Cocaine addiction as a homeostatic reinforcement learning disorder.

PubMed

Keramati, Mehdi; Durand, Audrey; Girardeau, Paul; Gutkin, Boris; Ahmed, Serge H

2017-03-01

Drug addiction implicates both reward learning and homeostatic regulation mechanisms of the brain. This has stimulated 2 partially successful theoretical perspectives on addiction. Many important aspects of addiction, however, remain to be explained within a single, unified framework that integrates the 2 mechanisms. Building upon a recently developed homeostatic reinforcement learning theory, the authors focus on a key transition stage of addiction that is well modeled in animals, escalation of drug use, and propose a computational theory of cocaine addiction where cocaine reinforces behavior due to its rapid homeostatic corrective effect, whereas its chronic use induces slow and long-lasting changes in homeostatic setpoint. Simulations show that our new theory accounts for key behavioral and neurobiological features of addiction, most notably, escalation of cocaine use, drug-primed craving and relapse, individual differences underlying dose-response curves, and dopamine D2-receptor downregulation in addicts. The theory also generates unique predictions about cocaine self-administration behavior in rats that are confirmed by new experimental results. Viewing addiction as a homeostatic reinforcement learning disorder coherently explains many behavioral and neurobiological aspects of the transition to cocaine addiction, and suggests a new perspective toward understanding addiction. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Active Inference, homeostatic regulation and adaptive behavioural control.

PubMed

Pezzulo, Giovanni; Rigoli, Francesco; Friston, Karl

2015-11-01

We review a theory of homeostatic regulation and adaptive behavioural control within the Active Inference framework. Our aim is to connect two research streams that are usually considered independently; namely, Active Inference and associative learning theories of animal behaviour. The former uses a probabilistic (Bayesian) formulation of perception and action, while the latter calls on multiple (Pavlovian, habitual, goal-directed) processes for homeostatic and behavioural control. We offer a synthesis these classical processes and cast them as successive hierarchical contextualisations of sensorimotor constructs, using the generative models that underpin Active Inference. This dissolves any apparent mechanistic distinction between the optimization processes that mediate classical control or learning. Furthermore, we generalize the scope of Active Inference by emphasizing interoceptive inference and homeostatic regulation. The ensuing homeostatic (or allostatic) perspective provides an intuitive explanation for how priors act as drives or goals to enslave action, and emphasises the embodied nature of inference. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Active Inference, homeostatic regulation and adaptive behavioural control

PubMed Central

Pezzulo, Giovanni; Rigoli, Francesco; Friston, Karl

2015-01-01

We review a theory of homeostatic regulation and adaptive behavioural control within the Active Inference framework. Our aim is to connect two research streams that are usually considered independently; namely, Active Inference and associative learning theories of animal behaviour. The former uses a probabilistic (Bayesian) formulation of perception and action, while the latter calls on multiple (Pavlovian, habitual, goal-directed) processes for homeostatic and behavioural control. We offer a synthesis these classical processes and cast them as successive hierarchical contextualisations of sensorimotor constructs, using the generative models that underpin Active Inference. This dissolves any apparent mechanistic distinction between the optimization processes that mediate classical control or learning. Furthermore, we generalize the scope of Active Inference by emphasizing interoceptive inference and homeostatic regulation. The ensuing homeostatic (or allostatic) perspective provides an intuitive explanation for how priors act as drives or goals to enslave action, and emphasises the embodied nature of inference. PMID:26365173

Homeostatic and non-homeostatic appetite control along the spectrum of physical activity levels: An updated perspective.

PubMed

Beaulieu, Kristine; Hopkins, Mark; Blundell, John; Finlayson, Graham

2017-12-28

The current obesogenic environment promotes physical inactivity and food consumption in excess of energy requirements, two important modifiable risk factors influencing energy balance. Habitual physical activity has been shown to impact not only energy expenditure, but also energy intake through mechanisms of appetite control. This review summarizes recent theory and evidence underpinning the role of physical activity in the homeostatic and non-homeostatic mechanisms controlling appetite. Energy intake along the spectrum of physical activity levels (inactive to highly active) appears to be J-shaped, with low levels of physical activity leading to dysregulated appetite and a mismatch between energy intake and expenditure. At higher levels, habitual physical activity influences homeostatic appetite control in a dual-process action by increasing the drive to eat through greater energy expenditure, but also by enhancing post-meal satiety, allowing energy intake to better match energy expenditure in response to hunger and satiety signals. There is clear presumptive evidence that physical activity energy expenditure can act as a drive (determinant) of energy intake. The influence of physical activity level on non-homeostatic appetite control is less clear, but low levels of physical activity may amplify hedonic states and behavioural traits favouring overconsumption indirectly through increased body fat. More evidence is required to understand the interaction between physical activity, appetite control and diet composition on passive overconsumption and energy balance. Furthermore, potential moderators of appetite control along the spectrum of physical activity, such as body composition, sex, and type, intensity and timing of physical activity, remain to be fully understood. Copyright © 2018 Elsevier Inc. All rights reserved.

Homeostatic control of neural activity: from phenomenology to molecular design.

PubMed

Davis, Graeme W

2006-01-01

Homeostasis is a specialized form of regulation that precisely maintains the function of a system at a set point level of activity. Recently, homeostatic signaling has been suggested to control neural activity through the modulation of synaptic efficacy and membrane excitability ( Davis & Goodman 1998a, Turrigiano & Nelson 2000, Marder & Prinz 2002, Perez-Otano & Ehlers 2005 ). In this way, homeostatic signaling is thought to constrain neural plasticity and contribute to the stability of neural function over time. Using a restrictive definition of homeostasis, this review first evaluates the phenomenological and molecular evidence for homeostatic signaling in the nervous system. Then, basic principles underlying the design and molecular implementation of homeostatic signaling are reviewed on the basis of work in other, simplified biological systems such as bacterial chemotaxis and the heat shock response. Data from these systems are then discussed in the context of homeostatic signaling in the nervous system.

Identifying the determinants of childhood immunization in the Philippines.

PubMed

Bondy, Jennifer N; Thind, Amardeep; Koval, John J; Speechley, Kathy N

2009-01-01

A key method of reducing morbidity and mortality is childhood immunization, yet in 2003 only 69% of Filipino children received all suggested vaccinations. Data from the 2003 Philippines Demographic Health Survey were used to identify risk factors for non- and partial-immunization. Results of the multinomial logistic regression analyses indicate that mothers who have less education, and who have not attended the minimally-recommended four antenatal visits are less likely to have fully immunized children. To increase immunization coverage in the Philippines, knowledge transfer to mothers must improve.

Traditional Chinese medicine and the positive correlation with homeostatic evolution of human being: based on medical perspective.

PubMed

Wang, Jie-Hua

2012-08-01

Adaptation is an eternal theme of biological evolution. The paper aims at exploring the conception of positive correlation between traditional Chinese medicine (TCM) and human homeostatic evolution based on medical perspective. Discussions mainly involve TCM conforming to natural laws and natural evolution of life, spontaneous harmonization of yin and yang and operating system of human self-healing, modern human immunology and human endogenous immune function in TCM, self-homeostasis of human micro-ecological state and balance mechanism on regulating base in TCM, as well as adaptation-eternal theme of biological evolution and safeguarding adaptability-value of TCM. In perspective of medicine, theory and practice of TCM are in positive correlation with human homeostatic evolution, and what TCM tries to maintain is human intrinsic adaptive capability to disease and nature. Therefore, it is the core value of TCM, which is to be further studied, explored, realized and known to the world.

Immune-Modulating Perspectives for Low Frequency Electromagnetic Fields in Innate Immunity

PubMed Central

Rosado, Maria Manuela; Simkó, Myrtill; Mattsson, Mats-Olof; Pioli, Claudio

2018-01-01

In recent years, the effects of electromagnetic fields (EMFs) on the immune system have received a considerable interest, not only to investigate possible negative health impact but also to explore the possibility to favorably modulate immune responses. To generate beneficial responses, the immune system should eradicate pathogens while “respecting” the organism and tolerating irrelevant antigens. According to the current view, damage-associated molecules released by infected or injured cells, or secreted by innate immune cells generate danger signals activating an immune response. These signals are also relevant to the subsequent activation of homeostatic mechanisms that control the immune response in pro- or anti-inflammatory reactions, a feature that allows modulation by therapeutic treatments. In the present review, we describe and discuss the effects of extremely low frequency (ELF)-EMF and pulsed EMF on cell signals and factors relevant to the activation of danger signals and innate immunity cells. By discussing the EMF modulating effects on cell functions, we envisage the use of EMF as a therapeutic agent to regulate immune responses associated with wound healing. PMID:29632855

Immune-Modulating Perspectives for Low Frequency Electromagnetic Fields in Innate Immunity.

PubMed

Rosado, Maria Manuela; Simkó, Myrtill; Mattsson, Mats-Olof; Pioli, Claudio

2018-01-01

In recent years, the effects of electromagnetic fields (EMFs) on the immune system have received a considerable interest, not only to investigate possible negative health impact but also to explore the possibility to favorably modulate immune responses. To generate beneficial responses, the immune system should eradicate pathogens while "respecting" the organism and tolerating irrelevant antigens. According to the current view, damage-associated molecules released by infected or injured cells, or secreted by innate immune cells generate danger signals activating an immune response. These signals are also relevant to the subsequent activation of homeostatic mechanisms that control the immune response in pro- or anti-inflammatory reactions, a feature that allows modulation by therapeutic treatments. In the present review, we describe and discuss the effects of extremely low frequency (ELF)-EMF and pulsed EMF on cell signals and factors relevant to the activation of danger signals and innate immunity cells. By discussing the EMF modulating effects on cell functions, we envisage the use of EMF as a therapeutic agent to regulate immune responses associated with wound healing.

Natural variation in the parameters of innate immune cells is preferentially driven by genetic factors.

PubMed

Patin, Etienne; Hasan, Milena; Bergstedt, Jacob; Rouilly, Vincent; Libri, Valentina; Urrutia, Alejandra; Alanio, Cécile; Scepanovic, Petar; Hammer, Christian; Jönsson, Friederike; Beitz, Benoît; Quach, Hélène; Lim, Yoong Wearn; Hunkapiller, Julie; Zepeda, Magge; Green, Cherie; Piasecka, Barbara; Leloup, Claire; Rogge, Lars; Huetz, François; Peguillet, Isabelle; Lantz, Olivier; Fontes, Magnus; Di Santo, James P; Thomas, Stéphanie; Fellay, Jacques; Duffy, Darragh; Quintana-Murci, Lluís; Albert, Matthew L

2018-03-01

The quantification and characterization of circulating immune cells provide key indicators of human health and disease. To identify the relative effects of environmental and genetic factors on variation in the parameters of innate and adaptive immune cells in homeostatic conditions, we combined standardized flow cytometry of blood leukocytes and genome-wide DNA genotyping of 1,000 healthy, unrelated people of Western European ancestry. We found that smoking, together with age, sex and latent infection with cytomegalovirus, were the main non-genetic factors that affected variation in parameters of human immune cells. Genome-wide association studies of 166 immunophenotypes identified 15 loci that showed enrichment for disease-associated variants. Finally, we demonstrated that the parameters of innate cells were more strongly controlled by genetic variation than were those of adaptive cells, which were driven by mainly environmental exposure. Our data establish a resource that will generate new hypotheses in immunology and highlight the role of innate immunity in susceptibility to common autoimmune diseases.

Identifying Bacterial Immune Evasion Proteins Using Phage Display.

PubMed

Fevre, Cindy; Scheepmaker, Lisette; Haas, Pieter-Jan

2017-01-01

Methods aimed at identification of immune evasion proteins are mainly rely on in silico prediction of sequence, structural homology to known evasion proteins or use a proteomics driven approach. Although proven successful these methods are limited by a low efficiency and or lack of functional identification. Here we describe a high-throughput genomic strategy to functionally identify bacterial immune evasion proteins using phage display technology. Genomic bacterial DNA is randomly fragmented and ligated into a phage display vector that is used to create a phage display library expressing bacterial secreted and membrane bound proteins. This library is used to select displayed bacterial secretome proteins that interact with host immune components.

Body weight homeostat that regulates fat mass independently of leptin in rats and mice

PubMed Central

Jansson, John-Olov; Hägg, Daniel A.; Schéle, Erik; Dickson, Suzanne L.; Anesten, Fredrik; Bake, Tina; Montelius, Mikael; Bellman, Jakob; Johansson, Maria E.; Cone, Roger D.; Drucker, Daniel J.; Wu, Jianyao; Aleksic, Biljana; Törnqvist, Anna E.; Sjögren, Klara; Gustafsson, Jan-Åke; Windahl, Sara H.; Ohlsson, Claes

2018-01-01

Subjects spending much time sitting have increased risk of obesity but the mechanism for the antiobesity effect of standing is unknown. We hypothesized that there is a homeostatic regulation of body weight. We demonstrate that increased loading of rodents, achieved using capsules with different weights implanted in the abdomen or s.c. on the back, reversibly decreases the biological body weight via reduced food intake. Importantly, loading relieves diet-induced obesity and improves glucose tolerance. The identified homeostat for body weight regulates body fat mass independently of fat-derived leptin, revealing two independent negative feedback systems for fat mass regulation. It is known that osteocytes can sense changes in bone strain. In this study, the body weight-reducing effect of increased loading was lost in mice depleted of osteocytes. We propose that increased body weight activates a sensor dependent on osteocytes of the weight-bearing bones. This induces an afferent signal, which reduces body weight. These findings demonstrate a leptin-independent body weight homeostat (“gravitostat”) that regulates fat mass. PMID:29279372

Homeostatic enhancement of active mechanotransduction

NASA Astrophysics Data System (ADS)

Milewski, Andrew; O'Maoiléidigh, Dáibhid; Hudspeth, A. J.

2018-05-01

Our sense of hearing boasts exquisite sensitivity to periodic signals. Experiments and modeling imply, however, that the auditory system achieves this performance for only a narrow range of parameter values. As a result, small changes in these values could compromise the ability of the mechanosensory hair cells to detect stimuli. We propose that, rather than exerting tight control over parameters, the auditory system employs a homeostatic mechanism that ensures the robustness of its operation to variation in parameter values. Through analytical techniques and computer simulations we investigate whether a homeostatic mechanism renders the hair bundle's signal-detection ability more robust to alterations in experimentally accessible parameters. When homeostasis is enforced, the range of values for which the bundle's sensitivity exceeds a threshold can increase by more than an order of magnitude. The robustness of cochlear function based on somatic motility or hair bundle motility may be achieved by employing the approach we describe here.

Identifying Immune Drivers of Gulf War Illness Using a Novel Daily Sampling Approach

DTIC Science & Technology

2017-10-01

AWARD NUMBER: W81XWH-12-1-0557 TITLE: Identifying Immune Drivers of Gulf War Illness Using a Novel Daily Sampling Approach PRINCIPAL...TITLE AND SUBTITLE Identifying Immune Drivers of Gulf War Illness Using A Novel 5a. CONTRACT NUMBER Daily Sampling Approach 5b. GRANT NUMBER...INTRODUCTION: The major aim of this research project is to identify aspects of the immune system that are dysregulated in veterans with Gulf War Illness

Autophagy in immunity and inflammation

PubMed Central

Levine, Beth; Mizushima, Noboru; Virgin, Herbert W.

2011-01-01

Autophagy is an essential, homeostatic process by which cells break down their own components. Perhaps the most primordial function of this lysosomal degradation pathway is adaptation to nutrient deprivation. However, in complex multicellular organisms, the core molecular machinery of autophagy — the ‘autophagy proteins’ — orchestrates diverse aspects of cellular and organismal responses to other dangerous stimuli such as infection. Recent developments reveal a crucial role for the autophagy pathway and proteins in immunity and inflammation. They balance the beneficial and detrimental effects of immunity and inflammation, and thereby may protect against infectious, autoimmune and inflammatory diseases. PMID:21248839

Maternal Zinc Intakes and Homeostatic Adjustments during Pregnancy and Lactation

PubMed Central

Donangelo, Carmen Marino; King, Janet C.

2012-01-01

Zinc plays critical roles during embryogenesis, fetal growth, and milk secretion, which increase the zinc need for pregnancy and lactation. Increased needs can be met by increasing the dietary zinc intake, along with making homeostatic adjustments in zinc utilization. Potential homeostatic adjustments include changes in circulating zinc, increased zinc absorption, decreased zinc losses, and changes in whole body zinc kinetics. Although severe zinc deficiency during pregnancy has devastating effects, systematic reviews and meta-analysis of the effect of maternal zinc supplementation on pregnancy outcomes have consistently shown a limited benefit. We hypothesize, therefore, that zinc homeostatic adjustments during pregnancy and lactation improve zinc utilization sufficiently to provide the increased zinc needs in these stages and, therefore, mitigate immediate detrimental effects due to a low zinc intake. The specific questions addressed are the following: How is zinc utilization altered during pregnancy and lactation? Are those homeostatic adjustments influenced by maternal zinc status, dietary zinc, or zinc supplementation? These questions are addressed by critically reviewing results from published human studies on zinc homeostasis during pregnancy and lactation carried out in different populations worldwide. PMID:22852063

Endocannabinoid modulation of homeostatic and non-homeostatic feeding circuits.

PubMed

Lau, Benjamin K; Cota, Daniela; Cristino, Luigia; Borgland, Stephanie L

2017-09-15

The endocannabinoid system has emerged as a key player in the control of eating. Endocannabinoids, including 2-arachidonoylglycerol (2-AG) and anandamide (AEA), modulate neuronal activity via cannabinoid 1 receptors (CB1Rs) in multiple nuclei of the hypothalamus to induce or inhibit food intake depending on nutritional and hormonal status, suggesting that endocannabinoids may act in the hypothalamus to integrate different types of signals informing about the animal's energy needs. In the mesocorticolimbic system, (endo)cannabinoids modulate synaptic transmission to promote dopamine release in response to palatable food. In addition, (endo)cannabinoids act within the nucleus accumbens to increase food's hedonic impact; although this effect depends on activation of CB1Rs at excitatory, but not inhibitory inputs in the nucleus accumbens. While hyperactivation of the endocannabinoid system is typically associated with overeating and obesity, much evidence has emerged in recent years suggesting a more complicated system than first thought - endocannabinoids promote or suppress feeding depending on cell and input type, or modulation by various neuronal or hormonal signals. This review presents our latest knowledge of the endocannabinoid system in non-homeostatic and homeostatic feeding circuits. In particular, we discuss the functional role and cellular mechanism of action by endocannabinoids within the hypothalamus and mesocorticolimbic system, and how these are modulated by neuropeptide signals related to feeding. In light of recent advances and complexity in the field, we review cannabinoid-based therapeutic strategies for the treatment of obesity and how peripheral restriction of CB1R antagonists may provide a different mechanism of weight loss without the central adverse effects. This article is part of the Special Issue entitled "A New Dawn in Cannabinoid Neurobiology". Copyright © 2017 Elsevier Ltd. All rights reserved.

Time- and polarity-dependent proteomic changes associated with homeostatic scaling at central synapses

PubMed Central

Schanzenbächer, Christoph T

2018-01-01

In homeostatic scaling at central synapses, the depth and breadth of cellular mechanisms that detect the offset from the set-point, detect the duration of the offset and implement a cellular response are not well understood. To understand the time-dependent scaling dynamics we treated cultured rat hippocampal cells with either TTX or bicucculline for 2 hr to induce the process of up- or down-scaling, respectively. During the activity manipulation we metabolically labeled newly synthesized proteins using BONCAT. We identified 168 newly synthesized proteins that exhibited significant changes in expression. To obtain a temporal trajectory of the response, we compared the proteins synthesized within 2 hr or 24 hr of the activity manipulation. Surprisingly, there was little overlap in the significantly regulated newly synthesized proteins identified in the early- and integrated late response datasets. There was, however, overlap in the functional categories that are modulated early and late. These data indicate that within protein function groups, different proteomic choices can be made to effect early and late homeostatic responses that detect the duration and polarity of the activity manipulation. PMID:29447110

Homeostatic enhancement of sensory transduction

PubMed Central

Milewski, Andrew R.; Ó Maoiléidigh, Dáibhid; Salvi, Joshua D.; Hudspeth, A. J.

2017-01-01

Our sense of hearing boasts exquisite sensitivity, precise frequency discrimination, and a broad dynamic range. Experiments and modeling imply, however, that the auditory system achieves this performance for only a narrow range of parameter values. Small changes in these values could compromise hair cells’ ability to detect stimuli. We propose that, rather than exerting tight control over parameters, the auditory system uses a homeostatic mechanism that increases the robustness of its operation to variation in parameter values. To slowly adjust the response to sinusoidal stimulation, the homeostatic mechanism feeds back a rectified version of the hair bundle’s displacement to its adaptation process. When homeostasis is enforced, the range of parameter values for which the sensitivity, tuning sharpness, and dynamic range exceed specified thresholds can increase by more than an order of magnitude. Signatures in the hair cell’s behavior provide a means to determine through experiment whether such a mechanism operates in the auditory system. Robustness of function through homeostasis may be ensured in any system through mechanisms similar to those that we describe here. PMID:28760949

An Adenosine-Mediated Glial-Neuronal Circuit for Homeostatic Sleep.

PubMed

Bjorness, Theresa E; Dale, Nicholas; Mettlach, Gabriel; Sonneborn, Alex; Sahin, Bogachan; Fienberg, Allen A; Yanagisawa, Masashi; Bibb, James A; Greene, Robert W

2016-03-30

Sleep homeostasis reflects a centrally mediated drive for sleep, which increases during waking and resolves during subsequent sleep. Here we demonstrate that mice deficient for glial adenosine kinase (AdK), the primary metabolizing enzyme for adenosine (Ado), exhibit enhanced expression of this homeostatic drive by three independent measures: (1) increased rebound of slow-wave activity; (2) increased consolidation of slow-wave sleep; and (3) increased time constant of slow-wave activity decay during an average slow-wave sleep episode, proposed and validated here as a new index for homeostatic sleep drive. Conversely, mice deficient for the neuronal adenosine A1 receptor exhibit significantly decreased sleep drive as judged by these same indices. Neuronal knock-out of AdK did not influence homeostatic sleep need. Together, these findings implicate a glial-neuronal circuit mediated by intercellular Ado, controlling expression of homeostatic sleep drive. Because AdK is tightly regulated by glial metabolic state, our findings suggest a functional link between cellular metabolism and sleep homeostasis. The work presented here provides evidence for an adenosine-mediated regulation of sleep in response to waking (i.e., homeostatic sleep need), requiring activation of neuronal adenosine A1 receptors and controlled by glial adenosine kinase. Adenosine kinase acts as a highly sensitive and important metabolic sensor of the glial ATP/ADP and AMP ratio directly controlling intracellular adenosine concentration. Glial equilibrative adenosine transporters reflect the intracellular concentration to the extracellular milieu to activate neuronal adenosine receptors. Thus, adenosine mediates a glial-neuronal circuit linking glial metabolic state to neural-expressed sleep homeostasis. This indicates a metabolically related function(s) for this glial-neuronal circuit in the buildup and resolution of our need to sleep and suggests potential therapeutic targets more directly related to

Zinc Signals and Immunity.

PubMed

Maywald, Martina; Wessels, Inga; Rink, Lothar

2017-10-24

Zinc homeostasis is crucial for an adequate function of the immune system. Zinc deficiency as well as zinc excess result in severe disturbances in immune cell numbers and activities, which can result in increased susceptibility to infections and development of especially inflammatory diseases. This review focuses on the role of zinc in regulating intracellular signaling pathways in innate as well as adaptive immune cells. Main underlying molecular mechanisms and targets affected by altered zinc homeostasis, including kinases, caspases, phosphatases, and phosphodiesterases, will be highlighted in this article. In addition, the interplay of zinc homeostasis and the redox metabolism in affecting intracellular signaling will be emphasized. Key signaling pathways will be described in detail for the different cell types of the immune system. In this, effects of fast zinc flux, taking place within a few seconds to minutes will be distinguish from slower types of zinc signals, also designated as "zinc waves", and late homeostatic zinc signals regarding prolonged changes in intracellular zinc.

Zinc Signals and Immunity

PubMed Central

Maywald, Martina; Wessels, Inga; Rink, Lothar

2017-01-01

Zinc homeostasis is crucial for an adequate function of the immune system. Zinc deficiency as well as zinc excess result in severe disturbances in immune cell numbers and activities, which can result in increased susceptibility to infections and development of especially inflammatory diseases. This review focuses on the role of zinc in regulating intracellular signaling pathways in innate as well as adaptive immune cells. Main underlying molecular mechanisms and targets affected by altered zinc homeostasis, including kinases, caspases, phosphatases, and phosphodiesterases, will be highlighted in this article. In addition, the interplay of zinc homeostasis and the redox metabolism in affecting intracellular signaling will be emphasized. Key signaling pathways will be described in detail for the different cell types of the immune system. In this, effects of fast zinc flux, taking place within a few seconds to minutes will be distinguish from slower types of zinc signals, also designated as “zinc waves”, and late homeostatic zinc signals regarding prolonged changes in intracellular zinc. PMID:29064429

The physiology of stress and effects on immune health in ruminants

USDA-ARS?s Scientific Manuscript database

As researchers have continued to explore the complex interactions among stress and production parameters such as growth, feed efficiency, and health, multidisciplinary efforts have emerged leading to a greater understanding of homeostatic regulation. The immune system can be regulated by several dif...

Breast Milk and Solid Food Shaping Intestinal Immunity

PubMed Central

Parigi, Sara M.; Eldh, Maria; Larssen, Pia; Gabrielsson, Susanne; Villablanca, Eduardo J.

2015-01-01

After birth, the intestinal immune system enters a critical developmental stage, in which tolerogenic and pro-inflammatory cells emerge to contribute to the overall health of the host. The neonatal health is continuously challenged by microbial colonization and food intake, first in the form of breast milk or formula and later in the form of solid food. The microbiota and dietary compounds shape the newborn immune system, which acquires the ability to induce tolerance against innocuous antigens or induce pro-inflammatory immune responses against pathogens. Disruption of these homeostatic mechanisms might lead to undesired immune reactions, such as food allergies and inflammatory bowel disease. Hence, a proper education and maturation of the intestinal immune system is likely important to maintain life-long intestinal homeostasis. In this review, the most recent literature regarding the effects of dietary compounds in the development of the intestinal immune system are discussed. PMID:26347740

Interoception, homeostatic emotions and sympathovagal balance.

PubMed

Strigo, Irina A; Craig, Arthur D Bud

2016-11-19

We briefly review the evidence for distinct neuroanatomical substrates that underlie interoception in humans, and we explain how they substantialize feelings from the body (in the insular cortex) that are conjoined with homeostatic motivations that guide adaptive behaviours (in the cingulate cortex). This hierarchical sensorimotor architecture coincides with the limbic cortical architecture that underlies emotions, and thus we regard interoceptive feelings and their conjoint motivations as homeostatic emotions We describe how bivalent feelings, emotions and sympathovagal balance can be organized and regulated efficiently in the bicameral forebrain as asymmetric positive/negative, approach/avoidance and parasympathetic/sympathetic components. We provide original evidence supporting this organization from studies of cardiorespiratory vagal activity in monkeys and functional imaging studies in healthy humans showing activation modulated by paced breathing and passively viewed emotional images. The neuroanatomical architecture of interoception provides deep insight into the functional organization of all emotional feelings and behaviours in humans.This article is part of the themed issue 'Interoception beyond homeostasis: affect, cognition and mental health'. © 2016 The Author(s).

