appendage development by regulating growth in the horn and mandible primordia. In contrast, changes in the IIS/TOR pathway produce minimal effects on the size of other adult structures, such as the male genitalia in fruit flies and dung beetles. The horn, mandible and genitalia illustrate that although all tissues are exposed to the same hormonal environment within the larval body, the extent to which insulin can induce growth is organ specific. In addition, the IIS/TOR pathway affects body size and shape by controlling production of metamorphic hormones important for regulating developmental timing, like the steroid molting hormone ecdysone and sesquiterpenoid hormone juvenile hormone. In this review, we discuss recent results from Drosophila and other insects that highlight mechanisms allowing tissues to differ in their sensitivity to IIS/TOR and the potential consequences of these differences on body size and shape. PMID:24133450

Group III mGluR regulation of synaptic transmission at the SC-CA1 synapse is developmentally regulated

PubMed Central

Ayala, Jennifer E.; Niswender, Colleen M.; Luo, Qingwei; Banko, Jessica L.; Conn, P. Jeffrey

2008-01-01

Summary Group III metabotropic glutamate receptors (mGluRs) reduce synaptic transmission at the Schaffer collateral-CA1 (SC-CA1) synapse in rats by a presynaptic mechanism. Previous studies show that low concentrations of the group III-selective agonist, L-AP4, reduce synaptic transmission in slices from neonatal but not adult rats, whereas high micromolar concentrations reduce transmission in both age groups. L-AP4 activates mGluRs 4 and 8 at much lower concentrations than those required to activate mGluR7, suggesting that the group III mGluR subtype modulating transmission is a high affinity receptor in neonates and a low affinity receptor in adults. The previous lack of subtype selective ligands has made it difficult to test this hypothesis. We have measured fEPSPs in the presence of novel subtype selective agents to address this question. We show that the effects of L-AP4 can be blocked by LY341495 in both neonates and adults, verifying that these effects are mediated by mGluRs. In addition, the selective mGluR8 agonist, DCPG, has a significant effect in slices from neonatal rats but does not reduce synaptic transmission in adult slices. The mGluR4 selective allosteric potentiator, PHCCC, is unable to potentiate the L-AP4-induced effects at either age. Taken together, our data suggest that group III mGluRs regulate transmission at the SC-CA1 synapse throughout development but there is a developmental regulation of the subtypes involved so that that both mGluR8 serves this role in neonates but not adults whereas mGluR7 is involved in regulating transmission at this synapse in throughout postnatal development. PMID:18255102

Conservation in the involvement of heterochronic genes and hormones during developmental transitions.

PubMed

Faunes, Fernando; Larraín, Juan

2016-08-01

Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

PubMed

Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

2017-01-01

Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

Female-specific gene expression in dioecious liverwort Pellia endiviifolia is developmentally regulated and connected to archegonia production

PubMed Central

2014-01-01

developmentally regulated. The contribution of the identified genes may be crucial for successful liverwort sexual reproduction. PMID:24939387

Female-specific gene expression in dioecious liverwort Pellia endiviifolia is developmentally regulated and connected to archegonia production.

PubMed

Sierocka, Izabela; Kozlowski, Lukasz P; Bujnicki, Janusz M; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

2014-06-17

In flowering plants a number of genes have been identified which control the transition from a vegetative to generative phase of life cycle. In bryophytes representing basal lineage of land plants, there is little data regarding the mechanisms that control this transition. Two species from bryophytes - moss Physcomitrella patens and liverwort Marchantia polymorpha are under advanced molecular and genetic research. The goal of our study was to identify genes connected to female gametophyte development and archegonia production in the dioecious liverwort Pellia endiviifolia species B, which is representative of the most basal lineage of the simple thalloid liverworts. The utility of the RDA-cDNA technique allowed us to identify three genes specifically expressed in the female individuals of P.endiviifolia: PenB_CYSP coding for cysteine protease, PenB_MT2 and PenB_MT3 coding for Mysterious Transcripts1 and 2 containing ORFs of 143 and 177 amino acid residues in length, respectively. The exon-intron structure of all three genes has been characterized and pre-mRNA processing was investigated. Interestingly, five mRNA isoforms are produced from the PenB_MT2 gene, which result from alternative splicing within the second and third exon. All observed splicing events take place within the 5'UTR and do not interfere with the coding sequence. All three genes are exclusively expressed in the female individuals, regardless of whether they were cultured in vitro or were collected from a natural habitat. Moreover we observed ten-fold increased transcripts level for all three genes in the archegonial tissue in comparison to the vegetative parts of the same female thalli grown in natural habitat suggesting their connection to archegonia development. We have identified three genes which are specifically expressed in P.endiviifolia sp B female gametophytes. Moreover, their expression is connected to the female sex-organ differentiation and is developmentally regulated. The

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs

PubMed Central

Goodale, B. C.; La Du, J.; Tilton, S. C.; Sullivan, C. M.; Bisson, W. H.; Waters, K. M.; Tanguay, R. L.

2015-01-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. PMID:26141390

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Developmental and light regulation of tumor suppressor protein PP2A in the retina

PubMed Central

Rajala, Ammaji; Wang, Yuhong; Abcouwer, Steven F.; Gardner, Thomas W.; Rajala, Raju V.S.

2018-01-01

Protein phosphatases are a group of universal enzymes that are responsible for the dephosphorylation of various proteins and enzymes in cells. Cellular signal transduction events are largely governed by the phosphorylation of key proteins. The length of cellular response depends on the activation of protein phosphatase that dephosphorylates the phosphate groups to halt a biological response, and fine-tune the defined cellular outcome. Dysregulation of these phosphatase(s) results in various disease phenotypes. The retina is a post-mitotic tissue, and oncogenic tyrosine and serine/ threonine kinase activities are important for retinal neuron survival. Aberrant activation of protein phosphatase(s) may have a negative effect on retinal neurons. In the current study, we characterized tumor suppressor protein phosphatase 2 (PP2A), a major serine/ threonine kinase with a broad substrate specificity. Our data suggest that PP2A is developmentally regulated in the retina, localized predominantly in the inner retina, and expressed in photoreceptor inner segments. Our findings indicate that PKCα and mTOR may serve as PP2A substrates. We found that light regulates PP2A activity. Our studies also suggest that rhodopsin regulates PP2A and its substrate(s) dephosphorylation. PP2A substrate phosphorylation is increased in mice lacking the A-subunit of PP2A. However, there is no accompanying effect on retina structure and function. Together, our findings suggest that controlling the activity of PP2A in the retina may be neuroprotective. PMID:29416710

RasGRP1 regulates antigen-induced developmental programming by naive CD8 T cells.

PubMed

Priatel, John J; Chen, Xiaoxi; Huang, Yu-Hsuan; Chow, Michael T; Zenewicz, Lauren A; Coughlin, Jason J; Shen, Hao; Stone, James C; Tan, Rusung; Teh, Hung Sia

2010-01-15

Ag encounter by naive CD8 T cells initiates a developmental program consisting of cellular proliferation, changes in gene expression, and the formation of effector and memory T cells. The strength and duration of TCR signaling are known to be important parameters regulating the differentiation of naive CD8 T cells, although the molecular signals arbitrating these processes remain poorly defined. The Ras-guanyl nucleotide exchange factor RasGRP1 has been shown to transduce TCR-mediated signals critically required for the maturation of developing thymocytes. To elucidate the role of RasGRP1 in CD8 T cell differentiation, in vitro and in vivo experiments were performed with 2C TCR transgenic CD8 T cells lacking RasGRP1. In this study, we report that RasGRP1 regulates the threshold of T cell activation and Ag-induced expansion, at least in part, through the regulation of IL-2 production. Moreover, RasGRP1(-/-) 2C CD8 T cells exhibit an anergic phenotype in response to cognate Ag stimulation that is partially reversible upon the addition of exogenous IL-2. By contrast, the capacity of IL-2/IL-2R interactions to mediate Ras activation and CD8 T cell expansion and differentiation appears to be largely RasGRP1-independent. Collectively, our results demonstrate that RasGRP1 plays a selective role in T cell signaling, controlling the initiation and duration of CD8 T cell immune responses.

Functional screening for miRNAs targeting Smad4 identified miR-199a as a negative regulator of TGF-β signalling pathway

PubMed Central

Zhang, Yan; Fan, Kai-Ji; Sun, Qiang; Chen, Ai-Zhong; Shen, Wen-Long; Zhao, Zhi-Hu; Zheng, Xiao-Fei; Yang, Xiao

2012-01-01

The transforming growth factor-β (TGF-β) signalling pathway participates in various biological processes. Dysregulation of Smad4, a central cellular transducer of TGF-β signalling, is implicated in a wide range of human diseases and developmental disorders. However, the mechanisms underlying Smad4 dysregulation are not fully understood. Using a functional screening approach based on luciferase reporter assays, we identified 39 microRNAs (miRNAs) as potential regulators of Smad4 from an expression library of 388 human miRNAs. The screening was supported by bioinformatic analysis, as 24 of 39 identified miRNAs were also predicted to target Smad4. MiR-199a, one of the identified miRNAs, was inversely correlated with Smad4 expression in various human cancer cell lines and gastric cancer tissues, and repressed Smad4 expression and blocked canonical TGF-β transcriptional responses in cell lines. These effects were dependent on the presence of a conserved, but not perfect seed paired, miR-199a-binding site in the Smad4 3′-untranslated region (UTR). Overexpression of miR-199a significantly inhibited the ability of TGF-β to induce gastric cancer cell growth arrest and apoptosis in vitro, and promoted anchorage-independent growth in soft agar, suggesting that miR-199a plays an oncogenic role in human gastric tumourigenesis. In conclusion, our functional screening uncovers multiple miRNAs that regulate the cellular responsiveness to TGF-β signalling and reveals important roles of miR-199a in gastric cancer by directly targeting Smad4. PMID:22821565

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental

Predicting Success of Developmental Math Students

ERIC Educational Resources Information Center

Martinez, Isaac

2017-01-01

Addressing the needs of developmental math students has been one of the most challenging problems in higher education. Administrators at a private university were concerned about poor academic performance of math-deficient students and sought to identify factors that influenced students' successful progression from developmental to college-level…

A genomic approach to identify hybrid incompatibility genes.

PubMed

Cooper, Jacob C; Phadnis, Nitin

2016-07-02

Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids.

A genomic approach to identify hybrid incompatibility genes

PubMed Central

Cooper, Jacob C.; Phadnis, Nitin

2016-01-01

ABSTRACT Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids. PMID:27230814

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Brief report: Poor self-regulation as a predictor of individual differences in adaptive functioning in young children with autism spectrum disorder.

PubMed

Uljarević, Mirko; Hedley, Darren; Nevill, Rose; Evans, David W; Cai, Ru Ying; Butter, Eric; Mulick, James A

2018-04-06

The present study examined the link between poor self-regulation (measured by the child behavior checklist dysregulated profile [DP]) and core autism symptoms, as well as with developmental level, in a sample of 107 children with autism spectrum disorder (ASD) aged 19-46 months. We further examined the utility of DP in predicting individual differences in adaptive functioning, relative to the influence of ASD severity, chronological age (CA), and developmental level. Poor self-regulation was unrelated to CA, developmental level, and severity of ADOS-2 restricted and repetitive behaviors, but was associated with lower ADOS-2 social affect severity. Hierarchical regression identified poor self-regulation as a unique independent predictor of adaptive behavior, with more severe dysregulation predicting poorer adaptive functioning. Results highlight the importance of early identification of deficits in self-regulation, and more specifically, of the utility of DP, when designing individually tailored treatments for young children with ASD. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. This study explored the relationship between poor self-regulation and age, verbal and non-verbal developmental level, severity of autism symptoms and adaptive functioning in 107 children with autism under 4 years of age. Poor self-regulation was unrelated to age, developmental level, and severity of restricted and repetitive behaviors but was associated with lower social affect severity. Importantly, more severe self-regulation deficits predicted poorer adaptive functioning. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.

Value of parents' estimates of children's developmental ages.

PubMed

Glascoe, F P; Sandler, H

1995-11-01

To determine whether parents' estimates of children's developmental ages can function as a prescreening technique. Parents of 234 children from birth to 77 months of age seeking well-child care in pediatric offices were queried in two separate studies. In the first study, parents were asked to give an estimate of their child's overall developmental age and, in the second study, to estimate ages in each of six developmental domains. Children were administered a range of screening measures of intelligence, speech-language, and adoptive behavior. The overall age-estimate, if less than chronologic age, was 75% sensitive to likely developmental problems and, if equal to or greater than chronologic age, was 90% specific in identifying children likely to have typical development. Age estimates for each developmental domain were 81% sensitive to likely developmental problems if less than chronologic age in the domains of fine motor, language, grass motor, or behavior, and 62% specific if equal to or greater than chronologic age. Estimates at or below chronologic age in receptive language or personal-social domains were 90% sensitive and 43% specific in identifying likely behavior problems. There were no differences in the accuracy of parents estimates on the basis of children's age, gender, race, parents' level of education, or parenting experience. Parents' overall age-estimates provided a sensitive and specific indicator of global developmental status, but insufficient information about strengths and weaknesses to enable focused referrals for services. In contrast, discrete patterns of age estimates in each developmental domain sensitively discriminated children with developmental versus behavioral problems, although specificity was limited. Age estimates appear to be a potentially helpful method for identifying a subset of children in need of thorough screening, although further research is needed on a larger sample given diagnostic rather than screening tests.

EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

PubMed Central

Brenner, Eric D; Katari, Manpreet S; Stevenson, Dennis W; Rudd, Stephen A; Douglas, Andrew W; Moss, Walter N; Twigg, Richard W; Runko, Suzan J; Stellari, Giulia M; McCombie, WR; Coruzzi, Gloria M

2005-01-01

Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate), female (megasporangiate), and vegetative organs (leaves) of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and pollen evolution, and to

29 CFR 1956.62 - Completion of developmental steps and certification. [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completion of developmental steps and certification. [Reserved] 1956.62 Section 1956.62 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... EMPLOYEE PLANS New Jersey § 1956.62 Completion of developmental steps and certification. [Reserved] ...

De novo pathogenic variants in CHAMP1 are associated with global developmental delay, intellectual disability, and dysmorphic facial features.

PubMed

Tanaka, Akemi J; Cho, Megan T; Retterer, Kyle; Jones, Julie R; Nowak, Catherine; Douglas, Jessica; Jiang, Yong-Hui; McConkie-Rosell, Allyn; Schaefer, G Bradley; Kaylor, Julie; Rahman, Omar A; Telegrafi, Aida; Friedman, Bethany; Douglas, Ganka; Monaghan, Kristin G; Chung, Wendy K

2016-01-01

We identified five unrelated individuals with significant global developmental delay and intellectual disability (ID), dysmorphic facial features and frequent microcephaly, and de novo predicted loss-of-function variants in chromosome alignment maintaining phosphoprotein 1 (CHAMP1). Our findings are consistent with recently reported de novo mutations in CHAMP1 in five other individuals with similar features. CHAMP1 is a zinc finger protein involved in kinetochore-microtubule attachment and is required for regulating the proper alignment of chromosomes during metaphase in mitosis. Mutations in CHAMP1 may affect cell division and hence brain development and function, resulting in developmental delay and ID.

Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

NASA Astrophysics Data System (ADS)

Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

1987-05-01

Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

Multi-scale computational modeling of developmental biology.

PubMed

Setty, Yaki

2012-08-01

Normal development of multicellular organisms is regulated by a highly complex process in which a set of precursor cells proliferate, differentiate and move, forming over time a functioning tissue. To handle their complexity, developmental systems can be studied over distinct scales. The dynamics of each scale is determined by the collective activity of entities at the scale below it. I describe a multi-scale computational approach for modeling developmental systems and detail the methodology through a synthetic example of a developmental system that retains key features of real developmental systems. I discuss the simulation of the system as it emerges from cross-scale and intra-scale interactions and describe how an in silico study can be carried out by modifying these interactions in a way that mimics in vivo experiments. I highlight biological features of the results through a comparison with findings in Caenorhabditis elegans germline development and finally discuss about the applications of the approach in real developmental systems and propose future extensions. The source code of the model of the synthetic developmental system can be found in www.wisdom.weizmann.ac.il/~yaki/MultiScaleModel. yaki.setty@gmail.com Supplementary data are available at Bioinformatics online.

A rapid throughput approach identifies cognitive deficits in adult zebrafish from developmental exposure to polybrominated flame retardants.

PubMed

Truong, Lisa; Mandrell, David; Mandrell, Rick; Simonich, Michael; Tanguay, Robert L

2014-07-01

A substantial body of evidence has correlated the human body burdens of some polybrominated diphenyl ether (PBDE) flame retardants with cognitive and other behavioral deficits. Adult zebrafish exhibit testable learning and memory, making them an increasingly attractive model for neurotoxicology. Our goal was to develop a rapid throughput means of identifying the cognitive impact of developmental exposure to flame retardants in the zebrafish model. We exposed embryos from 6h post fertilization to 5 days post fertilization to either PBDE 47 (0.1μM), PBDE 99 (0.1μM) or PBDE 153 (0.1μM), vehicle (0.1% DMSO), or embryo medium (EM). The larvae were grown to adulthood and evaluated for the rate at which they learned an active-avoidance response in an automated shuttle box array. Zebrafish developmentally exposed to PBDE 47 learned the active avoidance paradigm significantly faster than the 0.1% DMSO control fish (P<0.0001), but exhibited significantly poorer performance when retested suggestive of impaired memory retention or altered neuromotor activity. Learning in the PBDE 153 group was not significantly different from the DMSO group. Developmental exposure to 0.1% DMSO impaired adult active avoidance learning relative to the sham group (n=39; P<0.0001). PBDE 99 prevented the DMSO effect, yielding a learning rate not significantly different from the sham group (n=36; P>0.9). Our results underscore the importance of vehicle choice in accurately assessing chemical effects on behavior. Active avoidance response in zebrafish is an effective model of learning that, combined with automated shuttle box testing, will provide a highly efficient platform for evaluating persistent neurotoxic hazard from many chemicals. Copyright © 2014 Elsevier Inc. All rights reserved.

Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

PubMed

Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

2014-01-01

Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

TGMI: an efficient algorithm for identifying pathway regulators through evaluation of triple-gene mutual interaction

PubMed Central

Gunasekara, Chathura; Zhang, Kui; Deng, Wenping; Brown, Laura

2018-01-01

Abstract Despite their important roles, the regulators for most metabolic pathways and biological processes remain elusive. Presently, the methods for identifying metabolic pathway and biological process regulators are intensively sought after. We developed a novel algorithm called triple-gene mutual interaction (TGMI) for identifying these regulators using high-throughput gene expression data. It first calculated the regulatory interactions among triple gene blocks (two pathway genes and one transcription factor (TF)), using conditional mutual information, and then identifies significantly interacted triple genes using a newly identified novel mutual interaction measure (MIM), which was substantiated to reflect strengths of regulatory interactions within each triple gene block. The TGMI calculated the MIM for each triple gene block and then examined its statistical significance using bootstrap. Finally, the frequencies of all TFs present in all significantly interacted triple gene blocks were calculated and ranked. We showed that the TFs with higher frequencies were usually genuine pathway regulators upon evaluating multiple pathways in plants, animals and yeast. Comparison of TGMI with several other algorithms demonstrated its higher accuracy. Therefore, TGMI will be a valuable tool that can help biologists to identify regulators of metabolic pathways and biological processes from the exploded high-throughput gene expression data in public repositories. PMID:29579312

Ligand-specific transcriptional mechanisms underlie aryl hydrocarbon receptor-mediated developmental toxicity of oxygenated PAHs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodale, B. C.; Geisel School of Medicine at Dartmouth, Hanover, NH; La Du, J.

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, butmore » only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Furthermore, identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds.« less

Ligand-specific transcriptional mechanisms underlie aryl hydrocarbon receptor-mediated developmental toxicity of oxygenated PAHs

DOE PAGES

Goodale, B. C.; Geisel School of Medicine at Dartmouth, Hanover, NH; La Du, J.; ...

2015-07-03

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, butmore » only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Furthermore, identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds.« less

Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying both distinct and similar responses to cytokinin down- and up-regulation.

PubMed

Černý, Martin; Kuklová, Alena; Hoehenwarter, Wolfgang; Fragner, Lena; Novák, Ondrej; Rotková, Gabriela; Jedelsky, Petr L; Žáková, Katerina; Šmehilová, Mária; Strnad, Miroslav; Weckwerth, Wolfram; Brzobohaty, Bretislav

2013-11-01

In plants, numerous developmental processes are controlled by cytokinin (CK) levels and their ratios to levels of other hormones. While molecular mechanisms underlying the regulatory roles of CKs have been intensely researched, proteomic and metabolomic responses to CK deficiency are unknown. Transgenic Arabidopsis seedlings carrying inducible barley cytokinin oxidase/dehydrogenase (CaMV35S>GR>HvCKX2) and agrobacterial isopentenyl transferase (CaMV35S>GR>ipt) constructs were profiled to elucidate proteome- and metabolome-wide responses to down- and up-regulation of CK levels, respectively. Proteome profiling identified >1100 proteins, 155 of which responded to HvCKX2 and/or ipt activation, mostly involved in growth, development, and/or hormone and light signalling. The metabolome profiling covered 79 metabolites, 33 of which responded to HvCKX2 and/or ipt activation, mostly amino acids, carbohydrates, and organic acids. Comparison of the data sets obtained from activated CaMV35S>GR>HvCKX2 and CaMV35S>GR>ipt plants revealed unexpectedly extensive overlaps. Integration of the proteomic and metabolomic data sets revealed: (i) novel components of molecular circuits involved in CK action (e.g. ribosomal proteins); (ii) previously unrecognized links to redox regulation and stress hormone signalling networks; and (iii) CK content markers. The striking overlaps in profiles observed in CK-deficient and CK-overproducing seedlings might explain surprising previously reported similarities between plants with down- and up-regulated CK levels.

Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.

PubMed

Osborn, Daniel P S; Roccasecca, Rosa Maria; McMurray, Fiona; Hernandez-Hernandez, Victor; Mukherjee, Sriparna; Barroso, Inês; Stemple, Derek; Cox, Roger; Beales, Philip L; Christou-Savina, Sonia

2014-01-01

Common intronic variants in the Human fat mass and obesity-associated gene (FTO) are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish) and in vitro (Fto(-/-) MEFs and HEK293T). Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+) pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.

Developmental and environmental regulation of antifreeze proteins in the mealworm beetle Tenebrio molitor.

PubMed

Graham, L A; Walker, V K; Davies, P L

2000-11-01

The yellow mealworm beetle, Tenebrio molitor, contains a family of small Cys-rich and Thr-rich thermal hysteresis proteins that depress the hemolymph freezing point below the melting point by as much as 5. 5 degrees C (DeltaT = thermal hysteresis). Thermal hysteresis protein expression was evaluated throughout development and after exposure to altered environmental conditions. Under favorable growth conditions, small larvae (11-13 mg) had only low levels of thermal hysteresis proteins or thermal hysteresis protein message, but these levels increased 10-fold and 18-fold, respectively, by the final larval instar (> 190 mg), resulting in thermal hysteresis > 3 degrees C. Exposure of small larvae (11-13 mg) to 4 weeks of cold (4 degrees C) caused an approximately 20-fold increase in thermal hysteresis protein concentration, well in excess of the less than threefold developmental increase seen after 4 weeks at 22 degrees C. Exposure of large larvae (100-120 mg) to cold caused 12-fold and sixfold increases in thermal hysteresis protein message and protein levels, respectively, approximately double the maximum levels they would have attained in the final larval instar at 22 degrees C. Thus, thermal hysteresis increased to similar levels (> 4 degrees C) in the cold, irrespective of the size of the larvae (the overwintering stage). At pupation, thermal hysteresis protein message levels decreased > 20-fold and remained low thereafter, but thermal hysteresis activity decreased much more slowly. Exposure to cold did not reverse this decline. Desiccation or starvation of larvae had comparable effects to cold exposure, but surprisingly, short daylength photoperiod or total darkness had no effect on either thermal hysteresis or message levels. As all environmental conditions that caused increased thermal hysteresis also inhibited growth, we postulate that developmental arrest is a primary factor in the regulation of T. molitor thermal hysteresis proteins.

