Developmental model of static allometry in holometabolous insects.

PubMed

Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W

2008-08-22

The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.

Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

NASA Astrophysics Data System (ADS)

Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

2017-07-01

In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

The let-7 microRNA interfaces extensively with the translation machinery to regulate cell differentiation

PubMed Central

Ding, Xavier C.; Slack, Frank J.; Großhans, Helge

2010-01-01

MicroRNAs (miRNAs) are noncoding RNAs that regulate numerous target genes through a posttranscriptional mechanism and thus control major developmental pathways. The phylogenetically conserved let-7 miRNA regulates cell proliferation and differentiation, thus functioning as a key regulator of developmental timing in C. elegans and a tumor suppressor gene in humans. Using a reverse genetic screen, we have identified genetic interaction partners of C. elegans let-7, including known and novel potential target genes. Initial identification of several translation initiation factors as suppressors of a let-7 mutation led us to systematically examine genetic interaction between let-7 and the translational machinery, which we found to be widespread. In the presence of wild-type let-7, depletion of the translation initiation factor eIF3 resulted in precocious cell differentiation, suggesting that developmental timing is translationally regulated, possibly by let-7. As overexpression of eIF3 in humans promotes translation of mRNAs that are also targets of let-7-mediated repression, we suggest that eIF3 may directly or indirectly oppose let-7 activity. This might provide an explanation for the opposite functions of let-7 and eIF3 in regulating tumorigenesis. PMID:18818519

Abscisic Acid Synthesis and Response

PubMed Central

Finkelstein, Ruth

2013-01-01

Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

PubMed

Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

2017-10-01

Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

PubMed

Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

2018-02-13

With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

PubMed Central

Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

2006-01-01

Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells.

PubMed

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A; Engel, Felix B; Yamashita, Jun K

2013-12-01

The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provides therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells. The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse pluripotent stem cell-derived cardiomyocytes and identified 4 chemical compound groups: inhibitors of glycogen synthase kinase-3, p38 mitogen-activated protein kinase, and Ca(2+)/calmodulin-dependent protein kinase II, and activators of extracellular signal-regulated kinase. Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human pluripotent stem cells, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas extracellular signal-regulated kinase activators and Ca(2+)/calmodulin-dependent protein kinase II inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, glycogen synthase kinase-3 and p38 mitogen-activated protein kinase inhibitors substantially and synergistically induced re-entry and progression of cell cycle in neonatal but also as well as adult cardiomyocytes. Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered pluripotent stem cell-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies.

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

PubMed

Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

2013-10-01

Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

PubMed Central

Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies. PMID:23145190

RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

PubMed

Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

2012-01-01

The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies.

Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

PubMed

Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

2014-10-01

In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

Neuropeptides: Developmental Signals in Placode Progenitor Formation

PubMed Central

Lleras-Forero, Laura; Tambalo, Monica; Christophorou, Nicolas; Chambers, David; Houart, Corinne; Streit, Andrea

2013-01-01

Summary Few families of signaling factors have been implicated in the control of development. Here, we identify the neuropeptides nociceptin and somatostatin, a neurotransmitter and neuroendocrine hormone, as a class of developmental signals in both chick and zebrafish. We show that signals from the anterior mesendoderm are required for the formation of anterior placode progenitors, with one of the signals being somatostatin. Somatostatin controls ectodermal expression of nociceptin, and both peptides regulate Pax6 in lens and olfactory progenitors. Consequently, loss of somatostatin and nociceptin signaling leads to severe reduction of lens formation. Our findings not only uncover these neuropeptides as developmental signals but also identify a long-sought-after mechanism that initiates Pax6 in placode progenitors and may explain the ancient evolutionary origin of neuropeptides, predating a complex nervous system. PMID:23906067

MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

PubMed Central

Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

2013-01-01

Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

45 CFR 1385.2 - Purpose of the regulations.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

Systematic identification of genes involved in divergent skeletal muscle growth rates of broiler and layer chickens.

PubMed

Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai

2009-02-22

The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.

A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.

PubMed

Neal, Scott J; Park, JiSoo; DiTirro, Danielle; Yoon, Jason; Shibuya, Mayumi; Choi, Woochan; Schroeder, Frank C; Butcher, Rebecca A; Kim, Kyuhyung; Sengupta, Piali

2016-05-03

Animals must constantly assess their surroundings and integrate sensory cues to make appropriate behavioral and developmental decisions. Pheromones produced by conspecific individuals provide critical information regarding environmental conditions. Ascaroside pheromone concentration and composition are instructive in the decision of Caenorhabditis elegans to either develop into a reproductive adult or enter into the stress-resistant alternate dauer developmental stage. Pheromones are sensed by a small set of sensory neurons, and integrated with additional environmental cues, to regulate neuroendocrine signaling and dauer formation. To identify molecules required for pheromone-induced dauer formation, we performed an unbiased forward genetic screen and identified phd (pheromone response-defective dauer) mutants. Here, we describe new roles in dauer formation for previously identified neuronal molecules such as the WD40 domain protein QUI-1 and MACO-1 Macoilin, report new roles for nociceptive neurons in modulating pheromone-induced dauer formation, and identify tau tubulin kinases as new genes involved in dauer formation. Thus, phd mutants define loci required for the detection, transmission, or integration of pheromone signals in the regulation of dauer formation. Copyright © 2016 Neal et al.

Developmental control of hypoxia during bud burst in grapevine.

PubMed

Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

2018-05-01

Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

A Transcriptome Atlas of Physcomitrella patens Provides Insights into the Evolution and Development of Land Plants.

PubMed

Ortiz-Ramírez, Carlos; Hernandez-Coronado, Marcela; Thamm, Anna; Catarino, Bruno; Wang, Mingyi; Dolan, Liam; Feijó, José A; Becker, Jörg D

2016-02-01

Identifying the genetic mechanisms that underpin the evolution of new organ and tissue systems is an aim of evolutionary developmental biology. Comparative functional genetic studies between angiosperms and bryophytes can define those genetic changes that were responsible for developmental innovations. Here, we report the generation of a transcriptome atlas covering most phases in the life cycle of the model bryophyte Physcomitrella patens, including detailed sporophyte developmental progression. We identified a comprehensive set of sporophyte-specific transcription factors, and found that many of these genes have homologs in angiosperms that function in developmental processes such as flowering and shoot branching. Deletion of the PpTCP5 transcription factor results in development of supernumerary sporangia attached to a single seta, suggesting that it negatively regulates branching in the moss sporophyte. Given that TCP genes repress branching in angiosperms, we suggest that this activity is ancient. Finally, comparison of P. patens and Arabidopsis thaliana transcriptomes led us to the identification of a conserved core of transcription factors expressed in tip-growing cells. We identified modifications in the expression patterns of these genes that could account for developmental differences between P. patens tip-growing cells and A. thaliana pollen tubes and root hairs. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

PubMed Central

Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

2016-01-01

For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

iTRAQ and RNA-Seq Analyses Provide New Insights into Regulation Mechanism of Symbiotic Germination of Dendrobium officinale Seeds (Orchidaceae).

PubMed

Chen, Juan; Liu, Si Si; Kohler, Annegret; Yan, Bo; Luo, Hong Mei; Chen, Xiao Mei; Guo, Shun Xing

2017-06-02

Mycorrhizal fungi colonize orchid seeds and induce germination. This so-called symbiotic germination is a critical developmental process in the lifecycle of all orchid species. However, the molecular changes that occur during orchid seed symbiotic germination remain largely unknown. To better understand the molecular mechanism of orchid seed germination, we performed a comparative transcriptomic and proteomic analysis of the Chinese traditional medicinal orchid Dendrobium officinale to explore the change in protein expression at the different developmental stages during asymbiotic and symbiotic germination and identify the key proteins that regulate the symbiotic germination of orchid seeds. Among 2256 identified plant proteins, 308 were differentially expressed across three developmental stages during asymbiotic and symbiotic germination, and 229 were differentially expressed during symbiotic germination compared to asymbiotic development. Of these, 32 proteins were coup-regulated at both the proteomic and transcriptomic levels during symbiotic germination compared to asymbiotic germination. Our results suggest that symbiotic germination of D. officinale seeds shares a common signaling pathway with asymbiotic germination during the early germination stage. However, compared to asymbiotic germination, fungal colonization of orchid seeds appears to induce higher and earlier expression of some key proteins involved in lipid and carbohydrate metabolism and thus improves the efficiency of utilization of stored substances present in the embryo. This study provides new insight into the molecular basis of orchid seed germination.

Methodological Implications of the Affect Revolution: A 35-Year Review of Emotion Regulation Assessment in Children

ERIC Educational Resources Information Center

Adrian, Molly; Zeman, Janice; Veits, Gina

2011-01-01

This investigation analyzed the methods used over the past 35 years to study emotion regulation (ER) in children. Articles published from 1975 through 2010 were identified in 42 child clinical, developmental, and emotion psychology journals. Overall, 61.1% of published ER articles relied on one method and 23.6% used two methods. Analyses revealed…

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

An Atypical Phr Peptide Regulates the Developmental Switch Protein RapH ▿ †

PubMed Central

Mirouze, Nicolas; Parashar, Vijay; Baker, Melinda D.; Dubnau, David A.; Neiditch, Matthew B.

2011-01-01

Under conditions of nutrient limitation and high population density, the bacterium Bacillus subtilis can initiate a variety of developmental pathways. The signaling systems regulating B. subtilis differentiation are tightly controlled by switch proteins called Raps, named after the founding members of the family, which were shown to be response regulator aspartate phosphatases. A phr gene encoding a secreted pentapeptide that regulates the activity of its associated Rap protein was previously identified downstream of 8 of the chromosomally encoded rap genes. We identify and validate here the sequence of an atypical Phr peptide, PhrH, by in vivo and in vitro analyses. Using a luciferase reporter bioassay combined with in vitro experiments, we found that PhrH is a hexapeptide (TDRNTT), in contrast to the other characterized Phr pentapeptides. We also determined that phrH expression is driven by a promoter lying within rapH. Unlike the previously identified dedicated σH-driven phr promoters, it appears that phrH expression most likely requires σA. Furthermore, we show that PhrH can antagonize both of the known activities of RapH: the dephosphorylation of Spo0F and the sequestration of ComA, thus promoting the development of spores and the competent state. Finally, we propose that PhrH is the prototype of a newly identified class of Phr signaling molecules consisting of six amino acids. This class likely includes PhrI, which regulates RapI and the expression, excision, and transfer of the mobile genetic element ICEBs1. PMID:21908671

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

FRUITFULL controls SAUR10 expression and regulates Arabidopsis growth and architecture.

PubMed

Bemer, Marian; van Mourik, Hilda; Muiño, Jose M; Ferrándiz, Cristina; Kaufmann, Kerstin; Angenent, Gerco C

2017-06-15

MADS-domain transcription factors are well known for their roles in plant development and regulate sets of downstream genes that have been uncovered by high-throughput analyses. A considerable number of these targets are predicted to function in hormone responses or responses to environmental stimuli, suggesting that there is a close link between developmental and environmental regulators of plant growth and development. Here, we show that the Arabidopsis MADS-domain factor FRUITFULL (FUL) executes several functions in addition to its noted role in fruit development. Among the direct targets of FUL, we identified SMALL AUXIN UPREGULATED RNA 10 (SAUR10), a growth regulator that is highly induced by a combination of auxin and brassinosteroids and in response to reduced R:FR light. Interestingly, we discovered that SAUR10 is repressed by FUL in stems and inflorescence branches. SAUR10 is specifically expressed at the abaxial side of these branches and this localized activity is influenced by hormones, light conditions and by FUL, which has an effect on branch angle. Furthermore, we identified a number of other genes involved in hormone pathways and light signalling as direct targets of FUL in the stem, demonstrating a connection between developmentally and environmentally regulated growth programs. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

PubMed Central

Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

2013-01-01

Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and highlight biological processes important for pathogenicity. PMID:23665591

Polycomb-like 2 Associates with PRC2 and Regulates Transcriptional Networks during Mouse Embryonic Stem Cell Self-Renewal and Differentiation

PubMed Central

Walker, Emily; Chang, Wing Y.; Hunkapiller, Julie; Cagney, Gerard; Garcha, Kamal; Torchia, Joseph; Krogan, Nevan J.; Reiter, Jeremy F.; Stanford, William L.

2010-01-01

Summary Polycomb group (PcG) proteins are conserved epigenetic transcriptional repressors that control numerous developmental gene expression programs and have recently been implicated in modulating embryonic stem cell (ESC) fate. We identified the PcG protein PCL2 (polycomb-like 2) in a genome-wide screen for regulators of self-renewal and pluripotency and predicted that it would play an important role in mouse ESC fate determination. Using multiple biochemical strategies, we provide evidence that PCL2 is a Polycomb Repressive Complex 2 (PRC2)-associated protein in mouse ESCs. Knockdown of Pcl2 in ESCs resulted in heightened self-renewal characteristics, defects in differentiation and altered patterns of histone methylation. Integration of global gene expression and promoter occupancy analyses allowed us to identify PCL2 and PRC2 transcriptional targets and draft regulatory networks. We describe the role of PCL2 in both modulating transcription of ESC self-renewal genes in undifferentiated ESCs as well as developmental regulators during early commitment and differentiation. PMID:20144788

De novo mutations in the genome organizer CTCF cause intellectual disability.

PubMed

Gregor, Anne; Oti, Martin; Kouwenhoven, Evelyn N; Hoyer, Juliane; Sticht, Heinrich; Ekici, Arif B; Kjaergaard, Susanne; Rauch, Anita; Stunnenberg, Hendrik G; Uebe, Steffen; Vasileiou, Georgia; Reis, André; Zhou, Huiqing; Zweier, Christiane

2013-07-11

An increasing number of genes involved in chromatin structure and epigenetic regulation has been implicated in a variety of developmental disorders, often including intellectual disability. By trio exome sequencing and subsequent mutational screening we now identified two de novo frameshift mutations and one de novo missense mutation in CTCF in individuals with intellectual disability, microcephaly, and growth retardation. Furthermore, an individual with a larger deletion including CTCF was identified. CTCF (CCCTC-binding factor) is one of the most important chromatin organizers in vertebrates and is involved in various chromatin regulation processes such as higher order of chromatin organization, enhancer function, and maintenance of three-dimensional chromatin structure. Transcriptome analyses in all three individuals with point mutations revealed deregulation of genes involved in signal transduction and emphasized the role of CTCF in enhancer-driven expression of genes. Our findings indicate that haploinsufficiency of CTCF affects genomic interaction of enhancers and their regulated gene promoters that drive developmental processes and cognition. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

PubMed

Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

2012-02-01

MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Dafadine inhibits DAF-9 to promote dauer formation and longevity of Caenorhabditis elegans.

PubMed

Luciani, Genna M; Magomedova, Lilia; Puckrin, Rachel; Urbanus, Malene L; Wallace, Iain M; Giaever, Guri; Nislow, Corey; Cummins, Carolyn L; Roy, Peter J

2011-11-06

The DAF-9 cytochrome P450 is a key regulator of dauer formation, developmental timing and longevity in the nematode Caenorhabditis elegans. Here we describe the first identified chemical inhibitor of DAF-9 and the first reported small-molecule tool that robustly induces dauer formation in typical culture conditions. This molecule (called dafadine) also inhibits the mammalian ortholog of DAF-9(CYP27A1), suggesting that dafadine can be used to interrogate developmental control and longevity in other animals.

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

A developmental, body-oriented intervention for children and adolescents with medically unexplained chronic pain.

PubMed

Kozlowska, Kasia; Khan, Rubina

2011-10-01

The regulation of pain and other emotions is a developmental process that takes place in the context of attachment relationships. Children with chronic, medically unexplained pain struggle to accurately identify, communicate and regulate negative body states, and to connect these body states to their day-to-day experience. This article describes an individual intervention - one component of a multimodal treatment programme - whose aim is to help children find skills to manage their pain. The intervention incorporates ideas and practices from several theoretical models - the dynamic-maturational model of attachment, cognitive-behavioural theories, narrative therapy, art therapy, sensorimotor approaches -pragmatically selected and adapted to help children presenting to our Chronic Pain Service achieve good clinical outcomes. At the outset we assess the child's capacity to identify, regulate and communicate positive and negative body states, and tailor our individual intervention so as to extend each child's proximal level of development. We initially focus on the body in an effort to equip the child with a non-verbal, image-based language for identifying and communicating pain and other negative body states. Once the child has developed a non-verbal way of knowing her body, a range of cognitive-behavioural, narrative and other strategies are introduced. The intervention aims to increase the child's emotional functioning: her skill in identifying, symbolically representing, communicating and managing pain and other negative body states.

A cross-species bi-clustering approach to identifying conserved co-regulated genes.

PubMed

Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

2016-06-15

A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

PubMed Central

2013-01-01

Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

Aspp2 negatively regulates body growth but not developmental timing by modulating IRS signaling in zebrafish embryos.

PubMed

Liu, Chengdong; Luan, Jing; Bai, Yan; Li, Yun; Lu, Ling; Liu, Yunzhang; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Duan, Cunming; Zhou, Jianfeng

2014-02-01

The growth and developmental rate of developing embryos and fetus are tightly controlled and coordinated to maintain proper body shape and size. The insulin receptor substrate (IRS) proteins, key intracellular transducers of insulin and insulin-like growth factor signaling, play essential roles in the regulation of growth and development. A short isoform of apoptosis-stimulating protein of p53 2 (ASPP2) was recently identified as a binding partner of IRS-1 and IRS-2 in mammalian cells in vitro. However, it is unclear whether ASPP2 plays any role in vertebrate embryonic growth and development. Here, we show that zebrafish Aspp2a and Aspp2b negatively regulate embryonic growth without affecting developmental rate. Human ASPP2 had similar effects on body growth in zebrafish embryos. Aspp2a and 2b inhibit Akt signaling. This inhibition was reversed by coinjection of myr-Akt1, a constitutively active form of Akt1. Zebrafish Aspp2a and Aspp2b physically bound with Irs-1, and the growth inhibitory effects of ASPP2/Aspp2 depend on the presence of their ankyrin repeats and SH3 domains. These findings uncover a novel role of Aspp2 in regulating vertebrate embryonic growth. Copyright © 2013 Elsevier Inc. All rights reserved.

Discovery of Transcription Factors Novel to Mouse Cerebellar Granule Cell Development Through Laser-Capture Microdissection.

PubMed

Zhang, Peter G Y; Yeung, Joanna; Gupta, Ishita; Ramirez, Miguel; Ha, Thomas; Swanson, Douglas J; Nagao-Sato, Sayaka; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Daub, Carsten O; Arner, Erik; de Hoon, Michiel; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide; Goldowitz, Dan

2018-06-01

Laser-capture microdissection was used to isolate external germinal layer tissue from three developmental periods of mouse cerebellar development: embryonic days 13, 15, and 18. The cerebellar granule cell-enriched mRNA library was generated with next-generation sequencing using the Helicos technology. Our objective was to discover transcriptional regulators that could be important for the development of cerebellar granule cells-the most numerous neuron in the central nervous system. Through differential expression analysis, we have identified 82 differentially expressed transcription factors (TFs) from a total of 1311 differentially expressed genes. In addition, with TF-binding sequence analysis, we have identified 46 TF candidates that could be key regulators responsible for the variation in the granule cell transcriptome between developmental stages. Altogether, we identified 125 potential TFs (82 from differential expression analysis, 46 from motif analysis with 3 overlaps in the two sets). From this gene set, 37 TFs are considered novel due to the lack of previous knowledge about their roles in cerebellar development. The results from transcriptome-wide analyses were validated with existing online databases, qRT-PCR, and in situ hybridization. This study provides an initial insight into the TFs of cerebellar granule cells that might be important for development and provide valuable information for further functional studies on these transcriptional regulators.

Identification of Chemicals Inducing Cardiomyocyte Proliferation in Developmental Stage-Specific Manner with Pluripotent Stem Cells

PubMed Central

Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A.; Engel, Felix B.; Yamashita, Jun K.

2013-01-01

Background The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provide therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells (PSCs). The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. Methods and Results To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse PSC-derived cardiomyocytes and identified 4 chemical compound groups - inhibitors of glycogen synthase kinase-3 (GSK3), p38 mitogen-activated protein kinase (MAPK) and Ca2+/calmodulin-dependent protein kinase II (CaMKII), and activators of extracellular signal-regulated kinase (ERK). Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human PSCs, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas ERK activators and CaMKII inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, GSK3 and p38 MAPK inhibitors substantially and synergistically induced reentry and progression of cell cycle in not only neonatal but also adult cardiomyocytes. Conclusions Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered PSC-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies. PMID:24141057

Plant hormone signaling lightens up: integrators of light and hormones.

PubMed

Lau, On Sun; Deng, Xing Wang

2010-10-01

Light is an important environmental signal that regulates diverse growth and developmental processes in plants. In these light-regulated processes, multiple hormonal pathways are often modulated by light to mediate the developmental changes. Conversely, hormone levels in plants also serve as endogenous cues in influencing light responsiveness. Although interactions between light and hormone signaling pathways have long been observed, recent studies have advanced our understanding by identifying signaling integrators that connect the pathways. These integrators, namely PHYTOCHROME-INTERACTING FACTOR 3 (PIF3), PIF4, PIF3-LIKE 5 (PIL5)/PIF1 and LONG HYPOCOTYL 5 (HY5), are key light signaling components and they link light signals to the signaling of phytohormones, such as gibberellin (GA), abscisic acid (ABA), auxin and cytokinin, in regulating seedling photomorphogenesis and seed germination. This review focuses on these integrators in illustrating how light and hormone interact. Copyright © 2010 Elsevier Ltd. All rights reserved.

Arabidopsis HEAT SHOCK TRANSCRIPTION FACTORA1b regulates multiple developmental genes under benign and stress conditions.

PubMed

Albihlal, Waleed S; Obomighie, Irabonosi; Blein, Thomas; Persad, Ramona; Chernukhin, Igor; Crespi, Martin; Bechtold, Ulrike; Mullineaux, Philip M

2018-05-19

In Arabidopsis thaliana, HEAT SHOCK TRANSCRIPTION FACTORA1b (HSFA1b) controls resistance to environmental stress and is a determinant of reproductive fitness by influencing seed yield. To understand how HSFA1b achieves this, we surveyed its genome-wide targets (ChIP-seq) and its impact on the transcriptome (RNA-seq) under non-stress (NS), heat stress (HS) in the wild type, and in HSFA1b-overexpressing plants under NS. A total of 952 differentially expressed HSFA1b-targeted genes were identified, of which at least 85 are development associated and were bound predominantly under NS. A further 1780 genes were differentially expressed but not bound by HSFA1b, of which 281 were classified as having development-associated functions. These genes are indirectly regulated through a hierarchical network of 27 transcription factors (TFs). Furthermore, we identified 480 natural antisense non-coding RNA (cisNAT) genes bound by HSFA1b, defining a further mode of indirect regulation. Finally, HSFA1b-targeted genomic features not only harboured heat shock elements, but also MADS box, LEAFY, and G-Box promoter motifs. This revealed that HSFA1b is one of eight TFs that target a common group of stress defence and developmental genes. We propose that HSFA1b transduces environmental cues to many stress tolerance and developmental genes to allow plants to adjust their growth and development continually in a varying environment.

Behavioral Assessment of Emotion Discrimination, Emotion Regulation, and Cognitive Control in Childhood, Adolescence, and Adulthood

PubMed Central

Tottenham, Nim; Hare, Todd A.; Casey, B. J.

2011-01-01

Emotion discrimination, emotion regulation, and cognitive control are three related, yet separable processes that emerge over the course of development. The current study tested 100 children, adolescents, and adults on an Emotional Go/Nogo task, illustrating the ability of this paradigm to identify the unique developmental patterns for each of these three processes in the context of both positive (happy) and negative emotions (fear, sad, and anger), across three different age groups. Consistent with previous literature, our findings show that emotion discrimination and regulatory abilities (both cognitive control and emotion regulation) improve steadily for each age group, with each age group showing unique patterns of performance. The findings suggest that emotion regulation is constructed from basic cognition control and emotion discrimination skills. The patterns of behavior from the Emotional Go/Nogo task provide normative benchmark data across a wide range of emotions that can be used for future behavioral and neuroimaging studies that examine the developmental construction of emotion regulatory processes. PMID:21716604

Cell identity regulators link development and stress responses in the Arabidopsis root.

PubMed

Iyer-Pascuzzi, Anjali S; Jackson, Terry; Cui, Hongchang; Petricka, Jalean J; Busch, Wolfgang; Tsukagoshi, Hironaka; Benfey, Philip N

2011-10-18

Stress responses in plants are tightly coordinated with developmental processes, but interaction of these pathways is poorly understood. We used genome-wide assays at high spatiotemporal resolution to understand the processes that link development and stress in the Arabidopsis root. Our meta-analysis finds little evidence for a universal stress response. However, common stress responses appear to exist with many showing cell type specificity. Common stress responses may be mediated by cell identity regulators because mutations in these genes resulted in altered responses to stress. Evidence for a direct role for cell identity regulators came from genome-wide binding profiling of the key regulator SCARECROW, which showed binding to regulatory regions of stress-responsive genes. Coexpression in response to stress was used to identify genes involved in specific developmental processes. These results reveal surprising linkages between stress and development at cellular resolution, and show the power of multiple genome-wide data sets to elucidate biological processes. Copyright © 2011 Elsevier Inc. All rights reserved.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

PubMed

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.)

PubMed Central

Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

2017-01-01

Raspberries (Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm—plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus. These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop. PMID:28659963

De novo pathogenic variants in CHAMP1 are associated with global developmental delay, intellectual disability, and dysmorphic facial features.

PubMed

Tanaka, Akemi J; Cho, Megan T; Retterer, Kyle; Jones, Julie R; Nowak, Catherine; Douglas, Jessica; Jiang, Yong-Hui; McConkie-Rosell, Allyn; Schaefer, G Bradley; Kaylor, Julie; Rahman, Omar A; Telegrafi, Aida; Friedman, Bethany; Douglas, Ganka; Monaghan, Kristin G; Chung, Wendy K

2016-01-01

We identified five unrelated individuals with significant global developmental delay and intellectual disability (ID), dysmorphic facial features and frequent microcephaly, and de novo predicted loss-of-function variants in chromosome alignment maintaining phosphoprotein 1 (CHAMP1). Our findings are consistent with recently reported de novo mutations in CHAMP1 in five other individuals with similar features. CHAMP1 is a zinc finger protein involved in kinetochore-microtubule attachment and is required for regulating the proper alignment of chromosomes during metaphase in mitosis. Mutations in CHAMP1 may affect cell division and hence brain development and function, resulting in developmental delay and ID.

Pancreas and gallbladder agenesis in a newborn with semilobar holoprosencephaly, a case report.

PubMed

Hilbrands, Robert; Keymolen, Kathelijn; Michotte, Alex; Marichal, Miriam; Cools, Filip; Goossens, Anieta; Veld, Peter In't; De Schepper, Jean; Hattersley, Andrew; Heimberg, Harry

2017-05-19

Pancreatic agenesis is an extremely rare cause of neonatal diabetes mellitus and has enabled the discovery of several key transcription factors essential for normal pancreas and beta cell development. We report a case of a Caucasian female with complete pancreatic agenesis occurring together with semilobar holoprosencephaly (HPE), a more common brain developmental disorder. Clinical findings were later confirmed by autopsy, which also identified agenesis of the gallbladder. Although the sequences of a selected set of genes related to pancreas agenesis or HPE were wild-type, the patient's phenotype suggests a genetic defect that emerges early in embryonic development of brain, gallbladder and pancreas. Developmental defects of the pancreas and brain can occur together. Identifying the genetic defect may identify a novel key regulator in beta cell development.

Distinct Contributions of Conserved Modules to Runt Transcription Factor Activity

PubMed Central

Walrad, Pegine B.; Hang, Saiyu; Joseph, Genevieve S.; Salas, Julia

2010-01-01

Runx proteins play vital roles in regulating transcription in numerous developmental pathways throughout the animal kingdom. Two Runx protein hallmarks are the DNA-binding Runt domain and a C-terminal VWRPY motif that mediates interaction with TLE/Gro corepressor proteins. A phylogenetic analysis of Runt, the founding Runx family member, identifies four distinct regions C-terminal to the Runt domain that are conserved in Drosophila and other insects. We used a series of previously described ectopic expression assays to investigate the functions of these different conserved regions in regulating gene expression during embryogenesis and in controlling axonal projections in the developing eye. The results indicate each conserved region is required for a different subset of activities and identify distinct regions that participate in the transcriptional activation and repression of the segmentation gene sloppy-paired-1 (slp1). Interestingly, the C-terminal VWRPY-containing region is not required for repression but instead plays a role in slp1 activation. Genetic experiments indicating that Groucho (Gro) does not participate in slp1 regulation further suggest that Runt's conserved C-terminus interacts with other factors to promote transcriptional activation. These results provide a foundation for further studies on the molecular interactions that contribute to the context-dependent properties of Runx proteins as developmental regulators. PMID:20462957

Non-coding RNAs—Novel targets in neurotoxicity

PubMed Central

Tal, Tamara L.; Tanguay, Robert L.

2012-01-01

Over the past ten years non-coding RNAs (ncRNAs) have emerged as pivotal players in fundamental physiological and cellular processes and have been increasingly implicated in cancer, immune disorders, and cardiovascular, neurodegenerative, and metabolic diseases. MicroRNAs (miRNAs) represent a class of ncRNA molecules that function as negative regulators of post-transcriptional gene expression. miRNAs are predicted to regulate 60% of all human protein-coding genes and as such, play key roles in cellular and developmental processes, human health, and disease. Relative to counterparts that lack bindings sites for miRNAs, genes encoding proteins that are post-transcriptionally regulated by miRNAs are twice as likely to be sensitive to environmental chemical exposure. Not surprisingly, miRNAs have been recognized as targets or effectors of nervous system, developmental, hepatic, and carcinogenic toxicants, and have been identified as putative regulators of phase I xenobiotic-metabolizing enzymes. In this review, we give an overview of the types of ncRNAs and highlight their roles in neurodevelopment, neurological disease, activity-dependent signaling, and drug metabolism. We then delve into specific examples that illustrate their importance as mediators, effectors, or adaptive agents of neurotoxicants or neuroactive pharmaceutical compounds. Finally, we identify a number of outstanding questions regarding ncRNAs and neurotoxicity. PMID:22394481

A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance.

PubMed

Maheshwari, Richa; Pushpa, Kumari; Subramaniam, Kuppuswamy

2016-09-01

Membrane-bound receptors, which are crucial for mediating several key developmental signals, are synthesized on endoplasmic reticulum (ER). The functional integrity of ER must therefore be important for the regulation of at least some developmental programs. However, the developmental control of ER function is not well understood. Here, we identify the C. elegans protein FARL-11, an ortholog of the mammalian STRIPAK complex component STRIP1/2 (FAM40A/B), as an ER protein. In the C. elegans embryo, we find that FARL-11 is essential for the cell cycle-dependent morphological changes of ER and for embryonic viability. In the germline, FARL-11 is required for normal ER morphology and for membrane localization of the GLP-1/Notch receptor involved in germline stem cell (GSC) maintenance. Furthermore, we provide evidence that PUF-8, a key translational regulator in the germline, promotes the translation of farl-11 mRNA. These findings reveal that ER form and function in the C. elegans germline are post-transcriptionally regulated and essential for the niche-GSC signaling mediated by GLP-1. © 2016. Published by The Company of Biologists Ltd.

Identification of ARF and AUX/IAA gene families in Rafflesia cantleyi

NASA Astrophysics Data System (ADS)

Elias, Nur Atiqah Mohd; Goh, Hoe-Han; Isa, Nurulhikma Md; Wan, Kiew-Lian

2016-11-01

Rafflesia is a unique plant that produces the largest flowers in the world. It has a short blooming period of 6 to 7 days. Due to its rarity and limited accessibility, little is known about the growth and developmental process in the Rafflesia plant. In all plant species, auxin is the key hormone that is involved in growth and development. The auxin signal transduction involves members of the ARF transcription factor and AUX/IAA regulator families, which activate or inhibit the regulation of auxin response genes, thereby control the developmental process in plants. To gain a better understanding of molecular regulations in the Rafflesia plant development during flowering, members of the ARF and AUX/IAA gene families were identified from the transcriptome data of flower blooming stages in Rafflesia cantleyi. Based on Rafflesia unique transcripts (UTs) against the Arabidopsis TAIR database using BLASTX search, a total of nine UTs were identified as ARF transcription factors, while another seven UTs were identified as AUX/IAA regulators. These genes were found to be expressed in all three R. cantleyi flower stages i.e. days 1 (F1), 3 (F2), and 5 (F3). Gene expression analysis identified three genes that are differentially expressed in stage F1 vs. F2 i.e. IAA4 is upregulated while IAA8 and ARF3 are downregulated. These genes may be involved in the activation and/or inhibition of the auxin signal transduction pathway. Further analysis of these genes may unravel their function in the phenotypic development of the Rafflesia plant.

Transcriptome profiling reveals regulatory mechanisms underlying Corolla Senescence in Petunia

USDA-ARS?s Scientific Manuscript database

Genetic regulatory mechanisms that govern petal natural senescence in petunia is complicated and unclear. To identify key genes and pathways that regulate the process, we initiated a transcriptome analysis in petunia petals at four developmental time points, including petal opening without anthesis ...

Regulation of priority carcinogens and reproductive or developmental toxicants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hooper, K.; LaDou, J.; Rosenbaum, J.S.

In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies suchmore » as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.« less

Regulation of priority carcinogens and reproductive or developmental toxicants.

PubMed

Hooper, K; LaDou, J; Rosenbaum, J S; Book, S A

1992-01-01

In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies such as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci.

PubMed

Amaral, Paulo P; Leonardi, Tommaso; Han, Namshik; Viré, Emmanuelle; Gascoigne, Dennis K; Arias-Carrasco, Raúl; Büscher, Magdalena; Pandolfini, Luca; Zhang, Anda; Pluchino, Stefano; Maracaja-Coutinho, Vinicius; Nakaya, Helder I; Hemberg, Martin; Shiekhattar, Ramin; Enright, Anton J; Kouzarides, Tony

2018-03-15

The mammalian genome is transcribed into large numbers of long noncoding RNAs (lncRNAs), but the definition of functional lncRNA groups has proven difficult, partly due to their low sequence conservation and lack of identified shared properties. Here we consider promoter conservation and positional conservation as indicators of functional commonality. We identify 665 conserved lncRNA promoters in mouse and human that are preserved in genomic position relative to orthologous coding genes. These positionally conserved lncRNA genes are primarily associated with developmental transcription factor loci with which they are coexpressed in a tissue-specific manner. Over half of positionally conserved RNAs in this set are linked to chromatin organization structures, overlapping binding sites for the CTCF chromatin organiser and located at chromatin loop anchor points and borders of topologically associating domains (TADs). We define these RNAs as topological anchor point RNAs (tapRNAs). Characterization of these noncoding RNAs and their associated coding genes shows that they are functionally connected: they regulate each other's expression and influence the metastatic phenotype of cancer cells in vitro in a similar fashion. Furthermore, we find that tapRNAs contain conserved sequence domains that are enriched in motifs for zinc finger domain-containing RNA-binding proteins and transcription factors, whose binding sites are found mutated in cancers. This work leverages positional conservation to identify lncRNAs with potential importance in genome organization, development and disease. The evidence that many developmental transcription factors are physically and functionally connected to lncRNAs represents an exciting stepping-stone to further our understanding of genome regulation.

A spontaneous eggplant (Solanum melongena L.) color mutant conditions anthocyanin-free fruit pigmentation

USDA-ARS?s Scientific Manuscript database

Induced or spontaneously occuring color mutants in plants provide valuable tools for elucidating the genetic and developmental regulation of genes that influence pigmentation. We identified a single plant of the eggplant (Solanum melongena) cultivar Black Beauty bearing green fruit. Black Beauty no...

Behavioral Teratogenesis in Drosophila melanogaster.

PubMed

Mishra, Monalisa; Barik, Bedanta Kumar

2018-01-01

Developmental biology is a fascinating branch of science which helps us to understand the mechanism of development, thus the findings are used in various therapeutic approach. Drosophila melanogaster served as a model to find the key molecules that initiate and regulate the mechanism of development. Various genes, transcription factors, and signaling pathways helping in development are identified in Drosophila. Many toxic compounds, which can affect the development, are also recognized using Drosophila model. These compounds, which can affect the development, are named as a teratogen. Many teratogens identified using Drosophila may also act as a teratogen for a human being since 75% of conservation exist between the disease genes present in Drosophila and human. There are certain teratogens, which do not cause developmental defect if exposed during pregnancy, however; behavioral defect appears in later part of development. Such compounds are named as a behavioral teratogen. Thus, it is worthy to identify the potential behavioral teratogen using Drosophila model. Drosophila behavior is well studied in various developmental stages. This chapter describes various methods which can be employed to test behavioral teratogenesis in Drosophila.

Distinct emotion regulation skills explain psychopathology and problems in social relationships following childhood emotional abuse and neglect.

PubMed

Berzenski, Sara R

2018-03-22

Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Developmental regulation of diacylglycerol acyltransferase family gene expression in tung tree tissues

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferases (DGAT) are responsible for the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes, including DGAT1 and DGAT2 of tung tre...

Krebs Cycle Moonlights in Caspase Regulation.

PubMed

Minis, Adi; Steller, Hermann

2016-04-04

In this issue of Developmental Cell, Aram et al. (2016) identify a mechanism that uses a Krebs cycle protein to control local activation of a ubiquitin ligase complex at the mitochondrial outer membrane for temporally and spatially restricted caspase activation during Drosophila sperm differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

PubMed

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-12-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

PubMed Central

Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

2014-01-01

We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs

PubMed Central

Goodale, B. C.; La Du, J.; Tilton, S. C.; Sullivan, C. M.; Bisson, W. H.; Waters, K. M.; Tanguay, R. L.

2015-01-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. PMID:26141390

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience-Dependent Cortical Plasticity

PubMed Central

Smith, Milo R.; Burman, Poromendro

2016-01-01

Throughout childhood and adolescence, periods of heightened neuroplasticity are critical for the development of healthy brain function and behavior. Given the high prevalence of neurodevelopmental disorders, such as autism, identifying disruptors of developmental plasticity represents an essential step for developing strategies for prevention and intervention. Applying a novel computational approach that systematically assessed connections between 436 transcriptional signatures of disease and multiple signatures of neuroplasticity, we identified inflammation as a common pathological process central to a diverse set of diseases predicted to dysregulate plasticity signatures. We tested the hypothesis that inflammation disrupts developmental cortical plasticity in vivo using the mouse ocular dominance model of experience-dependent plasticity in primary visual cortex. We found that the administration of systemic lipopolysaccharide suppressed plasticity during juvenile critical period with accompanying transcriptional changes in a particular set of molecular regulators within primary visual cortex. These findings suggest that inflammation may have unrecognized adverse consequences on the postnatal developmental trajectory and indicate that treating inflammation may reduce the burden of neurodevelopmental disorders. PMID:28101530

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

miR-14 regulates autophagy during developmental cell death by targeting ip3-kinase 2.

PubMed

Nelson, Charles; Ambros, Victor; Baehrecke, Eric H

2014-11-06

Macroautophagy (autophagy) is a lysosome-dependent degradation process that has been implicated in age-associated diseases. Autophagy is involved in both cell survival and cell death, but little is known about the mechanisms that distinguish its use during these distinct cell fates. Here, we identify the microRNA miR-14 as being both necessary and sufficient for autophagy during developmentally regulated cell death in Drosophila. Loss of miR-14 prevented induction of autophagy during salivary gland cell death, but had no effect on starvation-induced autophagy in the fat body. Moreover, misexpression of miR-14 was sufficient to prematurely induce autophagy in salivary glands, but not in the fat body. Importantly, miR-14 regulates this context-specific autophagy through its target, inositol 1,4,5-trisphosphate kinase 2 (ip3k2), thereby affecting inositol 1,4,5-trisphosphate (IP3) signaling and calcium levels during salivary gland cell death. This study provides in vivo evidence of microRNA regulation of autophagy through modulation of IP3 signaling. Copyright © 2014 Elsevier Inc. All rights reserved.

Transcriptomic Analysis of Grapevine (cv. Summer Black) Leaf, Using the Illumina Platform

PubMed Central

Pervaiz, Tariq; Haifeng, Jia; Salman Haider, Muhammad; Cheng, Zhang; Cui, Mengjie; Wang, Mengqi; Cui, Liwen; Wang, Xicheng; Fang, Jinggui

2016-01-01

Proceeding to illumina sequencing, determining RNA integrity numbers for poly RNA were separated from each of the four developmental stages of cv. Summer Black leaves by using Illumina HiSeq™ 2000. The sums of 272,941,656 reads were generated from vitis vinifera leaf at four different developmental stages, with more than 27 billion nucleotides of the sequence data. At each growth stage, RNA samples were indexed through unique nucleic acid identifiers and sequenced. KEGG annotation results depicted that the highest number of transcripts in 2,963 (2Avs4A) followed by 1Avs4A (2,920), and 3Avs4A (2,294) out of 15,614 (71%) transcripts were recorded. In comparison, a total of 1,532 transcripts were annotated in GOs, including Cellular component, with the highest number in “Cell part” 251 out of 353 transcripts (71.1%), followed by intracellular organelle 163 out of 353 transcripts (46.2%), while in molecular function and metabolic process 375 out of 525 (71.4%) transcripts, multicellular organism process 40 out of 525 (7.6%) transcripts in biological process were most common in 1Avs2A. While in case of 1Avs3A, cell part 476 out of 662 transcripts (71.9%), and membrane-bounded organelle 263 out of 662 transcripts (39.7%) were recorded in Cellular component. In the grapevine transcriptome, during the initial stages of leaf development 1Avs2A showed single transcript was down-regulated and none of them were up-regulated. While in comparison of 1A to 3A showed one up-regulated (photosystem II reaction center protein C) and one down regulated (conserved gene of unknown function) transcripts, during the hormone regulating pathway namely SAUR-like auxin-responsive protein family having 2 up-regulated and 7 down-regulated transcripts, phytochrome-associated protein showed 1 up-regulated and 9 down-regulated transcripts, whereas genes associated with the Leucine-rich repeat protein kinase family protein showed 7 up-regulated and 1 down-regulated transcript, meanwhile Auxin Resistant 2 has single up-regulated transcript in second developmental stage, although 3 were down-regulated at lateral growth stages (3A and 4A). In the present study, 489 secondary metabolic pathways related genes were identified during leaf growth, which mainly includes alkaloid (40), anthocyanins (21), Diterpenoid (144), Monoterpenoid (90) and Flavonoids (93). Quantitative real-time PCR was applied to validate 10 differentially expressed transcripts patterns from flower, leaf and fruit metabolic pathways at different growth stages. PMID:26824474

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf.

PubMed

Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

2017-12-15

Black rice ( Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3-10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf.

The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.

PubMed

Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2014-01-01

Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.

Identification of Parent-Child Interaction Characteristics of High and Low Achieving Elementary Students.

ERIC Educational Resources Information Center

Portes, Pedro R.; And Others

The present study was designed to identify parent-child interaction patterns that might differentiate bright from below average elementary students in order to test the hypothesis that environmental processes related to regulation of executive processes influence both children's learning and developmental level. Thirty-two mother-child dyads (16…

Identifying Developmental Cascades among Differentiated Dimensions of Social Competence and Emotion Regulation

ERIC Educational Resources Information Center

Blair, Bethany L.; Perry, Nicole B.; O'Brien, Marion; Calkins, Susan D.; Keane, Susan P.; Shanahan, Lilly

2015-01-01

This study used data from 356 children, their mothers, teachers, and peers to examine the longitudinal and dynamic associations among 3 dimensions of social competence derived from Hinde's (1987) framework of social complexity: social skills, peer group acceptance, and friendship quality. Direct and indirect associations among each discrete…

Plasmodesmata: channels for intercellular signaling during plant growth and development.

PubMed

Sevilem, Iris; Yadav, Shri Ram; Helariutta, Ykä

2015-01-01

Plants have evolved strategies for short- and long-distance communication to coordinate plant development and to adapt to changing environmental conditions. Plasmodesmata (PD) are intercellular nanochannels that provide an effective pathway for both selective and nonselective movement of various molecules that function in diverse biological processes. Numerous non-cell-autonomous proteins (NCAP) and small RNAs have been identified that have crucial roles in cell fate determination and organ patterning during development. Both the density and aperture size of PD are developmentally regulated, allowing formation of spatial symplastic domains for establishment of tissue-specific developmental programs. The PD size exclusion limit (SEL) is controlled by reversible deposition of callose, as well as by some PD-associated proteins. Although a large number of PD-associated proteins have been identified, many of their functions remain unknown. Despite the fact that PD are primarily membranous structures, surprisingly very little is known about their lipid composition. Thus, future studies in PD biology will provide deeper insights into the high-resolution structure and tightly regulated functions of PD and the evolution of PD-mediated cell-to-cell communication in plants.