Immune Dysfunction in Cirrhosis

PubMed Central

Noor, Mohd Talha; Manoria, Piyush

2017-01-01

Abstract Cirrhosis due to any etiology disrupts the homeostatic role of liver in the body. Cirrhosis-associated immune dysfunction leads to alterations in both innate and acquired immunity, due to defects in the local immunity of liver as well as in systemic immunity. Cirrhosis-associated immune dysfunction is a dynamic phenomenon, comprised of both increased systemic inflammation and immunodeficiency, and is responsible for 30% mortality. It also plays an important role in acute as well as chronic decompensation. Immune paralysis can accompany it, which is characterized by increase in anti-inflammatory cytokines and suppression of proinflammatory cytokines. There is also presence of increased gut permeability, reduced gut motility and altered gut flora, all of which leads to increased bacterial translocation. This increased bacterial translocation and consequent endotoxemia leads to increased blood stream bacterial infections that cause systemic inflammatory response syndrome, sepsis, multiorgan failure and death. The gut microbiota of cirrhotic patients has more pathogenic microbes than that of non-cirrhotic individuals, and this disturbs the homeostasis and favors gut translocation. Prompt diagnosis and treatment of such infections are necessary for better survival. We have reviewed the various mechanisms of immune dysfunction and its consequences in cirrhosis. Recognizing the exact pathophysiology of immune dysfunction will help treating clinicians in avoiding its complications in their patients and can lead to newer therapeutic interventions and reducing the morbidity and mortality rates. PMID:28507927

The effect of burn injury on CD8+ and CD4+ T cells in an irradiation model of homeostatic proliferation.

PubMed

Buchanan, Ian B; Maile, Robert; Frelinger, Jeffrey A; Fair, Jeffrey H; Meyer, Anthony A; Cairns, Bruce A

2006-11-01

Homeostatic proliferation of T cells has recently been shown to be an important mechanism in the host response to infection. However, its role in the T cell response to burn injury is unknown. In this study, we examine the effect of burn injury on CD4+ and CD8+ T cell homeostatic proliferation after irradiation. Wild-type C57BL/6 female mice were irradiated with six grays ionizing radiation and 48 hours later, syngeneic whole splenocytes or purified CD4+ or CD8+ T cells labeled with carboxy-fluorescein diacetate, succinimidyl ester were adoptively transferred. Two days later, mice underwent a 20% burn injury, followed by splenocyte harvest 3 and 10 days after injury. Burn mice demonstrate increased splenic cellularity and CD8+ T cell proliferation after adoptive transfer of either purified CD8+ cells or whole spleen populations compared with unburned (sham) mice. In contrast, CD4+ T cell proliferation after burn injury is unchanged after adoptive transfer of whole spleen cells and drastically decreased after adoptive transfer of a purified CD4+ population compared with sham mice. Ten days after burn injury CD8+ T cells continue to demonstrate greater proliferation than CD4+ T cells. CD8+ T cells are more robust than CD4+ T cells in their proliferative response after burn injury. In addition, CD8+ T cell proliferation appears less reliant on other immune cells than purified CD4+ T cell proliferation. These data reiterate the importance of CD8+ T cells in the initial immune response to burn injury.

MCTP is an ER-resident calcium sensor that stabilizes synaptic transmission and homeostatic plasticity

PubMed Central

Genç, Özgür; Dickman, Dion K; Ma, Wenpei; Tong, Amy; Fetter, Richard D; Davis, Graeme W

2017-01-01

Presynaptic homeostatic plasticity (PHP) controls synaptic transmission in organisms from Drosophila to human and is hypothesized to be relevant to the cause of human disease. However, the underlying molecular mechanisms of PHP are just emerging and direct disease associations remain obscure. In a forward genetic screen for mutations that block PHP we identified mctp (Multiple C2 Domain Proteins with Two Transmembrane Regions). Here we show that MCTP localizes to the membranes of the endoplasmic reticulum (ER) that elaborate throughout the soma, dendrites, axon and presynaptic terminal. Then, we demonstrate that MCTP functions downstream of presynaptic calcium influx with separable activities to stabilize baseline transmission, short-term release dynamics and PHP. Notably, PHP specifically requires the calcium coordinating residues in each of the three C2 domains of MCTP. Thus, we propose MCTP as a novel, ER-localized calcium sensor and a source of calcium-dependent feedback for the homeostatic stabilization of neurotransmission. DOI: http://dx.doi.org/10.7554/eLife.22904.001 PMID:28485711

An RNAi-mediated screen identifies novel targets for next-generation antiepileptic drugs based on increased expression of the homeostatic regulator pumilio.

PubMed

Lin, Wei-Hsiang; He, Miaomiao; Fan, Yuen Ngan; Baines, Richard A

2018-05-02

Despite availability of a diverse range of anti-epileptic drugs (AEDs), only about two-thirds of epilepsy patients respond well to drug treatment. Thus, novel targets are required to catalyse the design of next-generation AEDs. Manipulation of neuron firing-rate homoeostasis, through enhancing Pumilio (Pum) activity, has been shown to be potently anticonvulsant in Drosophila. In this study, we performed a genome-wide RNAi screen in S2R + cells, using a luciferase-based dPum activity reporter and identified 1166 genes involved in dPum regulation. Of these genes, we focused on 699 genes that, on knock-down, potentiate dPum activity/expression. Of this subgroup, 101 genes are activity-dependent based on comparison with genes previously identified as activity-dependent by RNA-sequencing. Functional cluster analysis shows these genes are enriched in pathways involved in DNA damage, regulation of cell cycle and proteasomal protein catabolism. To test for anticonvulsant activity, we utilised an RNA-interference approach in vivo. RNAi-mediated knockdown showed that 57/101 genes (61%) are sufficient to significantly reduce seizure duration in the characterized seizure mutant, para bss . We further show that chemical inhibitors of protein products of some of the genes targeted are similarly anticonvulsant. Finally, to establish whether the anticonvulsant activity of identified compounds results from increased dpum transcription, we performed a luciferase-based assay to monitor dpum promoter activity. Third instar larvae exposed to sodium fluoride, gemcitabine, metformin, bestatin, WP1066 or valproic acid all showed increased dpum promoter activity. Thus, this study validates Pum as a favourable target for AED design and, moreover, identifies a number of lead compounds capable of increasing the expression of this homeostatic regulator.

Immunity and Inflammation in Epilepsy

PubMed Central

Vezzani, Annamaria; Lang, Bethan; Aronica, Eleonora

2016-01-01

This review reports the available evidence on the activation of the innate and adaptive branches of the immune system and the related inflammatory processes in epileptic disorders and the putative pathogenic role of inflammatory processes developing in the brain, as indicated by evidence from experimental and clinical research. Indeed, there is increasing knowledge supporting a role of specific inflammatory mediators and immune cells in the generation and recurrence of epileptic seizures, as well as in the associated neuropathology and comorbidities. Major challenges in this field remain: a better understanding of the key inflammatory pathogenic pathways activated in chronic epilepsy and during epileptogenesis, and how to counteract them efficiently without altering the homeostatic tissue repair function of inflammation. The relevance of this information for developing novel therapies will be highlighted. PMID:26684336

The Contribution of Job and Partner Satisfaction to the Homeostatic Defense of Subjective Wellbeing

ERIC Educational Resources Information Center

Lai, Lufanna C. H.; Cummins, Robert A.

2013-01-01

Two studies investigate subjective wellbeing (SWB) homeostasis. The first investigates the contribution of job satisfaction (JS) and partner satisfaction (PS) to the homeostatic defense of SWB. The extant model of homeostasis does not include either variable. The second study investigates the relationship between Homeostatically Protected Mood…

A Cerebellar Framework for Predictive Coding and Homeostatic Regulation in Depressive Disorder.

PubMed

Schutter, Dennis J L G

2016-02-01

Depressive disorder is associated with abnormalities in the processing of reward and punishment signals and disturbances in homeostatic regulation. These abnormalities are proposed to impair error minimization routines for reducing uncertainty. Several lines of research point towards a role of the cerebellum in reward- and punishment-related predictive coding and homeostatic regulatory function in depressive disorder. Available functional and anatomical evidence suggests that in addition to the cortico-limbic networks, the cerebellum is part of the dysfunctional brain circuit in depressive disorder as well. It is proposed that impaired cerebellar function contributes to abnormalities in predictive coding and homeostatic dysregulation in depressive disorder. Further research on the role of the cerebellum in depressive disorder may further extend our knowledge on the functional and neural mechanisms of depressive disorder and development of novel antidepressant treatments strategies targeting the cerebellum.

Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

PubMed

Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

2016-01-19

Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

Mast cell, the peculiar member of the immune system: A homeostatic aspect.

PubMed

Csaba, György

2015-09-01

The mast cell is a member of the immune system having a basic role in allergic (anaphylactic) reactions. However, it contains, synthesizes, stores and secretes lots of substances, which initiates other reactions or participates in them. These are in connection with the deterioration of tissue correlation, as malignant tumors, angiogenesis, wound healing, pregnancy and different pathological conditions. In addition - as other members of the immune system - mast cells can synthesize, store and secrete hormones characteristic to the endocrine glands and can transport them to the site of requirement (packed transport), or produce and employ them locally. The effect of mast cells is controversial and frequently dual, stimulatory or inhibitory to the same organ or process. This is likely due to the heterogeneity of the mast cells, in morphology and cell content alike and dependent on the actual condition of the targeted tissue. The cells are transported in an unmatured form by the blood circulation and are exposed to microenvironmental effects, which influence their maturation. Their enrichment around tumors suggested using them as targets for tumor therapy more than fifty years ago (by the author), however, this idea lives its renaissance now. The review discusses the facts and ideas critically.

Trafficking receptor signatures define blood plasmablasts responding to tissue-specific immune challenge

PubMed Central

Seong, Yekyung; Lazarus, Nicole H.; Sutherland, Lusijah; Habtezion, Aida; Abramson, Tzvia; He, Xiao-Song; Greenberg, Harry B.

2017-01-01

Antibody-secreting cells are generated in regional lymphoid tissues and traffic as plasmablasts (PBs) via lymph and blood to target sites for local immunity. We used multiparameter flow cytometry to define PB trafficking programs (TPs, combinations of adhesion molecules and chemoattractant receptors) and their imprinting in patients in response to localized infection or immune insults. TPs enriched after infection or autoimmune inflammation of mucosae correlate with sites of immune response or symptoms, with different TPs imprinted during small intestinal, colon, throat, and upper respiratory immune challenge. PBs induced after intramuscular or intradermal influenza vaccination, including flu-specific antibody–secreting cells, display TPs characterized by the lack of mucosal homing receptors. PBs of healthy donors display diverse mucosa-associated TPs, consistent with homeostatic immune activity. Identification of TP signatures of PBs may facilitate noninvasive monitoring of organ-specific immune responses. PMID:28352656

Label-free haemogram using wavelength modulated Raman spectroscopy for identifying immune-cell subset

NASA Astrophysics Data System (ADS)

Ashok, Praveen C.; Praveen, Bavishna B.; Campbell, Elaine C.; Dholakia, Kishan; Powis, Simon J.

2014-03-01

Leucocytes in the blood of mammals form a powerful protective system against a wide range of dangerous pathogens. There are several types of immune cells that has specific role in the whole immune system. The number and type of immune cells alter in the disease state and identifying the type of immune cell provides information about a person's state of health. There are several immune cell subsets that are essentially morphologically identical and require external labeling to enable discrimination. Here we demonstrate the feasibility of using Wavelength Modulated Raman Spectroscopy (WMRS) with suitable machine learning algorithms as a label-free method to distinguish between different closely lying immune cell subset. Principal Component Analysis (PCA) was performed on WMRS data from single cells, obtained using confocal Raman microscopy for feature reduction, followed by Support Vector Machine (SVM) for binary discrimination of various cell subset, which yielded an accuracy >85%. The method was successful in discriminating between untouched and unfixed purified populations of CD4+CD3+ and CD8+CD3+ T lymphocyte subsets, and CD56+CD3- natural killer cells with a high degree of specificity. It was also proved sensitive enough to identify unique Raman signatures that allow clear discrimination between dendritic cell subsets, comprising CD303+CD45+ plasmacytoid and CD1c+CD141+ myeloid dendritic cells. The results of this study clearly show that WMRS is highly sensitive and can distinguish between cell types that are morphologically identical.

The unresponsiveness of the immune system of the rat to hypergravity

NASA Technical Reports Server (NTRS)

Scibetta, S. M.; Caren, L. D.; Oyama, J.

1984-01-01

The immune response in rats exposed to simulated hypergravity (2.1 G and 3.1 G) by chronic centrifugation was assessed. Rats were immunized with sheep red blood cells (SRBC), either on the day of initial exposure to hypergravity (hyper-G), or after being centrifuged for 28 d and remaining on the centrifuge thereafter. Pair-fed and ad libitum fed noncentrifuged controls were used. Although there were some alterations in leukocyte counts, hyper-G did not systematically affect the primary or secondary anti-SRBC response, hematocrits, or the sizes of the liver, spleen, kidneys, thymus, or adrenal glands. The immune system is thus remarkably homeostatic under hypergravity conditions which do affect other physiologic parameters.

A postsynaptic PI3K-cII dependent signaling controller for presynaptic homeostatic plasticity

PubMed Central

Hauswirth, Anna G; Ford, Kevin J; Wang, Tingting; Fetter, Richard D; Tong, Amy

2018-01-01

Presynaptic homeostatic plasticity stabilizes information transfer at synaptic connections in organisms ranging from insect to human. By analogy with principles of engineering and control theory, the molecular implementation of PHP is thought to require postsynaptic signaling modules that encode homeostatic sensors, a set point, and a controller that regulates transsynaptic negative feedback. The molecular basis for these postsynaptic, homeostatic signaling elements remains unknown. Here, an electrophysiology-based screen of the Drosophila kinome and phosphatome defines a postsynaptic signaling platform that includes a required function for PI3K-cII, PI3K-cIII and the small GTPase Rab11 during the rapid and sustained expression of PHP. We present evidence that PI3K-cII localizes to Golgi-derived, clathrin-positive vesicles and is necessary to generate an endosomal pool of PI(3)P that recruits Rab11 to recycling endosomal membranes. A morphologically distinct subdivision of this platform concentrates postsynaptically where we propose it functions as a homeostatic controller for retrograde, trans-synaptic signaling. PMID:29303480

Apoptosis in the homeostasis of the immune system and in human immune mediated diseases.

PubMed

Giovannetti, A; Pierdominici, M; Di Iorio, A; Cianci, R; Murdaca, G; Puppo, F; Pandolfi, F; Paganelli, R

2008-01-01

The immune system has evolved sophisticated mechanisms controlling the development of responses to dangerous antigens while avoiding unnecessary attacks to innocuous, commensal or self antigens. The risk of autoimmunity is continuously checked and balanced against the risk of succumbing to exogenous infectious agents. It is therefore of paramount importance to understand the molecular events linking the breakdown of tolerance and the development of immunodeficiency. Apoptotic mechanisms are used to regulate the development of thymocytes, the shaping of T cell repertoire, its selection and the coordinate events leading to immune responses in the periphery. Moreover, they are at the heart of the homeostatic controls restoring T cell numbers and establishing T cell memory. T lymphocytes shift continuously from survival to death signals to ensure immune responsiveness without incurring in autoimmune damage. In this review we shall consider some key facts on the relationship of lymphopenia to autoreactivity, the mechanisms controlling positive and negative selection in the thymus, the role of apoptosis in selected primary immunodeficiency states and in systemic and organ-specific autoimmunity, with examples from human diseases and their animal models.

A Diffusive Homeostatic Signal Maintains Neural Heterogeneity and Responsiveness in Cortical Networks

PubMed Central

Sweeney, Yann; Hellgren Kotaleski, Jeanette; Hennig, Matthias H.

2015-01-01

Gaseous neurotransmitters such as nitric oxide (NO) provide a unique and often overlooked mechanism for neurons to communicate through diffusion within a network, independent of synaptic connectivity. NO provides homeostatic control of intrinsic excitability. Here we conduct a theoretical investigation of the distinguishing roles of NO-mediated diffusive homeostasis in comparison with canonical non-diffusive homeostasis in cortical networks. We find that both forms of homeostasis provide a robust mechanism for maintaining stable activity following perturbations. However, the resulting networks differ, with diffusive homeostasis maintaining substantial heterogeneity in activity levels of individual neurons, a feature disrupted in networks with non-diffusive homeostasis. This results in networks capable of representing input heterogeneity, and linearly responding over a broader range of inputs than those undergoing non-diffusive homeostasis. We further show that these properties are preserved when homeostatic and Hebbian plasticity are combined. These results suggest a mechanism for dynamically maintaining neural heterogeneity, and expose computational advantages of non-local homeostatic processes. PMID:26158556

HIV infection and specific mucosal immunity: workshop 4B.

PubMed

Challacombe, S J; Fidel, P L; Tugizov, S; Tao, L; Wahl, S M

2011-04-01

Most HIV infections are transmitted across mucosal epithelium. An area of fundamental importance is understanding the role of innate and specific mucosal immunity in susceptibility or protection against HIV infection, as well as the effect of HIV infection on mucosal immunity, which leads to increased susceptibility to bacterial, fungal, and viral infections of oral and other mucosae. This workshop attempted to address 5 basic issues-namely, HIV acquisition across mucosal surfaces, innate and adaptive immunity in HIV resistance, antiviral activity of breast milk as a model mucosal fluid, neutralizing immunoglobulin A antibodies against HIV, and progress toward a mucosal vaccine against HIV. The workshop attendants agreed that progress had been made in each area covered, with much recent information. However, these advances revealed how little work had been performed on stratified squamous epithelium compared with columnar epithelium, and the attendants identified several important biological questions that had not been addressed. It is increasingly clear that innate immunity has an important biological role, although basic understanding of the mechanisms of normal homeostasis is still being investigated. Application of the emerging knowledge was lacking with regard to homeostatic mucosal immunity to HIV and its role in changing this homeostasis. With regard to breast milk, a series of studies have demonstrated the differences between transmitters and nontransmitters, although whether these findings could be generalized to other secretions such as saliva was less clear. Important progress toward an oral mucosal HIV vaccine has been made, demonstrating proof of principle for administering vaccine candidates into oral lymphoid tissues to trigger anti-HIV local and systemic immune responses. Similarly, experimental data emphasized the central role of neutralizing antibodies to prevent HIV infection via mucosal routes.

Regulatory T Cell and Forkhead Box Protein 3 as Modulators of Immune Homeostasis

PubMed Central

Pereira, Leonn Mendes Soares; Gomes, Samara Tatielle Monteiro; Ishak, Ricardo; Vallinoto, Antonio Carlos Rosário

2017-01-01

The transcription factor forkhead box protein 3 (FOXP3) is an essential molecular marker of regulatory T cell (Treg) development in different microenvironments. Tregs are cells specialized in the suppression of inadequate immune responses and the maintenance of homeostatic tolerance. Studies have addressed and elucidated the role played by FOXP3 and Treg in countless autoimmune and infectious diseases as well as in more specific cases, such as cancer. Within this context, the present article reviews aspects of the immunoregulatory profile of FOXP3 and Treg in the management of immune homeostasis, including issues relating to pathology as well as immune tolerance. PMID:28603524

Identifying patterns of immune-related disease: use in disease prevention and management.

PubMed

Dietert, Rodney R; Zelikoff, Judith T

2010-05-01

Childhood susceptibility to diseases linked with immune dysfunction affects over a quarter of the pediatric population in some countries. While this alone is a significant health issue, the actual impact of immune-related diseases extends over a lifetime and involves additional secondary conditions. Some comorbidities are well known (e.g., allergic rhinitis and asthma). However, no systematic approach has been used to identify life-long patterns of immune-based disease where the primary condition arises in childhood. Such information is useful for both disease prevention and treatment approaches. Recent primary research papers as well as review articles were obtained from PubMed, Chem Abstracts, Biosis and from the personal files of the authors. Search words used were: the diseases and conditions shown Figs. 1 and 2 in conjunction with comorbid, comorbidities, pediatric, childhood, adult, immune, immune dysfunction, allergy, autoimmune, inflammatory, infectious, health risks, environment, risk factors. Childhood diseases such as asthma, type-1 diabetes, inflammatory bowel disease, respiratory infections /rhinitis, recurrent otitis media, pediatric celiac, juvenile arthritis and Kawasaki disease are examples of significant childhood health problems where immune dysfunction plays a significant role. Each of these pediatric diseases is associated with increased risk of several secondary conditions, many of which appear only later in life. To illustrate, four prototypes of immune-related disease patterns (i.e., allergy, autoimmunity, inflammation and infectious disease) are shown as tools for: 1) enhanced disease prevention; 2) improved management of immune-based pediatric diseases; and 3) better recognition of underlying pediatric immune dysfunction. Identification of immune-related disease patterns beginning in childhood provides the framework for examining the underlying immune dysfunctions that can contribute to additional diseases in later life. Many pediatric

Homeostatic scaling of vesicular glutamate and GABA transporter expression in rat neocortical circuits.

PubMed

De Gois, Stéphanie; Schäfer, Martin K-H; Defamie, Norah; Chen, Chu; Ricci, Anthony; Weihe, Eberhard; Varoqui, Hélène; Erickson, Jeffrey D

2005-08-03

Homeostatic control of pyramidal neuron firing rate involves a functional balance of feedforward excitation and feedback inhibition in neocortical circuits. Here, we reveal a dynamic scaling in vesicular excitatory (vesicular glutamate transporters VGLUT1 and VGLUT2) and inhibitory (vesicular inhibitory amino acid transporter VIAAT) transporter mRNA and synaptic protein expression in rat neocortical neuronal cultures, using a well established in vitro protocol to induce homeostatic plasticity. During the second and third week of synaptic differentiation, the predominant vesicular transporters expressed in neocortical neurons, VGLUT1 and VIAAT, are both dramatically upregulated. In mature cultures, VGLUT1 and VIAAT exhibit bidirectional and opposite regulation by prolonged activity changes. Endogenous coregulation during development and homeostatic scaling of the expression of the transporters in functionally differentiated cultures may serve to control vesicular glutamate and GABA filling and adjust functional presynaptic excitatory/inhibitory balance. Unexpectedly, hyperexcitation in differentiated cultures triggers a striking increase in VGLUT2 mRNA and synaptic protein, whereas decreased excitation reduces levels. VGLUT2 mRNA and protein are expressed in subsets of VGLUT1-encoded neocortical neurons that we identify in primary cultures and in neocortex in situ and in vivo. After prolonged hyperexcitation, downregulation of VGLUT1/synaptophysin intensity ratios at most synapses is observed, whereas a subset of VGLUT1-containing boutons selectively increase the expression of VGLUT2. Bidirectional and opposite regulation of VGLUT1 and VGLUT2 by activity may serve as positive or negative feedback regulators for cortical synaptic transmission. Intracortical VGLUT1/VGLUT2 coexpressing neurons have the capacity to independently modulate the level of expression of either transporter at discrete synapses and therefore may serve as a plastic interface between subcortical

Pathological effect of homeostatic synaptic scaling on network dynamics in diseases of the cortex.

PubMed

Fröhlich, Flavio; Bazhenov, Maxim; Sejnowski, Terrence J

2008-02-13

Slow periodic EEG discharges are common in CNS disorders. The pathophysiology of this aberrant rhythmic activity is poorly understood. We used a computational model of a neocortical network with a dynamic homeostatic scaling rule to show that loss of input (partial deafferentation) can trigger network reorganization that results in pathological periodic discharges. The decrease in average firing rate in the network by deafferentation was compensated by homeostatic synaptic scaling of recurrent excitation among pyramidal cells. Synaptic scaling succeeded in recovering the network target firing rate for all degrees of deafferentation (fraction of deafferented cells), but there was a critical degree of deafferentation for pathological network reorganization. For deafferentation degrees below this value, homeostatic upregulation of recurrent excitation had minimal effect on the macroscopic network dynamics. For deafferentation above this threshold, however, a slow periodic oscillation appeared, patterns of activity were less sparse, and bursting occurred in individual neurons. Also, comparison of spike-triggered afferent and recurrent excitatory conductances revealed that information transmission was strongly impaired. These results suggest that homeostatic plasticity can lead to secondary functional impairment in case of cortical disorders associated with cell loss.

Is Homeostatic Sleep Regulation Under Low Sleep Pressure Modified by Age?

PubMed Central

Munch, Mirjam; Knoblauch, Vera; Blatter, Katharina; Wirz-Justice, Anna; Cajochen, Christian

2007-01-01

Study Objectives: We have previously shown that healthy older volunteers react with an attenuated frontal predominance of sleep electroencephalogram (EEG) delta activity in response to high sleep pressure. Here, we investigated age-related changes in homeostatic sleep regulation under low sleep pressure conditions, with respect to regional EEG differences and their dynamics. Design: Analysis of the sleep EEG during an 8-hour baseline night, during a 40-hour multiple nap protocol (150 minutes of wakefulness and 75 minutes of sleep) and during the following 8-hour recovery night under constant posture conditions. Setting: Centre for Chronobiology, Psychiatric University Clinics, Basel, Switzerland Participants: Sixteen young (20–31 years) and 15 older (57–74 years) healthy volunteers Interventions: N/A. Measurements and Results: All-night EEG spectra revealed an increase in spindle activity (13–15.25 Hz) for both age groups, but only in the young did we find a significant decrease of delta activity (0.5–1.25 Hz) in response to low sleep pressure conditions, predominantly in occipital brain regions. However, delta activity during the first non-rapid eye movement (NREM) sleep episode was equally reduced in both age groups. This response lasted significantly longer in the young (across the first 2 NREM sleep episodes) than in the older participants (only the first NREM sleep episode). Conclusion: The initial EEG delta response to low sleep pressure was similar in healthy older and young participants. Therefore, age-related sleep deteriorations cannot solely be attributed to alterations in the homeostatic sleep-regulatory system. It is, rather, the interplay of circadian and homeostatic factors of sleep regulation, which is changed with aging. Citation: Munch M; Knoblauch V; Blatter K et al. Is homeostatic sleep regulation under low sleep pressure modified by age? SLEEP 2007;30(6):781-792. PMID:17580600

Effect of maternal exposure to ozone on reproductive outcome and immune, inflammatory, and allergic responses in the offspring

EPA Science Inventory

There is growing concern that exposure to air pollutants during pregnancy affects health outcomes in the offspring due to alterations in the development of immune and other homeostatic processes. To assess the risks of maternal inhalation exposure to ozone (O3), timed pregnant BA...

Immunity in Drosophila melanogaster--from microbial recognition to whole-organism physiology.

PubMed

Buchon, Nicolas; Silverman, Neal; Cherry, Sara

2014-12-01

Since the discovery of antimicrobial peptide responses 40 years ago, the fruit fly Drosophila melanogaster has proven to be a powerful model for the study of innate immunity. Early work focused on innate immune mechanisms of microbial recognition and subsequent nuclear factor-κB signal transduction. More recently, D. melanogaster has been used to understand how the immune response is regulated and coordinated at the level of the whole organism. For example, researchers have used this model in studies investigating interactions between the microbiota and the immune system at barrier epithelial surfaces that ensure proper nutritional and immune homeostasis both locally and systemically. In addition, studies in D. melanogaster have been pivotal in uncovering how the immune response is regulated by both endocrine and metabolic signalling systems, and how the immune response modifies these systems as part of a homeostatic circuit. In this Review, we briefly summarize microbial recognition and antiviral immunity in D. melanogaster, and we highlight recent studies that have explored the effects of organism-wide regulation of the immune response and, conversely, the effects of the immune response on organism physiology.