Co-Occurrence of Developmental Disorders: The Case of Developmental Dyscalculia

ERIC Educational Resources Information Center

Rubinsten, Orly

2009-01-01

Five to seven percent of children experience severe difficulties in learning mathematics and/or reading. Current trials that are focused on identifying biological markers suggest that these learning disabilities, known as Developmental Dyscalculia (DD) and Dyslexia (for reading), are due to underlying brain dysfunctions. One ongoing controversy…

Abscisic Acid Induction of Vacuolar H+-ATPase Activity in Mesembryanthemum crystallinum Is Developmentally Regulated1

PubMed Central

Barkla, Bronwyn J.; Vera-Estrella, Rosario; Maldonado-Gama, Minerva; Pantoja, Omar

1999-01-01

Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways. PMID:10398716

Transgenerational developmental programming.

PubMed

Aiken, Catherine E; Ozanne, Susan E

2014-01-01

The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations

Tensor-driven extraction of developmental features from varying paediatric EEG datasets.

PubMed

Kinney-Lang, Eli; Spyrou, Loukianos; Ebied, Ahmed; Chin, Richard Fm; Escudero, Javier

2018-05-21

Constant changes in developing children's brains can pose a challenge in EEG dependant technologies. Advancing signal processing methods to identify developmental differences in paediatric populations could help improve function and usability of such technologies. Taking advantage of the multi-dimensional structure of EEG data through tensor analysis may offer a framework for extracting relevant developmental features of paediatric datasets. A proof of concept is demonstrated through identifying latent developmental features in resting-state EEG. Approach. Three paediatric datasets (n = 50, 17, 44) were analyzed using a two-step constrained parallel factor (PARAFAC) tensor decomposition. Subject age was used as a proxy measure of development. Classification used support vector machines (SVM) to test if PARAFAC identified features could predict subject age. The results were cross-validated within each dataset. Classification analysis was complemented by visualization of the high-dimensional feature structures using t-distributed Stochastic Neighbour Embedding (t-SNE) maps. Main Results. Development-related features were successfully identified for the developmental conditions of each dataset. SVM classification showed the identified features could accurately predict subject at a significant level above chance for both healthy and impaired populations. t-SNE maps revealed suitable tensor factorization was key in extracting the developmental features. Significance. The described methods are a promising tool for identifying latent developmental features occurring throughout childhood EEG. © 2018 IOP Publishing Ltd.

A developmental-psychobiological approach to developmental neuropsychology.

PubMed

Michel, G F

2001-01-01

Although both developmental psychobiology and developmental neuropsychology examine the interface between biological and psychological processes, they differ in conceptual framework. This article argues for the incorporation into developmental neuropsychology of certain aspects of the conceptual framework of developmental psychobiology. Three principles of dynamic psychobiological interaction are described and applied to four issues in neuropsychology (handedness, sex differences in behavior, critical periods, and modularity of structure-function relations). Then, it is proposed that developmental psychobiology can make four direct contributions to developmental neuropsychology. Finally, it is argued that the value of the conceptual framework provided by developmental psychobiology depends, in part, on how well it translates into procedures that can be applied in the clinical settings of the developmental neuropsychologist.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

PubMed

Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A

2016-04-01

A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

Bulimia: A Self-Psychological and Ego-Developmental View.

ERIC Educational Resources Information Center

Brenner-Liss, Deborah

1986-01-01

Discusses key clinical issues in the treatment of bulimia with clinical examples from a self-psychological and ego-developmental point of view. Identifies three developmental issues for bulimia: self-regulatory, differentiation, and self-esteem. (Author/ABB)

Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

PubMed

Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

2017-10-01

Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

A Framework for Assessing Developmental Education Programs

ERIC Educational Resources Information Center

Goldwasser, Molly; Martin, Kimberly; Harris, Eugenia

2017-01-01

This paper presents a framework for educators, administrators, and researchers to assess distinct facets of developmental education programs. The researchers review the literature on best practices in developmental education with regards to program cost, program structure, and student placement procedures. This paper also identifies seven model…

Developmental Summer Bridge Programs. What Works Clearinghouse™ Intervention Report

ERIC Educational Resources Information Center

What Works Clearinghouse, 2015

2015-01-01

Developmental summer bridge programs are designed to reduce the need for developmental education in college by providing students with accelerated instruction in areas where additional knowledge and skills are needed to help them succeed in higher education. The WWC identified one study of developmental summer bridge programs that meets WWC…

Sequential evolution of bacterial morphology by co-option of a developmental regulator.

PubMed

Jiang, Chao; Brown, Pamela J B; Ducret, Adrien; Brun, Yves V

2014-02-27

What mechanisms underlie the transitions responsible for the diverse shapes observed in the living world? Although bacteria exhibit a myriad of morphologies, the mechanisms responsible for the evolution of bacterial cell shape are not understood. We investigated morphological diversity in a group of bacteria that synthesize an appendage-like extension of the cell envelope called the stalk. The location and number of stalks varies among species, as exemplified by three distinct subcellular positions of stalks within a rod-shaped cell body: polar in the genus Caulobacter and subpolar or bilateral in the genus Asticcacaulis. Here we show that a developmental regulator of Caulobacter crescentus, SpmX, is co-opted in the genus Asticcacaulis to specify stalk synthesis either at the subpolar or bilateral positions. We also show that stepwise evolution of a specific region of SpmX led to the gain of a new function and localization of this protein, which drove the sequential transition in stalk positioning. Our results indicate that changes in protein function, co-option and modularity are key elements in the evolution of bacterial morphology. Therefore, similar evolutionary principles of morphological transitions apply to both single-celled prokaryotes and multicellular eukaryotes.

The let-7 microRNA interfaces extensively with the translation machinery to regulate cell differentiation

PubMed Central

Ding, Xavier C.; Slack, Frank J.; Großhans, Helge

2010-01-01

MicroRNAs (miRNAs) are noncoding RNAs that regulate numerous target genes through a posttranscriptional mechanism and thus control major developmental pathways. The phylogenetically conserved let-7 miRNA regulates cell proliferation and differentiation, thus functioning as a key regulator of developmental timing in C. elegans and a tumor suppressor gene in humans. Using a reverse genetic screen, we have identified genetic interaction partners of C. elegans let-7, including known and novel potential target genes. Initial identification of several translation initiation factors as suppressors of a let-7 mutation led us to systematically examine genetic interaction between let-7 and the translational machinery, which we found to be widespread. In the presence of wild-type let-7, depletion of the translation initiation factor eIF3 resulted in precocious cell differentiation, suggesting that developmental timing is translationally regulated, possibly by let-7. As overexpression of eIF3 in humans promotes translation of mRNAs that are also targets of let-7-mediated repression, we suggest that eIF3 may directly or indirectly oppose let-7 activity. This might provide an explanation for the opposite functions of let-7 and eIF3 in regulating tumorigenesis. PMID:18818519

RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

PubMed Central

Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

PubMed

Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species

Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

EPA Science Inventory

Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

Macroevolutionary developmental biology: Embryos, fossils, and phylogenies.

PubMed

Organ, Chris L; Cooper, Lisa Noelle; Hieronymus, Tobin L

2015-10-01

The field of evolutionary developmental biology is broadly focused on identifying the genetic and developmental mechanisms underlying morphological diversity. Connecting the genotype with the phenotype means that evo-devo research often considers a wide range of evidence, from genetics and morphology to fossils. In this commentary, we provide an overview and framework for integrating fossil ontogenetic data with developmental data using phylogenetic comparative methods to test macroevolutionary hypotheses. We survey the vertebrate fossil record of preserved embryos and discuss how phylogenetic comparative methods can integrate data from developmental genetics and paleontology. Fossil embryos provide limited, yet critical, developmental data from deep time. They help constrain when developmental innovations first appeared during the history of life and also reveal the order in which related morphologies evolved. Phylogenetic comparative methods provide a powerful statistical approach that allows evo-devo researchers to infer the presence of nonpreserved developmental traits in fossil species and to detect discordant evolutionary patterns and processes across levels of biological organization. © 2015 Wiley Periodicals, Inc.

Developmental palaeobiology of trilobite eyes and its evolutionary significance

NASA Astrophysics Data System (ADS)

Thomas, A. T.

2005-06-01

Understanding of the calcified composite eyes of trilobites, the oldest preserved visual system, has advanced greatly in recent decades. Three types of trilobite eye occur, the more derived abathochroal and schizochroal types having evolved neotenically from holochroal eyes. Comparative morphology and phylogenetic considerations suggest that all three eye-types were underlain by common developmental systems. So far, understanding of these systems has been based entirely on morphological data from fossils, particularly the way the visual surface grew and the patterning of lens emplacement. Lenses characteristically form a hexagonal array comprising horizontal rows and, conspicuously in schizochroal eyes, dorso-ventral files. Because individual trilobites sometimes have eyes with different numbers of files, file number must reflect the operation of a developmental programme rather than being under immediate genetic control. An empirical developmental model has been devised to describe trilobite eye development, with separate rules dealing with the initiation of lens emplacement, growth and differentiation of the visual surface, and the termination of lens emplacement. Rarely, trilobites may have visual surfaces of normal size, but which lack lenses. This confirms that visual surface growth must have been regulated separately from lens emplacement, and is a feature that cannot be accounted for by the existing developmental model. Such a developmental separation is one of a number of similarities shared with Drosophila, the modern arthropod in which eye development is best understood. Many aspects of eye development are conserved in the Euarthropoda, and in bilaterian metazoans in general. A revised model for trilobite eye development is proposed using extant phylogenetic bracketing, interpreting morphological data from the fossils in the context of the hierarchy of developmental controls now becoming known from living animals. This new model suggests that overall eye

29 CFR 1952.221 - Developmental schedule.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...

Developmental changes in Ca2+ channel subtypes regulating endocytosis at the calyx of Held

PubMed Central

Midorikawa, Mitsuharu; Okamoto, Yuji; Sakaba, Takeshi

2014-01-01

At the mammalian central synapse, Ca2+ influx through Ca2+ channels triggers neurotransmitter release by exocytosis of synaptic vesicles, which fuse with the presynaptic membrane and are subsequently retrieved by endocytosis. At the calyx of Held terminal, P/Q-type Ca2+ channels mainly mediate exocytosis, while N- and R-type channels have a minor role in young terminals (postnatal days 8–11). The role of each Ca2+ channel subtype in endocytosis remains to be elucidated; therefore, we examined the role of each type of Ca2+ channel in endocytosis, by using whole-cell patch-clamp recordings in conjunction with capacitance measurement techniques. We found that at the young calyx terminal, when R-type Ca2+ channels were blocked, the slow mode of endocytosis was further slowed, while blocking of either P/Q- or N-type Ca2+ channels had no major effect. In more mature terminals (postnatal days 14–17), the slow mode of endocytosis was mainly triggered by P/Q-type Ca2+ channels, suggesting developmental changes in the regulation of the slow mode of endocytosis by different Ca2+ channel subtypes. In contrast, a fast mode of endocytosis was observed after strong stimulation in young terminals that was mediated mainly by P/Q-type, but not R- or N-type Ca2+ channels. These results suggest that different types of Ca2+ channels regulate the two different modes of endocytosis. The results may also suggest that exo- and endocytosis are regulated independently at different sites in young animals but are more tightly coupled in older animals, allowing more efficient synaptic vesicle cycling adapted for fast signalling. PMID:24907302

FRUITFULL controls SAUR10 expression and regulates Arabidopsis growth and architecture.

PubMed

Bemer, Marian; van Mourik, Hilda; Muiño, Jose M; Ferrándiz, Cristina; Kaufmann, Kerstin; Angenent, Gerco C

2017-06-15

MADS-domain transcription factors are well known for their roles in plant development and regulate sets of downstream genes that have been uncovered by high-throughput analyses. A considerable number of these targets are predicted to function in hormone responses or responses to environmental stimuli, suggesting that there is a close link between developmental and environmental regulators of plant growth and development. Here, we show that the Arabidopsis MADS-domain factor FRUITFULL (FUL) executes several functions in addition to its noted role in fruit development. Among the direct targets of FUL, we identified SMALL AUXIN UPREGULATED RNA 10 (SAUR10), a growth regulator that is highly induced by a combination of auxin and brassinosteroids and in response to reduced R:FR light. Interestingly, we discovered that SAUR10 is repressed by FUL in stems and inflorescence branches. SAUR10 is specifically expressed at the abaxial side of these branches and this localized activity is influenced by hormones, light conditions and by FUL, which has an effect on branch angle. Furthermore, we identified a number of other genes involved in hormone pathways and light signalling as direct targets of FUL in the stem, demonstrating a connection between developmentally and environmentally regulated growth programs. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The Ultimate Developmental Task in Adolescent Literature.

ERIC Educational Resources Information Center

Abrahamson, Richard F.

The significance of adolescent literature has been judged on the basis of the developmental tasks encountered by the main character. One writer has identified eight developmental tasks that teenagers must undertake as they move toward adulthood: discovering one's sex role in our culture, developing relationships with peers, achieving an easy…

Identifying and regulating carcinogens. Background paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1987-11-01

Contents include: Introduction and summary; policies for testing, assessing, and regulating carcinogens; federal agency assessment and regulation of carcinogens; the national toxicology program; agency responses to the annual report on carcinogens and NCI/NTP test results; statutory authority for regulating carcinogens; chemicals listed in annual report on carcinogens and NCI/NTP test results.

The Development of Self-Regulation across Early Childhood

PubMed Central

Montroy, Janelle J.; Bowles, Ryan P.; Skibbe, Lori E.; McClelland, Megan M.; Morrison, Frederick J.

2016-01-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of three and seven, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across three diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow three distinct developmental patterns of growth. These three trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds with implications for offering individualized support across children. PMID:27709999

A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

PubMed

Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

2015-12-01

A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

Regulation of nucleosome positioning by a CHD Type III chromatin remodeler and its relationship to developmental gene expression in Dictyostelium.

PubMed

Platt, James L; Kent, Nicholas A; Kimmel, Alan R; Harwood, Adrian J

2017-04-01

Nucleosome placement and repositioning can direct transcription of individual genes; however, the precise interactions of these events are complex and largely unresolved at the whole-genome level. The Chromodomain-Helicase-DNA binding (CHD) Type III proteins are a subfamily of SWI2/SNF2 proteins that control nucleosome positioning and are associated with several complex human disorders, including CHARGE syndrome and autism. Type III CHDs are required for multicellular development of animals and Dictyostelium but are absent in plants and yeast. These CHDs can mediate nucleosome translocation in vitro, but their in vivo mechanism is unknown. Here, we use genome-wide analysis of nucleosome positioning and transcription profiling to investigate the in vivo relationship between nucleosome positioning and gene expression during development of wild-type (WT) Dictyostelium and mutant cells lacking ChdC, a Type III CHD protein ortholog. We demonstrate major nucleosome positional changes associated with developmental gene regulation in WT. Loss of chdC caused an increase of intragenic nucleosome spacing and misregulation of gene expression, affecting ∼50% of the genes that are repositioned during WT development. These analyses demonstrate active nucleosome repositioning during Dictyostelium multicellular development, establish an in vivo function of CHD Type III chromatin remodeling proteins in this process, and reveal the detailed relationship between nucleosome positioning and gene regulation, as cells transition between developmental states. © 2017 Platt et al.; Published by Cold Spring Harbor Laboratory Press.

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

Strategies for Teaching Developmental Mathematics Students at the College Level

ERIC Educational Resources Information Center

Swaincott Kautz, Natalie Lynn

2016-01-01

The purpose of this investigation was to identify strategies used by effective instructors of developmental mathematics, and to discover the perceptions developmental mathematics students have about these strategies. While there are research projects focusing solely on developmental mathematics achievement, this study fills a need by incorporating…

Resilience as Regulation of Developmental and Family Processes

PubMed Central

MacPhee, David; Lunkenheimer, Erika; Riggs, Nathaniel

2015-01-01

Resilience can be defined as establishing equilibrium subsequent to disturbances to a system caused by significant adversity. When families experience adversity or transitions, multiple regulatory processes may be involved in establishing equilibrium, including adaptability, regulation of negative affect, and effective problem-solving skills. The authors’ resilience-as-regulation perspective integrates insights about the regulation of individual development with processes that regulate family systems. This middle-range theory of family resilience focuses on regulatory processes across levels that are involved in adaptation: whole-family systems such as routines and sense of coherence; coregulation of dyads involving emotion regulation, structuring, and reciprocal influences between social partners; and individual self-regulation. Insights about resilience-as-regulation are then applied to family-strengthening interventions that are designed to promote adaptation to adversity. Unresolved issues are discussed in relation to resilience-as-regulation in families, in particular how risk exposure is assessed, interrelations among family regulatory mechanisms, and how families scaffold the development of children’s resilience. PMID:26568647

Cell identity regulators link development and stress responses in the Arabidopsis root.

PubMed

Iyer-Pascuzzi, Anjali S; Jackson, Terry; Cui, Hongchang; Petricka, Jalean J; Busch, Wolfgang; Tsukagoshi, Hironaka; Benfey, Philip N

2011-10-18

Stress responses in plants are tightly coordinated with developmental processes, but interaction of these pathways is poorly understood. We used genome-wide assays at high spatiotemporal resolution to understand the processes that link development and stress in the Arabidopsis root. Our meta-analysis finds little evidence for a universal stress response. However, common stress responses appear to exist with many showing cell type specificity. Common stress responses may be mediated by cell identity regulators because mutations in these genes resulted in altered responses to stress. Evidence for a direct role for cell identity regulators came from genome-wide binding profiling of the key regulator SCARECROW, which showed binding to regulatory regions of stress-responsive genes. Coexpression in response to stress was used to identify genes involved in specific developmental processes. These results reveal surprising linkages between stress and development at cellular resolution, and show the power of multiple genome-wide data sets to elucidate biological processes. Copyright © 2011 Elsevier Inc. All rights reserved.

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs.

PubMed

Goodale, B C; La Du, J; Tilton, S C; Sullivan, C M; Bisson, W H; Waters, K M; Tanguay, R L

2015-10-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Developmentally regulated expression of APG-1, a member of heat shock protein 110 family in murine male germ cells.

PubMed

Kaneko, Y; Kimura, T; Nishiyama, H; Noda, Y; Fujita, J

1997-04-07

Apg-1 encodes a heat shock protein belonging to the heat shock protein 110 family, and is inducible by a 32 degrees C to 39 degrees C heat shock. Northern blot analysis of the testis from immature and adult mice, and of the purified germ cells revealed the quantitative change of the apg-1 transcripts during germ cell development. By in situ hybridization histochemistry the expressions of the apg-1 transcripts were detected in germ cells at specific stages of development including spermatocytes and spermatids. Although heat-induction of the apg-1 transcripts was observed in W/Wv mutant testis lacking germ cells, it was not detected in wild-type testis nor in the purified germ cells. Thus, the apg-1 expression is not heat-regulated but developmentally regulated in germ cells, suggesting that APG-1 plays a role in normal development of germ cells.

77 FR 35921 - Defense Federal Acquisition Regulation Supplement: Item Unique Identifier Update (DFARS Case 2011...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-15

... DEPARTMENT OF DEFENSE Defense Acquisition Regulations System 48 CFR Parts 211, 212, 218, 246, 252 and Appendix F to Chapter 2 RIN 0750-AH64 Defense Federal Acquisition Regulation Supplement: Item Unique Identifier Update (DFARS Case 2011-D055) AGENCY: Defense Acquisition Regulations System...

Developmental and Environmental Regulation of Aquaporin Gene Expression across Populus Species: Divergence or Redundancy?

PubMed Central

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

PubMed

Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

2013-01-01

Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

PubMed Central

Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

2011-01-01

Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and

Developmental Methodology as a Context for Interdisciplinary Dialogue in Developmental Science

ERIC Educational Resources Information Center

Card, Noel A.

2014-01-01

In this comment, I first highlight the contributions of Robinson-Cimpian, Lubienski, Ganley, and Copur-Gencturk (2014) in particular and a more interdisciplinary approach in general for the subdiscipline of developmental psychology. Second, I identify some historic methodological foci of psychology and encourage Robinson-Cimpian et al. to consider…

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

Influence maximization in time bounded network identifies transcription factors regulating perturbed pathways

PubMed Central

Jo, Kyuri; Jung, Inuk; Moon, Ji Hwan; Kim, Sun

2016-01-01

Motivation: To understand the dynamic nature of the biological process, it is crucial to identify perturbed pathways in an altered environment and also to infer regulators that trigger the response. Current time-series analysis methods, however, are not powerful enough to identify perturbed pathways and regulators simultaneously. Widely used methods include methods to determine gene sets such as differentially expressed genes or gene clusters and these genes sets need to be further interpreted in terms of biological pathways using other tools. Most pathway analysis methods are not designed for time series data and they do not consider gene-gene influence on the time dimension. Results: In this article, we propose a novel time-series analysis method TimeTP for determining transcription factors (TFs) regulating pathway perturbation, which narrows the focus to perturbed sub-pathways and utilizes the gene regulatory network and protein–protein interaction network to locate TFs triggering the perturbation. TimeTP first identifies perturbed sub-pathways that propagate the expression changes along the time. Starting points of the perturbed sub-pathways are mapped into the network and the most influential TFs are determined by influence maximization technique. The analysis result is visually summarized in TF-Pathway map in time clock. TimeTP was applied to PIK3CA knock-in dataset and found significant sub-pathways and their regulators relevant to the PIP3 signaling pathway. Availability and Implementation: TimeTP is implemented in Python and available at http://biohealth.snu.ac.kr/software/TimeTP/. Supplementary information: Supplementary data are available at Bioinformatics online. Contact: sunkim.bioinfo@snu.ac.kr PMID:27307609

Plants: Novel Developmental Processes.

ERIC Educational Resources Information Center

Goldberg, Robert B.

1988-01-01

Describes the diversity of plants. Outlines novel developmental and complex genetic processes that are specific to plants. Identifies approaches that can be used to solve problems in plant biology. Cites the advantages of using higher plants for experimental systems. (RT)

Developmental neurogenetics and neuro-ophthalmology.

PubMed

Bennett, Jeffrey L

2002-12-01

The field of developmental neurogenetics has burgeoned over the past decade. Through the combined efforts of developmental biologists, geneticists, and clinicians, genetic defects resulting in neuro-ophthalmic disorders such as holoprosencephaly, microphthalmia, dominant optic atrophy, and optic nerve colobomas have been identified and characterized at the molecular level. Experimental studies in model organisms are continuing to identify novel genes critical for ocular and central nervous system development. Mutations in some of these genes have revealed a spectrum of pathology similar to that observed in septo-optic dysplasia, Möebius syndrome, and Duane retraction syndrome. This review examines our current knowledge of the molecular genetics of neuro-ophthalmic disease and focuses on several candidate genes for afferent and efferent visual system disorders.