Methyl jasmonate as a vital substance in plants.

PubMed

Cheong, Jong-Joo; Choi, Yang Do

2003-07-01

The plant floral scent methyl jasmonate (MeJA) has been identified as a vital cellular regulator that mediates diverse developmental processes and defense responses against biotic and abiotic stresses. The pleiotropic effects of MeJA have raised numerous questions about its regulation for biogenesis and mode of action. Characterization of the gene encoding jasmonic acid carboxyl methyltransferase has provided basic information on the role(s) of this phytohormone in gene-activation control and systemic long-distance signaling. Recent approaches using functional genomics and bioinformatics have identified a whole set of MeJA-responsive genes, and provide insights into how plants use volatile signals to withstand diverse and variable environments.

Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

PubMed

Kovacs, Maria; Lopez-Duran, Nestor L

2012-04-01

For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

The chromatin remodeling factor CHD7 controls cerebellar development by regulating reelin expression

PubMed Central

Whittaker, Danielle E.; Riegman, Kimberley L.H.; Kasah, Sahrunizam; Mohan, Conor; Yu, Tian; Sala, Blanca Pijuan; Hebaishi, Husam; Caruso, Angela; Marques, Ana Claudia; Michetti, Caterina; Smachetti, María Eugenia Sanz; Shah, Apar; Sabbioni, Mara; Kulhanci, Omer; Tee, Wee-Wei; Reinberg, Danny; Scattoni, Maria Luisa; McGonnell, Imelda; Wardle, Fiona C.; Fernandes, Cathy

2017-01-01

The mechanisms underlying the neurodevelopmental deficits associated with CHARGE syndrome, which include cerebellar hypoplasia, developmental delay, coordination problems, and autistic features, have not been identified. CHARGE syndrome has been associated with mutations in the gene encoding the ATP-dependent chromatin remodeler CHD7. CHD7 is expressed in neural stem and progenitor cells, but its role in neurogenesis during brain development remains unknown. Here we have shown that deletion of Chd7 from cerebellar granule cell progenitors (GCps) results in reduced GCp proliferation, cerebellar hypoplasia, developmental delay, and motor deficits in mice. Genome-wide expression profiling revealed downregulated expression of the gene encoding the glycoprotein reelin (Reln) in Chd7-deficient GCps. Recessive RELN mutations have been associated with severe cerebellar hypoplasia in humans. We found molecular and genetic evidence that reductions in Reln expression contribute to GCp proliferative defects and cerebellar hypoplasia in GCp-specific Chd7 mouse mutants. Finally, we showed that CHD7 is necessary for maintaining an open, accessible chromatin state at the Reln locus. Taken together, this study shows that Reln gene expression is regulated by chromatin remodeling, identifies CHD7 as a previously unrecognized upstream regulator of Reln, and provides direct in vivo evidence that a mammalian CHD protein can control brain development by modulating chromatin accessibility in neuronal progenitors. PMID:28165338

A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

PubMed

Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

2015-12-01

A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

PubMed Central

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

2017-01-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

PubMed Central

2013-01-01

Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes important to early stages of mushroom fruiting development, though their precise molecular functions and biological roles are not yet fully known. This study serves to advance our understanding of the molecular mechanisms of fruiting body development in the model mushroom C. cinerea. PMID:23514374

RNA-Seq analysis of nodule development at five different developmental stages of soybean (Glycine max) inoculated with Bradyrhizobium japonicum strain 113-2

PubMed Central

Yuan, Song L.; Li, Rong; Chen, Hai F.; Zhang, Chan J.; Chen, Li M.; Hao, Qing N.; Chen, Shui L.; Shan, Zhi H.; Yang, Zhong L.; Zhang, Xiao J.; Qiu, De Z.; Zhou, Xin A.

2017-01-01

Nodule development directly affects nitrogen fixation efficiency during soybean growth. Although abundant genome-based information related to nodule development has been released and some studies have reported the molecular mechanisms that regulate nodule development, information on the way nodule genes operate in nodule development at different developmental stages of soybean is limited. In this report, notably different nodulation phenotypes in soybean roots inoculated with Bradyrhizobium japonicum strain 113-2 at five developmental stages (branching stage, flowering stage, fruiting stage, pod stage and harvest stage) were shown, and the expression of nodule genes at these five stages was assessed quantitatively using RNA-Seq. Ten comparisons were made between these developmental periods, and their differentially expressed genes were analysed. Some important genes were identified, primarily encoding symbiotic nitrogen fixation-related proteins, cysteine proteases, cystatins and cysteine-rich proteins, as well as proteins involving plant-pathogen interactions. There were no significant shifts in the distribution of most GO functional annotation terms and KEGG pathway enrichment terms between these five development stages. A cystatin Glyma18g12240 was firstly identified from our RNA-seq, and was likely to promote nodulation and delay nodule senescence. This study provides molecular material for further investigations into the mechanisms of nitrogen fixation at different soybean developmental stages. PMID:28169364

Developmental Programming of Branching Morphogenesis in the Kidney

PubMed Central

Schneider, Laura; Al-Awqati, Qais

2015-01-01

The kidney developmental program encodes the intricate branching and organization of approximately 1 million functional units (nephrons). Branching regulation is poorly understood, as is the source of a 10-fold variation in nephron number. Notably, low nephron count increases the risk for developing hypertension and renal failure. To better understand the source of this variation, we analyzed the complete gestational trajectory of mouse kidney development. We constructed a computerized architectural map of the branching process throughout fetal life and found that organogenesis is composed of two distinct developmental phases, each with stage-specific rate and morphologic parameters. The early phase is characterized by a rapid acceleration in branching rate and by branching divisions that repeat with relatively reproducible morphology. The latter phase, however, is notable for a significantly decreased yet constant branching rate and the presence of nonstereotyped branching events that generate progressive variability in tree morphology until birth. Our map identifies and quantitates the contribution of four developmental mechanisms that guide organogenesis: growth, patterning, branching rate, and nephron induction. When applied to organs that developed under conditions of malnutrition or in the setting of growth factor mutation, our normative map provided an essential link between kidney architecture and the fundamental morphogenetic mechanisms that guide development. This morphogenetic map is expected to find widespread applications and help identify modifiable targets to prevent developmental programming of common diseases. PMID:25644110

Developmental Programming of Branching Morphogenesis in the Kidney.

PubMed

Sampogna, Rosemary V; Schneider, Laura; Al-Awqati, Qais

2015-10-01

The kidney developmental program encodes the intricate branching and organization of approximately 1 million functional units (nephrons). Branching regulation is poorly understood, as is the source of a 10-fold variation in nephron number. Notably, low nephron count increases the risk for developing hypertension and renal failure. To better understand the source of this variation, we analyzed the complete gestational trajectory of mouse kidney development. We constructed a computerized architectural map of the branching process throughout fetal life and found that organogenesis is composed of two distinct developmental phases, each with stage-specific rate and morphologic parameters. The early phase is characterized by a rapid acceleration in branching rate and by branching divisions that repeat with relatively reproducible morphology. The latter phase, however, is notable for a significantly decreased yet constant branching rate and the presence of nonstereotyped branching events that generate progressive variability in tree morphology until birth. Our map identifies and quantitates the contribution of four developmental mechanisms that guide organogenesis: growth, patterning, branching rate, and nephron induction. When applied to organs that developed under conditions of malnutrition or in the setting of growth factor mutation, our normative map provided an essential link between kidney architecture and the fundamental morphogenetic mechanisms that guide development. This morphogenetic map is expected to find widespread applications and help identify modifiable targets to prevent developmental programming of common diseases. Copyright © 2015 by the American Society of Nephrology.

Identifying Developmental Zones in Maize Lateral Root Cell Length Profiles using Multiple Change-Point Models

PubMed Central

Moreno-Ortega, Beatriz; Fort, Guillaume; Muller, Bertrand; Guédon, Yann

2017-01-01

The identification of the limits between the cell division, elongation and mature zones in the root apex is still a matter of controversy when methods based on cellular features, molecular markers or kinematics are compared while methods based on cell length profiles have been comparatively underexplored. Segmentation models were developed to identify developmental zones within a root apex on the basis of epidermal cell length profiles. Heteroscedastic piecewise linear models were estimated for maize lateral roots of various lengths of both wild type and two mutants affected in auxin signaling (rtcs and rum-1). The outputs of these individual root analyses combined with morphological features (first root hair position and root diameter) were then globally analyzed using principal component analysis. Three zones corresponding to the division zone, the elongation zone and the mature zone were identified in most lateral roots while division zone and sometimes elongation zone were missing in arrested roots. Our results are consistent with an auxin-dependent coordination between cell flux, cell elongation and cell differentiation. The proposed segmentation models could extend our knowledge of developmental regulations in longitudinally organized plant organs such as roots, monocot leaves or internodes. PMID:29123533

A Temporal Chromatin Signature in Human Embryonic Stem Cells Identifies Regulators of Cardiac Development

PubMed Central

Paige, Sharon L.; Thomas, Sean; Stoick-Cooper, Cristi L.; Wang, Hao; Maves, Lisa; Sandstrom, Richard; Pabon, Lil; Reinecke, Hans; Pratt, Gabriel; Keller, Gordon; Moon, Randall T.; Stamatoyannopoulos, John; Murry, Charles E.

2012-01-01

Summary Directed differentiation of human embryonic stem cells (ESCs) into cardiovascular cells provides a model for studying molecular mechanisms of human cardiovascular development. Though it is known that chromatin modification patterns in ESCs differ markedly from those in lineage-committed progenitors and differentiated cells, the temporal dynamics of chromatin alterations during differentiation along a defined lineage have not been studied. We show that differentiation of human ESCs into cardiovascular cells is accompanied by programmed temporal alterations in chromatin structure that distinguish key regulators of cardiovascular development from other genes. We used this temporal chromatin signature to identify regulators of cardiac development, including the homeobox gene MEIS2. We demonstrate using the zebrafish model that MEIS2 is critical for proper heart tube formation and subsequent cardiac looping. Temporal chromatin signatures should be broadly applicable to other models of stem cell differentiation to identify regulators and provide key insights into major developmental decisions. PMID:22981225

Ligand-specific transcriptional mechanisms underlie aryl hydrocarbon receptor-mediated developmental toxicity of oxygenated PAHs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodale, B. C.; Geisel School of Medicine at Dartmouth, Hanover, NH; La Du, J.

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, butmore » only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Furthermore, identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds.« less

Ligand-specific transcriptional mechanisms underlie aryl hydrocarbon receptor-mediated developmental toxicity of oxygenated PAHs

DOE PAGES

Goodale, B. C.; Geisel School of Medicine at Dartmouth, Hanover, NH; La Du, J.; ...

2015-07-03

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, butmore » only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Furthermore, identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds.« less

Ligand-Specific Transcriptional Mechanisms Underlie Aryl Hydrocarbon Receptor-Mediated Developmental Toxicity of Oxygenated PAHs.

PubMed

Goodale, B C; La Du, J; Tilton, S C; Sullivan, C M; Bisson, W H; Waters, K M; Tanguay, R L

2015-10-01

Polycyclic aromatic hydrocarbons (PAHs) are priority environmental contaminants that exhibit mutagenic, carcinogenic, proinflammatory, and teratogenic properties. Oxygen-substituted PAHs (OPAHs) are formed during combustion processes and via phototoxidation and biological degradation of parent (unsubstituted) PAHs. Despite their prevalence both in contaminated industrial sites and in urban air, OPAH mechanisms of action in biological systems are relatively understudied. Like parent PAHs, OPAHs exert structure-dependent mutagenic activities and activation of the aryl hydrocarbon receptor (AHR) and cytochrome p450 metabolic pathway. Four-ring OPAHs 1,9-benz-10-anthrone (BEZO) and benz(a)anthracene-7,12-dione (7,12-B[a]AQ) cause morphological aberrations and induce markers of oxidative stress in developing zebrafish with similar potency, but only 7,12-B[a]AQ induces robust Cyp1a protein expression. We investigated the role of the AHR in mediating the toxicity of BEZO and 7,12-B[a]AQ, and found that knockdown of AHR2 rescued developmental effects caused by both compounds. Using RNA-seq and molecular docking, we identified transcriptional responses that precede developmental toxicity induced via differential interaction with AHR2. Redox-homeostasis genes were affected similarly by these OPAHs, while 7,12-B[a]AQ preferentially activated phase 1 metabolism and BEZO uniquely decreased visual system genes. Analysis of biological functions and upstream regulators suggests that BEZO is a weak AHR agonist, but interacts with other transcriptional regulators to cause developmental toxicity in an AHR-dependent manner. Identifying ligand-dependent AHR interactions and signaling pathways is essential for understanding toxicity of this class of environmentally relevant compounds. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Homeodomain protein Otp affects developmental neuropeptide switching in oxytocin neurons associated with a long-term effect on social behavior

PubMed Central

Wircer, Einav; Blechman, Janna; Borodovsky, Nataliya; Tsoory, Michael; Nunes, Ana Rita; Oliveira, Rui F; Levkowitz, Gil

2017-01-01

Proper response to stress and social stimuli depends on orchestrated development of hypothalamic neuronal circuits. Here we address the effects of the developmental transcription factor orthopedia (Otp) on hypothalamic development and function. We show that developmental mutations in the zebrafish paralogous gene otpa but not otpb affect both stress response and social preference. These behavioral phenotypes were associated with developmental alterations in oxytocinergic (OXT) neurons. Thus, otpa and otpb differentially regulate neuropeptide switching in a newly identified subset of OXT neurons that co-express the corticotropin-releasing hormone (CRH). Single-cell analysis revealed that these neurons project mostly to the hindbrain and spinal cord. Ablation of this neuronal subset specifically reduced adult social preference without affecting stress behavior, thereby uncoupling the contribution of a specific OXT cluster to social behavior from the general otpa−/− deficits. Our findings reveal a new role for Otp in controlling developmental neuropeptide balance in a discrete OXT circuit whose disrupted development affects social behavior. DOI: http://dx.doi.org/10.7554/eLife.22170.001 PMID:28094761

Phosphoproteomic analysis of the Chlamydia caviae elementary body and reticulate body forms

PubMed Central

Adams, Nancy E.; Maurelli, Anthony T.

2015-01-01

Chlamydia are Gram-negative, obligate intracellular bacteria responsible for significant diseases in humans and economically important domestic animals. These pathogens undergo a unique biphasic developmental cycle transitioning between the environmentally stable elementary body (EB) and the replicative intracellular reticulate body (RB), a conversion that appears to require extensive regulation of protein synthesis and function. However, Chlamydia possess a limited number of canonical mechanisms of transcriptional regulation. Ser/Thr/Tyr phosphorylation of proteins in bacteria has been increasingly recognized as an important mechanism of post-translational control of protein function. We utilized 2D gel electrophoresis coupled with phosphoprotein staining and MALDI-TOF/TOF analysis to map the phosphoproteome of the EB and RB forms of Chlamydia caviae. Forty-two non-redundant phosphorylated proteins were identified (some proteins were present in multiple locations within the gels). Thirty-four phosphorylated proteins were identified in EBs, including proteins found in central metabolism and protein synthesis, Chlamydia-specific hypothetical proteins and virulence-related proteins. Eleven phosphorylated proteins were identified in RBs, mostly involved in protein synthesis and folding and a single virulence-related protein. Only three phosphoproteins were found in both EB and RB phosphoproteomes. Collectively, 41 of 42 C. caviae phosphoproteins were present across Chlamydia species, consistent with the existence of a conserved chlamydial phosphoproteome. The abundance of stage-specific phosphoproteins suggests that protein phosphorylation may play a role in regulating the function of developmental-stage-specific proteins and/or may function in concert with other factors in directing EB–RB transitions. PMID:25998263

Identification and Expression Analysis of microRNAs at the Grain Filling Stage in Rice(Oryza sativa L.)via Deep Sequencing

PubMed Central

Yi, Rong; Zhu, Zhixuan; Hu, Jihong; Qian, Qian; Dai, Jincheng; Ding, Yi

2013-01-01

MicroRNAs (miRNAs) have been shown to play crucial roles in the regulation of plant development. In this study, high-throughput RNA-sequencing technology was used to identify novel miRNAs, and to reveal miRNAs expression patterns at different developmental stages during rice (Oryza sativa L.) grain filling. A total of 434 known miRNAs (380, 402, 390 and 392 at 5, 7, 12 and 17 days after fertilization, respectively.) were obtained from rice grain. The expression profiles of these identified miRNAs were analyzed and the results showed that 161 known miRNAs were differentially expressed during grain development, a high proportion of which were up-regulated from 5 to 7 days after fertilization. In addition, sixty novel miRNAs were identified, and five of these were further validated experimentally. Additional analysis showed that the predicted targets of the differentially expressed miRNAs may participate in signal transduction, carbohydrate and nitrogen metabolism, the response to stimuli and epigenetic regulation. In this study, differences were revealed in the composition and expression profiles of miRNAs among individual developmental stages during the rice grain filling process, and miRNA editing events were also observed, analyzed and validated during this process. The results provide novel insight into the dynamic profiles of miRNAs in developing rice grain and contribute to the understanding of the regulatory roles of miRNAs in grain filling. PMID:23469249

Phosphoproteomic analysis of the Chlamydia caviae elementary body and reticulate body forms.

PubMed

Fisher, Derek J; Adams, Nancy E; Maurelli, Anthony T

2015-08-01

Chlamydia are Gram-negative, obligate intracellular bacteria responsible for significant diseases in humans and economically important domestic animals. These pathogens undergo a unique biphasic developmental cycle transitioning between the environmentally stable elementary body (EB) and the replicative intracellular reticulate body (RB), a conversion that appears to require extensive regulation of protein synthesis and function. However, Chlamydia possess a limited number of canonical mechanisms of transcriptional regulation. Ser/Thr/Tyr phosphorylation of proteins in bacteria has been increasingly recognized as an important mechanism of post-translational control of protein function. We utilized 2D gel electrophoresis coupled with phosphoprotein staining and MALDI-TOF/TOF analysis to map the phosphoproteome of the EB and RB forms of Chlamydia caviae. Forty-two non-redundant phosphorylated proteins were identified (some proteins were present in multiple locations within the gels). Thirty-four phosphorylated proteins were identified in EBs, including proteins found in central metabolism and protein synthesis, Chlamydia-specific hypothetical proteins and virulence-related proteins. Eleven phosphorylated proteins were identified in RBs, mostly involved in protein synthesis and folding and a single virulence-related protein. Only three phosphoproteins were found in both EB and RB phosphoproteomes. Collectively, 41 of 42 C. caviae phosphoproteins were present across Chlamydia species, consistent with the existence of a conserved chlamydial phosphoproteome. The abundance of stage-specific phosphoproteins suggests that protein phosphorylation may play a role in regulating the function of developmental-stage-specific proteins and/or may function in concert with other factors in directing EB-RB transitions.

An integrative review of ethnic and cultural variation in socialization and children's self-regulation.

PubMed

LeCuyer, Elizabeth A; Zhang, Yi

2015-04-01

To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.

RNA-Sequencing Analysis Reveals a Regulatory Role for Transcription Factor Fezf2 in the Mature Motor Cortex

PubMed Central

Clare, Alison J.; Wicky, Hollie E.; Empson, Ruth M.; Hughes, Stephanie M.

2017-01-01

Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their expression could contribute to the progression of disease phenotypes. PMID:28936162

Single-nucleus analysis of accessible chromatin in developing mouse forebrain reveals cell-type-specific transcriptional regulation.

PubMed

Preissl, Sebastian; Fang, Rongxin; Huang, Hui; Zhao, Yuan; Raviram, Ramya; Gorkin, David U; Zhang, Yanxiao; Sos, Brandon C; Afzal, Veena; Dickel, Diane E; Kuan, Samantha; Visel, Axel; Pennacchio, Len A; Zhang, Kun; Ren, Bing

2018-03-01

Analysis of chromatin accessibility can reveal transcriptional regulatory sequences, but heterogeneity of primary tissues poses a significant challenge in mapping the precise chromatin landscape in specific cell types. Here we report single-nucleus ATAC-seq, a combinatorial barcoding-assisted single-cell assay for transposase-accessible chromatin that is optimized for use on flash-frozen primary tissue samples. We apply this technique to the mouse forebrain through eight developmental stages. Through analysis of more than 15,000 nuclei, we identify 20 distinct cell populations corresponding to major neuronal and non-neuronal cell types. We further define cell-type-specific transcriptional regulatory sequences, infer potential master transcriptional regulators and delineate developmental changes in forebrain cellular composition. Our results provide insight into the molecular and cellular dynamics that underlie forebrain development in the mouse and establish technical and analytical frameworks that are broadly applicable to other heterogeneous tissues.

Genome-wide identification of long non-coding RNA genes and their association with insecticide resistance and metamorphosis in diamondback moth, Plutella xylostella.

PubMed

Liu, Feiling; Guo, Dianhao; Yuan, Zhuting; Chen, Chen; Xiao, Huamei

2017-11-20

Long non-coding RNA (lncRNA) is a class of noncoding RNA >200 bp in length that has essential roles in regulating a variety of biological processes. Here, we constructed a computational pipeline to identify lncRNA genes in the diamondback moth (Plutella xylostella), a major insect pest of cruciferous vegetables. In total, 3,324 lncRNAs corresponding to 2,475 loci were identified from 13 RNA-Seq datasets, including samples from parasitized, insecticide-resistant strains and different developmental stages. The identified P. xylostella lncRNAs had shorter transcripts and fewer exons than protein-coding genes. Seven out of nine randomly selected lncRNAs were validated by strand-specific RT-PCR. In total, 54-172 lncRNAs were specifically expressed in the insecticide resistant strains, among which one lncRNA was located adjacent to the sodium channel gene. In addition, 63-135 lncRNAs were specifically expressed in different developmental stages, among which three lncRNAs overlapped or were located adjacent to the metamorphosis-associated genes. These lncRNAs were either strongly or weakly co-expressed with their overlapping or neighboring mRNA genes. In summary, we identified thousands of lncRNAs and presented evidence that lncRNAs might have key roles in conferring insecticide resistance and regulating the metamorphosis development in P. xylostella.

Square cell packing in the Drosophila embryo through spatiotemporally regulated EGF receptor signaling

PubMed Central

Tamada, Masako; Zallen, Jennifer A.

2015-01-01

Summary Cells display dynamic and diverse morphologies during development, but the strategies by which differentiated tissues achieve precise shapes and patterns are not well understood. Here we identify a developmental program that generates a highly ordered square cell grid in the Drosophila embryo through sequential and spatially regulated cell alignment, oriented cell division, and apicobasal cell elongation. The basic leucine zipper transcriptional regulator Cnc is necessary and sufficient to produce a square cell grid in the presence of a midline signal provided by the EGF receptor ligand, Spitz. Spitz orients cell divisions through a Pins/LGN-dependent spindle positioning mechanism and controls cell shape and alignment through a transcriptional pathway that requires the Pointed ETS domain protein. These results identify a strategy for producing ordered square cell packing configurations in epithelia and reveal a molecular mechanism by which organized tissue structure is generated through spatiotemporally regulated responses to EGF receptor activation. PMID:26506305

BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

PubMed

Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

2010-08-01

Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

New insights into the mechanism of phthalate-induced developmental effects.

PubMed

Mu, Xiyan; Huang, Ying; Li, Jia; Yang, Ke; Yang, Wenbo; Shen, Gongming; Li, Xuxing; Lei, Yunlei; Pang, Sen; Wang, Chengju; Li, Xuefeng; Li, Yingren

2018-06-11

To investigate the biological pathways involved in phthalate-induced developmental effects, zebrafish embryos were exposed to different concentrations of di-(2-ethylhexyl) (DEHP) and di-butyl phthalate (DBP) for 96 h. Embryonic exposure to DEHP and DBP induced body length decrease, yolk sac abnormities, and immune responses (up-regulation of immune proteins and genes). The lipidomic results showed that at a concentration of 50 μg/L, DEHP and DBP significantly reduced the levels of fatty acids, triglycerides, diacylglycerol, and cholesterol. These effects are partly explained by biological pathway enrichment based on data from the transcriptional and proteomic profiles. Co-exposure to DBP and ER antagonist did not significantly relieve the toxic symptoms compared with exposure to DBP alone. This indicates that phthalate-induced developmental abnormities in zebrafish might not be mediated by the ER pathway. In conclusion, we identified the possible biological pathways that mediate phthalate-induced developmental effects and found that these effects may not be driven by estrogenic activation. Copyright © 2018 Elsevier Ltd. All rights reserved.

Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

PubMed

Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

2016-01-01

Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators were known to be involved in muscle and adipose tissues development, but others not previously associated with pig muscle growth were also identified, as PVALB, KLF1 or IRF2. The present study discloses potential molecular mechanisms underlying phenotypic differences observed between IB and IBxDU pigs and highlights candidate genes implicated in these molecular mechanisms.

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

PubMed Central

Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

2017-01-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf

PubMed Central

Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

2017-01-01

Black rice (Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3–10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf. PMID:29244752

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Loss of FTO antagonises Wnt signaling and leads to developmental defects associated with ciliopathies.

PubMed

Osborn, Daniel P S; Roccasecca, Rosa Maria; McMurray, Fiona; Hernandez-Hernandez, Victor; Mukherjee, Sriparna; Barroso, Inês; Stemple, Derek; Cox, Roger; Beales, Philip L; Christou-Savina, Sonia

2014-01-01

Common intronic variants in the Human fat mass and obesity-associated gene (FTO) are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish) and in vitro (Fto(-/-) MEFs and HEK293T). Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+) pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.

Endocrine-Disrupting Chemicals and Public Health Protection: A Statement of Principles from The Endocrine Society

PubMed Central

Brown, T. R.; Doan, L. L.; Gore, A. C.; Skakkebaek, N. E.; Soto, A. M.; Woodruff, T. J.; Vom Saal, F. S.

2012-01-01

An endocrine-disrupting chemical (EDC) is an exogenous chemical, or mixture of chemicals, that can interfere with any aspect of hormone action. The potential for deleterious effects of EDC must be considered relative to the regulation of hormone synthesis, secretion, and actions and the variability in regulation of these events across the life cycle. The developmental age at which EDC exposures occur is a critical consideration in understanding their effects. Because endocrine systems exhibit tissue-, cell-, and receptor-specific actions during the life cycle, EDC can produce complex, mosaic effects. This complexity causes difficulty when a static approach to toxicity through endocrine mechanisms driven by rigid guidelines is used to identify EDC and manage risk to human and wildlife populations. We propose that principles taken from fundamental endocrinology be employed to identify EDC and manage their risk to exposed populations. We emphasize the importance of developmental stage and, in particular, the realization that exposure to a presumptive “safe” dose of chemical may impact a life stage when there is normally no endogenous hormone exposure, thereby underscoring the potential for very low-dose EDC exposures to have potent and irreversible effects. Finally, with regard to the current program designed to detect putative EDC, namely, the Endocrine Disruptor Screening Program, we offer recommendations for strengthening this program through the incorporation of basic endocrine principles to promote further understanding of complex EDC effects, especially due to developmental exposures. PMID:22733974

Plastic flies: the regulation and evolution of trait variability in Drosophila.

PubMed

Shingleton, Alexander W; Tang, Hui Yuan

2012-01-01

Individuals within species and populations vary. Such variation arises through environmental and genetic factors and ensures that no two individuals are identical. However, it is clear that not all traits show the same degree of intraspecific variation. Some traits, in particular secondary sexual characteristics used by males to compete for and attract females, are extremely variable among individuals in a population. Other traits, for example brain size in mammals, are not. Recent research has begun to explore the possibility that the extent of phenotypic variation (here referred to as "variability") may be a character itself and subject to natural selection. While these studies support the concept of variability as an evolvable trait, controversy remains over what precisely the trait is. At the heart of this controversy is the fact that there are very few examples of developmental mechanisms that regulate trait variability in response to any source of variation, be it environmental or genetic. Here, we describe a recent study from our laboratory that identifies such a mechanism. We then place the study in the context of current research on the regulation of trait variability, and discuss the implications for our understanding of the developmental regulation and evolution of phenotypic variation.

Identification of a NAC transcription factor, EPHEMERAL1, that controls petal senescence in Japanese morning glory.

PubMed

Shibuya, Kenichi; Shimizu, Keiichi; Niki, Tomoko; Ichimura, Kazuo

2014-09-01

In flowering plants, floral longevity is species-specific and is closely linked to reproductive strategy; petal senescence, a type of programmed cell death (PCD), is a highly regulated developmental process. However, little is known about regulatory pathways for cell death in petal senescence, which is developmentally controlled in an age-dependent manner. Here, we show that a NAC transcription factor, designated EPHEMERAL1 (EPH1), positively regulates PCD during petal senescence in the ephemeral flowers of Japanese morning glory (Ipomoea nil). EPH1 expression is induced independently of ethylene signaling, and suppression of EPH1 resulted in Japanese morning glory flowers that are in bloom until the second day. The suppressed expression of EPH1 delays progression of PCD, possibly through suppression of the expression of PCD-related genes, including genes for plant caspase and autophagy in the petals. Our data further suggest that EPH1 is involved in the regulation of ethylene-accelerated petal senescence. In this study, we identified a key regulator of PCD in petal senescence, which will facilitate further elucidation of the regulatory network of petal senescence. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Tyrosine pathway regulation is host-mediated in the pea aphid symbiosis during late embryonic and early larval development.

PubMed

Rabatel, Andréane; Febvay, Gérard; Gaget, Karen; Duport, Gabrielle; Baa-Puyoulet, Patrice; Sapountzis, Panagiotis; Bendridi, Nadia; Rey, Marjolaine; Rahbé, Yvan; Charles, Hubert; Calevro, Federica; Colella, Stefano

2013-04-10

Nutritional symbioses play a central role in insects' adaptation to specialized diets and in their evolutionary success. The obligatory symbiosis between the pea aphid, Acyrthosiphon pisum, and the bacterium, Buchnera aphidicola, is no exception as it enables this important agricultural pest insect to develop on a diet exclusively based on plant phloem sap. The symbiotic bacteria provide the host with essential amino acids lacking in its diet but necessary for the rapid embryonic growth seen in the parthenogenetic viviparous reproduction of aphids. The aphid furnishes, in exchange, non-essential amino acids and other important metabolites. Understanding the regulations acting on this integrated metabolic system during the development of this insect is essential in elucidating aphid biology. We used a microarray-based approach to analyse gene expression in the late embryonic and the early larval stages of the pea aphid, characterizing, for the first time, the transcriptional profiles in these developmental phases. Our analyses allowed us to identify key genes in the phenylalanine, tyrosine and dopamine pathways and we identified ACYPI004243, one of the four genes encoding for the aspartate transaminase (E.C. 2.6.1.1), as specifically regulated during development. Indeed, the tyrosine biosynthetic pathway is crucial for the symbiotic metabolism as it is shared between the two partners, all the precursors being produced by B. aphidicola. Our microarray data are supported by HPLC amino acid analyses demonstrating an accumulation of tyrosine at the same developmental stages, with an up-regulation of the tyrosine biosynthetic genes. Tyrosine is also essential for the synthesis of cuticular proteins and it is an important precursor for cuticle maturation: together with the up-regulation of tyrosine biosynthesis, we observed an up-regulation of cuticular genes expression. We were also able to identify some amino acid transporter genes which are essential for the switch over to the late embryonic stages in pea aphid development. Our data show that, in the development of A. pisum, a specific host gene set regulates the biosynthetic pathways of amino acids, demonstrating how the regulation of gene expression enables an insect to control the production of metabolites crucial for its own development and symbiotic metabolism.

Shavenbaby Couples Patterning to Epidermal Cell Shape Control

PubMed Central

Fernandes, Isabelle; Roch, Fernando; Payre, François

2006-01-01

It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes). It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms. PMID:16933974

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats.

PubMed

Beaudin, Stephane A; Strupp, Barbara J; Strawderman, Myla; Smith, Donald R

2017-02-01

Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1-21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230-237; http://dx.doi.org/10.1289/EHP258.

Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats

PubMed Central

Beaudin, Stephane A.; Strupp, Barbara J.; Strawderman, Myla; Smith, Donald R.

2016-01-01

Background: Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. Objectives: To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Methods: Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1–21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Results: Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. Conclusions: This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230–237; http://dx.doi.org/10.1289/EHP258 PMID:27384154

A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

PubMed

Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

2017-03-01

A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

Identification of High-Temperature-Responsive Genes in Cereals1[C][W

PubMed Central

Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

2012-01-01

High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

Developmental Regulation across the Life Span: Toward a New Synthesis

ERIC Educational Resources Information Center

Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

2013-01-01

How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

Regulatory Role of N6 -methyladenosine (m6 A) Methylation in RNA Processing and Human Diseases.

PubMed

Wei, Wenqiang; Ji, Xinying; Guo, Xiangqian; Ji, Shaoping

2017-09-01

N 6 -methyladenosine (m 6 A) modification is an abundant and conservative RNA modification in bacterial and eukaryotic cells. m 6 A modification mainly occurs in the 3' untranslated regions (UTRs) and near the stop codons of mRNA. Diverse strategies have been developed for identifying m 6 A sites in single nucleotide resolution. Dynamic regulation of m 6 A is found in metabolism, embryogenesis, and developmental processes, indicating a possible epigenetic regulation role along RNA processing and exerting biological functions. It has been known that m 6 A editing involves in nuclear RNA export, mRNA degradation, protein translation, and RNA splicing. Deficiency of m 6 A modification will lead to kinds of diseases, such as obesity, cancer, type 2 diabetes mellitus (T2DM), infertility, and developmental arrest. Some specific inhibitors against methyltransferase and demethylase have been developed to selectively regulate m 6 A modification, which may be advantageous for treatment of m 6 A related diseases. J. Cell. Biochem. 118: 2534-2543, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs

PubMed Central

Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De

2015-01-01

Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for the low reproductive efficiency reported in other obese breeds. The ovarian developmental potential was found to be greater in Meishan pigs than in Yorkshire pigs. PMID:26305539

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

The Development of Self-Regulation across Early Childhood

PubMed Central

Montroy, Janelle J.; Bowles, Ryan P.; Skibbe, Lori E.; McClelland, Megan M.; Morrison, Frederick J.

2016-01-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of three and seven, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across three diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow three distinct developmental patterns of growth. These three trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds with implications for offering individualized support across children. PMID:27709999

MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

PubMed Central

Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

2010-01-01

Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

Mining secreted proteins that function in pepper fruit development and ripening using a yeast secretion trap (YST)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Je Min, E-mail: jemin@knu.ac.kr; Department of Horticultural Science, Kyungpook National University, Daegu; Lee, Sang-Jik

Highlights: • Yeast secretion trap (YST) is a valuable tool for mining secretome. • A total of 80 secreted proteins are newly identified via YST in pepper fruits. • The secreted proteins are differentially regulated during pepper development and ripening. • Transient GFP-fusion assay and in planta secretion trap can effectively validate the secretion of proteins. - Abstract: Plant cells secrete diverse sets of constitutively- and conditionally-expressed proteins under various environmental and developmental states. Secreted protein populations, or secretomes have multiple functions, including defense responses, signaling, metabolic processes, and developmental regulation. To identify genes encoding secreted proteins that function inmore » fruit development and ripening, a yeast secretion trap (YST) screen was employed using pepper (Capsicum annuum) fruit cDNAs. The YST screen revealed 80 pepper fruit-related genes (CaPFRs) encoding secreted proteins including cell wall proteins, several of which have not been previously described. Transient GFP-fusion assay and an in planta secretion trap were used to validate the secretion of proteins encoded by selected YST clones. In addition, RNA gel blot analyses provided further insights into their expression and regulation during fruit development and ripening. Integrating our data, we conclude that the YST provides a valuable functional genomics tool for the identification of substantial numbers of novel secreted plant proteins that are associated with biological processes, including fruit development and ripening.« less

The flowering hormone florigen functions as a general systemic regulator of growth and termination

PubMed Central

Shalit, Akiva; Rozman, Alexander; Goldshmidt, Alexander; Alvarez, John P.; Bowman, John L.; Eshed, Yuval; Lifschitz, Eliezer

2009-01-01

The florigen paradigm implies a universal flowering-inducing hormone that is common to all flowering plants. Recent work identified FT orthologues as originators of florigen and their polypeptides as the likely systemic agent. However, the developmental processes targeted by florigen remained unknown. Here we identify local balances between SINGLE FLOWER TRUSS (SFT), the tomato precursor of florigen, and SELF-PRUNING (SP), a potent SFT-dependent SFT inhibitor as prime targets of mobile florigen. The graft-transmissible impacts of florigen on organ-specific traits in perennial tomato show that in addition to import by shoot apical meristems, florigen is imported by organs in which SFT is already expressed. By modulating local SFT/SP balances, florigen confers differential flowering responses of primary and secondary apical meristems, regulates the reiterative growth and termination cycles typical of perennial plants, accelerates leaf maturation, and influences the complexity of compound leaves, the growth of stems and the formation of abscission zones. Florigen is thus established as a plant protein functioning as a general growth hormone. Developmental interactions and a phylogenetic analysis suggest that the SFT/SP regulatory hierarchy is a recent evolutionary innovation unique to flowering plants. PMID:19416824

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Genetical Toxicogenomics in Drosophila Identifies Master Modulatory Loci that are Regulated by Developmental Exposure to Lead

PubMed Central

Ruden, Douglas M.; Chen, Lang; Possidente, Debra; Possidente, Bernard; Rasouli, Parsa; Wang, Luan; Lu, Xiangyi; Garfinkel, Mark D.; Hirsch, Helmut V. B.; Page, Grier P.

2009-01-01

The genetics of gene expression in recombinant inbred lines (RILs) can be mapped as expression quantitative trait loci (eQTLs). So-called “genetical genomics” studies have identified locally-acting eQTLs (cis-eQTLs) for genes that show differences in steady state RNA levels. These studies have also identified distantly-acting master-modulatory trans-eQTLs that regulate tens or hundreds of transcripts (hotspots or transbands). We expand on these studies by performing genetical genomics experiments in two environments in order to identify trans-eQTL that might be regulated by developmental exposure to the neurotoxin lead. Flies from each of 75 RIL were raised from eggs to adults on either control food (made with 250 µM sodium acetate), or lead-treated food (made with 250 µM lead acetate, PbAc). RNA expression analyses of whole adult male flies (5–10 days old) were performed with Affymetrix DrosII whole genome arrays (18,952 probesets). Among the 1,389 genes with cis-eQTL, there were 405 genes unique to control flies and 544 genes unique to lead-treated ones (440 genes had the same cis-eQTLs in both samples). There are 2,396 genes with trans-eQTL which mapped to 12 major transbands with greater than 95 genes. Permutation analyses of the strain labels but not the expression data suggests that the total number of eQTL and the number of transbands are more important criteria for validation than the size of the transband. Two transbands, one located on the 2nd chromosome and one on the 3rd chromosome, co-regulate 33 lead-induced genes, many of which are involved in neurodevelopmental processes. For these 33 genes, rather than allelic variation at one locus exerting differential effects in two environments, we found that variation at two different loci are required for optimal effects on lead-induced expression. PMID:19737576

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

PubMed

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome Analysis Identified a Novel Mutation in the RBP4 Gene in a Consanguineous Pedigree with Retinal Dystrophy and Developmental Abnormalities

PubMed Central

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V.; Chavali, Venkata R. M.; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G. Bhanuprakash; Sieving, Paul A.; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism. PMID:23189188

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma

PubMed Central

Gilmore, Sarah A.; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-01-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5’ leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature. PMID:26177267

Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma.

PubMed

Gilmore, Sarah A; Voorhies, Mark; Gebhart, Dana; Sil, Anita

2015-07-01

Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5' leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature.

The Development of Emotional and Behavioral Self-Regulation and Their Effects on Academic Achievement in Childhood

ERIC Educational Resources Information Center

Edossa, Ashenafi Kassahun; Schroeders, Ulrich; Weinert, Sabine; Artelt, Cordula

2018-01-01

Self-regulation is an essential ability of children to cope with various developmental challenges. This study examines the developmental interplay between emotional and behavioral self-regulation during childhood and the relationship with academic achievement using data from the longitudinal Millennium Cohort Study (UK). Using cross-lagged panel…

Developmental Origins of Infant Emotion Regulation: Mediation by Temperamental Negativity and Moderation by Maternal Sensitivity

ERIC Educational Resources Information Center

Thomas, Jenna C.; Letourneau, Nicole; Campbell, Tavis S.; Tomfohr-Madsen, Lianne; Giesbrecht, Gerald F.

2017-01-01

Emotion regulation is essential to cognitive, social, and emotional development and difficulties with emotion regulation portend future socioemotional, academic, and behavioral difficulties. There is growing awareness that many developmental outcomes previously thought to begin their development in the postnatal period have their origins in the…

De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

PubMed

Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

2017-11-01

Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

Conservation in the involvement of heterochronic genes and hormones during developmental transitions.

PubMed

Faunes, Fernando; Larraín, Juan

2016-08-01

Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

PubMed Central

Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

2017-01-01

The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

Deep Sequencing of the Medicago truncatula Root Transcriptome Reveals a Massive and Early Interaction between Nodulation Factor and Ethylene Signals1[OPEN

PubMed Central

Larrainzar, Estíbaliz; Riely, Brendan K.; Kim, Sang Cheol; Carrasquilla-Garcia, Noelia; Yu, Hee-Ju; Hwang, Hyun-Ju; Oh, Mijin; Kim, Goon Bo; Surendrarao, Anandkumar K.; Chasman, Deborah; Siahpirani, Alireza F.; Penmetsa, Ramachandra V.; Lee, Gang-Seob; Kim, Namshin; Roy, Sushmita; Mun, Jeong-Hwan; Cook, Douglas R.

2015-01-01

The legume-rhizobium symbiosis is initiated through the activation of the Nodulation (Nod) factor-signaling cascade, leading to a rapid reprogramming of host cell developmental pathways. In this work, we combine transcriptome sequencing with molecular genetics and network analysis to quantify and categorize the transcriptional changes occurring in roots of Medicago truncatula from minutes to days after inoculation with Sinorhizobium medicae. To identify the nature of the inductive and regulatory cues, we employed mutants with absent or decreased Nod factor sensitivities (i.e. Nodulation factor perception and Lysine motif domain-containing receptor-like kinase3, respectively) and an ethylene (ET)-insensitive, Nod factor-hypersensitive mutant (sickle). This unique data set encompasses nine time points, allowing observation of the symbiotic regulation of diverse biological processes with high temporal resolution. Among the many outputs of the study is the early Nod factor-induced, ET-regulated expression of ET signaling and biosynthesis genes. Coupled with the observation of massive transcriptional derepression in the ET-insensitive background, these results suggest that Nod factor signaling activates ET production to attenuate its own signal. Promoter:β-glucuronidase fusions report ET biosynthesis both in root hairs responding to rhizobium as well as in meristematic tissue during nodule organogenesis and growth, indicating that ET signaling functions at multiple developmental stages during symbiosis. In addition, we identified thousands of novel candidate genes undergoing Nod factor-dependent, ET-regulated expression. We leveraged the power of this large data set to model Nod factor- and ET-regulated signaling networks using MERLIN, a regulatory network inference algorithm. These analyses predict key nodes regulating the biological process impacted by Nod factor perception. We have made these results available to the research community through a searchable online resource. PMID:26175514

Poly(A) tail length regulates PABPC1 expression to tune translation in the heart.

PubMed

Chorghade, Sandip; Seimetz, Joseph; Emmons, Russell; Yang, Jing; Bresson, Stefan M; Lisio, Michael De; Parise, Gianni; Conrad, Nicholas K; Kalsotra, Auinash

2017-06-27

The rate of protein synthesis in the adult heart is one of the lowest in mammalian tissues, but it increases substantially in response to stress and hypertrophic stimuli through largely obscure mechanisms. Here, we demonstrate that regulated expression of cytosolic poly(A)-binding protein 1 (PABPC1) modulates protein synthetic capacity of the mammalian heart. We uncover a poly(A) tail-based regulatory mechanism that dynamically controls PABPC1 protein synthesis in cardiomyocytes and thereby titrates cellular translation in response to developmental and hypertrophic cues. Our findings identify PABPC1 as a direct regulator of cardiac hypertrophy and define a new paradigm of gene regulation in the heart, where controlled changes in poly(A) tail length influence mRNA translation.

Maternal abuse history and self-regulation difficulties in preadolescence

PubMed Central

Delker, Brianna C.; Noll, Laura K.; Kim, Hyoun K.; Fisher, Philip A.