Photonic homeostatics

NASA Astrophysics Data System (ADS)

Liu, Timon C.; Li, Fan-Hui

2010-11-01

Photonic homeostatics is a discipline to study the establishment, maintenance, decay, upgrading and representation of function-specific homoestasis (FSH) by using photonics. FSH is a negative-feedback response of a biosystem to maintain the function-specific fluctuations inside the biosystem so that the function is perfectly performed. A stress may increase sirtuin 1 (SIRT1) activities above FSH-specific SIRT1 activity to induce a function far from its FSH. On the one hand, low level laser irradiation or monochromatic light (LLL) can not modulate a function in its FSH or a stress in its stress-specific homeostasis (StSH), but modulate a function far from its FSH or a stress far from its StSH. On the other hand, the biophotons from a biosystem with its function in its FSH should be less than the one from the biosystem with its function far from its FSH. The non-resonant interaction of low intensity laser irradiation or monochromatic light (LIL) and a kind of membrane protein can be amplified by all the membrane proteins if the function is far from its FSH. This amplification might hold for biophoton emission of the membrane protein so that the photonic spectroscopy can be used to represent the function far from its FSH, which is called photonomics.

Synapse-specific and compartmentalized expression of presynaptic homeostatic potentiation

PubMed Central

Li, Xiling; Goel, Pragya; Chen, Catherine; Angajala, Varun; Chen, Xun

2018-01-01

Postsynaptic compartments can be specifically modulated during various forms of synaptic plasticity, but it is unclear whether this precision is shared at presynaptic terminals. Presynaptic homeostatic plasticity (PHP) stabilizes neurotransmission at the Drosophila neuromuscular junction, where a retrograde enhancement of presynaptic neurotransmitter release compensates for diminished postsynaptic receptor functionality. To test the specificity of PHP induction and expression, we have developed a genetic manipulation to reduce postsynaptic receptor expression at one of the two muscles innervated by a single motor neuron. We find that PHP can be induced and expressed at a subset of synapses, over both acute and chronic time scales, without influencing transmission at adjacent release sites. Further, homeostatic modulations to CaMKII, vesicle pools, and functional release sites are compartmentalized and do not spread to neighboring pre- or post-synaptic structures. Thus, both PHP induction and expression mechanisms are locally transmitted and restricted to specific synaptic compartments. PMID:29620520

Non-homeostatic body weight regulation through a brainstem-restricted receptor for GDF15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsu, Jer-Yuan; Crawley, Suzanne; Chen, Michael

Under homeostatic conditions, animals use well-defined hypothalamic neural circuits to help maintain stable body weight, by integrating metabolic and hormonal signals from the periphery to balance food consumption and energy expenditure1,2. In stressed or disease conditions, however, animals use alternative neuronal pathways to adapt to the metabolic challenges of altered energy demand3. Recent studies have identified brain areas outside the hypothalamus that are activated under these ‘non-homeostatic’ conditions4,5,6, but the molecular nature of the peripheral signals and brain-localized receptors that activate these circuits remains elusive. Here we identify glial cell-derived neurotrophic factor (GDNF) receptor alpha-like (GFRAL) as a brainstem-restricted receptormore » for growth and differentiation factor 15 (GDF15). GDF15 regulates food intake, energy expenditure and body weight in response to metabolic and toxin-induced stresses; we show that Gfral knockout mice are hyperphagic under stressed conditions and are resistant to chemotherapy-induced anorexia and body weight loss. GDF15 activates GFRAL-expressing neurons localized exclusively in the area postrema and nucleus tractus solitarius of the mouse brainstem. It then triggers the activation of neurons localized within the parabrachial nucleus and central amygdala, which constitute part of the ‘emergency circuit’ that shapes feeding responses to stressful conditions7. GDF15 levels increase in response to tissue stress and injury, and elevated levels are associated with body weight loss in numerous chronic human diseases8,9. By isolating GFRAL as the receptor for GDF15-induced anorexia and weight loss, we identify a mechanistic basis for the non-homeostatic regulation of neural circuitry by a peripheral signal associated with tissue damage and stress. These findings provide opportunities to develop therapeutic agents for the treatment of disorders with altered energy demand.« less

Longitudinal Antigenic Sequences and Sites from Intra-Host Evolution (LASSIE) identifies immune-selected HIV variants

DOE PAGES

Hraber, Peter; Korber, Bette; Wagh, Kshitij; ...

2015-10-21

Within-host genetic sequencing from samples collected over time provides a dynamic view of how viruses evade host immunity. Immune-driven mutations might stimulate neutralization breadth by selecting antibodies adapted to cycles of immune escape that generate within-subject epitope diversity. Comprehensive identification of immune-escape mutations is experimentally and computationally challenging. With current technology, many more viral sequences can readily be obtained than can be tested for binding and neutralization, making down-selection necessary. Typically, this is done manually, by picking variants that represent different time-points and branches on a phylogenetic tree. Such strategies are likely to miss many relevant mutations and combinations ofmore » mutations, and to be redundant for other mutations. Longitudinal Antigenic Sequences and Sites from Intrahost Evolution (LASSIE) uses transmitted founder loss to identify virus “hot-spots” under putative immune selection and chooses sequences that represent recurrent mutations in selected sites. LASSIE favors earliest sequences in which mutations arise. Here, with well-characterized longitudinal Env sequences, we confirmed selected sites were concentrated in antibody contacts and selected sequences represented diverse antigenic phenotypes. Finally, practical applications include rapidly identifying immune targets under selective pressure within a subject, selecting minimal sets of reagents for immunological assays that characterize evolving antibody responses, and for immunogens in polyvalent “cocktail” vaccines.« less

Homeostatic modulation on unconscious hedonic responses to food.

PubMed

Sato, Wataru; Sawada, Reiko; Kubota, Yasutaka; Toichi, Motomi; Fushiki, Tohru

2017-10-26

Hedonic/affective responses to food play a critical role in eating behavior. Previous behavioral studies have shown that hedonic responses to food are elicited consciously and unconsciously. Although the studies also showed that hunger and satiation have a modulatory effect on conscious hedonic responses to food, the effect of these homeostatic states on unconscious hedonic responses to food remains unknown. We investigated unconscious hedonic responses to food in hungry and satiated participants using the subliminal affective priming paradigm. Food images or corresponding mosaic images were presented in the left or right peripheral visual field during 33 ms. Then photographs of target faces with emotionally neutral expressions were presented, and the participants evaluated their preference for the faces. Additionally, daily eating behaviors were assessed using questionnaires. Preference for the target faces was increased by food images relative to the mosaics in the hungry, but not the satiated, state. The difference in preference ratings between the food and mosaic conditions was positively correlated with the tendency for external eating in the hungry, but not the satiated, group. Our findings suggest that homeostatic states modulate unconscious hedonic responses to food and that this phenomenon is related to daily eating behaviors.

Mannose-binding lectin and the balance between immune protection and complication

PubMed Central

Takahashi, Kazue

2012-01-01

The innate immune system is evolutionarily ancient and biologically primitive. Historically, it was first identified as an element of the immune system that provides the first-line response to pathogens, and increasingly it is recognized for its central housekeeping role and its essential functions in tissue homeostasis, including coagulation and inflammation, among others. A pivotal link between the innate immune system and other functions is mannose-binding lectin (MBL), a pattern recognition molecule. Multiple studies have demonstrated that MBL deficiency increases susceptibility to infection, and the mechanisms associated with this susceptibility to infection include reduced opsonophagocytic killing and reduced activation of the lectin complement pathway. Results from our laboratory have demonstrated that MBL and MBL-associated serine protease (MASP)-1/3 together mediate coagulation factor-like activities, including thrombin-like activity. MBL and/or MASP-1/3-deficient hosts demonstrate in vivo evidence that MBL and MASP-1/3 are involved with hemostasis following injury. Staphylococcus aureus-infected MBL null mice developed disseminated intravascular coagulation, which was associated with elevated blood IL-6 levels (but not TNF-α) and systemic inflammatory responses. Infected MBL null mice also develop liver injury. These findings suggest that MBL deficiency may manifest as disseminated intravascular coagulation and organ failure with infection. Beginning from these observations, this review focuses on the interaction of innate immunity and other homeostatic systems, the derangement of which may lead to complications in infection and other inflammatory states. PMID:22114968

Homeostatic Regulation of Memory Systems and Adaptive Decisions

PubMed Central

Mizumori, Sheri JY; Jo, Yong Sang

2013-01-01

While it is clear that many brain areas process mnemonic information, understanding how their interactions result in continuously adaptive behaviors has been a challenge. A homeostatic-regulated prediction model of memory is presented that considers the existence of a single memory system that is based on a multilevel coordinated and integrated network (from cells to neural systems) that determines the extent to which events and outcomes occur as predicted. The “multiple memory systems of the brain” have in common output that signals errors in the prediction of events and/or their outcomes, although these signals differ in terms of what the error signal represents (e.g., hippocampus: context prediction errors vs. midbrain/striatum: reward prediction errors). The prefrontal cortex likely plays a pivotal role in the coordination of prediction analysis within and across prediction brain areas. By virtue of its widespread control and influence, and intrinsic working memory mechanisms. Thus, the prefrontal cortex supports the flexible processing needed to generate adaptive behaviors and predict future outcomes. It is proposed that prefrontal cortex continually and automatically produces adaptive responses according to homeostatic regulatory principles: prefrontal cortex may serve as a controller that is intrinsically driven to maintain in prediction areas an experience-dependent firing rate set point that ensures adaptive temporally and spatially resolved neural responses to future prediction errors. This same drive by prefrontal cortex may also restore set point firing rates after deviations (i.e. prediction errors) are detected. In this way, prefrontal cortex contributes to reducing uncertainty in prediction systems. An emergent outcome of this homeostatic view may be the flexible and adaptive control that prefrontal cortex is known to implement (i.e. working memory) in the most challenging of situations. Compromise to any of the prediction circuits should result

Homeostatic regulation of memory systems and adaptive decisions.

PubMed

Mizumori, Sheri J Y; Jo, Yong Sang

2013-11-01

While it is clear that many brain areas process mnemonic information, understanding how their interactions result in continuously adaptive behaviors has been a challenge. A homeostatic-regulated prediction model of memory is presented that considers the existence of a single memory system that is based on a multilevel coordinated and integrated network (from cells to neural systems) that determines the extent to which events and outcomes occur as predicted. The "multiple memory systems of the brain" have in common output that signals errors in the prediction of events and/or their outcomes, although these signals differ in terms of what the error signal represents (e.g., hippocampus: context prediction errors vs. midbrain/striatum: reward prediction errors). The prefrontal cortex likely plays a pivotal role in the coordination of prediction analysis within and across prediction brain areas. By virtue of its widespread control and influence, and intrinsic working memory mechanisms. Thus, the prefrontal cortex supports the flexible processing needed to generate adaptive behaviors and predict future outcomes. It is proposed that prefrontal cortex continually and automatically produces adaptive responses according to homeostatic regulatory principles: prefrontal cortex may serve as a controller that is intrinsically driven to maintain in prediction areas an experience-dependent firing rate set point that ensures adaptive temporally and spatially resolved neural responses to future prediction errors. This same drive by prefrontal cortex may also restore set point firing rates after deviations (i.e. prediction errors) are detected. In this way, prefrontal cortex contributes to reducing uncertainty in prediction systems. An emergent outcome of this homeostatic view may be the flexible and adaptive control that prefrontal cortex is known to implement (i.e. working memory) in the most challenging of situations. Compromise to any of the prediction circuits should result in

Homeostatic theory of obesity

PubMed Central

2015-01-01

Health is regulated by homeostasis, a property of all living things. Homeostasis maintains equilibrium at set-points using feedback loops for optimum functioning of the organism. Imbalances in homeostasis causing overweight and obesity are evident in more than 1 billion people. In a new theory, homeostatic obesity imbalance is attributed to a hypothesized ‘Circle of Discontent’, a system of feedback loops linking weight gain, body dissatisfaction, negative affect and over-consumption. The Circle of Discontent theory is consistent with an extensive evidence base. A four-armed strategy to halt the obesity epidemic consists of (1) putting a stop to victim-blaming, stigma and discrimination; (2) devalorizing the thin-ideal; (3) reducing consumption of energy-dense, low-nutrient foods and drinks; and (4) improving access to plant-based diets. If fully implemented, interventions designed to restore homeostasis have the potential to halt the obesity epidemic. PMID:28070357

Homeostatic reinforcement learning for integrating reward collection and physiological stability.

PubMed

Keramati, Mehdi; Gutkin, Boris

2014-12-02

Efficient regulation of internal homeostasis and defending it against perturbations requires adaptive behavioral strategies. However, the computational principles mediating the interaction between homeostatic and associative learning processes remain undefined. Here we use a definition of primary rewards, as outcomes fulfilling physiological needs, to build a normative theory showing how learning motivated behaviors may be modulated by internal states. Within this framework, we mathematically prove that seeking rewards is equivalent to the fundamental objective of physiological stability, defining the notion of physiological rationality of behavior. We further suggest a formal basis for temporal discounting of rewards by showing that discounting motivates animals to follow the shortest path in the space of physiological variables toward the desired setpoint. We also explain how animals learn to act predictively to preclude prospective homeostatic challenges, and several other behavioral patterns. Finally, we suggest a computational role for interaction between hypothalamus and the brain reward system.

Homeostatic structural plasticity can account for topology changes following deafferentation and focal stroke.

PubMed

Butz, Markus; Steenbuck, Ines D; van Ooyen, Arjen

2014-01-01

After brain lesions caused by tumors or stroke, or after lasting loss of input (deafferentation), inter- and intra-regional brain networks respond with complex changes in topology. Not only areas directly affected by the lesion but also regions remote from the lesion may alter their connectivity-a phenomenon known as diaschisis. Changes in network topology after brain lesions can lead to cognitive decline and increasing functional disability. However, the principles governing changes in network topology are poorly understood. Here, we investigated whether homeostatic structural plasticity can account for changes in network topology after deafferentation and brain lesions. Homeostatic structural plasticity postulates that neurons aim to maintain a desired level of electrical activity by deleting synapses when neuronal activity is too high and by providing new synaptic contacts when activity is too low. Using our Model of Structural Plasticity, we explored how local changes in connectivity induced by a focal loss of input affected global network topology. In accordance with experimental and clinical data, we found that after partial deafferentation, the network as a whole became more random, although it maintained its small-world topology, while deafferentated neurons increased their betweenness centrality as they rewired and returned to the homeostatic range of activity. Furthermore, deafferentated neurons increased their global but decreased their local efficiency and got longer tailed degree distributions, indicating the emergence of hub neurons. Together, our results suggest that homeostatic structural plasticity may be an important driving force for lesion-induced network reorganization and that the increase in betweenness centrality of deafferentated areas may hold as a biomarker for brain repair.

Identifying Immune Drivers of Gulf War Illness Using Novel Daily Sampling Approach

DTIC Science & Technology

2013-10-01

of Gulf War Illness (GWI). We are targeting an enrollment of 60 men (40 veterans with GWI, 10 veterans with no GWI, and 10 with fibromyalgia ) over... treatment of the disorder. In order to make gains in curing GWI, it is essential that we develop objective, physiologic-based tests for the disorder...and identify physiological targets for treatments . The major aim of this research project is to identify aspects of the immune system that are

De Novo Assembly of the Japanese Flounder (Paralichthys olivaceus) Spleen Transcriptome to Identify Putative Genes Involved in Immunity

PubMed Central

Huang, Lin; Li, Guiyang; Mo, Zhaolan; Xiao, Peng; Li, Jie; Huang, Jie

2015-01-01

Background Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Asia and has suffered from disease outbreaks caused by various pathogens, which requires more information for immune relevant genes on genome background. However, genomic and transcriptomic data for Japanese flounder remain scarce, which limits studies on the immune system of this species. In this study, we characterized the Japanese flounder spleen transcriptome using an Illumina paired-end sequencing platform to identify putative genes involved in immunity. Methodology/Principal Findings A cDNA library from the spleen of P. olivaceus was constructed and randomly sequenced using an Illumina technique. The removal of low quality reads generated 12,196,968 trimmed reads, which assembled into 96,627 unigenes. A total of 21,391 unigenes (22.14%) were annotated in the NCBI Nr database, and only 1.1% of the BLASTx top-hits matched P. olivaceus protein sequences. Approximately 12,503 (58.45%) unigenes were categorized into three Gene Ontology groups, 19,547 (91.38%) were classified into 26 Cluster of Orthologous Groups, and 10,649 (49.78%) were assigned to six Kyoto Encyclopedia of Genes and Genomes pathways. Furthermore, 40,928 putative simple sequence repeats and 47, 362 putative single nucleotide polymorphisms were identified. Importantly, we identified 1,563 putative immune-associated unigenes that mapped to 15 immune signaling pathways. Conclusions/Significance The P. olivaceus transciptome data provides a rich source to discover and identify new genes, and the immune-relevant sequences identified here will facilitate our understanding of the mechanisms involved in the immune response. Furthermore, the plentiful potential SSRs and SNPs found in this study are important resources with respect to future development of a linkage map or marker assisted breeding programs for the flounder. PMID:25723398

A systems model for immune cell interactions unravels the mechanism of inflammation in human skin.

PubMed

Valeyev, Najl V; Hundhausen, Christian; Umezawa, Yoshinori; Kotov, Nikolay V; Williams, Gareth; Clop, Alex; Ainali, Crysanthi; Ouzounis, Christos; Tsoka, Sophia; Nestle, Frank O

2010-12-02

Inflammation is characterized by altered cytokine levels produced by cell populations in a highly interdependent manner. To elucidate the mechanism of an inflammatory reaction, we have developed a mathematical model for immune cell interactions via the specific, dose-dependent cytokine production rates of cell populations. The model describes the criteria required for normal and pathological immune system responses and suggests that alterations in the cytokine production rates can lead to various stable levels which manifest themselves in different disease phenotypes. The model predicts that pairs of interacting immune cell populations can maintain homeostatic and elevated extracellular cytokine concentration levels, enabling them to operate as an immune system switch. The concept described here is developed in the context of psoriasis, an immune-mediated disease, but it can also offer mechanistic insights into other inflammatory pathologies as it explains how interactions between immune cell populations can lead to disease phenotypes.

Endocannabinoids and the Immune System in Health and Disease.

PubMed

Cabral, Guy A; Ferreira, Gabriela A; Jamerson, Melissa J

2015-01-01

Endocannabinoids are bioactive lipids that have the potential to signal through cannabinoid receptors to modulate the functional activities of a variety of immune cells. Their activation of these seven-transmembranal, G protein-coupled receptors sets in motion a series of signal transductional events that converge at the transcriptional level to regulate cell migration and the production of cytokines and chemokines. There is a large body of data that supports a functional relevance for 2-arachidonoylglycerol (2-AG) as acting through the cannabinoid receptor type 2 (CB2R) to inhibit migratory activities for a diverse array of immune cell types. However, unequivocal data that supports a functional linkage of anandamide (AEA) to a cannabinoid receptor in immune modulation remains to be obtained. Endocannabinoids, as typical bioactive lipids, have a short half-life and appear to act in an autocrine and paracrine fashion. Their immediate effective action on immune function may be at localized sites in the periphery and within the central nervous system. It is speculated that endocannabinoids play an important role in maintaining the overall "fine-tuning" of the immune homeostatic balance within the host.

Homeostatic Signals do not Drive Post-thymic T cell Maturation

PubMed Central

Houston, Evan G.; Boursalian, Tamar E.; Fink, Pamela J.

2012-01-01

Recent thymic emigrants, the youngest T cells in the lymphoid periphery, undergo a 3-week-long period of functional and phenotypic maturation before being incorporated into the pool of mature, naïve T cells. Previous studies indicate that this maturation requires T cell exit from the thymus and access to secondary lymphoid organs, but is MHC-independent. We now show that post-thymic T cell maturation is independent of homeostatic and costimulatory pathways, requiring neither signals delivered by IL-7 nor CD80/86. Furthermore, while CCR7/CCL19,21-regulated homing of recent thymic emigrants to the T cell zones within the secondary lymphoid organs is not required for post-thymic T cell maturation, an intact dendritic cell compartment modulates this process. It is thus clear that, unlike T cell development and homeostasis, post-thymic maturation is focused not on interrogating the T cell receptor or the cell’s responsiveness to homeostatic or costimulatory signals, but on some as yet unrecognized property. PMID:22398309

Homeostatic reinforcement learning for integrating reward collection and physiological stability

PubMed Central

Keramati, Mehdi; Gutkin, Boris

2014-01-01

Efficient regulation of internal homeostasis and defending it against perturbations requires adaptive behavioral strategies. However, the computational principles mediating the interaction between homeostatic and associative learning processes remain undefined. Here we use a definition of primary rewards, as outcomes fulfilling physiological needs, to build a normative theory showing how learning motivated behaviors may be modulated by internal states. Within this framework, we mathematically prove that seeking rewards is equivalent to the fundamental objective of physiological stability, defining the notion of physiological rationality of behavior. We further suggest a formal basis for temporal discounting of rewards by showing that discounting motivates animals to follow the shortest path in the space of physiological variables toward the desired setpoint. We also explain how animals learn to act predictively to preclude prospective homeostatic challenges, and several other behavioral patterns. Finally, we suggest a computational role for interaction between hypothalamus and the brain reward system. DOI: http://dx.doi.org/10.7554/eLife.04811.001 PMID:25457346

Defensin-barbed innate immunity: clinical associations in the pediatric population.

PubMed

Underwood, Mark A; Bevins, Charles L

2010-06-01

Defensins and related antimicrobial peptides serve a central role in innate immunity in all species of plants and animals. In humans, defensins are widely expressed, including in neutrophils, skin, and mucosal epithelia. Most defensins are potent antibiotics, and some have chemotactic and toxin-neutralizing activities. Results of recent studies on the homeostatic and disease-fighting activities of human defensins point to a key relevance in several pediatric disorders. Inherited variation in defensin gene expression may contribute to susceptibility to several diseases, including psoriasis and Crohn disease. We review here the recent discoveries in innate immunity that shed light on the potential roles of defensins, and other antimicrobial molecules, in the pathophysiology of common pediatric diseases such as atopic dermatitis, necrotizing enterocolitis, cystic fibrosis, and otitis media.

C. elegans Body Cavity Neurons Are Homeostatic Sensors that Integrate Fluctuations in Oxygen Availability and Internal Nutrient Reserves.

PubMed

Witham, Emily; Comunian, Claudio; Ratanpal, Harkaranveer; Skora, Susanne; Zimmer, Manuel; Srinivasan, Supriya

2016-02-23

It is known that internal physiological state, or interoception, influences CNS function and behavior. However, the neurons and mechanisms that integrate sensory information with internal physiological state remain largely unknown. Here, we identify C. elegans body cavity neurons called URX(L/R) as central homeostatic sensors that integrate fluctuations in oxygen availability with internal metabolic state. We show that depletion of internal body fat reserves increases the tonic activity of URX neurons, which influences the magnitude of the evoked sensory response to oxygen. These responses are integrated via intracellular cGMP and Ca(2+). The extent of neuronal activity thus reflects the balance between the perception of oxygen and available fat reserves. The URX homeostatic sensor ensures that neural signals that stimulate fat loss are only deployed when there are sufficient fat reserves to do so. Our results uncover an interoceptive neuroendocrine axis that relays internal state information to the nervous system. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Extracellular cell stress (heat shock) proteins-immune responses and disease: an overview.

PubMed

Pockley, A Graham; Henderson, Brian

2018-01-19

Extracellular cell stress proteins are highly conserved phylogenetically and have been shown to act as powerful signalling agonists and receptors for selected ligands in several different settings. They also act as immunostimulatory 'danger signals' for the innate and adaptive immune systems. Other studies have shown that cell stress proteins and the induction of immune reactivity to self-cell stress proteins can attenuate disease processes. Some proteins (e.g. Hsp60, Hsp70, gp96) exhibit both inflammatory and anti-inflammatory properties, depending on the context in which they encounter responding immune cells. The burgeoning literature reporting the presence of stress proteins in a range of biological fluids in healthy individuals/non-diseased settings, the association of extracellular stress protein levels with a plethora of clinical and pathological conditions and the selective expression of a membrane form of Hsp70 on cancer cells now supports the concept that extracellular cell stress proteins are involved in maintaining/regulating organismal homeostasis and in disease processes and phenotype. Cell stress proteins, therefore, form a biologically complex extracellular cell stress protein network having diverse biological, homeostatic and immunomodulatory properties, the understanding of which offers exciting opportunities for delivering novel approaches to predict, identify, diagnose, manage and treat disease.This article is part of the theme issue 'Heat shock proteins as modulators and therapeutic targets of chronic disease: an integrated perspective'. © 2017 The Author(s).

Costs of mounting an immune response during pregnancy in a lizard.

PubMed

Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald

2013-01-01

Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

A leukocyte activation test identifies food items which induce release of DNA by innate immune peripheral blood leucocytes.

PubMed

Garcia-Martinez, Irma; Weiss, Theresa R; Yousaf, Muhammad N; Ali, Ather; Mehal, Wajahat Z

2018-01-01

Leukocyte activation (LA) testing identifies food items that induce a patient specific cellular response in the immune system, and has recently been shown in a randomized double blinded prospective study to reduce symptoms in patients with irritable bowel syndrome (IBS). We hypothesized that test reactivity to particular food items, and the systemic immune response initiated by these food items, is due to the release of cellular DNA from blood immune cells. We tested this by quantifying total DNA concentration in the cellular supernatant of immune cells exposed to positive and negative foods from 20 healthy volunteers. To establish if the DNA release by positive samples is a specific phenomenon, we quantified myeloperoxidase (MPO) in cellular supernatants. We further assessed if a particular immune cell population (neutrophils, eosinophils, and basophils) was activated by the positive food items by flow cytometry analysis. To identify the signaling pathways that are required for DNA release we tested if specific inhibitors of key signaling pathways could block DNA release. Foods with a positive LA test result gave a higher supernatant DNA content when compared to foods with a negative result. This was specific as MPO levels were not increased by foods with a positive LA test. Protein kinase C (PKC) inhibitors resulted in inhibition of positive food stimulated DNA release. Positive foods resulted in CD63 levels greater than negative foods in eosinophils in 76.5% of tests. LA test identifies food items that result in release of DNA and activation of peripheral blood innate immune cells in a PKC dependent manner, suggesting that this LA test identifies food items that result in release of inflammatory markers and activation of innate immune cells. This may be the basis for the improvement in symptoms in IBS patients who followed an LA test guided diet.

The motilin agonist erythromycin increases hunger by modulating homeostatic and hedonic brain circuits in healthy women: a randomized, placebo-controlled study.