Developmental Social Cognitive Neuroscience: Insights from Deafness

ERIC Educational Resources Information Center

Corina, David; Singleton, Jenny

2009-01-01

The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

NEW FRONTIER IN UNDERSTANDING THE MECHANISMS OF DEVELOPMENTAL ABNORMALITIES

EPA Science Inventory

Recent advancements in molecular developmental biology afford an opportunity to apply newly developed tools for understanding the mechanisms of both normal and abnormal development. lthough a number of agents have been identified as causing developmental abnormalities, knowledge ...

Systems analysis of a maize leaf developmental gradient redefines the current C4 model and provides candidates for regulation.

PubMed

Pick, Thea R; Bräutigam, Andrea; Schlüter, Urte; Denton, Alisandra K; Colmsee, Christian; Scholz, Uwe; Fahnenstich, Holger; Pieruschka, Roland; Rascher, Uwe; Sonnewald, Uwe; Weber, Andreas P M

2011-12-01

We systematically analyzed a developmental gradient of the third maize (Zea mays) leaf from the point of emergence into the light to the tip in 10 continuous leaf slices to study organ development and physiological and biochemical functions. Transcriptome analysis, oxygen sensitivity of photosynthesis, and photosynthetic rate measurements showed that the maize leaf undergoes a sink-to-source transition without an intermediate phase of C(3) photosynthesis or operation of a photorespiratory carbon pump. Metabolome and transcriptome analysis, chlorophyll and protein measurements, as well as dry weight determination, showed continuous gradients for all analyzed items. The absence of binary on-off switches and regulons pointed to a morphogradient along the leaf as the determining factor of developmental stage. Analysis of transcription factors for differential expression along the leaf gradient defined a list of putative regulators orchestrating the sink-to-source transition and establishment of C(4) photosynthesis. Finally, transcriptome and metabolome analysis, as well as enzyme activity measurements, and absolute quantification of selected metabolites revised the current model of maize C(4) photosynthesis. All data sets are included within the publication to serve as a resource for maize leaf systems biology.

Neuroendocrine Regulation of Maternal Behavior

PubMed Central

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

The development of self-regulation across early childhood.

PubMed

Montroy, Janelle J; Bowles, Ryan P; Skibbe, Lori E; McClelland, Megan M; Morrison, Frederick J

2016-11-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of 3 and 7 years, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across 3 diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow 3 distinct developmental patterns of growth. These 3 trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds, with implications for offering individualized support across children. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Best Instructional Practices in Developmental Education: Faculty Perceptions

ERIC Educational Resources Information Center

Pierce, Calisa A.

2012-01-01

This descriptive study employed a survey to examine the perspectives of developmental education faculty members at public community colleges regarding instructional practices that have been identified in the literature as effective for developmental education. The study focused on two major areas related to the instructional practices surveyed:…

Instructional Technology Practices in Developmental Education in Texas

ERIC Educational Resources Information Center

Martirosyan, Nara M.; Kennon, J. Lindsey; Saxon, D. Patrick; Edmonson, Stacey L.; Skidmore, Susan T.

2017-01-01

The purpose of this study was to examine the current state of technology integration in developmental education in Texas higher education. Analyzing survey data from developmental education faculty members in 70 2- and 4-year colleges in Texas, researchers identified instructor-reported best instructional technology practices in developmental…

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

Developmentally regulated GTP-binding protein 2 depletion leads to mitochondrial dysfunction through downregulation of dynamin-related protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Mai-Tram; Ko, Myoung Seok; Lee, Unn Hwa

Mitochondrial dynamics, including constant fusion and fission, play critical roles in maintaining mitochondrial morphology and function. Here, we report that developmentally regulated GTP-binding protein 2 (DRG2) regulates mitochondrial morphology by modulating the expression of the mitochondrial fission gene dynamin-related protein 1 (Drp1). shRNA-mediated silencing of DRG2 induced mitochondrial swelling, whereas expression of an shRNA-resistant version of DRG2 decreased mitochondrial swelling in DRG2-depleted cells. Analysis of the expression levels of genes involved in mitochondrial fusion and fission revealed that DRG2 depletion significantly decreased the level of Drp1. Overexpression of Drp1 rescued the defect in mitochondrial morphology induced by DRG2 depletion. DRG2more » depletion reduced the mitochondrial membrane potential, oxygen consumption rate (OCR), and amount of mitochondrial DNA (mtDNA), whereas it increased reactive oxygen species (ROS) production and apoptosis. Taken together, our data demonstrate that DRG2 acts as a regulator of mitochondrial fission by controlling the expression of Drp1. - Highlights: • DRG2 depletion increased mitochondrial swelling. • DRG2 depletion inhibited the expression of Drp1. • Overexpression of DRG2 or Drp1 rescued mitochondrial shape in DRG2 depleted cells. • DRG2 depletion induced mitochondrial dysfunction.« less

Epigenetics and the Developmental Origins of Health and ...

EPA Pesticide Factsheets

Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

Homeodomain protein Otp affects developmental neuropeptide switching in oxytocin neurons associated with a long-term effect on social behavior

PubMed Central

Wircer, Einav; Blechman, Janna; Borodovsky, Nataliya; Tsoory, Michael; Nunes, Ana Rita; Oliveira, Rui F; Levkowitz, Gil

2017-01-01

Proper response to stress and social stimuli depends on orchestrated development of hypothalamic neuronal circuits. Here we address the effects of the developmental transcription factor orthopedia (Otp) on hypothalamic development and function. We show that developmental mutations in the zebrafish paralogous gene otpa but not otpb affect both stress response and social preference. These behavioral phenotypes were associated with developmental alterations in oxytocinergic (OXT) neurons. Thus, otpa and otpb differentially regulate neuropeptide switching in a newly identified subset of OXT neurons that co-express the corticotropin-releasing hormone (CRH). Single-cell analysis revealed that these neurons project mostly to the hindbrain and spinal cord. Ablation of this neuronal subset specifically reduced adult social preference without affecting stress behavior, thereby uncoupling the contribution of a specific OXT cluster to social behavior from the general otpa−/− deficits. Our findings reveal a new role for Otp in controlling developmental neuropeptide balance in a discrete OXT circuit whose disrupted development affects social behavior. DOI: http://dx.doi.org/10.7554/eLife.22170.001 PMID:28094761

Monocyte recruitment and expression of monocyte chemoattractant protein-1 are developmentally regulated in remodeling bone in the mouse.

PubMed Central

Volejnikova, S.; Laskari, M.; Marks, S. C.; Graves, D. T.

1997-01-01

Tooth eruption is defined as the movement of a tooth from its site of development within the alveolar bone to its position of function in the oral cavity. It represents an excellent model to examine osseous metabolism as bone resorption and bone formation occur simultaneously and are spatially separated. Bone resorption occurs in the coronal (occlusal) area, whereas bone formation occurs in the basal area. Monocytes are thought to have a significant role in the regulation of osseous metabolism. The goal of this study was to examine the recruitment of monocytes to bone in C57BL/6J mice that are undergoing developmentally regulated bone remodeling. Monocytes were detected by immunohistochemistry and osteoclasts were counted as bone-associated multi-nucleated, tartrate-resistant acid phosphatase (TRAP)-positive cells. Cell numbers were obtained from histological sections of animals sacrificed daily for 14 days after birth; an image analysis system was used for quantification. The results demonstrated that, immediately after birth, there were relatively few monocytic cells. In the area of bone resorption, the number of monocytes increased with time, reaching peaks at 5 and 9 days, and decreased thereafter. A similar pattern was observed for osteoclasts. In the area of bone formation, there was a time-dependent increase in the number of monocytes. In contrast, the number of osteoclasts in this area was highest at the earliest time points and decreased after day 3. To investigate potential mechanisms for the recruitment of monocytes, expression of monocyte chemoattractant protein (MCP)-1 was assessed. The number of MCP-1-positive cells increased with time and was generally proportional to the recruitment of mononuclear phagocytes. Osteoblasts were the principal bone cell type expressing MCP-1. The results demonstrate that the recruitment of mononuclear cells in the occlusal area is associated with bone resorption. In contrast, recruitment of monocytes in the basal area

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

PubMed Central

Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

2017-01-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

Predictors of Developmental Outcomes of High-Risk and Developmentally Delayed Infants and Children Enrolled in a State Early Childhood Intervention Program

ERIC Educational Resources Information Center

Giannoni, Peggy P.; Kass, Philip H.

2012-01-01

A retrospective cohort study was conducted to identify child, maternal, family, and community factors associated with rate of developmental disability among children enrolled in the California Early Start Program. The cohort included 8,987 children considered at high risk for developmental disability due to medical risks and/or developmental…

A Manual on the Primary Prevention of Developmental Disabilities.

ERIC Educational Resources Information Center

Whitley, Elizabeth B.; Skiles, Laura Lopater

This manual presents information about major causes of developmental disabilities, discusses strategies to prevent development disabilities, and identifies relevant resources and reference material. Introductory information defines developmental disabilities and prevention (under Virginia statutes). The first section considers causes prior to and…

45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 4 2012-10-01 2012-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES...

Developmental Experiences of Child Sexual Abusers and Rapists

ERIC Educational Resources Information Center

Simons, Dominique A.; Wurtele, Sandy K.; Durham, Robert L.

2008-01-01

Objective: The aim of this study is to identify the distinct developmental experiences associated with child sexual abuse and rape. Method: For 269 sexual offenders (137 rapists and 132 child sexual abusers), developmental experiences were recorded from a behavioral checklist, a parental-bonding survey, and a sexual history questionnaire. Offender…

Maternal abuse history and self-regulation difficulties in preadolescence

PubMed Central

Delker, Brianna C.; Noll, Laura K.; Kim, Hyoun K.; Fisher, Philip A.

2014-01-01

Although poor parenting is known to be closely linked to self-regulation difficulties in early childhood, comparatively little is understood about the role of other risk factors in the early caregiving environment (such as a parent’s own experiences of childhood abuse) in developmental pathways of self-regulation into adolescence. Using a longitudinal design, this study aimed to examine how a mother’s history of abuse in childhood relates to her offspring’s self-regulation difficulties in preadolescence. Maternal controlling parenting and exposure to intimate partner aggression in the child’s first 24–36 months were examined as important early social and environmental influences that may explain the proposed connection between maternal abuse history and preadolescent self-regulation. An ethnically diverse sample of mothers (N = 488) who were identified as at-risk for child maltreatment was recruited at the time of their children’s birth. Mothers and their children were assessed annually from the child’s birth through 36 months, and at age 9–11 years. Structural equation modeling and bootstrap tests of indirect effects were conducted to address the study aims. Findings indicated that maternal abuse history indirectly predicted their children’s self-regulation difficulties in preadolescence mainly through maternal controlling parenting in early childhood, but not through maternal exposure to aggression by an intimate partner. Maternal history of childhood abuse and maternal controlling parenting in her child’s early life may have long-term developmental implications for child self-regulation. PMID:25459984

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma

PubMed Central

Gilmore, Sarah A.; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-01-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5’ leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature. PMID:26177267

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma.

PubMed

Gilmore, Sarah A; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-07-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5' leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature.

Developmental Screening of Refugees: A Qualitative Study

PubMed Central

Moore, Jessica A.; Welch, Therese R.; Halterman, Jill S.; Hyman, Susan L.

2016-01-01

BACKGROUND AND OBJECTIVES: Refugee children are at high developmental risk due to dislocation and deprivation. Standardized developmental screening in this diverse population is challenging. We used the Health Belief Model to guide key-informant interviews and focus groups with medical interpreters, health care providers, community collaborators, and refugee parents to explore key elements needed for developmental screening. Cultural and community-specific values and practices related to child development and barriers and facilitators to screening were examined. METHODS: We conducted 19 interviews and 2 focus groups involving 16 Bhutanese-Nepali, Burmese, Iraqi, and Somali participants, 7 community collaborators, and 6 providers from the Center for Refugee Health in Rochester, New York. Subjects were identified through purposive sampling until data saturation. Interviews were recorded, coded, and analyzed using a qualitative framework technique. RESULTS: Twenty-one themes in 4 domains were identified: values/beliefs about development/disability, practices around development/disability, the refugee experience, and feedback specific to the Parents’ Evaluation of Developmental Status screen. Most participants denied a word for “development” in their primary language and reported limited awareness of developmental milestones. Concern was unlikely unless speech or behavior problems were present. Physical disabilities were recognized but not seen as problematic. Perceived barriers to identification of delays included limited education, poor healthcare knowledge, language, and traditional healing practices. Facilitators included community navigators, trust in health care providers, in-person interpretation, visual supports, and education about child development. CONCLUSIONS: Refugee perspectives on child development may influence a parent’s recognition of and response to developmental concerns. Despite challenges, standardized screening was supported. PMID

Developmental Screening of Refugees: A Qualitative Study.

PubMed

Kroening, Abigail L H; Moore, Jessica A; Welch, Therese R; Halterman, Jill S; Hyman, Susan L

2016-09-01

Refugee children are at high developmental risk due to dislocation and deprivation. Standardized developmental screening in this diverse population is challenging. We used the Health Belief Model to guide key-informant interviews and focus groups with medical interpreters, health care providers, community collaborators, and refugee parents to explore key elements needed for developmental screening. Cultural and community-specific values and practices related to child development and barriers and facilitators to screening were examined. We conducted 19 interviews and 2 focus groups involving 16 Bhutanese-Nepali, Burmese, Iraqi, and Somali participants, 7 community collaborators, and 6 providers from the Center for Refugee Health in Rochester, New York. Subjects were identified through purposive sampling until data saturation. Interviews were recorded, coded, and analyzed using a qualitative framework technique. Twenty-one themes in 4 domains were identified: values/beliefs about development/disability, practices around development/disability, the refugee experience, and feedback specific to the Parents' Evaluation of Developmental Status screen. Most participants denied a word for "development" in their primary language and reported limited awareness of developmental milestones. Concern was unlikely unless speech or behavior problems were present. Physical disabilities were recognized but not seen as problematic. Perceived barriers to identification of delays included limited education, poor healthcare knowledge, language, and traditional healing practices. Facilitators included community navigators, trust in health care providers, in-person interpretation, visual supports, and education about child development. Refugee perspectives on child development may influence a parent's recognition of and response to developmental concerns. Despite challenges, standardized screening was supported. Copyright © 2016 by the American Academy of Pediatrics.

The SUMO Pathway Is Developmentally Regulated and Required for Programmed DNA Elimination in Paramecium tetraurelia† ‡

PubMed Central

Matsuda, Atsushi; Forney, James D.

2006-01-01

Extensive genome-wide remodeling occurs during the formation of the somatic macronuclei from the germ line micronuclei in ciliated protozoa. This process is limited to sexual reproduction and includes DNA amplification, chromosome fragmentation, and the elimination of internal segments of DNA. Our efforts to define the pathways regulating these events revealed a gene encoding a homologue of ubiquitin activating enzyme 2 (UBA2) that is upregulated at the onset of macronuclear development in Paramecium tetraurelia. Uba2 enzymes are known to activate the protein called small ubiquitin-related modifier (SUMO) that is covalently attached to target proteins. Consistent with this relationship, Northern analysis showed increased abundance of SUMO transcripts during sexual reproduction in Paramecium. RNA interference (RNAi) against UBA2 or SUMO during vegetative growth had little effect on cell survival or fission rates. In contrast, RNAi of mating cells resulted in failure to form a functional macronucleus. Despite normal amplification of the genome, excision of internal eliminated sequences was completely blocked. Additional experiments showed that the homologous UBA2 and SUMO genes in Tetrahymena thermophila are also upregulated during conjugation. These results provide evidence for the developmental regulation of the SUMO pathway in ciliates and suggest a key role for the pathway in controlling genome remodeling. PMID:16682458

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)

USGS Publications Warehouse

Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.

2003-01-01

Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance. 

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Epigenetic mechanisms in developmental programming of adult disease

PubMed Central

Chen, Man; Zhang, Lubo

2011-01-01

Adverse insults during intrauterine life can result in permanent changes in the physiology and metabolism of the offspring, which in turn leads to an increased risk of disease in adulthood. This is an adaptational response by the fetus to changes in the environmental signals that it receives during early life to ensure its survival and prepare itself for postnatal life. Increasing evidence suggests that the epigenetic regulation of gene expression patterns has a crucial role in the developmental programming of adult disease. This review summarizes recent studies of epigenetic mechanisms and focuses particularly on studies that explore identifiable epigenetic biomarkers in the promoters of specific disease-associated genes. Such biomarkers would enable early recognition of children who might be at risk of developing adult disease with fetal origins. PMID:21945859

Case study: child with global developmental delay.

PubMed

Okumakpeyi, Pearline; Lunney, Margaret

2010-01-01

This case study focused on the care of a child with global developmental delay. Data were obtained through the author's clinical practice in long-term care pediatric rehabilitation and literature sources. NANDA-International Classifications, the Nursing Interventions Classification (NIC), and Nursing Outcomes Classification (NOC) were used to identify the appropriate nursing diagnosis, nursing interventions, and patient outcomes. This case study provides the pertinent nursing diagnoses, interventions, and outcomes for a child with global developmental delay. The interdisciplinary team approach and family involvement is addressed. Use of NANDA, NIC, and NOC outcomes constructs for enhancing the care of a child with global developmental delay.

Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

PubMed

Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

2012-02-01

MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

Caffeine biosynthesis and degradation in tea [Camellia sinensis (L.) O. Kuntze] is under developmental and seasonal regulation.

PubMed

Mohanpuria, Prashant; Kumar, Vinay; Joshi, Robin; Gulati, Ashu; Ahuja, Paramvir Singh; Yadav, Sudesh Kumar

2009-10-01

To study caffeine biosynthesis and degradation, here we monitored caffeine synthase gene expression and caffeine and allantoin content in various tissues of four Camellia sinensis (L.) O. Kuntze cultivars during non-dormant (ND) and dormant (D) growth phases. Caffeine synthase expression as well as caffeine content was found to be higher in commercially utilized tissues like apical bud, 1st leaf, 2nd leaf, young stem, and was lower in old leaf during ND compared to D growth phase. Among fruit parts, fruit coats have higher caffeine synthase expression, caffeine content, and allantoin content. On contrary, allantoin content was found lower in the commercially utilized tissues and higher in old leaf. Results suggested that caffeine synthesis and degradation in tea appears to be under developmental and seasonal regulation.

Emotion regulation: a theme in search of definition.

PubMed

Thompson, R A

1994-01-01

Contemporary interest in emotion regulation promises to advance important new views of emotional development as well as offering applications to developmental psychopathology, but these potential contributions are contingent on developmentalists' attention to some basic definitional issues. This essay offers a perspective on these issues by considering how emotion regulation should be defined, the various components of the management of emotion, how emotion regulation strategies fit into the dynamics of social interaction, and how individual differences in emotion regulation should be conceptualized and measured. In the end, it seems clear that emotion regulation is a conceptual rubric for a remarkable range of developmental processes, each of which may have its own catalysts and control processes. Likewise, individual differences in emotion regulation skills likely have multifaceted origins and are also related in complex ways to the person's emotional goals and the immediate demands of the situation. Assessment approaches that focus on the dynamics of emotion are well suited to elucidating these complex developmental and individual differences. In sum, a challenging research agenda awaits those who enter this promising field of study.

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

Sucrose affects the developmental transition of rhizomes in Oryza longistaminata.

PubMed

Bessho-Uehara, Kanako; Nugroho, Jovano Erris; Kondo, Hirono; Angeles-Shim, Rosalyn B; Ashikari, Motoyuki

2018-05-08

Oryza longistaminata, the African wild rice, can propagate vegetatively through rhizomes. Rhizomes elongate horizontally underground as sink organs, however, they undergo a developmental transition that shifts their growth to the surface of the ground to become aerial stems. This particular stage is essential for the establishment of new ramets. While several determinants such as abiotic stimuli and plant hormones have been reported as key factors effecting developmental transition in aerial stem, the cause of this phenomenon in rhizome remains elusive. This study shows that depletion of nutrients, particularly sucrose, is the key stimulus that induces the developmental transition in rhizomes, as indicated by the gradient of sugars from the base to the tip of the rhizome. Sugar treatments revealed that sucrose specifically represses the developmental transition from rhizome to aerial stem by inhibiting the expression of sugar metabolism and hormone synthesis genes at the bending point. Sucrose depletion affected several factors contributing to the developmental transition of rhizome including signal transduction, transcriptional regulation and plant hormone balance.

Small-molecule studies identify CDK8 as a regulator of IL-10 in myeloid cells.

PubMed

Johannessen, Liv; Sundberg, Thomas B; O'Connell, Daniel J; Kolde, Raivo; Berstler, James; Billings, Katelyn J; Khor, Bernard; Seashore-Ludlow, Brinton; Fassl, Anne; Russell, Caitlin N; Latorre, Isabel J; Jiang, Baishan; Graham, Daniel B; Perez, Jose R; Sicinski, Piotr; Phillips, Andrew J; Schreiber, Stuart L; Gray, Nathanael S; Shamji, Alykhan F; Xavier, Ramnik J

2017-10-01

Enhancing production of the anti-inflammatory cytokine interleukin-10 (IL-10) is a promising strategy to suppress pathogenic inflammation. To identify new mechanisms regulating IL-10 production, we conducted a phenotypic screen for small molecules that enhance IL-10 secretion from activated dendritic cells. Mechanism-of-action studies using a prioritized hit from the screen, BRD6989, identified the Mediator-associated kinase CDK8, and its paralog CDK19, as negative regulators of IL-10 production during innate immune activation. The ability of BRD6989 to upregulate IL-10 is recapitulated by multiple, structurally differentiated CDK8 and CDK19 inhibitors and requires an intact cyclin C-CDK8 complex. Using a highly parallel pathway reporter assay, we identified a role for enhanced AP-1 activity in IL-10 potentiation following CDK8 and CDK19 inhibition, an effect associated with reduced phosphorylation of a negative regulatory site on c-Jun. These findings identify a function for CDK8 and CDK19 in regulating innate immune activation and suggest that these kinases may warrant consideration as therapeutic targets for inflammatory disorders.

Developmental Principles: Fact or Fiction

PubMed Central

Durston, A. J.

2012-01-01

While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them. PMID:22489210

Developmental principles: fact or fiction.

PubMed

Durston, A J

2012-01-01

While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, "whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm". We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

A developmental, body-oriented intervention for children and adolescents with medically unexplained chronic pain.

PubMed

Kozlowska, Kasia; Khan, Rubina

2011-10-01

The regulation of pain and other emotions is a developmental process that takes place in the context of attachment relationships. Children with chronic, medically unexplained pain struggle to accurately identify, communicate and regulate negative body states, and to connect these body states to their day-to-day experience. This article describes an individual intervention - one component of a multimodal treatment programme - whose aim is to help children find skills to manage their pain. The intervention incorporates ideas and practices from several theoretical models - the dynamic-maturational model of attachment, cognitive-behavioural theories, narrative therapy, art therapy, sensorimotor approaches -pragmatically selected and adapted to help children presenting to our Chronic Pain Service achieve good clinical outcomes. At the outset we assess the child's capacity to identify, regulate and communicate positive and negative body states, and tailor our individual intervention so as to extend each child's proximal level of development. We initially focus on the body in an effort to equip the child with a non-verbal, image-based language for identifying and communicating pain and other negative body states. Once the child has developed a non-verbal way of knowing her body, a range of cognitive-behavioural, narrative and other strategies are introduced. The intervention aims to increase the child's emotional functioning: her skill in identifying, symbolically representing, communicating and managing pain and other negative body states.