2014-01-01

Although poor parenting is known to be closely linked to self-regulation difficulties in early childhood, comparatively little is understood about the role of other risk factors in the early caregiving environment (such as a parent’s own experiences of childhood abuse) in developmental pathways of self-regulation into adolescence. Using a longitudinal design, this study aimed to examine how a mother’s history of abuse in childhood relates to her offspring’s self-regulation difficulties in preadolescence. Maternal controlling parenting and exposure to intimate partner aggression in the child’s first 24–36 months were examined as important early social and environmental influences that may explain the proposed connection between maternal abuse history and preadolescent self-regulation. An ethnically diverse sample of mothers (N = 488) who were identified as at-risk for child maltreatment was recruited at the time of their children’s birth. Mothers and their children were assessed annually from the child’s birth through 36 months, and at age 9–11 years. Structural equation modeling and bootstrap tests of indirect effects were conducted to address the study aims. Findings indicated that maternal abuse history indirectly predicted their children’s self-regulation difficulties in preadolescence mainly through maternal controlling parenting in early childhood, but not through maternal exposure to aggression by an intimate partner. Maternal history of childhood abuse and maternal controlling parenting in her child’s early life may have long-term developmental implications for child self-regulation. PMID:25459984

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders.

PubMed

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M; Weinberger, Daniel R; Kleinman, Joel E; Law, Amanda J

2017-03-01

Genes implicated in schizophrenia are enriched in networks differentially regulated during human CNS development. Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Isoform-specific increases in NRG3 are observed in schizophrenia and associated with rs10748842, a NRG3 risk polymorphism, suggesting NRG3 transcriptional dysregulation as a molecular mechanism of risk. The authors quantitatively mapped the temporal trajectories of NRG3 isoforms (classes I-IV) in the neocortex throughout the human lifespan, examined whether tissue-specific regulation of NRG3 occurs in humans, and determined if abnormalities in NRG3 transcriptomics occur in mood disorders and are genetically determined. NRG3 isoform classes I-IV were quantified using quantitative real-time polymerase chain reaction in human postmortem dorsolateral prefrontal cortex from 286 nonpsychiatric control individuals, from gestational week 14 to 85 years old, and individuals diagnosed with either bipolar disorder (N=34) or major depressive disorder (N=69). Tissue-specific mapping was investigated in several human tissues. rs10748842 was genotyped in individuals with mood disorders, and association with NRG3 isoform expression examined. NRG3 classes displayed individually specific expression trajectories across human neocortical development and aging; classes I, II, and IV were significantly associated with developmental stage. NRG3 class I was increased in bipolar and major depressive disorder, consistent with observations in schizophrenia. NRG3 class II was increased in bipolar disorder, and class III was increased in major depression. The rs10748842 risk genotype predicted elevated class II and III expression, consistent with previous reports in the brain, with tissue-specific analyses suggesting that classes II and III are brain-specific isoforms of NRG3. Mapping the temporal expression of genes during human brain development provides vital insight into gene function and identifies critical sensitive periods whereby genetic factors may influence risk for psychiatric disease. Here the authors provide comprehensive insight into the transcriptional landscape of the psychiatric risk gene, NRG3, in human neocortical development and expand on previous findings in schizophrenia to identify increased expression of developmentally and genetically regulated isoforms in the brain of patients with mood disorders. Principally, the finding that NRG3 classes II and III are brain-specific isoforms predicted by rs10748842 risk genotype and are increased in mood disorders further implicates a molecular mechanism of psychiatric risk at the NRG3 locus and identifies a potential developmental role for NRG3 in bipolar disorder and major depression. These observations encourage investigation of the neurobiology of NRG3 isoforms and highlight inhibition of NRG3 signaling as a potential target for psychiatric treatment development.

Temporal, Diagnostic, and Tissue-Specific Regulation of NRG3 Isoform Expression in Human Brain Development and Affective Disorders

PubMed Central

Paterson, Clare; Wang, Yanhong; Hyde, Thomas M.; Weinberger, Daniel R.; Kleinman, Joel E.; Law, Amanda J.

2018-01-01

Objective Genes implicated in schizophrenia are enriched in networks differentially regulated during human CNS development. Neuregulin 3 (NRG3), a brain-enriched neurotrophin, undergoes alternative splicing and is implicated in several neurological disorders with developmental origins. Isoform-specific increases in NRG3 are observed in schizophrenia and associated with rs10748842, a NRG3 risk polymorphism, suggesting NRG3 transcriptional dysregulation as a molecular mechanism of risk. The authors quantitatively mapped the temporal trajectories of NRG3 isoforms (classes I–IV) in the neocortex throughout the human lifespan, examined whether tissue-specific regulation of NRG3 occurs in humans, and determined if abnormalities in NRG3 transcriptomics occur in mood disorders and are genetically determined. Method NRG3 isoform classes I–IV were quantified using quantitative real-time polymerase chain reaction in human postmortem dorsolateral prefrontal cortex from 286 nonpsychiatric control individuals, from gestational week 14 to 85 years old, and individuals diagnosed with either bipolar disorder (N=34) or major depressive disorder (N=69). Tissue-specific mapping was investigated in several human tissues. rs10748842 was genotyped in individuals with mood disorders, and association with NRG3 isoform expression examined. Results NRG3 classes displayed individually specific expression trajectories across human neocortical development and aging; classes I, II, and IV were significantly associated with developmental stage. NRG3 class I was increased in bipolar and major depressive disorder, consistent with observations in schizophrenia. NRG3 class II was increased in bipolar disorder, and class III was increased in major depression. The rs10748842 risk genotype predicted elevated class II and III expression, consistent with previous reports in the brain, with tissue-specific analyses suggesting that classes II and III are brain-specific isoforms of NRG3. Conclusions Mapping the temporal expression of genes during human brain development provides vital insight into gene function and identifies critical sensitive periods whereby genetic factors may influence risk for psychiatric disease. Here the authors provide comprehensive insight into the transcriptional landscape of the psychiatric risk gene, NRG3, in human neocortical development and expand on previous findings in schizophrenia to identify increased expression of developmentally and genetically regulated isoforms in the brain of patients with mood disorders. Principally, the finding that NRG3 classes II and III are brain-specific isoforms predicted by rs10748842 risk genotype and are increased in mood disorders further implicates a molecular mechanism of psychiatric risk at the NRG3 locus and identifies a potential developmental role for NRG3 in bipolar disorder and major depression. These observations encourage investigation of the neurobiology of NRG3 isoforms and highlight inhibition of NRG3 signaling as a potential target for psychiatric treatment development. PMID:27771971

Self-Regulation and Math Attitudes: Effects on Academic Performance in Developmental Math Courses at a Community College

ERIC Educational Resources Information Center

Otts, Cynthia D.

2010-01-01

The purpose of the study was to investigate the relationship among math attitudes, self-regulated learning, and course outcomes in developmental math. Math attitudes involved perceived usefulness of math and math anxiety. Self-regulated learning represented the ability of students to control cognitive, metacognitive, and behavioral aspects of…

Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

ERIC Educational Resources Information Center

de Oliveira, Rita F.; Wann, John P.

2011-01-01

In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

Identification and expression analysis of a novel stylicin antimicrobial peptide from Kuruma shrimp (Marsupenaeus japonicus).

PubMed

Liu, Hong-tao; Wang, Jun; Mao, Yong; Liu, Min; Niu, Su-fang; Qiao, Ying; Su, Yong-quan; Wang, Chun-zhong; Zheng, Zhi-peng

2015-12-01

Antimicrobial peptides (AMPs) are important components of the innate immune system and function as the first line of defense against invading pathogens. In current study we identified, cloned and characterized a novel stylicin AMP from Kuruma shrimp Marsupenaeus japonicus (Mj-sty). The full-length cDNA of Mj-sty was 428 bp with an open reading frame of 315 bp that encoded 104 amino acids. The theoretical molecular mass of mature Mj-sty was 8.693 kDa with an isoelectric point (pI) of 4.79. A proline-rich N-terminal region and a C-terminal region contained 13 cysteine residues were identified. Genomic sequence analysis with respect to its cDNA showed that Mj-sty was organized into two exons interrupted by one intron. Tissue-specific expression revealed that Mj-sty was mainly transcribed in gills and hemocytes. Expression of Mj-sty in early developmental stages demonstrated that Mj-sty mRNA were present from fertilized eggs to post-larvae of 17 days (PL17), and the expression levels showed a significant variation in different developmental stages. After challenge of white spot syndrome virus (WSSV), the time-dependent expression pattern of Mj-sty in both gills and hepatopancrease showed down-regulation at the early hours of infection, subsequently up-regulation and down-regulation, and then up-regulation at the end hours to almost the half of the controls. The results indicate that Mj-sty is potentially involved in the ontogenesis and immune responses against WSSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

The developmental transcriptome atlas of the spoon worm Urechis unicinctus (Echiurida: Annelida).

PubMed

Park, Chungoo; Han, Yong-Hee; Lee, Sung-Gwon; Ry, Kyoung-Bin; Oh, Jooseong; Kern, Elizabeth M A; Park, Joong-Ki; Cho, Sung-Jin

2018-03-01

Echiurida is one of the most intriguing major subgroups of annelida because, unlike most other annelids, echiurids lack metameric body segmentation as adults. For this reason, transcriptome analyses from various developmental stages of echiurid species can be of substantial value for understanding precise expression levels and the complex regulatory networks during early and larval development. A total of 914 million raw RNA-Seq reads were produced from 14 developmental stages of Urechis unicinctus and were de novo assembled into contigs spanning 63,928,225 bp with an N50 length of 2700 bp. The resulting comprehensive transcriptome database of the early developmental stages of U. unicinctus consists of 20,305 representative functional protein-coding transcripts. Approximately 66% of unigenes were assigned to superphylum-level taxa, including Lophotrochozoa (40%). The completeness of the transcriptome assembly was assessed using benchmarking universal single-copy orthologs; 75.7% of the single-copy orthologs were presented in our transcriptome database. We observed 3 distinct patterns of global transcriptome profiles from 14 developmental stages and identified 12,705 genes that showed dynamic regulation patterns during the differentiation and maturation of U. unicinctus cells. We present the first large-scale developmental transcriptome dataset of U. unicinctus and provide a general overview of the dynamics of global gene expression changes during its early developmental stages. The analysis of time-course gene expression data is a first step toward understanding the complex developmental gene regulatory networks in U. unicinctus and will furnish a valuable resource for analyzing the functions of gene repertoires in various developmental phases.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

C. elegans sym-1 is a downstream target of the hunchback-like-1 developmental timing transcription factor

PubMed Central

Niwa, Ryusuke; Hada, Kazumasa; Moliyama, Kouichi; Ohniwa, Ryosuke L.; Tan, Yi-Meng; Olsson-Carter, Katherine; Chi, Woo; Reinke, Valerie; Slack, Frank J.

2010-01-01

In the nematode Caenorhabditis elegans, the let-7 microRNA (miRNA) and its family members control the timing of key developmental events in part by directly regulating expression of hunchback-like-1 (hbl-1). C. elegans hbl-1 mutants display multiple developmental timing deficiencies, including cell cycle defects during larval development. While hbl-1 is predicted to encode a transcriptional regulator, downstream targets of HBL-1 have not been fully elucidated. Here we report using microarray analysis to uncover genes downstream of HBL-1. We established a transgenic strain that overexpresses hbl-1 under the control of a heat shock promoter. Heat shock-induced hbl-1 overexpression led to retarded hypodermal structures at the adult stage, opposite to the effect seen in loss of function (lf) hbl-1 mutants. The microarray screen identified numerous potential genes that are upregulated or downregulated by HBL-1, including sym-1, which encodes a leucine-rich repeat protein with a signal sequence. We found an increase in sym-1 transcription in the heat shock-induced hbl-1 overexpression strain, while loss of hbl-1 function caused a decrease in sym-1 expression levels. Furthermore, we found that sym-1(lf) modified the hypodermal abnormalities in hbl-1 mutants. Given that SYM-1 is a protein secreted from hypodermal cells to the surrounding cuticle, we propose that the adult-specific cuticular structures may be under the temporal control of HBL-1 through regulation of sym-1 transcription. PMID:19923914

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae)

PubMed Central

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S.; Reichelt, Michael; Schranz, Michael E.

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C. Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema. Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction. PMID:28603537

Flowering Locus C (FLC) Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae).

PubMed

Mohammadin, Setareh; Nguyen, Thu-Phuong; van Weij, Marco S; Reichelt, Michael; Schranz, Michael E

2017-01-01

The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS) are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP) we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits) that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C . Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema . Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction.

Mas-allatotropin in the developing antennal lobe of the sphinx moth Manduca sexta: distribution, time course, developmental regulation, and colocalization with other neuropeptides.

PubMed

Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim

2008-01-01

The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

MicroRNAs: New Players in Anesthetic-Induced Developmental Neurotoxicity

PubMed Central

Twaroski, Danielle; Bosnjak, Zeljko J.; Bai, Xiaowen

2015-01-01

Growing evidence demonstrates that prolonged exposure to general anesthetics during brain development induces widespread neuronal cell death followed by long-term memory and learning disabilities in animal models. These studies have raised serious concerns about the safety of anesthetic use in pregnant women and young children. However, the underlying mechanisms of anesthetic-induced neurotoxicity are complex and are not well understood. MicroRNAs are endogenous, small, non-coding RNAs that have been implicated to play important roles in many different disease processes by negatively regulating target gene expression. A possible role for microRNAs in anesthetic-induced developmental neurotoxicity has recently been identified, suggesting that microRNA-based signaling might be a novel target for preventing the neurotoxicity. Here we provide an overview of anesthetic-induced developmental neurotoxicity and focus on the role of microRNAs in the neurotoxicity observed in both human stem cell-derived neuron and animal models. Aberrant expression of some microRNAs has been shown to be involved in anesthetic-induced developmental neurotoxicity, revealing the potential of microRNAs as therapeutic or preventive targets against the toxicity. PMID:26146587

Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

PubMed

Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

2016-02-01

Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life interventions may be a practical approach to promote physical activity in man.

The development of self-regulation across early childhood.

PubMed

Montroy, Janelle J; Bowles, Ryan P; Skibbe, Lori E; McClelland, Megan M; Morrison, Frederick J

2016-11-01

The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of 3 and 7 years, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across 3 diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow 3 distinct developmental patterns of growth. These 3 trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds, with implications for offering individualized support across children. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Morphological, Histobiochemical and Molecular Characterisation of Low Lignin Phloem Fibre (llpf) Mutant of Dark Jute (Corchorus olitorius L.).

PubMed

Choudhary, S B; Chowdhury, I; Singh, R K; Pandey, S P; Sharma, H K; Anil Kumar, A; Karmakar, P G; Kumari, N; Souframanien, J; Jambhulkar, S J

2017-11-01

Lignin is a versatile plant metabolite challenging high-end industrial applications of several plant products including jute. Application of developmental mutant in regulation of lignification in jute may open up door for much awaited jute based diversified products. In the present study, a novel dark jute (Corchorus olitorius L.) mutant with low lignin (7.23%) in phloem fibre being compared to wild-type JRO 204 (13.7%) was identified and characterised. Unique morphological features including undulated stem, petiole and leaf vein distinguished the mutant in gamma ray irradiated mutant population. Histological and biochemical analysis revealed reduced lignification of phloem fibre cells of the plant. RT-PCR analysis demonstrated temporal transcriptional regulation of CCoAMT1 gene in the mutant. The mutant was found an extremely useful model to study phloem fibre developmental biology in the crop besides acting as a donor genetic stock for low lignin containing jute fibre in dark jute improvement programme.

The ADAMTS5 Metzincin Regulates Zebrafish Somite Differentiation

PubMed Central

Dancevic, Carolyn M.; Gibert, Yann; Smith, Adam D.; Ward, Alister C.; McCulloch, Daniel R.

2018-01-01

The ADAMTS5 metzincin, a secreted zinc-dependent metalloproteinase, modulates the extracellular matrix (ECM) during limb morphogenesis and other developmental processes. Here, the role of ADAMTS5 was investigated by knockdown of zebrafish adamts5 during embryogenesis. This revealed impaired Sonic Hedgehog (Shh) signaling during somite patterning and early myogenesis. Notably, synergistic regulation of myod expression by ADAMTS5 and Shh during somite differentiation was observed. These roles were not dependent upon the catalytic activity of ADAMTS5. These data identify a non-enzymatic function for ADAMTS5 in regulating an important cell signaling pathway that impacts on muscle development, with implications for musculoskeletal diseases in which ADAMTS5 and Shh have been associated. PMID:29518972

Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

PubMed Central

2010-01-01

Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate. Conclusions These results suggest that microarray analysis of chemical-induced spore formation is an excellent system to specifically identify genes necessary for the core sporulation process of a Gram negative model organism for differentiation. PMID:20420673

Sporulation in Bacteria: Beyond the Standard Model.

PubMed

Hutchison, Elizabeth A; Miller, David A; Angert, Esther R

2014-10-01

Endospore formation follows a complex, highly regulated developmental pathway that occurs in a broad range of Firmicutes. Although Bacillus subtilis has served as a powerful model system to study the morphological, biochemical, and genetic determinants of sporulation, fundamental aspects of the program remain mysterious for other genera. For example, it is entirely unknown how most lineages within the Firmicutes regulate entry into sporulation. Additionally, little is known about how the sporulation pathway has evolved novel spore forms and reproductive schemes. Here, we describe endospore and internal offspring development in diverse Firmicutes and outline progress in characterizing these programs. Moreover, comparative genomics studies are identifying highly conserved sporulation genes, and predictions of sporulation potential in new isolates and uncultured bacteria can be made from these data. One surprising outcome of these comparative studies is that core regulatory and some structural aspects of the program appear to be universally conserved. This suggests that a robust and sophisticated developmental framework was already in place in the last common ancestor of all extant Firmicutes that produce internal offspring or endospores. The study of sporulation in model systems beyond B. subtilis will continue to provide key information on the flexibility of the program and provide insights into how changes in this developmental course may confer advantages to cells in diverse environments.

Macrophage/epithelium cross-talk regulates cell cycle progression and migration in pancreatic progenitors.

PubMed

Mussar, Kristin; Tucker, Andrew; McLennan, Linsey; Gearhart, Addie; Jimenez-Caliani, Antonio J; Cirulli, Vincenzo; Crisa, Laura

2014-01-01

Macrophages populate the mesenchymal compartment of all organs during embryogenesis and have been shown to support tissue organogenesis and regeneration by regulating remodeling of the extracellular microenvironment. Whether this mesenchymal component can also dictate select developmental decisions in epithelia is unknown. Here, using the embryonic pancreatic epithelium as model system, we show that macrophages drive the epithelium to execute two developmentally important choices, i.e. the exit from cell cycle and the acquisition of a migratory phenotype. We demonstrate that these developmental decisions are effectively imparted by macrophages activated toward an M2 fetal-like functional state, and involve modulation of the adhesion receptor NCAM and an uncommon "paired-less" isoform of the transcription factor PAX6 in the epithelium. Over-expression of this PAX6 variant in pancreatic epithelia controls both cell motility and cell cycle progression in a gene-dosage dependent fashion. Importantly, induction of these phenotypes in embryonic pancreatic transplants by M2 macrophages in vivo is associated with an increased frequency of endocrine-committed cells emerging from ductal progenitor pools. These results identify M2 macrophages as key effectors capable of coordinating epithelial cell cycle withdrawal and cell migration, two events critical to pancreatic progenitors' delamination and progression toward their differentiated fates.

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

A co-expression gene network associated with developmental regulation of apple fruit acidity.

PubMed

Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

2015-08-01

Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

Polar auxin transport: controlling where and how much

NASA Technical Reports Server (NTRS)

Muday, G. K.; DeLong, A.; Brown, C. S. (Principal Investigator)

2001-01-01

Auxin is transported through plant tissues, moving from cell to cell in a unique polar manner. Polar auxin transport controls important growth and developmental processes in higher plants. Recent studies have identified several proteins that mediate polar auxin transport and have shown that some of these proteins are asymmetrically localized, paving the way for studies of the mechanisms that regulate auxin transport. New data indicate that reversible protein phosphorylation can control the amount of auxin transport, whereas protein secretion through Golgi-derived vesicles and interactions with the actin cytoskeleton might regulate the localization of auxin efflux complexes.

Turmeric (Curcuma longa): miRNAs and their regulating targets are involved in development and secondary metabolite pathways.

PubMed

Singh, Noopur; Sharma, Ashok

Turmeric has been used as a therapeutic herb over centuries in traditional medicinal systems due to the presence of several secondary metabolite compounds. microRNAs are known to regulate gene expression at the post-transcriptional level by transcriptional cleavage or translation repression. miRNAs have been demonstrated to play an active role in secondary metabolism regulation. The present work was focused on the identification of the miRNAs involved in the regulation of secondary metabolite and development process of turmeric. Eighteen miRNA families were identified for turmeric. Sixteen miRNA families were observed to regulate 238 target transcripts. LncRNAs targets of the putative miRNA candidates were also predicted. Our results indicated their role in binding, reproduction, stress, and other developmental processes. Gene annotation and pathway analysis illustrated the biological function of the targets regulated by the putative miRNAs. The miRNA-mediated gene regulatory network also revealed co-regulated targets that were regulated by two or more miRNA families. miR156 and miR5015 were observed to be involved in rhizome development. miR5021 showed regulation for terpenoid backbone biosynthesis and isoquinoline alkaloid biosynthesis pathways. The flavonoid biosynthesis pathway was observed to be regulated by miR2919. The analysis revealed the probable involvement of three miRNAs (miR1168.2, miR156b and miR1858) in curcumin biosynthesis. Other miRNAs were found to be involved in the growth and developmental process of turmeric. Phylogenetic analysis of selective miRNAs was also performed. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function

PubMed Central

Bagley, Joshua A.; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill

2014-01-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the “histone code,” in regulating dendrite morphology. PMID:25184680

The Splice Isoforms of the Drosophila Ecdysis Triggering Hormone Receptor Have Developmentally Distinct Roles

PubMed Central

Diao, Feici; Mena, Wilson; Shi, Jonathan; Park, Dongkook; Diao, Fengqiu; Taghert, Paul; Ewer, John; White, Benjamin H.

2016-01-01

To grow, insects must periodically shed their exoskeletons. This process, called ecdysis, is initiated by the endocrine release of Ecdysis Trigger Hormone (ETH) and has been extensively studied as a model for understanding the hormonal control of behavior. Understanding how ETH regulates ecdysis behavior, however, has been impeded by limited knowledge of the hormone’s neuronal targets. An alternatively spliced gene encoding a G-protein-coupled receptor (ETHR) that is activated by ETH has been identified, and several lines of evidence support a role in ecdysis for its A-isoform. The function of a second ETHR isoform (ETHRB) remains unknown. Here we use the recently introduced “Trojan exon” technique to simultaneously mutate the ETHR gene and gain genetic access to the neurons that express its two isoforms. We show that ETHRA and ETHRB are expressed in largely distinct subsets of neurons and that ETHRA- but not ETHRB-expressing neurons are required for ecdysis at all developmental stages. However, both genetic and neuronal manipulations indicate an essential role for ETHRB at pupal and adult, but not larval, ecdysis. We also identify several functionally important subsets of ETHR-expressing neurons including one that coexpresses the peptide Leucokinin and regulates fluid balance to facilitate ecdysis at the pupal stage. The general strategy presented here of using a receptor gene as an entry point for genetic and neuronal manipulations should be useful in establishing patterns of functional connectivity in other hormonally regulated networks. PMID:26534952

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

Transcriptomics insights into the genetic regulation of root apical meristem exhaustion and determinate primary root growth in Pachycereus pringlei (Cactaceae).

PubMed

Rodriguez-Alonso, Gustavo; Matvienko, Marta; López-Valle, Mayra L; Lázaro-Mixteco, Pedro E; Napsucialy-Mendivil, Selene; Dubrovsky, Joseph G; Shishkova, Svetlana

2018-06-04

Many Cactaceae species exhibit determinate growth of the primary root as a consequence of root apical meristem (RAM) exhaustion. The genetic regulation of this growth pattern is unknown. Here, we de novo assembled and annotated the root apex transcriptome of the Pachycereus pringlei primary root at three developmental stages, with active or exhausted RAM. The assembled transcriptome is robust and comprehensive, and was used to infer a transcriptional regulatory network of the primary root apex. Putative orthologues of Arabidopsis regulators of RAM maintenance, as well as putative lineage-specific transcripts were identified. The transcriptome revealed putative orthologues of most proteins involved in housekeeping processes, hormone signalling, and metabolic pathways. Our results suggest that specific transcriptional programs operate in the root apex at specific developmental time points. Moreover, the transcriptional state of the P. pringlei root apex as the RAM becomes exhausted is comparable to the transcriptional state of cells from the meristematic, elongation, and differentiation zones of Arabidopsis roots along the root axis. We suggest that the transcriptional program underlying the drought stress response is induced during Cactaceae root development, and that lineage-specific transcripts could contribute to RAM exhaustion in Cactaceae.

45 CFR 1385.1 - General.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES... the Rights of Individuals with Developmental Disabilities; (c)Projects of National Significance;and (d...

Transcriptomic profile of leg muscle during early growth in chicken

PubMed Central

Zhang, Genxi; Li, Tingting; Ling, Jiaojiao; Zhang, Xiangqian; Wang, Jinyu

2017-01-01

The early growth pattern, especially the age of peak growth, of broilers affects the time to market and slaughter weight, which in turn affect the profitability of the poultry industry. However, the underlying mechanisms regulating chicken growth and development have rarely been studied. This study aimed to identify candidate genes involved in chicken growth and investigated the potential regulatory mechanisms of early growth in chicken. RNA sequencing was applied to compare the transcriptomes of chicken muscle tissues at three developmental stages during early growth. In total, 978 differentially expressed genes (DEGs) (fold change ≥ 2; false discovery rate < 0.05) were detected by pairwise comparison. Functional analysis showed that the DEGs are mainly involved in the processes of cell growth, muscle development, and cellular activities (such as junction, migration, assembly, differentiation, and proliferation). Many of the DEGs are well known to be related to chicken growth, such as MYOD1, GH, IGF2BP2, IGFBP3, SMYD1, CEBPB, FGF2, and IGFBP5. KEGG pathway analysis identified that the DEGs were significantly enriched in five pathways (P < 0.1) related to growth and development: extracellular matrix–receptor interaction, focal adhesion, tight junction, insulin signaling pathway, and regulation of the actin cytoskeleton. A total of 42 DEGs assigned to these pathways are potential candidate genes inducing the difference in growth among the three developmental stages, such as MYH10, FGF2, FGF16, FN1, CFL2, MAPK9, IRS1, PHKA1, PHKB, and PHKG1. Thus, our study identified a series of genes and several pathways that may participate in the regulation of early growth in chicken. These results should serve as an important resource revealing the molecular basis of chicken growth and development. PMID:28291821

A genomic approach to identify hybrid incompatibility genes.

PubMed

Cooper, Jacob C; Phadnis, Nitin

2016-07-02

Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids.

Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

PubMed Central

2010-01-01

Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

Developmentally regulated, alternative splicing of the Rpn10 gene generates multiple forms of 26S proteasomes

PubMed Central

Kawahara, Hiroyuki; Kasahara, Masanori; Nishiyama, Atsuya; Ohsumi, Keita; Goto, Tetsuya; Kishimoto, Takeo; Saeki, Yasushi; Yokosawa, Hideyoshi; Shimbara, Naoki; Murata, Shigeo; Chiba, Tomoki; Suzuki, Koichi; Tanaka, Keiji

2000-01-01

The 26S proteasome is a multisubunit protein- destroying machinery that degrades ubiquitin-tagged proteins. To date only a single species of Rpn10, which possibly functions as a multiubiquitin chain-binding subunit, has been identified in various organisms. Here we report that mouse Rpn10 mRNAs occur in at least five distinct forms, named Rpn10a to Rpn10e, and that they are generated from a single gene by developmentally regulated, alternative splicing. Rpn10a is ubiquitously expressed, whereas Rpn10e is expressed only in embryos, with the highest levels of expression in the brain. Both forms of Rpn10 are components of the 26S proteasome, with an apparently similar affinity for multiubiquitylated [125I]lysozyme in vitro. However, they exert markedly divergent effects on the destruction of B-type cyclin in Xenopus egg extracts. Thus, the 26S proteasome occurs in at least two functionally distinct forms: one containing a ubiquitously expressed Rpn10a and the other a newly identified, embryo-specific Rpn10e. While the former is thought to perform proteolysis constitutively in a wide variety of cells, the latter may play a specialized role in early embryonic development. PMID:10921894

Embryonic common snapping turtles (Chelydra serpentina) preferentially regulate intracellular tissue pH during acid-base challenges.

PubMed

Shartau, Ryan B; Crossley, Dane A; Kohl, Zachary F; Brauner, Colin J

2016-07-01

The nests of embryonic turtles naturally experience elevated CO2 (hypercarbia), which leads to increased blood PCO2  and a respiratory acidosis, resulting in reduced blood pH [extracellular pH (pHe)]. Some fishes preferentially regulate tissue pH [intracellular pH (pHi)] against changes in pHe; this has been proposed to be associated with exceptional CO2 tolerance and has never been identified in amniotes. As embryonic turtles may be CO2 tolerant based on nesting strategy, we hypothesized that they preferentially regulate pHi, conferring tolerance to severe acute acid-base challenges. This hypothesis was tested by investigating pH regulation in common snapping turtles (Chelydra serpentina) reared in normoxia then exposed to hypercarbia (13 kPa PCO2 ) for 1 h at three developmental ages: 70% and 90% of incubation, and yearlings. Hypercarbia reduced pHe but not pHi, at all developmental ages. At 70% of incubation, pHe was depressed by 0.324 pH units while pHi of brain, white muscle and lung increased; heart, liver and kidney pHi remained unchanged. At 90% of incubation, pHe was depressed by 0.352 pH units but heart pHi increased with no change in pHi of other tissues. Yearlings exhibited a pHe reduction of 0.235 pH units but had no changes in pHi of any tissues. The results indicate common snapping turtles preferentially regulate pHi during development, but the degree of response is reduced throughout development. This is the first time preferential pHi regulation has been identified in an amniote. These findings may provide insight into the evolution of acid-base homeostasis during development of amniotes, and vertebrates in general. © 2016. Published by The Company of Biologists Ltd.

Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

PubMed Central

2012-01-01

Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

Coco is a dual activity modulator of TGFβ signaling

PubMed Central

Deglincerti, Alessia; Haremaki, Tomomi; Warmflash, Aryeh; Sorre, Benoit; Brivanlou, Ali H.

2015-01-01

The TGFβ signaling pathway is a crucial regulator of developmental processes and disease. The activity of TGFβ ligands is modulated by various families of soluble inhibitors that interfere with the interactions between ligands and receptors. In an unbiased, genome-wide RNAi screen to identify genes involved in ligand-dependent signaling, we unexpectedly identified the BMP/Activin/Nodal inhibitor Coco as an enhancer of TGFβ1 signaling. Coco synergizes with TGFβ1 in both cell culture and Xenopus explants. Molecularly, Coco binds to TGFβ1 and enhances TGFβ1 binding to its receptor Alk5. Thus, Coco acts as both an inhibitor and an enhancer of signaling depending on the ligand it binds. This finding raises the need for a global reconsideration of the molecular mechanisms regulating TGFβ signaling. PMID:26116664

Genomic Identification and Analysis of Shared Cis-regulator Elements in a Developmentally Critical homeobox Cluster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chris Amemiya

2003-04-01

The goals of this project were to isolate, characterize, and sequence the Dlx3/Dlx7 bigene cluster from twelve different species of mammals. The Dlx3 and Dlx7 genes are known to encode homeobox transcription factors involved in patterning of structures in the vertebrate jaw as well as vertebrate limbs. Genomic sequences from the respective taxa will subsequently be compared in order to identify conserved non-coding sequences that are potential cis-regulatory elements. Based on the comparisons they will fashion transgenic mouse experiments to functionally test the strength of the potential cis-regulatory elements. A goal of the project is to attempt to identify thosemore » elements that may function in coordinately regulating both Dlx3 and Dlx7 functions.« less

45 CFR 1386.80 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... Developmental Disabilities Assistance and Bill of Rights Act. This term includes Federal funds provided under...

Spatial mapping and quantification of developmental branching morphogenesis.

PubMed

Short, Kieran; Hodson, Mark; Smyth, Ian

2013-01-15

Branching morphogenesis is a fundamental developmental mechanism that shapes the formation of many organs. The complex three-dimensional shapes derived by this process reflect equally complex genetic interactions between branching epithelia and their surrounding mesenchyme. Despite the importance of this process to normal adult organ function, analysis of branching has been stymied by the absence of a bespoke method to quantify accurately the complex spatial datasets that describe it. As a consequence, although many developmentally important genes are proposed to influence branching morphogenesis, we have no way of objectively assessing their individual contributions to this process. We report the development of a method for accurately quantifying many aspects of branching morphogenesis and we demonstrate its application to the study of organ development. As proof of principle we have employed this approach to analyse the developing mouse lung and kidney, describing the spatial characteristics of the branching ureteric bud and pulmonary epithelia. To demonstrate further its capacity to profile unrecognised genetic contributions to organ development, we examine Tgfb2 mutant kidneys, identifying elements of both developmental delay and specific spatial dysmorphology caused by haplo-insufficiency for this gene. This technical advance provides a crucial resource that will enable rigorous characterisation of the genetic and environmental factors that regulate this essential and evolutionarily conserved developmental mechanism.

Transcriptome analysis on the exoskeleton formation in early developmetal stages and reconstruction scenario in growth-moulting in Litopenaeus vannamei.

PubMed

Gao, Yi; Wei, Jiankai; Yuan, Jianbo; Zhang, Xiaojun; Li, Fuhua; Xiang, Jianhai

2017-04-24

Exoskeleton construction is an important issue in shrimp. To better understand the molecular mechanism of exoskeleton formation, development and reconstruction, the transcriptome of the entire developmental process in Litopenaeus vannamei, including nine early developmental stages and eight adult-moulting stages, was sequenced and analysed using Illumina RNA-seq technology. A total of 117,539 unigenes were obtained, with 41.2% unigenes predicting the full-length coding sequence. Gene Ontology, Clusters of Orthologous Group (COG), the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and functional annotation of all unigenes gave a better understanding of the exoskeleton developmental process in L. vannamei. As a result, more than six hundred unigenes related to exoskeleton development were identified both in the early developmental stages and adult-moulting. A cascade of sequential expression events of exoskeleton-related genes were summarized, including exoskeleton formation, regulation, synthesis, degradation, mineral absorption/reabsorption, calcification and hardening. This new insight on major transcriptional events provide a deep understanding for exoskeleton formation and reconstruction in L. vannamei. In conclusion, this is the first study that characterized the integrated transcriptomic profiles cover the entire exoskeleton development from zygote to adult-moulting in a crustacean, and these findings will serve as significant references for exoskeleton developmental biology and aquaculture research.

Self-Regulated Strategy Instruction in College Developmental Writing

ERIC Educational Resources Information Center

MacArthur, Charles A.; Philippakos, Zoi A.; Ianetta, Melissa

2015-01-01

The purpose of this study was to evaluate the effects of a curriculum for college developmental writing classes, developed in prior design research and based on self-regulated strategy instruction. Students learned strategies for planning, drafting, and revising compositions with an emphasis on using knowledge of genre organization to guide…

GLUCOCORTICOID RECEPTOR REGULATION IN THE RAT EMBRYO: A POTENTIAL SITE FOR DEVELOPMENTAL TOXICITY?

EPA Science Inventory

Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?

Ghosh B, Wood CR, Held GA, Abbott BD, Lau C.

National Research Council, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711, USA.

Assessment of Reproductive and Developmental Toxicity of Mixtures of Regulated Drinking Water Chlorination By-Products in a Multigenerational Rat Bioassay

EPA Science Inventory

Epidemiological and animal toxicity studies have raised concerns regarding possible adverse reproductive and developmental effects of disinfection by-products (DBPs) in drinking water. To address these concerns, we provided mixtures of the regulated trihalomethanes (THMs; chlorof...

Developmental mechanisms regulating secondary growth in woody plants

Treesearch

Andrew Groover; Marcel Robischon

2006-01-01

Secondary growth results in the radial expansion of woody stems, and requires the coordination of tissue patterning, cell differentiation, and the maintenance of meristematic stem cells within the vascular cambium. Advances are being made towards describing molecular mechanisms that regulate these developmental processes, thanks in part to the application of new...

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three color and developmental stages in 'Anji Baicha' (Camellia sinensis).

PubMed

Li, Chun-Fang; Xu, Yan-Xia; Ma, Jian-Qiang; Jin, Ji-Qiang; Huang, Dan-Juan; Yao, Ming-Zhe; Ma, Chun-Lei; Chen, Liang

2016-09-08

The new shoots of the albino tea cultivar 'Anji Baicha' are yellow or white at low temperatures and turn green as the environmental temperatures increase during the early spring. 'Anji Baicha' metabolite profiles exhibit considerable variability over three color and developmental stages, especially regarding the carotenoid, chlorophyll, and theanine concentrations. Previous studies focused on physiological characteristics, gene expression differences, and variations in metabolite abundances in albino tea plant leaves at specific growth stages. However, the molecular mechanisms regulating metabolite biosynthesis in various color and developmental stages in albino tea leaves have not been fully characterized. We used RNA-sequencing to analyze 'Anji Baicha' leaves at the yellow-green, albescent, and re-greening stages. The leaf transcriptomes differed considerably among the three stages. Functional classifications based on Gene Ontology enrichment and Kyoto Encyclopedia of Genes and Genomes enrichment analyses revealed that differentially expressed unigenes were mainly related to metabolic pathways, biosynthesis of secondary metabolites, phenylpropanoid biosynthesis, and carbon fixation in photosynthetic organisms. Chemical analyses revealed higher β-carotene and theanine levels, but lower chlorophyll a levels, in the albescent stage than in the green stage. Furthermore, unigenes involved in carotenoid, chlorophyll, and theanine biosyntheses were identified, and the expression patterns of the differentially expressed unigenes in these biosynthesis pathways were characterized. Through co-expression analyses, we identified the key genes in these pathways. These genes may be responsible for the metabolite biosynthesis differences among the different leaf color and developmental stages of 'Anji Baicha' tea plants. Our study presents the results of transcriptomic and biochemical analyses of 'Anji Baicha' tea plants at various stages. The distinct transcriptome profiles for each color and developmental stage enabled us to identify changes to biosynthesis pathways and revealed the contributions of such variations to the albino phenotype of tea plants. Furthermore, comparisons of the transcriptomes and related metabolites helped clarify the molecular regulatory mechanisms underlying the secondary metabolic pathways in different stages.

The History of Legislation and Regulations Related to Children with Developmental Disabilities: Implications for School Nursing Practice Today

ERIC Educational Resources Information Center

Dang, Michelle T.

2010-01-01

A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…

Oxidative Stress, Unfolded Protein Response, and Apoptosis in Developmental Toxicity

PubMed Central

Kupsco, Allison; Schlenk, Daniel

2016-01-01

Physiological development requires precise spatiotemporal regulation of cellular and molecular processes. Disruption of these key events can generate developmental toxicity in the form of teratogenesis or mortality. The mechanism behind many developmental toxicants remains unknown. While recent work has focused on the unfolded protein response (UPR), oxidative stress, and apoptosis in the pathogenesis of disease, few studies have addressed their relationship in developmental toxicity. Redox regulation, UPR, and apoptosis are essential for physiological development and can be disturbed by a variety of endogenous and exogenous toxicants to generate lethality and diverse malformations. This review examines the current knowledge of the role of oxidative stress, UPR, and apoptosis in physiological development as well as in developmental toxicity, focusing on studies and advances in vertebrates model systems. PMID:26008783

Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

PubMed

Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

2008-11-01

Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

BDNF regulates the translation of a select group of mRNAs by a mammalian target of rapamycin-phosphatidylinositol 3-kinase-dependent pathway during neuronal development.

PubMed

Schratt, Gerhard M; Nigh, Elizabeth A; Chen, Wen G; Hu, Linda; Greenberg, Michael E

2004-08-18

Local regulation of mRNA translation plays an important role in axon guidance, synaptic development, and neuronal plasticity. Little is known, however, regarding the mechanisms that control translation in neurons, and only a few mRNAs have been identified that are locally translated within axon and dendrites. Using Affymetrix gene arrays to identify mRNAs that are newly associated with polysomes after exposure to BDNF, we identified subsets of mRNAs for which translation is enhanced in neurons at different developmental stages. In mature neurons, many of these mRNAs encode proteins that are known to function at synapses, including CamKIIalpha, NMDA receptor subunits, and the postsynaptic density (PSD) scaffolding protein Homer2. BDNF regulates the translation of Homer2 locally in the synaptodendritic compartment by activating translational initiation via a mammalian target of rapamycin-phosphatidylinositol 3-kinase-dependent pathway. These findings suggest that BDNF likely regulates synaptic function by inducing the local synthesis of numerous synaptic proteins. The local translation of the cytoskeleton-associated protein Homer2 in particular might have important implications for growth cone dynamics and dendritic spine development.

Genome-wide discovery and differential regulation of conserved and novel microRNAs in chickpea via deep sequencing.

PubMed

Jain, Mukesh; Chevala, V V S Narayana; Garg, Rohini

2014-11-01

MicroRNAs (miRNAs) are essential components of complex gene regulatory networks that orchestrate plant development. Although several genomic resources have been developed for the legume crop chickpea, miRNAs have not been discovered until now. For genome-wide discovery of miRNAs in chickpea (Cicer arietinum), we sequenced the small RNA content from seven major tissues/organs employing Illumina technology. About 154 million reads were generated, which represented more than 20 million distinct small RNA sequences. We identified a total of 440 conserved miRNAs in chickpea based on sequence similarity with known miRNAs in other plants. In addition, 178 novel miRNAs were identified using a miRDeep pipeline with plant-specific scoring. Some of the conserved and novel miRNAs with significant sequence similarity were grouped into families. The chickpea miRNAs targeted a wide range of mRNAs involved in diverse cellular processes, including transcriptional regulation (transcription factors), protein modification and turnover, signal transduction, and metabolism. Our analysis revealed several miRNAs with differential spatial expression. Many of the chickpea miRNAs were expressed in a tissue-specific manner. The conserved and differential expression of members of the same miRNA family in different tissues was also observed. Some of the same family members were predicted to target different chickpea mRNAs, which suggested the specificity and complexity of miRNA-mediated developmental regulation. This study, for the first time, reveals a comprehensive set of conserved and novel miRNAs along with their expression patterns and putative targets in chickpea, and provides a framework for understanding regulation of developmental processes in legumes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

45 CFR 1386.33 - Protection of employee's interests.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Section 1386.33 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Federal Assistance to State Developmental Disabilities...