PubMed

Zhao, Dongxing; Meyer-Gerspach, Anne Christin; Deloose, Eveline; Iven, Julie; Weltens, Nathalie; Depoortere, Inge; O'daly, Owen; Tack, Jan; Van Oudenhove, Lukas

2018-01-29

The motilin agonist, erythromycin, induces gastric phase III of the migrating motor complex, which in turn generates hunger peaks. To identify the brain mechanisms underlying these orexigenic effects, 14 healthy women participated in a randomized, placebo-controlled crossover study. Functional magnetic resonance brain images were acquired for 50 minutes interprandially. Intravenous infusion of erythromycin (40 mg) or saline started 10 minutes after the start of scanning. Blood samples (for glucose and hormone levels) and hunger ratings were collected at fixed timepoints. Thirteen volunteers completed the study, without any adverse events. Brain regions involved in homeostatic and hedonic control of appetite and food intake responded to erythromycin, including pregenual anterior cingulate cortex, anterior insula cortex, orbitofrontal cortex, amygdala, caudate, pallidum and putamen bilaterally, right accumbens, hypothalamus, and midbrain. Octanoylated ghrelin levels decreased, whereas both glucose and insulin increased after erythromycin. Hunger were higher after erythromycin, and these differences covaried with the brain response in most of the abovementioned regions. The motilin agonist erythromycin increases hunger by modulating neurocircuitry related to homeostatic and hedonic control of appetite and feeding. These results confirm recent behavioural findings identifying motilin as a key orexigenic hormone in humans, and identify the brain mechanisms underlying its effect.

The Homeostatic Regulation of REM Sleep: A role for Localized Expression of Brain-Derived Neurotrophic Factor in the Brainstem

PubMed Central

Datta, Subimal; Knapp, Clifford M.; Koul-Tiwari, Richa; Barnes, Abigail

2015-01-01

Homeostatic regulation of REM sleep plays a key role in neural plasticity and deficits in this process are implicated in the development of many neuropsychiatric disorders. Little is known, however, about the molecular mechanisms that underlie this homeostatic regulation process. This study examined the hypothesis that, during selective REM sleep deprivation (RSD), increased brain-derived neurotrophic factor (BDNF) expression in REM sleep regulating areas is critical for the development of homeostatic drive for REM sleep, as measured by an increase in the number of REM sleep transitions. Rats were assigned to RSD, non-sleep deprived (BSL), or total sleep deprivation (TSD) groups. Physiological recordings were obtained from cortical, hippocampal, and pontine EEG electrodes over a 6-hour period, in which sleep deprivation occurred during the first 3 hours. In the RSD, but not the other conditions, homeostatic drive for REM sleep increased progressively. BDNF protein expression was significantly greater in the pedunculopontine tegmentum (PPT) and subcoeruleus nucleus (SubCD) in the RSD as compared to the TSD and BSL groups, areas that regulate REM sleep, but not in the medial preoptic area, which regulates non-REM sleep. There was a significant positive correlation between RSD-induced increases in number of REM sleep episodes and increased BDNF expression in the PPT and SubCD. These increases positively correlated with levels of homeostatic drive for REM sleep. These results, for the first time, suggest that selective RSD-induced increased expression of BDNF in the PPT and SubCD are determinant factors in the development of the homeostatic drive for REM sleep. PMID:26146031

Zinc as a Gatekeeper of Immune Function

PubMed Central

Wessels, Inga; Maywald, Martina; Rink, Lothar

2017-01-01

After the discovery of zinc deficiency in the 1960s, it soon became clear that zinc is essential for the function of the immune system. Zinc ions are involved in regulating intracellular signaling pathways in innate and adaptive immune cells. Zinc homeostasis is largely controlled via the expression and action of zinc “importers” (ZIP 1–14), zinc “exporters” (ZnT 1–10), and zinc-binding proteins. Anti-inflammatory and anti-oxidant properties of zinc have long been documented, however, underlying mechanisms are still not entirely clear. Here, we report molecular mechanisms underlying the development of a pro-inflammatory phenotype during zinc deficiency. Furthermore, we describe links between altered zinc homeostasis and disease development. Consequently, the benefits of zinc supplementation for a malfunctioning immune system become clear. This article will focus on underlying mechanisms responsible for the regulation of cellular signaling by alterations in zinc homeostasis. Effects of fast zinc flux, intermediate “zinc waves”, and late homeostatic zinc signals will be discriminated. Description of zinc homeostasis-related effects on the activation of key signaling molecules, as well as on epigenetic modifications, are included to emphasize the role of zinc as a gatekeeper of immune function. PMID:29186856

Immune responses in age-related macular degeneration and a possible long-term therapeutic strategy for prevention.

PubMed

Nussenblatt, Robert B; Lee, Richard W J; Chew, Emily; Wei, Lai; Liu, Baoying; Sen, H Nida; Dick, Andrew D; Ferris, Frederick L

2014-07-01

To describe the immune alterations associated with age-related macular degeneration (AMD); and, based on these findings, to offer an approach to possibly prevent the expression of late disease. Perspective. Review of the existing literature dealing with epidemiology, models, and immunologic findings in patients. Significant genetic associations have been identified and reported, but environmentally induced (including epigenetic) changes are also an important consideration. Immune alterations include a strong interleukin 17 family signature as well as marked expression of these molecules in the eye. Oxidative stress as well as other homeostatic altering mechanisms occur throughout life. With this immune dysregulation there is a rationale for considering immunotherapy. Indeed, immunotherapy has been shown to affect the late stages of AMD. Immune dysregulation appears to be an underlying alteration in AMD, as in other diseases thought to be degenerative and attributable to aging. Para-inflammation and immunosenescence may importantly contribute to the development of disease. The role of complement factor H still needs to be better defined, but in light of its association with ocular inflammatory conditions such as sarcoidosis, it does not appear to be unique to AMD but rather may be a marker for retinal pigment epithelium function. With the strong interleukin 17 family signature and the need to treat early on in the disease process, oral tolerance may be considered to prevent disease progression. Published by Elsevier Inc.

Homeostatic signals do not drive post-thymic T cell maturation.

PubMed

Houston, Evan G; Boursalian, Tamar E; Fink, Pamela J

2012-01-01

Recent thymic emigrants, the youngest T cells in the lymphoid periphery, undergo a 3 week-long period of functional and phenotypic maturation before being incorporated into the pool of mature, naïve T cells. Previous studies indicate that this maturation requires T cell exit from the thymus and access to secondary lymphoid organs, but is MHC-independent. We now show that post-thymic T cell maturation is independent of homeostatic and costimulatory pathways, requiring neither signals delivered by IL-7 nor CD80/86. Furthermore, while CCR7/CCL19,21-regulated homing of recent thymic emigrants to the T cell zones within the secondary lymphoid organs is not required for post-thymic T cell maturation, an intact dendritic cell compartment modulates this process. It is thus clear that, unlike T cell development and homeostasis, post-thymic maturation is focused not on interrogating the T cell receptor or the cell's responsiveness to homeostatic or costimulatory signals, but on some as yet unrecognized property. Copyright © 2012 Elsevier Inc. All rights reserved.

Endothelial cells: From innocent bystanders to active participants in immune responses.

PubMed

Al-Soudi, A; Kaaij, M H; Tas, S W

2017-09-01

The endothelium is crucially important for the delivery of oxygen and nutrients throughout the body under homeostatic conditions. However, it also contributes to pathology, including the initiation and perpetuation of inflammation. Understanding the function of endothelial cells (ECs) in inflammatory diseases and molecular mechanisms involved may lead to novel approaches to dampen inflammation and restore homeostasis. In this article, we discuss the various functions of ECs in inflammation with a focus on pathological angiogenesis, attraction of immune cells, antigen presentation, immunoregulatory properties and endothelial-to-mesenchymal transition (EndMT). We also review the current literature on approaches to target these processes in ECs to modulate immune responses and advance anti-inflammatory therapies. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

Comparative Proteomics Identifies Host Immune System Proteins Affected by Infection with Mycobacterium bovis

PubMed Central

López, Vladimir; Villar, Margarita; Queirós, João; Vicente, Joaquín; Mateos-Hernández, Lourdes; Díez-Delgado, Iratxe; Contreras, Marinela; Alves, Paulo C.; Alberdi, Pilar; Gortázar, Christian; de la Fuente, José

2016-01-01

Mycobacteria of the Mycobacterium tuberculosis complex (MTBC) greatly impact human and animal health worldwide. The mycobacterial life cycle is complex, and the mechanisms resulting in pathogen infection and survival in host cells are not fully understood. Eurasian wild boar (Sus scrofa) are natural reservoir hosts for MTBC and a model for mycobacterial infection and tuberculosis (TB). In the wild boar TB model, mycobacterial infection affects the expression of innate and adaptive immune response genes in mandibular lymph nodes and oropharyngeal tonsils, and biomarkers have been proposed as correlates with resistance to natural infection. However, the mechanisms used by mycobacteria to manipulate host immune response are not fully characterized. Our hypothesis is that the immune system proteins under-represented in infected animals, when compared to uninfected controls, are used by mycobacteria to guarantee pathogen infection and transmission. To address this hypothesis, a comparative proteomics approach was used to compare host response between uninfected (TB-) and M. bovis-infected young (TB+) and adult animals with different infection status [TB lesions localized in the head (TB+) or affecting multiple organs (TB++)]. The results identified host immune system proteins that play an important role in host response to mycobacteria. Calcium binding protein A9, Heme peroxidase, Lactotransferrin, Cathelicidin and Peptidoglycan-recognition protein were under-represented in TB+ animals when compared to uninfected TB- controls, but protein levels were higher as infection progressed in TB++ animals when compared to TB- and/or TB+ adult wild boar. MHCI was the only protein over-represented in TB+ adult wild boar when compared to uninfected TB- controls. The results reported here suggest that M. bovis manipulates host immune response by reducing the production of immune system proteins. However, as infection progresses, wild boar immune response recovers to limit pathogen

Nutritionally mediated programming of the developing immune system.

PubMed

Palmer, Amanda C

2011-09-01

A growing body of evidence highlights the importance of a mother's nutrition from preconception through lactation in programming the emerging organ systems and homeostatic pathways of her offspring. The developing immune system may be particularly vulnerable. Indeed, examples of nutrition-mediated immune programming can be found in the literature on intra-uterine growth retardation, maternal micronutrient deficiencies, and infant feeding. Current models of immune ontogeny depict a "layered" expansion of increasingly complex defenses, which may be permanently altered by maternal malnutrition. One programming mechanism involves activation of the maternal hypothalamic-pituitary-adrenal axis in response to nutritional stress. Fetal or neonatal exposure to elevated stress hormones is linked in animal studies to permanent changes in neuroendocrine-immune interactions, with diverse manifestations such as an attenuated inflammatory response or reduced resistance to tumor colonization. Maternal malnutrition may also have a direct influence, as evidenced by nutrient-driven epigenetic changes to developing T regulatory cells and subsequent risk of allergy or asthma. A 3rd programming pathway involves placental or breast milk transfer of maternal immune factors with immunomodulatory functions (e.g. cytokines). Maternal malnutrition can directly affect transfer mechanisms or influence the quality or quantity of transferred factors. The public health implications of nutrition-mediated immune programming are of particular importance in the developing world, where prevalent maternal undernutrition is coupled with persistent infectious challenges. However, early alterations to the immune system, resulting from either nutritional deficiencies or excesses, have broad relevance for immune-mediated diseases, such as asthma, and chronic inflammatory conditions like cardiovascular disease.

Blaming the brain for obesity: Integration of hedonic and homeostatic mechanisms

PubMed Central

Berthoud, Hans-Rudolf; Münzberg, Heike; Morrison, Christopher D.

2017-01-01

The brain plays a key role in the controls of energy intake and expenditure and many genes associated with obesity are expressed in the central nervous system. Technological and conceptual advances in both basic and clinical neurosciences have expanded the traditional view of homeostatic regulation of body weight by mainly the hypothalamus to include hedonic controls of appetite by cortical and subcortical brain areas processing external sensory information, reward, cognition, and executive functions. Thus, hedonic controls interact with homeostatic controls to regulate body weight in a flexible and adaptive manner that takes environmental conditions into account. This new conceptual framework has several important implications for the treatment of obesity. Because much of this interactive neural processing is outside awareness, cognitive restraint in a world of plenty is made difficult and prevention and treatment of obesity should be more rationally directed to the complex and often redundant mechanisms underlying this interaction. PMID:28192106

Heart rate variability and pain: associations of two interrelated homeostatic processes.

PubMed

Appelhans, Bradley M; Luecken, Linda J

2008-02-01

Between-person variability in pain sensitivity remains poorly understood. Given a conceptualization of pain as a homeostatic emotion, we hypothesized inverse associations between measures of resting heart rate variability (HRV), an index of autonomic regulation of heart rate that has been linked to emotionality, and sensitivity to subsequently administered thermal pain. Resting electrocardiography was collected, and frequency-domain measures of HRV were derived through spectral analysis. Fifty-nine right-handed participants provided ratings of pain intensity and unpleasantness following exposure to 4 degrees C thermal pain stimulation, and indicated their thresholds for barely noticeable and moderate pain during three exposures to decreasing temperature. Greater low-frequency HRV was associated with lower ratings of 4 degrees C pain unpleasantness and higher thresholds for barely noticeable and moderate pain. High-frequency HRV was unrelated to measures of pain sensitivity. Findings suggest pain sensitivity is influenced by characteristics of a central homeostatic system also involved in emotion.

The homeostatic regulation of REM sleep: A role for localized expression of brain-derived neurotrophic factor in the brainstem.

PubMed

Datta, Subimal; Knapp, Clifford M; Koul-Tiwari, Richa; Barnes, Abigail

2015-10-01

Homeostatic regulation of REM sleep plays a key role in neural plasticity and deficits in this process are implicated in the development of many neuropsychiatric disorders. Little is known, however, about the molecular mechanisms that underlie this homeostatic regulation process. This study examined the hypothesis that, during selective REM sleep deprivation (RSD), increased brain-derived neurotrophic factor (BDNF) expression in REM sleep regulating areas is critical for the development of homeostatic drive for REM sleep, as measured by an increase in the number of REM sleep transitions. Rats were assigned to RSD, non-sleep deprived (BSL), or total sleep deprivation (TSD) groups. Physiological recordings were obtained from cortical, hippocampal, and pontine EEG electrodes over a 6h period, in which sleep deprivation occurred during the first 3h. In the RSD, but not the other conditions, homeostatic drive for REM sleep increased progressively. BDNF protein expression was significantly greater in the pedunculopontine tegmentum (PPT) and subcoeruleus nucleus (SubCD) in the RSD as compared to the TSD and BSL groups, areas that regulate REM sleep, but not in the medial preoptic area, which regulates non-REM sleep. There was a significant positive correlation between RSD-induced increases in number of REM sleep episodes and increased BDNF expression in the PPT and SubCD. These increases positively correlated with levels of homeostatic drive for REM sleep. These results, for the first time, suggest that selective RSD-induced increased expression of BDNF in the PPT and SubCD are determinant factors in the development of the homeostatic drive for REM sleep. Copyright © 2015 Elsevier B.V. All rights reserved.

Uridine homeostatic disorder leads to DNA damage and tumorigenesis.

PubMed

Cao, Zhe; Ma, Jun; Chen, Xinchun; Zhou, Boping; Cai, Chuan; Huang, Dan; Zhang, Xuewen; Cao, Deliang

2016-03-28

Uridine is a natural nucleoside precursor of uridine monophosphate in organisms and thus is considered to be safe and is used in a wide range of clinical settings. The far-reaching effects of pharmacological uridine have long been neglected. Here, we report that the homeostatic disorder of uridine is carcinogenic. Targeted disruption (-/-) of murine uridine phosphorylase (UPase) disrupted the homeostasis of uridine and increased spontaneous tumorigenesis by more than 3-fold. Multiple tumors (e.g., lymphoma, hepatoma and lung adenoma) occurred simultaneously in some UPase deficient mice, but not in wild-type mice raised under the same conditions. In the tissue from UPase -/- mice, the 2'-deoxyuridine,5'-triphosphate (dUTP) levels and uracil DNA were increased and p53 was activated with an increased phospho-Ser18 p53 level. Exposing cell lines (e.g., MCF-7, RKO, HCT-8 and NCI-H460) to uridine (10 or 30 µM) led to uracil DNA damage and p53 activation, which in turn triggered the DNA damage response. In these cells, phospho-ATM, phospho-CHK2, and phospho-γH2AX were increased by uridine. These data suggest that uridine homeostatic disorder leads to uracil DNA damage and that pharmacological uridine may be carcinogenic. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Using administrative claims to identify children with chronic conditions in a statewide immunization registry.

PubMed

Dombkowski, Kevin J; Costello, Lauren; Dong, Shiming; Clark, Sarah J

2014-05-01

To demonstrate the feasibility and utility of using administrative claims data from commercial health plans to establish a high-risk indicator in a statewide immunization registry for enrollees with chronic conditions. Retrospective cohort analysis. Administrative data were used to identify children with 1 or more chronic conditions enrolled in 2 commercial health plans during the 2008-2009 and 2009-2010 influenza seasons and matched with a statewide immunization registry. The proportion of cases that successfully matched and historical health services utilization, including influenza vaccinations and missed opportunities, were assessed. A total of 93% of children with chronic conditions identified through administrative claims were successfully matched with the statewide registry. Less than one-third of children received the seasonal influenza vaccine in either the 2008-2009 (29%) or 2009-2010 (32%) seasons; 30% of children received the H1N1 vaccination in 2009-2010. Most children in the 2008-2009 (63%) and 2009-2010 (63%) seasons had at least 1 missed opportunity for seasonal influenza vaccination. Younger children had the highest percentage of missed opportunities while adolescents had the lowest rate of missed opportunities for vaccination. Conclusions It is feasible to identify children with chronic conditions using administrative data and to link them with a statewide immunization registry. Low influenza vaccination rates and high occurrences of missed opportunities among children with chronic conditions suggest the utility of integrating administrative claims data with statewide registries to support various outreach mechanisms, including physician-focused and parent-targeted reminder/recall, based on target age to improve vaccination rates.

Homeostatic and Circadian Contribution to EEG and Molecular State Variables of Sleep Regulation

PubMed Central

Curie, Thomas; Mongrain, Valérie; Dorsaz, Stéphane; Mang, Géraldine M.; Emmenegger, Yann; Franken, Paul

2013-01-01

Study Objectives: Besides their well-established role in circadian rhythms, our findings that the forebrain expression of the clock-genes Per2 and Dbp increases and decreases, respectively, in relation to time spent awake suggest they also play a role in the homeostatic aspect of sleep regulation. Here, we determined whether time of day modulates the effects of elevated sleep pressure on clock-gene expression. Time of day effects were assessed also for recognized electrophysiological (EEG delta power) and molecular (Homer1a) markers of sleep homeostasis. Design: EEG and qPCR data were obtained for baseline and recovery from 6-h sleep deprivation starting at ZT0, -6, -12, or -18. Setting: Mouse sleep laboratory. Participants: Male mice. Interventions: Sleep deprivation. Results: The sleep-deprivation induced changes in Per2 and Dbp expression importantly varied with time of day, such that Per2 could even decrease during sleep deprivations occurring at the decreasing phase in baseline. Dbp showed similar, albeit opposite dynamics. These unexpected results could be reliably predicted assuming that these transcripts behave according to a driven damped harmonic oscillator. As expected, the sleep-wake distribution accounted for a large degree of the changes in EEG delta power and Homer1a. Nevertheless, the sleep deprivation-induced increase in delta power varied also with time of day with higher than expected levels when recovery sleep started at dark onset. Conclusions: Per2 and delta power are widely used as exclusive state variables of the circadian and homeostatic process, respectively. Our findings demonstrate a considerable cross-talk between these two processes. As Per2 in the brain responds to both sleep loss and time of day, this molecule is well positioned to keep track of and to anticipate homeostatic sleep need. Citation: Curie T; Mongrain V; Dorsaz S; Mang GM; Emmenegger Y; Franken P. Homeostatic and circadian contribution to EEG and molecular state

Homeostatic and circadian contribution to EEG and molecular state variables of sleep regulation.

PubMed

Curie, Thomas; Mongrain, Valérie; Dorsaz, Stéphane; Mang, Géraldine M; Emmenegger, Yann; Franken, Paul

2013-03-01

Besides their well-established role in circadian rhythms, our findings that the forebrain expression of the clock-genes Per2 and Dbp increases and decreases, respectively, in relation to time spent awake suggest they also play a role in the homeostatic aspect of sleep regulation. Here, we determined whether time of day modulates the effects of elevated sleep pressure on clock-gene expression. Time of day effects were assessed also for recognized electrophysiological (EEG delta power) and molecular (Homer1a) markers of sleep homeostasis. EEG and qPCR data were obtained for baseline and recovery from 6-h sleep deprivation starting at ZT0, -6, -12, or -18. Mouse sleep laboratory. Male mice. Sleep deprivation. The sleep-deprivation induced changes in Per2 and Dbp expression importantly varied with time of day, such that Per2 could even decrease during sleep deprivations occurring at the decreasing phase in baseline. Dbp showed similar, albeit opposite dynamics. These unexpected results could be reliably predicted assuming that these transcripts behave according to a driven damped harmonic oscillator. As expected, the sleep-wake distribution accounted for a large degree of the changes in EEG delta power and Homer1a. Nevertheless, the sleep deprivation-induced increase in delta power varied also with time of day with higher than expected levels when recovery sleep started at dark onset. Per2 and delta power are widely used as exclusive state variables of the circadian and homeostatic process, respectively. Our findings demonstrate a considerable cross-talk between these two processes. As Per2 in the brain responds to both sleep loss and time of day, this molecule is well positioned to keep track of and to anticipate homeostatic sleep need. Curie T; Mongrain V; Dorsaz S; Mang GM; Emmenegger Y; Franken P. Homeostatic and circadian contribution to EEG and molecular state variables of sleep regulation. SLEEP 2013;36(3):311-323.

Activity-Dependent Bidirectional Regulation of GAD Expression in a Homeostatic Fashion Is Mediated by BDNF-Dependent and Independent Pathways

PubMed Central

Hanno-Iijima, Yoko; Tanaka, Masami; Iijima, Takatoshi

2015-01-01

Homeostatic synaptic plasticity, or synaptic scaling, is a mechanism that tunes neuronal transmission to compensate for prolonged, excessive changes in neuronal activity. Both excitatory and inhibitory neurons undergo homeostatic changes based on synaptic transmission strength, which could effectively contribute to a fine-tuning of circuit activity. However, gene regulation that underlies homeostatic synaptic plasticity in GABAergic (GABA, gamma aminobutyric) neurons is still poorly understood. The present study demonstrated activity-dependent dynamic scaling in which NMDA-R (N-methyl-D-aspartic acid receptor) activity regulated the expression of GABA synthetic enzymes: glutamic acid decarboxylase 65 and 67 (GAD65 and GAD67). Results revealed that activity-regulated BDNF (brain-derived neurotrophic factor) release is necessary, but not sufficient, for activity-dependent up-scaling of these GAD isoforms. Bidirectional forms of activity-dependent GAD expression require both BDNF-dependent and BDNF-independent pathways, both triggered by NMDA-R activity. Additional results indicated that these two GAD genes differ in their responsiveness to chronic changes in neuronal activity, which could be partially caused by differential dependence on BDNF. In parallel to activity-dependent bidirectional scaling in GAD expression, the present study further observed that a chronic change in neuronal activity leads to an alteration in neurotransmitter release from GABAergic neurons in a homeostatic, bidirectional fashion. Therefore, the differential expression of GAD65 and 67 during prolonged changes in neuronal activity may be implicated in some aspects of bidirectional homeostatic plasticity within mature GABAergic presynapses. PMID:26241953

Activity-Dependent Bidirectional Regulation of GAD Expression in a Homeostatic Fashion Is Mediated by BDNF-Dependent and Independent Pathways.

PubMed

Hanno-Iijima, Yoko; Tanaka, Masami; Iijima, Takatoshi

2015-01-01

Homeostatic synaptic plasticity, or synaptic scaling, is a mechanism that tunes neuronal transmission to compensate for prolonged, excessive changes in neuronal activity. Both excitatory and inhibitory neurons undergo homeostatic changes based on synaptic transmission strength, which could effectively contribute to a fine-tuning of circuit activity. However, gene regulation that underlies homeostatic synaptic plasticity in GABAergic (GABA, gamma aminobutyric) neurons is still poorly understood. The present study demonstrated activity-dependent dynamic scaling in which NMDA-R (N-methyl-D-aspartic acid receptor) activity regulated the expression of GABA synthetic enzymes: glutamic acid decarboxylase 65 and 67 (GAD65 and GAD67). Results revealed that activity-regulated BDNF (brain-derived neurotrophic factor) release is necessary, but not sufficient, for activity-dependent up-scaling of these GAD isoforms. Bidirectional forms of activity-dependent GAD expression require both BDNF-dependent and BDNF-independent pathways, both triggered by NMDA-R activity. Additional results indicated that these two GAD genes differ in their responsiveness to chronic changes in neuronal activity, which could be partially caused by differential dependence on BDNF. In parallel to activity-dependent bidirectional scaling in GAD expression, the present study further observed that a chronic change in neuronal activity leads to an alteration in neurotransmitter release from GABAergic neurons in a homeostatic, bidirectional fashion. Therefore, the differential expression of GAD65 and 67 during prolonged changes in neuronal activity may be implicated in some aspects of bidirectional homeostatic plasticity within mature GABAergic presynapses.

TLR4, NOD1 and NOD2 mediate immune recognition of putative newly identified periodontal pathogens.

PubMed

Marchesan, Julie; Jiao, Yizu; Schaff, Riley A; Hao, Jie; Morelli, Thiago; Kinney, Janet S; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J; Inohara, Naohiro; Giannobile, William V

2016-06-01

Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. Although the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, six being classical pathogens and four putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone-marrow-derived macrophages (BMDM) from wild-type (WT) and Toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. Campylobacter concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2 stimulatory activity. These studies allowed us to provide important evidence on newly identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

TLR4, NOD1 and NOD2 Mediate Immune Recognition of Putative Newly-Identified Periodontal Pathogens

PubMed Central

Schaff, Riley A.; Hao, Jie; Morelli, Thiago; Kinney, Janet S.; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J.; Inohara, Naohiro; Giannobile, William V.

2015-01-01

SUMMARY Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. While the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, 6 being classical pathogens and 4 putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone marrow–derived macrophages (BMDM) from wild-type (WT) and toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. C. concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney (HEK) cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2-stimulatory activity. These studies allowed us to provide important evidence on newly-identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). PMID:26177212

Nutritionally Mediated Programming of the Developing Immune System12

PubMed Central

Palmer, Amanda C.