Plant developmental responses to climate change.

PubMed

Gray, Sharon B; Brady, Siobhan M

2016-11-01

Climate change is multi-faceted, and includes changing concentrations of greenhouse gases in the atmosphere, rising temperatures, changes in precipitation patterns, and increasing frequency of extreme weather events. Here, we focus on the effects of rising atmospheric CO 2 concentrations, rising temperature, and drought stress and their interaction on plant developmental processes in leaves, roots, and in reproductive structures. While in some cases these responses are conserved across species, such as decreased root elongation, perturbation of root growth angle and reduced seed yield in response to drought, or an increase in root biomass in shallow soil in response to elevated CO 2 , most responses are variable within and between species and are dependent on developmental stage. These variable responses include species-specific thresholds that arrest development of reproductive structures, reduce root growth rate and the rate of leaf initiation and expansion in response to elevated temperature. Leaf developmental responses to elevated CO 2 vary by cell type and by species. Variability also exists between C 3 and C 4 species in response to elevated CO 2 , especially in terms of growth and seed yield stimulation. At the molecular level, significantly less is understood regarding conservation and variability in molecular mechanisms underlying these traits. Abscisic acid-mediated changes in cell wall expansion likely underlie reductions in growth rate in response to drought, and changes in known regulators of flowering time likely underlie altered reproductive transitions in response to elevated temperature and CO 2 . Genes that underlie most other organ or tissue-level responses have largely only been identified in a single species in response to a single stress and their level of conservation is unknown. We conclude that there is a need for further research regarding the molecular mechanisms of plant developmental responses to climate change factors in general, and

Developmental Regulation of an Adhesin Gene during Cellular Morphogenesis in the Fungal Pathogen Candida albicans▿ †

PubMed Central

Argimón, Silvia; Wishart, Jill A.; Leng, Roger; Macaskill, Susan; Mavor, Abigail; Alexandris, Thomas; Nicholls, Susan; Knight, Andrew W.; Enjalbert, Brice; Walmsley, Richard; Odds, Frank C.; Gow, Neil A. R.; Brown, Alistair J. P.

2007-01-01

Candida albicans expresses specific virulence traits that promote disease establishment and progression. These traits include morphological transitions between yeast and hyphal growth forms that are thought to contribute to dissemination and invasion and cell surface adhesins that promote attachment to the host. Here, we describe the regulation of the adhesin gene ALS3, which is expressed specifically during hyphal development in C. albicans. Using a combination of reporter constructs and regulatory mutants, we show that this regulation is mediated by multiple factors at the transcriptional level. The analysis of ALS3 promoter deletions revealed that this promoter contains two activation regions: one is essential for activation during hyphal development, while the second increases the amplitude of this activation. Further deletion analyses using the Renilla reniformis luciferase reporter delineate the essential activation region between positions −471 and −321 of the promoter. Further 5′ or 3′ deletions block activation. ALS3 transcription is repressed mainly by Nrg1 and Tup1, but Rfg1 contributes to this repression. Efg1, Tec1, and Bcr1 are essential for the transcriptional activation of ALS3, with Tec1 mediating its effects indirectly through Bcr1 rather than through the putative Tec1 sites in the ALS3 promoter. ALS3 transcription is not affected by Cph2, but Cph1 contributes to full ALS3 activation. The data suggest that multiple morphogenetic signaling pathways operate through the promoter of this adhesin gene to mediate its developmental regulation in this major fungal pathogen. PMID:17277173

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

PubMed Central

Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

2011-01-01

Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low

Developmental regulation by cytokines of bone marrow-derived dendritic cells and epidermal Langerhans cells.

PubMed

Yamaguchi, Y

1998-01-01

Dendritic cells (DC) are specialized antigen-presenting cells involved in T cell-mediated immune responses. Differentiation and functional maturation of the DC are now known to be regulated by various cytokines, including TGF-beta1. The experiments of this study examined the effect of other cytokines, such as IL-4, IL-10 and IL-6, on the differentiation and maturation of bone marrow (BM)-derived DC (BM-DC) and epidermal Langerhans cells (LC). When IL-6 or IL-10 was added to cultures of BM cells in the presence of GM-CSF, both cytokines, as in the case of TGF-beta1, suppressed the maturation of DC in terms of the expression of adhesion and costimulatory molecules and T cell-stimulating activity. In contrast, IL-4 was not suppressive but rather supportive for the differentiation of DC. However, these suppressive cytokines hardly counteracted the maturation-inducing activity of TNF-alpha when added to cultures of immature DC. In addition, they appeared to block the overmaturation of DC, which is characterized by a loss of MHC class II molecules. Regarding LC maturation in epidermal cell cultures, IL-6 and IL-10 were inhibitory for the expression of CD86 and CD80 in a dose-dependent fashion. Unlike BM-DC, LC maturation was slightly enhanced by TGF-beta1. The protein antigen-presentation by LC to Th1 clone was not affected by IL-6, but slightly reduced by IL-10. These results suggest that each cytokine contributes to regulate the differentiation and maturation of DC at a different developmental stage.

Developmental Gene Regulation and Mechanisms of Evolution

NASA Technical Reports Server (NTRS)

1998-01-01

The Marine Biological Laboratory and the National Aeronautics and Space Administration have established a cooperative agreement with the formation of a Center for Advanced Studies 'in the Space Life Sciences (CASSLS) at the MBL. This Center serves as an interface between NASA and the basic science community, addressing issues of mutual interest. The Center for Advanced Studies 'in the Space Life Sciences provides a forum for scientists to think and discuss, often for the first time, the role that gravity and aspects of spaceflight may play 'in fundamental cellular and physiologic processes. In addition the Center will sponsor discussions on evolutionary biology. These interactions will inform the community of research opportunities that are of interest to NASA. This workshop is one of a series of symposia, workshops and seminars that will be held at the MBL to advise NASA on a wide variety of topics in the life sciences, including cell biology, developmental biology, mg evolutionary biology, molecular biology, neurobiology, plant biology and systems biology.

Postnatal Developmental Trajectories of Neural Circuits in the Primate Prefrontal Cortex: Identifying Sensitive Periods for Vulnerability to Schizophrenia

PubMed Central

Hoftman, Gil D.; Lewis, David A.

2011-01-01

Schizophrenia is a disorder of cognitive neurodevelopment with characteristic abnormalities in working memory attributed, at least in part, to alterations in the circuitry of the dorsolateral prefrontal cortex. Various environmental exposures from conception through adolescence increase risk for the illness, possibly by altering the developmental trajectories of prefrontal cortical circuits. Macaque monkeys provide an excellent model system for studying the maturation of prefrontal cortical circuits. Here, we review the development of glutamatergic and γ-aminobutyric acid (GABA)-ergic circuits in macaque monkey prefrontal cortex and discuss how these trajectories may help to identify sensitive periods during which environmental exposures, such as those associated with increased risk for schizophrenia, might lead to the types of abnormalities in prefrontal cortical function present in schizophrenia. PMID:21505116

Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

PubMed Central

Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

2016-01-01

Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

Neuroendocrine regulation of maternal behavior.

PubMed

Bridges, Robert S

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

Developmental milestones among Aboriginal children in Canada

PubMed Central

Findlay, Leanne; Kohen, Dafna; Miller, Anton

2014-01-01

BACKGROUND: Windows of achievement provide age ranges for the attainment of early developmental skills. Group-specific research is warranted given that development may be influenced by social or cultural factors. OBJECTIVES: To examine developmental milestones for Inuit, Métis and off-reserve First Nation children in Canada, based on developmental domains collected from the 2006 Aboriginal Children’s Survey. Sociodemographic and health predictors of risk for developmental delay were also examined. RESULTS: The ranges in which children achieve certain developmental milestones are presented. Gross motor and self-help skills were found to be achieved earlier (across the three Aboriginal groups), whereas language skills were achieved slightly later than in Canadian children in general. Furthermore, health factors (eg, low birth weight, chronic health conditions) were associated with late achievement of developmental outcomes even when sociodemographic characteristics were considered. CONCLUSIONS: Findings suggest that the timing of milestone achievement may differ for Aboriginal children, highlighting the importance of establishing culturally specific norms and standards rather than relying on those derived from general populations. This information may be useful for practitioners and parents interested in identifying the age ranges for development, as well as age ranges indicating potential for developmental risk and opportunities for early intervention among Aboriginal children. PMID:24855426

Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

PubMed Central

Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

2011-01-01

Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

Identifying the Correlates and Barriers of Future Planning Among Parents of Individuals With Intellectual and Developmental Disabilities.

PubMed

Burke, Meghan; Arnold, Catherine; Owen, Aleksa

2018-04-01

Although individuals with intellectual and developmental disabilities (IDD) are living longer lives, fewer than half of parents of individuals with IDD conduct future planning. The correlates and barriers to future planning must be identified to develop targeted interventions to facilitate future planning. In this study, 388 parents of individuals with IDD responded to a national, web-based survey. Participants who were older, more educated, attended more parent training and support activities, and had children with fewer functional abilities, were more likely to engage in future planning. Reported barriers to future planning included: (a) lack of available services, (b) financial challenges, (c) reluctance of family members, (d) lack of time, (e) the emotional nature of future planning, (f) inertia, and (g) a lack of family members to be caregivers. Implications for policy, practice, and future research are discussed.

CB1 Cannabinoid Receptor Expression in the Striatum: Association with Corticostriatal Circuits and Developmental Regulation

PubMed Central

Van Waes, Vincent; Beverley, Joel A.; Siman, Homayoun; Tseng, Kuei Y.; Steiner, Heinz

2012-01-01

Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains). We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25) and then progressively decreases toward adolescent (P40) and adult (P70) levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors) tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors) receive inputs from cortical regions with higher expression (medial prefrontal cortex). In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important. PMID:22416230

Behavioral Assessment of Emotion Discrimination, Emotion Regulation, and Cognitive Control in Childhood, Adolescence, and Adulthood

PubMed Central

Tottenham, Nim; Hare, Todd A.; Casey, B. J.

2011-01-01

Emotion discrimination, emotion regulation, and cognitive control are three related, yet separable processes that emerge over the course of development. The current study tested 100 children, adolescents, and adults on an Emotional Go/Nogo task, illustrating the ability of this paradigm to identify the unique developmental patterns for each of these three processes in the context of both positive (happy) and negative emotions (fear, sad, and anger), across three different age groups. Consistent with previous literature, our findings show that emotion discrimination and regulatory abilities (both cognitive control and emotion regulation) improve steadily for each age group, with each age group showing unique patterns of performance. The findings suggest that emotion regulation is constructed from basic cognition control and emotion discrimination skills. The patterns of behavior from the Emotional Go/Nogo task provide normative benchmark data across a wide range of emotions that can be used for future behavioral and neuroimaging studies that examine the developmental construction of emotion regulatory processes. PMID:21716604

Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

PubMed Central

Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

2012-01-01

Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

Profiling Synaptic Proteins Identifies Regulators of Insulin Secretion and Lifespan

PubMed Central

Kaplan, Joshua M.

2008-01-01

Cells are organized into distinct compartments to perform specific tasks with spatial precision. In neurons, presynaptic specializations are biochemically complex subcellular structures dedicated to neurotransmitter secretion. Activity-dependent changes in the abundance of presynaptic proteins are thought to endow synapses with different functional states; however, relatively little is known about the rules that govern changes in the composition of presynaptic terminals. We describe a genetic strategy to systematically analyze protein localization at Caenorhabditis elegans presynaptic specializations. Nine presynaptic proteins were GFP-tagged, allowing visualization of multiple presynaptic structures. Changes in the distribution and abundance of these proteins were quantified in 25 mutants that alter different aspects of neurotransmission. Global analysis of these data identified novel relationships between particular presynaptic components and provides a new method to compare gene functions by identifying shared protein localization phenotypes. Using this strategy, we identified several genes that regulate secretion of insulin-like growth factors (IGFs) and influence lifespan in a manner dependent on insulin/IGF signaling. PMID:19043554

The History of Legislation and Regulations Related to Children with Developmental Disabilities: Implications for School Nursing Practice Today

ERIC Educational Resources Information Center

Dang, Michelle T.

2010-01-01

A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…

The developmental genetics of biological robustness

PubMed Central

Mestek Boukhibar, Lamia; Barkoulas, Michalis

2016-01-01

Background Living organisms are continuously confronted with perturbations, such as environmental changes that include fluctuations in temperature and nutrient availability, or genetic changes such as mutations. While some developmental systems are affected by such challenges and display variation in phenotypic traits, others continue consistently to produce invariable phenotypes despite perturbation. This ability of a living system to maintain an invariable phenotype in the face of perturbations is termed developmental robustness. Biological robustness is a phenomenon observed across phyla, and studying its mechanisms is central to deciphering the genotype–phenotype relationship. Recent work in yeast, animals and plants has shown that robustness is genetically controlled and has started to reveal the underlying mechinisms behind it. Scope and Conclusions Studying biological robustness involves focusing on an important property of developmental traits, which is the phenotypic distribution within a population. This is often neglected because the vast majority of developmental biology studies instead focus on population aggregates, such as trait averages. By drawing on findings in animals and yeast, this Viewpoint considers how studies on plant developmental robustness may benefit from strict definitions of what is the developmental system of choice and what is the relevant perturbation, and also from clear distinctions between gene effects on the trait mean and the trait variance. Recent advances in quantitative developmental biology and high-throughput phenotyping now allow the design of targeted genetic screens to identify genes that amplify or restrict developmental trait variance and to study how variation propagates across different phenotypic levels in biological systems. The molecular characterization of more quantitative trait loci affecting trait variance will provide further insights into the evolution of genes modulating developmental robustness. The

Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

PubMed

Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

2008-11-01

Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

Fired up or burned out? How developmental challenge differentially impacts leader behavior.

PubMed

Courtright, Stephen H; Colbert, Amy E; Choi, Daejeong

2014-07-01

Leadership development research has largely drawn on experiential and enactive learning theories to explore the positive effects of developmental challenge on leaders. In contrast, we examined potential positive and negative effects of developmental challenge (i.e., challenging job assignments) on leader behavior through an alternative theoretical lens--transactional stress theory. We predicted, on one hand, that developmental challenge may be associated with higher leader engagement and transformational leadership behavior; however, developmental challenge also has the potential to be associated with higher leader emotional exhaustion and laissez-faire leadership behavior. We further proposed that leadership self-efficacy (LSE) moderates these potential effects of developmental challenge and helps explain why leaders react either positively or negatively to developmental challenge. We tested our hypotheses in a sample of 153 leaders and 631 direct reports at a Fortune 500 company. Findings supported positive relationships among developmental challenge, leader engagement, and transformational leadership. However, we also found support for significant relationships among developmental challenge, emotional exhaustion, and laissez-faire leadership. Additionally, leaders lower in LSE were more likely to encounter the negative effects of developmental challenge by experiencing increased emotional exhaustion and displaying laissez-faire leadership behaviors. Our study contributes to theory and practice by elucidating a "dark side" of developmental challenge, identifying LSE as a moderator of the negative effects of developmental challenge, identifying antecedents of transformational and laissez-faire leadership behaviors, and investigating demands and stress in leadership roles.

Hydroxylated PBDEs induce developmental arrest in zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu

The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was notmore » observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.« less

Developmental Characteristics of Middle Schoolers and Middle School Organization.

ERIC Educational Resources Information Center

Thornburg, Hershel D.

The extent to which the middle school becomes a true educational alternative is directly related to the ability of middle school educators and researchers to identify and investigate the developmental needs and learning capacities of students. Three important developmental characteristics of early adolescents are a high need for peer friendships,…

Identifying gene coexpression networks underlying the dynamic regulation of wood-forming tissues in Populus under diverse environmental conditions.

PubMed

Zinkgraf, Matthew; Liu, Lijun; Groover, Andrew; Filkov, Vladimir

2017-06-01

Trees modify wood formation through integration of environmental and developmental signals in complex but poorly defined transcriptional networks, allowing trees to produce woody tissues appropriate to diverse environmental conditions. In order to identify relationships among genes expressed during wood formation, we integrated data from new and publically available datasets in Populus. These datasets were generated from woody tissue and include transcriptome profiling, transcription factor binding, DNA accessibility and genome-wide association mapping experiments. Coexpression modules were calculated, each of which contains genes showing similar expression patterns across experimental conditions, genotypes and treatments. Conserved gene coexpression modules (four modules totaling 8398 genes) were identified that were highly preserved across diverse environmental conditions and genetic backgrounds. Functional annotations as well as correlations with specific experimental treatments associated individual conserved modules with distinct biological processes underlying wood formation, such as cell-wall biosynthesis, meristem development and epigenetic pathways. Module genes were also enriched for DNase I hypersensitivity footprints and binding from four transcription factors associated with wood formation. The conserved modules are excellent candidates for modeling core developmental pathways common to wood formation in diverse environments and genotypes, and serve as testbeds for hypothesis generation and testing for future studies. No claim to original US government works. New Phytologist © 2017 New Phytologist Trust.

Developmentally arrested structures preceding cerebellar tumors in von Hippel–Lindau disease

PubMed Central

Shively, Sharon B; Falke, Eric A; Li, Jie; Tran, Maxine G B; Thompson, Eli R; Maxwell, Patrick H; Roessler, Erich; Oldfield, Edward H; Lonser, Russell R; Vortmeyer, Alexander O

2011-01-01

There is increasing evidence that suggests that knockout of tumor-suppressor gene function causes developmental arrest and protraction of cellular differentiation. In the peripheral nervous system of patients with the tumor-suppressor gene disorder, von Hippel–Lindau disease, we have demonstrated developmentally arrested structural elements composed of hemangioblast progenitor cells. Some developmentally arrested structural elements progress to a frank tumor, hemangioblastoma. However, in von Hippel–Lindau disease, hemangioblastomas are frequently observed in the cerebellum, suggesting an origin in the central nervous system. We performed a structural and topographic analysis of cerebellar tissues obtained from von Hippel–Lindau disease patients to identify and characterize developmentally arrested structural elements in the central nervous system. We examined the entire cerebella of five tumor-free von Hippel–Lindau disease patients and of three non-von Hippel–Lindau disease controls. In all, 9 cerebellar developmentally arrested structural elements were detected and topographically mapped in 385 blocks of von Hippel–Lindau disease cerebella. No developmentally arrested structural elements were seen in 214 blocks from control cerebella. Developmentally arrested structural elements are composed of poorly differentiated cells that express hypoxia-inducible factor (HIF)2α, but not HIF1α or brachyury, and preferentially involve the molecular layer of the dorsum cerebelli. For the first time, we identify and characterize developmentally arrested structural elements in the central nervous system of von Hippel–Lindau patients. We provide evidence that developmentally arrested structural elements in the cerebellum are composed of developmentally arrested hemangioblast progenitor cells in the molecular layer of the dorsum cerebelli. PMID:21499240

Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

PubMed Central

Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

2012-01-01

Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

The ADAMTS5 Metzincin Regulates Zebrafish Somite Differentiation

PubMed Central

Dancevic, Carolyn M.; Gibert, Yann; Smith, Adam D.; Ward, Alister C.; McCulloch, Daniel R.

2018-01-01

The ADAMTS5 metzincin, a secreted zinc-dependent metalloproteinase, modulates the extracellular matrix (ECM) during limb morphogenesis and other developmental processes. Here, the role of ADAMTS5 was investigated by knockdown of zebrafish adamts5 during embryogenesis. This revealed impaired Sonic Hedgehog (Shh) signaling during somite patterning and early myogenesis. Notably, synergistic regulation of myod expression by ADAMTS5 and Shh during somite differentiation was observed. These roles were not dependent upon the catalytic activity of ADAMTS5. These data identify a non-enzymatic function for ADAMTS5 in regulating an important cell signaling pathway that impacts on muscle development, with implications for musculoskeletal diseases in which ADAMTS5 and Shh have been associated. PMID:29518972

Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

PubMed Central

Almoguera, C.; Coca, M. A.; Jordano, J.

1995-01-01

We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

Developmental Toxicology##

EPA Science Inventory

Developmental toxicology encompasses the study of developmental exposures, pharmacokinetics, mechanisms, pathogenesis, and outcomes potentially leading to adverse health effects. Manifestations of developmental toxicity include structural malformations, growth retardation, functi...

Developmental staging of male murine embryonic gonad by SAGE analysis

PubMed Central

Lee, Tin-Lap; Li, Yunmin; Alba, Diana; Vong, Queenie P.; Wu, Shao-Ming; Baxendale, Vanessa; Rennert, Owen M.; Lau, Yun-Fai Chris; Chan, Wai-Yee

2012-01-01

Despite the identification of key genes such as Sry integral to embryonic gonadal development, the genomic classification and identification of chromosomal activation of this process is still poorly understood. To better understand the genetic regulation of gonadal development, we performed Serial Analysis of Gene Expression (SAGE) to profile the genes and novel transcripts, and an average of 152,000 tags from male embryonic gonads at E10.5 (embryonic day 10.5), E11.5, E12.5, E13.5, E15.5 and E17.5 were analyzed. A total of 275,583 non-singleton tags that do not map to any annotated sequence were identified in the six gonad libraries, and 47,255 tags were mapped to 24,975 annotated sequences, among which 987 sequences were uncharacterized. Utilizing an unsupervised pattern identification technique, we established molecular staging of male gonadal development. Rather than providing a static descriptive analysis, we developed algorithms to cluster the SAGE data and assign SAGE tags to a corresponding chromosomal position; these data are displayed in chromosome graphic format. A prominent increase in global genomic activity from E10.5 to E17.5 was observed. Important chromosomal regions related to the developmental processes were identified and validated based on established mouse models with developmental disorders. These regions may represent markers for early diagnosis for disorders of male gonad development as well as potential treatment targets. PMID:19376482

Expression screening using a Medaka cDNA library identifies evolutionarily conserved regulators of the p53/Mdm2 pathway.

PubMed

Zhang, Ping; Kratz, Anne Sophie; Salama, Mohammed; Elabd, Seham; Heinrich, Thorsten; Wittbrodt, Joachim; Blattner, Christine; Davidson, Gary

2015-10-08

The p53 tumor suppressor protein is mainly regulated by alterations in the half-life of the protein, resulting in significant differences in p53 protein levels in cells. The major regulator of this process is Mdm2, which ubiquitinates p53 and targets it for proteasomal degradation. This process can be enhanced or reduced by proteins that associate with p53 or Mdm2 and several proteins have been identified with such an activity. Furthermore, additional ubiquitin ligases for p53 have been identified in recent years. Nevertheless, our understanding of how p53 abundance and Mdm2 activity are regulated remains incomplete. Here we describe a cell culture based overexpression screen to identify evolutionarily conserved regulators of the p53/Mdm2 circuit. The results from this large-scale screening method will contribute to a better understanding of the regulation of these important proteins. Expression screening was based on co-transfection of H1299 cells with pools of cDNA's from a Medaka library together with p53, Mdm2 and, as internal control, Ror2. After cell lysis, SDS-PAGE/WB analysis was used to detect alterations in these proteins. More than one hundred hits that altered the abundance of either p53, Mdm2, or both were identified in the primary screen. Subscreening of the library pools that were identified in the primary screen identified several potential novel regulators of p53 and/or Mdm2. We also tested whether the human orthologues of the Medaka genes regulate p53 and/or Mdm2 abundance. All human orthologues regulated p53 and/or Mdm2 abundance in the same manner as the proteins from Medaka, which underscores the suitability of this screening methodology for the identification of new modifiers of p53 and Mdm2. Despite enormous efforts in the last two decades, many unknown regulators for p53 and Mdm2 abundance are predicted to exist. This cross-species approach to identify evolutionarily conserved regulators demonstrates that our Medaka unigene cDNA library

Constructivist developmental theory is needed in developmental neuroscience

NASA Astrophysics Data System (ADS)

Arsalidou, Marie; Pascual-Leone, Juan

2016-12-01

Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.