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Isolation and functional characterization of Lycopene β-cyclase (CYC-B) promoter from Solanum habrochaites

PubMed Central

2010-01-01

Background Carotenoids are a group of C40 isoprenoid molecules that play diverse biological and ecological roles in plants. Tomato is an important vegetable in human diet and provides the vitamin A precursor β-carotene. Genes encoding enzymes involved in carotenoid biosynthetic pathway have been cloned. However, regulation of genes involved in carotenoid biosynthetic pathway and accumulation of specific carotenoid in chromoplasts are not well understood. One of the approaches to understand regulation of carotenoid metabolism is to characterize the promoters of genes encoding proteins involved in carotenoid metabolism. Lycopene β-cyclase is one of the crucial enzymes in carotenoid biosynthesis pathway in plants. Its activity is required for synthesis of both α-and β-carotenes that are further converted into other carotenoids such as lutein, zeaxanthin, etc. This study describes the isolation and characterization of chromoplast-specific Lycopene β-cyclase (CYC-B) promoter from a green fruited S. habrochaites genotype EC520061. Results A 908 bp region upstream to the initiation codon of the Lycopene β-cyclase gene was cloned and identified as full-length promoter. To identify promoter region necessary for regulating developmental expression of the ShCYC-B gene, the full-length promoter and its three different 5' truncated fragments were cloned upstream to the initiation codon of GUS reporter cDNA in binary vectors. These four plant transformation vectors were separately transformed in to Agrobacterium. Agrobacterium-mediated transient and stable expression systems were used to study the GUS expression driven by the full-length promoter and its 5' deletion fragments in tomato. The full-length promoter showed a basal level activity in leaves, and its expression was upregulated > 5-fold in flowers and fruits in transgenic tomato plants. Deletion of -908 to -577 bp 5' to ATG decreases the ShCYC-B promoter strength, while deletion of -908 to -437 bp 5' to ATG led to significant increase in the activity of GUS in the transgenic plants. Promoter deletion analysis led to the identification of a short promoter region (-436 bp to ATG) that exhibited a higher promoter strength but similar developmental expression pattern as compared with the full-length ShCYC-B promoter. Conclusion Functional characterization of the full-length ShCYC-B promoter and its deletion fragments in transient expression system in fruto as well as in stable transgenic tomato revealed that the promoter is developmentally regulated and its expression is upregulated in chromoplast-rich flowers and fruits. Our study identified a short promoter region with functional activity and developmental expression pattern similar to that of the full-length ShCYC-B promoter. This 436 bp promoter region can be used in promoter::reporter fusion molecular genetic screens to identify mutants impaired in CYC-B expression, and thus can be a valuable tool in understanding carotenoid metabolism in tomato. Moreover, this short promoter region of ShCYC-B may be useful in genetic engineering of carotenoid content and other agronomic traits in tomato fruits. PMID:20380705

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

The B-cell identity factor Pax5 regulates distinct transcriptional programmes in early and late B lymphopoiesis

PubMed Central

Revilla-i-Domingo, Roger; Bilic, Ivan; Vilagos, Bojan; Tagoh, Hiromi; Ebert, Anja; Tamir, Ido M; Smeenk, Leonie; Trupke, Johanna; Sommer, Andreas; Jaritz, Markus; Busslinger, Meinrad

2012-01-01

Pax5 controls the identity and development of B cells by repressing lineage-inappropriate genes and activating B-cell-specific genes. Here, we used genome-wide approaches to identify Pax5 target genes in pro-B and mature B cells. In these cell types, Pax5 bound to 40% of the cis-regulatory elements defined by mapping DNase I hypersensitive (DHS) sites, transcription start sites and histone modifications. Although Pax5 bound to 8000 target genes, it regulated only 4% of them in pro-B and mature B cells by inducing enhancers at activated genes and eliminating DHS sites at repressed genes. Pax5-regulated genes in pro-B cells account for 23% of all expression changes occurring between common lymphoid progenitors and committed pro-B cells, which identifies Pax5 as an important regulator of this developmental transition. Regulated Pax5 target genes minimally overlap in pro-B and mature B cells, which reflects massive expression changes between these cell types. Hence, Pax5 controls B-cell identity and function by regulating distinct target genes in early and late B lymphopoiesis. PMID:22669466

Meeting Report: Alternatives for Developmental Neurotoxicity Testing

PubMed Central

Lein, Pamela; Locke, Paul; Goldberg, Alan

2007-01-01

Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternatives to current animal testing protocols and guidelines. To address this need, the Johns Hopkins Center for Alternatives to Animal Testing (CAAT), the U.S. Environmental Protection Agency, and the National Toxicology Program are collaborating in a program called TestSmart DNT, the goals of which are to: (a) develop alternative methodologies for identifying and prioritizing chemicals and exposures that may cause developmental neurotoxicity in humans; (b) develop the policies for incorporating DNT alternatives into regulatory decision making; and (c) identify opportunities for reducing, refining, or replacing the use of animals in DNT. The first TestSmart DNT workshop was an open registration meeting held 13–15 March 2006 in Reston, Virginia. The primary objective was to bring together stakeholders (test developers, test users, regulators, and advocates for children’s health, animal welfare, and environmental health) and individuals representing diverse disciplines (developmental neurobiology, toxicology, policy, and regulatory science) from around the world to share information and concerns relating to the science and policy of DNT. Individual presentations are available at the CAAT TestSmart website. This report provides a synthesis of workgroup discussions and recommendations for future directions and priorities, which include initiating a systematic evaluation of alternative models and technologies, developing a framework for the creation of an open database to catalog DNT data, and devising a strategy for harmonizing the validation process across international jurisdictional borders. PMID:17520065

Meeting report: alternatives for developmental neurotoxicity testing.

PubMed

Lein, Pamela; Locke, Paul; Goldberg, Alan

2007-05-01

Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternatives to current animal testing protocols and guidelines. To address this need, the Johns Hopkins Center for Alternatives to Animal Testing (CAAT), the U.S. Environmental Protection Agency, and the National Toxicology Program are collaborating in a program called TestSmart DNT, the goals of which are to: (a) develop alternative methodologies for identifying and prioritizing chemicals and exposures that may cause developmental neurotoxicity in humans; (b) develop the policies for incorporating DNT alternatives into regulatory decision making; and (c) identify opportunities for reducing, refining, or replacing the use of animals in DNT. The first TestSmart DNT workshop was an open registration meeting held 13-15 March 2006 in Reston, Virginia. The primary objective was to bring together stakeholders (test developers, test users, regulators, and advocates for children's health, animal welfare, and environmental health) and individuals representing diverse disciplines (developmental neurobiology, toxicology, policy, and regulatory science) from around the world to share information and concerns relating to the science and policy of DNT. Individual presentations are available at the CAAT TestSmart website. This report provides a synthesis of workgroup discussions and recommendations for future directions and priorities, which include initiating a systematic evaluation of alternative models and technologies, developing a framework for the creation of an open database to catalog DNT data, and devising a strategy for harmonizing the validation process across international jurisdictional borders.

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development

PubMed Central

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development. PMID:26039357

IMMU-22. ADOPTIVE CELL THERAPY AGAINST DIPG USING DEVELOPMENTALLY REGULATED ANTIGENS

PubMed Central

Flores, Catherine; Gil, Jorge; Abraham, Rebecca; Pham, Christina; Wildes, Tyler; Moore, Ginger; Drake, Jeffrey; Dyson, Kyle; Mitchell, Duane

2017-01-01

Abstract INTRODUCTION: Diffuse intrinsic pontine glioma (DIPG) survival has remained static over decades and DIPG is now the main cause of brain tumor-related deaths in children. Immunotherapy has emerged as a treatment modality with the highest curative potential in patients with refractory malignancies. Our group has pioneered an adoptive cell therapy platform employing total tumor RNA pulsed dendritic cells to generate large amounts of polyclonal antigen-specific T cells in both human and murine systems. As DIPGs are embryonal tumors, our objective in this proposal is to identify a set of developmentally regulated antigens that are overexpressed during oncogenesis of DIPG in order to cause immunological rejection of this tumor without the need for tumor tissue. METHODS: We employ RNA-pulsed bone marrow-derived dendritic cells to ex vivo activate tumor-reactive T cells for use in adoptive cell therapy. Here we use either total RNA isolated from tumor tissue, (TTRNA) or developmental antigens (DevAg) RNA isolated from postnatal day 4 murine brain stem. Either TTRNA-T cells or DevAg-T cells were used in adoptive cell therapy against a preclinical model of DIPG. RESULTS: Pediatric brain tumors are bland relative to peripheral tumors in terms of high expression of immunogenic antigens. Since DIPG antigens remain largely uncharacterized, we used total RNA isolated from tumor cells to generate tumor-specific T cells to use for our therapeutic approach to first demonstrate that immune responses can be generated against this tumor. We also successfully generated immunity against DIPG in a preclinical model using DevAg-T cells for adoptive cell therapy. CONCLUSION: The region- and age- specific nature of DIPG suggests that the underlying pathophysiology likely involves dysregulation of a postnatal neurodevelopmental process which occurs in embryonal tumors. Here we leverage this and demonstrate that DIPG can be effectively treated using adoptive cell therapy against overexpressed developmentally regulated antigens.

The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development.

PubMed

Li, Shutian

2015-01-01

The TCP family of transcription factors is named after the first 4 characterized members, namely TEOSINTE BRANCHED1 (TB1) from maize (Zea mays), CYCLOIDEA (CYC) from snapdragon (Antirrhinum majus), as well as PROLIFERATING CELL NUCLEAR ANTIGEN FACTOR1 (PCF1) and PCF2 from rice (Oryza sativa). Phylogenic analysis of this plant-specific protein family unveils a conserved bHLH-containing DNA-binding motif known as the TCP domain. In accordance with the structure of this shared domain, TCP proteins are grouped into class I (TCP-P) and class II (TCP-C), which are suggested to antagonistically modulate plant growth and development via competitively binding similar cis-regulatory modules called site II elements. Over the last decades, TCPs across the plant kingdom have been demonstrated to control a plethora of plant processes. Notably, TCPs also regulate plant development and defense responses via stimulating the biosynthetic pathways of bioactive metabolites, such as brassinosteroid (BR), jasmonic acid (JA) and flavonoids. Besides, mutagenesis analysis coupled with biochemical experiments identifies several crucial amino acids located within the TCP domain, which confer the redox sensitivity of class I TCPs and determine the distinct DNA-binding properties of TCPs. In this review, developmental functions of TCPs in various biological pathways are briefly described with an emphasis on their involvement in the synthesis of bioactive substances. Furthermore, novel biochemical aspects of TCPs with respect to redox regulation and DNA-binding preferences are elaborated. In addition, the unexpected participation of TCPs in effector-triggered immunity (ETI) and defense against insects indicates that the widely recognized developmental regulators are capable of fine-tuning defense signaling and thereby enable plants to evade deleterious developmental phenotypes. Altogether, these recent impressive breakthroughs remarkably advance our understanding as to how TCPs integrate internal developmental cues with external environmental stimuli to orchestrate plant development.

Proteomic analysis of the signaling pathway mediated by the heterotrimeric Gα protein Pga1 of Penicillium chrysogenum.

PubMed

Carrasco-Navarro, Ulises; Vera-Estrella, Rosario; Barkla, Bronwyn J; Zúñiga-León, Eduardo; Reyes-Vivas, Horacio; Fernández, Francisco J; Fierro, Francisco

2016-10-06

The heterotrimeric Gα protein Pga1-mediated signaling pathway regulates the entire developmental program in Penicillium chrysogenum, from spore germination to the formation of conidia. In addition it participates in the regulation of penicillin biosynthesis. We aimed to advance the understanding of this key signaling pathway using a proteomics approach, a powerful tool to identify effectors participating in signal transduction pathways. Penicillium chrysogenum mutants with different levels of activity of the Pga1-mediated signaling pathway were used to perform comparative proteomic analyses by 2D-DIGE and LC-MS/MS. Thirty proteins were identified which showed differences in abundance dependent on Pga1 activity level. By modifying the intracellular levels of cAMP we could establish cAMP-dependent and cAMP-independent pathways in Pga1-mediated signaling. Pga1 was shown to regulate abundance of enzymes in primary metabolic pathways involved in ATP, NADPH and cysteine biosynthesis, compounds that are needed for high levels of penicillin production. An in vivo phosphorylated protein containing a pleckstrin homology domain was identified; this protein is a candidate for signal transduction activity. Proteins with possible roles in purine metabolism, protein folding, stress response and morphogenesis were also identified whose abundance was regulated by Pga1 signaling. Thirty proteins whose abundance was regulated by the Pga1-mediated signaling pathway were identified. These proteins are involved in primary metabolism, stress response, development and signal transduction. A model describing the pathways through which Pga1 signaling regulates different cellular processes is proposed.

Quantitative Profiling Identifies Potential Regulatory Proteins Involved in Development from Dauer Stage to L4 Stage in Caenorhabditis elegans.

PubMed

Kim, Sunhee; Lee, Hyoung-Joo; Hahm, Jeong-Hoon; Jeong, Seul-Ki; Park, Don-Ha; Hancock, William S; Paik, Young-Ki

2016-02-05

When Caenorhabditis elegans encounters unfavorable growth conditions, it enters the dauer stage, an alternative L3 developmental period. A dauer larva resumes larval development to the normal L4 stage by uncharacterized postdauer reprogramming (PDR) when growth conditions become more favorable. During this transition period, certain heterochronic genes involved in controlling the proper sequence of developmental events are known to act, with their mutations suppressing the Muv (multivulva) phenotype in C. elegans. To identify the specific proteins in which the Muv phenotype is highly suppressed, quantitative proteomic analysis with iTRAQ labeling of samples obtained from worms at L1 + 30 h (for continuous development [CD]) and dauer recovery +3 h (for postdauer development [PD]) was carried out to detect changes in protein abundance in the CD and PD states of both N2 and lin-28(n719). Of the 1661 unique proteins identified with a < 1% false discovery rate at the peptide level, we selected 58 proteins exhibiting ≥2-fold up-regulation or ≥2-fold down-regulation in the PD state and analyzed the Gene Ontology terms. RNAi assays against 15 selected up-regulated genes showed that seven genes were predicted to be involved in higher Muv phenotype (p < 0.05) in lin-28(n791), which is not seen in N2. Specifically, two genes, K08H10.1 and W05H9.1, displayed not only the highest rate (%) of Muv phenotype in the RNAi assay but also the dauer-specific mRNA expression, indicating that these genes may be required for PDR, leading to the very early onset of dauer recovery. Thus, our proteomic approach identifies and quantitates the regulatory proteins potentially involved in PDR in C. elegans, which safeguards the overall lifecycle in response to environmental changes.

Parallelism and Epistasis in Skeletal Evolution Identified through Use of Phylogenomic Mapping Strategies

PubMed Central

Daane, Jacob M.; Rohner, Nicolas; Konstantinidis, Peter; Djuranovic, Sergej; Harris, Matthew P.

2016-01-01

The identification of genetic mechanisms underlying evolutionary change is critical to our understanding of natural diversity, but is presently limited by the lack of genetic and genomic resources for most species. Here, we present a new comparative genomic approach that can be applied to a broad taxonomic sampling of nonmodel species to investigate the genetic basis of evolutionary change. Using our analysis pipeline, we show that duplication and divergence of fgfr1a is correlated with the reduction of scales within fishes of the genus Phoxinellus. As a parallel genetic mechanism is observed in scale-reduction within independent lineages of cypriniforms, our finding exposes significant developmental constraint guiding morphological evolution. In addition, we identified fixed variation in fgf20a within Phoxinellus and demonstrated that combinatorial loss-of-function of fgfr1a and fgf20a within zebrafish phenocopies the evolved scalation pattern. Together, these findings reveal epistatic interactions between fgfr1a and fgf20a as a developmental mechanism regulating skeletal variation among fishes. PMID:26452532

Repression of cell proliferation by miR319-regulated TCP4.

PubMed

Schommer, Carla; Debernardi, Juan M; Bresso, Edgardo G; Rodriguez, Ramiro E; Palatnik, Javier F

2014-10-01

Leaf development has been extensively studied on a genetic level. However, little is known about the interplay between the developmental regulators and the cell cycle machinery--a link that ultimately affects leaf form and size. miR319 is a conserved microRNA that regulates TCP transcription factors involved in multiple developmental pathways, including leaf development and senescence, organ curvature, and hormone biosynthesis and signaling. Here, we analyze the participation of TCP4 in the control of cell proliferation. A small increase in TCP4 activity has an immediate impact on leaf cell number, by significantly reducing cell proliferation. Plants with high TCP4 levels have a strong reduction in the expression of genes known to be active in G2-M phase of the cell cycle. Part of these effects is mediated by induction of miR396, which represses Growth-Regulating Factor (GRF) transcription factors. Detailed analysis revealed TCP4 to be a direct regulator of MIR396b. However, we found that TCP4 can control cell proliferation through additional pathways, and we identified a direct connection between TCP4 and ICK1/KRP1, a gene involved in the progression of the cell cycle. Our results show that TCP4 can activate different pathways that repress cell proliferation. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

Transcriptomic and functional analyses unveil the role of long non-coding RNAs in anthocyanin biosynthesis during sea buckthorn fruit ripening.

PubMed

Zhang, Guoyun; Chen, Daoguo; Zhang, Tong; Duan, Aiguo; Zhang, Jianguo; He, Caiyun

2018-06-04

Fruit ripening is a developmental process regulated by a complex network of endogenous and exogenous cues. Sea buckthorn is an excellent material for fruit ripening studies due to its dramatic ripening process and high contents of nutritional and anti-oxidant compounds in berries. Here, the whole transcriptome of sea buckthorn fruit at three development stages were analysed using multiple high-throughput sequencings. We assembled and annotated 9,008 long non-coding RNAs (lncRNAs) in sea buckthorn fruits, and identified 118 differentially expressed lncRNAs (DE-lncRNAs) and 32 differentially expressed microRNAs in fruit developmental process. In addition, we predicted 1,061 cis-regulated and 782 trans-regulated targets of DE-lncRNAs, and these DE-lncRNAs are specifically enriched in the biosynthesis of ascorbic acid, carotenoids and flavonoids. Moreover, the silencing of two lncRNAs (LNC1 and LNC2) in vivo and expression analysis revealed that LNC1 and LNC2 can act as endogenous target mimics of miR156a and miR828a to reduce SPL9 and induce MYB114 expression, respectively, which lead to increased and decreased anthocyanin content as revealed by high-performance liquid chromatography analysis. Our results present the first global functional analysis of lncRNA in sea buckthorn and provide two essential regulators of anthocyanin biosynthesis, which provides new insights into the regulation of fruit quality.

A novel zinc-finger protein with a proline-rich domain mediates ABA-regulated seed dormancy in Arabidopsis.

PubMed

He, Yuehui; Gan, Susheng

2004-01-01

Seed dormancy is an important developmental process that prevents pre-harvest sprouting in many grains and other seeds. Abscisic acid (ABA), a plant hormone, plays a crucial role in regulating dormancy but the underlying molecular regulatory mechanisms are not fully understood. An Arabidopsis zinc-finger gene, MEDIATOR OF ABA-REGULATED DORMANCY 1 ( MARD1 ) was identified and functionally analyzed. MARD1 expression is up-regulated by ABA. A T-DNA insertion in the promoter region downstream of two ABA-responsive elements (ABREs) renders MARD1 unable to respond to ABA. The mard1 seeds are less dormant and germinate in total darkness; their germination is resistant to external ABA at the stage of radicle protrusion. These results suggest that this novel zinc-finger protein with a proline-rich N-terminus is an important downstream component of the ABA signaling pathway that mediates ABA-regulated seed dormancy in Arabidopsis.

A Novel 3-Hydroxysteroid Dehydrogenase That Regulates Reproductive Development and Longevity

PubMed Central

Wollam, Joshua; Magner, Daniel B.; Magomedova, Lilia; Rass, Elisabeth; Shen, Yidong; Rottiers, Veerle; Habermann, Bianca; Cummins, Carolyn L.; Antebi, Adam

2012-01-01

Endogenous small molecule metabolites that regulate animal longevity are emerging as a novel means to influence health and life span. In C. elegans, bile acid-like steroids called the dafachronic acids (DAs) regulate developmental timing and longevity through the conserved nuclear hormone receptor DAF-12, a homolog of mammalian sterol-regulated receptors LXR and FXR. Using metabolic genetics, mass spectrometry, and biochemical approaches, we identify new activities in DA biosynthesis and characterize an evolutionarily conserved short chain dehydrogenase, DHS-16, as a novel 3-hydroxysteroid dehydrogenase. Through regulation of DA production, DHS-16 controls DAF-12 activity governing longevity in response to signals from the gonad. Our elucidation of C. elegans bile acid biosynthetic pathways reveals the possibility of novel ligands as well as striking biochemical conservation to other animals, which could illuminate new targets for manipulating longevity in metazoans. PMID:22505847

Emotion regulation: a theme in search of definition.

PubMed

Thompson, R A

1994-01-01

Contemporary interest in emotion regulation promises to advance important new views of emotional development as well as offering applications to developmental psychopathology, but these potential contributions are contingent on developmentalists' attention to some basic definitional issues. This essay offers a perspective on these issues by considering how emotion regulation should be defined, the various components of the management of emotion, how emotion regulation strategies fit into the dynamics of social interaction, and how individual differences in emotion regulation should be conceptualized and measured. In the end, it seems clear that emotion regulation is a conceptual rubric for a remarkable range of developmental processes, each of which may have its own catalysts and control processes. Likewise, individual differences in emotion regulation skills likely have multifaceted origins and are also related in complex ways to the person's emotional goals and the immediate demands of the situation. Assessment approaches that focus on the dynamics of emotion are well suited to elucidating these complex developmental and individual differences. In sum, a challenging research agenda awaits those who enter this promising field of study.

Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

PubMed

Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

2017-10-01

The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao

PubMed Central

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-01-01

Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440

Molecular dissection of transcriptional reprogramming of steviol glycosides synthesis in leaf tissue during developmental phase transitions in Stevia rebaudiana Bert.

PubMed

Singh, Gopal; Singh, Gagandeep; Singh, Pradeep; Parmar, Rajni; Paul, Navgeet; Vashist, Radhika; Swarnkar, Mohit Kumar; Kumar, Ashok; Singh, Sanatsujat; Singh, Anil Kumar; Kumar, Sanjay; Sharma, Ram Kumar

2017-09-19

Stevia is a natural source of commercially important steviol glycosides (SGs), which share biosynthesis route with gibberellic acids (GAs) through plastidal MEP and cytosolic MVA pathways. Ontogeny-dependent deviation in SGs biosynthesis is one of the key factor for global cultivation of Stevia, has not been studied at transcriptional level. To dissect underlying molecular mechanism, we followed a global transcriptome sequencing approach and generated more than 100 million reads. Annotation of 41,262 de novo assembled transcripts identified all the genes required for SGs and GAs biosynthesis. Differential gene expression and quantitative analysis of important pathway genes (DXS, HMGR, KA13H) and gene regulators (WRKY, MYB, NAC TFs) indicated developmental phase dependent utilization of metabolic flux between SGs and GAs synthesis. Further, identification of 124 CYPs and 45 UGTs enrich the genomic resources, and their PPI network analysis with SGs/GAs biosynthesis proteins identifies putative candidates involved in metabolic changes, as supported by their developmental phase-dependent expression. These putative targets can expedite molecular breeding and genetic engineering efforts to enhance SGs content, biomass and yield. Futuristically, the generated dataset will be a useful resource for development of functional molecular markers for diversity characterization, genome mapping and evolutionary studies in Stevia.

Development of Civic Engagement: Theoretical and Methodological Issues

ERIC Educational Resources Information Center

Lerner, Richard M.; Wang, Jun; Champine, Robey B.; Warren, Daniel J. A.; Erickson, Karl

2014-01-01

Within contemporary developmental science, models derived from relational developmental systems (RDS) metatheory emphasize that the basic process of human development involves mutually-influential relations, termed developmental regulations, between the developing individual and his or her complex and changing physical, social, and cultural…

Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

EPA Science Inventory

Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

PubMed Central

Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

2016-01-01

Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

MRCK-1 drives apical constriction in C. elegans by linking developmental patterning to force generation

PubMed Central

Marston, Daniel J.; Higgins, Christopher D.; Peters, Kimberly A.; Cupp, Timothy D.; Dickinson, Daniel J.; Pani, Ariel M.; Moore, Regan P.; Cox, Amanda H.; Kiehart, Daniel P.; Goldstein, Bob

2016-01-01

Summary Apical constriction is a change in cell shape that drives key morphogenetic events including gastrulation and neural tube formation. Apical force-producing actomyosin networks drive apical constriction by contracting while connected to cell-cell junctions. The mechanisms by which developmental patterning regulates these actomyosin networks and associated junctions with spatial precision are not fully understood. Here, we identify a myosin light chain kinase MRCK-1 as a key regulator of C. elegans gastrulation that integrates spatial and developmental patterning information. We show that MRCK-1 is required for activation of contractile actomyosin dynamics and elevated cortical tension in the apical cell cortex of endodermal precursor cells. MRCK-1 is apically localized by active Cdc42 at the external, cell-cell contact-free surfaces of apically constricting cells, downstream of cell fate determination mechanisms. We establish that the junctional components α-catenin, β-catenin, and cadherin become highly enriched at the apical junctions of apically-constricting cells, and that MRCK-1 and myosin activity are required in vivo for this enrichment. Taken together, our results define mechanisms that position a myosin activator to a specific cell surface where it both locally increases cortical tension and locally enriches junctional components to facilitate apical constriction. These results reveal crucial links that can tie spatial information to local force generation to drive morphogenesis. PMID:27451898

Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

PubMed Central

Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

2011-01-01

Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low- and highly-methyl-esterified HG epitopes are developmentally regulated in diverse embryogenic stages during somatic embryogenesis. This study provides new information about pectin composition, HG methyl-esterification and developmental localization of pectin epitopes during somatic embryogenesis of banana. PMID:21826225

Epigenetic mechanisms in developmental programming of adult disease

PubMed Central

Chen, Man; Zhang, Lubo

2011-01-01

Adverse insults during intrauterine life can result in permanent changes in the physiology and metabolism of the offspring, which in turn leads to an increased risk of disease in adulthood. This is an adaptational response by the fetus to changes in the environmental signals that it receives during early life to ensure its survival and prepare itself for postnatal life. Increasing evidence suggests that the epigenetic regulation of gene expression patterns has a crucial role in the developmental programming of adult disease. This review summarizes recent studies of epigenetic mechanisms and focuses particularly on studies that explore identifiable epigenetic biomarkers in the promoters of specific disease-associated genes. Such biomarkers would enable early recognition of children who might be at risk of developing adult disease with fetal origins. PMID:21945859

Hey bHLH transcription factors.

PubMed

Weber, David; Wiese, Cornelia; Gessler, Manfred

2014-01-01

Hey bHLH transcription factors are direct targets of canonical Notch signaling. The three mammalian Hey proteins are closely related to Hes proteins and they primarily repress target genes by either directly binding to core promoters or by inhibiting other transcriptional activators. Individual candidate gene approaches and systematic screens identified a number of Hey target genes, which often encode other transcription factors involved in various developmental processes. Here, we review data on interaction partners and target genes and conclude with a model for Hey target gene regulation. Furthermore, we discuss how expression of Hey proteins affects processes like cell fate decisions and differentiation, e.g., in cardiovascular, skeletal, and neural development or oncogenesis and how this relates to the observed developmental defects and phenotypes observed in various knockout mice. © 2014 Elsevier Inc. All rights reserved.

Genome-Wide Analysis Reveals Novel Regulators of Growth in Drosophila melanogaster

PubMed Central

Vonesch, Sibylle Chantal; Lamparter, David; Mackay, Trudy F. C.; Bergmann, Sven; Hafen, Ernst

2016-01-01

Organismal size depends on the interplay between genetic and environmental factors. Genome-wide association (GWA) analyses in humans have implied many genes in the control of height but suffer from the inability to control the environment. Genetic analyses in Drosophila have identified conserved signaling pathways controlling size; however, how these pathways control phenotypic diversity is unclear. We performed GWA of size traits using the Drosophila Genetic Reference Panel of inbred, sequenced lines. We find that the top associated variants differ between traits and sexes; do not map to canonical growth pathway genes, but can be linked to these by epistasis analysis; and are enriched for genes and putative enhancers. Performing GWA on well-studied developmental traits under controlled conditions expands our understanding of developmental processes underlying phenotypic diversity. PMID:26751788

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire.

PubMed

Gates, Michael A; Kannan, Ramakrishnan; Giniger, Edward

2011-11-30

The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis.

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function.

PubMed

Bagley, Joshua A; Yan, Zhiqiang; Zhang, Wei; Wildonger, Jill; Jan, Lily Yeh; Jan, Yuh Nung

2014-09-01

A complex array of genetic factors regulates neuronal dendrite morphology. Epigenetic regulation of gene expression represents a plausible mechanism to control pathways responsible for specific dendritic arbor shapes. By studying the Drosophila dendritic arborization (da) neurons, we discovered a role of the double-bromodomain and extraterminal (BET) family proteins in regulating dendrite arbor complexity. A loss-of-function mutation in the single Drosophila BET protein encoded by female sterile 1 homeotic [fs(1)h] causes loss of fine, terminal dendritic branches. Moreover, fs(1)h is necessary for the induction of branching caused by a previously identified transcription factor, Cut (Ct), which regulates subtype-specific dendrite morphology. Finally, disrupting fs(1)h function impairs the mechanosensory response of class III da sensory neurons without compromising the expression of the ion channel NompC, which mediates the mechanosensitive response. Thus, our results identify a novel role for BET family proteins in regulating dendrite morphology and a possible separation of developmental pathways specifying neural cell morphology and ion channel expression. Since the BET proteins are known to bind acetylated histone tails, these results also suggest a role of epigenetic histone modifications and the "histone code," in regulating dendrite morphology. © 2014 Bagley et al.; Published by Cold Spring Harbor Laboratory Press.

29 CFR 1952.384 - Completed developmental steps.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completed developmental steps. 1952.384 Section 1952.384 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION....384 Completed developmental steps. (a) In accordance with the requirements of § 1952.10, Puerto Rico's...

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

29 CFR 1902.33 - Developmental period.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

Transcriptomic Analysis of Flower Blooming in Jasminum sambac through De Novo RNA Sequencing.

PubMed

Li, Yong-Hua; Zhang, Wei; Li, Yong

2015-06-10

Flower blooming is a critical and complicated plant developmental process in flowering plants. However, insufficient information is available about the complex network that regulates flower blooming in Jasminum sambac. In this study, we used the RNA-Seq platform to analyze the molecular regulation of flower blooming in J. sambac by comparing the transcript profiles at two flower developmental stages: budding and blooming. A total of 4577 differentially-expressed genes (DEGs) were identified between the two floral stages. The Gene Ontology and the Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses revealed that the DEGs in the "oxidation-reduction process", "extracellular region", "steroid biosynthesis", "glycosphingolipid biosynthesis", "plant hormone signal transduction" and "pentose and glucuronate interconversions" might be associated with flower development. A total of 103 and 92 unigenes exhibited sequence similarities to the known flower development and floral scent genes from other plants. Among these unigenes, five flower development and 19 floral scent unigenes exhibited at least four-fold differences in expression between the two stages. Our results provide abundant genetic resources for studying the flower blooming mechanisms and molecular breeding of J. sambac.

Oscillatory Protein Expression Dynamics Endows Stem Cells with Robust Differentiation Potential

PubMed Central

Kaneko, Kunihiko

2011-01-01

The lack of understanding of stem cell differentiation and proliferation is a fundamental problem in developmental biology. Although gene regulatory networks (GRNs) for stem cell differentiation have been partially identified, the nature of differentiation dynamics and their regulation leading to robust development remain unclear. Herein, using a dynamical system modeling cell approach, we performed simulations of the developmental process using all possible GRNs with a few genes, and screened GRNs that could generate cell type diversity through cell-cell interactions. We found that model stem cells that both proliferated and differentiated always exhibited oscillatory expression dynamics, and the differentiation frequency of such stem cells was regulated, resulting in a robust number distribution. Moreover, we uncovered the common regulatory motifs for stem cell differentiation, in which a combination of regulatory motifs that generated oscillatory expression dynamics and stabilized distinct cellular states played an essential role. These findings may explain the recently observed heterogeneity and dynamic equilibrium in cellular states of stem cells, and can be used to predict regulatory networks responsible for differentiation in stem cell systems. PMID:22073296

Migrating Interneurons Secrete Fractalkine to Promote Oligodendrocyte Formation in the Developing Mammalian Brain.

PubMed

Voronova, Anastassia; Yuzwa, Scott A; Wang, Beatrix S; Zahr, Siraj; Syal, Charvi; Wang, Jing; Kaplan, David R; Miller, Freda D

2017-05-03

During development, newborn interneurons migrate throughout the embryonic brain. Here, we provide evidence that these interneurons act in a paracrine fashion to regulate developmental oligodendrocyte formation. Specifically, we show that medial ganglionic eminence (MGE) interneurons secrete factors that promote genesis of oligodendrocytes from glially biased cortical precursors in culture. Moreover, when MGE interneurons are genetically ablated in vivo prior to their migration, this causes a deficit in cortical oligodendrogenesis. Modeling of the interneuron-precursor paracrine interaction using transcriptome data identifies the cytokine fractalkine as responsible for the pro-oligodendrocyte effect in culture. This paracrine interaction is important in vivo, since knockdown of the fractalkine receptor CX3CR1 in embryonic cortical precursors, or constitutive knockout of CX3CR1, causes decreased numbers of oligodendrocyte progenitor cells (OPCs) and oligodendrocytes in the postnatal cortex. Thus, in addition to their role in regulating neuronal excitability, interneurons act in a paracrine fashion to promote the developmental genesis of oligodendrocytes. Copyright © 2017 Elsevier Inc. All rights reserved.

ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

PubMed

Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

2013-05-01

Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride

PubMed Central

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E.; Staege, Martin S.; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS. PMID:29515560

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

PubMed

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

Deep Sequencing of the Medicago truncatula Root Transcriptome Reveals a Massive and Early Interaction between Nodulation Factor and Ethylene Signals.

PubMed

Larrainzar, Estíbaliz; Riely, Brendan K; Kim, Sang Cheol; Carrasquilla-Garcia, Noelia; Yu, Hee-Ju; Hwang, Hyun-Ju; Oh, Mijin; Kim, Goon Bo; Surendrarao, Anandkumar K; Chasman, Deborah; Siahpirani, Alireza F; Penmetsa, Ramachandra V; Lee, Gang-Seob; Kim, Namshin; Roy, Sushmita; Mun, Jeong-Hwan; Cook, Douglas R

2015-09-01

The legume-rhizobium symbiosis is initiated through the activation of the Nodulation (Nod) factor-signaling cascade, leading to a rapid reprogramming of host cell developmental pathways. In this work, we combine transcriptome sequencing with molecular genetics and network analysis to quantify and categorize the transcriptional changes occurring in roots of Medicago truncatula from minutes to days after inoculation with Sinorhizobium medicae. To identify the nature of the inductive and regulatory cues, we employed mutants with absent or decreased Nod factor sensitivities (i.e. Nodulation factor perception and Lysine motif domain-containing receptor-like kinase3, respectively) and an ethylene (ET)-insensitive, Nod factor-hypersensitive mutant (sickle). This unique data set encompasses nine time points, allowing observation of the symbiotic regulation of diverse biological processes with high temporal resolution. Among the many outputs of the study is the early Nod factor-induced, ET-regulated expression of ET signaling and biosynthesis genes. Coupled with the observation of massive transcriptional derepression in the ET-insensitive background, these results suggest that Nod factor signaling activates ET production to attenuate its own signal. Promoter:β-glucuronidase fusions report ET biosynthesis both in root hairs responding to rhizobium as well as in meristematic tissue during nodule organogenesis and growth, indicating that ET signaling functions at multiple developmental stages during symbiosis. In addition, we identified thousands of novel candidate genes undergoing Nod factor-dependent, ET-regulated expression. We leveraged the power of this large data set to model Nod factor- and ET-regulated signaling networks using MERLIN, a regulatory network inference algorithm. These analyses predict key nodes regulating the biological process impacted by Nod factor perception. We have made these results available to the research community through a searchable online resource. © 2015 American Society of Plant Biologists. All Rights Reserved.

Identifying Support Functions in Developmental Relationships: A Self-Determination Perspective

ERIC Educational Resources Information Center

Janssen, Suzanne; van Vuuren, Mark; de Jong, Menno D. T.

2013-01-01

This study examines the content of developmental networks from the perspective of self-determination theory. We qualitatively examine 18 proteges' constellations of developmental relationships to identify specific types of developmental support functions. Our study shows that the adoption of self-determination theory leads to a theory-based…

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

The ULTRAPETALA1 trxG factor contributes to patterning the Arabidopsis adaxial-abaxial leaf polarity axis

USDA-ARS?s Scientific Manuscript database

The SAND domain protein ULTRAPETALA1 (ULT1) functions as a trithorax group factor that regulates a variety of developmental processes in Arabidopsis. We have recently shown that ULT1 regulates developmental patterning in the gynoecia and leaves. ULT1 acts together with the KANADI1 (KAN1) transcripti...

Using Formative Assessment and Self-Regulated Learning to Help Developmental Mathematics Students Achieve: A Multi-Campus Program

ERIC Educational Resources Information Center

Hudesman, John; Crosby, Sara; Ziehmke, Niesha; Everson, Howard; Issac, Sharlene; Flugman, Bert; Zimmerman, Barry; Moylan, Adam

2014-01-01

The authors describe an Enhanced Formative Assessment and Self-Regulated Learning (EFA-SRL) program designed to improve the achievement of community college students enrolled in developmental mathematics courses. Their model includes the use of specially formatted quizzes designed to assess both the students' mathematics and metacognitive skill…

Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

ERIC Educational Resources Information Center

Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

2016-01-01

The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

The Effects of Self-Regulated Learning Training on Community College Students' Metacognition and Achievement in Developmental Math Courses

ERIC Educational Resources Information Center

Bol, Linda; Campbell, Karen D. Y.; Perez, Tony; Yen, Cherng-Jyh

2016-01-01

The effects of training in self-regulation on metacognition and math achievement were investigated. The participants were 116 community college students enrolled in developmental math courses. Students enrolled in 16 classrooms were randomly assigned to the treatment and control groups. Participants in the treatment group completed four…

SNAT2 and LAT1 transporter abundance is developmentally regulated in skeletal muscle of neonatal pigs

USDA-ARS?s Scientific Manuscript database

Previously, we demonstrated that the insulin and amino acid–induced activation of the mammalian target of rapamycin complex 1 (mTORC1), is developmentally regulated in neonatal pigs. Recent studies have indicated an important role of the System A transporters (SNAT2 and SLC1A5) and the L transporter...

Arabidopsis REGULATOR OF AXILLARY MERISTEMS1 controls a leaf axil stem cell niche and modulates vegetative development.

PubMed

Keller, Thomas; Abbott, Jessica; Moritz, Thomas; Doerner, Peter

2006-03-01

Shoot branching is a major determinant of variation in plant stature. Branches, which form secondary growth axes, originate from stem cells activated in leaf axils. The initial steps by which axillary meristems (AMs) are specified and their stem cells organized are still poorly understood. We identified gain- and loss-of-function alleles at the Arabidopsis thaliana REGULATOR OF AXILLARY MERISTEMS1 (RAX1) locus. RAX1 is encoded by the Myb-like transcription factor MYB37 and is an Arabidopsis homolog of the tomato (Solanum lycopersicum) Blind gene. RAX1 is transiently expressed in a small central domain within the boundary zone separating shoot apical meristem and leaf primordia early in leaf primordium development. RAX1 genetically interacts with CUP-SHAPED COTYLEDON (CUC) genes and is required for the expression of CUC2 in the RAX1 expression domain, suggesting that RAX1 acts through CUC2. We propose that RAX1 functions to positionally specify a stem cell niche for AM formation. RAX1 also affects the timing of developmental phase transitions by negatively regulating gibberellic acid levels in the shoot apex. RAX1 thus defines a novel activity that links the specification of AM formation with the modulation of the rate of progression through developmental phases.

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana

PubMed Central

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H.; Trivedi, Prabodh K.

2016-01-01

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana. PMID:27539368

Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

PubMed

Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

2016-08-19

Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Arabidopsis thaliana G2-LIKE FLAVONOID REGULATOR and BRASSINOSTEROID ENHANCED EXPRESSION1 are low-temperature regulators of flavonoid accumulation.

PubMed

Petridis, Antonios; Döll, Stefanie; Nichelmann, Lars; Bilger, Wolfgang; Mock, Hans-Peter

2016-08-01

Flavonoid synthesis is predominantly regulated at the transcriptional level through the MYB-basic helix-loop-helix (bHLH)-WD40 (MBW) (MYB: transcription factor of the myeloblastosis protein family, WD40: tanscription factor with a short structural motif of 40 amino acids which terminates in an aspartic acid-tryptophan dipeptide) complex, and responds to both environmental and developmental stimuli. Although the developmental regulation of flavonoid accumulation in Arabidopsis thaliana has been examined in great detail, the response of the flavonoid synthesis pathway to abiotic stress (particularly low temperature) remains unclear. A screen of a Dissociation element (Ds) transposon-induced mutation collection identified two lines which exhibited an altered profile of phenylpropanoid accumulation following exposure to low-temperature stress. One of the mutated genes (BRASSINOSTEROID ENHANCED EXPRESSION1 (BEE1)) encoded a brassinosteroid enhanced expression transcription factor, while the other (G2-LIKE FLAVONOID REGULATOR (GFR)) encoded a G2-like flavonoid regulator. Phenylpropanoid-targeted analysis was performed using high-performance LC-MS, and gene expression analysis using quantitative reverse transcription-PCR. In both mutants, the accumulation of quercetins and scopolin was reduced under low-temperature growing conditions, whereas that of anthocyanin was increased. BEE1 and GFR were both shown to negatively regulate anthocyanin accumulation by inhibiting anthocyanin synthesis genes via the suppression of the bHLH (TRANSPARENT TESTA8 (TT8) and GLABROUS3 (GL3)) and/or the MYB (PRODUCTION OF ANTHOCYANIN PIGMENTS2 (PAP2)) components of the MBW complex. Our results provide new insight into the regulatory control of phenylpropanoid metabolism at low temperatures, and reveal that BEE1 and GFR act as important components of the signal transduction chain. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

Cyber "Pokes": Motivational Antidote for Developmental College Readers

ERIC Educational Resources Information Center

Bowers-Campbell, Joy

2008-01-01

Difficulties characterizing developmental college students are reviewed within the context of motivational theories of learning. The author highlights problems of low self-efficacy and inadequate self-regulated learning for developmental college students. The author argues that the use of Facebook, a widely-used social networking technology, may…

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

PubMed

Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

2015-06-01

Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

From genomes to vaccines: Leishmania as a model.

PubMed Central

Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M

2002-01-01

The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease control in humans. PMID:11839176

De novo sequencing and analysis of the cranberry fruit transcriptome to identify putative genes involved in flavonoid biosynthesis, transport and regulation.

PubMed

Sun, Haiyue; Liu, Yushan; Gai, Yuzhuo; Geng, Jinman; Chen, Li; Liu, Hongdi; Kang, Limin; Tian, Youwen; Li, Yadong

2015-09-02

Cranberries (Vaccinium macrocarpon Ait.), renowned for their excellent health benefits, are an important berry crop. Here, we performed transcriptome sequencing of one cranberry cultivar, from fruits at two different developmental stages, on the Illumina HiSeq 2000 platform. Our main goals were to identify putative genes for major metabolic pathways of bioactive compounds and compare the expression patterns between white fruit (W) and red fruit (R) in cranberry. In this study, two cDNA libraries of W and R were constructed. Approximately 119 million raw sequencing reads were generated and assembled de novo, yielding 57,331 high quality unigenes with an average length of 739 bp. Using BLASTx, 38,460 unigenes were identified as putative homologs of annotated sequences in public protein databases, including NCBI NR, NT, Swiss-Prot, KEGG, COG and GO. Of these, 21,898 unigenes mapped to 128 KEGG pathways, with the metabolic pathways, secondary metabolites, glycerophospholipid metabolism, ether lipid metabolism, starch and sucrose metabolism, purine metabolism, and pyrimidine metabolism being well represented. Among them, many candidate genes were involved in flavonoid biosynthesis, transport and regulation. Furthermore, digital gene expression (DEG) analysis identified 3,257 unigenes that were differentially expressed between the two fruit developmental stages. In addition, 14,473 simple sequence repeats (SSRs) were detected. Our results present comprehensive gene expression information about the cranberry fruit transcriptome that could facilitate our understanding of the molecular mechanisms of fruit development in cranberries. Although it will be necessary to validate the functions carried out by these genes, these results could be used to improve the quality of breeding programs for the cranberry and related species.

Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

PubMed

Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

Dynamic and Widespread lncRNA Expression in a Sponge and the Origin of Animal Complexity

PubMed Central

Gaiti, Federico; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Calcino, Andrew D.; Yanai, Itai; Tanurdzic, Milos; Degnan, Bernard M.

2015-01-01

Long noncoding RNAs (lncRNAs) are important developmental regulators in bilaterian animals. A correlation has been claimed between the lncRNA repertoire expansion and morphological complexity in vertebrate evolution. However, this claim has not been tested by examining morphologically simple animals. Here, we undertake a systematic investigation of lncRNAs in the demosponge Amphimedon queenslandica, a morphologically simple, early-branching metazoan. We combine RNA-Seq data across multiple developmental stages of Amphimedon with a filtering pipeline to conservatively predict 2,935 lncRNAs. These include intronic overlapping lncRNAs, exonic antisense overlapping lncRNAs, long intergenic nonprotein coding RNAs, and precursors for small RNAs. Sponge lncRNAs are remarkably similar to their bilaterian counterparts in being relatively short with few exons and having low primary sequence conservation relative to protein-coding genes. As in bilaterians, a majority of sponge lncRNAs exhibit typical hallmarks of regulatory molecules, including high temporal specificity and dynamic developmental expression. Specific lncRNA expression profiles correlate tightly with conserved protein-coding genes likely involved in a range of developmental and physiological processes, such as the Wnt signaling pathway. Although the majority of Amphimedon lncRNAs appears to be taxonomically restricted with no identifiable orthologs, we find a few cases of conservation between demosponges in lncRNAs that are antisense to coding sequences. Based on the high similarity in the structure, organization, and dynamic expression of sponge lncRNAs to their bilaterian counterparts, we propose that these noncoding RNAs are an ancient feature of the metazoan genome. These results are consistent with lncRNAs regulating the development of animals, regardless of their level of morphological complexity. PMID:25976353

Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

PubMed Central

2014-01-01

Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

PubMed

Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

2016-08-01

Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE PAGES

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

2017-06-21

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

MEDIATOR18 and MEDIATOR20 confer susceptibility to Fusarium oxysporum in Arabidopsis thaliana

PubMed Central

Stiller, Jiri; Davoine, Celine; Björklund, Stefan; Manners, John M.; Kazan, Kemal; Schenk, Peer M.