2011-01-01

A growing body of evidence highlights the importance of a mother’s nutrition from preconception through lactation in programming the emerging organ systems and homeostatic pathways of her offspring. The developing immune system may be particularly vulnerable. Indeed, examples of nutrition-mediated immune programming can be found in the literature on intra-uterine growth retardation, maternal micronutrient deficiencies, and infant feeding. Current models of immune ontogeny depict a “layered” expansion of increasingly complex defenses, which may be permanently altered by maternal malnutrition. One programming mechanism involves activation of the maternal hypothalamic-pituitary-adrenal axis in response to nutritional stress. Fetal or neonatal exposure to elevated stress hormones is linked in animal studies to permanent changes in neuroendocrine-immune interactions, with diverse manifestations such as an attenuated inflammatory response or reduced resistance to tumor colonization. Maternal malnutrition may also have a direct influence, as evidenced by nutrient-driven epigenetic changes to developing T regulatory cells and subsequent risk of allergy or asthma. A 3rd programming pathway involves placental or breast milk transfer of maternal immune factors with immunomodulatory functions (e.g. cytokines). Maternal malnutrition can directly affect transfer mechanisms or influence the quality or quantity of transferred factors. The public health implications of nutrition-mediated immune programming are of particular importance in the developing world, where prevalent maternal undernutrition is coupled with persistent infectious challenges. However, early alterations to the immune system, resulting from either nutritional deficiencies or excesses, have broad relevance for immune-mediated diseases, such as asthma, and chronic inflammatory conditions like cardiovascular disease. PMID:22332080

Rivalry of homeostatic and sensory-evoked emotions: Dehydration attenuates olfactory disgust and its neural correlates.

PubMed

Meier, Lea; Friedrich, Hergen; Federspiel, Andrea; Jann, Kay; Morishima, Yosuke; Landis, Basile Nicolas; Wiest, Roland; Strik, Werner; Dierks, Thomas

2015-07-01

Neural correlates have been described for emotions evoked by states of homeostatic imbalance (e.g. thirst, hunger, and breathlessness) and for emotions induced by external sensory stimulation (such as fear and disgust). However, the neurobiological mechanisms of their interaction, when they are experienced simultaneously, are still unknown. We investigated the interaction on the neurobiological and the perceptional level using subjective ratings, serum parameters, and functional magnetic resonance imaging (fMRI) in a situation of emotional rivalry, when both a homeostatic and a sensory-evoked emotion were experienced at the same time. Twenty highly dehydrated male subjects rated a disgusting odor as significantly less repulsive when they were thirsty. On the neurobiological level, we found that this reduction in subjective disgust during thirst was accompanied by a significantly reduced neural activity in the insular cortex, a brain area known to be considerably involved in processing of disgust. Furthermore, during the experience of disgust in the satiated condition, we observed a significant functional connectivity between brain areas responding to the disgusting odor, which was absent during the stimulation in the thirsty condition. These results suggest interference of conflicting emotions: an acute homeostatic imbalance can attenuate the experience of another emotion evoked by the sensory perception of a potentially harmful external agent. This finding offers novel insights with regard to the behavioral relevance of biologically different types of emotions, indicating that some types of emotions are more imperative for behavior than others. As a general principle, this modulatory effect during the conflict of homeostatic and sensory-evoked emotions may function to safeguard survival. Copyright © 2015 Elsevier Inc. All rights reserved.

The circadian clock controls toll-like receptor 9-mediated innate and adaptive immunity

PubMed Central

Silver, Adam C.; Arjona, Alvaro; Walker, Wendy E.; Fikrig, Erol

2012-01-01

Circadian rhythms refer to biologic processes that oscillate with a period of approximately 24 hours. These rhythms are sustained by a molecular clock and provide a temporal matrix that ensures the coordination of homeostatic processes with the periodicity of environmental challenges. We demonstrate the circadian molecular clock controls the expression and function of toll like receptor 9 (TLR9). In a vaccination model using TLR9 ligand as adjuvant, mice immunized at the time of enhanced TLR9 responsiveness presented weeks later with an improved adaptive immune response. In a TLR9-dependent mouse model of sepsis, we found that disease severity was dependent on the timing of sepsis induction, coinciding with the daily changes in TLR9 expression and function. These findings unveil a direct molecular link between the circadian and innate immune systems with important implications for immunoprophylaxis and immunotherapy. PMID:22342842

Socially Isolated Mice Exhibit a Blunted Homeostatic Sleep Response to Acute Sleep Deprivation Compared to Socially Paired Mice

PubMed Central

Kaushal, Navita; Nair, Deepti; Gozal, David; Ramesh, Vijay

2012-01-01

Sleep is an important physiological process underlying maintenance of physical, mental and emotional health. Consequently, sleep deprivation (SD) is associated with adverse consequences and increases the risk for anxiety, immune, and cognitive disorders. SD is characterized by increased energy expenditure responses and sleep rebound upon recovery that are regulated by homeostatic processes, which in turn are influenced by stress. Since all previous studies on SD were conducted in a setting of social isolation, the impact of the social contextual setting is unknown. Therefore, we used a relatively stress-free SD paradigm in mice to assess the impact of social isolation on sleep, wakefulness and delta electroencephalogram (EEG) power during non-rapid eye movement (NREM) sleep. Paired or isolated C57BL/6J adult chronically-implanted male mice were exposed to SD for 6 hours and telemetric polygraphic recordings were conducted, including 18 hours recovery. Recovery from SD in the paired group showed a significant decrease in wake and significant increase in NREM sleep and rapid eye movement (REM), and a similar, albeit less robust response occurred in the isolated mice. Delta power during NREM sleep was increased in both groups immediately following SD, but paired mice exhibited significantly higher delta power throughout the dark period. The increase in body temperature and gross motor activity observed during the SD procedure was decreased during the dark period. In both open field and elevated plus maze tests, socially isolated mice showed significantly higher anxiety than paired mice. The homeostatic processes altered by SD are differentially affected in paired and isolated mice, suggesting that the social context of isolation stress may adversely affect the quantity and quality of sleep in mice. PMID:22498175

Homeostatic Scaling of Excitability in Recurrent Neural Networks

PubMed Central

Remme, Michiel W. H.; Wadman, Wytse J.

2012-01-01

Neurons adjust their intrinsic excitability when experiencing a persistent change in synaptic drive. This process can prevent neural activity from moving into either a quiescent state or a saturated state in the face of ongoing plasticity, and is thought to promote stability of the network in which neurons reside. However, most neurons are embedded in recurrent networks, which require a delicate balance between excitation and inhibition to maintain network stability. This balance could be disrupted when neurons independently adjust their intrinsic excitability. Here, we study the functioning of activity-dependent homeostatic scaling of intrinsic excitability (HSE) in a recurrent neural network. Using both simulations of a recurrent network consisting of excitatory and inhibitory neurons that implement HSE, and a mean-field description of adapting excitatory and inhibitory populations, we show that the stability of such adapting networks critically depends on the relationship between the adaptation time scales of both neuron populations. In a stable adapting network, HSE can keep all neurons functioning within their dynamic range, while the network is undergoing several (patho)physiologically relevant types of plasticity, such as persistent changes in external drive, changes in connection strengths, or the loss of inhibitory cells from the network. However, HSE cannot prevent the unstable network dynamics that result when, due to such plasticity, recurrent excitation in the network becomes too strong compared to feedback inhibition. This suggests that keeping a neural network in a stable and functional state requires the coordination of distinct homeostatic mechanisms that operate not only by adjusting neural excitability, but also by controlling network connectivity. PMID:22570604

Nonlinear feedback drives homeostatic plasticity in H2O2 stress response

PubMed Central

Goulev, Youlian; Morlot, Sandrine; Matifas, Audrey; Huang, Bo; Molin, Mikael; Toledano, Michel B; Charvin, Gilles

2017-01-01

Homeostatic systems that rely on genetic regulatory networks are intrinsically limited by the transcriptional response time, which may restrict a cell’s ability to adapt to unanticipated environmental challenges. To bypass this limitation, cells have evolved mechanisms whereby exposure to mild stress increases their resistance to subsequent threats. However, the mechanisms responsible for such adaptive homeostasis remain largely unknown. Here, we used live-cell imaging and microfluidics to investigate the adaptive response of budding yeast to temporally controlled H2O2 stress patterns. We demonstrate that acquisition of tolerance is a systems-level property resulting from nonlinearity of H2O2 scavenging by peroxiredoxins and our study reveals that this regulatory scheme induces a striking hormetic effect of extracellular H2O2 stress on replicative longevity. Our study thus provides a novel quantitative framework bridging the molecular architecture of a cellular homeostatic system to the emergence of nonintuitive adaptive properties. DOI: http://dx.doi.org/10.7554/eLife.23971.001 PMID:28418333

Genetic associations with micronutrient levels identified in immune and gastrointestinal networks.

PubMed

Morine, Melissa J; Monteiro, Jacqueline Pontes; Wise, Carolyn; Teitel, Candee; Pence, Lisa; Williams, Anna; Ning, Baitang; McCabe-Sellers, Beverly; Champagne, Catherine; Turner, Jerome; Shelby, Beatrice; Bogle, Margaret; Beger, Richard D; Priami, Corrado; Kaput, Jim

2014-07-01

The discovery of vitamins and clarification of their role in preventing frank essential nutrient deficiencies occurred in the early 1900s. Much vitamin research has understandably focused on public health and the effects of single nutrients to alleviate acute conditions. The physiological processes for maintaining health, however, are complex systems that depend upon interactions between multiple nutrients, environmental factors, and genetic makeup. To analyze the relationship between these factors and nutritional health, data were obtained from an observational, community-based participatory research program of children and teens (age 6-14) enrolled in a summer day camp in the Delta region of Arkansas. Assessments of erythrocyte S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH), plasma homocysteine (Hcy) and 6 organic micronutrients (retinol, 25-hydroxy vitamin D3, pyridoxal, thiamin, riboflavin, and vitamin E), and 1,129 plasma proteins were performed at 3 time points in each of 2 years. Genetic makeup was analyzed with 1 M SNP genotyping arrays, and nutrient status was assessed with 24-h dietary intake questionnaires. A pattern of metabolites (met_PC1) that included the ratio of erythrocyte SAM/SAH, Hcy, and 5 vitamins were identified by principal component analysis. Met_PC1 levels were significantly associated with (1) single-nucleotide polymorphisms, (2) levels of plasma proteins, and (3) multilocus genotypes coding for gastrointestinal and immune functions, as identified in a global network of metabolic/protein-protein interactions. Subsequent mining of data from curated pathway, network, and genome-wide association studies identified genetic and functional relationships that may be explained by gene-nutrient interactions. The systems nutrition strategy described here has thus associated a multivariate metabolite pattern in blood with genes involved in immune and gastrointestinal functions.

Persistent viral infections and immune aging.

PubMed

Brunner, Stefan; Herndler-Brandstetter, Dietmar; Weinberger, Birgit; Grubeck-Loebenstein, Beatrix

2011-07-01

Immunosenescence comprises a set of dynamic changes occurring to both, the innate as well as the adaptive immune system that accompany human aging and result in complex manifestations of still poorly defined deficiencies in the elderly population. One of the most prominent alterations during aging is the continuous involution of the thymus gland which is almost complete by the age of 50. Consequently, the output of naïve T cells is greatly diminished in elderly individuals which puts pressure on homeostatic forces to maintain a steady T cell pool for most of adulthood. In a great proportion of the human population, this fragile balance is challenged by persistent viral infections, especially Cytomegalovirus (CMV), that oblige certain T cell clones to monoclonally expand repeatedly over a lifetime which then occupy space within the T cell pool. Eventually, these inflated memory T cell clones become exhausted and their extensive accumulation accelerates the age-dependent decline of the diversity of the T cell pool. As a consequence, infectious diseases are more frequent and severe in elderly persons and immunological protection following vaccination is reduced. This review therefore aims to shed light on how various types of persistent viral infections, especially CMV, influence the aging of the immune system and highlight potential measures to prevent the age-related decline in immune function. Copyright © 2010 Elsevier B.V. All rights reserved.

Moving HAIRS: Towards adaptive, homeostatic materials

NASA Astrophysics Data System (ADS)

Aizenberg, Joanna

Dynamic structures that respond reversibly to changes in their environment are central to self-regulating thermal and lighting systems, targeted drug delivery, sensors, and self-propelled locomotion. Since an adaptive change requires energy input, an ideal strategy would be to design materials that harvest energy directly from the environment and use it to drive an appropriate response. This lecture will present the design of a novel class of reconfigurable materials that use surfaces bearing arrays of nanostructures put in motion by environment-responsive gels. Their unique hybrid architecture, and chemical and mechanical properties can be optimized to confer a wide range of adaptive behaviors. Using both experimental and modeling approaches, we are developing these hydrogel-actuated integrated responsive systems (HAIRS) as new materials with reversible optical and wetting properties, as a multifunctional platform for controlling cell differentiation and function, and as a first homeostatic system with autonomous self-regulation.

CXCR4 is critical for CD8+ memory T cell homeostatic self-renewal but not rechallenge self-renewal1

PubMed Central

Chaix, Julie; Nish, Simone A.; Lin, Wen-Hsuan W.; Rothman, Nyanza J.; Ding, Lei; Wherry, E. John; Reiner, Steven L.

2014-01-01

Central memory (CM) CD8+ T cells “remember” prior encounters because they maintain themselves through cell division in the absence of ongoing challenge (homeostatic self-renewal) as well as reproduce the central memory fate while manufacturing effector cells during secondary antigen encounters (rechallenge self-renewal). We tested the consequence of conditional deletion of the bone marrow (BM) homing receptor CXCR4 on antiviral T cell responses. CXCR4-deficient CD8+ T cells have impaired memory cell maintenance due to defective homeostatic proliferation. Upon rechallenge, however, CXCR4-deficient T cells can re-expand and renew the central memory pool while producing secondary effector cells. The critical BM-derived signals essential for CD8+ T cell homeostatic self-renewal appear to be dispensable to yield self-renewing, functionally asymmetric cell fates during rechallenge. PMID:24973450

Neural responses to macronutrients: hedonic and homeostatic mechanisms.

PubMed

Tulloch, Alastair J; Murray, Susan; Vaicekonyte, Regina; Avena, Nicole M

2015-05-01

The brain responds to macronutrients via intricate mechanisms. We review how the brain's neural systems implicated in homeostatic control of feeding and hedonic responses are influenced by the ingestion of specific types of food. We discuss how these neural systems are dysregulated in preclinical models of obesity. Findings from these studies can increase our understanding of overeating and, perhaps in some cases, the development of obesity. In addition, a greater understanding of the neural circuits affected by the consumption of specific macronutrients, and by obesity, might lead to new treatments and strategies for preventing unhealthy weight gain. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

The associations between increasing degrees of homeostatic model assessment for insulin resistance and muscular strengthening activities among euglycaemic US adults.

PubMed

Boyer, William R; Johnson, Tammie M; Fitzhugh, Eugene C; Richardson, Michael R; Churilla, James R

2015-11-01

To examine the associations between the homeostatic model assessment for insulin resistance and self-reported muscular strengthening activity in a nationally representative sample of euglycaemic US adults. Sample included euglycaemic adults (⩾20 years of age (n = 2009)) from the 1999 to 2004 National Health and Nutrition Examination Survey. Homeostatic model assessment for insulin resistance was categorized into quartiles and was the primary independent variable of interest. No reported muscular strengthening activity was the dependent variable. Following adjustment for covariates, those with homeostatic model assessment for insulin resistance values in fourth (odds ratio: 2.04, 95% confidence interval: 1.35-3.06, p < 0.001) quartile were found to have significantly greater odds of reporting no muscular strengthening activity. Following further adjustment for non-muscular strengthening activity specific aerobic leisure-time physical activity, results remained significant for the fourth (odds ratio: 2.30, 95% confidence interval: 1.50-3.52, p < 0.001) quartile. A significant trend was seen across quartiles of homeostatic model assessment for insulin resistance for increasing prevalence of no muscular strengthening activity (p < 0.001). Having a higher homeostatic model assessment for insulin resistance value is associated with greater odds of reporting no muscular strengthening activity among euglycaemic US adults. This implies that subjects with an increasing degree of insulin resistance are more likely to not engage in muscular strengthening activity, an exercise modality that has been shown to reduce the risk of several cardiometabolic diseases and improve glycaemic status. © The Author(s) 2015.

Identifying and managing the adverse effects of immune checkpoint blockade

PubMed Central

Winer, Arthur; Bodor, J. Nicholas

2018-01-01

Immunotherapy has revolutionized the field of oncology. By inhibiting the cytotoxic T-lymphocyte-associated protein (CTLA-4) and programmed death-1 (PD-1) immune checkpoint pathways, multiple studies have demonstrated greatly improved survival in locally advanced and metastatic cancers including melanoma, renal, lung, gastric, and hepatocellular carcinoma. Trials in other malignancies are ongoing, and undoubtedly the number of drugs in this space will grow beyond the six currently approved by the Food and Drug Administration. However, by altering the immune response to fight cancer, a new class of side effects has emerged known as immune-related adverse events (irAEs). These adverse events are due to overactivation of the immune system in almost any organ of the body, and can occur at any point along a patient’s treatment course. irAEs such as endocrinopathies (thyroiditis), colitis, and pneumonitis may occur more commonly. However, other organs such as the liver, heart, or brain may also be affected by immune overactivation and any of these side effects may become life threatening. This review presents an approach to promptly recognize and manage these toxicities, to hopefully minimize morbidity and mortality from irAEs. PMID:29593893

Emerging role of the brain in the homeostatic regulation of energy and glucose metabolism.

PubMed

Roh, Eun; Song, Do Kyeong; Kim, Min-Seon

2016-03-11

Accumulated evidence from genetic animal models suggests that the brain, particularly the hypothalamus, has a key role in the homeostatic regulation of energy and glucose metabolism. The brain integrates multiple metabolic inputs from the periphery through nutrients, gut-derived satiety signals and adiposity-related hormones. The brain modulates various aspects of metabolism, such as food intake, energy expenditure, insulin secretion, hepatic glucose production and glucose/fatty acid metabolism in adipose tissue and skeletal muscle. Highly coordinated interactions between the brain and peripheral metabolic organs are critical for the maintenance of energy and glucose homeostasis. Defective crosstalk between the brain and peripheral organs contributes to the development of obesity and type 2 diabetes. Here we comprehensively review the above topics, discussing the main findings related to the role of the brain in the homeostatic regulation of energy and glucose metabolism.

Emerging role of the brain in the homeostatic regulation of energy and glucose metabolism

PubMed Central

Roh, Eun; Song, Do Kyeong; Kim, Min-Seon

2016-01-01

Accumulated evidence from genetic animal models suggests that the brain, particularly the hypothalamus, has a key role in the homeostatic regulation of energy and glucose metabolism. The brain integrates multiple metabolic inputs from the periphery through nutrients, gut-derived satiety signals and adiposity-related hormones. The brain modulates various aspects of metabolism, such as food intake, energy expenditure, insulin secretion, hepatic glucose production and glucose/fatty acid metabolism in adipose tissue and skeletal muscle. Highly coordinated interactions between the brain and peripheral metabolic organs are critical for the maintenance of energy and glucose homeostasis. Defective crosstalk between the brain and peripheral organs contributes to the development of obesity and type 2 diabetes. Here we comprehensively review the above topics, discussing the main findings related to the role of the brain in the homeostatic regulation of energy and glucose metabolism. PMID:26964832

Whole genome analysis using Bayesian models to identify candidate genes for immune response to vaccination

USDA-ARS?s Scientific Manuscript database

This study identified genome regions associated with variation in immune response to vaccination against bovine viral diarrhea virus type 2 (BVDV 2) in American Angus calves. Calves were born in the spring or fall of 2006-2008 (n = 620). Two doses of modified live vaccine were administered three wee...

Roles and Regulation of Gastrointestinal Eosinophils in Immunity and Disease

PubMed Central

Jung, YunJae; Rothenberg, Marc E.

2014-01-01

Eosinophils have been considered to be destructive end-stage effector cells that have a role in parasitic infections and allergy reactions by the release of their granule-derived cytotoxic proteins. However, an increasing number of experimental observations indicate that eosinophils also are multifunctional leukocytes involved in diverse inflammatory and physiologic immune responses. Under homeostatic conditions, eosinophils are particularly abundant in the lamina propria of the gastrointestinal tract where their involvement in various biological processes within the gastrointestinal tract has been posited. In this review, we summarize the molecular steps involved in eosinophil development and describe eosinophil trafficking to the gastrointestinal tract. We synthesize the current findings on the phenotypic and functional properties of gastrointestinal eosinophils and the accumulating evidence that they have a contributory role in gastrointestinal disorders, with a focus on primary eosinophilic gastrointestinal disorders. Finally, we discuss the potential role of eosinophils as modulators of the intestinal immune system. PMID:25049430

The dependence of neuronal encoding efficiency on Hebbian plasticity and homeostatic regulation of neurotransmitter release

PubMed Central

Faghihi, Faramarz; Moustafa, Ahmed A.

2015-01-01

Synapses act as information filters by different molecular mechanisms including retrograde messenger that affect neuronal spiking activity. One of the well-known effects of retrograde messenger in presynaptic neurons is a change of the probability of neurotransmitter release. Hebbian learning describe a strengthening of a synapse between a presynaptic input onto a postsynaptic neuron when both pre- and postsynaptic neurons are coactive. In this work, a theory of homeostatic regulation of neurotransmitter release by retrograde messenger and Hebbian plasticity in neuronal encoding is presented. Encoding efficiency was measured for different synaptic conditions. In order to gain high encoding efficiency, the spiking pattern of a neuron should be dependent on the intensity of the input and show low levels of noise. In this work, we represent spiking trains as zeros and ones (corresponding to non-spike or spike in a time bin, respectively) as words with length equal to three. Then the frequency of each word (here eight words) is measured using spiking trains. These frequencies are used to measure neuronal efficiency in different conditions and for different parameter values. Results show that neurons that have synapses acting as band-pass filters show the highest efficiency to encode their input when both Hebbian mechanism and homeostatic regulation of neurotransmitter release exist in synapses. Specifically, the integration of homeostatic regulation of feedback inhibition with Hebbian mechanism and homeostatic regulation of neurotransmitter release in the synapses leads to even higher efficiency when high stimulus intensity is presented to the neurons. However, neurons with synapses acting as high-pass filters show no remarkable increase in encoding efficiency for all simulated synaptic plasticity mechanisms. This study demonstrates the importance of cooperation of Hebbian mechanism with regulation of neurotransmitter release induced by rapid diffused retrograde

Evidence for a novel functional role of astrocytes in the acute homeostatic response to high-fat diet intake in mice

PubMed Central

Buckman, Laura B.; Thompson, Misty M.; Lippert, Rachel N.; Blackwell, Timothy S.; Yull, Fiona E.; Ellacott, Kate L.J.

2014-01-01

Objective Introduction of a high-fat diet to mice results in a period of voracious feeding, known as hyperphagia, before homeostatic mechanisms prevail to restore energy intake to an isocaloric level. Acute high-fat diet hyperphagia induces astrocyte activation in the rodent hypothalamus, suggesting a potential role of these cells in the homeostatic response to the diet. The objective of this study was to determine physiologic role of astrocytes in the acute homeostatic response to high-fat feeding. Methods We bred a transgenic mouse model with doxycycline-inducible inhibition of NFkappaB (NFκB) signaling in astrocytes to determine the effect of loss of NFκB-mediated astrocyte activation on acute high-fat hyperphagia. ELISA was used to measure the levels of markers of astrocyte activation, glial-fibrillary acidic protein (GFAP) and S100B, in the medial basal hypothalamus. Results Inhibition of NFκB signaling in astrocytes prevented acute high-fat diet-induced astrocyte activation and resulted in a 15% increase in caloric intake (P < 0.01) in the first 24 h after introduction of the diet. Conclusions These data reveal a novel homeostatic role for astrocytes in the acute physiologic regulation of food intake in response to high-fat feeding. PMID:25685690

Evidence for a novel functional role of astrocytes in the acute homeostatic response to high-fat diet intake in mice.

PubMed

Buckman, Laura B; Thompson, Misty M; Lippert, Rachel N; Blackwell, Timothy S; Yull, Fiona E; Ellacott, Kate L J

2015-01-01

Introduction of a high-fat diet to mice results in a period of voracious feeding, known as hyperphagia, before homeostatic mechanisms prevail to restore energy intake to an isocaloric level. Acute high-fat diet hyperphagia induces astrocyte activation in the rodent hypothalamus, suggesting a potential role of these cells in the homeostatic response to the diet. The objective of this study was to determine physiologic role of astrocytes in the acute homeostatic response to high-fat feeding. We bred a transgenic mouse model with doxycycline-inducible inhibition of NFkappaB (NFκB) signaling in astrocytes to determine the effect of loss of NFκB-mediated astrocyte activation on acute high-fat hyperphagia. ELISA was used to measure the levels of markers of astrocyte activation, glial-fibrillary acidic protein (GFAP) and S100B, in the medial basal hypothalamus. Inhibition of NFκB signaling in astrocytes prevented acute high-fat diet-induced astrocyte activation and resulted in a 15% increase in caloric intake (P < 0.01) in the first 24 h after introduction of the diet. These data reveal a novel homeostatic role for astrocytes in the acute physiologic regulation of food intake in response to high-fat feeding.

The hemochromatosis protein HFE 20 years later: An emerging role in antigen presentation and in the immune system

PubMed Central

Chung, Jacqueline W.; Santos, Manuela M.

2017-01-01

Abstract Introduction Since its discovery, the hemochromatosis protein HFE has been primarily defined by its role in iron metabolism and homeostasis, and its involvement in the genetic disease termed hereditary hemochromatosis (HH). While HH patients are typically afflicted by dysregulated iron levels, many are also affected by several immune defects and increased incidence of autoimmune diseases that have thereby implicated HFE in the immune response. Growing evidence has supported an immunological role for HFE with recent studies describing HFE specifically as it relates to MHC I antigen presentation. Methods/Results Here, we present a comprehensive overview of the relationship between iron metabolism, HFE, and the immune system to better understand the origin and cause of immune defects in HH patients. We further describe the role of HFE in MHC I antigen presentation and its potential to impair autoimmune responses in homeostatic conditions, a mechanism which may be exploited by tumors to evade immune surveillance. Conclusion Overall, this increased understanding of the role of HFE in the immune response sets the stage for better treatment and management of HH and other iron‐related diseases, as well as of the immune defects related to this condition. PMID:28474781

Behavioral and biochemical dissociation of arousal and homeostatic sleep need influenced by prior wakeful experience in mice.

PubMed

Suzuki, Ayako; Sinton, Christopher M; Greene, Robert W; Yanagisawa, Masashi

2013-06-18

Sleep is regulated by homeostatic mechanisms, and the low-frequency power in the electroencephalogram (delta power) during non-rapid eye movement sleep reflects homeostatic sleep need. Additionally, sleep is limited by circadian and environmentally influenced arousal. Little is known, however, about the underlying neural substrates for sleep homeostasis and arousal and about the potential link between them. Here, we subjected C57BL/6 mice to 6 h of sleep deprivation using two different methods: gentle handling and continual cage change. Both groups were deprived of sleep to a similar extent (>99%), and, as expected, the delta power increase during recovery sleep was quantitatively similar in both groups. However, in a multiple sleep latency test, the cage change group showed significantly longer sleep latencies than the gentle handling group, indicating that the cage change group had a higher level of arousal despite the similar sleep loss. To investigate the possible biochemical correlates of these behavioral changes, we screened for arousal-related and sleep need-related phosphoprotein markers from the diencephalon. We found that the abundance of highly phosphorylated forms of dynamin 1, a presynaptic neuronal protein, was associated with sleep latency in the multiple sleep latency test. In contrast, the abundance of highly phosphorylated forms of N-myc downstream regulated gene 2, a glial protein, was increased in parallel with delta power. The changes of these protein species disappeared after 2 h of recovery sleep. These results suggest that homeostatic sleep need and arousal can be dissociated behaviorally and biochemically and that phosphorylated N-myc downstream regulated gene 2 and dynamin 1 may serve as markers of homeostatic sleep need and arousal, respectively.