Genome-wide in vivo screen identifies novel host regulators of metastatic colonization.

PubMed

van der Weyden, Louise; Arends, Mark J; Campbell, Andrew D; Bald, Tobias; Wardle-Jones, Hannah; Griggs, Nicola; Velasco-Herrera, Martin Del Castillo; Tüting, Thomas; Sansom, Owen J; Karp, Natasha A; Clare, Simon; Gleeson, Diane; Ryder, Edward; Galli, Antonella; Tuck, Elizabeth; Cambridge, Emma L; Voet, Thierry; Macaulay, Iain C; Wong, Kim; Spiegel, Sarah; Speak, Anneliese O; Adams, David J

2017-01-12

Metastasis is the leading cause of death for cancer patients. This multi-stage process requires tumour cells to survive in the circulation, extravasate at distant sites, then proliferate; it involves contributions from both the tumour cell and tumour microenvironment ('host', which includes stromal cells and the immune system). Studies suggest the early steps of the metastatic process are relatively efficient, with the post-extravasation regulation of tumour growth ('colonization') being critical in determining metastatic outcome. Here we show the results of screening 810 mutant mouse lines using an in vivo assay to identify microenvironmental regulators of metastatic colonization. We identify 23 genes that, when disrupted in mouse, modify the ability of tumour cells to establish metastatic foci, with 19 of these genes not previously demonstrated to play a role in host control of metastasis. The largest reduction in pulmonary metastasis was observed in sphingosine-1-phosphate (S1P) transporter spinster homologue 2 (Spns2)-deficient mice. We demonstrate a novel outcome of S1P-mediated regulation of lymphocyte trafficking, whereby deletion of Spns2, either globally or in a lymphatic endothelial-specific manner, creates a circulating lymphopenia and a higher percentage of effector T cells and natural killer (NK) cells present in the lung. This allows for potent tumour cell killing, and an overall decreased metastatic burden.

Genome-wide in vivo screen identifies novel host regulators of metastatic colonization

PubMed Central

van der Weyden, Louise; Arends, Mark J.; Campbell, Andrew D.; Bald, Tobias; Wardle-Jones, Hannah; Griggs, Nicola; Velasco-Herrera, Martin Del Castillo; Tüting, Thomas; Sansom, Owen J.; Karp, Natasha A.; Clare, Simon; Gleeson, Diane; Ryder, Edward; Galli, Antonella; Tuck, Elizabeth; Cambridge, Emma L.; Voet, Thierry; Macaulay, Iain C.; Wong, Kim; Spiegel, Sarah; Speak, Anneliese O.; Adams, David J.

2017-01-01

Metastasis is the leading cause of death for cancer patients. This multi-stage process requires tumour cells to survive in the circulation, extravasate at distant sites, then proliferate; it involves contributions from both the tumour cell and tumour microenvironment (‘host’, which includes stromal cells and the immune system1). Studies suggest the early steps of the metastatic process are relatively efficient, with the post-extravasation regulation of tumour growth (‘colonization’) being critical in determining metastatic outcome2. Here we show the results of screening 810 mutant mouse lines using an in vivo assay to identify microenvironmental regulators of metastatic colonization. We identify 23 genes that, when disrupted in mouse, modify the ability of tumour cells to establish metastatic foci, with 19 of these genes not previously demonstrated to play a role in host control of metastasis. The largest reduction in pulmonary metastasis was observed in sphingosine-1-phosphate (S1P) transporter spinster homologue 2 (Spns2)-deficient mice. We demonstrate a novel outcome of S1P-mediated regulation of lymphocyte trafficking, whereby deletion of Spns2, either globally or in a lymphatic endothelial-specific manner, creates a circulating lymphopenia and a higher percentage of effector T cells and natural killer (NK) cells present in the lung. This allows for potent tumour cell killing, and an overall decreased metastatic burden. PMID:28052056

The expression of the Alzheimer’s Amyloid Precursor Protein-like gene is regulated by developmental timing microRNAs and their targets in Caenorhabditis elegans

PubMed Central

Niwa, Ryusuke; Zhou, Feng; Li, Chris; Slack, Frank J.

2008-01-01

Alzheimer’s Disease (AD) is a neurodegenerative disorder characterized by the accumulation of dense plaques in the brain, resulting in progressive dementia. A major plaque component is the β-amyloid peptide, which is a cleavage product of the amyloid precursor protein (APP). Studies of dominant inheritable familial AD support the hypothesis that APP is critical for AD development. On the other hand, the pathogenesis of amyloid plaque deposition in AD is thought to be the result of age-related changes with unknown mechanisms. Here we show that the Caenorhabditis elegans homolog of APP, APP-like-1 (apl-1), functions with and is under the control of molecules regulating developmental progression. In C. elegans, the timing of cell fate determination is controlled by the heterochronic genes, including let-7 microRNAs. C. elegans apl-1 shows significant genetic interactions with let-7 family microRNAs and let-7-targeted heterochronic genes, hbl-1, lin-41 and lin-42. apl-1 expression is upregulated during the last larval stage in hypodermal seam cells which is transcriptionally regulated by hbl-1, lin-41 and lin-42. Moreover, the levels of the apl-1 transcription are modulated by the activity of let-7 family microRNAs. Our works places apl-1 in a developmental timing pathway and may provide new insights into the time-dependent progression of AD. PMID:18262516

Developmental issues in underage drinking research.

PubMed

To better understand underage drinking and how it can be prevented, research is being conducted in a wide variety of disciplines--focusing on aspects such as risk and protective factors, biological processes underlying human development, and the impact of socioenvironmental and pharmacologic influences on these mechanisms. This article examines underage drinking from a developmental perspective, which seeks to identify critical developmental periods during which interventions may be especially useful. These critical periods can provide key opportunities to redirect the course of development and alter the life course trajectory of the individual.

Developmental biology in marine invertebrate symbioses.

PubMed

McFall-Ngai, M J; Ruby, E G

2000-12-01

Associations between marine invertebrates and their cooperative bacterial symbionts offer access to an understanding of the roots of host-microbe interaction; for example, several symbioses like the squid-vibrio light organ association serve as models for investigating how each partner affects the developmental biology of the other. Previous results have identified a program of specific developmental events that unfolds as the association is initiated. In the past year, published studies have focused primarily on describing the mechanisms underlying the signaling processes that occur between the juvenile squid and the luminous bacteria that colonize it.

Applying Evolutionary Genetics to Developmental Toxicology and Risk Assessment

PubMed Central

Leung, Maxwell C. K.; Procter, Andrew C.; Goldstone, Jared V.; Foox, Jonathan; DeSalle, Robert; Mattingly, Carolyn J.; Siddall, Mark E.; Timme-Laragy, Alicia R.

2018-01-01

Evolutionary thinking continues to challenge our views on health and disease. Yet, there is a communication gap between evolutionary biologists and toxicologists in recognizing the connections among developmental pathways, high-throughput screening, and birth defects in humans. To increase our capability in identifying potential developmental toxicants in humans, we propose to apply evolutionary genetics to improve the experimental design and data interpretation with various in vitro and whole-organism models. We review five molecular systems of stress response and update 18 consensual cell-cell signaling pathways that are the hallmark for early development, organogenesis, and differentiation; and revisit the principles of teratology in light of recent advances in high-throughput screening, big data techniques, and systems toxicology. Multiscale systems modeling plays an integral role in the evolutionary approach to cross-species extrapolation. Phylogenetic analysis and comparative bioinformatics are both valuable tools in identifying and validating the molecular initiating events that account for adverse developmental outcomes in humans. The discordance of susceptibility between test species and humans (ontogeny) reflects their differences in evolutionary history (phylogeny). This synthesis not only can lead to novel applications in developmental toxicity and risk assessment, but also can pave the way for applying an evo-devo perspective to the study of developmental origins of health and disease. PMID:28267574

Developmental Dyscalculia and Medical Assessment.

ERIC Educational Resources Information Center

Shalev, Ruth S.; Gross-Tsur, Varda

1993-01-01

Medical evaluation of seven third-grade children with developmental dyscalculia in a mainstream setting identified neurological conditions (including petit mal seizures, Gerstmann syndrome, and attention deficit disorder without hyperactivity) in all the children. Findings suggest that children who are not improving academically should undergo…

Systems Analysis of a Maize Leaf Developmental Gradient Redefines the Current C4 Model and Provides Candidates for Regulation[W][OA

PubMed Central

Pick, Thea R.; Bräutigam, Andrea; Schlüter, Urte; Denton, Alisandra K.; Colmsee, Christian; Scholz, Uwe; Fahnenstich, Holger; Pieruschka, Roland; Rascher, Uwe; Sonnewald, Uwe; Weber, Andreas P.M.

2011-01-01

We systematically analyzed a developmental gradient of the third maize (Zea mays) leaf from the point of emergence into the light to the tip in 10 continuous leaf slices to study organ development and physiological and biochemical functions. Transcriptome analysis, oxygen sensitivity of photosynthesis, and photosynthetic rate measurements showed that the maize leaf undergoes a sink-to-source transition without an intermediate phase of C3 photosynthesis or operation of a photorespiratory carbon pump. Metabolome and transcriptome analysis, chlorophyll and protein measurements, as well as dry weight determination, showed continuous gradients for all analyzed items. The absence of binary on–off switches and regulons pointed to a morphogradient along the leaf as the determining factor of developmental stage. Analysis of transcription factors for differential expression along the leaf gradient defined a list of putative regulators orchestrating the sink-to-source transition and establishment of C4 photosynthesis. Finally, transcriptome and metabolome analysis, as well as enzyme activity measurements, and absolute quantification of selected metabolites revised the current model of maize C4 photosynthesis. All data sets are included within the publication to serve as a resource for maize leaf systems biology. PMID:22186372

Evolution of branched regulatory genetic pathways: directional selection on pleiotropic loci accelerates developmental system drift.

PubMed

Johnson, Norman A; Porter, Adam H

2007-01-01

Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.

Developmental Education: A Twenty-First Century Social and Economic Imperative.

ERIC Educational Resources Information Center

McCabe, Robert H., Ed.; Day, Philip R., Jr., Ed.

This monograph addresses developmental education in the 21st Century, identifying the major issues and providing examples of successful developmental programs. The first chapter, "Access and the New America of the Twenty-First Century," emphasizes several changes in American society that have affected access to education and…

Spelling well Despite Developmental Language Disorder: What Makes It Possible?

ERIC Educational Resources Information Center

Rakhlin, Natalia; Cardoso-Martins, Cláudia; Kornilov, Sergey A.; Grigorenko, Elena L.

2013-01-01

The goal of the study was to investigate the overlap between developmental language disorder (DLD) and developmental dyslexia, identified through spelling difficulties (SD), in Russian-speaking children. In particular, we studied the role of phoneme awareness (PA), rapid automatized naming (RAN), pseudoword repetition (PWR), morphological (MA),…

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

The Comet Cometh: Evolving Developmental Systems.

PubMed

Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner

In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.

Causal network analysis of head and neck keloid tissue identifies potential master regulators.

PubMed

Garcia-Rodriguez, Laura; Jones, Lamont; Chen, Kang Mei; Datta, Indrani; Divine, George; Worsham, Maria J

2016-10-01

To generate novel insights and hypotheses in keloid development from potential master regulators. Prospective cohort. Six fresh keloid and six normal skin samples from 12 anonymous donors were used in a prospective cohort study. Genome-wide profiling was done previously on the cohort using the Infinium HumanMethylation450 BeadChip (Illumina, San Diego, CA). The 190 statistically significant CpG islands between keloid and normal tissue mapped to 152 genes (P < .05). The top 10 statistically significant genes (VAMP5, ACTR3C, GALNT3, KCNAB2, LRRC61, SCML4, SYNGR1, TNS1, PLEKHG5, PPP1R13-α, false discovery rate <.015) were uploaded into the Ingenuity Pathway Analysis software's Causal Network Analysis (QIAGEN, Redwood City, CA). To reflect expected gene expression direction in the context of methylation changes, the inverse of the methylation ratio from keloid versus normal tissue was used for the analysis. Causal Network Analysis identified disease-specific master regulator molecules based on downstream differentially expressed keloid-specific genes and expected directionality of expression (hypermethylated vs. hypomethylated). Causal Network Analysis software identified four hierarchical networks that included four master regulators (pyroxamide, tributyrin, PRKG2, and PENK) and 19 intermediate regulators. Causal Network Analysis of differentiated methylated gene data of keloid versus normal skin demonstrated four causal networks with four master regulators. These hierarchical networks suggest potential driver roles for their downstream keloid gene targets in the pathogenesis of the keloid phenotype, likely triggered due to perturbation/injury to normal tissue. NA Laryngoscope, 126:E319-E324, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs

PubMed Central

Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De

2015-01-01

Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for

Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

PubMed

Misra, Ashish; Green, Michael R

2017-01-01

Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

PubMed

Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

2017-11-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

Methodological Implications of the Affect Revolution: A 35-Year Review of Emotion Regulation Assessment in Children

ERIC Educational Resources Information Center

Adrian, Molly; Zeman, Janice; Veits, Gina

2011-01-01

This investigation analyzed the methods used over the past 35 years to study emotion regulation (ER) in children. Articles published from 1975 through 2010 were identified in 42 child clinical, developmental, and emotion psychology journals. Overall, 61.1% of published ER articles relied on one method and 23.6% used two methods. Analyses revealed…

Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

PubMed

Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

2016-06-30

Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage

MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

PubMed Central

Alsaweed, Mohammed; Hartmann, Peter E.; Geddes, Donna T.; Kakulas, Foteini

2015-01-01

Human milk (HM) is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance. PMID:26529003

Environmental Toxicants and Developmental Disabilities: A Challenge for Psychologists

ERIC Educational Resources Information Center

Koger, Susan M.; Schettler, Ted; Weiss, Bernard

2005-01-01

Developmental, learning, and behavioral disabilities are a significant public health problem. Environmental chemicals can interfere with brain development during critical periods, thereby impacting sensory, motor, and cognitive function. Because regulation in the United States is based on limited testing protocols and essentially requires proof of…

Proximity-Based Differential Single-Cell Analysis of the Niche to Identify Stem/Progenitor Cell Regulators.

PubMed

Silberstein, Lev; Goncalves, Kevin A; Kharchenko, Peter V; Turcotte, Raphael; Kfoury, Youmna; Mercier, Francois; Baryawno, Ninib; Severe, Nicolas; Bachand, Jacqueline; Spencer, Joel A; Papazian, Ani; Lee, Dongjun; Chitteti, Brahmananda Reddy; Srour, Edward F; Hoggatt, Jonathan; Tate, Tiffany; Lo Celso, Cristina; Ono, Noriaki; Nutt, Stephen; Heino, Jyrki; Sipilä, Kalle; Shioda, Toshihiro; Osawa, Masatake; Lin, Charles P; Hu, Guo-Fu; Scadden, David T

2016-10-06

Physiological stem cell function is regulated by secreted factors produced by niche cells. In this study, we describe an unbiased approach based on the differential single-cell gene expression analysis of mesenchymal osteolineage cells close to, and further removed from, hematopoietic stem/progenitor cells (HSPCs) to identify candidate niche factors. Mesenchymal cells displayed distinct molecular profiles based on their relative location. We functionally examined, among the genes that were preferentially expressed in proximal cells, three secreted or cell-surface molecules not previously connected to HSPC biology-the secreted RNase angiogenin, the cytokine IL18, and the adhesion molecule Embigin-and discovered that all of these factors are HSPC quiescence regulators. Therefore, our proximity-based differential single-cell approach reveals molecular heterogeneity within niche cells and can be used to identify novel extrinsic stem/progenitor cell regulators. Similar approaches could also be applied to other stem cell/niche pairs to advance the understanding of microenvironmental regulation of stem cell function. Copyright © 2016 Elsevier Inc. All rights reserved.

Identifying Toxicity Pathways with ToxCast High-Throughput Screening and Applications to Predicting Developmental Toxicity

EPA Science Inventory

Results from rodent and non-rodent prenatal developmental toxicity tests for over 300 chemicals have been curated into the relational database ToxRefDB. These same chemicals have been run in concentration-response format through over 500 high-throughput screening assays assessin...

Applied Developmental Science, Social Justice, and Socio-Political Well-Being

ERIC Educational Resources Information Center

Fisher, Celia B.; Busch-Rossnagel, Nancy A.; Jopp, Daniela S.; Brown, Joshua L.

2012-01-01

In this article we present a vision of applied developmental science (ADS) as a means of promoting social justice and socio-political well-being. This vision draws upon the field's significant accomplishments in identifying and strengthening developmental assets in marginalized youth communities, understanding the effects of poverty and racial…

Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

PubMed

Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

2016-07-01

Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

Functional genomics identifies regulators of the phototransduction machinery in the Drosophila larval eye and adult ocelli.

PubMed

Mishra, Abhishek Kumar; Bargmann, Bastiaan O R; Tsachaki, Maria; Fritsch, Cornelia; Sprecher, Simon G

2016-02-15

Sensory perception of light is mediated by specialized Photoreceptor neurons (PRs) in the eye. During development all PRs are genetically determined to express a specific Rhodopsin (Rh) gene and genes mediating a functional phototransduction pathway. While the genetic and molecular mechanisms of PR development is well described in the adult compound eye, it remains unclear how the expression of Rhodopsins and the phototransduction cascade is regulated in other visual organs in Drosophila, such as the larval eye and adult ocelli. Using transcriptome analysis of larval PR-subtypes and ocellar PRs we identify and study new regulators required during PR differentiation or necessary for the expression of specific signaling molecules of the functional phototransduction pathway. We found that the transcription factor Krüppel (Kr) is enriched in the larval eye and controls PR differentiation by promoting Rh5 and Rh6 expression. We also identified Camta, Lola, Dve and Hazy as key genes acting during ocellar PR differentiation. Further we show that these transcriptional regulators control gene expression of the phototransduction cascade in both larval eye and adult ocelli. Our results show that PR cell type-specific transcriptome profiling is a powerful tool to identify key transcriptional regulators involved during several aspects of PR development and differentiation. Our findings greatly contribute to the understanding of how combinatorial action of key transcriptional regulators control PR development and the regulation of a functional phototransduction pathway in both larval eye and adult ocelli. Copyright © 2015 Elsevier Inc. All rights reserved.

More normal than not: a qualitative assessment of the developmental experiences of gay male youth.

PubMed

Eccles, Thomas A; Sayegh, M A; Fortenberry, J D; Zimet, G D

2004-11-01

To examine gay youth experiences within the context of normal adolescent development. Thematic analyses of interviews with 13 self-identified gay male youth, aged 16-22 years, each reporting minimal sexual identity distress, were completed. Interviews focused on: (a) descriptions of developmental changes perceived to occur for all adolescents, (b) descriptions of the participants' developmental experience, and (c) participants' direct comparisons of their perceptions of gay and nongay developmental experience. Data were analyzed by two investigators who, after initial review of the interview transcripts, developed a unified coding template to permit systematic analysis of the transcripts for recurrent themes. (a) Few (2 of 13) participants reported overall developmental experience markedly different from nongay peers. (b) Peer interaction was seen as the domain most different from that of nongay peers. (c) Open gay self-identification altered, generally positively, all peer interaction. (d) Increased peer interaction enhanced maturity in other domains. (e) Family dynamics were not substantively altered by open gay self-identification. (f) Middle and high school were identified as relatively hostile environments in which to openly identify as gay, affecting the timing and the extent of self-disclosure. (g) Developmental progress showed asynchrony across developmental domains. General developmental dysfunction is not inevitable for gay adolescents, nor is identifiable personal or family pathology directly related to sexual identity.

In silico analysis of single-cell RNA sequencing data from 3 and 7 days old mouse spermatogonial stem cells to identify their differentially expressed genes and transcriptional regulators.

PubMed

Sisakhtnezhad, Sajjad

2018-05-11

Spermatogonial stem cells (SSCs), which are at the basis of spermatogenesis process, are valuable cells with different applications in biotechnology and regenerative medicine. Understanding the molecular basis of SSC self-renewal and differentiation at various developmental stages of the male organism is crucial to find key factors in the SSCs fate and function. Therefore, this study was aimed to use single-cell RNA-sequencing dataset analysis for identification of differentially expressed genes (DEGs) and their regulators in 3 and 7 days old mouse-derived single SSCs (mSSCs). Results showed 68 upregulated and 203 downregulated genes in 7 days old mouse-derived SSCs compared to 3 days old mSSCs, which were associated with 1493 and 3077 biological processes, respectively. It also found that DAZL, FKBP6, PAIP2, DDX4, H3F3B, TEX15, XRN2, MAEL, and SOD1 are important factors with the higher gene expression pattern, which may be pivotal for mSSCs fate and function during development of germ cells. Moreover, NR3C1, RXRA, NCOA, ESR1, PML, ATF2, BMI1, POU5F1, and CHD1 were the main central regulators for the upregulated DEGs, while HNF1A, C/EBPα, and NFATC1 were the master regulators for the downregulated DEGs. In this regard, two significant protein complexes were found in the protein-protein interactions network for the upregulated DEGs regulators. Furthermore, 24 protein kinases detected upstream of the main central regulators of DEGs. In conclusion, this study presents DEGs and their transcriptional regulators that are crucial for inducing and regulating SSCs commitment during development, and for developing efficient protocols to identify and isolate SSCs for different applications. © 2018 Wiley Periodicals, Inc.

An integrative review of ethnic and cultural variation in socialization and children's self-regulation.

PubMed

LeCuyer, Elizabeth A; Zhang, Yi

2015-04-01

To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.

Identifying developmental toxicity pathways for a subset of ToxCast chemicals using human embryonic stem cells and metabolomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kleinstreuer, N.C., E-mail: kleinstreuer.nicole@epa.gov; Smith, A.M.; West, P.R.

2011-11-15

Metabolomics analysis was performed on the supernatant of human embryonic stem (hES) cell cultures exposed to a blinded subset of 11 chemicals selected from the chemical library of EPA's ToxCast Trade-Mark-Sign chemical screening and prioritization research project. Metabolites from hES cultures were evaluated for known and novel signatures that may be indicative of developmental toxicity. Significant fold changes in endogenous metabolites were detected for 83 putatively annotated mass features in response to the subset of ToxCast chemicals. The annotations were mapped to specific human metabolic pathways. This revealed strong effects on pathways for nicotinate and nicotinamide metabolism, pantothenate and CoAmore » biosynthesis, glutathione metabolism, and arginine and proline metabolism pathways. Predictivity for adverse outcomes in mammalian prenatal developmental toxicity studies used ToxRefDB and other sources of information, including Stemina Biomarker Discovery's predictive DevTox Registered-Sign model trained on 23 pharmaceutical agents of known developmental toxicity and differing potency. The model initially predicted developmental toxicity from the blinded ToxCast compounds in concordance with animal data with 73% accuracy. Retraining the model with data from the unblinded test compounds at one concentration level increased the predictive accuracy for the remaining concentrations to 83%. These preliminary results on a 11-chemical subset of the ToxCast chemical library indicate that metabolomics analysis of the hES secretome provides information valuable for predictive modeling and mechanistic understanding of mammalian developmental toxicity. -- Highlights: Black-Right-Pointing-Pointer We tested 11 environmental compounds in a hESC metabolomics platform. Black-Right-Pointing-Pointer Significant changes in secreted small molecule metabolites were observed. Black-Right-Pointing-Pointer Perturbed mass features map to pathways critical for normal

In Silico Analysis Identifies a Novel Role for Androgens in the Regulation of Human Endometrial Apoptosis

PubMed Central

Marshall, Elaine; Lowrey, Jacqueline; MacPherson, Sheila; Maybin, Jacqueline A.; Collins, Frances; Critchley, Hilary O. D.