2017-01-01

The conserved protein complex known as Mediator conveys transcriptional signals by acting as an intermediary between transcription factors and RNA polymerase II. As a result, Mediator subunits play multiple roles in regulating developmental as well as abiotic and biotic stress pathways. In this report we identify the head domain subunits MEDIATOR18 and MEDIATOR20 as important susceptibility factors for Fusarium oxysporum infection in Arabidopsis thaliana. Mutants of MED18 and MED20 display down-regulation of genes associated with jasmonate signaling and biosynthesis while up-regulation of salicylic acid associated pathogenesis related genes and reactive oxygen producing and scavenging genes. We propose that MED18 and MED20 form a sub-domain within Mediator that controls the balance of salicylic acid and jasmonate associated defense pathways. PMID:28441405

29 CFR 1956.62 - Completion of developmental steps and certification. [Reserved

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Completion of developmental steps and certification. [Reserved] 1956.62 Section 1956.62 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... EMPLOYEE PLANS New Jersey § 1956.62 Completion of developmental steps and certification. [Reserved] ...

New Directions in Developmental Emotion Regulation Research across the Life Span: Introduction to the Special Section

ERIC Educational Resources Information Center

Zimmermann, Peter; Thompson, Ross A.

2014-01-01

Research on the development of emotion regulation has become a prominent topic in developmental science covering a broad age range from infancy to old age because of its theoretical importance and practical implications. This introductory essay of this special section includes reflections on some of the conceptual themes of this research field and…

Abundance of amino acid transporters involved in mTORC1 activation in skeletal muscle of neonatal pigs is developmentally regulated

USDA-ARS?s Scientific Manuscript database

Previously we demonstrated that the insulinand amino acid-induced activation of the mammalian target of rapamycin complex 1 (mTORC1) is developmentally regulated in neonatal pigs. Recent studies have indicated that members of the System A transporter (SNAT2), the System N transporter (SNAT3), the Sy...

Medicaid program; mental retardation--definition of "persons with related conditions"--Health Care Financing Administration. Proposed rule.

PubMed

1983-02-23

We propose to amend the 1978 Medicaid regulations on intermediate care facility services for the mentally retarded and persons with related conditions to correct the definition of "persons with related conditions". This definition, because of an inadvertent error in 1978, is currently tied to the definition of developmental disability in the Developmental Disabilities Assistance and Bill of Rights Act (DDABRA) as amended in 1978. The DDABRA, as amended, covers the mentally ill. The 1978 regulations intended to make "no substantive change" to prior Medicaid regulations which did not cover the mentally ill. The cross-reference to the DDABRA produced the unintended result of incorporating into Medicaid regulations the revision to the definition of the developmentally disabled created by the 1978 amendments to the DDABRA and may tend to cause confusion about the kind of care that is covered by the Medicaid program. Therefore, a correction of this drafting error is necessary. To avoid results of this kind in the future this proposal would establish a Medicaid definition of conditions related to mental retardation that would meet specific needs of the Medicaid program and would be independent of the definition of developmental disability in the DDABRA.

Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)

USGS Publications Warehouse

Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.

2003-01-01

Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance. 

Specification of Drosophila Corpora Cardiaca Neuroendocrine Cells from Mesoderm Is Regulated by Notch Signaling

PubMed Central

Park, Sangbin; Bustamante, Erika L.; Antonova, Julie; McLean, Graeme W.; Kim, Seung K.

2011-01-01

Drosophila neuroendocrine cells comprising the corpora cardiaca (CC) are essential for systemic glucose regulation and represent functional orthologues of vertebrate pancreatic α-cells. Although Drosophila CC cells have been regarded as developmental orthologues of pituitary gland, the genetic regulation of CC development is poorly understood. From a genetic screen, we identified multiple novel regulators of CC development, including Notch signaling factors. Our studies demonstrate that the disruption of Notch signaling can lead to the expansion of CC cells. Live imaging demonstrates localized emergence of extra precursor cells as the basis of CC expansion in Notch mutants. Contrary to a recent report, we unexpectedly found that CC cells originate from head mesoderm. We show that Tinman expression in head mesoderm is regulated by Notch signaling and that the combination of Daughterless and Tinman is sufficient for ectopic CC specification in mesoderm. Understanding the cellular, genetic, signaling, and transcriptional basis of CC cell specification and expansion should accelerate discovery of molecular mechanisms regulating ontogeny of organs that control metabolism. PMID:21901108

Establishing a Framework for the Ad/Abaxial Regulatory Network of Arabidopsis: Ascertaining Targets of Class III HOMEODOMAIN LEUCINE ZIPPER and KANADI Regulation[W

PubMed Central

Reinhart, Brenda J.; Liu, Tie; Newell, Nicole R.; Magnani, Enrico; Huang, Tengbo; Kerstetter, Randall; Michaels, Scott; Barton, M. Kathryn

2013-01-01

The broadly conserved Class III HOMEODOMAIN LEUCINE ZIPPER (HD-ZIPIII) and KANADI transcription factors have opposing and transformational effects on polarity and growth in all tissues and stages of the plant's life. To obtain a comprehensive understanding of how these factors work, we have identified transcripts that change in response to induced HD-ZIPIII or KANADI function. Additional criteria used to identify high-confidence targets among this set were presence of an adjacent HD-ZIPIII binding site, expression enriched within a subdomain of the shoot apical meristem, mutant phenotype showing defect in polar leaf and/or meristem development, physical interaction between target gene product and HD-ZIPIII protein, opposite regulation by HD-ZIPIII and KANADI, and evolutionary conservation of the regulator–target relationship. We find that HD-ZIPIII and KANADI regulate tissue-specific transcription factors involved in subsidiary developmental decisions, nearly all major hormone pathways, and new actors (such as INDETERMINATE DOMAIN4) in the ad/abaxial regulatory network. Multiple feedback loops regulating HD-ZIPIII and KANADI are identified, as are mechanisms through which HD-ZIPIII and KANADI oppose each other. This work lays the foundation needed to understand the components, structure, and workings of the ad/abaxial regulatory network directing basic plant growth and development. PMID:24076978

Development and regulation of chloride homeostasis in the central nervous system.

PubMed

Watanabe, Miho; Fukuda, Atsuo

2015-01-01

γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter of the mature central nervous system (CNS). The developmental switch of GABAergic transmission from excitation to inhibition is induced by changes in Cl(-) gradients, which are generated by cation-Cl(-) co-transporters. An accumulation of Cl(-) by the Na(+)-K(+)-2Cl(-) co-transporter (NKCC1) increases the intracellular Cl(-) concentration ([Cl(-)]i) such that GABA depolarizes neuronal precursors and immature neurons. The subsequent ontogenetic switch, i.e., upregulation of the Cl(-)-extruder KCC2, which is a neuron-specific K(+)-Cl(-) co-transporter, with or without downregulation of NKCC1, results in low [Cl(-)]i levels and the hyperpolarizing action of GABA in mature neurons. Development of Cl(-) homeostasis depends on developmental changes in NKCC1 and KCC2 expression. Generally, developmental shifts (decreases) in [Cl(-)]i parallel the maturation of the nervous system, e.g., early in the spinal cord, hypothalamus and thalamus, followed by the limbic system, and last in the neocortex. There are several regulators of KCC2 and/or NKCC1 expression, including brain-derived neurotrophic factor (BDNF), insulin-like growth factor (IGF), and cystic fibrosis transmembrane conductance regulator (CFTR). Therefore, regionally different expression of these regulators may also contribute to the regional developmental shifts of Cl(-) homeostasis. KCC2 and NKCC1 functions are also regulated by phosphorylation by enzymes such as PKC, Src-family tyrosine kinases, and WNK1-4 and their downstream effectors STE20/SPS1-related proline/alanine-rich kinase (SPAK)-oxidative stress responsive kinase-1 (OSR1). In addition, activation of these kinases is modulated by humoral factors such as estrogen and taurine. Because these transporters use the electrochemical driving force of Na(+) and K(+) ions, topographical interaction with the Na(+)-K(+) ATPase and its modulators such as creatine kinase (CK) should modulate functions of Cl(-) transporters. Therefore, regional developmental regulation of these regulators and modulators of Cl(-) transporters may also play a pivotal role in the development of Cl(-) homeostasis.

Characterization of the cork oak transcriptome dynamics during acorn development.

PubMed

Miguel, Andreia; de Vega-Bartol, José; Marum, Liliana; Chaves, Inês; Santo, Tatiana; Leitão, José; Varela, Maria Carolina; Miguel, Célia M

2015-06-25

Cork oak (Quercus suber L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water. A total of 80,357 expressed sequence tags (ESTs) were de novo assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in Q. suber transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability. To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.

A genomic approach to identify hybrid incompatibility genes

PubMed Central

Cooper, Jacob C.; Phadnis, Nitin

2016-01-01

ABSTRACT Uncovering the genetic and molecular basis of barriers to gene flow between populations is key to understanding how new species are born. Intrinsic postzygotic reproductive barriers such as hybrid sterility and hybrid inviability are caused by deleterious genetic interactions known as hybrid incompatibilities. The difficulty in identifying these hybrid incompatibility genes remains a rate-limiting step in our understanding of the molecular basis of speciation. We recently described how whole genome sequencing can be applied to identify hybrid incompatibility genes, even from genetically terminal hybrids. Using this approach, we discovered a new hybrid incompatibility gene, gfzf, between Drosophila melanogaster and Drosophila simulans, and found that it plays an essential role in cell cycle regulation. Here, we discuss the history of the hunt for incompatibility genes between these species, discuss the molecular roles of gfzf in cell cycle regulation, and explore how intragenomic conflict drives the evolution of fundamental cellular mechanisms that lead to the developmental arrest of hybrids. PMID:27230814

Epigenetic mechanisms in heart development and disease.

PubMed

Martinez, Shannalee R; Gay, Maresha S; Zhang, Lubo

2015-07-01

Suboptimal intrauterine development has been linked to predisposition to cardiovascular disease in adulthood, a concept termed 'developmental origins of health and disease'. Although the exact mechanisms underlying this developmental programming are unknown, a growing body of evidence supports the involvement of epigenetic regulation. Epigenetic mechanisms such as DNA methylation, histone modifications and micro-RNA confer added levels of gene regulation without altering DNA sequences. These modifications are relatively stable signals, offering possible insight into the mechanisms underlying developmental origins of health and disease. This review will discuss the role of epigenetic mechanisms in heart development as well as aberrant epigenetic regulation contributing to cardiovascular disease. Additionally, we will address recent advances targeting epigenetic mechanisms as potential therapeutic approaches to cardiovascular disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

PubMed Central

Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F

2012-01-01

Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

Gene Expression Profiles in Rice Developing Ovules Provided Evidence for the Role of Sporophytic Tissue in Female Gametophyte Development.

PubMed

Wu, Ya; Yang, Liyu; Cao, Aqin; Wang, Jianbo

2015-01-01

The development of ovule in rice (Oryza sativa) is vital during its life cycle. To gain more understanding of the molecular events associated with the ovule development, we used RNA sequencing approach to perform transcriptome-profiling analysis of the leaf and ovules at four developmental stages. In total, 25,401, 23,343, 23,647 and 23,806 genes were identified from the four developmental stages of the ovule, respectively. We identified a number of differently expressed genes (DEGs) from three adjacent stage comparisons, which may play crucial roles in ovule development. The DEGs were then conducted functional annotations and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses. Genes related to cellular component biogenesis, membrane-bounded organelles and reproductive regulation were identified to be highly expressed during the ovule development. Different expression levels of auxin-related and cytokinin-related genes were also identified at various stages, providing evidence for the role of sporophytic ovule tissue in female gametophyte development from the aspect of gene expression. Generally, an overall transcriptome analysis for rice ovule development has been conducted. These results increased our knowledge of the complex molecular and cellular events that occur during the development of rice ovule and provided foundation for further studies on rice ovule development.

Evolution and regulation of complex life cycles: a brown algal perspective.

PubMed

Cock, J Mark; Godfroy, Olivier; Macaisne, Nicolas; Peters, Akira F; Coelho, Susana M

2014-02-01

The life cycle of an organism is one of its fundamental features, influencing many aspects of its biology. The brown algae exhibit a diverse range of life cycles indicating that transitions between life cycle types may have been key adaptive events in the evolution of this group. Life cycle mutants, identified in the model organism Ectocarpus, are providing information about how life cycle progression is regulated at the molecular level in brown algae. We explore some of the implications of the phenotypes of the life cycle mutants described to date and draw comparisons with recent insights into life cycle regulation in the green lineage. Given the importance of coordinating growth and development with life cycle progression, we suggest that the co-option of ancient life cycle regulators to control key developmental events may be a common feature in diverse groups of multicellular eukaryotes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis

DOE PAGES

Chang, Katherine Noelani; Zhong, Shan; Weirauch, Matthew T.; ...

2013-06-11

The gaseous plant hormone ethylene regulates a multitude of growth and developmental processes. How the numerous growth control pathways are coordinated by the ethylene transcriptional response remains elusive. We characterized the dynamic ethylene transcriptional response by identifying targets of the master regulator of the ethylene signaling pathway, ETHYLENE INSENSITIVE3 (EIN3), using chromatin immunoprecipitation sequencing and transcript sequencing during a timecourse of ethylene treatment. Ethylene-induced transcription occurs in temporal waves regulated by EIN3, suggesting distinct layers of transcriptional control. EIN3 binding was found to modulate a multitude of downstream transcriptional cascades, including a major feedback regulatory circuitry of the ethylene signalingmore » pathway, as well as integrating numerous connections between most of the hormone mediated growth response pathways. These findings provide direct evidence linking each of the major plant growth and development networks in novel ways.« less

Learning the Languages of the Chloroplast: Retrograde Signaling and Beyond.

PubMed

Chan, Kai Xun; Phua, Su Yin; Crisp, Peter; McQuinn, Ryan; Pogson, Barry J

2016-04-29

The chloroplast can act as an environmental sensor, communicating with the cell during biogenesis and operation to change the expression of thousands of proteins. This process, termed retrograde signaling, regulates expression in response to developmental cues and stresses that affect photosynthesis and yield. Recent advances have identified many signals and pathways-including carotenoid derivatives, isoprenes, phosphoadenosines, tetrapyrroles, and heme, together with reactive oxygen species and proteins-that build a communication network to regulate gene expression, RNA turnover, and splicing. However, retrograde signaling pathways have been viewed largely as a means of bilateral communication between organelles and nuclei, ignoring their potential to interact with hormone signaling and the cell as a whole to regulate plant form and function. Here, we discuss new findings on the processes by which organelle communication is initiated, transmitted, and perceived, not only to regulate chloroplastic processes but also to intersect with cellular signaling and alter physiological responses.

Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis

PubMed Central

Chang, Katherine Noelani; Zhong, Shan; Weirauch, Matthew T; Hon, Gary; Pelizzola, Mattia; Li, Hai; Huang, Shao-shan Carol; Schmitz, Robert J; Urich, Mark A; Kuo, Dwight; Nery, Joseph R; Qiao, Hong; Yang, Ally; Jamali, Abdullah; Chen, Huaming; Ideker, Trey; Ren, Bing; Bar-Joseph, Ziv; Hughes, Timothy R; Ecker, Joseph R

2013-01-01

The gaseous plant hormone ethylene regulates a multitude of growth and developmental processes. How the numerous growth control pathways are coordinated by the ethylene transcriptional response remains elusive. We characterized the dynamic ethylene transcriptional response by identifying targets of the master regulator of the ethylene signaling pathway, ETHYLENE INSENSITIVE3 (EIN3), using chromatin immunoprecipitation sequencing and transcript sequencing during a timecourse of ethylene treatment. Ethylene-induced transcription occurs in temporal waves regulated by EIN3, suggesting distinct layers of transcriptional control. EIN3 binding was found to modulate a multitude of downstream transcriptional cascades, including a major feedback regulatory circuitry of the ethylene signaling pathway, as well as integrating numerous connections between most of the hormone mediated growth response pathways. These findings provide direct evidence linking each of the major plant growth and development networks in novel ways. DOI: http://dx.doi.org/10.7554/eLife.00675.001 PMID:23795294

Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

2008-07-01

Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

PubMed

Kishi, Shuji

2011-09-01

Senescence may be considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena during the process of aging. We investigated whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We conducted experiments to isolate zebrafish mutants expressing an apparent senescence phenotype during embryogenesis (embryonic senescence). Some of the genes we thereby identified had already been associated with cellular senescence and chronological aging in other organisms, but many had not yet been linked to these processes. Complete loss-of-function of developmentally essential genes induce embryonic (or larval) lethality, whereas it seems like their partial loss-of-function (i.e., decrease-of-function by heterozygote or hypomorphic mutations) still remains sufficient to go through the early developmental process because of its adaptive plasticity or rather heterozygote advantage. However, in some cases, such partial loss-of-function of genes compromise normal homeostasis due to haploinsufficiency later in adult life having many environmental stress challenges. By contrast, any heterozygote-advantageous genes might gain a certain benefit(s) (much more fitness) by such partial loss-of-function later in life. Physiological senescence may evolutionarily arise from both genetic and epigenetic drifts as well as from losing adaptive developmental plasticity in face of stress signals from the external environment that interacts with functions of multiple genes rather than effects of only a single gene mutation or defect. Previously uncharacterized developmental genes may thus mediate the aging process and play a pivotal role in senescence. Moreover, unexpected senescence-related genes might also be involved in the early developmental process and regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.

Can Zebrafish be used to Identify Developmentally Neurotoxic Chemicals

EPA Science Inventory

Can Zebrafish be Used to Identify Developmentally Neurotoxic Chemicals? The U.S. Environmental Protection Agency is evaluating methods to screen and prioritize large numbers of chemicals for developmental neurotoxicity. We are exploring behavioral methods using zebrafish by desig...

Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

PubMed Central

Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

2012-01-01

Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 45 Public Welfare 4 2012-10-01 2012-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES...

Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

PubMed

Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

2012-06-01

In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

Starch as a major integrator in the regulation of plant growth

PubMed Central

Sulpice, Ronan; Pyl, Eva-Theresa; Ishihara, Hirofumi; Trenkamp, Sandra; Steinfath, Matthias; Witucka-Wall, Hanna; Gibon, Yves; Usadel, Björn; Poree, Fabien; Piques, Maria Conceição; Von Korff, Maria; Steinhauser, Marie Caroline; Keurentjes, Joost J. B.; Guenther, Manuela; Hoehne, Melanie; Selbig, Joachim; Fernie, Alisdair R.; Altmann, Thomas; Stitt, Mark

2009-01-01

Rising demand for food and bioenergy makes it imperative to breed for increased crop yield. Vegetative plant growth could be driven by resource acquisition or developmental programs. Metabolite profiling in 94 Arabidopsis accessions revealed that biomass correlates negatively with many metabolites, especially starch. Starch accumulates in the light and is degraded at night to provide a sustained supply of carbon for growth. Multivariate analysis revealed that starch is an integrator of the overall metabolic response. We hypothesized that this reflects variation in a regulatory network that balances growth with the carbon supply. Transcript profiling in 21 accessions revealed coordinated changes of transcripts of more than 70 carbon-regulated genes and identified 2 genes (myo-inositol-1-phosphate synthase, a Kelch-domain protein) whose transcripts correlate with biomass. The impact of allelic variation at these 2 loci was shown by association mapping, identifying them as candidate lead genes with the potential to increase biomass production. PMID:19506259

Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

PubMed

Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

2018-04-11

The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

Neural correlates of social exclusion across ages: A coordinate-based meta-analysis of functional MRI studies.

PubMed

Vijayakumar, Nandita; Cheng, Theresa W; Pfeifer, Jennifer H

2017-06-01

Given the recent surge in functional neuroimaging studies on social exclusion, the current study employed activation likelihood estimation (ALE) based meta-analyses to identify brain regions that have consistently been implicated across different experimental paradigms used to investigate exclusion. We also examined the neural correlates underlying Cyberball, the most commonly used paradigm to study exclusion, as well as differences in exclusion-related activation between developing (7-18 years of age, from pre-adolescence up to late adolescence) and emerging adult (broadly defined as undergraduates, including late adolescence and young adulthood) samples. Results revealed involvement of the bilateral medial prefrontal and posterior cingulate cortices, right precuneus and left ventrolateral prefrontal cortex across the different paradigms used to examine social exclusion; similar activation patterns were identified when restricting the analysis to Cyberball studies. Investigations into age-related effects revealed that ventrolateral prefrontal activations identified in the full sample were driven by (i.e. present in) developmental samples, while medial prefrontal activations were driven by emerging adult samples. In addition, the right ventral striatum was implicated in exclusion, but only in developmental samples. Subtraction analysis revealed significantly greater activation likelihood in striatal and ventrolateral prefrontal clusters in the developmental samples as compared to emerging adults, though the opposite contrast failed to identify any significant regions. Findings integrate the knowledge accrued from functional neuroimaging studies on social exclusion to date, highlighting involvement of lateral prefrontal regions implicated in regulation and midline structures involved in social cognitive and self-evaluative processes across experimental paradigms and ages, as well as limbic structures in developing samples specifically. Copyright © 2017 Elsevier Inc. All rights reserved.

Mechanisms and pathways of growth failure in primordial dwarfism.

PubMed

Klingseisen, Anna; Jackson, Andrew P

2011-10-01

The greatest difference between species is size; however, the developmental mechanisms determining organism growth remain poorly understood. Primordial dwarfism is a group of human single-gene disorders with extreme global growth failure (which includes Seckel syndrome, microcephalic osteodysplastic primordial dwarfism I [MOPD] types I and II, and Meier-Gorlin syndrome). Ten genes have now been identified for microcephalic primordial dwarfism, encoding proteins involved in fundamental cellular processes including genome replication (ORC1 [origin recognition complex 1], ORC4, ORC6, CDT1, and CDC6), DNA damage response (ATR [ataxia-telangiectasia and Rad3-related]), mRNA splicing (U4atac), and centrosome function (CEP152, PCNT, and CPAP). Here, we review the cellular and developmental mechanisms underlying the pathogenesis of these conditions and address whether further study of these genes could provide novel insight into the physiological regulation of organism growth.

Genetic changes associated with testicular cancer susceptibility.

PubMed

Pyle, Louise C; Nathanson, Katherine L

2016-10-01

Testicular germ cell tumor (TGCT) is a highly heritable cancer primarily affecting young white men. Genome-wide association studies (GWAS) have been particularly effective in identifying multiple common variants with strong contribution to TGCT risk. These loci identified through association studies have implicated multiple genes as associated with TGCT predisposition, many of which are unique among cancer types, and regulate processes such as pluripotency, sex specification, and microtubule assembly. Together these biologically plausible genes converge on pathways involved in male germ cell development and maturation, and suggest that perturbation of them confers susceptibility to TGCT, as a developmental defect of germ cell differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

PubMed

Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

2017-01-11

A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Apoplastic and intracellular plant sugars regulate developmental transitions in witches' broom disease of cacao.

PubMed

Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

2015-03-01

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Antagonistic Basic Helix-Loop-Helix/bZIP Transcription Factors Form Transcriptional Modules That Integrate Light and Reactive Oxygen Species Signaling in Arabidopsis[W

PubMed Central

Chen, Dongqin; Xu, Gang; Tang, Weijiang; Jing, Yanjun; Ji, Qiang; Fei, Zhangjun; Lin, Rongcheng

2013-01-01

The critical developmental switch from heterotrophic to autotrophic growth of plants involves light signaling transduction and the production of reactive oxygen species (ROS). ROS function as signaling molecules that regulate multiple developmental processes, including cell death. However, the relationship between light and ROS signaling remains unclear. Here, we identify transcriptional modules composed of the basic helix-loop-helix and bZIP transcription factors PHYTOCHROME-INTERACTING FACTOR1 (PIF1), PIF3, ELONGATED HYPOCOTYL5 (HY5), and HY5 HOMOLOGY (HYH) that bridge light and ROS signaling to regulate cell death and photooxidative response. We show that pif mutants release more singlet oxygen and exhibit more extensive cell death than the wild type during Arabidopsis thaliana deetiolation. Genome-wide expression profiling indicates that PIF1 represses numerous ROS and stress-related genes. Molecular and biochemical analyses reveal that PIF1/PIF3 and HY5/HYH physically interact and coordinately regulate the expression of five ROS-responsive genes by directly binding to their promoters. Furthermore, PIF1/PIF3 and HY5/HYH function antagonistically during the seedling greening process. In addition, phytochromes, cryptochromes, and CONSTITUTIVE PHOTOMORPHOGENIC1 act upstream to regulate ROS signaling. Together, this study reveals that the PIF1/PIF3-HY5/HYH transcriptional modules mediate crosstalk between light and ROS signaling and sheds light on a new mechanism by which plants adapt to the light environments. PMID:23645630

Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

PubMed

Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

2006-09-01

Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

Mechanisms linking energy balance and reproduction: impact of prenatal environment.

PubMed

Rhinehart, Erin M

2016-01-01

The burgeoning field of metabolic reproduction regulation has been gaining momentum due to highly frequent discoveries of new neuroendocrine factors regulating both energy balance and reproduction. Universally throughout the animal kingdom, energy deficits inhibit the reproductive axis, which demonstrates that reproduction is acutely sensitive to fuel availability. Entrainment of reproductive efforts with energy availability is especially critical for females because they expend large amounts of energy on gestation and lactation. Research has identified an assortment of both central and peripheral factors involved in the metabolic regulation of reproduction. From an evolutionary perspective, these mechanisms likely evolved to optimize reproductive fitness in an environment with an unpredictable food supply and regular bouts of famine. To be effective, however, the mechanisms responsible for the metabolic regulation of reproduction must also retain developmental plasticity to allow organisms to adapt their reproductive strategies to their particular niche. In particular, the prenatal environment has emerged as a critical developmental window for programming the mechanisms responsible for the metabolic control of reproduction. This review will discuss the current knowledge about hormonal and molecular mechanisms that entrain reproduction with prevailing energy availability. In addition, it will provide an evolutionary, human life-history framework to assist in the interpretation of findings on gestational programming of the female reproductive function, with a focus on pubertal timing as an example. Future research should aim to shed light on mechanisms underlying the prenatal modulation of the adaptation to an environment with unstable resources in a way that optimizes reproductive fitness.

Genome-Wide Association Mapping of Fertility Reduction upon Heat Stress Reveals Developmental Stage-Specific QTLs in Arabidopsis thaliana.

PubMed

Bac-Molenaar, Johanna A; Fradin, Emilie F; Becker, Frank F M; Rienstra, Juriaan A; van der Schoot, J; Vreugdenhil, Dick; Keurentjes, Joost J B

2015-07-01

For crops that are grown for their fruits or seeds, elevated temperatures that occur during flowering and seed or fruit set have a stronger effect on yield than high temperatures during the vegetative stage. Even short-term exposure to heat can have a large impact on yield. In this study, we used Arabidopsis thaliana to study the effect of short-term heat exposure on flower and seed development. The impact of a single hot day (35°C) was determined in more than 250 natural accessions by measuring the lengths of the siliques along the main inflorescence. Two sensitive developmental stages were identified, one before anthesis, during male and female meiosis, and one after anthesis, during fertilization and early embryo development. In addition, we observed a correlation between flowering time and heat tolerance. Genome-wide association mapping revealed four quantitative trait loci (QTLs) strongly associated with the heat response. These QTLs were developmental stage specific, as different QTLs were detected before and after anthesis. For a number of QTLs, T-DNA insertion knockout lines could validate assigned candidate genes. Our findings show that the regulation of complex traits can be highly dependent on the developmental timing. © 2015 American Society of Plant Biologists. All rights reserved.

Genome-Wide Association Mapping of Fertility Reduction upon Heat Stress Reveals Developmental Stage-Specific QTLs in Arabidopsis thaliana

PubMed Central

Bac-Molenaar, Johanna A.; Fradin, Emilie F.; Becker, Frank F.M.; Rienstra, Juriaan A.; van der Schoot, J.; Vreugdenhil, Dick; Keurentjes, Joost J.B.

2015-01-01

For crops that are grown for their fruits or seeds, elevated temperatures that occur during flowering and seed or fruit set have a stronger effect on yield than high temperatures during the vegetative stage. Even short-term exposure to heat can have a large impact on yield. In this study, we used Arabidopsis thaliana to study the effect of short-term heat exposure on flower and seed development. The impact of a single hot day (35°C) was determined in more than 250 natural accessions by measuring the lengths of the siliques along the main inflorescence. Two sensitive developmental stages were identified, one before anthesis, during male and female meiosis, and one after anthesis, during fertilization and early embryo development. In addition, we observed a correlation between flowering time and heat tolerance. Genome-wide association mapping revealed four quantitative trait loci (QTLs) strongly associated with the heat response. These QTLs were developmental stage specific, as different QTLs were detected before and after anthesis. For a number of QTLs, T-DNA insertion knockout lines could validate assigned candidate genes. Our findings show that the regulation of complex traits can be highly dependent on the developmental timing. PMID:26163573

Analysis of Dachsous2 in Breast Cancer Progression and Recurrence

DTIC Science & Technology

2011-10-01

Dev Dyn, 2005. 234(3): p. 747-55. 2. Casal, J ., G. Struhl, and P.A. Lawrence , Developmental compartments and planar polarity in Drosophila. Curr Biol...Schrauth, and M. Gessler, Expression of mouse dchs1, fjx1, and fat- j suggests conservation of the planar cell polarity pathway identified in Drosophila...2002. 12(14): p. 1189-98. 3. Yang, C.H., J.D. Axelrod , and M.A. Simon, Regulation of Frizzled by fat-like cadherins during planar polarity

Identification and Transcription Profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): Developmental Regulation and Environmental Response

DTIC Science & Technology

2014-12-18

permissions.php Open Access Insect Physiology 2015:5 1–12 Open Access Insect Physiology Dovepress submit your manuscript | www.dovepress.com Dovepress 1 O r I...markers to identify ecotypes in different populations of plants,3,4 and animals, including insects and mosquitoes.5–13 The critical role of NADH in...article has been viewed This article was published in the following Dove Press journal: Open Access Insect Physiology 18 December 2014 Report

Developmental staging of male murine embryonic gonad by SAGE analysis

PubMed Central

Lee, Tin-Lap; Li, Yunmin; Alba, Diana; Vong, Queenie P.; Wu, Shao-Ming; Baxendale, Vanessa; Rennert, Owen M.; Lau, Yun-Fai Chris; Chan, Wai-Yee

2012-01-01

Despite the identification of key genes such as Sry integral to embryonic gonadal development, the genomic classification and identification of chromosomal activation of this process is still poorly understood. To better understand the genetic regulation of gonadal development, we performed Serial Analysis of Gene Expression (SAGE) to profile the genes and novel transcripts, and an average of 152,000 tags from male embryonic gonads at E10.5 (embryonic day 10.5), E11.5, E12.5, E13.5, E15.5 and E17.5 were analyzed. A total of 275,583 non-singleton tags that do not map to any annotated sequence were identified in the six gonad libraries, and 47,255 tags were mapped to 24,975 annotated sequences, among which 987 sequences were uncharacterized. Utilizing an unsupervised pattern identification technique, we established molecular staging of male gonadal development. Rather than providing a static descriptive analysis, we developed algorithms to cluster the SAGE data and assign SAGE tags to a corresponding chromosomal position; these data are displayed in chromosome graphic format. A prominent increase in global genomic activity from E10.5 to E17.5 was observed. Important chromosomal regions related to the developmental processes were identified and validated based on established mouse models with developmental disorders. These regions may represent markers for early diagnosis for disorders of male gonad development as well as potential treatment targets. PMID:19376482

Genome-wide expression analysis of soybean NF-Y genes reveals potential function in development and drought response.

PubMed

Quach, Truyen N; Nguyen, Hanh T M; Valliyodan, Babu; Joshi, Trupti; Xu, Dong; Nguyen, Henry T

2015-06-01

Nuclear factor-Y (NF-Y), a heterotrimeric transcription factor, is composed of NF-YA, NF-YB and NF-YC proteins. In plants, there are usually more than 10 genes for each family and their members have been identified to be key regulators in many developmental and physiological processes controlling gametogenesis, embryogenesis, nodule development, seed development, abscisic acid (ABA) signaling, flowering time, primary root elongation, blue light responses, endoplasmic reticulum (ER) stress response and drought tolerance. Taking the advantages of the recent soybean genome draft and information on functional characterizations of nuclear factor Y (NF-Y) transcription factor family in plants, we identified 21 GmNF-YA, 32 GmNF-YB, and 15 GmNF-YC genes in the soybean (Glycine max) genome. Phylogenetic analyses show that soybean's proteins share strong homology to Arabidopsis and many of them are closely related to functionally characterized NF-Y in plants. Expression analysis in various tissues of flower, leaf, root, seeds of different developmental stages, root hairs under rhizobium inoculation, and drought-treated roots and leaves revealed that certain groups of soybean NF-Y are likely involved in specific developmental and stress responses. This study provides extensive evaluation of the soybean NF-Y family and is particularly useful for further functional characterization of GmNF-Y proteins in seed development, nodulation and drought adaptation of soybean.

Developmental Programming Mediated by Complementary Roles of Imprinted Grb10 in Mother and Pup

PubMed Central

Cowley, Michael; Garfield, Alastair S.; Madon-Simon, Marta; Charalambous, Marika; Clarkson, Richard W.; Smalley, Matthew J.; Kendrick, Howard; Isles, Anthony R.; Parry, Aled J.; Carney, Sara; Oakey, Rebecca J.; Heisler, Lora K.; Moorwood, Kim; Wolf, Jason B.; Ward, Andrew

2014-01-01

Developmental programming links growth in early life with health status in adulthood. Although environmental factors such as maternal diet can influence the growth and adult health status of offspring, the genetic influences on this process are poorly understood. Using the mouse as a model, we identify the imprinted gene Grb10 as a mediator of nutrient supply and demand in the postnatal period. The combined actions of Grb10 expressed in the mother, controlling supply, and Grb10 expressed in the offspring, controlling demand, jointly regulate offspring growth. Furthermore, Grb10 determines the proportions of lean and fat tissue during development, thereby influencing energy homeostasis in the adult. Most strikingly, we show that the development of normal lean/fat proportions depends on the combined effects of Grb10 expressed in the mother, which has the greater effect on offspring adiposity, and Grb10 expressed in the offspring, which influences lean mass. These distinct functions of Grb10 in mother and pup act complementarily, which is consistent with a coadaptation model of imprinting evolution, a model predicted but for which there is limited experimental evidence. In addition, our findings identify Grb10 as a key genetic component of developmental programming, and highlight the need for a better understanding of mother-offspring interactions at the genetic level in predicting adult disease risk. PMID:24586114

Proteome profiling of flax (Linum usitatissimum) seed: characterization of functional metabolic pathways operating during seed development.

PubMed

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Kadoo, Narendra Y; Giri, Ashok P; Gupta, Vidya S

2012-12-07

Flax (Linum usitatissimum L.) seeds are an important source of food and feed due to the presence of various health promoting compounds, making it a nutritionally and economically important plant. An in-depth analysis of the proteome of developing flax seed is expected to provide significant information with respect to the regulation and accumulation of such storage compounds. Therefore, a proteomic analysis of seven seed developmental stages (4, 8, 12, 16, 22, 30, and 48 days after anthesis) in a flax variety, NL-97 was carried out using a combination of 1D-SDS-PAGE and LC-MSE methods. A total 1716 proteins were identified and their functional annotation revealed that a majority of them were involved in primary metabolism, protein destination, storage and energy. Three carbon assimilatory pathways appeared to operate in flax seeds. Reverse transcription quantitative PCR of selected 19 genes was carried out to understand their roles during seed development. Besides storage proteins, methionine synthase, RuBisCO and S-adenosylmethionine synthetase were highly expressed transcripts, highlighting their importance in flax seed development. Further, the identified proteins were mapped onto developmental seed specific expressed sequence tag (EST) libraries of flax to obtain transcriptional evidence and 81% of them had detectable expression at the mRNA level. This study provides new insights into the complex seed developmental processes operating in flax.

A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

PubMed

Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

2013-11-06

Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

Imaging C. elegans embryos using an epifluorescent microscope and open source software.

PubMed

Verbrugghe, Koen J C; Chan, Raymond C

2011-03-24

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples(1,2). Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage(3), thus providing an ideal experiment model for studying questions in cell biology(4,5)and development(6-9). C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis(10,11)) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis(12-15)). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters(16,17). These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo(18-21). In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach.

PubMed

Macchiaroli, Natalia; Cucher, Marcela; Zarowiecki, Magdalena; Maldonado, Lucas; Kamenetzky, Laura; Rosenzvit, Mara Cecilia

2015-02-06

microRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in fundamental biological processes such as development and metabolism. The particular developmental and metabolic characteristics of cestode parasites highlight the importance of studying miRNA gene regulation in these organisms. Here, we perform a comprehensive analysis of miRNAs in the parasitic cestode Echinococcus canadensis G7, one of the causative agents of the neglected zoonotic disease cystic echinococcosis. Small RNA libraries from protoscoleces and cyst walls of E. canadensis G7 and protoscoleces of E. granulosus sensu stricto G1 were sequenced using Illumina technology. For miRNA prediction, miRDeep2 core algorithm was used. The output list of candidate precursors was manually curated to generate a high confidence set of miRNAs. Differential expression analysis of miRNAs between stages or species was estimated with DESeq. Expression levels of selected miRNAs were validated using poly-A RT-qPCR. In this study we used a high-throughput approach and found transcriptional evidence of 37 miRNAs thus expanding the miRNA repertoire of E. canadensis G7. Differential expression analysis showed highly regulated miRNAs between life cycle stages, suggesting a role in maintaining the features of each developmental stage or in the regulation of developmental timing. In this work we characterize conserved and novel Echinococcus miRNAs which represent 30 unique miRNA families. Here we confirmed the remarkable loss of conserved miRNA families in E. canadensis, reflecting their low morphological complexity and high adaptation to parasitism. We performed the first in-depth study profiling of small RNAs in the zoonotic parasite E. canadensis G7. We found that miRNAs are the preponderant small RNA silencing molecules, suggesting that these small RNAs could be an essential mechanism of gene regulation in this species. We also identified both parasite specific and divergent miRNAs which are potential biomarkers of infection. This study will provide valuable information for better understanding of the complex biology of this parasite and could help to find new potential targets for therapy and/or diagnosis.

Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

PubMed Central

2009-01-01

Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic genes in grape berries. Integration of the transcript, radiotracer and metabolite data demonstrates that Asc and TA metabolism are developmentally regulated in grapevines; resulting in low accumulated levels of the biosynthetic intermediate Asc, and high accumulated levels of the metabolic end-product TA. PMID:19995454

Regulation of Sex Determination in Mice by a Non-coding Genomic Region

PubMed Central

Arboleda, Valerie A.; Fleming, Alice; Barseghyan, Hayk; Délot, Emmanuèle; Sinsheimer, Janet S.; Vilain, Eric

2014-01-01

To identify novel genomic regions that regulate sex determination, we utilized the powerful C57BL/6J-YPOS (B6-YPOS) model of XY sex reversal where mice with autosomes from the B6 strain and a Y chromosome from a wild-derived strain, Mus domesticus poschiavinus (YPOS), show complete sex reversal. In B6-YPOS, the presence of a 55-Mb congenic region on chromosome 11 protects from sex reversal in a dose-dependent manner. Using mouse genetic backcross designs and high-density SNP arrays, we narrowed the congenic region to a 1.62-Mb genomic region on chromosome 11 that confers 80% protection from B6-YPOS sex reversal when one copy is present and complete protection when two copies are present. It was previously believed that the protective congenic region originated from the 129S1/SviMJ (129) strain. However, genomic analysis revealed that this region is not derived from 129 and most likely is derived from the semi-inbred strain POSA. We show that the small 1.62-Mb congenic region that protects against B6-YPOS sex reversal is located within the Sox9 promoter and promotes the expression of Sox9, thereby driving testis development within the B6-YPOS background. Through 30 years of backcrossing, this congenic region was maintained, as it promoted male sex determination and fertility despite the female-promoting B6-YPOS genetic background. Our findings demonstrate that long-range enhancer regions are critical to developmental processes and can be used to identify the complex interplay between genome variants, epigenetics, and developmental gene regulation. PMID:24793290

Transcriptomic Analysis Reveals Mechanisms of Sterile and Fertile Flower Differentiation and Development in Viburnum macrocephalum f. keteleeri

PubMed Central

Lu, Zhaogeng; Xu, Jing; Li, Weixing; Zhang, Li; Cui, Jiawen; He, Qingsong; Wang, Li; Jin, Biao

2017-01-01

Sterile and fertile flowers are an important evolutionary developmental (evo-devo) phenotype in angiosperm flowers, playing important roles in pollinator attraction and sexual reproductive success. However, the gene regulatory mechanisms underlying fertile and sterile flower differentiation and development remain largely unknown. Viburnum macrocephalum f. keteleeri, which possesses fertile and sterile flowers in a single inflorescence, is a useful candidate species for investigating the regulatory networks in differentiation and development. We developed a de novo-assembled flower reference transcriptome. Using RNA sequencing (RNA-seq), we compared the expression patterns of fertile and sterile flowers isolated from the same inflorescence over its rapid developmental stages. The flower reference transcriptome consisted of 105,683 non-redundant transcripts, of which 5,675 transcripts showed significant differential expression between fertile and sterile flowers. Combined with morphological and cytological changes between fertile and sterile flowers, we identified expression changes of many genes potentially involved in reproductive processes, phytohormone signaling, and cell proliferation and expansion using RNA-seq and qRT-PCR. In particular, many transcription factors (TFs), including MADS-box family members and ABCDE-class genes, were identified, and expression changes in TFs involved in multiple functions were analyzed and highlighted to determine their roles in regulating fertile and sterile flower differentiation and development. Our large-scale transcriptional analysis of fertile and sterile flowers revealed the dynamics of transcriptional networks and potentially key components in regulating differentiation and development of fertile and sterile flowers in Viburnum macrocephalum f. keteleeri. Our data provide a useful resource for Viburnum transcriptional research and offer insights into gene regulation of differentiation of diverse evo-devo processes in flowers. PMID:28298915

A genome-wide analysis reveals that the Drosophila transcription factor Lola promotes axon growth in part by suppressing expression of the actin nucleation factor Spire

PubMed Central

2011-01-01

Background The phylogenetically conserved transcription factor Lola is essential for many aspects of axon growth and guidance, synapse formation and neural circuit development in Drosophila. To date it has been difficult, however, to obtain an overall view of Lola functions and mechanisms. Results We use expression microarrays to identify the lola-dependent transcriptome in the Drosophila embryo. We find that lola regulates the expression of a large selection of genes that are known to affect each of several lola-dependent developmental processes. Among other loci, we find lola to be a negative regulator of spire, an actin nucleation factor that has been studied for its essential role in oogenesis. We show that spire is expressed in the nervous system and is required for a known lola-dependent axon guidance decision, growth of ISNb motor axons. We further show that reducing spire gene dosage suppresses this aspect of the lola phenotype, verifying that derepression of spire is an important contributor to the axon stalling phenotype of embryonic motor axons in lola mutants. Conclusions These data shed new light on the molecular mechanisms of many lola-dependent processes, and also identify several developmental processes not previously linked to lola that are apt to be regulated by this transcription factor. These data further demonstrate that excessive expression of the actin nucleation factor Spire is as deleterious for axon growth in vivo as is the loss of Spire, thus highlighting the need for a balance in the elementary steps of actin dynamics to achieve effective neuronal morphogenesis. PMID:22129300

Ly6d marks the earliest stage of B-cell specification and identifies the branchpoint between B-cell and T-cell development

PubMed Central

Inlay, Matthew A.; Bhattacharya, Deepta; Sahoo, Debashis; Serwold, Thomas; Seita, Jun; Karsunky, Holger; Plevritis, Sylvia K.; Dill, David L.; Weissman, Irving L.

2009-01-01

Common lymphoid progenitors (CLPs) clonally produce both B- and T-cell lineages, but have little myeloid potential in vivo. However, some studies claim that the upstream lymphoid-primed multipotent progenitor (LMPP) is the thymic seeding population, and suggest that CLPs are primarily B-cell-restricted. To identify surface proteins that distinguish functional CLPs from B-cell progenitors, we used a new computational method of Mining Developmentally Regulated Genes (MiDReG). We identified Ly6d, which divides CLPs into two distinct populations: one that retains full in vivo lymphoid potential and produces more thymocytes at early timepoints than LMPP, and another that behaves essentially as a B-cell progenitor. PMID:19833765

A genome-wide survey on basic helix-loop-helix transcription factors in giant panda.