Malondialdehyde epitopes as targets of immunity and the implications for atherosclerosis

PubMed Central

Binder, Christoph J.

2018-01-01

Accumulating evidence suggests that oxidation-specific epitopes (OSEs) constitute a novel class of damage-associated molecular patterns (DAMPs) generated during high oxidative stress but also in the physiological process of apoptosis. To deal with the potentially harmful consequences of such epitopes, the immune system has developed several mechanisms to protect from OSEs and to orchestrate their clearance, including IgM natural antibodies and both cellular and membrane-bound receptors. Here, we focus on malondialdehyde (MDA) epitopes as prominent examples of OSEs that trigger both innate and adaptive immune responses. First, we review the mechanism of MDA generation, the different types of adducts on various biomolecules and provide relevant examples for physiological carriers of MDA such as apoptotic cells, microvesicles (MV) or oxidized low-density lipoproteins (LDL). Based on recent insights, we argue that MDA epitopes contribute to the maintenance of homeostatic functions by acting as markers of elevated oxidative stress and tissue damage. We discuss multiple lines of evidence that MDA epitopes are pro-inflammatory and thus important targets of innate and adaptive immune responses. Finally, we illustrate the relevance of MDA epitopes in human pathologies by describing their capacity to drive inflammatory processes in atherosclerosis and highlighting protective mechanisms of immunity that could be exploited for therapeutic purposes. PMID:27235680

Bassoon-disruption slows vesicle replenishment and induces homeostatic plasticity at a CNS synapse

PubMed Central

Mendoza Schulz, Alejandro; Jing, Zhizi; María Sánchez Caro, Juan; Wetzel, Friederike; Dresbach, Thomas; Strenzke, Nicola; Wichmann, Carolin; Moser, Tobias

2014-01-01

Endbulb of Held terminals of auditory nerve fibers (ANF) transmit auditory information at hundreds per second to bushy cells (BCs) in the anteroventral cochlear nucleus (AVCN). Here, we studied the structure and function of endbulb synapses in mice that lack the presynaptic scaffold bassoon and exhibit reduced ANF input into the AVCN. Endbulb terminals and active zones were normal in number and vesicle complement. Postsynaptic densities, quantal size and vesicular release probability were increased while vesicle replenishment and the standing pool of readily releasable vesicles were reduced. These opposing effects canceled each other out for the first evoked EPSC, which showed unaltered amplitude. We propose that ANF activity deprivation drives homeostatic plasticity in the AVCN involving synaptic upscaling and increased intrinsic BC excitability. In vivo recordings from individual mutant BCs demonstrated a slightly improved response at sound onset compared to ANF, likely reflecting the combined effects of ANF convergence and homeostatic plasticity. Further, we conclude that bassoon promotes vesicular replenishment and, consequently, a large standing pool of readily releasable synaptic vesicles at the endbulb synapse. PMID:24442636

Adolescent Changes in the Homeostatic and Circadian Regulation of Sleep

PubMed Central

Hagenauer, M.H.; Perryman, J.I.; Lee, T.M.; Carskadon, M.A.

2009-01-01

Sleep deprivation among adolescents is epidemic. We argue that this sleep deprivation is due in part to pubertal changes in the homeostatic and circadian regulation of sleep. These changes promote a delayed sleep phase that is exacerbated by evening light exposure and incompatible with aspects of modern society, notably early school start times. In this review of human and animal literature, we demonstrate that delayed sleep phase during puberty is likely a common phenomenon in mammals, not specific to human adolescents, and we provide insight into the mechanisms underlying this phenomenon. PMID:19546564

Neonatal Fc receptor expression in dendritic cells mediates protective immunity against colorectal cancer.

PubMed

Baker, Kristi; Rath, Timo; Flak, Magdalena B; Arthur, Janelle C; Chen, Zhangguo; Glickman, Jonathan N; Zlobec, Inti; Karamitopoulou, Eva; Stachler, Matthew D; Odze, Robert D; Lencer, Wayne I; Jobin, Christian; Blumberg, Richard S

2013-12-12

Cancers arising in mucosal tissues account for a disproportionately large fraction of malignancies. Immunoglobulin G (IgG) and the neonatal Fc receptor for IgG (FcRn) have an important function in the mucosal immune system that we have now shown extends to the induction of CD8(+) T cell-mediated antitumor immunity. We demonstrate that FcRn within dendritic cells (DCs) was critical for homeostatic activation of mucosal CD8(+) T cells that drove protection against the development of colorectal cancers and lung metastases. FcRn-mediated tumor protection was driven by DCs activation of endogenous tumor-reactive CD8(+) T cells via the cross-presentation of IgG complexed antigens (IgG IC), as well as the induction of cytotoxicity-promoting cytokine secretion, particularly interleukin-12, both of which were independently triggered by the FcRn-IgG IC interaction in murine and human DCs. FcRn thus has a primary role within mucosal tissues in activating local immune responses that are critical for priming efficient anti-tumor immunosurveillance. Copyright © 2013 Elsevier Inc. All rights reserved.

Testicular defense systems: immune privilege and innate immunity

PubMed Central

Zhao, Shutao; Zhu, Weiwei; Xue, Shepu; Han, Daishu

2014-01-01

The mammalian testis possesses a special immunological environment because of its properties of remarkable immune privilege and effective local innate immunity. Testicular immune privilege protects immunogenic germ cells from systemic immune attack, and local innate immunity is important in preventing testicular microbial infections. The breakdown of local testicular immune homeostasis may lead to orchitis, an etiological factor of male infertility. The mechanisms underlying testicular immune privilege have been investigated for a long time. Increasing evidence shows that both a local immunosuppressive milieu and systemic immune tolerance are involved in maintaining testicular immune privilege status. The mechanisms underlying testicular innate immunity are emerging based on the investigation of the pattern recognition receptor-mediated innate immune response in testicular cells. This review summarizes our current understanding of testicular defense mechanisms and identifies topics that merit further investigation. PMID:24954222

Sleep homeostatic pressure and PER3 VNTR gene polymorphism influence antidepressant response to sleep deprivation in bipolar depression.

PubMed

Dallaspezia, Sara; Locatelli, Clara; Lorenzi, Cristina; Pirovano, Adele; Colombo, Cristina; Benedetti, Francesco

2016-03-01

Combined Total sleep deprivation (TSD) and light therapy (LT) cause a rapid improvement in bipolar depression which has been hypothesized to be paralleled by changes in sleep homeostasis. Recent studies showed that bipolar patients had lower changes of EEG theta power after sleep and responders to antidepressant TSD+LT slept less and showed a lower increase of EEG theta power then non-responders. A polymorphism in PER3 gene has been associated with diurnal preference, sleep structure and homeostatic response to sleep deprivation in healthy subjects. We hypothesized that the individual variability in the homeostatic response to TSD could be a correlate of antidepressant response and be influenced by genetic factors. We administered three TSD+LT cycles to bipolar depressed patients. Severity of depression was rated on Hamilton Depression Rating Scale. Actigraphic recordings were performed in a group of patients. PER3 polymorphism influenced changes in total sleep time (F=2.24; p=0.024): while PER3(4/4) and PER3(4/5) patients showed a reduction in it after treatment, PER3(5/5) subjects showed an increase of about 40min, suggesting a higher homeostatic pressure. The same polymorphism influenced the change of depressive symptomatology during treatment (F=3.72; p=0.028). Sleep information was recorded till the day after the end of treatment: a longer period of observation could give more information about the possible maintenance of allostatic adaptation. A higher sleep homeostatic pressure reduced the antidepressant response to TSD+LT, while an allostatic adaptation to sleep loss was associated with better response. This process seems to be under genetic control. Copyright © 2015 Elsevier B.V. All rights reserved.

Homeostatic and Circadian Abnormalities in Sleep and Arousal in Gulf War Syndrome

DTIC Science & Technology

2015-10-01

for the daytime fatigue and cognitive impairments commonly reported in GWI may be that these veterans undergo frontally specific sleep deprivation ...long-term sleep loss or as a result of an unknown process related to Gulf-War participation. The notion that sleep pathology results in acute...1 Award Number: W81XWH-10-2-0129 TITLE: Homeostatic and Circadian Abnormalities in Sleep and Arousal in Gulf War Syndrome PRINCIPAL INVESTIGATOR

Differential modulation of global and local neural oscillations in REM sleep by homeostatic sleep regulation.

PubMed

Kim, Bowon; Kocsis, Bernat; Hwang, Eunjin; Kim, Youngsoo; Strecker, Robert E; McCarley, Robert W; Choi, Jee Hyun

2017-02-28

Homeostatic rebound in rapid eye movement (REM) sleep normally occurs after acute sleep deprivation, but REM sleep rebound settles on a persistently elevated level despite continued accumulation of REM sleep debt during chronic sleep restriction (CSR). Using high-density EEG in mice, we studied how this pattern of global regulation is implemented in cortical regions with different functions and network architectures. We found that across all areas, slow oscillations repeated the behavioral pattern of persistent enhancement during CSR, whereas high-frequency oscillations showed progressive increases. This pattern followed a common rule despite marked topographic differences. The findings suggest that REM sleep slow oscillations may translate top-down homeostatic control to widely separated brain regions whereas fast oscillations synchronizing local neuronal ensembles escape this global command. These patterns of EEG oscillation changes are interpreted to reconcile two prevailing theories of the function of sleep, synaptic homeostasis and sleep dependent memory consolidation.

Immunization with a heat-killed preparation of the environmental bacterium Mycobacterium vaccae promotes stress resilience in mice

PubMed Central

Reber, Stefan O.; Siebler, Philip H.; Donner, Nina C.; Morton, James T.; Smith, David G.; Kopelman, Jared M.; Lowe, Kenneth R.; Wheeler, Kristen J.; Fox, James H.; Hassell, James E.; Greenwood, Benjamin N.; Jansch, Charline; Lechner, Anja; Schmidt, Dominic; Uschold-Schmidt, Nicole; Füchsl, Andrea M.; Langgartner, Dominik; Walker, Frederick R.; Hale, Matthew W.; Lopez Perez, Gerardo; Van Treuren, Will; González, Antonio; Halweg-Edwards, Andrea L.; Fleshner, Monika; Raison, Charles L.; Rook, Graham A.; Peddada, Shyamal D.; Knight, Rob

2016-01-01

The prevalence of inflammatory diseases is increasing in modern urban societies. Inflammation increases risk of stress-related pathology; consequently, immunoregulatory or antiinflammatory approaches may protect against negative stress-related outcomes. We show that stress disrupts the homeostatic relationship between the microbiota and the host, resulting in exaggerated inflammation. Repeated immunization with a heat-killed preparation of Mycobacterium vaccae, an immunoregulatory environmental microorganism, reduced subordinate, flight, and avoiding behavioral responses to a dominant aggressor in a murine model of chronic psychosocial stress when tested 1–2 wk following the final immunization. Furthermore, immunization with M. vaccae prevented stress-induced spontaneous colitis and, in stressed mice, induced anxiolytic or fear-reducing effects as measured on the elevated plus-maze, despite stress-induced gut microbiota changes characteristic of gut infection and colitis. Immunization with M. vaccae also prevented stress-induced aggravation of colitis in a model of inflammatory bowel disease. Depletion of regulatory T cells negated protective effects of immunization with M. vaccae on stress-induced colitis and anxiety-like or fear behaviors. These data provide a framework for developing microbiome- and immunoregulation-based strategies for prevention of stress-related pathologies. PMID:27185913

Hedonic Homeostatic Dysregulation as a Driver of Drug-Seeking Behavior

PubMed Central

Koob, George F.

2009-01-01

Drug addiction can be defined by a compulsion to seek and take drug and loss of control in limiting intake, and the excessive drug taking derives from multiple motivational mechanisms. One such mechanism is the emergence of a negative emotional state when access to the drug is prevented, reflecting hedonic homeostatic dysregulation. Excessive drug taking then results in part via the construct of negative reinforcement. The negative emotional state that drives such negative reinforcement is hypothesized to derive from dysregulation of key neurochemical elements involved in reward and stress within basal forebrain structures, including the ventral striatum and extended amygdala. Specific neurochemical elements in these structures include not only decreases in reward neurotransmission, such as decreases in dopamine and opioid peptide function in the ventral striatum, but also recruitment of brain stress systems, such as corticotropin-releasing factor (CRF), in the extended amygdala. Chronic exposure or extended access to self-administration of all major drugs of abuse produces during abstinence increases in reward thresholds, increases in aversive anxiety-like responses, increases in extracellular levels of CRF in the central nucleus of the amygdala, and increases in drug self-administration. CRF receptor antagonists block excessive drug intake produced by dependence. A combination of decreased reward system function and increased brain stress response system function is hypothesized to be responsible for hedonic homeostatic dysregulation that drives drug seeking behavior in dependence. Such hedonic dysregulation is hypothesized to extend into protracted abstinence to provide a residual negative emotional state that enhances the salience of cues eliciting drug seeking and relapse. PMID:20054425

De Novo Assembly of Mud Loach (Misgurnus anguillicaudatus) Skin Transcriptome to Identify Putative Genes Involved in Immunity and Epidermal Mucus Secretion

PubMed Central

Long, Yong; Li, Qing; Zhou, Bolan; Song, Guili; Li, Tao; Cui, Zongbin

2013-01-01

Fish skin serves as the first line of defense against a wide variety of chemical, physical and biological stressors. Secretion of mucus is among the most prominent characteristics of fish skin and numerous innate immune factors have been identified in the epidermal mucus. However, molecular mechanisms underlying the mucus secretion and immune activities of fish skin remain largely unclear due to the lack of genomic and transcriptomic data for most economically important fish species. In this study, we characterized the skin transcriptome of mud loach using Illumia paired-end sequencing. A total of 40364 unigenes were assembled from 86.6 million (3.07 gigabases) filtered reads. The mean length, N50 size and maximum length of assembled transcripts were 387, 611 and 8670 bp, respectively. A total of 17336 (43.76%) unigenes were annotated by blast searches against the NCBI non-redundant protein database. Gene ontology mapping assigned a total of 108513 GO terms to 15369 (38.08%) unigenes. KEGG orthology mapping annotated 9337 (23.23%) unigenes. Among the identified KO categories, immune system is the largest category that contains various components of multiple immune pathways such as chemokine signaling, leukocyte transendothelial migration and T cell receptor signaling, suggesting the complexity of immune mechanisms in fish skin. As for mucin biosynthesis, 37 unigenes were mapped to 7 enzymes of the mucin type O-glycan biosynthesis pathway and 8 members of the polypeptide N-acetylgalactosaminyltransferase family were identified. Additionally, 38 unigenes were mapped to 23 factors of the SNARE interactions in vesicular transport pathway, indicating that the activity of this pathway is required for the processes of epidermal mucus storage and release. Moreover, 1754 simple sequence repeats (SSRs) were detected in 1564 unigenes and dinucleotide repeats represented the most abundant type. These findings have laid the foundation for further understanding the secretary

De novo assembly of mud loach (Misgurnus anguillicaudatus) skin transcriptome to identify putative genes involved in immunity and epidermal mucus secretion.

PubMed

Long, Yong; Li, Qing; Zhou, Bolan; Song, Guili; Li, Tao; Cui, Zongbin

2013-01-01

Fish skin serves as the first line of defense against a wide variety of chemical, physical and biological stressors. Secretion of mucus is among the most prominent characteristics of fish skin and numerous innate immune factors have been identified in the epidermal mucus. However, molecular mechanisms underlying the mucus secretion and immune activities of fish skin remain largely unclear due to the lack of genomic and transcriptomic data for most economically important fish species. In this study, we characterized the skin transcriptome of mud loach using Illumia paired-end sequencing. A total of 40364 unigenes were assembled from 86.6 million (3.07 gigabases) filtered reads. The mean length, N50 size and maximum length of assembled transcripts were 387, 611 and 8670 bp, respectively. A total of 17336 (43.76%) unigenes were annotated by blast searches against the NCBI non-redundant protein database. Gene ontology mapping assigned a total of 108513 GO terms to 15369 (38.08%) unigenes. KEGG orthology mapping annotated 9337 (23.23%) unigenes. Among the identified KO categories, immune system is the largest category that contains various components of multiple immune pathways such as chemokine signaling, leukocyte transendothelial migration and T cell receptor signaling, suggesting the complexity of immune mechanisms in fish skin. As for mucin biosynthesis, 37 unigenes were mapped to 7 enzymes of the mucin type O-glycan biosynthesis pathway and 8 members of the polypeptide N-acetylgalactosaminyltransferase family were identified. Additionally, 38 unigenes were mapped to 23 factors of the SNARE interactions in vesicular transport pathway, indicating that the activity of this pathway is required for the processes of epidermal mucus storage and release. Moreover, 1754 simple sequence repeats (SSRs) were detected in 1564 unigenes and dinucleotide repeats represented the most abundant type. These findings have laid the foundation for further understanding the secretary

Brain glucose sensing in homeostatic and hedonic regulation.

PubMed

Steinbusch, Laura; Labouèbe, Gwenaël; Thorens, Bernard

2015-09-01

Glucose homeostasis as well as homeostatic and hedonic control of feeding is regulated by hormonal, neuronal, and nutrient-related cues. Glucose, besides its role as a source of metabolic energy, is an important signal controlling hormone secretion and neuronal activity, hence contributing to whole-body metabolic integration in coordination with feeding control. Brain glucose sensing plays a key, but insufficiently explored, role in these metabolic and behavioral controls, which when deregulated may contribute to the development of obesity and diabetes. The recent introduction of innovative transgenic, pharmacogenetic, and optogenetic techniques allows unprecedented analysis of the complexity of central glucose sensing at the molecular, cellular, and neuronal circuit levels, which will lead to a new understanding of the pathogenesis of metabolic diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regulatory T-cell stability and plasticity in mucosal and systemic immune systems.

PubMed

Murai, M; Krause, P; Cheroutre, H; Kronenberg, M

2010-09-01

Regulatory T cells (Treg) express the forkhead box p3 (Foxp3) transcription factor and suppress pathological immune responses against self and foreign antigens, including commensal microorganisms. Foxp3 has been proposed as a master key regulator for Treg, required for their differentiation, maintenance, and suppressive functions. Two types of Treg have been defined. Natural Treg (nTreg) are usually considered to be a separate sublineage arising during thymus differentiation. Induced Treg (iTreg) originate upon T cell receptor (TCR) stimulation in the presence of tumor growth factor beta. Although under homeostatic conditions most Treg in the periphery are nTreg, special immune challenges in the intestine promote more frequently the generation of iTreg. Furthermore, recent observations have challenged the notion that Treg are a stable sublineage, and they suggest that, particularly under lymphopenic and/or inflammatory conditions, Treg may lose Foxp3 and/or acquire diverse effector functions, especially in the intestine, which may contribute to uncontrolled inflammation.

Operation of a homeostatic sleep switch.

PubMed

Pimentel, Diogo; Donlea, Jeffrey M; Talbot, Clifford B; Song, Seoho M; Thurston, Alexander J F; Miesenböck, Gero

2016-08-18

Sleep disconnects animals from the external world, at considerable risks and costs that must be offset by a vital benefit. Insight into this mysterious benefit will come from understanding sleep homeostasis: to monitor sleep need, an internal bookkeeper must track physiological changes that are linked to the core function of sleep. In Drosophila, a crucial component of the machinery for sleep homeostasis is a cluster of neurons innervating the dorsal fan-shaped body (dFB) of the central complex. Artificial activation of these cells induces sleep, whereas reductions in excitability cause insomnia. dFB neurons in sleep-deprived flies tend to be electrically active, with high input resistances and long membrane time constants, while neurons in rested flies tend to be electrically silent. Correlative evidence thus supports the simple view that homeostatic sleep control works by switching sleep-promoting neurons between active and quiescent states. Here we demonstrate state switching by dFB neurons, identify dopamine as a neuromodulator that operates the switch, and delineate the switching mechanism. Arousing dopamine caused transient hyperpolarization of dFB neurons within tens of milliseconds and lasting excitability suppression within minutes. Both effects were transduced by Dop1R2 receptors and mediated by potassium conductances. The switch to electrical silence involved the downregulation of voltage-gated A-type currents carried by Shaker and Shab, and the upregulation of voltage-independent leak currents through a two-pore-domain potassium channel that we term Sandman. Sandman is encoded by the CG8713 gene and translocates to the plasma membrane in response to dopamine. dFB-restricted interference with the expression of Shaker or Sandman decreased or increased sleep, respectively, by slowing the repetitive discharge of dFB neurons in the ON state or blocking their entry into the OFF state. Biophysical changes in a small population of neurons are thus linked to the

Innate and adaptive immune responses in male and female reproductive tracts in homeostasis and following HIV infection

PubMed Central

Nguyen, Philip V; Kafka, Jessica K; Ferreira, Victor H; Roth, Kristy; Kaushic, Charu

2014-01-01

The male and female reproductive tracts are complex microenvironments that have diverse functional demands. The immune system in the reproductive tract has the demanding task of providing a protective environment for a fetal allograft while simultaneously conferring protection against potential pathogens. As such, it has evolved a unique set of adaptations, primarily under the influence of sex hormones, which make it distinct from other mucosal sites. Here, we discuss the various components of the immune system that are present in both the male and female reproductive tracts, including innate soluble factors and cells and humoral and cell-mediated adaptive immunity under homeostatic conditions. We review the evidence showing unique phenotypic and functional characteristics of immune cells and responses in the male and female reproductive tracts that exhibit compartmentalization from systemic immunity and discuss how these features are influenced by sex hormones. We also examine the interactions among the reproductive tract, sex hormones and immune responses following HIV-1 infection. An improved understanding of the unique characteristics of the male and female reproductive tracts will provide insights into improving clinical treatments of the immunological causes of infertility and the design of prophylactic interventions for the prevention of sexually transmitted infections. PMID:24976268

Expansion of brain T cells in homeostatic conditions in lymphopenic Rag2(-/-) mice.

PubMed

Song, Chang; Nicholson, James D; Clark, Sarah M; Li, Xin; Keegan, Achsah D; Tonelli, Leonardo H

2016-10-01

The concept of the brain as an immune privileged organ is rapidly evolving in light of new findings outlining the sophisticated relationship between the central nervous and the immune systems. The role of T cells in brain development and function, as well as modulation of behavior has been demonstrated by an increasing number of studies. Moreover, recent studies have redefined the existence of a brain lymphatic system and the presence of T cells in specific brain structures, such as the meninges and choroid plexus. Nevertheless, much information is needed to further the understanding of brain T cells and their relationship with the central nervous system under non-inflammatory conditions. In the present study we employed the Rag2(-/-) mouse model of lymphocyte deficiency and reconstitution by adoptive transfer to study the temporal and anatomical expansion of T cells in the brain under homeostatic conditions. Lymphopenic Rag2(-/-) mice were reconstituted with 10 million lymphoid cells and studied at one, two and four weeks after transfer. Moreover, lymphoid cells and purified CD4(+) and CD8(+) T cells from transgenic GFP expressing mice were used to define the neuroanatomical localization of transferred cells. T cell numbers were very low in the brain of reconstituted mice up to one week after transfer and significantly increased by 2weeks, reaching wild type values at 4weeks after transfer. CD4(+) T cells were the most abundant lymphocyte subtype found in the brain followed by CD8(+) T cells and lastly B cells. Furthermore, proliferation studies showed that CD4(+) T cells expand more rapidly than CD8(+) T cells. Lymphoid cells localize abundantly in meningeal structures, choroid plexus, and circumventricular organs. Lymphocytes were also found in vascular and perivascular spaces and in the brain parenchyma across several regions of the brain, in particular in structures rich in white matter content. These results provide proof of concept that the brain meningeal

IL-7–dependent STAT1 activation limits homeostatic CD4+ T cell expansion

PubMed Central

Le Saout, Cecile; Luckey, Megan A.; Villarino, Alejandro V.; Smith, Mindy; Hasley, Rebecca B.; Myers, Timothy G.; Imamichi, Hiromi; Park, Jung-Hyun; O’Shea, John J.; Lane, H. Clifford

2017-01-01

IL-7 regulates homeostatic mechanisms that maintain the overall size of the T cell pool throughout life. We show that, under steady-state conditions, IL-7 signaling is principally mediated by activation of signal transducers and activators of transcription 5 (STAT5). In contrast, under lymphopenic conditions, there is a modulation of STAT1 expression resulting in an IL-7–dependent STAT1 and STAT5 activation. Consequently, the IL-7–induced transcriptome is altered with enrichment of IFN-stimulated genes (ISGs). Moreover, STAT1 overexpression was associated with reduced survival in CD4+ T cells undergoing lymphopenia-induced proliferation (LIP). We propose a model in which T cells undergoing LIP upregulate STAT1 protein, “switching on” an alternate IL-7–dependent program. This mechanism could be a physiological process to regulate the expansion and size of the CD4+ T cell pool. During HIV infection, the virus could exploit this pathway, leading to the homeostatic dysregulation of the T cell pools observed in these patients. PMID:29202461

Differential modulation of global and local neural oscillations in REM sleep by homeostatic sleep regulation

PubMed Central

Kim, Bowon; Kocsis, Bernat; Hwang, Eunjin; Kim, Youngsoo; Strecker, Robert E.; McCarley, Robert W.; Choi, Jee Hyun

2017-01-01

Homeostatic rebound in rapid eye movement (REM) sleep normally occurs after acute sleep deprivation, but REM sleep rebound settles on a persistently elevated level despite continued accumulation of REM sleep debt during chronic sleep restriction (CSR). Using high-density EEG in mice, we studied how this pattern of global regulation is implemented in cortical regions with different functions and network architectures. We found that across all areas, slow oscillations repeated the behavioral pattern of persistent enhancement during CSR, whereas high-frequency oscillations showed progressive increases. This pattern followed a common rule despite marked topographic differences. The findings suggest that REM sleep slow oscillations may translate top-down homeostatic control to widely separated brain regions whereas fast oscillations synchronizing local neuronal ensembles escape this global command. These patterns of EEG oscillation changes are interpreted to reconcile two prevailing theories of the function of sleep, synaptic homeostasis and sleep dependent memory consolidation. PMID:28193862

Cognitive Workload and Sleep Restriction Interact to Influence Sleep Homeostatic Responses

PubMed Central

Goel, Namni; Abe, Takashi; Braun, Marcia E.; Dinges, David F.