2011-01-01

Context: The endometrium is a multicellular, steroid-responsive tissue that undergoes dynamic remodeling every menstrual cycle in preparation for implantation and, in absence of pregnancy, menstruation. Androgen receptors are present in the endometrium. Objective: The objective of the study was to investigate the impact of androgens on human endometrial stromal cells (hESC). Design: Bioinformatics was used to identify an androgen-regulated gene set and processes associated with their function. Regulation of target genes and impact of androgens on cell function were validated using primary hESC. Setting: The study was conducted at the University Research Institute. Patients: Endometrium was collected from women with regular menses; tissues were used for recovery of cells, total mRNA, or protein and for immunohistochemistry. Results: A new endometrial androgen target gene set (n = 15) was identified. Bioinformatics revealed 12 of these genes interacted in one pathway and identified an association with control of cell survival. Dynamic androgen-dependent changes in expression of the gene set were detected in hESC with nine significantly down-regulated at 2 and/or 8 h. Treatment of hESC with dihydrotestosterone reduced staurosporine-induced apoptosis and cell migration/proliferation. Conclusions: Rigorous in silico analysis resulted in identification of a group of androgen-regulated genes expressed in human endometrium. Pathway analysis and functional assays suggest androgen-dependent changes in gene expression may have a significant impact on stromal cell proliferation, migration, and survival. These data provide the platform for further studies on the role of circulatory or local androgens in the regulation of endometrial function and identify androgens as candidates in the pathogenesis of common endometrial disorders including polycystic ovarian syndrome, cancer, and endometriosis. PMID:21865353

Configural Frequency Analysis as a Statistical Tool for Developmental Research.

ERIC Educational Resources Information Center

Lienert, Gustav A.; Oeveste, Hans Zur

1985-01-01

Configural frequency analysis (CFA) is suggested as a technique for longitudinal research in developmental psychology. Stability and change in answers to multiple choice and yes-no item patterns obtained with repeated measurements are identified by CFA and illustrated by developmental analysis of an item from Gorham's Proverb Test. (Author/DWH)

What Aspects of Face Processing Are Impaired in Developmental Prosopagnosia?

ERIC Educational Resources Information Center

Le Grand, Richard; Cooper, Philip A.; Mondloch, Catherine J.; Lewis, Terri L.; Sagiv, Noam; de Gelder, Beatrice; Maurer, Daphne

2006-01-01

Developmental prosopagnosia (DP) is a severe impairment in identifying faces that is present from early in life and that occurs despite no apparent brain damage and intact visual and intellectual function. Here, we investigated what aspects of face processing are impaired/spared in developmental prosopagnosia by examining a relatively large group…

A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation

PubMed Central

2011-01-01

Background Green plant leaves have always fascinated biologists as hosts for photosynthesis and providers of basic energy to many food webs. Today, comprehensive databases of gene expression data enable us to apply increasingly more advanced computational methods for reverse-engineering the regulatory network of leaves, and to begin to understand the gene interactions underlying complex emergent properties related to stress-response and development. These new systems biology methods are now also being applied to organisms such as Populus, a woody perennial tree, in order to understand the specific characteristics of these species. Results We present a systems biology model of the regulatory network of Populus leaves. The network is reverse-engineered from promoter information and expression profiles of leaf-specific genes measured over a large set of conditions related to stress and developmental. The network model incorporates interactions between regulators, such as synergistic and competitive relationships, by evaluating increasingly more complex regulatory mechanisms, and is therefore able to identify new regulators of leaf development not found by traditional genomics methods based on pair-wise expression similarity. The approach is shown to explain available gene function information and to provide robust prediction of expression levels in new data. We also use the predictive capability of the model to identify condition-specific regulation as well as conserved regulation between Populus and Arabidopsis. Conclusions We outline a computationally inferred model of the regulatory network of Populus leaves, and show how treating genes as interacting, rather than individual, entities identifies new regulators compared to traditional genomics analysis. Although systems biology models should be used with care considering the complexity of regulatory programs and the limitations of current genomics data, methods describing interactions can provide hypotheses about

Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

PubMed Central

Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

2010-01-01

Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

Child Abuse and Developmental Disabilities.

ERIC Educational Resources Information Center

Grayson, Joann, Ed.; Bartlette, Don

1992-01-01

Literature indicating high rates of abuse in this population is reviewed, as is literature indicating high rates of developmental disabilities in child victims of abuse. Problems in data collecting practices are noted. Reasons for these children's greater risk for abuse are identified, including child attributes, stress, parent vulnerabilities,…

Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.

PubMed

Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina

2015-10-01

The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

PubMed

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Distinct emotion regulation skills explain psychopathology and problems in social relationships following childhood emotional abuse and neglect.

PubMed

Berzenski, Sara R

2018-03-22

Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.

Regulation of Expressive Behavior as Reflecting Affect Socialization.

ERIC Educational Resources Information Center

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Transcriptional Network Analysis Identifies BACH1 as a Master Regulator of Breast Cancer Bone Metastasis

PubMed Central

Liang, Yajun; Wu, Heng; Lei, Rong; Chong, Robert A.; Wei, Yong; Lu, Xin; Tagkopoulos, Ilias; Kung, Sun-Yuan; Yang, Qifeng; Hu, Guohong; Kang, Yibin

2012-01-01

The application of functional genomic analysis of breast cancer metastasis has led to the identification of a growing number of organ-specific metastasis genes, which often function in concert to facilitate different steps of the metastatic cascade. However, the gene regulatory network that controls the expression of these metastasis genes remains largely unknown. Here, we demonstrate a computational approach for the deconvolution of transcriptional networks to discover master regulators of breast cancer bone metastasis. Several known regulators of breast cancer bone metastasis such as Smad4 and HIF1 were identified in our analysis. Experimental validation of the networks revealed BACH1, a basic leucine zipper transcription factor, as the common regulator of several functional metastasis genes, including MMP1 and CXCR4. Ectopic expression of BACH1 enhanced the malignance of breast cancer cells, and conversely, BACH1 knockdown significantly reduced bone metastasis. The expression of BACH1 and its target genes was linked to the higher risk of breast cancer recurrence in patients. This study established BACH1 as the master regulator of breast cancer bone metastasis and provided a paradigm to identify molecular determinants in complex pathological processes. PMID:22875853

Identification of Developmentally Regulated PCP-Responsive Non-Coding RNA, prt6, in the Rat Thalamus

PubMed Central

Umino, Asami; Nishikawa, Toru

2014-01-01

Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP) and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c.)) significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD) 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c.), and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c.), mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible dysregulation of

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

Diversity in genomic organisation, developmental regulation and distribution of the murine PR72/B" subunits of protein phosphatase 2A

PubMed Central

Zwaenepoel, Karen; Louis, Justin V; Goris, Jozef; Janssens, Veerle

2008-01-01

Background Protein phosphatase 2A (PP2A) is a serine/threonine-specific phosphatase displaying vital functions in growth and development through its role in various signalling pathways. PP2A holoenzymes comprise a core dimer composed of a catalytic C and a structural A subunit, which can associate with a variable B-type subunit. The importance of the B-type subunits for PP2A regulation cannot be overestimated as they determine holoenzyme localisation, activity and substrate specificity. Three B-type subunit families have been identified: PR55/B, PR61/B' and PR72/B", of which the latter is currently the least characterised. Results We deduced the sequences and genomic organisation of the different murine PR72/B" isoforms: three genes encode nine isoforms, five of which are abundantly expressed and give rise to genuine PP2A subunits. Thereby, one novel subunit was identified. Using Northern blotting, we examined the tissue-specific and developmental expression of these subunits. All subunits are highly expressed in heart, suggesting an important cardiac function. Immunohistochemical analysis revealed a striated expression pattern of PR72 and PR130 in heart and skeletal muscle, but not in bladder smooth muscle. The subcellular localisation and cell cycle regulatory ability of several PR72/B" isoforms were determined, demonstrating differences as well as similarities. Conclusion In contrast to PR55/B and PR61/B', the PR72/B" family seems evolutionary more divergent, as only two of the murine genes have a human orthologue. We have integrated these results in a more consistent nomenclature of both human and murine PR72/B" genes and their transcripts/proteins. Our results provide a platform for the future generation of PR72/B" knockout mice. PMID:18715506

Arabidopsis thaliana G2-LIKE FLAVONOID REGULATOR and BRASSINOSTEROID ENHANCED EXPRESSION1 are low-temperature regulators of flavonoid accumulation.

PubMed

Petridis, Antonios; Döll, Stefanie; Nichelmann, Lars; Bilger, Wolfgang; Mock, Hans-Peter

2016-08-01

Flavonoid synthesis is predominantly regulated at the transcriptional level through the MYB-basic helix-loop-helix (bHLH)-WD40 (MBW) (MYB: transcription factor of the myeloblastosis protein family, WD40: tanscription factor with a short structural motif of 40 amino acids which terminates in an aspartic acid-tryptophan dipeptide) complex, and responds to both environmental and developmental stimuli. Although the developmental regulation of flavonoid accumulation in Arabidopsis thaliana has been examined in great detail, the response of the flavonoid synthesis pathway to abiotic stress (particularly low temperature) remains unclear. A screen of a Dissociation element (Ds) transposon-induced mutation collection identified two lines which exhibited an altered profile of phenylpropanoid accumulation following exposure to low-temperature stress. One of the mutated genes (BRASSINOSTEROID ENHANCED EXPRESSION1 (BEE1)) encoded a brassinosteroid enhanced expression transcription factor, while the other (G2-LIKE FLAVONOID REGULATOR (GFR)) encoded a G2-like flavonoid regulator. Phenylpropanoid-targeted analysis was performed using high-performance LC-MS, and gene expression analysis using quantitative reverse transcription-PCR. In both mutants, the accumulation of quercetins and scopolin was reduced under low-temperature growing conditions, whereas that of anthocyanin was increased. BEE1 and GFR were both shown to negatively regulate anthocyanin accumulation by inhibiting anthocyanin synthesis genes via the suppression of the bHLH (TRANSPARENT TESTA8 (TT8) and GLABROUS3 (GL3)) and/or the MYB (PRODUCTION OF ANTHOCYANIN PIGMENTS2 (PAP2)) components of the MBW complex. Our results provide new insight into the regulatory control of phenylpropanoid metabolism at low temperatures, and reveal that BEE1 and GFR act as important components of the signal transduction chain. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Prevalence of entomophthoralean fungi (Entomophthoromycota) of aphids in relation to developmental stages.

PubMed

Manfrino, Romina G; Gutierrez, Alejandra C; Rueda Páramo, Manuel E; Salto, César E; López Lastra, Claudia C

2016-08-01

Transmission of fungal pathogens of aphids may be affected by the host developmental stage. Brassica and Lactuca sativa L. crops were sampled in Santa Fe, Argentina, to determine the prevalence of fungal-diseased aphids and investigate the differences between developmental stages of aphids. The fungal pathogens identified were Zoophthora radicans (Bref.) A. Batko, Pandora neoaphidis (Remaud. & Hennebert) Humber and Entomophthora planchoniana Cornu. Their prevalence on each crop was calculated. The numbers of infected aphids were significantly different between the different developmental stages on all crops except B. oleracea var. botrytis L. The entomophthoralean fungi identified are important mortality factors of aphids on horticultural crops in Santa Fe. The numbers of infected nymphs and adults were significantly different, nymphs being the most affected developmental stage. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Developmental and Thyroid Hormone Regulation of the DNA Methyltransferase 3a Gene in Xenopus Tadpoles

PubMed Central

Kyono, Yasuhiro; Sachs, Laurent M.; Bilesimo, Patrice; Wen, Luan

2016-01-01

Thyroid hormone is essential for normal development in vertebrates. In amphibians, T3 controls metamorphosis by inducing tissue-specific gene regulation programs. A hallmark of T3 action is the modification of chromatin structure, which underlies changes in gene transcription. We found that mRNA for the de novo DNA methyltransferase (DNMT) dnmt3a, but not dnmt1, increased in the brain of Xenopus tadpoles during metamorphosis in parallel with plasma [T3]. Addition of T3 to the rearing water caused a time-dependent increase in dnmt3a mRNA in tadpole brain, tail, and hind limb. By analyzing data from a genome-wide analysis of T3 receptor (TR) binding in tadpole tail, we identified several putative T3 response elements (TREs) within the dnmt3a locus. Using in vitro DNA binding, transient transfection-reporter, and chromatin immunoprecipitation assays for TRs, we identified two functional TREs at −7.1 kb and +5.1 kb relative to the dnmt3a transcription start site. Sequence alignment showed that these TREs are conserved between two related frog species, X. laevis and X. tropicalis, but not with amniotes. Our previous findings showed that this gene is directly regulated by liganded TRs in mouse brain, and whereas the two mouse TREs are conserved among Eutherian mammals, they are not conserved in Xenopus species. Thus, although T3 regulation of dnmt3a may be an ancient pathway in vertebrates, the genomic sites responsible for hormone regulation may have diverged or arisen by convergent evolution. We hypothesize that direct T3 regulation of dnmt3a may be an important mechanism for modulating global changes in DNA methylation. PMID:27779916

Role of the pre- and post-natal environment in developmental programming of health and productivity.

PubMed

Reynolds, Lawrence P; Caton, Joel S

2012-05-06

The concept that developmental insults (for example, poor pre- or postnatal nutrition) can have long-term consequences on health and well-being of the offspring has been termed developmental programming. In livestock, developmental programming affects production traits, including growth, body composition, and reproduction. Although low birth weight was used as a proxy for compromised fetal development in the initial epidemiological studies, based on controlled studies using livestock and other animal models in the last two decades we now know that developmental programming can occur independently of any effects on birth weight. Studies in humans, rodents, and livestock also have confirmed the critical role of the placenta in developmental programming. In addition, the central role of epigenetic regulation in developmental programming has been confirmed. Lastly, relatively simple therapeutic/management strategies designed to 'rescue' placental development and function are being developed to minimize the effects of developmental programming on health and productivity of humans, livestock, and other mammals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

PubMed

Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

2017-02-01

Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Causal Inference and Developmental Psychology

ERIC Educational Resources Information Center

Foster, E. Michael

2010-01-01

Causal inference is of central importance to developmental psychology. Many key questions in the field revolve around improving the lives of children and their families. These include identifying risk factors that if manipulated in some way would foster child development. Such a task inherently involves causal inference: One wants to know whether…

A Novel 3-Hydroxysteroid Dehydrogenase That Regulates Reproductive Development and Longevity

PubMed Central

Wollam, Joshua; Magner, Daniel B.; Magomedova, Lilia; Rass, Elisabeth; Shen, Yidong; Rottiers, Veerle; Habermann, Bianca; Cummins, Carolyn L.; Antebi, Adam

2012-01-01

Endogenous small molecule metabolites that regulate animal longevity are emerging as a novel means to influence health and life span. In C. elegans, bile acid-like steroids called the dafachronic acids (DAs) regulate developmental timing and longevity through the conserved nuclear hormone receptor DAF-12, a homolog of mammalian sterol-regulated receptors LXR and FXR. Using metabolic genetics, mass spectrometry, and biochemical approaches, we identify new activities in DA biosynthesis and characterize an evolutionarily conserved short chain dehydrogenase, DHS-16, as a novel 3-hydroxysteroid dehydrogenase. Through regulation of DA production, DHS-16 controls DAF-12 activity governing longevity in response to signals from the gonad. Our elucidation of C. elegans bile acid biosynthetic pathways reveals the possibility of novel ligands as well as striking biochemical conservation to other animals, which could illuminate new targets for manipulating longevity in metazoans. PMID:22505847

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, J.; Pei-Chen Lin, C.; Pathak, M. C.

2016-07-06

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumedmore » during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.« less

A phosphatidylinositol transfer protein integrates phosphoinositide signaling with lipid droplet metabolism to regulate a developmental program of nutrient stress-induced membrane biogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.

2014-07-11

Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumedmore » during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.« less

Plastic flies: the regulation and evolution of trait variability in Drosophila.

PubMed

Shingleton, Alexander W; Tang, Hui Yuan

2012-01-01

Individuals within species and populations vary. Such variation arises through environmental and genetic factors and ensures that no two individuals are identical. However, it is clear that not all traits show the same degree of intraspecific variation. Some traits, in particular secondary sexual characteristics used by males to compete for and attract females, are extremely variable among individuals in a population. Other traits, for example brain size in mammals, are not. Recent research has begun to explore the possibility that the extent of phenotypic variation (here referred to as "variability") may be a character itself and subject to natural selection. While these studies support the concept of variability as an evolvable trait, controversy remains over what precisely the trait is. At the heart of this controversy is the fact that there are very few examples of developmental mechanisms that regulate trait variability in response to any source of variation, be it environmental or genetic. Here, we describe a recent study from our laboratory that identifies such a mechanism. We then place the study in the context of current research on the regulation of trait variability, and discuss the implications for our understanding of the developmental regulation and evolution of phenotypic variation.

Root gravitropism and root hair development constitute coupled developmental responses regulated by auxin homeostasis in the Arabidopsis root apex.

PubMed

Rigas, Stamatis; Ditengou, Franck Anicet; Ljung, Karin; Daras, Gerasimos; Tietz, Olaf; Palme, Klaus; Hatzopoulos, Polydefkis

2013-03-01

Active polar transport establishes directional auxin flow and the generation of local auxin gradients implicated in plant responses and development. Auxin modulates gravitropism at the root tip and root hair morphogenesis at the differentiation zone. Genetic and biochemical analyses provide evidence for defective basipetal auxin transport in trh1 roots. The trh1, pin2, axr2 and aux1 mutants, and transgenic plants overexpressing PIN1, all showing impaired gravity response and root hair development, revealed ectopic PIN1 localization. The auxin antagonist hypaphorine blocked root hair elongation and caused moderate agravitropic root growth, also leading to PIN1 mislocalization. These results suggest that auxin imbalance leads to proximal and distal developmental defects in Arabidopsis root apex, associated with agravitropic root growth and root hair phenotype, respectively, providing evidence that these two auxin-regulated processes are coupled. Cell-specific subcellular localization of TRH1-YFP in stele and epidermis supports TRH1 engagement in auxin transport, and hence impaired function in trh1 causes dual defects of auxin imbalance. The interplay between intrinsic cues determining root epidermal cell fate through the TTG/GL2 pathway and environmental cues including abiotic stresses modulates root hair morphogenesis. As a consequence of auxin imbalance in Arabidopsis root apex, ectopic PIN1 mislocalization could be a risk aversion mechanism to trigger root developmental responses ensuring root growth plasticity. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

PubMed Central

2009-01-01

Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic

Young Children’s Developmental Ecologies and Kindergarten Readiness

PubMed Central

Mollborn, Stefanie

2016-01-01

Children enter the crucial transition to school with sociodemographic disparities firmly established. Domain-specific research (e.g., on poverty and family structure) has shed light on these disparities, but we need broader operationalizations of children’s environments to explain them. Building on existing theory, this study articulates the concept of developmental ecology—those interrelated features of a child’s proximal environment that shape development and health. Developmental ecology links structural and demographic factors with interactional, psychological, and genetic factors. Using the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B), this study conducts latent class analyses to identify how 41 factors from three domains—namely, household resources, health risks, and ecological changes—cluster within children as four overarching developmental ecologies. Because it documents how numerous factors co-occur within children, this method allows an approximation of their lived environments. Findings illuminate powerful relationships between race/ethnicity, parental age, socioeconomic background, and nativity and a child’s developmental ecology, as well as associations between developmental ecology and kindergarten cognition, behavior, and health. Developmental ecology represents a major pathway through which demographic characteristics shape school readiness. Because specific factors have different implications depending on the ecologies in which they are embedded, findings support the usefulness of a broad ecological approach. PMID:27873222

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2

Mild Developmental Foreign Accent Syndrome and Psychiatric Comorbidity: Altered White Matter Integrity in Speech and Emotion Regulation Networks

PubMed Central

Berthier, Marcelo L.; Roé-Vellvé, Núria; Moreno-Torres, Ignacio; Falcon, Carles; Thurnhofer-Hemsi, Karl; Paredes-Pacheco, José; Torres-Prioris, María J.; De-Torres, Irene; Alfaro, Francisco; Gutiérrez-Cardo, Antonio L.; Baquero, Miquel; Ruiz-Cruces, Rafael; Dávila, Guadalupe

2016-01-01

Foreign accent syndrome (FAS) is a speech disorder that is defined by the emergence of a peculiar manner of articulation and intonation which is perceived as foreign. In most cases of acquired FAS (AFAS) the new accent is secondary to small focal lesions involving components of the bilaterally distributed neural network for speech production. In the past few years FAS has also been described in different psychiatric conditions (conversion disorder, bipolar disorder, and schizophrenia) as well as in developmental disorders (specific language impairment, apraxia of speech). In the present study, two adult males, one with atypical phonetic production and the other one with cluttering, reported having developmental FAS (DFAS) since their adolescence. Perceptual analysis by naïve judges could not confirm the presence of foreign accent, possibly due to the mildness of the speech disorder. However, detailed linguistic analysis provided evidence of prosodic and segmental errors previously reported in AFAS cases. Cognitive testing showed reduced communication in activities of daily living and mild deficits related to psychiatric disorders. Psychiatric evaluation revealed long-lasting internalizing disorders (neuroticism, anxiety, obsessive-compulsive disorder, social phobia, depression, alexithymia, hopelessness, and apathy) in both subjects. Diffusion tensor imaging (DTI) data from each subject with DFAS were compared with data from a group of 21 age- and gender-matched healthy control subjects. Diffusion parameters (MD, AD, and RD) in predefined regions of interest showed changes of white matter microstructure in regions previously related with AFAS and psychiatric disorders. In conclusion, the present findings militate against the possibility that these two subjects have FAS of psychogenic origin. Rather, our findings provide evidence that mild DFAS occurring in the context of subtle, yet persistent, developmental speech disorders may be associated with structural brain

C. elegans sym-1 is a downstream target of the hunchback-like-1 developmental timing transcription factor

PubMed Central

Niwa, Ryusuke; Hada, Kazumasa; Moliyama, Kouichi; Ohniwa, Ryosuke L.; Tan, Yi-Meng; Olsson-Carter, Katherine; Chi, Woo; Reinke, Valerie; Slack, Frank J.