PubMed

Dang, Chunwang; Wang, Yong; Zhang, Debao; Yao, Qin; Chen, Keping

2011-01-01

The giant panda (Ailuropoda melanoleuca) is a critically endangered mammalian species. Studies on functions of regulatory proteins involved in developmental processes would facilitate understanding of specific behavior in giant panda. The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including fruit fly, zebrafish, mouse and human. Our present study identified 107 bHLH family members being encoded in giant panda genome. Phylogenetic analyses revealed that they belong to 44 bHLH families with 46, 25, 15, 4, 11 and 3 members in group A, B, C, D, E and F, respectively, while the remaining 3 members were assigned into "orphan". Compared to mouse, the giant panda does not encode seven bHLH proteins namely Beta3a, Mesp2, Sclerax, S-Myc, Hes5 (or Hes6), EBF4 and Orphan 1. These results provide useful background information for future studies on structure and function of bHLH proteins in the regulation of giant panda development.

Neuroendocrine Regulation of Maternal Behavior

PubMed Central

Bridges, Robert S.

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

Neuroendocrine regulation of maternal behavior.

PubMed

Bridges, Robert S

2015-01-01

The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

GABA-CREB signalling regulates maturation and survival of newly generated neurons in the adult hippocampus

PubMed Central

Jagasia, Ravi; Steib, Kathrin; Englberger, Elisabeth; Herold, Sabine; Faus-Kessler, Theresa; Saxe, Michael; Gage, Fred H.; Song, Hongjun; Lie, D. Chichung

2009-01-01

Survival and integration of new neurons in the hippocampal circuit are rate-limiting steps in adult hippocampal neurogenesis. Neuronal network activity is a major regulator of these processes, yet little is known about the respective downstream signalling pathways. Here, we investigate the role of CREB signalling in adult hippocampal neurogenesis. CREB is activated in new granule neurons during a distinct developmental period. Loss of CREB function in a cell-autonomous fashion impairs dendritic development, decreases the expression of the neurogenic transcription factor NeuroD and of the neuronal microtubule associated protein, DCX, and compromises the survival of newborn neurons. In addition, GABA-mediated excitation regulates CREB activation at early developmental stages. Importantly, developmental defects following loss of GABA-mediated excitation can be compensated by enhanced CREB signalling. These results indicate that CREB signalling is a central pathway in adult hippocampal neurogenesis, regulating the development and survival of new hippocampal neurons downstream of GABA-mediated excitation. PMID:19553437

Tbx16 regulates hox gene activation in mesodermal progenitor cells

PubMed Central

Payumo, Alexander Y.; McQuade, Lindsey E.; Walker, Whitney J.; Yamazoe, Sayumi; Chen, James K.

2016-01-01

The transcription factor T-box 16 (Tbx16/Spadetail) is an essential regulator of paraxial mesoderm development in zebrafish (Danio rerio). Mesodermal progenitor cells (MPCs) fail to differentiate into trunk somites in tbx16 mutants and instead accumulate within the tailbud in an immature state. The mechanisms by which Tbx16 controls mesoderm patterning have remained enigmatic, and we describe here the application of photoactivatable morpholino oligonucleotides to determine the Tbx16 transcriptome in MPCs. We identify 124 Tbx16-regulated genes that are expressed in zebrafish gastrulae, including several developmental signaling proteins and regulators of gastrulation, myogenesis, and somitogenesis. Unexpectedly, we observe that loss of Tbx16 function precociously activates posterior hox genes in MPCs, and overexpression of a single posterior hox gene is sufficient to disrupt MPC migration. Our studies support a model in which Tbx16 regulates the timing of collinear hox gene activation to coordinate the anterior-posterior fates and positions of paraxial MPCs. PMID:27376691

Tensor-driven extraction of developmental features from varying paediatric EEG datasets.

PubMed

Kinney-Lang, Eli; Spyrou, Loukianos; Ebied, Ahmed; Chin, Richard Fm; Escudero, Javier

2018-05-21

Constant changes in developing children's brains can pose a challenge in EEG dependant technologies. Advancing signal processing methods to identify developmental differences in paediatric populations could help improve function and usability of such technologies. Taking advantage of the multi-dimensional structure of EEG data through tensor analysis may offer a framework for extracting relevant developmental features of paediatric datasets. A proof of concept is demonstrated through identifying latent developmental features in resting-state EEG. Approach. Three paediatric datasets (n = 50, 17, 44) were analyzed using a two-step constrained parallel factor (PARAFAC) tensor decomposition. Subject age was used as a proxy measure of development. Classification used support vector machines (SVM) to test if PARAFAC identified features could predict subject age. The results were cross-validated within each dataset. Classification analysis was complemented by visualization of the high-dimensional feature structures using t-distributed Stochastic Neighbour Embedding (t-SNE) maps. Main Results. Development-related features were successfully identified for the developmental conditions of each dataset. SVM classification showed the identified features could accurately predict subject at a significant level above chance for both healthy and impaired populations. t-SNE maps revealed suitable tensor factorization was key in extracting the developmental features. Significance. The described methods are a promising tool for identifying latent developmental features occurring throughout childhood EEG. © 2018 IOP Publishing Ltd.

dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.

PubMed

Kaplan, Rebecca E W; Chen, Yutao; Moore, Brad T; Jordan, James M; Maxwell, Colin S; Schindler, Adam J; Baugh, L Ryan

2015-12-01

Nutrient availability has profound influence on development. In the nematode C. elegans, nutrient availability governs post-embryonic development. L1-stage larvae remain in a state of developmental arrest after hatching until they feed. This "L1 arrest" (or "L1 diapause") is associated with increased stress resistance, supporting starvation survival. Loss of the transcription factor daf-16/FOXO, an effector of insulin/IGF signaling, results in arrest-defective and starvation-sensitive phenotypes. We show that daf-16/FOXO regulates L1 arrest cell-nonautonomously, suggesting that insulin/IGF signaling regulates at least one additional signaling pathway. We used mRNA-seq to identify candidate signaling molecules affected by daf-16/FOXO during L1 arrest. dbl-1/TGF-β, a ligand for the Sma/Mab pathway, daf-12/NHR and daf-36/oxygenase, an upstream component of the daf-12 steroid hormone signaling pathway, were up-regulated during L1 arrest in a daf-16/FOXO mutant. Using genetic epistasis analysis, we show that dbl-1/TGF-β and daf-12/NHR steroid hormone signaling pathways are required for the daf-16/FOXO arrest-defective phenotype, suggesting that daf-16/FOXO represses dbl-1/TGF-β, daf-12/NHR and daf-36/oxygenase. The dbl-1/TGF-β and daf-12/NHR pathways have not previously been shown to affect L1 development, but we found that disruption of these pathways delayed L1 development in fed larvae, consistent with these pathways promoting development in starved daf-16/FOXO mutants. Though the dbl-1/TGF-β and daf-12/NHR pathways are epistatic to daf-16/FOXO for the arrest-defective phenotype, disruption of these pathways does not suppress starvation sensitivity of daf-16/FOXO mutants. This observation uncouples starvation survival from developmental arrest, indicating that DAF-16/FOXO targets distinct effectors for each phenotype and revealing that inappropriate development during starvation does not cause the early demise of daf-16/FOXO mutants. Overall, this study shows that daf-16/FOXO promotes developmental arrest cell-nonautonomously by repressing pathways that promote larval development.

dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest

PubMed Central

Moore, Brad T.; Jordan, James M.; Maxwell, Colin S.; Schindler, Adam J.; Baugh, L. Ryan

2015-01-01

Nutrient availability has profound influence on development. In the nematode C. elegans, nutrient availability governs post-embryonic development. L1-stage larvae remain in a state of developmental arrest after hatching until they feed. This “L1 arrest” (or "L1 diapause") is associated with increased stress resistance, supporting starvation survival. Loss of the transcription factor daf-16/FOXO, an effector of insulin/IGF signaling, results in arrest-defective and starvation-sensitive phenotypes. We show that daf-16/FOXO regulates L1 arrest cell-nonautonomously, suggesting that insulin/IGF signaling regulates at least one additional signaling pathway. We used mRNA-seq to identify candidate signaling molecules affected by daf-16/FOXO during L1 arrest. dbl-1/TGF-β, a ligand for the Sma/Mab pathway, daf-12/NHR and daf-36/oxygenase, an upstream component of the daf-12 steroid hormone signaling pathway, were up-regulated during L1 arrest in a daf-16/FOXO mutant. Using genetic epistasis analysis, we show that dbl-1/TGF-β and daf-12/NHR steroid hormone signaling pathways are required for the daf-16/FOXO arrest-defective phenotype, suggesting that daf-16/FOXO represses dbl-1/TGF-β, daf-12/NHR and daf-36/oxygenase. The dbl-1/TGF-β and daf-12/NHR pathways have not previously been shown to affect L1 development, but we found that disruption of these pathways delayed L1 development in fed larvae, consistent with these pathways promoting development in starved daf-16/FOXO mutants. Though the dbl-1/TGF-β and daf-12/NHR pathways are epistatic to daf-16/FOXO for the arrest-defective phenotype, disruption of these pathways does not suppress starvation sensitivity of daf-16/FOXO mutants. This observation uncouples starvation survival from developmental arrest, indicating that DAF-16/FOXO targets distinct effectors for each phenotype and revealing that inappropriate development during starvation does not cause the early demise of daf-16/FOXO mutants. Overall, this study shows that daf-16/FOXO promotes developmental arrest cell-nonautonomously by repressing pathways that promote larval development. PMID:26656736

Defining pancreatic endocrine precursors and their descendants.

PubMed

White, Peter; May, Catherine Lee; Lamounier, Rodrigo N; Brestelli, John E; Kaestner, Klaus H

2008-03-01

The global incidence of diabetes continues to increase. Cell replacement therapy and islet transplantation offer hope, especially for severely affected patients. Efforts to differentiate insulin-producing beta-cells from progenitor or stem cells require knowledge of the transcriptional programs that regulate the development of the endocrine pancreas. Differentiation toward the endocrine lineage is dependent on the transcription factor Neurogenin 3 (Neurog3, Ngn3). We utilize a Neurog3-enhanced green fluorescent protein knock-in mouse model to isolate endocrine progenitor cells from embryonic pancreata (embryonic day [E]13.5 through E17.5). Using advanced genomic approaches, we generate a comprehensive gene expression profile of these progenitors and their immediate descendants. A total of 1,029 genes were identified as being temporally regulated in the endocrine lineage during fetal development, 237 of which are transcriptional regulators. Through pathway analysis, we have modeled regulatory networks involving these proteins that highlight the complex transcriptional hierarchy governing endocrine differentiation. We have been able to accurately capture the gene expression profile of the pancreatic endocrine progenitors and their descendants. The list of temporally regulated genes identified in fetal endocrine precursors and their immediate descendants provides a novel and important resource for developmental biologists and diabetes researchers alike.

NtKRP, a kinesin-12 protein, regulates embryo/seed size and seed germination via involving in cell cycle progression at the G2/M transition.

PubMed

Tian, Shujuan; Wu, Jingjing; Li, Fen; Zou, Jianwei; Liu, Yuwen; Zhou, Bing; Bai, Yang; Sun, Meng-Xiang

2016-10-25

Kinesins comprise a superfamily of microtubule-based motor proteins involved in essential processes in plant development, but few kinesins have been functionally identified during seed development. Especially, few kinesins that regulate cell division during embryogenesis have been identified. Here we report the functional characterization of NtKRP, a motor protein of the kinesin-12 family. NtKRP is predominantly expressed in embryos and embryonic roots. NtKRP RNAi lines displayed reductions in cell numbers in the meristematic zone, in embryonic root length, and in mature embryo and seed sizes. Furthermore, we also show that CDKA;1 binds to NtKRP at the consensus phosphorylation sites and that the decreased cell numbers in NtKRP-silenced embryos are due to a delay in cell division cycle at the G2/M transition. In addition, binding between the cargo-binding tail domain of NtKRP and CDKA; 1 was also determined. Our results reveal a novel molecular pathway that regulates embryo/seed development and critical role of kinesin in temporal and spatial regulation of a specific issue of embryo developmental.

Path from schizophrenia genomics to biology: gene regulation and perturbation in neurons derived from induced pluripotent stem cells and genome editing.

PubMed

Duan, Jubao

2015-02-01

Schizophrenia (SZ) is a devastating mental disorder afflicting 1% of the population. Recent genome-wide association studies (GWASs) of SZ have identified >100 risk loci. However, the causal variants/genes and the causal mechanisms remain largely unknown, which hinders the translation of GWAS findings into disease biology and drug targets. Most risk variants are noncoding, thus likely regulate gene expression. A major mechanism of transcriptional regulation is chromatin remodeling, and open chromatin is a versatile predictor of regulatory sequences. MicroRNA-mediated post-transcriptional regulation plays an important role in SZ pathogenesis. Neurons differentiated from patient-specific induced pluripotent stem cells (iPSCs) provide an experimental model to characterize the genetic perturbation of regulatory variants that are often specific to cell type and/or developmental stage. The emerging genome-editing technology enables the creation of isogenic iPSCs and neurons to efficiently characterize the effects of SZ-associated regulatory variants on SZ-relevant molecular and cellular phenotypes involving dopaminergic, glutamatergic, and GABAergic neurotransmissions. SZ GWAS findings equipped with the emerging functional genomics approaches provide an unprecedented opportunity for understanding new disease biology and identifying novel drug targets.

Arabidopsis TCH4, regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase

NASA Technical Reports Server (NTRS)

Xu, W.; Purugganan, M. M.; Polisensky, D. H.; Antosiewicz, D. M.; Fry, S. C.; Braam, J.

1995-01-01

Adaptation of plants to environmental conditions requires that sensing of external stimuli be linked to mechanisms of morphogenesis. The Arabidopsis TCH (for touch) genes are rapidly upregulated in expression in response to environmental stimuli, but a connection between this molecular response and developmental alterations has not been established. We identified TCH4 as a xyloglucan endotransglycosylase by sequence similarity and enzyme activity. Xyloglucan endotransglycosylases most likely modify cell walls, a fundamental determinant of plant form. We determined that TCH4 expression is regulated by auxin and brassinosteroids, by environmental stimuli, and during development, by a 1-kb region. Expression was restricted to expanding tissues and organs that undergo cell wall modification. Regulation of genes encoding cell wall-modifying enzymes, such as TCH4, may underlie plant morphogenetic responses to the environment.

Berry Flesh and Skin Ripening Features in Vitis vinifera as Assessed by Transcriptional Profiling

PubMed Central

Grimplet, Jérôme; Bravo, Gema; Flores, Pilar; Fenoll, José; Hellín, Pilar; Oliveros, Juan Carlos; Martínez-Zapater, José M.

2012-01-01

Background Ripening of fleshy fruit is a complex developmental process involving the differentiation of tissues with separate functions. During grapevine berry ripening important processes contributing to table and wine grape quality take place, some of them flesh- or skin-specific. In this study, transcriptional profiles throughout flesh and skin ripening were followed during two different seasons in a table grape cultivar ‘Muscat Hamburg’ to determine tissue-specific as well as common developmental programs. Methodology/Principal Findings Using an updated GrapeGen Affymetrix GeneChip® annotation based on grapevine 12×v1 gene predictions, 2188 differentially accumulated transcripts between flesh and skin and 2839 transcripts differentially accumulated throughout ripening in the same manner in both tissues were identified. Transcriptional profiles were dominated by changes at the beginning of veraison which affect both pericarp tissues, although frequently delayed or with lower intensity in the skin than in the flesh. Functional enrichment analysis identified the decay on biosynthetic processes, photosynthesis and transport as a major part of the program delayed in the skin. In addition, a higher number of functional categories, including several related to macromolecule transport and phenylpropanoid and lipid biosynthesis, were over-represented in transcripts accumulated to higher levels in the skin. Functional enrichment also indicated auxin, gibberellins and bHLH transcription factors to take part in the regulation of pre-veraison processes in the pericarp, whereas WRKY and C2H2 family transcription factors seems to more specifically participate in the regulation of skin and flesh ripening, respectively. Conclusions/Significance A transcriptomic analysis indicates that a large part of the ripening program is shared by both pericarp tissues despite some components are delayed in the skin. In addition, important tissue differences are present from early stages prior to the ripening onset including tissue-specific regulators. Altogether, these findings provide key elements to understand berry ripening and its differential regulation in flesh and skin. PMID:22768087

Adult Circadian Behavior in Drosophila Requires Developmental Expression of cycle, But Not period

PubMed Central

Kim, Min-Ho; Rao, Neethi Varadaraja; Bonilla, Gloribel; Wijnen, Herman

2011-01-01

Circadian clocks have evolved as internal time keeping mechanisms that allow anticipation of daily environmental changes and organization of a daily program of physiological and behavioral rhythms. To better examine the mechanisms underlying circadian clocks in animals and to ask whether clock gene expression and function during development affected subsequent daily time keeping in the adult, we used the genetic tools available in Drosophila to conditionally manipulate the function of the CYCLE component of the positive regulator CLOCK/CYCLE (CLK/CYC) or its negative feedback inhibitor PERIOD (PER). Differential manipulation of clock function during development and in adulthood indicated that there is no developmental requirement for either a running clock mechanism or expression of per. However, conditional suppression of CLK/CYC activity either via per over-expression or cyc depletion during metamorphosis resulted in persistent arrhythmic behavior in the adult. Two distinct mechanisms were identified that may contribute to this developmental function of CLK/CYC and both involve the ventral lateral clock neurons (LNvs) that are crucial to circadian control of locomotor behavior: (1) selective depletion of cyc expression in the LNvs resulted in abnormal peptidergic small-LNv dorsal projections, and (2) PER expression rhythms in the adult LNvs appeared to be affected by developmental inhibition of CLK/CYC activity. Given the conservation of clock genes and circuits among animals, this study provides a rationale for investigating a possible similar developmental role of the homologous mammalian CLOCK/BMAL1 complex. PMID:21750685

Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

PubMed Central

Hall, F. Scott; Perona, Maria T. G.

2012-01-01

This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways.

PubMed

Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula

2014-01-20

Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response.

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways

PubMed Central

2014-01-01

Background Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. Results We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. Conclusions This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response. PMID:24443808

Female-specific gene expression in dioecious liverwort Pellia endiviifolia is developmentally regulated and connected to archegonia production.

PubMed

Sierocka, Izabela; Kozlowski, Lukasz P; Bujnicki, Janusz M; Jarmolowski, Artur; Szweykowska-Kulinska, Zofia

2014-06-17

In flowering plants a number of genes have been identified which control the transition from a vegetative to generative phase of life cycle. In bryophytes representing basal lineage of land plants, there is little data regarding the mechanisms that control this transition. Two species from bryophytes - moss Physcomitrella patens and liverwort Marchantia polymorpha are under advanced molecular and genetic research. The goal of our study was to identify genes connected to female gametophyte development and archegonia production in the dioecious liverwort Pellia endiviifolia species B, which is representative of the most basal lineage of the simple thalloid liverworts. The utility of the RDA-cDNA technique allowed us to identify three genes specifically expressed in the female individuals of P.endiviifolia: PenB_CYSP coding for cysteine protease, PenB_MT2 and PenB_MT3 coding for Mysterious Transcripts1 and 2 containing ORFs of 143 and 177 amino acid residues in length, respectively. The exon-intron structure of all three genes has been characterized and pre-mRNA processing was investigated. Interestingly, five mRNA isoforms are produced from the PenB_MT2 gene, which result from alternative splicing within the second and third exon. All observed splicing events take place within the 5'UTR and do not interfere with the coding sequence. All three genes are exclusively expressed in the female individuals, regardless of whether they were cultured in vitro or were collected from a natural habitat. Moreover we observed ten-fold increased transcripts level for all three genes in the archegonial tissue in comparison to the vegetative parts of the same female thalli grown in natural habitat suggesting their connection to archegonia development. We have identified three genes which are specifically expressed in P.endiviifolia sp B female gametophytes. Moreover, their expression is connected to the female sex-organ differentiation and is developmentally regulated. The contribution of the identified genes may be crucial for successful liverwort sexual reproduction.

Understanding developmental and adaptive cues in pine through metabolite profiling and co-expression network analysis

PubMed Central

Cañas, Rafael A.; Canales, Javier; Muñoz-Hernández, Carmen; Granados, Jose M.; Ávila, Concepción; García-Martín, María L.; Cánovas, Francisco M.

2015-01-01

Conifers include long-lived evergreen trees of great economic and ecological importance, including pines and spruces. During their long lives conifers must respond to seasonal environmental changes, adapt to unpredictable environmental stresses, and co-ordinate their adaptive adjustments with internal developmental programmes. To gain insights into these responses, we examined metabolite and transcriptomic profiles of needles from naturally growing 25-year-old maritime pine (Pinus pinaster L. Aiton) trees over a year. The effect of environmental parameters such as temperature and rain on needle development were studied. Our results show that seasonal changes in the metabolite profiles were mainly affected by the needles’ age and acclimation for winter, but changes in transcript profiles were mainly dependent on climatic factors. The relative abundance of most transcripts correlated well with temperature, particularly for genes involved in photosynthesis or winter acclimation. Gene network analysis revealed relationships between 14 co-expressed gene modules and development and adaptation to environmental stimuli. Novel Myb transcription factors were identified as candidate regulators during needle development. Our systems-based analysis provides integrated data of the seasonal regulation of maritime pine growth, opening new perspectives for understanding the complex regulatory mechanisms underlying conifers’ adaptive responses. Taken together, our results suggest that the environment regulates the transcriptome for fine tuning of the metabolome during development. PMID:25873654

Genome-Wide Small RNA Analysis of Soybean Reveals Auxin-Responsive microRNAs that are Differentially Expressed in Response to Salt Stress in Root Apex

PubMed Central

Sun, Zhengxi; Wang, Youning; Mou, Fupeng; Tian, Yinping; Chen, Liang; Zhang, Senlei; Jiang, Qiong; Li, Xia

2016-01-01

Root growth and the architecture of the root system in Arabidopsis are largely determined by root meristematic activity. Legume roots show strong developmental plasticity in response to both abiotic and biotic stimuli, including symbiotic rhizobia. However, a global analysis of gene regulation in the root meristem of soybean plants is lacking. In this study, we performed a global analysis of the small RNA transcriptome of root tips from soybean seedlings grown under normal and salt stress conditions. In total, 71 miRNA candidates, including known and novel variants of 59 miRNA families, were identified. We found 66 salt-responsive miRNAs in the soybean root meristem; among them, 22 are novel miRNAs. Interestingly, we found auxin-responsive cis-elements in the promoters of many salt-responsive miRNAs, implying that these miRNAs may be regulated by auxin and auxin signaling plays a key role in regulating the plasticity of the miRNAome and root development in soybean. A functional analysis of miR399, a salt-responsive miRNA in the root meristem, indicates the crucial role of this miRNA in modulating soybean root developmental plasticity. Our data provide novel insight into the miRNAome-mediated regulatory mechanism in soybean root growth under salt stress. PMID:26834773

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism.

PubMed

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R; Raikhel, Natasha V

2015-01-06

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red staining suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

SETDB1 modulates PRC2 activity at developmental genes independently of H3K9 trimethylation in mouse ES cells

PubMed Central

Fei, Qi; Yang, Xiaoqin; Jiang, Hua; Wang, Qian; Yu, Yanyan; Yu, Yiling; Yi, Wei; Zhou, Shaolian; Chen, Taiping; Lu, Chris; Atadja, Peter; Liu, Xiaole Shirley; Li, En; Zhang, Yong; Shou, Jianyong

2015-01-01

SETDB1, a histone methyltransferase responsible for methylation of histone H3 lysine 9 (H3K9), is involved in maintenance of embryonic stem (ES) cells and early embryonic development of the mouse. However, how SETDB1 regulates gene expression during development is largely unknown. Here, we characterized genome-wide SETDB1 binding and H3K9 trimethylation (H3K9me3) profiles in mouse ES cells and uncovered two distinct classes of SETDB1 binding sites, termed solo and ensemble peaks. The solo peaks were devoid of H3K9me3 and enriched near developmental regulators while the ensemble peaks were associated with H3K9me3. A subset of the SETDB1 solo peaks, particularly those near neural development–related genes, was found to be associated with Polycomb Repressive Complex 2 (PRC2) as well as PRC2-interacting proteins JARID2 and MTF2. Genetic deletion of Setdb1 reduced EZH2 binding as well as histone 3 lysine 27 (H3K27) trimethylation level at SETDB1 solo peaks and facilitated neural differentiation. Furthermore, we found that H3K27me3 inhibits SETDB1 methyltransferase activity. The currently identified reciprocal action between SETDB1 and PRC2 reveals a novel mechanism underlying ES cell pluripotency and differentiation regulation. PMID:26160163

Fibroblast growth factor receptors: multifactorial-contributors to tumor initiation and progression.

PubMed

Feng, Shachuan; Zhou, Li; Nice, Edouard Collins; Huang, Canhua

2015-01-01

Fibroblast growth factor receptors (FGFRs), encoded by four genes (FGFR1, FGFR2, FGFR3, and FGFR4) are tightly associated with many biological processes such as organ development, cell proliferation and migration. Studies over the past decades have validated the pivotal roles FGFRs play in tumorigenesis due to the regulation of diverse tumorigenesis-related processes, including cell survival, proliferation, inflammation, metastasis and angiogenesis. Interestingly, FGFR mutations in somatic cells leading to tumorigenesis and those in germ cells leading to developmental disorders are identical, suggesting that FGFR mutations result in different diseases due to their spatio-temporal expression. Thus, discoveries in developmental biology may also be applicable to cancer. FGFRs regulate the expression and/or the activity of a myriad of molecules (e.g. matrix metalloproteinases (MMPs) and Snail) that are tightly linked to tumorigenesis by four main signaling pathways (RAS-MAPK, PI3K-AKT, PLCγ-PIP2, and STAT), as well as other minor branches. Epigenetic and genetic alteration of FGFR genes, including DNA methylation, histone remodeling, microRNA regulation, single nucleotide polymorphisms (SNPs), gene missense mutations, amplification, and fusion of FGFRs with other genes, which result in gain or loss of FGFR function, have been identified in many types of cancer. In this review, we focus in particular on recent advances in the relationship between FGFR disorders and tumorigenesis.

Variants of the Xenopus laevis ribosomal transcription factor xUBF are developmentally regulated by differential splicing.

PubMed

Guimond, A; Moss, T

1992-07-11

XUBF is a Xenopus ribosomal transcription factor of the HMG-box family which contains five tandemly disposed homologies to the HMG1 & 2 DNA binding domains. XUBF has been isolated as a protein doublet and two cDNAs encoding the two molecular weight variants have been characterised. The major two forms of xUBF identified differ by the presence or absence of a 22 amino acid segment lying between HMG-boxes 3 and 4. Here we show that the mRNAs for these two forms of xUBF are regulated during development and differentiation over a range of nearly 20 fold. By isolating two of the xUBF genes, it was possible to show that both encoded the variable 22 amino acid segment in exon 12. Oocyte splicing assays and the sequencing of PCR-generated cDNA fragments, demonstrated that the transcripts from one of these genes were differentially spliced in a developmentally regulated manner. Transcripts from the second gene were found to be predominantly or exclusively spliced to produce the lower molecular weight form of xUBF. Expression of a high molecular weight form from yet a third gene was also detected. Although the intron-exon structures of the Xenopus and mouse UBF genes were found to be essentially identical, the differential splicing of exon 8 found in mammals, was not detected in Xenopus.

Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

PubMed

Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

2018-01-01

The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

Lipid phosphate phosphatase 3 regulates adipocyte sphingolipid synthesis, but not developmental adipogenesis or diet-induced obesity in mice.

PubMed

Federico, Lorenzo; Yang, Liping; Brandon, Jason; Panchatcharam, Manikandan; Ren, Hongmei; Mueller, Paul; Sunkara, Manjula; Escalante-Alcalde, Diana; Morris, Andrew J; Smyth, Susan S

2018-01-01

Dephosphorylation of phosphatidic acid (PA) is the penultimate step in triglyceride synthesis. Adipocytes express soluble intracellular PA-specific phosphatases (Lipins) and broader specificity membrane-associated lipid phosphate phosphatases (LPPs) that can also dephosphorylate PA. Inactivation of lipin1 causes lipodystrophy in mice due to defective developmental adipogenesis. Triglyceride synthesis is diminished but not ablated by inactivation of lipin1 in differentiated adipocytes implicating other PA phosphatases in this process. To investigate the possible role of LPPs in adipocyte lipid metabolism and signaling we made mice with adipocyte-targeted inactivation of LPP3 encoded by the Plpp3(Ppap2b) gene. Adipocyte LPP3 deficiency resulted in blunted ceramide and sphingomyelin accumulation during diet-induced adipose tissue expansion, accumulation of the LPP3 substrate sphingosine 1- phosphate, and reduced expression of serine palmitoyl transferase. However, adiposity was unaffected by LPP3 deficiency on standard, high fat diet or Western diets, although Western diet-fed mice with adipocyte LPP3 deficiency exhibited improved glucose tolerance. Our results demonstrate functional compartmentalization of lipid phosphatase activity in adipocytes and identify an unexpected role for LPP3 in the regulation of diet-dependent sphingolipid synthesis that may impact on insulin signaling.

Tissue specific characterisation of Lim-kinase 1 expression during mouse embryogenesis

PubMed Central

Lindström, Nils O.; Neves, Carlos; McIntosh, Rebecca; Miedzybrodzka, Zosia; Vargesson, Neil; Collinson, J. Martin

2012-01-01

The Lim-kinase (LIMK) proteins are important for the regulation of the actin cytoskeleton, in particular the control of actin nucleation and depolymerisation via regulation of cofilin, and hence may control a large number of processes during development, including cell tensegrity, migration, cell cycling, and axon guidance. LIMK1/LIMK2 knockouts disrupt spinal cord morphogenesis and synapse formation but other tissues and developmental processes that require LIMK are yet to be fully determined. To identify tissues and cell-types that may require LIMK, we characterised the pattern of LIMK1 protein during mouse embryogenesis. We showed that LIMK1 displays an expression pattern that is temporally dynamic and tissue-specific. In several tissues LIMK1 is detected in cell-types that also express Wilms’ tumour protein 1 and that undergo transitions between epithelial and mesenchymal states, including the pleura, epicardium, kidney nephrons, and gonads. LIMK1 was also found in a subset of cells in the dorsal retina, and in mesenchymal cells surrounding the peripheral nerves. This detailed study of the spatial and temporal expression of LIMK1 shows that LIMK1 expression is more dynamic than previously reported, in particular at sites of tissue–tissue interactions guiding multiple developmental processes. PMID:21167960

Sex and hedgehog: roles of genes in the hedgehog signaling pathway in mammalian sexual differentiation.

PubMed

Franco, Heather L; Yao, Humphrey H-C

2012-01-01

The chromosome status of the mammalian embryo initiates a multistage process of sexual development in which the bipotential reproductive system establishes itself as either male or female. These events are governed by intricate cell-cell and interorgan communication that is regulated by multiple signaling pathways. The hedgehog signaling pathway was originally identified for its key role in the development of Drosophila, but is now recognized as a critical developmental regulator in many species, including humans. In addition to its developmental roles, the hedgehog signaling pathway also modulates adult organ function, and misregulation of this pathway often leads to diseases, such as cancer. The hedgehog signaling pathway acts through its morphogenetic ligands that signal from ligand-producing cells to target cells over a specified distance. The target cells then respond in a graded manner based on the concentration of the ligands that they are exposed to. Through this unique mechanism of action, the hedgehog signaling pathway elicits cell fate determination, epithelial-mesenchymal interactions, and cellular homeostasis. Here, we review current findings on the roles of hedgehog signaling in the sexually dimorphic development of the reproductive organs with an emphasis on mammals and comparative evidence in other species.

Semaphorin 5A inhibits synaptogenesis in early postnatal- and adult-born hippocampal dentate granule cells.

PubMed

Duan, Yuntao; Wang, Shih-Hsiu; Song, Juan; Mironova, Yevgeniya; Ming, Guo-li; Kolodkin, Alex L; Giger, Roman J

2014-10-14

Human SEMAPHORIN 5A (SEMA5A) is an autism susceptibility gene; however, its function in brain development is unknown. In this study, we show that mouse Sema5A negatively regulates synaptogenesis in early, developmentally born, hippocampal dentate granule cells (GCs). Sema5A is strongly expressed by GCs and regulates dendritic spine density in a cell-autonomous manner. In the adult mouse brain, newly born Sema5A-/- GCs show an increase in dendritic spine density and increased AMPA-type synaptic responses. Sema5A signals through PlexinA2 co-expressed by GCs, and the PlexinA2-RasGAP activity is necessary to suppress spinogenesis. Like Sema5A-/- mutants, PlexinA2-/- mice show an increase in GC glutamatergic synapses, and we show that Sema5A and PlexinA2 genetically interact with respect to GC spine phenotypes. Sema5A-/- mice display deficits in social interaction, a hallmark of autism-spectrum-disorders. These experiments identify novel intra-dendritic Sema5A/PlexinA2 interactions that inhibit excitatory synapse formation in developmentally born and adult-born GCs, and they provide support for SEMA5A contributions to autism-spectrum-disorders.

Serotonin homeostasis and serotonin receptors as actors of cortical construction: special attention to the 5-HT3A and 5-HT6 receptor subtypes

PubMed Central

Vitalis, Tania; Ansorge, Mark S.; Dayer, Alexandre G.

2013-01-01

Cortical circuits control higher-order cognitive processes and their function is highly dependent on their structure that emerges during development. The construction of cortical circuits involves the coordinated interplay between different types of cellular processes such as proliferation, migration, and differentiation of neural and glial cell subtypes. Among the multiple factors that regulate the assembly of cortical circuits, 5-HT is an important developmental signal that impacts on a broad diversity of cellular processes. 5-HT is detected at the onset of embryonic telencephalic formation and a variety of serotonergic receptors are dynamically expressed in the embryonic developing cortex in a region and cell-type specific manner. Among these receptors, the ionotropic 5-HT3A receptor and the metabotropic 5-HT6 receptor have recently been identified as novel serotonergic targets regulating different aspects of cortical construction including neuronal migration and dendritic differentiation. In this review, we focus on the developmental impact of serotonergic systems on the construction of cortical circuits and discuss their potential role in programming risk for human psychiatric disorders. PMID:23801939

Prediction of C. elegans Longevity Genes by Human and Worm Longevity Networks

PubMed Central

de Magalhães, João Pedro; Ruvkun, Gary; Fraifeld, Vadim E.; Curran, Sean P.

2012-01-01

Intricate and interconnected pathways modulate longevity, but screens to identify the components of these pathways have not been saturating. Because biological processes are often executed by protein complexes and fine-tuned by regulatory factors, the first-order protein-protein interactors of known longevity genes are likely to participate in the regulation of longevity. Data-rich maps of protein interactions have been established for many cardinal organisms such as yeast, worms, and humans. We propose that these interaction maps could be mined for the identification of new putative regulators of longevity. For this purpose, we have constructed longevity networks in both humans and worms. We reasoned that the essential first-order interactors of known longevity-associated genes in these networks are more likely to have longevity phenotypes than randomly chosen genes. We have used C. elegans to determine whether post-developmental inactivation of these essential genes modulates lifespan. Our results suggest that the worm and human longevity networks are functionally relevant and possess a high predictive power for identifying new longevity regulators. PMID:23144747

Axonal Degeneration Is Regulated by a Transcriptional Program that Coordinates Expression of Pro- and Anti-degenerative Factors.

PubMed

Maor-Nof, Maya; Romi, Erez; Sar Shalom, Hadas; Ulisse, Valeria; Raanan, Calanit; Nof, Aviv; Leshkowitz, Dena; Lang, Roland; Yaron, Avraham

2016-12-07

Developmental neuronal cell death and axonal elimination are controlled by transcriptional programs, of which their nature and the function of their components remain elusive. Here, we identified the dual specificity phosphatase Dusp16 as part of trophic deprivation-induced transcriptome in sensory neurons. Ablation of Dusp16 enhanced axonal degeneration in response to trophic withdrawal, suggesting that it has a protective function. Moreover, axonal skin innervation was severely reduced while neuronal elimination was increased in the Dusp16 knockout. Mechanistically, Dusp16 negatively regulates the transcription factor p53 and antagonizes the expression of the pro-degenerative factor, Puma (p53 upregulated modulator of apoptosis). Co-ablation of Puma with Dusp16 protected axons from rapid degeneration and specifically reversed axonal innervation loss early in development with no effect on neuronal deficits. Overall, these results reveal that physiological axonal elimination is regulated by a transcriptional program that integrates regressive and progressive elements and identify Dusp16 as a new axonal preserving factor. Copyright © 2016 Elsevier Inc. All rights reserved.

An elt-3/elt-5/elt-6 GATA Transcription Circuit Guides Aging in C. elegans

PubMed Central

Budovskaya, Yelena V.; Wu, Kendall; Southworth, Lucinda K.; Jiang, Min; Tedesco, Patricia; Johnson, Thomas E.; Kim, Stuart K.

2016-01-01

SUMMARY To define the C. elegans aging process at the molecular level, we used DNA microarray experiments to identify a set of 1294 age-regulated genes and found that the GATA transcription factors ELT-3, ELT-5, and ELT-6 are responsible for age regulation of a large fraction of these genes. Expression of elt-5 and elt-6 increases during normal aging, and both of these GATA factors repress expression of elt-3, which shows a corresponding decrease in expression in old worms. elt-3 regulates a large number of downstream genes that change expression in old age, including ugt-9, col-144, and sod-3. elt-5(RNAi) and elt-6(RNAi) worms have extended longevity, indicating that elt-3, elt-5, and elt-6 play an important functional role in the aging process. These results identify a transcriptional circuit that guides the rapid aging process in C. elegans and indicate that this circuit is driven by drift of developmental pathways rather than accumulation of damage. PMID:18662544

45 CFR 1386.103 - Discovery.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Practice and Procedure for Hearings Pertaining to States...

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Developmental toxicology: adequacy of current methods.

PubMed

Peters, P W

1998-01-01

Toxicology embraces several disciplines such as carcinogenicity, mutagenicity and reproductive toxicity. Reproductive toxicology is concerned with possible effects of substances on the reproductive process, i.e. on sexual organs and their functions, endocrine regulation, fertilization, transport of the fertilized ovum, implantation, and embryonic, fetal and postnatal development, until the end-differentiation of the organs is achieved. Reproductive toxicology is divided into areas related to male and female fertility, and developmental toxicology. Developmental toxicology can be further broken down into prenatal and postnatal toxicology. Today, much new information is available about the origins of developmental disorders resulting from chemical exposure. While these findings seem to promise important new developments in methodology and research, there is a danger of losing sight of the precepts and principles established in the light of existing knowledge. There is also a danger that we may fail to correct shortcomings in our existing procedures and practice. The aim of this presentation is to emphasize the importance of testing substances for their impact in advance of their use and to underline that we must use the best existing tools for carrying out risk assessments. Moreover, it needs to be stressed that there are many substances that are never assessed with respect to reproductive and developmental toxicity. Similarly, our programmes for post-marketing surveillance with respect to developmental toxicology are grossly inadequate. Our ability to identify risks to normal development and reproduction would be much improved, first if a number of straightforward precepts were always followed and second, if we had a clearer understanding of what we mean by risk and acceptable levels of risk in the context of development. Other aims of this paper are: to stress the complexity of the different stages of normal prenatal development; to note the principles that are applicable in developmental and especially prenatal toxicology; to describe the different agents that might act as developmental toxicants or teratogens; to show the broad scope of different effects caused by developmental toxic agents; and to indicate methods to detect and to recognise causes of developmental defects with the primary objective of preventing these disorders.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn.

PubMed

Dong, Yongbin; Wang, Qilei; Zhang, Long; Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize.

Dynamic Proteomic Characteristics and Network Integration Revealing Key Proteins for Two Kernel Tissue Developments in Popcorn

PubMed Central

Du, Chunguang; Xiong, Wenwei; Chen, Xinjian; Deng, Fei; Ma, Zhiyan; Qiao, Dahe; Hu, Chunhui; Ren, Yangliu; Li, Yuling

2015-01-01

The formation and development of maize kernel is a complex dynamic physiological and biochemical process that involves the temporal and spatial expression of many proteins and the regulation of metabolic pathways. In this study, the protein profiles of the endosperm and pericarp at three important developmental stages were analyzed by isobaric tags for relative and absolute quantification (iTRAQ) labeling coupled with LC-MS/MS in popcorn inbred N04. Comparative quantitative proteomic analyses among developmental stages and between tissues were performed, and the protein networks were integrated. A total of 6,876 proteins were identified, of which 1,396 were nonredundant. Specific proteins and different expression patterns were observed across developmental stages and tissues. The functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the development of the tissues. The whole, endosperm-specific and pericarp-specific protein networks integrated 125, 9 and 77 proteins, respectively, which were involved in 54 KEGG pathways and reflected their complex metabolic interactions. Confirmation for the iTRAQ endosperm proteins by two-dimensional gel electrophoresis showed that 44.44% proteins were commonly found. However, the concordance between mRNA level and the protein abundance varied across different proteins, stages, tissues and inbred lines, according to the gene cloning and expression analyses of four relevant proteins with important functions and different expression levels. But the result by western blot showed their same expression tendency for the four proteins as by iTRAQ. These results could provide new insights into the developmental mechanisms of endosperm and pericarp, and grain formation in maize. PMID:26587848

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

The histone acetyltransferases CBP and Chameau integrate developmental and DNA replication programs in Drosophila ovarian follicle cells

PubMed Central

McConnell, Kristopher H.; Dixon, Michael; Calvi, Brian R.

2012-01-01

DNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic location of origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins in concert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarian follicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histone acetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm had relatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of its ortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also binds amplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect on nucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaborate in origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate the developmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of origin epigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integrates differentiation and DNA replication programs. PMID:22951641

Specification of select hypothalamic circuits and innate behaviors by the embryonic patterning gene Dbx1

PubMed Central

Sokolowski, Katie; Esumi, Shigeyuki; Hirata, Tsutomu; Kamal, Yasman; Tran, Tuyen; Lam, Andrew; Oboti, Livio; Brighthaupt, Sherri-Chanelle; Zaghlula, Manar; Martinez, Jennifer; Ghimbovschi, Svetlana; Knoblach, Susan; Pierani, Alessandra; Tamamaki, Nobuaki; Shah, Nirao M; Jones, Kevin S; Corbin, Joshua G

2015-01-01

SUMMARY The hypothalamus integrates information required for the production of a variety of innate behaviors such as feeding, mating, aggression and predator avoidance. Despite an extensive knowledge of hypothalamic function, how embryonic genetic programs specify circuits that regulate these behaviors remains unknown. Here, we find that in the hypothalamus the developmentally regulated homeodomain-containing transcription factor Dbx1 is required for the generation of specific subclasses of neurons within the lateral hypothalamic area/zona incerta (LH) and the arcuate (Arc) nucleus. Consistent with this specific developmental role, Dbx1 hypothalamic-specific conditional-knockout mice display attenuated responses to predator odor and feeding stressors but do not display deficits in other innate behaviors such as mating or conspecific aggression. Thus, activity of a single developmentally regulated gene, Dbx1, is a shared requirement for the specification of hypothalamic nuclei governing a subset of innate behaviors. PMID:25864637

Production of systemically circulating Hedgehog by the intestine couples nutrition to growth and development.

PubMed

Rodenfels, Jonathan; Lavrynenko, Oksana; Ayciriex, Sophie; Sampaio, Julio L; Carvalho, Maria; Shevchenko, Andrej; Eaton, Suzanne

2014-12-01

In Drosophila larvae, growth and developmental timing are regulated by nutrition in a tightly coordinated fashion. The networks that couple these processes are far from understood. Here, we show that the intestine responds to nutrient availability by regulating production of a circulating lipoprotein-associated form of the signaling protein Hedgehog (Hh). Levels of circulating Hh tune the rates of growth and developmental timing in a coordinated fashion. Circulating Hh signals to the fat body to control larval growth. It regulates developmental timing by controlling ecdysteroid production in the prothoracic gland. Circulating Hh is especially important during starvation, when it is also required for mobilization of fat body triacylglycerol (TAG) stores. Thus, we demonstrate that Hh, previously known only for its local morphogenetic functions, also acts as a lipoprotein-associated endocrine hormone, coordinating the response of multiple tissues to nutrient availability. © 2014 Rodenfels et al.; Published by Cold Spring Harbor Laboratory Press.