2014-01-01

Study Objectives: Determine the effects of high versus moderate workload on sleep physiology and neurobehavioral measures, during sleep restriction (SR) and no sleep restriction (NSR) conditions. Design: Ten-night experiment involving cognitive workload and SR manipulations. Setting: Controlled laboratory environment. Participants: Sixty-three healthy adults (mean ± standard deviation: 33.2 ± 8.7 y; 29 females), age 22–50 y. Interventions: Following three baseline 8 h time in bed (TIB) nights, subjects were randomized to one of four conditions: high cognitive workload (HW) + SR; moderate cognitive workload (MW) + SR; HW + NSR; or MW + NSR. SR entailed 5 consecutive nights at 4 h TIB; NSR entailed 5 consecutive nights at 8 h TIB. Subjects received three workload test sessions/day consisting of 15-min preworkload assessments, followed by a 60-min (MW) or 120-min (HW) workload manipulation comprised of visually based cognitive tasks, and concluding with 15-min of postworkload assessments. Experimental nights were followed by two 8-h TIB recovery sleep nights. Polysomnography was collected on baseline night 3, experimental nights 1, 4, and 5, and recovery night 1 using three channels (central, frontal, occipital [C3, Fz, O2]). Measurements and Results: High workload, regardless of sleep duration, increased subjective fatigue and sleepiness (all P < 0.05). In contrast, sleep restriction produced cumulative increases in Psychomotor Vigilance Test (PVT) lapses, fatigue, and sleepiness and decreases in PVT response speed and Maintenance of Wakefulness Test (MWT) sleep onset latencies (all P < 0.05). High workload produced longer sleep onset latencies (P < 0.05, d = 0.63) and less wake after sleep onset (P < 0.05, d = 0.64) than moderate workload. Slow-wave energy—the putative marker of sleep homeostasis—was higher at O2 than C3 only in the HW + SR condition (P < 0.05). Conclusions: High cognitive workload delayed sleep onset, but it also promoted sleep homeostatic

Homeostatic Control of the Thyroid–Pituitary Axis: Perspectives for Diagnosis and Treatment

PubMed Central

Hoermann, Rudolf; Midgley, John E. M.; Larisch, Rolf; Dietrich, Johannes W.

2015-01-01

The long-held concept of a proportional negative feedback control between the thyroid and pituitary glands requires reconsideration in the light of more recent studies. Homeostatic equilibria depend on dynamic inter-relationships between thyroid hormones and pituitary thyrotropin (TSH). They display a high degree of individuality, thyroid-state-related hierarchy, and adaptive conditionality. Molecular mechanisms involve multiple feedback loops on several levels of organization, different time scales, and varying conditions of their optimum operation, including a proposed feedforward motif. This supports the concept of a dampened response and multistep regulation, making the interactions between TSH, FT4, and FT3 situational and mathematically more complex. As a homeostatically integrated parameter, TSH becomes neither normatively fixed nor a precise marker of euthyroidism. This is exemplified by the therapeutic situation with l-thyroxine (l-T4) where TSH levels defined for optimum health may not apply equivalently during treatment. In particular, an FT3–FT4 dissociation, discernible FT3–TSH disjoint, and conversion inefficiency have been recognized in l-T4-treated athyreotic patients. In addition to regulating T4 production, TSH appears to play an essential role in maintaining T3 homeostasis by directly controlling deiodinase activity. While still allowing for tissue-specific variation, this questions the currently assumed independence of the local T3 supply. Rather it integrates peripheral and central elements into an overarching control system. On l-T4 treatment, altered equilibria have been shown to give rise to lower circulating FT3 concentrations in the presence of normal serum TSH. While data on T3 in tissues are largely lacking in humans, rodent models suggest that the disequilibria may reflect widespread T3 deficiencies at the tissue level in various organs. As a consequence, the use of TSH, valuable though it is in many situations, should be scaled

Sustained IFN-I Expression during Established Persistent Viral Infection: A “Bad Seed” for Protective Immunity

PubMed Central

Murira, Armstrong; Laulhé, Xavier; Stäger, Simona; Lamarre, Alain; van Grevenynghe, Julien

2017-01-01

Type I interferons (IFN-I) are one of the primary immune defenses against viruses. Similar to all other molecular mechanisms that are central to eliciting protective immune responses, IFN-I expression is subject to homeostatic controls that regulate cytokine levels upon clearing the infection. However, in the case of established persistent viral infection, sustained elevation of IFN-I expression bears deleterious effects to the host and is today considered as the major driver of inflammation and immunosuppression. In fact, numerous emerging studies place sustained IFN-I expression as a common nexus in the pathogenesis of multiple chronic diseases including persistent infections with the human immunodeficiency virus type 1 (HIV-1), simian immunodeficiency virus (SIV), as well as the rodent-borne lymphocytic choriomeningitis virus clone 13 (LCMV clone 13). In this review, we highlight recent studies illustrating the molecular dysregulation and resultant cellular dysfunction in both innate and adaptive immune responses driven by sustained IFN-I expression. Here, we place particular emphasis on the efficacy of IFN-I receptor (IFNR) blockade towards improving immune responses against viral infections given the emerging therapeutic approach of blocking IFNR using neutralizing antibodies (Abs) in chronically infected patients. PMID:29301196

Metabolic and Homeostatic Changes in Seizures and Acquired Epilepsy—Mitochondria, Calcium Dynamics and Reactive Oxygen Species

PubMed Central

Kovac, Stjepana; Dinkova Kostova, Albena T.; Melzer, Nico; Meuth, Sven G.; Gorji, Ali

2017-01-01

Acquired epilepsies can arise as a consequence of brain injury and result in unprovoked seizures that emerge after a latent period of epileptogenesis. These epilepsies pose a major challenge to clinicians as they are present in the majority of patients seen in a common outpatient epilepsy clinic and are prone to pharmacoresistance, highlighting an unmet need for new treatment strategies. Metabolic and homeostatic changes are closely linked to seizures and epilepsy, although, surprisingly, no potential treatment targets to date have been translated into clinical practice. We summarize here the current knowledge about metabolic and homeostatic changes in seizures and acquired epilepsy, maintaining a particular focus on mitochondria, calcium dynamics, reactive oxygen species and key regulators of cellular metabolism such as the Nrf2 pathway. Finally, we highlight research gaps that will need to be addressed in the future which may help to translate these findings into clinical practice. PMID:28885567

A Quantitative RNAi Screen for JNK Modifiers Identifies Pvr as a Novel Regulator of Drosophila Immune Signaling

PubMed Central

Bond, David; Foley, Edan

2009-01-01

Drosophila melanogaster responds to gram-negative bacterial challenges through the IMD pathway, a signal transduction cassette that is driven by the coordinated activities of JNK, NF-κB and caspase modules. While many modifiers of NF-κB activity were identified in cell culture and in vivo assays, the regulatory apparatus that determines JNK inputs into the IMD pathway is relatively unexplored. In this manuscript, we present the first quantitative screen of the entire genome of Drosophila for novel regulators of JNK activity in the IMD pathway. We identified a large number of gene products that negatively or positively impact on JNK activation in the IMD pathway. In particular, we identified the Pvr receptor tyrosine kinase as a potent inhibitor of JNK activation. In a series of in vivo and cell culture assays, we demonstrated that activation of the IMD pathway drives JNK-dependent expression of the Pvr ligands, Pvf2 and Pvf3, which in turn act through the Pvr/ERK MAP kinase pathway to attenuate the JNK and NF-κB arms of the IMD pathway. Our data illuminate a poorly understood arm of a critical and evolutionarily conserved innate immune response. Furthermore, given the pleiotropic involvement of JNK in eukaryotic cell biology, we believe that many of the novel regulators identified in this screen are of interest beyond immune signaling. PMID:19893628

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

Quantitative profiling of immune repertoires for minor lymphocyte counts using unique molecular identifiers.

PubMed

Egorov, Evgeny S; Merzlyak, Ekaterina M; Shelenkov, Andrew A; Britanova, Olga V; Sharonov, George V; Staroverov, Dmitriy B; Bolotin, Dmitriy A; Davydov, Alexey N; Barsova, Ekaterina; Lebedev, Yuriy B; Shugay, Mikhail; Chudakov, Dmitriy M

2015-06-15

Emerging high-throughput sequencing methods for the analyses of complex structure of TCR and BCR repertoires give a powerful impulse to adaptive immunity studies. However, there are still essential technical obstacles for performing a truly quantitative analysis. Specifically, it remains challenging to obtain comprehensive information on the clonal composition of small lymphocyte populations, such as Ag-specific, functional, or tissue-resident cell subsets isolated by sorting, microdissection, or fine needle aspirates. In this study, we report a robust approach based on unique molecular identifiers that allows profiling Ag receptors for several hundred to thousand lymphocytes while preserving qualitative and quantitative information on clonal composition of the sample. We also describe several general features regarding the data analysis with unique molecular identifiers that are critical for accurate counting of starting molecules in high-throughput sequencing applications. Copyright © 2015 by The American Association of Immunologists, Inc.

Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins.

PubMed

Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K

2018-04-15

African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia

Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins

PubMed Central

2018-01-01

ABSTRACT African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant

Investigating the interaction between the homeostatic and circadian processes of sleep-wake regulation for the prediction of waking neurobehavioural performance

NASA Technical Reports Server (NTRS)

Van Dongen, Hans P A.; Dinges, David F.

2003-01-01

The two-process model of sleep regulation has been applied successfully to describe, predict, and understand sleep-wake regulation in a variety of experimental protocols such as sleep deprivation and forced desynchrony. A non-linear interaction between the homeostatic and circadian processes was reported when the model was applied to describe alertness and performance data obtained during forced desynchrony. This non-linear interaction could also be due to intrinsic non-linearity in the metrics used to measure alertness and performance, however. Distinguishing these possibilities would be of theoretical interest, but could also have important implications for the design and interpretation of experiments placing sleep at different circadian phases or varying the duration of sleep and/or wakefulness. Although to date no resolution to this controversy has been found, here we show that the issue can be addressed with existing data sets. The interaction between the homeostatic and circadian processes of sleep-wake regulation was investigated using neurobehavioural performance data from a laboratory experiment involving total sleep deprivation. The results provided evidence of an actual non-linear interaction between the homeostatic and circadian processes of sleep-wake regulation for the prediction of waking neurobehavioural performance.

Identifying causal networks linking cancer processes and anti-tumor immunity using Bayesian network inference and metagene constructs.

PubMed

Kaiser, Jacob L; Bland, Cassidy L; Klinke, David J

2016-03-01

Cancer arises from a deregulation of both intracellular and intercellular networks that maintain system homeostasis. Identifying the architecture of these networks and how they are changed in cancer is a pre-requisite for designing drugs to restore homeostasis. Since intercellular networks only appear in intact systems, it is difficult to identify how these networks become altered in human cancer using many of the common experimental models. To overcome this, we used the diversity in normal and malignant human tissue samples from the Cancer Genome Atlas (TCGA) database of human breast cancer to identify the topology associated with intercellular networks in vivo. To improve the underlying biological signals, we constructed Bayesian networks using metagene constructs, which represented groups of genes that are concomitantly associated with different immune and cancer states. We also used bootstrap resampling to establish the significance associated with the inferred networks. In short, we found opposing relationships between cell proliferation and epithelial-to-mesenchymal transformation (EMT) with regards to macrophage polarization. These results were consistent across multiple carcinomas in that proliferation was associated with a type 1 cell-mediated anti-tumor immune response and EMT was associated with a pro-tumor anti-inflammatory response. To address the identifiability of these networks from other datasets, we could identify the relationship between EMT and macrophage polarization with fewer samples when the Bayesian network was generated from malignant samples alone. However, the relationship between proliferation and macrophage polarization was identified with fewer samples when the samples were taken from a combination of the normal and malignant samples. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:470-479, 2016. © 2016 American Institute of Chemical Engineers.

Rejection Triggers Liver Transplant Tolerance: Involvements of Mesenchyme-Mediated Immune Control Mechanisms

PubMed Central

Morita, Miwa; Joyce, Daniel; Miller, Charles; Fung, John J.; Lu, Lina; Qian, Shiguang

2015-01-01

Liver tolerance was initially recognized by the spontaneous acceptance of liver allograft in many species. The underlying mechanisms are not completely understood. We have been inspired by an unexpected phenomenon that the liver transplant tolerance absolutely requires interferon (IFN)-γ, a rejection-associated inflammatory cytokine. In this study, we investigate the rejection of liver allografts deficient in IFN-γ receptor and reveal that the liver graft is equipped with machineries capable of counterattacking the host immune response through a mesenchyme-mediated immune control (MMIC) mechanism. MMIC is triggered by T effectors (Tef) cell-derived IFN-γ to drive the expression of B7-H1 on graft mesenchymal cells leading to Tef cell apoptosis. We describe the negative feedback loop between graft mesenchymal and Tef cells that ultimately results in liver transplant tolerance. Comparable elevations of T regulatory cells and myeloid-derived suppressor cells are seen in both rejection and tolerance groups, and are not dependent on IFN-γ stimulation, suggesting a critical role of Tef cell elimination in tolerance induction. We identify potent MMIC activity in hepatic stellate cells and liver sinusoidal endothelial cells. MMIC is unlikely exclusive to the liver, as spontaneous acceptance of kidney allografts has been reported, although less commonly, probably reflecting variance in MMIC activity. MMCI may represent an important homeostatic mechanism that supports peripheral tolerance, and could be a target for the prevention and treatment of transplant rejection. This study highlights that the graft is actively participant in the equipoise between tolerance and rejection and warrants more attention in the search for tolerance biomarkers. PMID:25998530

Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

PubMed Central

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-01-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750

A yeast-based assay identifies drugs that interfere with immune evasion of the Epstein-Barr virus.

PubMed

Voisset, Cécile; Daskalogianni, Chrysoula; Contesse, Marie-Astrid; Mazars, Anne; Arbach, Hratch; Le Cann, Marie; Soubigou, Flavie; Apcher, Sébastien; Fåhraeus, Robin; Blondel, Marc

2014-04-01

Epstein-Barr virus (EBV) is tightly associated with certain human cancers, but there is as yet no specific treatment against EBV-related diseases. The EBV-encoded EBNA1 protein is essential to maintain viral episomes and for viral persistence. As such, EBNA1 is expressed in all EBV-infected cells, and is highly antigenic. All infected individuals, including individuals with cancer, have CD8(+) T cells directed towards EBNA1 epitopes, yet the immune system fails to detect and destroy cells harboring the virus. EBV immune evasion depends on the capacity of the Gly-Ala repeat (GAr) domain of EBNA1 to inhibit the translation of its own mRNA in cis, thereby limiting the production of EBNA1-derived antigenic peptides presented by the major histocompatibility complex (MHC) class I pathway. Here we establish a yeast-based assay for monitoring GAr-dependent inhibition of translation. Using this assay we identify doxorubicin (DXR) as a compound that specifically interferes with the GAr effect on translation in yeast. DXR targets the topoisomerase-II-DNA complexes and thereby causes genomic damage. We show, however, that the genotoxic effect of DXR and various analogs thereof is uncoupled from the effect on GAr-mediated translation control. This is further supported by the observation that etoposide and teniposide, representing another class of topoisomerase-II-DNA targeting drugs, have no effect on GAr-mediated translation control. DXR and active analogs stimulate, in a GAr-dependent manner, EBNA1 expression in mammalian cells and overcome GAr-dependent restriction of MHC class I antigen presentation. These results validate our approach as an effective high-throughput screening assay to identify drugs that interfere with EBV immune evasion and, thus, constitute candidates for treating EBV-related diseases, in particular EBV-associated cancers.

Vaginal Mucosal Homeostatic Response May Determine Pregnancy Outcome in Women With Bacterial Vaginosis

PubMed Central

Faure, Emmanuel; Faure, Karine; Figeac, Martin; Kipnis, Eric; Grandjean, Teddy; Dubucquoi, Sylvain; Villenet, Céline; Grandbastien, Bruno; Brabant, Gilles; Subtil, Damien; Dessein, Rodrigue

2016-01-01

Abstract Bacterial vaginosis (BV) is considered as a trigger for an inflammatory response that could promote adverse pregnancy outcome (APO). We hypothesized that BV-related inflammation could be counterbalanced by anti-inflammatory and mucosal homeostatic responses that could participate in pregnancy outcomes. A total of 402 vaginal self-samples from pregnant women in their first trimester were screened by Nugent score. In this population, we enrolled 23 pregnant women with BV but without APO, 5 pregnant women with BV and developing APO, 21 pregnant women with intermediate flora, and 28 random control samples from pregnant women without BV or APO. BV without APO in pregnant women was associated with 28-fold interleukin-8, 5-fold interleukin-10, and 40-fold interleukin-22 increases in expression compared to controls. BV associated with APO in pregnant women shared 4-fold increase in tumor necrosis factor, 100-fold decrease in interleukin-10, and no variation in interleukin-22 expressions compared to controls. Next-generation sequencing of vaginal microbiota revealed a shift from obligate anaerobic bacteria dominance in BV without APO pregnant women to Lactobacillus dominance microbiota in BV with APO. Our results show that the anti-inflammatory and mucosal homeostatic responses to BV may determine outcome of pregnancy in the setting of BV possibly through effects on the vaginal microbiota. PMID:26844497

Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

PubMed Central

Saeed, Sadia; Quintin, Jessica; Kerstens, Hindrik H.D.; Rao, Nagesha A; Aghajanirefah, Ali; Matarese, Filomena; Cheng, Shih-Chin; Ratter, Jacqueline; Berentsen, Kim; van der Ent, Martijn A.; Sharifi, Nilofar; Janssen-Megens, Eva M.; Huurne, Menno Ter; Mandoli, Amit; van Schaik, Tom; Ng, Aylwin; Burden, Frances; Downes, Kate; Frontini, Mattia; Kumar, Vinod; Giamarellos-Bourboulis, Evangelos J; Ouwehand, Willem H; van der Meer, Jos W.M.; Joosten, Leo A.B.; Wijmenga, Cisca; Martens, Joost H.A.; Xavier, Ramnik J.; Logie, Colin; Netea, Mihai G.; Stunnenberg, Hendrik G.

2014-01-01

Structured Abstract Introduction Monocytes circulate in the bloodstream for up to 3–5 days. Concomitantly, immunological imprinting of either tolerance (immunosuppression) or trained immunity (innate immune memory) determines the functional fate of monocytes and monocyte-derived macrophages, as observed after infection or vaccination. Methods Purified circulating monocytes from healthy volunteers were differentiated under the homeostatic M-CSF concentrations present in human serum. During the first 24 hours, trained immunity was induced by β-glucan (BG) priming, while post-sepsis immunoparalysis was mimicked by exposure to LPS, generating endotoxin-induced tolerance. Epigenomic profiling of the histone marks H3K4me1, H3K4me3 and H3K27ac, DNase I accessibility and RNA sequencing were performed at both the start of the experiment (ex vivo monocytes) and at the end of the six days of in vitro culture (macrophages). Results Compared to monocytes (Mo), naïve macrophages (Mf) display a remodeled metabolic enzyme repertoire and attenuated innate inflammatory pathways; most likely necessary to generate functional tissue macrophages. Epigenetic profiling uncovered ~8000 dynamic regions associated with ~11000 DNase I hypersensitive sites. Changes in histone acetylation identified most dynamic events. Furthermore, these regions of differential histone marks displayed some degree of DNase I accessibility that was already present in monocytes. H3K4me1 mark increased in parallel with de novo H3K27ac deposition at distal regulatory regions; H3K4me1 mark remained even after the loss of H3K27ac, marking decommissioned regulatory elements. β-glucan priming specifically induced ~3000 distal regulatory elements, whereas LPS-tolerization uniquely induced H3K27ac at ~500 distal regulatory regions. At the transcriptional level, we identified co-regulated gene modules during monocyte to macrophage differentiation, as well as discordant modules between trained and tolerized cells

The Homeostatic Interaction Between Anodal Transcranial Direct Current Stimulation and Motor Learning in Humans is Related to GABAA Activity.

PubMed

Amadi, Ugwechi; Allman, Claire; Johansen-Berg, Heidi; Stagg, Charlotte J

2015-01-01

The relative timing of plasticity-induction protocols is known to be crucial. For example, anodal transcranial direct current stimulation (tDCS), which increases cortical excitability and typically enhances plasticity, can impair performance if it is applied before a motor learning task. Such timing-dependent effects have been ascribed to homeostatic plasticity, but the specific synaptic site of this interaction remains unknown. We wished to investigate the synaptic substrate, and in particular the role of inhibitory signaling, underpinning the behavioral effects of anodal tDCS in homeostatic interactions between anodal tDCS and motor learning. We used transcranial magnetic stimulation (TMS) to investigate cortical excitability and inhibitory signaling following tDCS and motor learning. Each subject participated in four experimental sessions and data were analyzed using repeated measures ANOVAs and post-hoc t-tests as appropriate. As predicted, we found that anodal tDCS prior to the motor task decreased learning rates. This worsening of learning after tDCS was accompanied by a correlated increase in GABAA activity, as measured by TMS-assessed short interval intra-cortical inhibition (SICI). This provides the first direct demonstration in humans that inhibitory synapses are the likely site for the interaction between anodal tDCS and motor learning, and further, that homeostatic plasticity at GABAA synapses has behavioral relevance in humans. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Homeostatic and pathogenic extramedullary hematopoiesis

PubMed Central

Kim, Chang H

2010-01-01

Extramedullary hematopoiesis (EH) is defined as hematopoiesis occurring in organs outside of the bone marrow; it occurs in diverse conditions, including fetal development, normal immune responses, and pathological circumstances. During fetal development, before formation of mature marrow, EH occurs in the yolk sac, fetal liver, and spleen. EH also occurs during active immune responses to pathogens. Most frequently, this response occurs in the spleen and liver for the production of antigen-presenting cells and phagocytes. EH also occurs when the marrow becomes inhabitable for stem and progenitor cells in certain pathological conditions, including myelofibrosis, where marrow cells are replaced with collagenous connective tissue fibers. Thus, EH occurs either actively or passively in response to diverse changes in the hematopoietic environment. This article reviews the key features and regulators of the major types of EH. PMID:22282679

Homeostatic regulation of excitatory synapses on striatal medium spiny neurons expressing the D2 dopamine receptor.

PubMed

Thibault, Dominic; Giguère, Nicolas; Loustalot, Fabien; Bourque, Marie-Josée; Ducrot, Charles; El Mestikawy, Salah; Trudeau, Louis-Éric

2016-05-01

Striatal medium spiny neurons (MSNs) are contacted by glutamatergic axon terminals originating from cortex, thalamus and other regions. The striatum is also innervated by dopaminergic (DAergic) terminals, some of which release glutamate as a co-transmitter. Despite evidence for functional DA release at birth in the striatum, the role of DA in the establishment of striatal circuitry is unclear. In light of recent work suggesting activity-dependent homeostatic regulation of glutamatergic terminals on MSNs expressing the D2 DA receptor (D2-MSNs), we used primary co-cultures to test the hypothesis that stimulation of DA and glutamate receptors regulates the homeostasis of glutamatergic synapses on MSNs. Co-culture of D2-MSNs with mesencephalic DA neurons or with cortical neurons produced an increase in spines and functional glutamate synapses expressing VGLUT2 or VGLUT1, respectively. The density of VGLUT2-positive terminals was reduced by the conditional knockout of this gene from DA neurons. In the presence of both mesencephalic and cortical neurons, the density of synapses reached the same total, compatible with the possibility of a homeostatic mechanism capping excitatory synaptic density. Blockade of D2 receptors increased the density of cortical and mesencephalic glutamatergic terminals, without changing MSN spine density or mEPSC frequency. Combined blockade of AMPA and NMDA glutamate receptors increased the density of cortical terminals and decreased that of mesencephalic VGLUT2-positive terminals, with no net change in total excitatory terminal density or in mEPSC frequency. These results suggest that DA and glutamate signaling regulate excitatory inputs to striatal D2-MSNs at both the pre- and postsynaptic level, under the influence of a homeostatic mechanism controlling functional output of the circuit.

Bacterial immunostat: Mycobacterium tuberculosis lipids and their role in the host immune response.

PubMed

Queiroz, Adriano; Riley, Lee W

2017-01-01

The lipid-rich cell wall of Mycobacterium tuberculosis is a dynamic structure that is involved in the regulation of the transport of nutrients, toxic host-cell effector molecules, and anti-tuberculosis drugs. It is therefore postulated to contribute to the long-term bacterial survival in an infected human host. Accumulating evidence suggests that M. tuberculosis remodels the lipid composition of the cell wall as an adaptive mechanism against host-imposed stress. Some of these lipid species (trehalose dimycolate, diacylated sulphoglycolipid, and mannan-based lipoglycans) trigger an immunopathologic response, whereas others (phthiocerol dimycocerosate, mycolic acids, sulpholipid-1, and di-and polyacyltrehalose) appear to dampen the immune responses. These lipids appear to be coordinately expressed in the cell wall of M. tuberculosis during different phases of infection, ultimately determining the clinical fate of the infection. This review summarizes the current state of knowledge on the metabolism, transport, and homeostatic or immunostatic regulation of the cell wall lipids, and their orchestrated interaction with host immune responses that results in bacterial clearance, persistence, or tuberculosis.

Homeostatic effects of exercise and sleep on metabolic processes in mice with an overexpressed skeletal muscle clock.

PubMed

Brager, Allison J; Heemstra, Lydia; Bhambra, Raman; Ehlen, J Christopher; Esser, Karyn A; Paul, Ketema N; Novak, Colleen M

2017-01-01

Brain and muscle-ARNT-like factor (Bmal1/BMAL1) is an essential transcriptional/translational factor of circadian clocks. Loss of function of Bmal1/BMAL1 is highly disruptive to physiological and behavioral processes. In light of these previous findings, we examined if transgenic overexpression of Bmal1/BMAL1 in skeletal muscle could alter metabolic processes. First, we characterized in vivo and ex vivo metabolic phenotypes of muscle overexpressed mice (male and female) compared to wild-type littermates (WT). Second, we examined in vivo and ex vivo metabolic processes in the presence of positive and negative homeostatic challenges: high-intensity treadmill running (positive) and acute sleep deprivation (negative). In vivo measures of metabolic processes included body composition, respiratory exchange ratio (RER; VCO 2 /VO 2 ), energy expenditure, total activity counts, and food intake collected from small animal indirect calorimetry. Ex vivo measure of insulin sensitivity in skeletal muscle was determined from radioassays. RER was lower for muscle overexpressed females compared to female WTs. There were no genotype-dependent differences in metabolic phenotypes for males. With homeostatic challenges, muscle overexpressed mice had lower energy expenditure after high-intensity treadmill running. Acute sleep deprivation reduced insulin sensitivity in skeletal muscle in overexpressed male mice, but not male WTs. The present study contributes to a body of evidence showing pleiotropic, non-circadian, and homeostatic effects of altered Bmal1/BMAL1 expression on metabolic processes, demonstrating a critical need to further investigate the broad and complex actions of Bmal1/BMAL1 on physiology and behavior. Published by Elsevier B.V.

Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival.

PubMed

Curiel, Tyler J; Coukos, George; Zou, Linhua; Alvarez, Xavier; Cheng, Pui; Mottram, Peter; Evdemon-Hogan, Melina; Conejo-Garcia, Jose R; Zhang, Lin; Burow, Matthew; Zhu, Yun; Wei, Shuang; Kryczek, Ilona; Daniel, Ben; Gordon, Alan; Myers, Leann; Lackner, Andrew; Disis, Mary L; Knutson, Keith L; Chen, Lieping; Zou, Weiping

2004-09-01

Regulatory T (T(reg)) cells mediate homeostatic peripheral tolerance by suppressing autoreactive T cells. Failure of host antitumor immunity may be caused by exaggerated suppression of tumor-associated antigen-reactive lymphocytes mediated by T(reg) cells; however, definitive evidence that T(reg) cells have an immunopathological role in human cancer is lacking. Here we show, in detailed studies of CD4(+)CD25(+)FOXP3(+) T(reg) cells in 104 individuals affected with ovarian carcinoma, that human tumor T(reg) cells suppress tumor-specific T cell immunity and contribute to growth of human tumors in vivo. We also show that tumor T(reg) cells are associated with a high death hazard and reduced survival. Human T(reg) cells preferentially move to and accumulate in tumors and ascites, but rarely enter draining lymph nodes in later cancer stages. Tumor cells and microenvironmental macrophages produce the chemokine CCL22, which mediates trafficking of T(reg) cells to the tumor. This specific recruitment of T(reg) cells represents a mechanism by which tumors may foster immune privilege. Thus, blocking T(reg) cell migration or function may help to defeat human cancer.