2010-01-01

In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) and its family members control the timing of key developmental events in part by directly regulating expression of hunchback-like-1 (hbl-1). C. elegans hbl-1 mutants display multiple developmental timing deficiencies, including cell cycle defects during larval development. While hbl-1 is predicted to encode a transcriptional regulator, downstream targets of HBL-1 have not been fully elucidated. Here we report using microarray analysis to uncover genes downstream of HBL-1. We established a transgenic strain that overexpresses hbl-1 under the control of a heat shock promoter. Heat shock-induced hbl-1 overexpression led to retarded hypodermal structures at the adult stage, opposite to the effect seen in loss of function (lf) hbl-1 mutants. The microarray screen identified numerous potential genes that are upregulated or downregulated by HBL-1, including sym-1, which encodes a leucine-rich repeat protein with a signal sequence. We found an increase in sym-1 transcription in the heat shock-induced hbl-1 overexpression strain, while loss of hbl-1 function caused a decrease in sym-1 expression levels. Furthermore, we found that sym-1(lf) modified the hypodermal abnormalities in hbl-1 mutants. Given that SYM-1 is a protein secreted from hypodermal cells to the surrounding cuticle, we propose that the adult-specific cuticular structures may be under the temporal control of HBL-1 through regulation of sym-1 transcription. PMID:19923914

[The principle of the energy minimum in ontogeny and the channeling of developmental processes].

PubMed

Ozerniuk, N D

1989-01-01

The principle of minimum of energy in ontogenesis has been formulated on the basis of data concerning age changes in energetic metabolism, as well as the influence of ecological factors on this process. According to this principle the smallest expenditures of energy are observed in the zone of the most favorable developmental conditions. The minimal level of energetic metabolism at every developmental stage that corresponds to the most stable state of organism is treated as homeostasis and the developmental stability is treated as homeorrhesis. Regulation mechanisms of energetic metabolism during ontogenesis and under the influence of environmental factors are analyzed.

MRCK-1 drives apical constriction in C. elegans by linking developmental patterning to force generation

PubMed Central

Marston, Daniel J.; Higgins, Christopher D.; Peters, Kimberly A.; Cupp, Timothy D.; Dickinson, Daniel J.; Pani, Ariel M.; Moore, Regan P.; Cox, Amanda H.; Kiehart, Daniel P.; Goldstein, Bob

2016-01-01

Summary Apical constriction is a change in cell shape that drives key morphogenetic events including gastrulation and neural tube formation. Apical force-producing actomyosin networks drive apical constriction by contracting while connected to cell-cell junctions. The mechanisms by which developmental patterning regulates these actomyosin networks and associated junctions with spatial precision are not fully understood. Here, we identify a myosin light chain kinase MRCK-1 as a key regulator of C. elegans gastrulation that integrates spatial and developmental patterning information. We show that MRCK-1 is required for activation of contractile actomyosin dynamics and elevated cortical tension in the apical cell cortex of endodermal precursor cells. MRCK-1 is apically localized by active Cdc42 at the external, cell-cell contact-free surfaces of apically constricting cells, downstream of cell fate determination mechanisms. We establish that the junctional components α-catenin, β-catenin, and cadherin become highly enriched at the apical junctions of apically-constricting cells, and that MRCK-1 and myosin activity are required in vivo for this enrichment. Taken together, our results define mechanisms that position a myosin activator to a specific cell surface where it both locally increases cortical tension and locally enriches junctional components to facilitate apical constriction. These results reveal crucial links that can tie spatial information to local force generation to drive morphogenesis. PMID:27451898

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Sexual Abuse Prevention: A Training Program for Developmental Disabilities Service Providers

ERIC Educational Resources Information Center

Bowman, Rachel A.; Scotti, Joseph R.; Morris, Tracy L.

2010-01-01

Persons with developmental disabilities are at an increased risk for becoming victims of sexual abuse. Research has revealed that the largest group of identified perpetrators of sexual abuse is developmental disability service providers. The purpose of the present study was to develop, implement, and evaluate the effectiveness of a sexual abuse…

Systems analysis identifies miR-29b regulation of invasiveness in melanoma.

PubMed

Andrews, Miles C; Cursons, Joseph; Hurley, Daniel G; Anaka, Matthew; Cebon, Jonathan S; Behren, Andreas; Crampin, Edmund J

2016-11-16

In many cancers, microRNAs (miRs) contribute to metastatic progression by modulating phenotypic reprogramming processes such as epithelial-mesenchymal plasticity. This can be driven by miRs targeting multiple mRNA transcripts, inducing regulated changes across large sets of genes. The miR-target databases TargetScan and DIANA-microT predict putative relationships by examining sequence complementarity between miRs and mRNAs. However, it remains a challenge to identify which miR-mRNA interactions are active at endogenous expression levels, and of biological consequence. We developed a workflow to integrate TargetScan and DIANA-microT predictions into the analysis of data-driven associations calculated from transcript abundance (RNASeq) data, specifically the mutual information and Pearson's correlation metrics. We use this workflow to identify putative relationships of miR-mediated mRNA repression with strong support from both lines of evidence. Applying this approach systematically to a large, published collection of unique melanoma cell lines - the Ludwig Melbourne melanoma (LM-MEL) cell line panel - we identified putative miR-mRNA interactions that may contribute to invasiveness. This guided the selection of interactions of interest for further in vitro validation studies. Several miR-mRNA regulatory relationships supported by TargetScan and DIANA-microT demonstrated differential activity across cell lines of varying matrigel invasiveness. Strong negative statistical associations for these putative regulatory relationships were consistent with target mRNA inhibition by the miR, and suggest that differential activity of such miR-mRNA relationships contribute to differences in melanoma invasiveness. Many of these relationships were reflected across the skin cutaneous melanoma TCGA dataset, indicating that these observations also show graded activity across clinical samples. Several of these miRs are implicated in cancer progression (miR-211, -340, -125b, -221, and

Genome-Wide Association Mapping of Fertility Reduction upon Heat Stress Reveals Developmental Stage-Specific QTLs in Arabidopsis thaliana

PubMed Central

Bac-Molenaar, Johanna A.; Fradin, Emilie F.; Becker, Frank F.M.; Rienstra, Juriaan A.; van der Schoot, J.; Vreugdenhil, Dick; Keurentjes, Joost J.B.

2015-01-01

For crops that are grown for their fruits or seeds, elevated temperatures that occur during flowering and seed or fruit set have a stronger effect on yield than high temperatures during the vegetative stage. Even short-term exposure to heat can have a large impact on yield. In this study, we used Arabidopsis thaliana to study the effect of short-term heat exposure on flower and seed development. The impact of a single hot day (35°C) was determined in more than 250 natural accessions by measuring the lengths of the siliques along the main inflorescence. Two sensitive developmental stages were identified, one before anthesis, during male and female meiosis, and one after anthesis, during fertilization and early embryo development. In addition, we observed a correlation between flowering time and heat tolerance. Genome-wide association mapping revealed four quantitative trait loci (QTLs) strongly associated with the heat response. These QTLs were developmental stage specific, as different QTLs were detected before and after anthesis. For a number of QTLs, T-DNA insertion knockout lines could validate assigned candidate genes. Our findings show that the regulation of complex traits can be highly dependent on the developmental timing. PMID:26163573

Developmental regulation of CYCA2s contributes to tissue-specific proliferation in Arabidopsis

PubMed Central

Vanneste, Steffen; Coppens, Frederik; Lee, EunKyoung; Donner, Tyler J; Xie, Zidian; Van Isterdael, Gert; Dhondt, Stijn; De Winter, Freya; De Rybel, Bert; Vuylsteke, Marnik; De Veylder, Lieven; Friml, Jiří; Inzé, Dirk; Grotewold, Erich; Scarpella, Enrico; Sack, Fred; Beemster, Gerrit T S; Beeckman, Tom

2011-01-01

In multicellular organisms, morphogenesis relies on a strict coordination in time and space of cell proliferation and differentiation. In contrast to animals, plant development displays continuous organ formation and adaptive growth responses during their lifespan relying on a tight coordination of cell proliferation. How developmental signals interact with the plant cell-cycle machinery is largely unknown. Here, we characterize plant A2-type cyclins, a small gene family of mitotic cyclins, and show how they contribute to the fine-tuning of local proliferation during plant development. Moreover, the timely repression of CYCA2;3 expression in newly formed guard cells is shown to require the stomatal transcription factors FOUR LIPS/MYB124 and MYB88, providing a direct link between developmental programming and cell-cycle exit in plants. Thus, transcriptional downregulation of CYCA2s represents a critical mechanism to coordinate proliferation during plant development. PMID:21772250

Developmental mechanisms underlying variation in craniofacial disease and evolution.

PubMed

Fish, Jennifer L

2016-07-15

Craniofacial disease phenotypes exhibit significant variation in penetrance and severity. Although many genetic contributions to phenotypic variation have been identified, genotype-phenotype correlations remain imprecise. Recent work in evolutionary developmental biology has exposed intriguing developmental mechanisms that potentially explain incongruities in genotype-phenotype relationships. This review focuses on two observations from work in comparative and experimental animal model systems that highlight how development structures variation. First, multiple genetic inputs converge on relatively few developmental processes. Investigation of when and how variation in developmental processes occurs may therefore help predict potential genetic interactions and phenotypic outcomes. Second, genetic mutation is typically associated with an increase in phenotypic variance. Several models outlining developmental mechanisms underlying mutational increases in phenotypic variance are discussed using Satb2-mediated variation in jaw size as an example. These data highlight development as a critical mediator of genotype-phenotype correlations. Future research in evolutionary developmental biology focusing on tissue-level processes may help elucidate the "black box" between genotype and phenotype, potentially leading to novel treatment, earlier diagnoses, and better clinical consultations for individuals affected by craniofacial anomalies. Copyright © 2015 Elsevier Inc. All rights reserved.

Evaluating alterations in Zebrafish retino-tectal projections as an indication of developmental neurotoxicity

EPA Science Inventory

The U.S. EPA is developing alternative screening methods to identify putative developmental neurotoxicants and prioritize chemicals for additional testing. One method developmentally exposes zebrafish embryos and assesses nervous system structure at 2 days post-fertilization (dpf...

Hormonal regulation and developmental role of Krüppel homolog 1, a repressor of metamorphosis, in the silkworm Bombyx mori.

PubMed

Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro

2014-04-01

Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.

A Screening of UNF Targets Identifies Rnb, a Novel Regulator of Drosophila Circadian Rhythms.

PubMed

Kozlov, Anatoly; Jaumouillé, Edouard; Machado Almeida, Pedro; Koch, Rafael; Rodriguez, Joseph; Abruzzi, Katharine C; Nagoshi, Emi

2017-07-12

Behavioral circadian rhythms are controlled by multioscillator networks comprising functionally different subgroups of clock neurons. Studies have demonstrated that molecular clocks in the fruit fly Drosophila melanogaster are regulated differently in clock neuron subclasses to support their specific functions (Lee et al., 2016; Top et al., 2016). The nuclear receptor unfulfilled ( unf ) represents a regulatory node that provides the small ventral lateral neurons (s-LNvs) unique characteristics as the master pacemaker (Beuchle et al., 2012). We previously showed that UNF interacts with the s-LNv molecular clocks by regulating transcription of the core clock gene period ( per ) (Jaumouillé et al., 2015). To gain more insight into the mechanisms by which UNF contributes to the functioning of the circadian master pacemaker, we identified UNF target genes using chromatin immunoprecipitation. Our data demonstrate that a previously uncharacterized gene CG7837 , which we termed R and B ( Rnb ), acts downstream of UNF to regulate the function of the s-LNvs as the master circadian pacemaker. Mutations and LNv-targeted adult-restricted knockdown of Rnb impair locomotor rhythms. RNB localizes to the nucleus, and its loss-of-function blunts the molecular rhythms and output rhythms of the s-LNvs, particularly the circadian rhythms in PDF accumulation and axonal arbor remodeling. These results establish a second pathway by which UNF interacts with the molecular clocks in the s-LNvs and highlight the mechanistic differences in the molecular clockwork within the pacemaker circuit. SIGNIFICANCE STATEMENT Circadian behavior is generated by a pacemaker circuit comprising diverse classes of pacemaker neurons, each of which contains a molecular clock. In addition to the anatomical and functional diversity, recent studies have shown the mechanistic differences in the molecular clockwork among the pacemaker neurons in Drosophila Here, we identified the molecular characteristics

Borderline personality disorder and the emerging field of developmental neuroscience.

PubMed

Crowell, Sheila E; Kaufman, Erin A

2016-10-01

Over the past 2 decades there has been a dramatic shift in understanding of personality disorders, such as borderline personality disorder (BPD). What was historically viewed as an entrenched pattern of antagonistic, interpersonally dependent, and uncorrectable conduct is now seen as the outcome of complex-yet modifiable-developmental processes. The borderline label, which once inspired such harsh opprobrium in clinical communities that early diagnosis was considered taboo, is now increasingly applied to adolescents who are receiving effective treatment and desisting from a borderline trajectory. Research examining the developmental origins and early manifestations of BPD is increasing rapidly, making it an appropriate time to take stock of current developmental research and articulate an agenda for the future. We identify 4 challenges that continue to impede innovative research on borderline personality development: (a) inadequate attention to continuity and discontinuity across development, (b) medical and diagnostic systems that localize personality pathology within the individual, (c) the lingering belief that biological research is antithetical to contextual/interpersonal understandings of psychopathology (and vice versa), and (d) reluctance to reach across disciplinary and developmental boundaries to identify creative paradigms and foster innovative discovery. In order to overcome these challenges, we propose an approach to future research on adolescent borderline pathology that integrates developmental psychopathology, social and affective neuroscience, and personality theory perspectives. This intersection-the developmental neuroscience of personality pathology-offers theoretical and methodological advantages over disciplinary isolation and is fertile ground for generating novel hypotheses on the development and prevention of BPD. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Proteomic Analysis of Grape Berry Cell Cultures Reveals that Developmentally Regulated Ripening Related Processes Can Be Studied Using Cultured Cells

PubMed Central

Sharathchandra, Ramaschandra G.; Stander, Charmaine; Jacobson, Dan; Ndimba, Bongani; Vivier, Melané A.

2011-01-01

Background This work describes a proteomics profiling method, optimized and applied to berry cell suspensions to evaluate organ-specific cultures as a platform to study grape berry ripening. Variations in berry ripening within a cluster(s) on a vine and in a vineyard are a major impediment towards complete understanding of the functional processes that control ripening, specifically when a characterized and homogenous sample is required. Berry cell suspensions could overcome some of these problems, but their suitability as a model system for berry development and ripening needs to be established first. Methodology/Principal Findings In this study we report on the proteomic evaluation of the cytosolic proteins obtained from synchronized cell suspension cultures that were established from callus lines originating from green, véraison and ripe Vitis vinifera berry explants. The proteins were separated using liquid phase IEF in a Microrotofor cell and SDS PAGE. This method proved superior to gel-based 2DE. Principal component analysis confirmed that biological and technical repeats grouped tightly and importantly, showed that the proteomes of berry cultures originating from the different growth/ripening stages were distinct. A total of twenty six common bands were selected after band matching between different growth stages and twenty two of these bands were positively identified. Thirty two % of the identified proteins are currently annotated as hypothetical. The differential expression profile of the identified proteins, when compared with published literature on grape berry ripening, suggested common trends in terms of relative abundance in the different developmental stages between real berries and cell suspensions. Conclusions The advantages of having suspension cultures that accurately mimic specific developmental stages are profound and could significantly contribute to the study of the intricate regulatory and signaling networks responsible for berry

Integrated genomic approaches identify major pathways and upstream regulators in late onset Alzheimer’s disease

PubMed Central

Li, Xinzhong; Long, Jintao; He, Taigang; Belshaw, Robert; Scott, James

2015-01-01

Previous studies have evaluated gene expression in Alzheimer’s disease (AD) brains to identify mechanistic processes, but have been limited by the size of the datasets studied. Here we have implemented a novel meta-analysis approach to identify differentially expressed genes (DEGs) in published datasets comprising 450 late onset AD (LOAD) brains and 212 controls. We found 3124 DEGs, many of which were highly correlated with Braak stage and cerebral atrophy. Pathway Analysis revealed the most perturbed pathways to be (a) nitric oxide and reactive oxygen species in macrophages (NOROS), (b) NFkB and (c) mitochondrial dysfunction. NOROS was also up-regulated, and mitochondrial dysfunction down-regulated, in healthy ageing subjects. Upstream regulator analysis predicted the TLR4 ligands, STAT3 and NFKBIA, for activated pathways and RICTOR for mitochondrial genes. Protein-protein interaction network analysis emphasised the role of NFKB; identified a key interaction of CLU with complement; and linked TYROBP, TREM2 and DOK3 to modulation of LPS signalling through TLR4 and to phosphatidylinositol metabolism. We suggest that NEUROD6, ZCCHC17, PPEF1 and MANBAL are potentially implicated in LOAD, with predicted links to calcium signalling and protein mannosylation. Our study demonstrates a highly injurious combination of TLR4-mediated NFKB signalling, NOROS inflammatory pathway activation, and mitochondrial dysfunction in LOAD. PMID:26202100

Developmental regulation of N-methyl-D-aspartate- and kainate-type glutamate receptor expression in the rat spinal cord

NASA Technical Reports Server (NTRS)

Stegenga, S. L.; Kalb, R. G.

2001-01-01

Spinal motor neurons undergo experience-dependent development during a critical period in early postnatal life. It has been suggested that the repertoire of glutamate receptor subunits differs between young and mature motor neurons and contributes to this activity-dependent development. In the present study we examined the expression patterns of N-methyl-D-aspartate- and kainate-type glutamate receptor subunits during the postnatal maturation of the spinal cord. Young motor neurons express much higher levels of the N-methyl-D-aspartate receptor subunit NR1 than do adult motor neurons. Although there are eight potential splice variants of NR1, only a subgroup is expressed by motor neurons. With respect to NR2 receptor subunits, young motor neurons express NR2A and C, while adult motor neurons express only NR2A. Young motor neurons express kainate receptor subunits GluR5, 6 and KA2 but we are unable to detect these or any other kainate receptor subunits in the adult spinal cord. Other spinal cord regions display a distinct pattern of developmental regulation of N-methyl-D-aspartate and kainate receptor subunit expression in comparison to motor neurons. Our findings indicate a precise spatio-temporal regulation of individual subunit expression in the developing spinal cord. Specific combinations of subunits in developing neurons influence their excitable properties and could participate in the emergence of adult neuronal form and function.

Plasmodesmal regulation during plant-pathogen interactions.

PubMed

Cheval, Cecilia; Faulkner, Christine

2018-01-01

Contents Summary 62 I. Introduction 62 II. Plasmodesmal regulation is an innate defence response 63 III. Reactive oxygen species regulate plasmodesmal function 63 IV. Plasmodesmal regulation by and of defence-associated small molecules 64 V. Plasmodesmata facilitate systemic defence signalling 64 VI. Virulent pathogens exploit plasmodesmata 66 VII. Outlook 66 Acknowledgements 66 References 66 SUMMARY: Plasmodesmata (PD) are plasma membrane-lined pores that connect neighbouring plant cells, bridging the cell wall and establishing cytoplasmic and membrane continuity between cells. PD are dynamic structures regulated by callose deposition in a variety of stress and developmental contexts. This process crudely controls the aperture of the pore and thus the flux of molecules between cells. During pathogen infection, plant cells initiate a range of immune responses and it was recently identified that, following perception of fungal and bacterial pathogens, plant cells initially close their PD. Systemic defence responses depend on the spread of signals between cells, raising questions about whether PD are in different functional states during different immune responses. It is well established that viral pathogens exploit PD to spread between cells, but it has more recently been identified that protein effectors secreted by fungal pathogens can spread between host cells via PD. It is possible that many classes of pathogens specifically target PD to aid infection, which would infer antagonistic regulation of PD by host and pathogen. How PD regulation benefits both host immune responses and pathogen infection is an important question and demands that we examine the multicellular nature of plant-pathogen interactions. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Developmental Programming Mediated by Complementary Roles of Imprinted Grb10 in Mother and Pup

PubMed Central

Cowley, Michael; Garfield, Alastair S.; Madon-Simon, Marta; Charalambous, Marika; Clarkson, Richard W.; Smalley, Matthew J.; Kendrick, Howard; Isles, Anthony R.; Parry, Aled J.; Carney, Sara; Oakey, Rebecca J.; Heisler, Lora K.; Moorwood, Kim; Wolf, Jason B.; Ward, Andrew

2014-01-01

Developmental programming links growth in early life with health status in adulthood. Although environmental factors such as maternal diet can influence the growth and adult health status of offspring, the genetic influences on this process are poorly understood. Using the mouse as a model, we identify the imprinted gene Grb10 as a mediator of nutrient supply and demand in the postnatal period. The combined actions of Grb10 expressed in the mother, controlling supply, and Grb10 expressed in the offspring, controlling demand, jointly regulate offspring growth. Furthermore, Grb10 determines the proportions of lean and fat tissue during development, thereby influencing energy homeostasis in the adult. Most strikingly, we show that the development of normal lean/fat proportions depends on the combined effects of Grb10 expressed in the mother, which has the greater effect on offspring adiposity, and Grb10 expressed in the offspring, which influences lean mass. These distinct functions of Grb10 in mother and pup act complementarily, which is consistent with a coadaptation model of imprinting evolution, a model predicted but for which there is limited experimental evidence. In addition, our findings identify Grb10 as a key genetic component of developmental programming, and highlight the need for a better understanding of mother-offspring interactions at the genetic level in predicting adult disease risk. PMID:24586114

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

PubMed Central

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

Adaptive developmental delay in Chagas disease vectors: an evolutionary ecology approach.

PubMed

Menu, Frédéric; Ginoux, Marine; Rajon, Etienne; Lazzari, Claudio R; Rabinovich, Jorge E

2010-05-25

The developmental time of vector insects is important in population dynamics, evolutionary biology, epidemiology and in their responses to global climatic change. In the triatomines (Triatominae, Reduviidae), vectors of Chagas disease, evolutionary ecology concepts, which may allow for a better understanding of their biology, have not been applied. Despite delay in the molting in some individuals observed in triatomines, no effort was made to explain this variability. We applied four methods: (1) an e-mail survey sent to 30 researchers with experience in triatomines, (2) a statistical description of the developmental time of eleven triatomine species, (3) a relationship between development time pattern and climatic inter-annual variability, (4) a mathematical optimization model of evolution of developmental delay (diapause). 85.6% of responses informed on prolonged developmental times in 5(th) instar nymphs, with 20 species identified with remarkable developmental delays. The developmental time analysis showed some degree of bi-modal pattern of the development time of the 5(th) instars in nine out of eleven species but no trend between development time pattern and climatic inter-annual variability was observed. Our optimization model predicts that the developmental delays could be due to an adaptive risk-spreading diapause strategy, only if survival throughout the diapause period and the probability of random occurrence of "bad" environmental conditions are sufficiently high. Developmental delay may not be a simple non-adaptive phenotypic plasticity in development time, and could be a form of adaptive diapause associated to a physiological mechanism related to the postponement of the initiation of reproduction, as an adaptation to environmental stochasticity through a spreading of risk (bet-hedging) strategy. We identify a series of parameters that can be measured in the field and laboratory to test this hypothesis. The importance of these findings is discussed in

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

PubMed Central

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

Square cell packing in the Drosophila embryo through spatiotemporally regulated EGF receptor signaling

PubMed Central

Tamada, Masako; Zallen, Jennifer A.