A Proteomic Study of Brassinosteroid Response in Arabidopsis

PubMed Central

Deng, Zhiping; Zhang, Xin; Tang, Wenqiang; Oses-Prieto, Juan A; Suzuki, Nagi; Gendron, Joshua M; Chen, Huanjing; Guan, Shenheng; Chalkley, Robert J.; Peterman, T. Kaye; Burlingame, Alma L.; Wang, Zhi-Yong

2010-01-01

Summary The plant steroid hormones brassinosteroids (BRs) play an important role in a wide range of developmental and physiological processes. How BR signaling regulates diverse processes remains unclear. To understand the molecular details of BR responses, we have performed a proteomic study of BR-regulated proteins in Arabidopsis using two-dimensional difference gel electrophoresis (2-D DIGE) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). We identified 42 BR-regulated proteins, which are predicted to play potential roles in BR regulation of specific cellular processes, such as signaling, cytoskeleton rearrangement, vesicle trafficking, and biosynthesis of hormones and vitamins. Analyses of the BR insensitive mutant bri1-116 and BR hypersensitive mutant bzr1-1D identified 5 proteins (PATL1, PATL2, THI1, AtMDAR3 and NADP-ME2) affected by both BR-treatment and in the mutants, suggesting their importance in BR action. Selected proteins were further studied using insertion knockout mutants or immunoblotting. Interestingly, about 80% of the BR-responsive proteins were not identified in previous microarray studies, and direct comparison between protein- and RNA changes in BR mutants revealed a very weak correlation. RT-PCR analysis of selected genes revealed gene-specific kinetic relationships between RNA and protein responses. Furthermore, BR-regulated posttranslational modification of BiP2 protein was detected as spot shifts in 2-D DIGE. This study provides novel insights into the molecular networks that link BR signaling to specific cellular and physiological responses. PMID:17848588

Evolution of branched regulatory genetic pathways: directional selection on pleiotropic loci accelerates developmental system drift.

PubMed

Johnson, Norman A; Porter, Adam H

2007-01-01

Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.

Systems theory and cascades in developmental psychopathology.

PubMed

Cox, Martha J; Mills-Koonce, Roger; Propper, Cathi; Gariépy, Jean-Louis

2010-08-01

In the wake of prominent theoreticians in developmental science, whose contributions we review in this article, many developmental psychologists came to endorse a systems approach to understanding how the individual, as it develops, establishes functional relationships to social ecological contexts that from birth to school entry rapidly increase in complexity. The concept of developmental cascade has been introduced in this context to describe lawful processes by which antecedent conditions may be related with varying probabilities to specified outcomes. These are understood as processes by which function at one level or in one domain of behavior affect the organization of competency in later developing domains of general adaptation. Here we propose a developmental sequence by which the developing child acquires regulative capacities that are key to adjustment to a society that demands considerable control of emotional and cognitive functions early in life. We report empirical evidence showing that the acquisition of regulative capacities may be understood as a cascade of shifts in control parameters induced by the progressive integration of biological, transactional, and socioaffective systems over development. We conclude by suggesting how the developmental process may be accessed for effective intervention in populations deemed "at risk" for later problems of psychosocial adjustment.

Suppression of OsKu80 results in defects in developmental growth and increased telomere length in rice (Oryza sativa L.).

PubMed

Byun, Mi Young; Cui, Li Hua; Kim, Woo Taek

2015-12-25

The Ku70-Ku80 heterodimer plays a critical role in the maintenance of genomic stability in humans and yeasts. In this report, we identified and characterized OsKu80 in rice, a model monocot crop. OsKu80 forms a heterodimer with OsKu70 in yeast and plant cells, as demonstrated by yeast two-hybrid, in vivo co-immunoprecipitation, and bimolecular fluorescence complementation assays. RNAi-mediated knock-down T3 transgenic rice plants (Ubi:RNAi-OsKu80) displayed a retarded growth phenotype at the post-germination stage. In addition, the Ubi:RNAi-OsKu80 knock-down progeny exhibited noticeably increased telomere length as compared to wild-type rice. These results are discussed with the idea that OsKu80 plays a role in developmental growth and telomere length regulation in rice plants. Copyright © 2015 Elsevier Inc. All rights reserved.

Comparative cell cycle transcriptomics reveals synchronization of developmental transcription factor networks in cancer cells

PubMed Central

Johard, Helena; Mahdessian, Diana; Fedr, Radek; Marks, Carolyn; Medalová, Jiřina; Souček, Karel; Lundberg, Emma; Linnarsson, Sten; Bryja, Vítězslav; Sekyrova, Petra; Altun, Mikael; Andäng, Michael

2017-01-01

The cell cycle coordinates core functions such as replication and cell division. However, cell-cycle-regulated transcription in the control of non-core functions, such as cell identity maintenance through specific transcription factors (TFs) and signalling pathways remains unclear. Here, we provide a resource consisting of mapped transcriptomes in unsynchronized HeLa and U2OS cancer cells sorted for cell cycle phase by Fucci reporter expression. We developed a novel algorithm for data analysis that enables efficient visualization and data comparisons and identified cell cycle synchronization of Notch signalling and TFs associated with development. Furthermore, the cell cycle synchronizes with the circadian clock, providing a possible link between developmental transcriptional networks and the cell cycle. In conclusion we find that cell cycle synchronized transcriptional patterns are temporally compartmentalized and more complex than previously anticipated, involving genes, which control cell identity and development. PMID:29228002

Current progress in orchid flowering/flower development research

PubMed Central

Wang, Hsin-Mei; Tong, Chii-Gong

2017-01-01

ABSTRACT Genetic pathways relevant to flowering of Arabidopsis are under the control of environmental cues such as day length and temperatures, and endogenous signals including phytohormones and developmental aging. However, genes and even regulatory pathways for flowering identified in crops show divergence from those of Arabidopsis and often do not have functional equivalents to Arabidopsis and/or existing species- or genus-specific regulators and show modified or novel pathways. Orchids are the largest, most highly evolved flowering plants, and form an extremely peculiar group of plants. Here, we briefly summarize the flowering pathways of Arabidopsis, rice and wheat and present them alongside recent discoveries/progress in orchid flowering and flower developmental processes including our transgenic Phalaenopsis orchids for LEAFY overexpression. Potential biotechnological applications in flowering/flower development of orchids with potential target genes are also discussed from an interactional and/or comparative viewpoint. PMID:28448202

Mechanisms and pathways of growth failure in primordial dwarfism

PubMed Central

Klingseisen, Anna; Jackson, Andrew P.

2011-01-01

The greatest difference between species is size; however, the developmental mechanisms determining organism growth remain poorly understood. Primordial dwarfism is a group of human single-gene disorders with extreme global growth failure (which includes Seckel syndrome, microcephalic osteodysplastic primordial dwarfism I [MOPD] types I and II, and Meier-Gorlin syndrome). Ten genes have now been identified for microcephalic primordial dwarfism, encoding proteins involved in fundamental cellular processes including genome replication (ORC1 [origin recognition complex 1], ORC4, ORC6, CDT1, and CDC6), DNA damage response (ATR [ataxia-telangiectasia and Rad3-related]), mRNA splicing (U4atac), and centrosome function (CEP152, PCNT, and CPAP). Here, we review the cellular and developmental mechanisms underlying the pathogenesis of these conditions and address whether further study of these genes could provide novel insight into the physiological regulation of organism growth. PMID:21979914

Worker honey bee pheromone regulation of foraging ontogeny

NASA Astrophysics Data System (ADS)

Pankiw, Tanya

The evolution of sociality has configured communication chemicals, called primer pheromones, which play key roles in regulating the organization of social life. Primer pheromones exert relatively slow effects that fundamentally alter developmental, physiological, and neural systems. Here, I demonstrate how substances extracted from the surface of foraging and young pre-foraging worker bees regulated age at onset of foraging, a developmental process. Hexane-extractable compounds washed from foraging workers increased foraging age compared with controls, whereas extracts of young pre-foraging workers decreased foraging age. This represents the first known direct demonstration of primer pheromone activity derived from adult worker bees.

AGCVIII Kinases: at the crossroads of cellular signaling

USDA-ARS?s Scientific Manuscript database

AGCVIII kinases regulate diverse developmental and cellular processes in plants. As putative mediators of secondary messengers, AGCVIII kinases potentially integrate developmental and environmental cues into specific cellular responses through substrate phosphorylation. Here we discuss the functiona...

45 CFR 1386.19 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights of...

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

PubMed Central

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

PubMed Central

Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

2013-01-01

Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

Regulation of Expressive Behavior as Reflecting Affect Socialization.

ERIC Educational Resources Information Center

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

Identifying gene coexpression networks underlying the dynamic regulation of wood-forming tissues in Populus under diverse environmental conditions.

PubMed

Zinkgraf, Matthew; Liu, Lijun; Groover, Andrew; Filkov, Vladimir

2017-06-01

Trees modify wood formation through integration of environmental and developmental signals in complex but poorly defined transcriptional networks, allowing trees to produce woody tissues appropriate to diverse environmental conditions. In order to identify relationships among genes expressed during wood formation, we integrated data from new and publically available datasets in Populus. These datasets were generated from woody tissue and include transcriptome profiling, transcription factor binding, DNA accessibility and genome-wide association mapping experiments. Coexpression modules were calculated, each of which contains genes showing similar expression patterns across experimental conditions, genotypes and treatments. Conserved gene coexpression modules (four modules totaling 8398 genes) were identified that were highly preserved across diverse environmental conditions and genetic backgrounds. Functional annotations as well as correlations with specific experimental treatments associated individual conserved modules with distinct biological processes underlying wood formation, such as cell-wall biosynthesis, meristem development and epigenetic pathways. Module genes were also enriched for DNase I hypersensitivity footprints and binding from four transcription factors associated with wood formation. The conserved modules are excellent candidates for modeling core developmental pathways common to wood formation in diverse environments and genotypes, and serve as testbeds for hypothesis generation and testing for future studies. No claim to original US government works. New Phytologist © 2017 New Phytologist Trust.

Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

PubMed

Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

2004-01-01

This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

More normal than not: a qualitative assessment of the developmental experiences of gay male youth.

PubMed

Eccles, Thomas A; Sayegh, M A; Fortenberry, J D; Zimet, G D

2004-11-01

To examine gay youth experiences within the context of normal adolescent development. Thematic analyses of interviews with 13 self-identified gay male youth, aged 16-22 years, each reporting minimal sexual identity distress, were completed. Interviews focused on: (a) descriptions of developmental changes perceived to occur for all adolescents, (b) descriptions of the participants' developmental experience, and (c) participants' direct comparisons of their perceptions of gay and nongay developmental experience. Data were analyzed by two investigators who, after initial review of the interview transcripts, developed a unified coding template to permit systematic analysis of the transcripts for recurrent themes. (a) Few (2 of 13) participants reported overall developmental experience markedly different from nongay peers. (b) Peer interaction was seen as the domain most different from that of nongay peers. (c) Open gay self-identification altered, generally positively, all peer interaction. (d) Increased peer interaction enhanced maturity in other domains. (e) Family dynamics were not substantively altered by open gay self-identification. (f) Middle and high school were identified as relatively hostile environments in which to openly identify as gay, affecting the timing and the extent of self-disclosure. (g) Developmental progress showed asynchrony across developmental domains. General developmental dysfunction is not inevitable for gay adolescents, nor is identifiable personal or family pathology directly related to sexual identity.

45 CFR 1386.25 - Allowable litigation costs.

Code of Federal Regulations, 2010 CFR

2010-10-01

....25 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights...

Socio-emotional regulation in children with intellectual disability and typically developing children, and teachers' perceptions of their social adjustment.

PubMed

Baurain, Céline; Nader-Grosbois, Nathalie; Dionne, Carmen

2013-09-01

This study examined the extent to which socio-emotional regulation displayed in three dyadic interactive play contexts (neutral, competitive or cooperative) by 45 children with intellectual disability compared with 45 typically developing children (matched on developmental age, ranging from 3 to 6 years) is linked with the teachers' perceptions of their social adjustment. A Coding Grid of Socio-Emotional Regulation by Sequences (Baurain & Nader-Grosbois, 2011b, 2011c) focusing on Emotional Expression, Social Behavior and Behavior toward Social Rules in children was applied. The Social Adjustment for Children Scale (EASE, Hugues, Soares-Boucaud, Hochman, & Frith, 1997) and the Assessment, Evaluation and Intervention Program System (AEPS, Bricker, 2002) were completed by teachers. Regression analyses emphasized, in children with intellectual disability only, a positive significant link between their Behavior toward Social Rules in interactive contexts and the teachers' perceptions of their social adjustment. Children with intellectual disabilities who listen to and follow instructions, who are patient in waiting for their turn, and who moderate their externalized behavior are perceived by their teachers as socially adapted in their daily social relationships. The between-groups dissimilarity in the relational patterns between abilities in socio-emotional regulation and social adjustment supports the "structural difference hypothesis" with regard to the group with intellectual disability, compared with the typically developing group. Hierarchical cluster cases analyses identified distinct subgroups showing variable structural patterns between the three specific categories of abilities in socio-emotional regulation and their levels of social adjustment perceived by teachers. In both groups, several abilities in socio-emotional regulation and teachers' perceptions of social adjustment vary depending on children's developmental age. Chronological age in children with intellectual disability had no impact on their socio-emotional regulation and social adjustment. Copyright © 2013 Elsevier Ltd. All rights reserved.

Developmental delays in emotion regulation strategies in preschoolers with autism.

PubMed

Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

2017-11-01

Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These findings suggest targeting communication with people outside of the family and personality development as appropriate intervention goals. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.

PubMed

Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa

2007-03-01

The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.

Directed targeting of chromatin to the nuclear lamina is mediated by chromatin state and A-type lamins.

PubMed

Harr, Jennifer C; Luperchio, Teresa Romeo; Wong, Xianrong; Cohen, Erez; Wheelan, Sarah J; Reddy, Karen L

2015-01-05

Nuclear organization has been implicated in regulating gene activity. Recently, large developmentally regulated regions of the genome dynamically associated with the nuclear lamina have been identified. However, little is known about how these lamina-associated domains (LADs) are directed to the nuclear lamina. We use our tagged chromosomal insertion site system to identify small sequences from borders of fibroblast-specific variable LADs that are sufficient to target these ectopic sites to the nuclear periphery. We identify YY1 (Ying-Yang1) binding sites as enriched in relocating sequences. Knockdown of YY1 or lamin A/C, but not lamin A, led to a loss of lamina association. In addition, targeted recruitment of YY1 proteins facilitated ectopic LAD formation dependent on histone H3 lysine 27 trimethylation and histone H3 lysine di- and trimethylation. Our results also reveal that endogenous loci appear to be dependent on lamin A/C, YY1, H3K27me3, and H3K9me2/3 for maintenance of lamina-proximal positioning. © 2015 Harr et al.

PHF6 Degrees of Separation: The Multifaceted Roles of a Chromatin Adaptor Protein.

PubMed

Todd, Matthew A M; Ivanochko, Danton; Picketts, David J

2015-06-19

The importance of chromatin regulation to human disease is highlighted by the growing number of mutations identified in genes encoding chromatin remodeling proteins. While such mutations were first identified in severe developmental disorders, or in specific cancers, several genes have been implicated in both, including the plant homeodomain finger protein 6 (PHF6) gene. Indeed, germline mutations in PHF6 are the cause of the Börjeson-Forssman-Lehmann X-linked intellectual disability syndrome (BFLS), while somatic PHF6 mutations have been identified in T-cell acute lymphoblastic leukemia (T-ALL) and acute myeloid leukemia (AML). Studies from different groups over the last few years have made a significant impact towards a functional understanding of PHF6 protein function. In this review, we summarize the current knowledge of PHF6 with particular emphasis on how it interfaces with a distinct set of interacting partners and its functional roles in the nucleoplasm and nucleolus. Overall, PHF6 is emerging as a key chromatin adaptor protein critical to the regulation of neurogenesis and hematopoiesis.

Epidermal stem cells: location, potential and contribution to cancer.

PubMed

Ambler, C A; Määttä, A

2009-01-01

Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

Neuron class-specific requirements for Fragile X Mental Retardation Protein in critical period development of calcium signaling in learning and memory circuitry.

PubMed

Doll, Caleb A; Broadie, Kendal

2016-05-01

Neural circuit optimization occurs through sensory activity-dependent mechanisms that refine synaptic connectivity and information processing during early-use developmental critical periods. Fragile X Mental Retardation Protein (FMRP), the gene product lost in Fragile X syndrome (FXS), acts as an activity sensor during critical period development, both as an RNA-binding translation regulator and channel-binding excitability regulator. Here, we employ a Drosophila FXS disease model to assay calcium signaling dynamics with a targeted transgenic GCaMP reporter during critical period development of the mushroom body (MB) learning/memory circuit. We find FMRP regulates depolarization-induced calcium signaling in a neuron-specific manner within this circuit, suppressing activity-dependent calcium transients in excitatory cholinergic MB input projection neurons and enhancing calcium signals in inhibitory GABAergic MB output neurons. Both changes are restricted to the developmental critical period and rectified at maturity. Importantly, conditional genetic (dfmr1) rescue of null mutants during the critical period corrects calcium signaling defects in both neuron classes, indicating a temporally restricted FMRP requirement. Likewise, conditional dfmr1 knockdown (RNAi) during the critical period replicates constitutive null mutant defects in both neuron classes, confirming cell-autonomous requirements for FMRP in developmental regulation of calcium signaling dynamics. Optogenetic stimulation during the critical period enhances depolarization-induced calcium signaling in both neuron classes, but this developmental change is eliminated in dfmr1 null mutants, indicating the activity-dependent regulation requires FMRP. These results show FMRP shapes neuron class-specific calcium signaling in excitatory vs. inhibitory neurons in developing learning/memory circuitry, and that FMRP mediates activity-dependent regulation of calcium signaling specifically during the early-use critical period. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

PubMed

Cusick, John K; Hager, Elizabeth; Gill, Ronald E

2015-01-01

The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Role of the immune modulator programmed cell death-1 during development and apoptosis of mouse retinal ganglion cells

PubMed Central

Chen, Ling; Sham, Caroline W.; Chan, Ann M.; Francisco, Loise M.; Wu, Yin; Mareninov, Sergey; Sharpe, Arlene H.; Freeman, Gordon J.; Yang, Xian-Jie; Braun, Jonathan; Gordon, Lynn K.

2011-01-01

PURPOSE Mammalian programmed cell death-1 (PD-1) is a membrane-associated receptor regulating the balance between T cell activation, tolerance and immunopathology, however its role in neurons has not yet been defined. We investigate the hypothesis that PD-1 signaling actively promotes retinal ganglion cell (RGC) death within the developing mouse retina. METHODS Mature retinal cell types expressing PD-1 were identified by immunofluorescence staining of vertical retina sections; developmental expression was localized by immunostaining and quantified by Western analysis. PD-1 involvement in developmental RGC survival was assessed in vitro using retina explants and in vivo using PD-1 knockout mice. PD-1 ligand gene expression was detected by RT-PCR. RESULTS PD-1 is expressed in most adult RGCs, and undergoes dynamic upregulation during the early postnatal window of retinal cell maturation and physiological programmed cell death (PCD). In vitro blockade of PD-1 signaling during this time selectively increases survival of RGCs. Furthermore, PD-1 deficient mice show a selective increase in RGC number in the neonatal retina at the peak of developmental RGC death. Lastly, throughout postnatal retina maturation, we find gene expression of both immune PD-1 ligand genes, PD-L1 and PD-L2. CONCLUSIONS These findings collectively support a novel role for a PD-1-mediated signaling pathway in developmental PCD during postnatal RGC maturation. PMID:19420345

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

NASA Astrophysics Data System (ADS)

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-01

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

PubMed

Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

2016-11-17

Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

Brain development in rodents and humans: Identifying benchmarks of maturation and vulnerability to injury across species

PubMed Central

Semple, Bridgette D.; Blomgren, Klas; Gimlin, Kayleen; Ferriero, Donna M.; Noble-Haeusslein, Linda J.

2013-01-01

Hypoxic-ischemic and traumatic brain injuries are leading causes of long-term mortality and disability in infants and children. Although several preclinical models using rodents of different ages have been developed, species differences in the timing of key brain maturation events can render comparisons of vulnerability and regenerative capacities difficult to interpret. Traditional models of developmental brain injury have utilized rodents at postnatal day 7–10 as being roughly equivalent to a term human infant, based historically on the measurement of post-mortem brain weights during the 1970s. Here we will examine fundamental brain development processes that occur in both rodents and humans, to delineate a comparable time course of postnatal brain development across species. We consider the timing of neurogenesis, synaptogenesis, gliogenesis, oligodendrocyte maturation and age-dependent behaviors that coincide with developmentally regulated molecular and biochemical changes. In general, while the time scale is considerably different, the sequence of key events in brain maturation is largely consistent between humans and rodents. Further, there are distinct parallels in regional vulnerability as well as functional consequences in response to brain injuries. With a focus on developmental hypoxicischemic encephalopathy and traumatic brain injury, this review offers guidelines for researchers when considering the most appropriate rodent age for the developmental stage or process of interest to approximate human brain development. PMID:23583307

Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

PubMed Central

Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

2014-01-01

Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

Site-Specific Nitrosoproteomic Identification of Endogenously S-Nitrosylated Proteins in Arabidopsis1

PubMed Central

Hu, Jiliang; Huang, Xiahe; Chen, Lichao; Sun, Xuwu; Lu, Congming; Zhang, Lixin; Wang, Yingchun; Zuo, Jianru

2015-01-01

Nitric oxide (NO) regulates multiple developmental events and stress responses in plants. A major biologically active species of NO is S-nitrosoglutathione (GSNO), which is irreversibly degraded by GSNO reductase (GSNOR). The major physiological effect of NO is protein S-nitrosylation, a redox-based posttranslational modification mechanism by covalently linking an NO molecule to a cysteine thiol. However, little is known about the mechanisms of S-nitrosylation-regulated signaling, partly due to limited S-nitrosylated proteins being identified. In this study, we identified 1,195 endogenously S-nitrosylated peptides in 926 proteins from the Arabidopsis (Arabidopsis thaliana) by a site-specific nitrosoproteomic approach, which, to date, is the largest data set of S-nitrosylated proteins among all organisms. Consensus sequence analysis of these peptides identified several motifs that contain acidic, but not basic, amino acid residues flanking the S-nitrosylated cysteine residues. These S-nitrosylated proteins are involved in a wide range of biological processes and are significantly enriched in chlorophyll metabolism, photosynthesis, carbohydrate metabolism, and stress responses. Consistently, the gsnor1-3 mutant shows the decreased chlorophyll content and altered photosynthetic properties, suggesting that S-nitrosylation is an important regulatory mechanism in these processes. These results have provided valuable resources and new clues to the studies on S-nitrosylation-regulated signaling in plants. PMID:25699590

Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

PubMed

Cho, Jungnam; Paszkowski, Jerzy

2017-08-26

It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.

PubMed

Alan, Jamie K; Struckhoff, Eric C; Lundquist, Erik A

2013-01-01

Rho GTPases are key regulators of cellular protrusion and are involved in many developmental events including axon guidance during nervous system development. Rho GTPase pathways display functional redundancy in developmental events, including axon guidance. Therefore, their roles can often be masked when using simple loss-of-function genetic approaches. As a complement to loss-of-function genetics, we constructed a constitutively activated CDC-42(G12V) expressed in C. elegans neurons. CDC-42(G12V) drove the formation of ectopic lamellipodial and filopodial protrusions in the PDE neurons, which resembled protrusions normally found on migrating growth cones of axons. We then used a candidate gene approach to identify molecules that mediate CDC-42(G12V)-induced ectopic protrusions by determining if loss of function of the genes could suppress CDC-42(G12V). Using this approach, we identified 3 cytoskeletal pathways previously implicated in axon guidance, the Arp2/3 complex, UNC-115/abLIM, and UNC-43/Ena. We also identified the Nck-interacting kinase MIG-15/NIK and p21-activated kinases (PAKs), also implicated in axon guidance. Finally, PI3K signaling was required, specifically the Rictor/mTORC2 branch but not the mTORC1 branch that has been implicated in other aspects of PI3K signaling including stress and aging. Our results indicate that multiple pathways can mediate CDC-42-induced neuronal protrusions that might be relevant to growth cone protrusions during axon pathfinding. Each of these pathways involves Rac GTPases, which might serve to integrate the pathways and coordinate the multiple CDC-42 pathways. These pathways might be relevant to developmental events such as axon pathfinding as well as disease states such as metastatic melanoma.

Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans

PubMed Central

Alan, Jamie K; Struckhoff, Eric C; Lundquist, Erik A

2013-01-01

Rho GTPases are key regulators of cellular protrusion and are involved in many developmental events including axon guidance during nervous system development. Rho GTPase pathways display functional redundancy in developmental events, including axon guidance. Therefore, their roles can often be masked when using simple loss-of-function genetic approaches. As a complement to loss-of-function genetics, we constructed a constitutively activated CDC-42(G12V) expressed in C. elegans neurons. CDC-42(G12V) drove the formation of ectopic lamellipodial and filopodial protrusions in the PDE neurons, which resembled protrusions normally found on migrating growth cones of axons. We then used a candidate gene approach to identify molecules that mediate CDC-42(G12V)-induced ectopic protrusions by determining if loss of function of the genes could suppress CDC-42(G12V). Using this approach, we identified 3 cytoskeletal pathways previously implicated in axon guidance, the Arp2/3 complex, UNC-115/abLIM, and UNC-43/Ena. We also identified the Nck-interacting kinase MIG-15/NIK and p21-activated kinases (PAKs), also implicated in axon guidance. Finally, PI3K signaling was required, specifically the Rictor/mTORC2 branch but not the mTORC1 branch that has been implicated in other aspects of PI3K signaling including stress and aging. Our results indicate that multiple pathways can mediate CDC-42-induced neuronal protrusions that might be relevant to growth cone protrusions during axon pathfinding. Each of these pathways involves Rac GTPases, which might serve to integrate the pathways and coordinate the multiple CDC-42 pathways. These pathways might be relevant to developmental events such as axon pathfinding as well as disease states such as metastatic melanoma. PMID:24149939

Methylation and microRNA-mediated epigenetic regulation of SOCS3

PubMed Central

Boosani, Chandra S.; Agrawal, Devendra K.

2017-01-01

Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

Onto-clust--a methodology for combining clustering analysis and ontological methods for identifying groups of comorbidities for developmental disorders.

PubMed

Peleg, Mor; Asbeh, Nuaman; Kuflik, Tsvi; Schertz, Mitchell

2009-02-01

Children with developmental disorders usually exhibit multiple developmental problems (comorbidities). Hence, such diagnosis needs to revolve on developmental disorder groups. Our objective is to systematically identify developmental disorder groups and represent them in an ontology. We developed a methodology that combines two methods (1) a literature-based ontology that we created, which represents developmental disorders and potential developmental disorder groups, and (2) clustering for detecting comorbid developmental disorders in patient data. The ontology is used to interpret and improve clustering results and the clustering results are used to validate the ontology and suggest directions for its development. We evaluated our methodology by applying it to data of 1175 patients from a child development clinic. We demonstrated that the ontology improves clustering results, bringing them closer to an expert generated gold-standard. We have shown that our methodology successfully combines an ontology with a clustering method to support systematic identification and representation of developmental disorder groups.

A knock-in mouse line conditionally expressing the tumor suppressor WTX/AMER1.

PubMed

Boutet, Agnès; Comai, Glenda; Charlet, Aurélie; Jian Motamedi, Fariba; Dhib, Haroun; Bandiera, Roberto; Schedl, Andreas

2017-11-01

WTX/AMER1 is an important developmental regulator, mutations in which have been identified in a proportion of patients suffering from the renal neoplasm Wilms' tumor and in the bone malformation syndrome Osteopathia Striata with Cranial Sclerosis (OSCS). Its cellular functions appear complex and the protein can be found at the membrane, within the cytoplasm and the nucleus. To understand its developmental and cellular function an allelic series for Wtx in the mouse is crucial. Whereas mice carrying a conditional knock out allele for Wtx have been previously reported, a gain-of-function mouse model that would allow studying the molecular, cellular and developmental role of Wtx is still missing. Here we describe the generation of a novel mouse strain that permits the conditional activation of WTX expression. Wtx fused to GFP was introduced downstream a stop cassette flanked by loxP sites into the Rosa26 locus by gene targeting. Ectopic WTX expression is reported after crosses with several Cre transgenic mice in different embryonic tissues. Further, functionality of the fusion protein was demonstrated in the context of a Wtx null allele. © 2017 Wiley Periodicals, Inc.

45 CFR 1385.5 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.5 Section 1385.5 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

45 CFR 1385.7 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.7 Section 1385.7 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

45 CFR 1387.1 - General requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false General requirements. 1387.1 Section 1387.1 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

45 CFR 1388.8 - [Reserved

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1388.8 Section 1388.8 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

2017-03-01

Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

An RNAi based screen in Drosophila larvae identifies fascin as a regulator of myoblast fusion and myotendinous junction structure.

PubMed

Camuglia, Jaclyn M; Mandigo, Torrey R; Moschella, Richard; Mark, Jenna; Hudson, Christine H; Sheen, Derek; Folker, Eric S

2018-04-06

A strength of Drosophila as a model system is its utility as a tool to screen for novel regulators of various functional and developmental processes. However, the utility of Drosophila as a screening tool is dependent on the speed and simplicity of the assay used. Here, we use larval locomotion as an assay to identify novel regulators of skeletal muscle function. We combined this assay with muscle-specific depletion of 82 genes to identify genes that impact muscle function by their expression in muscle cells. The data from the screen were supported with characterization of the muscle pattern in embryos and larvae that had disrupted expression of the strongest hit from the screen. With this assay, we showed that 12/82 tested genes regulate muscle function. Intriguingly, the disruption of five genes caused an increase in muscle function, illustrating that mechanisms that reduce muscle function exist and that the larval locomotion assay is sufficiently quantitative to identify conditions that both increase and decrease muscle function. We extended the data from this screen and tested the mechanism by which the strongest hit, fascin, impacted muscle function. Compared to controls, animals in which fascin expression was disrupted with either a mutant allele or muscle-specific expression of RNAi had fewer muscles, smaller muscles, muscles with fewer nuclei, and muscles with disrupted myotendinous junctions. However, expression of RNAi against fascin only after the muscle had finished embryonic development did not recapitulate any of these phenotypes. These data suggest that muscle function is reduced due to impaired myoblast fusion, muscle growth, and muscle attachment. Together, these data demonstrate the utility of Drosophila larval locomotion as an assay for the identification of novel regulators of muscle development and implicate fascin as necessary for embryonic muscle development.

Defining the developmental parameters of temper loss in early childhood: implications for developmental psychopathology

PubMed Central

Wakschlag, Lauren S.; Choi, Seung W.; Carter, Alice S.; Hullsiek, Heide; Burns, James; McCarthy, Kimberly; Leibenluft, Ellen; Briggs-Gowan, Margaret J.

2013-01-01

Background Temper modulation problems are both a hallmark of early childhood and a common mental health concern. Thus, characterizing specific behavioral manifestations of temper loss along a dimension from normative misbehaviors to clinically significant problems is an important step toward identifying clinical thresholds. Methods Parent-reported patterns of temper loss were delineated in a diverse community sample of preschoolers (n = 1,490). A developmentally sensitive questionnaire, the Multidimensional Assessment of Preschool Disruptive Behavior (MAP-DB), was used to assess temper loss in terms of tantrum features and anger regulation. Specific aims were: (a) document the normative distribution of temper loss in preschoolers from normative misbehaviors to clinically concerning temper loss behaviors, and test for sociodemographic differences; (b) use Item Response Theory (IRT) to model a Temper Loss dimension; and (c) examine associations of temper loss and concurrent emotional and behavioral problems. Results Across sociodemographic subgroups, a unidimensional Temper Loss model fit the data well. Nearly all (83.7%) preschoolers had tantrums sometimes but only 8.6% had daily tantrums. Normative misbehaviors occurred more frequently than clinically concerning temper loss behaviors. Milder behaviors tended to reflect frustration in expectable contexts, whereas clinically concerning problem indicators were unpredictable, prolonged, and/or destructive. In multivariate models, Temper Loss was associated with emotional and behavioral problems. Conclusions Parent reports on a developmentally informed questionnaire, administered to a large and diverse sample, distinguished normative and problematic manifestations of preschool temper loss. A developmental, dimensional approach shows promise for elucidating the boundaries between normative early childhood temper loss and emergent psychopathology. PMID:22928674

The PsB glycoprotein complex is secreted as a preassembled precursor of the spore coat in Dictyostelium discoideum.

PubMed

Watson, N; McGuire, V; Alexander, S

1994-09-01

The PsB glycoprotein in Dictyostelium discoideum is one of a diverse group of developmentally regulated, prespore-cell-specific proteins, that contain a common O-linked oligosaccharide. This post-translational modification is dependent on the wild-type modB allele. The PsB protein exists as part of a multiprotein complex of six different proteins, which have different post-translational modifications and are held together by both covalent and non-covalent interactions (Watson et al. (1993). J. Biol. Chem. 268, 22634-22641). In this study we have used microscopic and biochemical analyses to examine the cellular localization and function of the PsB complex during development. We found that the PsB complex first accumulates in prespore vesicles in slug cells and is secreted later during culmination and becomes localized to both the extracellular matrix of the apical spore mass of mature fruiting bodies and to the inner layer of the spore coat. The PsB associated with the spore coat is covalently bound by disulfide bridges. The PsB protein always exists in a multiprotein complex, but the composition of the PsB complex changes during secretion and spore maturation. Some of the PsB complex proteins have been identified as spore coat proteins. These data demonstrate that some of the proteins that form the spore coat exist as a preassembled precursor complex. The PsB complex is secreted in a developmentally regulated manner during the process of spore differentiation, at which time proteins of the complex, as well as additional spore coat proteins, become covalently associated in at least two forms of extracellular matrix: the interspore matrix and the spore coat. These and other studies show that proteins with modB dependent O-linked oligosaccharides are involved in a wide variety of processes underlying morphogenesis in this organism. These developmental processes are the direct result of cellular mechanisms regulating protein targeting, assembly and secretion, and the assembly of specific extracellular matrices.

A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation

PubMed Central

2011-01-01

Background Green plant leaves have always fascinated biologists as hosts for photosynthesis and providers of basic energy to many food webs. Today, comprehensive databases of gene expression data enable us to apply increasingly more advanced computational methods for reverse-engineering the regulatory network of leaves, and to begin to understand the gene interactions underlying complex emergent properties related to stress-response and development. These new systems biology methods are now also being applied to organisms such as Populus, a woody perennial tree, in order to understand the specific characteristics of these species. Results We present a systems biology model of the regulatory network of Populus leaves. The network is reverse-engineered from promoter information and expression profiles of leaf-specific genes measured over a large set of conditions related to stress and developmental. The network model incorporates interactions between regulators, such as synergistic and competitive relationships, by evaluating increasingly more complex regulatory mechanisms, and is therefore able to identify new regulators of leaf development not found by traditional genomics methods based on pair-wise expression similarity. The approach is shown to explain available gene function information and to provide robust prediction of expression levels in new data. We also use the predictive capability of the model to identify condition-specific regulation as well as conserved regulation between Populus and Arabidopsis. Conclusions We outline a computationally inferred model of the regulatory network of Populus leaves, and show how treating genes as interacting, rather than individual, entities identifies new regulators compared to traditional genomics analysis. Although systems biology models should be used with care considering the complexity of regulatory programs and the limitations of current genomics data, methods describing interactions can provide hypotheses about the underlying cause of emergent properties and are needed if we are to identify target genes other than those constituting the "low hanging fruit" of genomic analysis. PMID:21232107

Identification of novel drought-responsive microRNAs and trans-acting siRNAs from Sorghum bicolor (L.) Moench by high-throughput sequencing analysis

PubMed Central

Katiyar, Amit; Smita, Shuchi; Muthusamy, Senthilkumar K.; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

2015-01-01

Small non-coding RNAs (sRNAs) namely microRNAs (miRNAs) and trans-acting small interfering RNAs (tasi-RNAs) play a crucial role in post-transcriptional regulation of gene expression and thus the control plant development and stress responses. In order to identify drought-responsive miRNAs and tasi-RNAs in sorghum, we constructed small RNA libraries from a drought tolerant (M35-1) and susceptible (C43) sorghum genotypes grown under control and drought stress conditions, and sequenced by Illumina Genome Analyzer IIx. Ninety seven conserved and 526 novel miRNAs representing 472 unique miRNA families were identified from sorghum. Ninety-six unique miRNAs were found to be regulated by drought stress, of which 32 were up- and 49 were down-regulated (fold change ≥ 2 or ≤ −2) at least in one genotype, while the remaining 15 miRNAs showed contrasting drought-regulated expression pattern between genotypes. A maximum of 17 and 18 miRNAs was differentially regulated under drought stress condition in the sensitive and tolerant genotypes, respectively. These results suggest that genotype dependent stress responsive regulation of miRNAs may contribute, at least in part, to the differential drought tolerance of sorghum genotypes. We also identified two miR390-directed TAS3 gene homologs and the auxin response factors as tasi-RNA targets. We predicted more than 1300 unique target genes for the novel and conserved miRNAs. These target genes were predicted to be involved in different cellular, metabolic, response to stimulus, biological regulation, and developmental processes. Genome-wide identification of stress-responsive miRNAs, tasi-RNAs and their targets identified in this study will be useful in unraveling the molecular mechanisms underlying drought stress responses and genetic improvement of biomass production and stress tolerance in sorghum. PMID:26236318

Drosophila melanogaster as a model system for assessing development under conditions of microgravity

NASA Technical Reports Server (NTRS)

Abbott, M. K.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

1992-01-01

More is known about the regulation of early developmental events in Drosophila than any other animal. In addition, its size and short life cycle make it a facile experimental system. Since developmental perturbations have been demonstrated when both oogenesis and embryogenesis occur in the space environment, there is a strong rationale for using this organism for the elucidation of specific gravity-sensitive developmental events.

Infralimbic EphB2 Modulates Fear Extinction in Adolescent Rats

PubMed Central

Cruz, Emmanuel; Soler-Cedeño, Omar; Negrón, Geovanny; Criado-Marrero, Marangelie; Chompré, Gladys

2015-01-01

Adolescent rats are prone to impaired fear extinction, suggesting that mechanistic differences in extinction could exist in adolescent and adult rats. Since the infralimbic cortex (IL) is critical for fear extinction, we used PCR array technology to identify gene expression changes in IL induced by fear extinction in adolescent rats. Interestingly, the ephrin type B receptor 2 (EphB2), a tyrosine kinase receptor associated with synaptic development, was downregulated in IL after fear extinction. Consistent with the PCR array results, EphB2 levels of mRNA and protein were reduced in IL after fear extinction compared with fear conditioning, suggesting that EphB2 signaling in IL regulates fear extinction memory in adolescents. Finally, reducing EphB2 synthesis in IL with shRNA accelerated fear extinction learning in adolescent rats, but not in adult rats. These findings identify EphB2 in IL as a key regulator of fear extinction during adolescence, perhaps due to the increase in synaptic remodeling occurring during this developmental phase. PMID:26354908

Identification of Lmo1 as part of a Hox-dependent regulatory network for hindbrain patterning.

PubMed

Matis, Christelle; Oury, Franck; Remacle, Sophie; Lampe, Xavier; Gofflot, Françoise; Picard, Jacques J; Rijli, Filippo M; Rezsohazy, René

2007-09-01

The embryonic functions of Hox proteins have been extensively investigated in several animal phyla. These transcription factors act as selectors of developmental programmes, to govern the morphogenesis of multiple structures and organs. However, despite the variety of morphogenetic processes Hox proteins are involved in, only a limited set of their target genes has been identified so far. To find additional targets, we used a strategy based upon the simultaneous overexpression of Hoxa2 and its cofactors Pbx1 and Prep in a cellular model. Among genes whose expression was upregulated, we identified LMO1, which codes for an intertwining LIM-only factor involved in protein-DNA oligomeric complexes. By analysing its expression in Hox knockout mice, we show that Lmo1 is differentially regulated by Hoxa2 and Hoxb2, in specific columns of hindbrain neuronal progenitors. These results suggest that Lmo1 takes part in a Hox paralogue 2-dependent network regulating anteroposterior and dorsoventral hindbrain patterning. (c) 2007 Wiley-Liss, Inc.

Uncontrolled angiogenic precursor expansion causes coronary artery anomalies in mice lacking Pofut1.

PubMed

Wang, Yidong; Wu, Bingruo; Lu, Pengfei; Zhang, Donghong; Wu, Brian; Varshney, Shweta; Del Monte-Nieto, Gonzalo; Zhuang, Zhenwu; Charafeddine, Rabab; Kramer, Adam H; Sibinga, Nicolas E; Frangogiannis, Nikolaos G; Kitsis, Richard N; Adams, Ralf H; Alitalo, Kari; Sharp, David J; Harvey, Richard P; Stanley, Pamela; Zhou, Bin

2017-09-18

Coronary artery anomalies may cause life-threatening cardiac complications; however, developmental mechanisms underpinning coronary artery formation remain ill-defined. Here we identify an angiogenic cell population for coronary artery formation in mice. Regulated by a DLL4/NOTCH1/VEGFA/VEGFR2 signaling axis, these angiogenic cells generate mature coronary arteries. The NOTCH modulator POFUT1 critically regulates this signaling axis. POFUT1 inactivation disrupts signaling events and results in excessive angiogenic cell proliferation and plexus formation, leading to anomalous coronary arteries, myocardial infarction and heart failure. Simultaneous VEGFR2 inactivation fully rescues these defects. These findings show that dysregulated angiogenic precursors link coronary anomalies to ischemic heart disease.Though coronary arteries are crucial for heart function, the mechanisms guiding their formation are largely unknown. Here, Wang et al. identify a unique, endocardially-derived angiogenic precursor cell population for coronary artery formation in mice and show that a DLL4/NOTCH1/VEGFA/VEGFR2 signaling axis is key for coronary artery development.

Bombyx mori Transcription Factors: Genome-Wide Identification, Expression Profiles and Response to Pathogens by Microarray Analysis

PubMed Central

Huang, Lulin; Cheng, Tingcai; Xu, Pingzhen; Fang, Ting; Xia, Qingyou

2012-01-01

Transcription factors are present in all living organisms, and play vital roles in a wide range of biological processes. Studies of transcription factors will help reveal the complex regulation mechanism of organisms. So far, hundreds of domains have been identified that show transcription factor activity. Here, 281 reported transcription factor domains were used as seeds to search the transcription factors in genomes of Bombyx mori L. (Lepidoptera: Bombycidae) and four other model insects. Overall, 666 transcription factors including 36 basal factors and 630 other factors were identified in B. mori genome, which accounted for 4.56% of its genome. The silkworm transcription factors' expression profiles were investigated in relation to multiple tissues, developmental stages, sexual dimorphism, and responses to oral infection by pathogens and direct bacterial injection. These all provided rich clues for revealing the transcriptional regulation mechanism of silkworm organ differentiation, growth and development, sexual dimorphism, and response to pathogen infection. PMID:22943524

48 CFR 1852.223-71 - Frequency authorization.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Frequency authorization... obtained by the Contractor or subcontractor in need thereof. (b) For any experimental, developmental, or... device to the Contracting Officer during the initial planning, experimental, or developmental phase of...

45 CFR 1386.102 - Rights of parties.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Rights of parties. 1386.102 Section 1386.102 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

Integrated mRNA and microRNA transcriptome analyses reveal regulation of thermal acclimation in Gymnocypris przewalskii: A case study in Tibetan Schizothoracine fish

PubMed Central

Tian, Fei; Zhao, Kai

2017-01-01

Environmental acclimation is important episode in wildlife occupation of the high-altitude Tibetan Plateau (TP). Transcriptome-wide studies on thermal acclimation mechanism in fish species are rarely revealed in Tibetan Plateau fish at high altitude. Thus, we used mRNA and miRNA transcriptome sequencing to investigate regulation of thermal acclimation in larval Tibetan naked carp, Gymnocypris przewalskii. We first remodeled the regulation network of mRNA and miRNA in thermal acclimation, and then identified differential expression of miRNAs and target mRNAs enriched in metabolic and digestive pathways. Interestingly, we identified two candidate genes contributed to normal skeletal development. The altered expression of these gene groups could potentially be associated with the developmental issues of deformity and induced larval death. Our results have three important implications: first, these findings provide strong evidences to support our hypothesis that G. przewalskii possess ability to build heat-tolerance against the controversial issue. Second, this study shows that transcriptional and post-transcriptional regulations are extensively involved in thermal acclimation. Third, the integrated mRNA and microRNA transcriptome analyses provide a large number of valuable genetic resources for future studies on environmental stress response in G. przewalskii and as a case study in Tibetan Schizothoracine fish. PMID:29045433

Epigenome profiling and editing of neocortical progenitor cells during development.