2015-01-01

Summary Cells display dynamic and diverse morphologies during development, but the strategies by which differentiated tissues achieve precise shapes and patterns are not well understood. Here we identify a developmental program that generates a highly ordered square cell grid in the Drosophila embryo through sequential and spatially regulated cell alignment, oriented cell division, and apicobasal cell elongation. The basic leucine zipper transcriptional regulator Cnc is necessary and sufficient to produce a square cell grid in the presence of a midline signal provided by the EGF receptor ligand, Spitz. Spitz orients cell divisions through a Pins/LGN-dependent spindle positioning mechanism and controls cell shape and alignment through a transcriptional pathway that requires the Pointed ETS domain protein. These results identify a strategy for producing ordered square cell packing configurations in epithelia and reveal a molecular mechanism by which organized tissue structure is generated through spatiotemporally regulated responses to EGF receptor activation. PMID:26506305

Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

PubMed

Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

2016-01-01

Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators

Building clinical networks: a developmental evaluation framework.

PubMed

Carswell, Peter; Manning, Benjamin; Long, Janet; Braithwaite, Jeffrey

2014-05-01

Clinical networks have been designed as a cross-organisational mechanism to plan and deliver health services. With recent concerns about the effectiveness of these structures, it is timely to consider an evidence-informed approach for how they can be developed and evaluated. To document an evaluation framework for clinical networks by drawing on the network evaluation literature and a 5-year study of clinical networks. We searched literature in three domains: network evaluation, factors that aid or inhibit network development, and on robust methods to measure network characteristics. This material was used to build a framework required for effective developmental evaluation. The framework's architecture identifies three stages of clinical network development; partner selection, network design and network management. Within each stage is evidence about factors that act as facilitators and barriers to network growth. These factors can be used to measure progress via appropriate methods and tools. The framework can provide for network growth and support informed decisions about progress. For the first time in one place a framework incorporating rigorous methods and tools can identify factors known to affect the development of clinical networks. The target user group is internal stakeholders who need to conduct developmental evaluation to inform key decisions along their network's developmental pathway.

Child Health, Developmental Plasticity, and Epigenetic Programming

PubMed Central

Feil, R.; Constancia, M.; Fraga, M.; Junien, C.; Carel, J.-C.; Boileau, P.; Le Bouc, Y.; Deal, C. L.; Lillycrop, K.; Scharfmann, R.; Sheppard, A.; Skinner, M.; Szyf, M.; Waterland, R. A.; Waxman, D. J.; Whitelaw, E.; Ong, K.; Albertsson-Wikland, K.

2011-01-01

Plasticity in developmental programming has evolved in order to provide the best chances of survival and reproductive success to the organism under changing environments. Environmental conditions that are experienced in early life can profoundly influence human biology and long-term health. Developmental origins of health and disease and life-history transitions are purported to use placental, nutritional, and endocrine cues for setting long-term biological, mental, and behavioral strategies in response to local ecological and/or social conditions. The window of developmental plasticity extends from preconception to early childhood and involves epigenetic responses to environmental changes, which exert their effects during life-history phase transitions. These epigenetic responses influence development, cell- and tissue-specific gene expression, and sexual dimorphism, and, in exceptional cases, could be transmitted transgenerationally. Translational epigenetic research in child health is a reiterative process that ranges from research in the basic sciences, preclinical research, and pediatric clinical research. Identifying the epigenetic consequences of fetal programming creates potential applications in clinical practice: the development of epigenetic biomarkers for early diagnosis of disease, the ability to identify susceptible individuals at risk for adult diseases, and the development of novel preventive and curative measures that are based on diet and/or novel epigenetic drugs. PMID:20971919

Pharmacotherapy in the Developmental Disabilities: New Developments.

ERIC Educational Resources Information Center

Aman, Michael G.

1991-01-01

This paper identifies and evaluates emerging developments in the behavioral pharmacotherapy of people with developmental disabilities, including such medications as the opiate antagonists, fenfluramine, beta adrenergic blockers, buspirone, antipsychotics, amantadine hydrochloride, and antilibidinal drugs. The need for more well-designed drug…

Developmental Regulation of p66Shc Is Altered by Bronchopulmonary Dysplasia in Baboons and Humans

PubMed Central

Lee, Matt K.; Pryhuber, Gloria S.; Schwarz, Margaret A.; Smith, Susan M.; Pavlova, Zdena; Sunday, Mary E.

2005-01-01

Rationale: The p66Shc adapter protein antagonizes mitogen-activated protein, or MAP, kinase, mediates oxidative stress, and is developmentally regulated in fetal mouse lungs. Objectives: To determine if p66Shc is similarly regulated in primates and in bronchopulmonary dysplasia (BPD), which results from oxidative injury to immature lungs. Methods: Normal and injured lungs from humans and baboons were evaluated by Western analysis and immunohistochemistry. Measurements and Main Results: In baboons, p66Shc decreased 80% between 125 and 175 days' gestation (p = 0.025), then doubled after term delivery at 185 days (p = 0.0013). In the hyperoxic 140-day fetal baboon BPD model, p66Shc expression persisted, and its localization shifted from the epithelium of gestational controls to the mesenchyme of diseased lungs, coincident with expression of proliferating cell nuclear antigen and cleaved poly(adenyl ribose) polymerase, a marker of apoptosis. Treatment with the antibombesin antibody 2A11 attenuated BPD, reduced cell proliferation, increased p66Shc expression 10.5-fold, and preserved epithelial p66Shc localization. p66Shc also decreased during normal human lung development, falling 87% between 18 and 24 weeks' gestation (p = 0.02). p66Shc was expressed throughout 18-week human lungs, became restricted to scattered epithelial cells by 24 weeks, and localized to isolated mesenchymal cells after term delivery. In contrast, p66Shc remained prominent in the epithelium of lungs with acute injury or mild BPD, and in the mesenchyme of lungs with severe disease. p66Shc localized to tissues expressing proliferating cell nuclear antigen and cleaved poly(adenyl ribose) polymerase. Conclusions: p66Shc expression, cell proliferation, and apoptosis are concomitantly altered during lung development and in BPD. PMID:15778491

Using Administrative Health Data to Identify Individuals with Intellectual and Developmental Disabilities: A Comparison of Algorithms

ERIC Educational Resources Information Center

Lin, E.; Balogh, R.; Cobigo, V.; Ouellette-Kuntz, H.; Wilton, A. S.; Lunsky, Y.

2013-01-01

Background: Individuals with intellectual and developmental disabilities (IDD) experience high rates of physical and mental health problems; yet their health care is often inadequate. Information about their characteristics and health services needs is critical for planning efficient and equitable services. A logical source of such information is…

Repression of cell proliferation by miR319-regulated TCP4.

PubMed

Schommer, Carla; Debernardi, Juan M; Bresso, Edgardo G; Rodriguez, Ramiro E; Palatnik, Javier F

2014-10-01

Leaf development has been extensively studied on a genetic level. However, little is known about the interplay between the developmental regulators and the cell cycle machinery--a link that ultimately affects leaf form and size. miR319 is a conserved microRNA that regulates TCP transcription factors involved in multiple developmental pathways, including leaf development and senescence, organ curvature, and hormone biosynthesis and signaling. Here, we analyze the participation of TCP4 in the control of cell proliferation. A small increase in TCP4 activity has an immediate impact on leaf cell number, by significantly reducing cell proliferation. Plants with high TCP4 levels have a strong reduction in the expression of genes known to be active in G2-M phase of the cell cycle. Part of these effects is mediated by induction of miR396, which represses Growth-Regulating Factor (GRF) transcription factors. Detailed analysis revealed TCP4 to be a direct regulator of MIR396b. However, we found that TCP4 can control cell proliferation through additional pathways, and we identified a direct connection between TCP4 and ICK1/KRP1, a gene involved in the progression of the cell cycle. Our results show that TCP4 can activate different pathways that repress cell proliferation. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

Tbx16 regulates hox gene activation in mesodermal progenitor cells

PubMed Central

Payumo, Alexander Y.; McQuade, Lindsey E.; Walker, Whitney J.; Yamazoe, Sayumi; Chen, James K.

2016-01-01

The transcription factor T-box 16 (Tbx16/Spadetail) is an essential regulator of paraxial mesoderm development in zebrafish (Danio rerio). Mesodermal progenitor cells (MPCs) fail to differentiate into trunk somites in tbx16 mutants and instead accumulate within the tailbud in an immature state. The mechanisms by which Tbx16 controls mesoderm patterning have remained enigmatic, and we describe here the application of photoactivatable morpholino oligonucleotides to determine the Tbx16 transcriptome in MPCs. We identify 124 Tbx16-regulated genes that are expressed in zebrafish gastrulae, including several developmental signaling proteins and regulators of gastrulation, myogenesis, and somitogenesis. Unexpectedly, we observe that loss of Tbx16 function precociously activates posterior hox genes in MPCs, and overexpression of a single posterior hox gene is sufficient to disrupt MPC migration. Our studies support a model in which Tbx16 regulates the timing of collinear hox gene activation to coordinate the anterior-posterior fates and positions of paraxial MPCs. PMID:27376691

Developmental Screening

MedlinePlus

Learn More about Your Child’s Development: Developmental Monitoring and Screening Taking a first step, waving “bye-bye,” and pointing to something interesting are all developmental milestones, ...

Disparities in Unmet Service Needs Among Adults with Intellectual and Other Developmental Disabilities.

PubMed

Burke, Meghan M; Heller, Tamar

2017-09-01

Due to long waiting lists for services, many adults with intellectual and developmental disabilities in the United States have unmet service needs. Little research, however, has identified the characteristics of caregivers and individuals with intellectual and developmental disabilities that relate to the unmet service needs among individuals who are waiting for services. The present authors conducted a statewide mail survey of 234 caregivers of individuals with intellectual and developmental disabilities who were waiting for services. The present authors identified which parent and individual with intellectual and developmental disability characteristics were significantly associated with the number of unmet service needs. Individuals with intellectual and developmental disabilities who were in poor health, from minority backgrounds and non-verbal were significantly more likely to have a greater number of unmet service needs. Additionally, individuals with younger caregivers and individuals with caregivers from low-income backgrounds were significantly more likely to report a greater number of unmet service needs. Implications for research and policy are discussed. © 2016 John Wiley & Sons Ltd.

Developmental Programming, a Pathway to Disease

PubMed Central

Cardoso, Rodolfo C.; Puttabyatappa, Muraly

2016-01-01

Accumulating evidence suggests that insults occurring during the perinatal period alter the developmental trajectory of the fetus/offspring leading to long-term detrimental outcomes that often culminate in adult pathologies. These perinatal insults include maternal/fetal disease states, nutritional deficits/excess, stress, lifestyle choices, exposure to environmental chemicals, and medical interventions. In addition to reviewing the various insults that contribute to developmental programming and the benefits of animal models in addressing underlying mechanisms, this review focuses on the commonalities in disease outcomes stemming from various insults, the convergence of mechanistic pathways via which various insults can lead to common outcomes, and identifies the knowledge gaps in the field and future directions. PMID:26859334

Integrative Analysis of DNA Methylation and Gene Expression Data Identifies EPAS1 as a Key Regulator of COPD

PubMed Central

Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Feronjy, Robert; Spira, Avrum; Schadt, Eric E.; Powell, Charles A.; Zhu, Jun

2015-01-01

Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a ‘causal’ role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology. PMID:25569234

Integrative analysis of DNA methylation and gene expression data identifies EPAS1 as a key regulator of COPD.

PubMed

Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Foronjy, Robert F; Feronjy, Robert; Spira, Avrum; Schadt, Eric E; Powell, Charles A; Zhu, Jun

2015-01-01

Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a 'causal' role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology.

Genetic Diversity Influences the Response of the Brain to Developmental Lead Exposure

PubMed Central

Schneider, Jay S.; Talsania, Keyur; Mettil, William; Anderson, David W.

2014-01-01

Although extrinsic factors, such as nutritional status, and some intrinsic genetic factors may modify susceptibility to developmental lead (Pb) poisoning, no studies have specifically examined the influence of genetic background on outcomes from Pb exposure. In this study, we used gene microarray profiling to identify Pb-responsive genes in rats of different genetic backgrounds, including inbred (Fischer 344 (F344)) and outbred (Long Evans (LE), Sprague Dawley (SD)) strains, to investigate the role that genetic variation may play in influencing outcomes from developmental Pb exposure. Male and female animals received either perinatal (gestation through lactation) or postnatal (birth through weaning) exposure to Pb in food (0, 250, or 750 ppm). RNA was extracted from the hippocampus at day 55 and hybridized to Affymetrix Rat Gene 1.0 ST Arrays. There were significant strain-specific effects of Pb on the hippocampal transcriptome with 978 transcripts differentially expressed in LE rats across all experimental groups, 269 transcripts differentially expressed in F344 rats, and only 179 transcripts differentially expressed in SD rats. These results were not due to strain-related differences in brain accumulation of Pb. Further, no genes were consistently differentially regulated in all experimental conditions. There was no set of “Pb toxicity” genes that are a molecular signature for Pb neurotoxicity that transcended sex, exposure condition, and strain. These results demonstrate the influence that strain and genetic background play in modifying the brain's response to developmental Pb exposure and may have relevance for better understanding the molecular underpinnings of the lack of a neurobehavioral signature in childhood Pb poisoning. PMID:24913800

Correlational analysis for identifying genes whose regulation contributes to chronic neuropathic pain

PubMed Central

Persson, Anna-Karin; Gebauer, Mathias; Jordan, Suzana; Metz-Weidmann, Christiane; Schulte, Anke M; Schneider, Hans-Christoph; Ding-Pfennigdorff, Danping; Thun, Jonas; Xu, Xiao-Jun; Wiesenfeld-Hallin, Zsuzsanna; Darvasi, Ariel; Fried, Kaj; Devor, Marshall

2009-01-01

Background Nerve injury-triggered hyperexcitability in primary sensory neurons is considered a major source of chronic neuropathic pain. The hyperexcitability, in turn, is thought to be related to transcriptional switching in afferent cell somata. Analysis using expression microarrays has revealed that many genes are regulated in the dorsal root ganglion (DRG) following axotomy. But which contribute to pain phenotype versus other nerve injury-evoked processes such as nerve regeneration? Using the L5 spinal nerve ligation model of neuropathy we examined differential changes in gene expression in the L5 (and L4) DRGs in five mouse strains with contrasting susceptibility to neuropathic pain. We sought genes for which the degree of regulation correlates with strain-specific pain phenotype. Results In an initial experiment six candidate genes previously identified as important in pain physiology were selected for in situ hybridization to DRG sections. Among these, regulation of the Na+ channel α subunit Scn11a correlated with levels of spontaneous pain behavior, and regulation of the cool receptor Trpm8 correlated with heat hypersensibility. In a larger scale experiment, mRNA extracted from individual mouse DRGs was processed on Affymetrix whole-genome expression microarrays. Overall, 2552 ± 477 transcripts were significantly regulated in the axotomized L5DRG 3 days postoperatively. However, in only a small fraction of these was the degree of regulation correlated with pain behavior across strains. Very few genes in the "uninjured" L4DRG showed altered expression (24 ± 28). Conclusion Correlational analysis based on in situ hybridization provided evidence that differential regulation of Scn11a and Trpm8 contributes to across-strain variability in pain phenotype. This does not, of course, constitute evidence that the others are unrelated to pain. Correlational analysis based on microarray data yielded a larger "look-up table" of genes whose regulation likely

Mixed Integer Linear Programming based machine learning approach identifies regulators of telomerase in yeast.

PubMed

Poos, Alexandra M; Maicher, André; Dieckmann, Anna K; Oswald, Marcus; Eils, Roland; Kupiec, Martin; Luke, Brian; König, Rainer

2016-06-02

Understanding telomere length maintenance mechanisms is central in cancer biology as their dysregulation is one of the hallmarks for immortalization of cancer cells. Important for this well-balanced control is the transcriptional regulation of the telomerase genes. We integrated Mixed Integer Linear Programming models into a comparative machine learning based approach to identify regulatory interactions that best explain the discrepancy of telomerase transcript levels in yeast mutants with deleted regulators showing aberrant telomere length, when compared to mutants with normal telomere length. We uncover novel regulators of telomerase expression, several of which affect histone levels or modifications. In particular, our results point to the transcription factors Sum1, Hst1 and Srb2 as being important for the regulation of EST1 transcription, and we validated the effect of Sum1 experimentally. We compiled our machine learning method leading to a user friendly package for R which can straightforwardly be applied to similar problems integrating gene regulator binding information and expression profiles of samples of e.g. different phenotypes, diseases or treatments. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae).

PubMed

Chen, Juan; Liu, Si Si; Kohler, Annegret; Yan, Bo; Luo, Hong Mei; Chen, Xiao Mei; Guo, Shun Xing

2017-06-02

Mycorrhizal fungi colonize orchid seeds and induce germination. This so-called symbiotic germination is a critical developmental process in the lifecycle of all orchid species. However, the molecular changes that occur during orchid seed symbiotic germination remain largely unknown. To better understand the molecular mechanism of orchid seed germination, we performed a comparative transcriptomic and proteomic analysis of the Chinese traditional medicinal orchid Dendrobium officinale to explore the change in protein expression at the different developmental stages during asymbiotic and symbiotic germination and identify the key proteins that regulate the symbiotic germination of orchid seeds. Among 2256 identified plant proteins, 308 were differentially expressed across three developmental stages during asymbiotic and symbiotic germination, and 229 were differentially expressed during symbiotic germination compared to asymbiotic development. Of these, 32 proteins were coup-regulated at both the proteomic and transcriptomic levels during symbiotic germination compared to asymbiotic germination. Our results suggest that symbiotic germination of D. officinale seeds shares a common signaling pathway with asymbiotic germination during the early germination stage. However, compared to asymbiotic germination, fungal colonization of orchid seeds appears to induce higher and earlier expression of some key proteins involved in lipid and carbohydrate metabolism and thus improves the efficiency of utilization of stored substances present in the embryo. This study provides new insight into the molecular basis of orchid seed germination.

The AtRbx1 protein is part of plant SCF complexes, and its down-regulation causes severe growth and developmental defects.

PubMed

Lechner, Esther; Xie, Daoxin; Grava, Sandrine; Pigaglio, Emmanuelle; Planchais, Severine; Murray, James A H; Parmentier, Yves; Mutterer, Jerome; Dubreucq, Bertrand; Shen, Wen-Hui; Genschik, Pascal

2002-12-20

Recently in yeast and animal cells, one particular class of ubiquitin ligase (E3), called the SCF, was demonstrated to regulate diverse processes including cell cycle and development. In plants SCF-dependent proteolysis is also involved in different developmental and hormonal regulations. To further investigate the function of SCF, we characterized at the molecular level the Arabidopsis RING-H2 finger protein AtRbx1. We demonstrated that the plant gene is able to functionally complement a yeast knockout mutant strain and showed that AtRbx1 protein interacts physically with at least two members of the Arabidopsis cullin family (AtCul1 and AtCul4). AtRbx1 also associates with AtCul1 and the Arabidopsis SKP1-related proteins in planta, indicating that it is part of plant SCF complexes. AtRbx1 mRNAs accumulate in various tissues of the plant, but at higher levels in tissues containing actively dividing cells. Finally to study the function of the gene in planta, we either overexpressed AtRbx1 or reduced its expression by a dsRNA strategy. Down-regulation of AtRbx1 impaired seedling growth and development, indicating that the gene is essential in plants. Furthermore, the AtRbx1-silenced plants showed a reduced level of AtCul1 protein, but accumulated higher level of cyclin D3.

Developmental regulation of P-glycoprotein activity within thymocytes results in increased anti-HIV protease inhibitor activity.

PubMed

Haraguchi, Soichi; Ho, Sarah K; Morrow, Matthew; Goodenow, Maureen M; Sleasman, John W

2011-10-01

The thymus harbors HIV-1 and supports its replication. Treatment with PI-containing ART restores thymic output of naïve T cells. This study demonstrates that CXCR4-using WT viruses are more sensitive to PI in fetal thymcocytes than mature T cells with average IC(50) values for two PIs, RTV and IDV, of 1.5 nM (RTV) and 4.4 nM (IDV) in thymocytes versus 309.4 nM (RTV) and 27.3 nM (IDV) in mature T cells. P-gp activity, as measured using Rh123 efflux and quantitation of P-gp mRNA, increased with thymocyte maturation into CD4 and CD8 lineage T cells. P-gp activity is developmentally regulated in the thymus. Thymocytes developed increased levels of P-gp activity as maturation from DP to SP CD4 or CD8 T cells occurred, although CD4 T cells acquired activity more rapidly. Reduced P-gp activity in thymocytes is one mechanism for effectiveness of PI therapy in suppressing viral replication in the thymus and in reconstitution of naïve T cells, particularly among children receiving PI-containing ART.

Developmental Programming: State-of-the-Science and Future Directions

PubMed Central

Sutton, Elizabeth F.; Gilmore, L. Anne; Dunger, David B.; Heijmans, Bas T.; Hivert, Marie-France; Ling, Charlotte; Martinez, J. Alfredo; Ozanne, Susan E.; Simmons, Rebecca A.; Szyf, Moshe; Waterland, Robert A.; Redman, Leanne M.; Ravussin, Eric

2016-01-01

Objective On December 8–9, 2014, the Pennington Biomedical Research Center convened a scientific symposium to review the state-of-the-science and future directions for the study of developmental programming of obesity and chronic disease. The objectives of the symposium were to discuss: (i) past and current scientific advances in animal models, population-based cohort studies and human clinical trials, (ii) the state-of-the-science of epigenetic-based research, and (iii) considerations for future studies. Results The overarching goal was to provide a comprehensive assessment of the state of the scientific field, to identify research gaps and opportunities for future research in order to identify and understand the mechanisms contributing to the developmental programming of health and disease. Conclusions Identifying the mechanisms which cause or contribute to developmental programming of future generations will be invaluable to the scientific and medical community. The ability to intervene during critical periods of prenatal and early postnatal life to promote lifelong health is the ultimate goal. Considerations for future research including the use of animal models, the study design in human cohorts with considerations about the timing of the intrauterine exposure and the resulting tissue specific epigenetic signature were extensively discussed and are presented in this meeting summary. PMID:27037645

Developmental effects of antiepileptic drugs and the need for improved regulations

PubMed Central

Loring, David W.

2016-01-01

Antiepileptic drugs (AEDs) are among the most common teratogenic drugs prescribed to women of childbearing age. AEDs can induce both anatomical (malformations) and behavioral (cognitive/behavioral deficits) teratogenicity. Only in the last decade have we begun to truly discriminate differential AED developmental effects. Fetal valproate exposure carries a special risk for both anatomical and behavioral teratogenic abnormalities, but the mechanisms and reasons for individual variability are unknown. Intermediate anatomical risks exist for phenobarbital and topiramate. Several AEDs (e.g., lamotrigine and levetiracetam) appear to possess low risks for both anatomical and behavioral teratogenesis. Despite advances in the past decade, our knowledge of the teratogenic risks for most AEDs and the underlying mechanisms remain inadequate. Further, the long-term effects of AEDs in neonates and older children remain uncertain. The pace of progress is slow given the lifelong consequences of diminished developmental outcomes, exposing children unnecessarily to potential adverse effects. It is imperative that new approaches be employed to determine risks more expediently. Our recommendations include a national reporting system for congenital malformations, federal funding of the North American AED Pregnancy Registry, routine meta-analyses of cohort studies to detect teratogenic signals, monitoring of AED prescription practices for women, routine preclinical testing of all new AEDs for neurodevelopmental effects, more specific Food and Drug Administration requirements to establish differential AED cognitive effects in children, and improved funding of basic and clinical research to fully delineate risks and underlying mechanisms for AED-induced anatomical and behavioral teratogenesis. PMID:26519545