PubMed

Albert, Mareike; Kalebic, Nereo; Florio, Marta; Lakshmanaperumal, Naharajan; Haffner, Christiane; Brandl, Holger; Henry, Ian; Huttner, Wieland B

2017-09-01

The generation of neocortical neurons from neural progenitor cells (NPCs) is primarily controlled by transcription factors binding to DNA in the context of chromatin. To understand the complex layer of regulation that orchestrates different NPC types from the same DNA sequence, epigenome maps with cell type resolution are required. Here, we present genomewide histone methylation maps for distinct neural cell populations in the developing mouse neocortex. Using different chromatin features, we identify potential novel regulators of cortical NPCs. Moreover, we identify extensive H3K27me3 changes between NPC subtypes coinciding with major developmental and cell biological transitions. Interestingly, we detect dynamic H3K27me3 changes on promoters of several crucial transcription factors, including the basal progenitor regulator Eomes We use catalytically inactive Cas9 fused with the histone methyltransferase Ezh2 to edit H3K27me3 at the Eomes locus in vivo , which results in reduced Tbr2 expression and lower basal progenitor abundance, underscoring the relevance of dynamic H3K27me3 changes during neocortex development. Taken together, we provide a rich resource of neocortical histone methylation data and outline an approach to investigate its contribution to the regulation of selected genes during neocortical development. © 2017 The Authors.

Detection of genes regulated by Lmx1b during limb dorsalization.

PubMed

Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

2012-05-01

Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

Parallelism and Epistasis in Skeletal Evolution Identified through Use of Phylogenomic Mapping Strategies.

PubMed

Daane, Jacob M; Rohner, Nicolas; Konstantinidis, Peter; Djuranovic, Sergej; Harris, Matthew P

2016-01-01

The identification of genetic mechanisms underlying evolutionary change is critical to our understanding of natural diversity, but is presently limited by the lack of genetic and genomic resources for most species. Here, we present a new comparative genomic approach that can be applied to a broad taxonomic sampling of nonmodel species to investigate the genetic basis of evolutionary change. Using our analysis pipeline, we show that duplication and divergence of fgfr1a is correlated with the reduction of scales within fishes of the genus Phoxinellus. As a parallel genetic mechanism is observed in scale-reduction within independent lineages of cypriniforms, our finding exposes significant developmental constraint guiding morphological evolution. In addition, we identified fixed variation in fgf20a within Phoxinellus and demonstrated that combinatorial loss-of-function of fgfr1a and fgf20a within zebrafish phenocopies the evolved scalation pattern. Together, these findings reveal epistatic interactions between fgfr1a and fgf20a as a developmental mechanism regulating skeletal variation among fishes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

PubMed

Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

2015-01-01

Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

Werner's Relevance for Contemporary Developmental Psychology.

ERIC Educational Resources Information Center

Glick, Joseph A.

1992-01-01

Considers the contributions of Heinz Werner to developmental psychology and identifies the tensions between Werner's theory and the practices of contemporary developmental psychology. Core issues of Werner's psychology concern: (1) development as heuristic, rather than phenomenon; (2) developmental process analysis; and (3) conceptions of the…

The genome and transcriptome of the enteric parasite Entamoeba invadens, a model for encystation

PubMed Central

2013-01-01

Background Several eukaryotic parasites form cysts that transmit infection. The process is found in diverse organisms such as Toxoplasma, Giardia, and nematodes. In Entamoeba histolytica this process cannot be induced in vitro, making it difficult to study. In Entamoeba invadens, stage conversion can be induced, but its utility as a model system to study developmental biology has been limited by a lack of genomic resources. We carried out genome and transcriptome sequencing of E. invadens to identify molecular processes involved in stage conversion. Results We report the sequencing and assembly of the E. invadens genome and use whole transcriptome sequencing to characterize changes in gene expression during encystation and excystation. The E. invadens genome is larger than that of E. histolytica, apparently largely due to expansion of intergenic regions; overall gene number and the machinery for gene regulation are conserved between the species. Over half the genes are regulated during the switch between morphological forms and a key signaling molecule, phospholipase D, appears to regulate encystation. We provide evidence for the occurrence of meiosis during encystation, suggesting that stage conversion may play a key role in recombination between strains. Conclusions Our analysis demonstrates that a number of core processes are common to encystation between distantly related parasites, including meiosis, lipid signaling and RNA modification. These data provide a foundation for understanding the developmental cascade in the important human pathogen E. histolytica and highlight conserved processes more widely relevant in enteric pathogens. PMID:23889909

Quantitative analysis of oyster larval proteome provides new insights into the effects of multiple climate change stressors.

PubMed

Dineshram, Ramadoss; Chandramouli, Kondethimmanahalli; Ko, Ginger Wai Kuen; Zhang, Huoming; Qian, Pei-Yuan; Ravasi, Timothy; Thiyagarajan, Vengatesen

2016-06-01

The metamorphosis of planktonic larvae of the Pacific oyster (Crassostrea gigas) underpins their complex life-history strategy by switching on the molecular machinery required for sessile life and building calcite shells. Metamorphosis becomes a survival bottleneck, which will be pressured by different anthropogenically induced climate change-related variables. Therefore, it is important to understand how metamorphosing larvae interact with emerging climate change stressors. To predict how larvae might be affected in a future ocean, we examined changes in the proteome of metamorphosing larvae under multiple stressors: decreased pH (pH 7.4), increased temperature (30 °C), and reduced salinity (15 psu). Quantitative protein expression profiling using iTRAQ-LC-MS/MS identified more than 1300 proteins. Decreased pH had a negative effect on metamorphosis by down-regulating several proteins involved in energy production, metabolism, and protein synthesis. However, warming switched on these down-regulated pathways at pH 7.4. Under multiple stressors, cell signaling, energy production, growth, and developmental pathways were up-regulated, although metamorphosis was still reduced. Despite the lack of lethal effects, significant physiological responses to both individual and interacting climate change related stressors were observed at proteome level. The metamorphosing larvae of the C. gigas population in the Yellow Sea appear to have adequate phenotypic plasticity at the proteome level to survive in future coastal oceans, but with developmental and physiological costs. © 2016 John Wiley & Sons Ltd.

MicroRNA biogenesis pathway from the salmon louse (Caligus rogercresseyi): emerging role in delousing drug response.

PubMed

Valenzuela-Miranda, Diego; Nuñez-Acuña, Gustavo; Valenzuela-Muñoz, Valentina; Asgari, Sassan; Gallardo-Escárate, Cristian

2015-01-25

Despite the increasing evidence of the importance of microRNAs (miRNAs) in the regulation of multiple biological processes, the molecular bases supporting this regulation are still barely understood in crustaceans. Therefore, the molecular characterization and transcriptome modulation of the miRNA biogenesis pathway were evaluated in the salmon louse Caligus rogercresseyi, an ectoparasite that constitutes one of the biggest concerns for salmonid aquaculture industry. Hence, RNA-Seq analysis was conducted from six different developmental stages, and also after bioassays with delousing drugs Deltamethrin and Azamethiphos using adult individuals. In silico analysis evidenced 24 putative genes involved in the miRNA pathway such as biogenesis, transport, maturation and miRNA-target interaction. Moreover, 243 putative single nucleotide polymorphisms (SNPs) were identified, 15 of which showed non-synonym mutations. RNA-Seq analysis revealed that CCR4-Not complex subunit 3 (CNOT3) was upregulated at earlier developmental stages (nauplius I-II and copepodid), and also after the exposure to Azamethiphos, but not to Deltamethrin. In contrast, the subunit 7 (CNOT7) showed an inverse expression pattern. Different Argonaute transcripts were associated to chalimus and adult stages, revealing specific expression patterns in response to antiparasitic drugs. Our results suggest novel insights into the regulatory network of the post-transcriptional gene regulation in C. rogercresseyi mediated by miRNAs, evidencing a putative role during the ontogeny and drug response. Copyright © 2014 Elsevier B.V. All rights reserved.

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism

DOE PAGES

Li, Ruixi; Sun, Ruobai; Hicks, Glenn R.; ...

2014-12-22

The vacuole is the most prominent compartment in plant cells and is important for ion and protein storage. In our effort to search for key regulators in the plant vacuole sorting pathway, ribosomal large subunit 4 (rpl4d) was identified as a translational mutant defective in both vacuole trafficking and normal development. Polysome profiling of the rpl4d mutant showed reduction in polysome-bound mRNA compared with wild-type, but no significant change in the general mRNA distribution pattern. Ribsomal profiling data indicated that genes in the lipid metabolism pathways were translationally down-regulated in the rpl4d mutant. Live imaging studies by Nile red stainingmore » suggested that both polar and nonpolar lipid accumulation was reduced in meristem tissues of rpl4d mutants. Pharmacological evidence showed that sterol and sphingolipid biosynthetic inhibitors can phenocopy the defects of the rpl4d mutant, including an altered vacuole trafficking pattern. Genetic evidence from lipid biosynthetic mutants indicates that alteration in the metabolism of either sterol or sphingolipid biosynthesis resulted in vacuole trafficking defects, similar to the rpl4d mutant. Tissue-specific complementation with key enzymes from lipid biosynthesis pathways can partially rescue both vacuole trafficking and auxin-related developmental defects in the rpl4d mutant. These results indicate that lipid metabolism modulates auxin-mediated tissue differentiation and endomembrane trafficking pathways downstream of ribosomal protein function.« less

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

PubMed Central

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

2018-01-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

PubMed

Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

2017-10-01

Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

The Intersection of Emotional and Sociocognitive Competencies with Civic Engagement in Middle Childhood and Adolescence.

PubMed

Metzger, Aaron; Alvis, Lauren M; Oosterhoff, Benjamin; Babskie, Elizabeth; Syvertsen, Amy; Wray-Lake, Laura

2018-03-23

Civic developmental theory anticipates connections between normative developmental competencies and civic engagement, but little previous research has directly studied such links. The current study sought to contribute to civic development theory by examining associations between emotional and sociocognitive competencies (empathy, emotion regulation, prosocial moral reasoning, future-orientation) and civic engagement (volunteering, informal helping, political behaviors and beliefs, environmental behaviors, social responsibility values, civic skills). Data came from a geographically and racially diverse sample of 2467 youth (M age  = 13.4, Range: 8-20 years, 56% female). The results indicated that empathy and future-orientation significantly predicted nearly all forms of civic engagement, whereas emotion regulation and prosocial moral reasoning were uniquely associated with specific forms of civic engagement. Exploratory multi-group models indicated that empathy and emotion regulation were more strongly associated with civic engagement among younger youth and prosocial moral reasoning and future-orientation were more strongly related to civic engagement among older youth. The findings help to advance developmental theory of youth civic engagement.

Callose homeostasis at plasmodesmata: molecular regulators and developmental relevance

PubMed Central

De Storme, Nico; Geelen, Danny

2014-01-01

Plasmodesmata are membrane-lined channels that are located in the plant cell wall and that physically interconnect the cytoplasm and the endoplasmic reticulum (ER) of adjacent cells. Operating as controllable gates, plasmodesmata regulate the symplastic trafficking of micro- and macromolecules, such as endogenous proteins [transcription factors (TFs)] and RNA-based signals (mRNA, siRNA, etc.), hence mediating direct cell-to-cell communication and long distance signaling. Besides this physiological role, plasmodesmata also form gateways through which viral genomes can pass, largely facilitating the pernicious spread of viral infections. Plasmodesmatal trafficking is either passive (e.g., diffusion) or active and responses both to developmental and environmental stimuli. In general, plasmodesmatal conductivity is regulated by the controlled build-up of callose at the plasmodesmatal neck, largely mediated by the antagonistic action of callose synthases (CalSs) and β-1,3-glucanases. Here, in this theory and hypothesis paper, we outline the importance of callose metabolism in PD SEL control, and highlight the main molecular factors involved. In addition, we also review other proteins that regulate symplastic PD transport, both in a developmental and stress-responsive framework, and discuss on their putative role in the modulation of PD callose turn-over. Finally, we hypothesize on the role of structural sterols in the regulation of (PD) callose deposition and outline putative mechanisms by which this regulation may occur. PMID:24795733

Etsrp/etv2 is directly regulated by foxc1a/b in the zebrafish angioblast

PubMed Central

Veldman, Matthew B.; Lin, Shuo

2012-01-01

Rationale Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. Objective We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. Methods and Results To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all three regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative RT-PCR and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed while pronephric gene pax2a was relatively normal in expression level and pattern. Conclusions These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast. PMID:22135404

Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

PubMed

Veldman, Matthew B; Lin, Shuo

2012-01-20

Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

A transcriptional switch underlies commitment to sexual development in malaria parasites.

PubMed

Kafsack, Björn F C; Rovira-Graells, Núria; Clark, Taane G; Bancells, Cristina; Crowley, Valerie M; Campino, Susana G; Williams, April E; Drought, Laura G; Kwiatkowski, Dominic P; Baker, David A; Cortés, Alfred; Llinás, Manuel

2014-03-13

The life cycles of many parasites involve transitions between disparate host species, requiring these parasites to go through multiple developmental stages adapted to each of these specialized niches. Transmission of malaria parasites (Plasmodium spp.) from humans to the mosquito vector requires differentiation from asexual stages replicating within red blood cells into non-dividing male and female gametocytes. Although gametocytes were first described in 1880, our understanding of the molecular mechanisms involved in commitment to gametocyte formation is extremely limited, and disrupting this critical developmental transition remains a long-standing goal. Here we show that expression levels of the DNA-binding protein PfAP2-G correlate strongly with levels of gametocyte formation. Using independent forward and reverse genetics approaches, we demonstrate that PfAP2-G function is essential for parasite sexual differentiation. By combining genome-wide PfAP2-G cognate motif occurrence with global transcriptional changes resulting from PfAP2-G ablation, we identify early gametocyte genes as probable targets of PfAP2-G and show that their regulation by PfAP2-G is critical for their wild-type level expression. In the asexual blood-stage parasites pfap2-g appears to be among a set of epigenetically silenced loci prone to spontaneous activation. Stochastic activation presents a simple mechanism for a low baseline of gametocyte production. Overall, these findings identify PfAP2-G as a master regulator of sexual-stage development in malaria parasites and mark the first discovery of a transcriptional switch controlling a differentiation decision in protozoan parasites.

Mining meiosis and gametogenesis with DNA microarrays.

PubMed

Schlecht, Ulrich; Primig, Michael

2003-04-01

Gametogenesis is a key developmental process that involves complex transcriptional regulation of numerous genes including many that are conserved between unicellular eukaryotes and mammals. Recent expression-profiling experiments using microarrays have provided insight into the co-ordinated transcription of several hundred genes during mitotic growth and meiotic development in budding and fission yeast. Furthermore, microarray-based studies have identified numerous loci that are regulated during the cell cycle or expressed in a germ-cell specific manner in eukaryotic model systems like Caenorhabditis elegans, Mus musculus as well as Homo sapiens. The unprecedented amount of information produced by post-genome biology has spawned novel approaches to organizing biological knowledge using currently available information technology. This review outlines experiments that contribute to an emerging comprehensive picture of the molecular machinery governing sexual reproduction in eukaryotes.

Gibberellin control of stamen development: a fertile field.

PubMed

Plackett, Andrew R G; Thomas, Stephen G; Wilson, Zoe A; Hedden, Peter

2011-10-01

Stamen development is governed by a conserved genetic pathway, within which the role of hormones has been the subject of considerable recent research. Our understanding of the involvement of gibberellin (GA) signalling in this developmental process is further advanced than for the other phytohormones, and here we review recent experimental results in rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana) that have provided insight into the timing and mechanisms of GA regulation of stamen development, identifying the tapetum and developing pollen as major targets. GA signalling governs both tapetum secretory functions and entry into programmed cell death via the GAMYB class of transcription factor, the targets of which integrate with the established genetic framework for the regulation of tapetum function at multiple hierarchical levels. Copyright © 2011 Elsevier Ltd. All rights reserved.

Major epigenetic development distinguishing neuronal and non-neuronal cells occurs postnatally in the murine hypothalamus

USDA-ARS?s Scientific Manuscript database

Prenatal and early postnatal environment can persistently alter one's risk of obesity. Environmental effects on hypothalamic developmental epigenetics constitute a likely mechanism underlying such 'developmental programming' of energy balance regulation. To advance our understanding of these process...

Developmental Social Cognitive Neuroscience: Insights from Deafness

ERIC Educational Resources Information Center

Corina, David; Singleton, Jenny

2009-01-01

The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

29 CFR 1952.221 - Developmental schedule.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...

DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

PubMed Central

Hua, Brian L.; Orr-Weaver, Terry L.

2017-01-01

Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

Molecular dissection of prethymic progenitor entry into the T lymphocyte developmental pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fung, Elizabeth-sharon

2008-01-01

Notch signaling activates T lineage differentiation from hemopoietic progenitors, but relatively few regulators that initiate this program have been identified, e.g., GATA3 and T cell factor-I (TCF-1) (gene name Tcli). To identify additional regulators of T cell specification, a cDNA libnlrY from mouse Pro-T cells was screened for genes that are specifically up-regulated in intrathymic T cell precursors as compared with myeloid progenitors. Over 90 genes of interest were identified, and 35 of 44 tested were confirmed to be more highly expressed in T lineage precursors relative to precursors of B and/or myeloid lineage. To a remarkable extent, however, expressionmore » of these T lineage-enriched genes, including zinc finger transcription factor, helicase, and signaling adaptor genes, was also shared by stem cells (Lin{sup -}Sca-1{sup +}Kit{sup +}CD27{sup -}) and multipotent progenitors (Lin{sup -}Sca-l{sup +}Kit{sup +}CD27{sup +}), although down-regulated in other lineages. Thus, a major fraction of these early T lineage genes are a regulatory legacy from stem cells. The few genes sharply up-regulated between multipotent progenitors and Pro-T cell stages included those encoding transcription factors Bclllb, TCF-I (Tcli), and HEBalt, Notch target Deltexl, Deltex3L, Fkbp5, Eval, and Tmem13l. Like GATA3 and Deltexl, Bclllb, Fkbp5, and Eval were dependent on Notch/Delta signaling for induction in fetal liver precursors, but only BcIlI band HEBalt were up-regulated between the first two stages of intrathymic T cell development (double negative I and double negative 2) corresponding to T lineage specification. Bclllb was uniquely T lineage restricted and induced by NotchlDelta signaling specifically upon entry into the T lineage differentiation pathway.« less

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

PubMed Central

Kleinjan, Dirk A.; van Heyningen, Veronica

2005-01-01

Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

A C-terminally truncated form of β-catenin acts as a novel regulator of Wnt/β-catenin signaling in planarians

PubMed Central

Rabaneda-Lombarte, Neus; Gelabert, Maria; Xie, Jianlei; Wu, Wei

2017-01-01

β-Catenin, the core element of the Wnt/β-catenin pathway, is a multifunctional and evolutionarily conserved protein which performs essential roles in a variety of developmental and homeostatic processes. Despite its crucial roles, the mechanisms that control its context-specific functions in time and space remain largely unknown. The Wnt/β-catenin pathway has been extensively studied in planarians, flatworms with the ability to regenerate and remodel the whole body, providing a ‘whole animal’ developmental framework to approach this question. Here we identify a C-terminally truncated β-catenin (β-catenin4), generated by gene duplication, that is required for planarian photoreceptor cell specification. Our results indicate that the role of β-catenin4 is to modulate the activity of β-catenin1, the planarian β-catenin involved in Wnt signal transduction in the nucleus, mediated by the transcription factor TCF-2. This inhibitory form of β-catenin, expressed in specific cell types, would provide a novel mechanism to modulate nuclear β-catenin signaling levels. Genomic searches and in vitro analysis suggest that the existence of a C-terminally truncated form of β-catenin could be an evolutionarily conserved mechanism to achieve a fine-tuned regulation of Wnt/β-catenin signaling in specific cellular contexts. PMID:28976975

An analysis of candidates for addition to the Clean Air Act list of hazardous air pollutants.

PubMed

Lunder, Sonya; Woodruff, Tracey J; Axelrad, Daniel A

2004-02-01

There are 188 air toxics listed as hazardous air pollutants (HAPs) in the Clean Air Act (CAA), based on their potential to adversely impact public health. This paper presents several analyses performed to screen potential candidates for addition to the HAPs list. We analyzed 1086 HAPs and potential HAPs, including chemicals regulated by the state of California or with emissions reported to the Toxics Release Inventory (TRI). HAPs and potential HAPs were ranked by their emissions to air, and by toxicity-weighted (tox-wtd) emissions for cancer and noncancer, using emissions information from the TRI and toxicity information from state and federal agencies. Separate consideration was given for persistent, bioaccumulative toxins (PBTs), reproductive or developmental toxins, and chemicals under evaluation for regulation as toxic air contaminants in California. Forty-four pollutants were identified as candidate HAPs based on three ranking analyses and whether they were a PBT or a reproductive or developmental toxin. Of these, nine qualified in two or three different rankings (ammonia [NH3], copper [Cu], Cu compounds, nitric acid [HNO3], N-methyl-2-pyrrolidone, sulfuric acid [H2SO4], vanadium [V] compounds, zinc [Zn], and Zn compounds). This analysis suggests further evaluation of several pollutants for possible addition to the CAA list of HAPs.

A C-terminally truncated form of β-catenin acts as a novel regulator of Wnt/β-catenin signaling in planarians.

PubMed

Su, Hanxia; Sureda-Gomez, Miquel; Rabaneda-Lombarte, Neus; Gelabert, Maria; Xie, Jianlei; Wu, Wei; Adell, Teresa

2017-10-01

β-Catenin, the core element of the Wnt/β-catenin pathway, is a multifunctional and evolutionarily conserved protein which performs essential roles in a variety of developmental and homeostatic processes. Despite its crucial roles, the mechanisms that control its context-specific functions in time and space remain largely unknown. The Wnt/β-catenin pathway has been extensively studied in planarians, flatworms with the ability to regenerate and remodel the whole body, providing a 'whole animal' developmental framework to approach this question. Here we identify a C-terminally truncated β-catenin (β-catenin4), generated by gene duplication, that is required for planarian photoreceptor cell specification. Our results indicate that the role of β-catenin4 is to modulate the activity of β-catenin1, the planarian β-catenin involved in Wnt signal transduction in the nucleus, mediated by the transcription factor TCF-2. This inhibitory form of β-catenin, expressed in specific cell types, would provide a novel mechanism to modulate nuclear β-catenin signaling levels. Genomic searches and in vitro analysis suggest that the existence of a C-terminally truncated form of β-catenin could be an evolutionarily conserved mechanism to achieve a fine-tuned regulation of Wnt/β-catenin signaling in specific cellular contexts.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

PubMed

Traeger, Stefanie; Nowrousian, Minou

2015-04-14

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora

PubMed Central

Traeger, Stefanie; Nowrousian, Minou

2015-01-01

During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638

The Two Faces of Temptation: Differing Motives for Self-Control

ERIC Educational Resources Information Center

Jensen-Campbell, Lauri A.; Graziano, William G.

2005-01-01

Self-regulation is critical to social and personality development in all cultures. Self-regulation may have developmental origins in temperament, yet it also interacts with socialization processes. This research specifically probes children's self-regulation during resistance to temptation. Socialization of self-regulation may be influenced by the…

Developmentally defined forebrain circuits regulate appetitive and aversive olfactory learning.

PubMed

Muthusamy, Nagendran; Zhang, Xuying; Johnson, Caroline A; Yadav, Prem N; Ghashghaei, H Troy

2017-01-01

Postnatal and adult neurogenesis are region- and modality-specific, but the significance of developmentally distinct neuronal populations remains unclear. We demonstrate that chemogenetic inactivation of a subset of forebrain and olfactory neurons generated at birth disrupts responses to an aversive odor. In contrast, novel appetitive odor learning is sensitive to inactivation of adult-born neurons, revealing that developmentally defined sets of neurons may differentially participate in hedonic aspects of sensory learning.

Calcium-binding proteins and development

NASA Technical Reports Server (NTRS)

Beckingham, K.; Lu, A. Q.; Andruss, B. F.; McIntire, L. V. (Principal Investigator)

1998-01-01

The known roles for calcium-binding proteins in developmental signaling pathways are reviewed. Current information on the calcium-binding characteristics of three classes of cell-surface developmental signaling proteins (EGF-domain proteins, cadherins and integrins) is presented together with an overview of the intracellular pathways downstream of these surface receptors. The developmental roles delineated to date for the universal intracellular calcium sensor, calmodulin, and its targets, and for calcium-binding regulators of the cytoskeleton are also reviewed.

Transcriptome analysis reveals the complexity of alternative splicing regulation in the fungus Verticillium dahliae.

PubMed

Jin, Lirong; Li, Guanglin; Yu, Dazhao; Huang, Wei; Cheng, Chao; Liao, Shengjie; Wu, Qijia; Zhang, Yi

2017-02-06

Alternative splicing (AS) regulation is extensive and shapes the functional complexity of higher organisms. However, the contribution of alternative splicing to fungal biology is not well studied. This study provides sequences of the transcriptomes of the plant wilt pathogen Verticillium dahliae, using two different strains and multiple methods for cDNA library preparations. We identified alternatively spliced mRNA isoforms in over a half of the multi-exonic fungal genes. Over one-thousand isoforms involve TopHat novel splice junction; multiple types of combinatory alternative splicing patterns were identified. We showed that one Verticillium gene could use four different 5' splice sites and two different 3' donor sites to produce up to five mature mRNAs, representing one of the most sophisticated alternative splicing model in eukaryotes other than animals. Hundreds of novel intron types involving a pair of new splice sites were identified in the V. dahliae genome. All the types of AS events were validated by using RT-PCR. Functional enrichment analysis showed that AS genes are involved in most known biological functions and enriched in ATP biosynthesis, sexual/asexual reproduction, morphogenesis, signal transduction etc., predicting that the AS regulation modulates mRNA isoform output and shapes the V. dahliae proteome plasticity of the pathogen in response to the environmental and developmental changes. These findings demonstrate the comprehensive alternative splicing mechanisms in a fungal plant pathogen, which argues the importance of this fungus in developing complicate genome regulation strategies in eukaryotes.

Ambient temperature regulates the expression of a small set of sRNAs influencing plant development through NF-YA2 and YUC2.

PubMed

Gyula, Péter; Baksa, Ivett; Tóth, Tamás; Mohorianu, Irina; Dalmay, Tamás; Szittya, György

2018-06-01

Plants substantially alter their developmental program upon changes in the ambient temperature. The 21-24 nt small RNAs (sRNAs) are important gene expression regulators, which play a major role in development and adaptation. However, little is known about how the different sRNA classes respond to changes in the ambient temperature. We profiled the sRNA populations in four different tissues of Arabidopsis thaliana plants grown at 15, 21 and 27 °C. We found that only a small fraction (0.6%) of the sRNA loci are ambient temperature-controlled. We identified thermoresponsive miRNAs and identified their target genes using degradome libraries. We verified that the target of the thermoregulated miR169, NF-YA2, is also ambient temperature-regulated. NF-YA2, as the component of the conserved transcriptional regulator NF-Y complex, binds the promoter of the flowering time regulator FT and the auxin biosynthesis gene YUC2. Other differentially expressed loci include thermoresponsive phased siRNA loci that target various auxin pathway genes and tRNA fragments. Furthermore, a temperature dependent 24-nt heterochromatic siRNA locus in the promoter of YUC2 may contribute to the epigenetic regulation of auxin homeostasis. This holistic approach facilitated a better understanding of the role of different sRNA classes in ambient temperature adaptation of plants. This article is protected by copyright. All rights reserved.

Longitudinal Relations between Beliefs Supporting Aggression,Anger Regulation, and Dating Aggression among Early Adolescents.

PubMed

Sullivan, Terri N; Garthe, Rachel C; Goncy, Elizabeth A; Carlson, Megan M; Behrhorst, Kathryn L

2017-05-01

Dating aggression occurs frequently in early to mid-adolescence and has negative repercussions for psychosocial adjustment and physical health. The patterns of behavior learned during this developmental timeframe may persist in future dating relationships, underscoring the need to identify risk factors for this outcome. The current study examined longitudinal relations between beliefs supporting aggression, anger regulation, and dating aggression. Participants were 176 middle school students in sixth, seventh, and eighth grade (50 % female; 82 % African American). No direct effects were found between beliefs supporting reactive or proactive aggression and dating aggression. Beliefs supporting reactive aggression predicted increased rates of anger dysregulation, and beliefs supporting proactive aggression led to subsequent increases in anger inhibition. Anger dysregulation and inhibition were associated with higher frequencies of dating aggression. An indirect effect was found for the relation between beliefs supporting reactive aggression and dating aggression via anger dysregulation. Another indirect effect emerged for the relation between beliefs supporting proactive aggression and dating aggression through anger inhibition. The study's findings suggested that beliefs supporting proactive and reactive aggression were differentially related to emotion regulation processes, and identified anger dysregulation and inhibition as risk factors for dating aggression among adolescents.

The Mediator Complex Subunit PFT1 Is a Key Regulator of Jasmonate-Dependent Defense in Arabidopsis[C][W

PubMed Central

Kidd, Brendan N.; Edgar, Cameron I.; Kumar, Krish K.; Aitken, Elizabeth A.; Schenk, Peer M.; Manners, John M.; Kazan, Kemal

2009-01-01

Jasmonate signaling plays an important role in both plant defense and development. Here, we have identified a subunit of the Mediator complex as a regulator of the jasmonate signaling pathway in Arabidopsis thaliana. The Mediator complex is a conserved multiprotein complex that acts as a universal adaptor between transcription factors and the RNA polymerase II transcriptional machinery. We report that the PHYTOCHROME AND FLOWERING TIME1 (PFT1) gene, which encodes the MEDIATOR25 subunit of Mediator, is required for jasmonate-dependent defense gene expression and resistance to leaf-infecting necrotrophic fungal pathogens. Conversely, PFT1 appears to confer susceptibility to Fusarium oxysporum, a root-infecting hemibiotrophic fungal pathogen known to hijack jasmonate responses for disease development. Consistent with this, jasmonate gene expression was suppressed in the pft1 mutant during infection with F. oxysporum. In addition, a wheat (Triticum aestivum) homolog of PFT1 complemented the defense and the developmental phenotypes of the pft1 mutant, suggesting that the jasmonate signaling functions of PFT1 may be conserved in higher plants. Overall, our results identify an important control point in the regulation of the jasmonate signaling pathway within the transcriptional machinery. PMID:19671879

Developmental Rainbow: Early Childhood Development Profile.

ERIC Educational Resources Information Center

Mahoney, Gerald; Mahoney, Frida

One of the most important skills of professionals who work with young children is the ability to assess developmental functioning through informal observation. This skill serves as the foundation for screening or identifying children in need of developmental services, conducting play-based developmental assessments, and helping parents to…

Do Hassles and Uplifts Change with Age? Longitudinal Findings from the VA Normative Aging Study

PubMed Central

Aldwin, Carolyn M.; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

2014-01-01

To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed three scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Growth based modelling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative non-linear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. PMID:24660796

Do hassles and uplifts change with age? Longitudinal findings from the VA normative aging study.

PubMed

Aldwin, Carolyn M; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

2014-03-01

To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed 3 scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Group-based modeling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative nonlinear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. (c) 2014 APA, all rights reserved.

Environmental Toxicants and Developmental Disabilities: A Challenge for Psychologists

ERIC Educational Resources Information Center

Koger, Susan M.; Schettler, Ted; Weiss, Bernard

2005-01-01

Developmental, learning, and behavioral disabilities are a significant public health problem. Environmental chemicals can interfere with brain development during critical periods, thereby impacting sensory, motor, and cognitive function. Because regulation in the United States is based on limited testing protocols and essentially requires proof of…

Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

USDA-ARS?s Scientific Manuscript database

A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

PubMed

Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

2016-06-30

Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage product accumulation (10-16 DAF). The results highlight versatile cellular metabolic activity in the transition phase and strong convergence towards storage product accumulation in the storage phase. Notably, both phases are characterized by particular protective mechanism, such as scavenging of oxidative stress and defence against pathogens, during the transition and the storage phase, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

Developmental palaeobiology of trilobite eyes and its evolutionary significance

NASA Astrophysics Data System (ADS)

Thomas, A. T.

2005-06-01

Understanding of the calcified composite eyes of trilobites, the oldest preserved visual system, has advanced greatly in recent decades. Three types of trilobite eye occur, the more derived abathochroal and schizochroal types having evolved neotenically from holochroal eyes. Comparative morphology and phylogenetic considerations suggest that all three eye-types were underlain by common developmental systems. So far, understanding of these systems has been based entirely on morphological data from fossils, particularly the way the visual surface grew and the patterning of lens emplacement. Lenses characteristically form a hexagonal array comprising horizontal rows and, conspicuously in schizochroal eyes, dorso-ventral files. Because individual trilobites sometimes have eyes with different numbers of files, file number must reflect the operation of a developmental programme rather than being under immediate genetic control. An empirical developmental model has been devised to describe trilobite eye development, with separate rules dealing with the initiation of lens emplacement, growth and differentiation of the visual surface, and the termination of lens emplacement. Rarely, trilobites may have visual surfaces of normal size, but which lack lenses. This confirms that visual surface growth must have been regulated separately from lens emplacement, and is a feature that cannot be accounted for by the existing developmental model. Such a developmental separation is one of a number of similarities shared with Drosophila, the modern arthropod in which eye development is best understood. Many aspects of eye development are conserved in the Euarthropoda, and in bilaterian metazoans in general. A revised model for trilobite eye development is proposed using extant phylogenetic bracketing, interpreting morphological data from the fossils in the context of the hierarchy of developmental controls now becoming known from living animals. This new model suggests that overall eye shape and size did not require differential growth of the generative zone, as previously thought, and that no separate instruction was needed to specify the termination of lens emplacement. Instead, these features were regulated directly, by controlling the proliferation of cells making up the nascent visual surface. A process documented from Drosophila, which involves the selective inhibition of cells in front of a wave-like front of differentiation, and that is regulated by widely conserved genes, can be used to explain how the trilobite visual surface became differentiated. The model implies also that changes in hormonally regulated developmental pathways known from recent arthropods may have been responsible for the development of abathochroal and schizochroal eyes, and for heterochronic secondary eye reduction and blindness in trilobites.

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

Developmental Assets and the Middle School Counselor

ERIC Educational Resources Information Center

Scales, Peter C.

2005-01-01

Search Institute has identified 40 Developmental Assets[TM] that are building blocks of healthy development and success for children and adolescents. Young people's experience of most of these developmental assets declines over the middle school years. In this article, research is described showing the prevalence and impact of developmental assets…

Strategies for Teaching Developmental Mathematics Students at the College Level

ERIC Educational Resources Information Center

Swaincott Kautz, Natalie Lynn

2016-01-01

The purpose of this investigation was to identify strategies used by effective instructors of developmental mathematics, and to discover the perceptions developmental mathematics students have about these strategies. While there are research projects focusing solely on developmental mathematics achievement, this study fills a need by incorporating…

Developmental Summer Bridge Programs. What Works Clearinghouse™ Intervention Report

ERIC Educational Resources Information Center

What Works Clearinghouse, 2015

2015-01-01

Developmental summer bridge programs are designed to reduce the need for developmental education in college by providing students with accelerated instruction in areas where additional knowledge and skills are needed to help them succeed in higher education. The WWC identified one study of developmental summer bridge programs that meets WWC…

WRKY transcription factors

PubMed Central

Bakshi, Madhunita; Oelmüller, Ralf

2014-01-01

WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

Markers of Developmentally Regulated Programmed Cell Death and Their Analysis in Cereal Seeds.

PubMed

Domínguez, Fernando; Cejudo, Francisco Javier

2018-01-01

Programmed cell death (PCD) is a key process for the development and differentiation of multicellular organisms, which is characterized by well-defined morphological and biochemical features. These include chromatin condensation, DNA degradation and nuclear fragmentation, with nucleases and proteases playing a relevant function in these processes. In this chapter we describe methods routinely used for the analysis of hallmarks of developmentally regulated PCD in cereal seed tissues, which are based on agarose and polyacrylamide gel electrophoresis, in situ staining of DNA fragmentation, and cell-free assays of relevant enzymatic activities.

A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

PubMed

Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

2017-01-12

We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

PubMed

Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

2010-06-09

Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be used to alter the transcriptional response to prevent the motor neurons from entering a state of hyper-excitability.

Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

PubMed Central

2010-01-01

Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be used to alter the transcriptional response to prevent the motor neurons from entering a state of hyper-excitability. PMID:20534130

Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

PubMed

Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

2015-05-29

MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

Circadian oscillatory transcriptional programs in grapevine ripening fruits

PubMed Central

2014-01-01

Background Temperature and solar radiation influence Vitis vinifera L. berry ripening. Both environmental conditions fluctuate cyclically on a daily period basis and the strength of this fluctuation affects grape ripening too. Additionally, a molecular circadian clock regulates daily cyclic expression in a large proportion of the plant transcriptome modulating multiple developmental processes in diverse plant organs and developmental phases. Circadian cycling of fruit transcriptomes has not been characterized in detail despite their putative relevance in the final composition of the fruit. Thus, in this study, gene expression throughout 24 h periods in pre-ripe berries of Tempranillo and Verdejo grapevine cultivars was followed to determine whether different ripening transcriptional programs are activated during certain times of day in different grape tissues and genotypes. Results Microarray analyses identified oscillatory transcriptional profiles following circadian variations in the photocycle and the thermocycle. A higher number of expression oscillating transcripts were detected in samples carrying exocarp tissue including biotic stress-responsive transcripts activated around dawn. Thermotolerance-like responses and regulation of circadian clock-related genes were observed in all studied samples. Indeed, homologs of core clock genes were identified in the grapevine genome and, among them, VvREVEILLE1 (VvRVE1), showed a consistent circadian expression rhythm in every grape berry tissue analysed. Light signalling components and terpenoid biosynthetic transcripts were specifically induced during the daytime in Verdejo, a cultivar bearing white-skinned and aromatic berries, whereas transcripts involved in phenylpropanoid biosynthesis were more prominently regulated in Tempranillo, a cultivar bearing black-skinned berries. Conclusions The transcriptome of ripening fruits varies in response to daily environmental changes, which might partially be under the control of circadian clock components. Certain cultivar and berry tissue features could rely on specific circadian oscillatory expression profiles. These findings may help to a better understanding of the progress of berry ripening in short term time scales. PMID:24666982

TATN-1 Mutations Reveal a Novel Role for Tyrosine as a Metabolic Signal That Influences Developmental Decisions and Longevity in Caenorhabditis elegans

PubMed Central

Ferguson, Annabel A.; Dumas, Kathleen J.; Ritov, Vladimir B.; Matern, Dietrich; Hu, Patrick J.; Fisher, Alfred L.

2013-01-01

Recent work has identified changes in the metabolism of the aromatic amino acid tyrosine as a risk factor for diabetes and a contributor to the development of liver cancer. While these findings could suggest a role for tyrosine as a direct regulator of the behavior of cells and tissues, evidence for this model is currently lacking. Through the use of RNAi and genetic mutants, we identify tatn-1, which is the worm ortholog of tyrosine aminotransferase and catalyzes the first step of the conserved tyrosine degradation pathway, as a novel regulator of the dauer decision and modulator of the daf-2 insulin/IGF-1-like (IGFR) signaling pathway in Caenorhabditis elegans. Mutations affecting tatn-1 elevate tyrosine levels in the animal, and enhance the effects of mutations in genes that lie within the daf-2/insulin signaling pathway or are otherwise upstream of daf-16/FOXO on both dauer formation and worm longevity. These effects are mediated by elevated tyrosine levels as supplemental dietary tyrosine mimics the phenotypes produced by a tatn-1 mutation, and the effects still occur when the enzymes needed to convert tyrosine into catecholamine neurotransmitters are missing. The effects on dauer formation and lifespan require the aak-2/AMPK gene, and tatn-1 mutations increase phospho-AAK-2 levels. In contrast, the daf-16/FOXO transcription factor is only partially required for the effects on dauer formation and not required for increased longevity. We also find that the controlled metabolism of tyrosine by tatn-1 may function normally in dauer formation because the expression of the TATN-1 protein is regulated both by daf-2/IGFR signaling and also by the same dietary and environmental cues which influence dauer formation. Our findings point to a novel role for tyrosine as a developmental regulator and modulator of longevity, and support a model where elevated tyrosine levels play a causal role in the development of diabetes and cancer in people. PMID:24385923

HUPO BPP pilot study: a proteomics analysis of the mouse brain of different developmental stages.

PubMed

Wang, Jing; Gu, Yong; Wang, Lihong; Hang, Xingyi; Gao, Yan; Wang, Hangyan; Zhang, Chenggang

2007-11-01

This study is a part of the HUPO Brain Proteome Project (BPP) pilot study, which aims at obtaining a reliable database of mouse brain proteome, at the comparison of techniques, laboratories, and approaches as well as at preparing subsequent proteome studies of neurologic diseases. The C57/Bl6 mouse brains of three developmental stages at embryonic day 16 (E16), postnatal day 7 (P7), and 8 wk (P56) (n = 5 in each group) were provided by the HUPO BPP executive committee. The whole brain proteins of each animal were individually prepared using 2-DE coupled with PDQuest software analysis. The protein spots representing developmentally related or stably expressed proteins were then prepared with in-gel digestion followed with MALDI-TOF/TOF MS/MS and analyzed using the MASCOT search engines to search the Swiss-Prot or NCBInr database. The 2-DE gel maps of the mouse brains of all of the developmental stages were obtained and submitted to the Data Collection Centre (DCC). The proteins alpha-enolase, stathmin, actin, C14orf166 homolog, 28,000 kDa heat- and acid-stable phosphoprotein, 3-mercaptopyruvate sulfurtransferase and 40 S ribosomal protein S3a were successfully identified. A further Western blotting analysis demonstrated that enolase is a protein up-regulated in the mouse brain from embryonic stage to adult stage. These data are helpful for understanding the proteome changes in the development of the mouse brain.

Association of Transition Readiness to Intentional Self-Regulation and Hopeful Future Expectations in Youth With Illness.

PubMed

Hart, Laura C; Pollock, McLean; Hill, Sherika; Maslow, Gary

Little is known about how transition readiness relates to other developmental skills of adolescence in youth with chronic illness. Better understanding of how transition readiness relates to these other developmental skills could lead to a broader array of tools to improve transition readiness. Intentional self-regulation (ISR) and hopeful future expectations (HFE) are 2 developmental skills of adolescence that improve with participation in developmental programming and thus are modifiable. We explored associations between transition readiness, as measured by the Transition Readiness Assessment Questionnaire 29 (TRAQ-29) and ISR and HFE in youth with chronic illness recruited from a variety of subspecialty clinics from a major southeast medical center. A total of 71 adolescents with chronic illness were included in the analysis. The TRAQ-29 Self-Advocacy domain showed positive associations to both ISR (P = .03) and HFE (P = .009). In addition, the TRAQ-29 overall had positive associations to HFE (P = .04). The significant associations between TRAQ-29 Self-Advocacy domain scores and ISR and HFE suggest that transition readiness is developing within the context of other developmental areas in adolescence. More work is needed to see if the programming that improves these other developmental skills might also improve transition readiness. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

Plasmodesmal regulation during plant-pathogen interactions.

PubMed

Cheval, Cecilia; Faulkner, Christine

2018-01-01

Contents Summary 62 I. Introduction 62 II. Plasmodesmal regulation is an innate defence response 63 III. Reactive oxygen species regulate plasmodesmal function 63 IV. Plasmodesmal regulation by and of defence-associated small molecules 64 V. Plasmodesmata facilitate systemic defence signalling 64 VI. Virulent pathogens exploit plasmodesmata 66 VII. Outlook 66 Acknowledgements 66 References 66 SUMMARY: Plasmodesmata (PD) are plasma membrane-lined pores that connect neighbouring plant cells, bridging the cell wall and establishing cytoplasmic and membrane continuity between cells. PD are dynamic structures regulated by callose deposition in a variety of stress and developmental contexts. This process crudely controls the aperture of the pore and thus the flux of molecules between cells. During pathogen infection, plant cells initiate a range of immune responses and it was recently identified that, following perception of fungal and bacterial pathogens, plant cells initially close their PD. Systemic defence responses depend on the spread of signals between cells, raising questions about whether PD are in different functional states during different immune responses. It is well established that viral pathogens exploit PD to spread between cells, but it has more recently been identified that protein effectors secreted by fungal pathogens can spread between host cells via PD. It is possible that many classes of pathogens specifically target PD to aid infection, which would infer antagonistic regulation of PD by host and pathogen. How PD regulation benefits both host immune responses and pathogen infection is an important question and demands that we examine the multicellular nature of plant-pathogen interactions. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.