Lgr5 Identifies Progenitor Cells Capable of Taste Bud Regeneration after Injury.

PubMed

Takeda, Norifumi; Jain, Rajan; Li, Deqiang; Li, Li; Lu, Min Min; Epstein, Jonathan A

2013-01-01

Taste buds are composed of a variety of taste receptor cell types that develop from tongue epithelium and are regularly replenished under normal homeostatic conditions as well as after injury. The characteristics of cells that give rise to regenerating taste buds are poorly understood. Recent studies have suggested that Lgr5 (leucine-rich repeat-containing G-protein coupled receptor 5) identifies taste bud stem cells that contribute to homeostatic regeneration in adult circumvallate and foliate taste papillae, which are located in the posterior region of the tongue. Taste papillae in the adult anterior region of the tongue do not express Lgr5. Here, we confirm and extend these studies by demonstrating that Lgr5 cells give rise to both anterior and posterior taste buds during development, and are capable of regenerating posterior taste buds after injury induced by glossopharyngeal nerve transection.

Entorhinal Denervation Induces Homeostatic Synaptic Scaling of Excitatory Postsynapses of Dentate Granule Cells in Mouse Organotypic Slice Cultures

PubMed Central

Vlachos, Andreas; Becker, Denise; Jedlicka, Peter; Winkels, Raphael; Roeper, Jochen; Deller, Thomas

2012-01-01

Denervation-induced changes in excitatory synaptic strength were studied following entorhinal deafferentation of hippocampal granule cells in mature (≥3 weeks old) mouse organotypic entorhino-hippocampal slice cultures. Whole-cell patch-clamp recordings revealed an increase in excitatory synaptic strength in response to denervation during the first week after denervation. By the end of the second week synaptic strength had returned to baseline. Because these adaptations occurred in response to the loss of excitatory afferents, they appeared to be in line with a homeostatic adjustment of excitatory synaptic strength. To test whether denervation-induced changes in synaptic strength exploit similar mechanisms as homeostatic synaptic scaling following pharmacological activity blockade, we treated denervated cultures at 2 days post lesion for 2 days with tetrodotoxin. In these cultures, the effects of denervation and activity blockade were not additive, suggesting that similar mechanisms are involved. Finally, we investigated whether entorhinal denervation, which removes afferents from the distal dendrites of granule cells while leaving the associational afferents to the proximal dendrites of granule cells intact, results in a global or a local up-scaling of granule cell synapses. By using computational modeling and local electrical stimulations in Strontium (Sr2+)-containing bath solution, we found evidence for a lamina-specific increase in excitatory synaptic strength in the denervated outer molecular layer at 3–4 days post lesion. Taken together, our data show that entorhinal denervation results in homeostatic functional changes of excitatory postsynapses of denervated dentate granule cells in vitro. PMID:22403720

[Mucosal immunity with emphasis on urinary tract immunity and diabetes].

PubMed

Krejsek, J; Kudlová, M; Kolácková, M; Novosad, J

2008-05-01

Protective immune response in urinary tract is frequently impaired in patients with diabetes. Immunity in this mucosal compartment displays unique characteristics; e.g. absence of physiological microflora and lack of mucus. Pathogens are identified by the PRR receptors expressed on both epithelial and immune cells. Inflammatory response characterised by the acumulation ofgranulocytes is followed. Both protective and harm characteristics of inflammatory response are inseparable linked and delineated by gene polymorphisms in PRR receptors.

Identifying genome-wide immune gene variation underlying infectious disease in wildlife populations - a next generation sequencing approach in the gopher tortoise.

PubMed

Elbers, Jean P; Brown, Mary B; Taylor, Sabrina S

2018-01-19

Infectious disease is the single greatest threat to taxa such as amphibians (chytrid fungus), bats (white nose syndrome), Tasmanian devils (devil facial tumor disease), and black-footed ferrets (canine distemper virus, plague). Although understanding the genetic basis to disease susceptibility is important for the long-term persistence of these groups, most research has been limited to major-histocompatibility and Toll-like receptor genes. To better understand the genetic basis of infectious disease susceptibility in a species of conservation concern, we sequenced all known/predicted immune response genes (i.e., the immunomes) in 16 Florida gopher tortoises, Gopherus polyphemus. All tortoises produced antibodies against Mycoplasma agassizii (an etiologic agent of infectious upper respiratory tract disease; URTD) and, at the time of sampling, either had (n = 10) or lacked (n = 6) clinical signs. We found several variants associated with URTD clinical status in complement and lectin genes, which may play a role in Mycoplasma immunity. Thirty-five genes deviated from neutrality according to Tajima's D. These genes were enriched in functions relating to macromolecule and protein modifications, which are vital to immune system functioning. These results are suggestive of genetic differences that might contribute to disease severity, a finding that is consistent with other mycoplasmal diseases. This has implications for management because tortoises across their range may possess genetic variation associated with a more severe response to URTD. More generally: 1) this approach demonstrates that a broader consideration of immune genes is better able to identify important variants, and; 2) this data pipeline can be adopted to identify alleles associated with disease susceptibility or resistance in other taxa, and therefore provide information on a population's risk of succumbing to disease, inform translocations to increase genetic variation for disease resistance

Genome-wide DNA methylation profile identified a unique set of differentially methylated immune genes in oral squamous cell carcinoma patients in India.

PubMed

Basu, Baidehi; Chakraborty, Joyeeta; Chandra, Aditi; Katarkar, Atul; Baldevbhai, Jadav Ritesh Kumar; Dhar Chowdhury, Debjit; Ray, Jay Gopal; Chaudhuri, Keya; Chatterjee, Raghunath

2017-01-01

Oral squamous cell carcinoma (OSCC) is one of the common malignancies in Southeast Asia. Epigenetic changes, mainly the altered DNA methylation, have been implicated in many cancers. Considering the varied environmental and genotoxic exposures among the Indian population, we conducted a genome-wide DNA methylation study on paired tumor and adjacent normal tissues of ten well-differentiated OSCC patients and validated in an additional 53 well-differentiated OSCC and adjacent normal samples. Genome-wide DNA methylation analysis identified several novel differentially methylated regions associated with OSCC. Hypermethylation is primarily enriched in the CpG-rich regions, while hypomethylation is mainly in the open sea. Distinct epigenetic drifts for hypo- and hypermethylation across CpG islands suggested independent mechanisms of hypo- and hypermethylation in OSCC development. Aberrant DNA methylation in the promoter regions are concomitant with gene expression. Hypomethylation of immune genes reflect the lymphocyte infiltration into the tumor microenvironment. Comparison of methylome data with 312 TCGA HNSCC samples identified a unique set of hypomethylated promoters among the OSCC patients in India. Pathway analysis of unique hypomethylated promoters indicated that the OSCC patients in India induce an anti-tumor T cell response, with mobilization of T lymphocytes in the neoplastic environment. Survival analysis of these epigenetically regulated immune genes suggested their prominent role in OSCC progression. Our study identified a unique set of hypomethylated regions, enriched in the promoters of immune response genes, and indicated the presence of a strong immune component in the tumor microenvironment. These methylation changes may serve as potential molecular markers to define risk and to monitor the prognosis of OSCC patients in India.

Immunizations challenge healthcare personnel and affects immunization rates.

PubMed

Strohfus, Pamela K; Kim, Susan C; Palma, Sara; Duke, Russell A; Remington, Richard; Roberts, Caleb

2017-02-01

This study measured 1. medical office immunization rates and 2. health care personnel competency in managing vaccine practices before and after evidence-based immunization education was provided. This descriptive study compared 32 family medicine and pediatric offices and 178 medical assistants, licensed practical nurses, registered nurses, nurse practitioners, and physicians in knowledge-based testing pre-education, post-education, and 12-months post-education. Immunization rates were assessed before and 18-months post-education. Immunization rates increased 10.3% - 18months post-education; knowledge increased 7.8% - 12months post-education. Family medicine offices, licensed practical nurses, and medical assistants showed significant knowledge deficits before and 12-months post-education. All demographic groups scored less in storage/handling 12-months post-education. This study is one of the first studies to identify competency challenges in effective immunization delivery among medical assistants, licensed practical nurses, and family medicine offices. Formal and continuous education in immunization administration and storage/handling is recommended among these select groups. Copyright © 2016 Elsevier Inc. All rights reserved.

De novo assembly of the sea trout (Salmo trutta m. trutta) skin transcriptome to identify putative genes involved in the immune response and epidermal mucus secretion

PubMed Central

Wenne, Roman; Burzynski, Artur

2017-01-01

In fish, the skin is a multifunctional organ and the first barrier against pathogens. Salmonids differ in their susceptibility to microorganisms due to varied skin morphology and gene expression patterns. The brown trout is a salmonid species with important commercial and ecological value in Europe. However, there is a lack of knowledge regarding the genes involved in the immune response and mucus secretion in the skin of this fish. Thus, we characterized the skin transcriptome of anadromous brown trout using next-generation sequencing (NGS). A total of 1,348,306 filtered reads were obtained and assembled into 75,970 contigs. Of these contigs 48.57% were identified using BLAST tool searches against four public databases. KEGG pathway and Gene Ontology analyses revealed that 13.40% and 34.57% of the annotated transcripts, respectively, represent a variety of biological processes and functions. Among the identified KEGG Orthology categories, the best represented were signal transduction (23.28%) and immune system (8.82%), with a variety of genes involved in immune pathways, implying the differentiation of immune responses in the trout skin. We also identified and transcriptionally characterized 8 types of mucin proteins–the main structural components of the mucosal layer. Moreover, 140 genes involved in mucin synthesis were identified, and 1,119 potential simple sequence repeats (SSRs) were detected in 3,134 transcripts. PMID:28212382

Homeostatic Presynaptic Plasticity Is Specifically Regulated by P/Q-type Ca2+ Channels at Mammalian Hippocampal Synapses.

PubMed

Jeans, Alexander F; van Heusden, Fran C; Al-Mubarak, Bashayer; Padamsey, Zahid; Emptage, Nigel J

2017-10-10

Voltage-dependent Ca 2+ channels (VGCC) represent the principal source of Ca 2+ ions driving evoked neurotransmitter release at presynaptic boutons. In mammals, presynaptic Ca 2+ influx is mediated mainly via P/Q-type and N-type VGCC, which differ in their properties. Changes in their relative contributions tune neurotransmission both during development and in Hebbian plasticity. However, whether this represents a functional motif also present in other forms of activity-dependent regulation is unknown. Here, we study the role of VGCC in homeostatic plasticity (HSP) in mammalian hippocampal neurons using optical techniques. We find that changes in evoked Ca 2+ currents specifically through P/Q-type, but not N-type, VGCC mediate bidirectional homeostatic regulation of both neurotransmitter release efficacy and the size of the major synaptic vesicle pools. Selective dependence of HSP on P/Q-type VGCC in mammalian terminals has important implications for phenotypes associated with P/Q-type channelopathies, including migraine and epilepsy. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

A quantitative systems approach to identify paracrine mechanisms that locally suppress immune response to Interleukin-12 in the B16 melanoma model

PubMed Central

Kulkarni, Yogesh M.; Chambers, Emily; McGray, A. J. Robert; Ware, Jason S.; Bramson, Jonathan L.

2012-01-01

Interleukin-12 (IL12) enhances anti-tumor immunity when delivered to the tumor microenvironment. However, local immunoregulatory elements dampen the efficacy of IL12. The identity of these local mechanisms used by tumors to suppress immunosurveillance represents a key knowledge gap for improving tumor immunotherapy. From a systems perspective, local suppression of anti-tumor immunity is a closed-loop system - where system response is determined by an unknown combination of external inputs and local cellular cross-talk. Here, we recreated this closed-loop system in vitro and combined quantitative high content assays, in silico model-based inference, and a proteomic workflow to identify the biochemical cues responsible for immunosuppression. Following an induction period, the B16 melanoma cell model, a transplantable model for spontaneous malignant melanoma, inhibited the response of a T helper cell model to IL12. This paracrine effect was not explained by induction of apoptosis or creation of a cytokine sink, despite both mechanisms present within the co-culture assay. Tumor-derived Wnt-inducible signaling protein-1 (WISP-1) was identified to exert paracrine action on immune cells by inhibiting their response to IL12. Moreover, WISP-1 was expressed in vivo following intradermal challenge with B16F10 cells and was inferred to be expressed at the tumor periphery. Collectively, the data suggest that (1) biochemical cues associated with epithelial-to-mesenchymal transition can shape anti-tumor immunity through paracrine action and (2) remnants of the immunoselective pressure associated with evolution in cancer include both sculpting of tumor antigens and expression of proteins that proactively shape anti-tumor immunity. PMID:22777646

International Team Identifies Biomarker for Scleroderma

MedlinePlus

... Identifies Biomarker for Scleroderma Spotlight on Research International Team Identifies Biomarker for Scleroderma By Kirstie Saltsman, Ph. ... suggests it stems from immune system malfunction. The team chose to focus on immune cells called plasmacytoid ...

Measuring polio immunity to plan immunization activities.

PubMed

Voorman, Arend; Lyons, Hil M

2016-11-21

The Global Polio Eradication Initiative is closer than ever to achieving a polio-free world. Immunization activities must still be carried out in non-endemic countries to maintain population immunity at levels which will stop poliovirus from spreading if it is re-introduced from still-infected areas. In areas where there is no active transmission of poliovirus, programs must rely on surrogate indicators of population immunity to determine the appropriate immunization activities, typically caregiver-reported vaccination history obtained from non-polio acute flaccid paralysis patients identified through polio surveillance. We used regression models to examine the relationship between polio vaccination campaigns and caregiver-reported polio vaccination history. We find that in many countries, vaccination campaigns have a surprisingly weak impact on these commonly used indicators. We conclude that alternative criteria and data, such as routine immunization indicators from vaccination records or household surveys, should be considered for planning polio vaccination campaigns, and that validation of such surrogate indicators is necessary if they are to be used as the basis for program planning and risk assessment. We recommend that the GPEI and similar organizations consider or continue devoting additional resources to rigorously study population immunity and campaign effectiveness in at-risk countries. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Multiplexed screening of natural humoral immunity identifies antibodies at fine specificity for complex and dynamic viral targets.

PubMed

McCutcheon, Krista M; Gray, Julia; Chen, Natalie Y; Liu, Keyi; Park, Minha; Ellsworth, Stote; Tripp, Ralph A; Tompkins, S Mark; Johnson, Scott K; Samet, Shelly; Pereira, Lenore; Kauvar, Lawrence M

2014-01-01

Viral entry targets with therapeutic neutralizing potential are subject to multiple escape mechanisms, including antigenic drift, immune dominance of functionally irrelevant epitopes, and subtle variations in host cell mechanisms. A surprising finding of recent years is that potent neutralizing antibodies to viral epitopes independent of strain exist, but are poorly represented across the diverse human population. Identifying these antibodies and understanding the biology mediating the specific immune response is thus difficult. An effective strategy for meeting this challenge is to incorporate multiplexed antigen screening into a high throughput survey of the memory B cell repertoire from immune individuals. We used this approach to discover suites of cross-clade antibodies directed to conformational epitopes in the stalk region of the influenza A hemagglutinin (HA) protein and to select high-affinity anti-peptide antibodies to the glycoprotein B (gB) of human cytomegalovirus. In each case, our screens revealed a restricted VH and VL germline usage, including published and previously unidentified gene families. The in vivo evolution of paratope specificity with optimal neutralizing activity was understandable after correlating biological activities with kinetic binding and epitope recognition. Iterative feedback between antigen probe design based on structure and function information with high throughput multiplexed screening demonstrated a generally applicable strategy for efficient identification of safe, native, finely tuned antibodies with the potential for high genetic barriers to viral escape.

Prolonged Ischemia Triggers Necrotic Depletion of Tissue Resident Macrophages to Facilitate Inflammatory Immune Activation in Liver Ischemia Reperfusion Injury

PubMed Central

Yue, Shi; Zhou, Haoming; Wang, Xuehao; Busuttil, Ronald W.; Kupiec-Weglinski, Jerzy W.; Zhai, Yuan

2017-01-01

Although mechanisms of immune activation against liver ischemia reperfusion injury (IRI) have been studied extensively, questions regarding liver resident macrophages, i.e., Kupffer cells, remain controversial. Recent progress in the biology of tissue resident macrophages implicates homeostatic functions of KCs. This study aims to dissect responses and functions of KCs in liver IRI. In a murine liver partial warm ischemia model, we analyzed liver resident vs. infiltrating macrophages by fluorescence-activated cell sorting (FACS) and immunofluorescence staining. Our data showed that liver immune activation by IR was associated with not only infiltrations/activations of peripheral macrophages (iMØ), but also necrotic depletion of KCs. Inhibition of Receptor Interacting Protein 1 (RIP1) by necrostatin-1s protected KCs from ischemia-induce depletion, resulting in the reduction of iMØ infiltration, suppression of pro-inflammatory immune activation and protection of livers from IRI. The depletion of KCs by clodronate-liposomes abrogated these effects of Nec-1s. Additionally, liver reconstitutions with KCs post-ischemia exerted anti-inflammatory/cytoprotective effects against IRI. These results reveal a unique response of KCs against liver IR, i.e., RIP-1-dependent necrosis, which constitutes a novel mechanism of liver inflammatory immune activation in the pathogenesis of liver IRI. PMID:28289160

Multiancestry association study identifies new asthma risk loci that colocalize with immune-cell enhancer marks.

PubMed

Demenais, Florence; Margaritte-Jeannin, Patricia; Barnes, Kathleen C; Cookson, William O C; Altmüller, Janine; Ang, Wei; Barr, R Graham; Beaty, Terri H; Becker, Allan B; Beilby, John; Bisgaard, Hans; Bjornsdottir, Unnur Steina; Bleecker, Eugene; Bønnelykke, Klaus; Boomsma, Dorret I; Bouzigon, Emmanuelle; Brightling, Christopher E; Brossard, Myriam; Brusselle, Guy G; Burchard, Esteban; Burkart, Kristin M; Bush, Andrew; Chan-Yeung, Moira; Chung, Kian Fan; Couto Alves, Alexessander; Curtin, John A; Custovic, Adnan; Daley, Denise; de Jongste, Johan C; Del-Rio-Navarro, Blanca E; Donohue, Kathleen M; Duijts, Liesbeth; Eng, Celeste; Eriksson, Johan G; Farrall, Martin; Fedorova, Yuliya; Feenstra, Bjarke; Ferreira, Manuel A; Freidin, Maxim B; Gajdos, Zofia; Gauderman, Jim; Gehring, Ulrike; Geller, Frank; Genuneit, Jon; Gharib, Sina A; Gilliland, Frank; Granell, Raquel; Graves, Penelope E; Gudbjartsson, Daniel F; Haahtela, Tari; Heckbert, Susan R; Heederik, Dick; Heinrich, Joachim; Heliövaara, Markku; Henderson, John; Himes, Blanca E; Hirose, Hiroshi; Hirschhorn, Joel N; Hofman, Albert; Holt, Patrick; Hottenga, Jouke; Hudson, Thomas J; Hui, Jennie; Imboden, Medea; Ivanov, Vladimir; Jaddoe, Vincent W V; James, Alan; Janson, Christer; Jarvelin, Marjo-Riitta; Jarvis, Deborah; Jones, Graham; Jonsdottir, Ingileif; Jousilahti, Pekka; Kabesch, Michael; Kähönen, Mika; Kantor, David B; Karunas, Alexandra S; Khusnutdinova, Elza; Koppelman, Gerard H; Kozyrskyj, Anita L; Kreiner, Eskil; Kubo, Michiaki; Kumar, Rajesh; Kumar, Ashish; Kuokkanen, Mikko; Lahousse, Lies; Laitinen, Tarja; Laprise, Catherine; Lathrop, Mark; Lau, Susanne; Lee, Young-Ae; Lehtimäki, Terho; Letort, Sébastien; Levin, Albert M; Li, Guo; Liang, Liming; Loehr, Laura R; London, Stephanie J; Loth, Daan W; Manichaikul, Ani; Marenholz, Ingo; Martinez, Fernando J; Matheson, Melanie C; Mathias, Rasika A; Matsumoto, Kenji; Mbarek, Hamdi; McArdle, Wendy L; Melbye, Mads; Melén, Erik; Meyers, Deborah; Michel, Sven; Mohamdi, Hamida; Musk, Arthur W; Myers, Rachel A; Nieuwenhuis, Maartje A E; Noguchi, Emiko; O'Connor, George T; Ogorodova, Ludmila M; Palmer, Cameron D; Palotie, Aarno; Park, Julie E; Pennell, Craig E; Pershagen, Göran; Polonikov, Alexey; Postma, Dirkje S; Probst-Hensch, Nicole; Puzyrev, Valery P; Raby, Benjamin A; Raitakari, Olli T; Ramasamy, Adaikalavan; Rich, Stephen S; Robertson, Colin F; Romieu, Isabelle; Salam, Muhammad T; Salomaa, Veikko; Schlünssen, Vivi; Scott, Robert; Selivanova, Polina A; Sigsgaard, Torben; Simpson, Angela; Siroux, Valérie; Smith, Lewis J; Solodilova, Maria; Standl, Marie; Stefansson, Kari; Strachan, David P; Stricker, Bruno H; Takahashi, Atsushi; Thompson, Philip J; Thorleifsson, Gudmar; Thorsteinsdottir, Unnur; Tiesler, Carla M T; Torgerson, Dara G; Tsunoda, Tatsuhiko; Uitterlinden, André G; van der Valk, Ralf J P; Vaysse, Amaury; Vedantam, Sailaja; von Berg, Andrea; von Mutius, Erika; Vonk, Judith M; Waage, Johannes; Wareham, Nick J; Weiss, Scott T; White, Wendy B; Wickman, Magnus; Widén, Elisabeth; Willemsen, Gonneke; Williams, L Keoki; Wouters, Inge M; Yang, James J; Zhao, Jing Hua; Moffatt, Miriam F; Ober, Carole; Nicolae, Dan L

2018-01-01

We examined common variation in asthma risk by conducting a meta-analysis of worldwide asthma genome-wide association studies (23,948 asthma cases, 118,538 controls) of individuals from ethnically diverse populations. We identified five new asthma loci, found two new associations at two known asthma loci, established asthma associations at two loci previously implicated in the comorbidity of asthma plus hay fever, and confirmed nine known loci. Investigation of pleiotropy showed large overlaps in genetic variants with autoimmune and inflammatory diseases. The enrichment in enhancer marks at asthma risk loci, especially in immune cells, suggested a major role of these loci in the regulation of immunologically related mechanisms.

From The Cover: Genome-wide RNA interference screen identifies previously undescribed regulators of polyglutamine aggregation

NASA Astrophysics Data System (ADS)

Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.

2004-04-01

Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases

Microbiota induces tonic CCL2 systemic levels that control pDC trafficking in steady state.

PubMed

Swiecki, M; Miller, H L; Sesti-Costa, R; Cella, M; Gilfillan, S; Colonna, M

2017-07-01

Plasmacytoid dendritic cells (pDCs) detect viruses initiating antiviral type I interferon responses. The microbiota is known to shape immune responses, but whether it influences pDC homeostasis and/or function is poorly understood. By comparing pDCs in germ-free and specific pathogen-free mice, we found that the microbiota supports homeostatic trafficking by eliciting constitutive levels of the chemokine CCL2 that engages CCR2. Mononuclear phagocytes were required for tonic CCL2 levels. CCL2 was particularly important for trafficking of a CCR2 hi subset of pDCs that produced proinflammatory cytokines and was prone to apoptosis. We further demonstrated that CCR2 was also essential for pDC migration during inflammation. Wild-type (WT):Ccr2 -/- mixed bone marrow chimeras revealed that CCR2 promotes pDC migration in a cell-intrinsic manner. Overall, we identify a novel role for the microbiota in shaping immunity, which includes induction of CCL2 levels that control homeostatic trafficking of pDCs.

Barriers to Immunizations and Strategies to Enhance Immunization Rates in Adults with Autoimmune Inflammatory Diseases.

PubMed

Kirchner, Elizabeth; Ruffing, Victoria

2017-02-01

For as long as there have been immunizations, there have been barriers to them. Immunization rates in the United States are below target. Rheumatologists and rheumatology practitioners need to understand the issues of immunizations in patients with autoimmune inflammatory disease to identify and overcome barriers to immunization. Several strategies for overcoming these barriers are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

The soluble pattern recognition receptor PTX3 links humoral innate and adaptive immune responses by helping marginal zone B cells

PubMed Central

Sintes, Jordi; Polentarutti, Nadia; Walland, A. Cooper; Yeiser, John R.; Cunha, Cristina; Lacerda, João F.; Salvatori, Giovanni; Blander, J. Magarian

2016-01-01

Pentraxin 3 (PTX3) is a fluid-phase pattern recognition receptor of the humoral innate immune system with ancestral antibody-like properties but unknown antibody-inducing function. In this study, we found binding of PTX3 to splenic marginal zone (MZ) B cells, an innate-like subset of antibody-producing lymphocytes strategically positioned at the interface between the circulation and the adaptive immune system. PTX3 was released by a subset of neutrophils that surrounded the splenic MZ and expressed an immune activation–related gene signature distinct from that of circulating neutrophils. Binding of PTX3 promoted homeostatic production of IgM and class-switched IgG antibodies to microbial capsular polysaccharides, which decreased in PTX3-deficient mice and humans. In addition, PTX3 increased IgM and IgG production after infection with blood-borne encapsulated bacteria or immunization with bacterial carbohydrates. This immunogenic effect stemmed from the activation of MZ B cells through a neutrophil-regulated pathway that elicited class switching and plasmablast expansion via a combination of T cell–independent and T cell–dependent signals. Thus, PTX3 may bridge the humoral arms of the innate and adaptive immune systems by serving as an endogenous adjuvant for MZ B cells. This property could be harnessed to develop more effective vaccines against encapsulated pathogens. PMID:27621420

Analytical quality goals derived from the total deviation from patients' homeostatic set points, with a margin for analytical errors.

PubMed

Bolann, B J; Asberg, A

2004-01-01

The deviation of test results from patients' homeostatic set points in steady-state conditions may complicate interpretation of the results and the comparison of results with clinical decision limits. In this study the total deviation from the homeostatic set point is defined as the maximum absolute deviation for 95% of measurements, and we present analytical quality requirements that prevent analytical error from increasing this deviation to more than about 12% above the value caused by biology alone. These quality requirements are: 1) The stable systematic error should be approximately 0, and 2) a systematic error that will be detected by the control program with 90% probability, should not be larger than half the value of the combined analytical and intra-individual standard deviation. As a result, when the most common control rules are used, the analytical standard deviation may be up to 0.15 times the intra-individual standard deviation. Analytical improvements beyond these requirements have little impact on the interpretability of measurement results.

Physiology and Anatomy for Nurses and Healthcare Practitioners: A Homeostatic Approach - Third edition Clancy John McVicar Andrew J Physiology and Anatomy for Nurses and Healthcare Practitioners: A Homeostatic Approach - Third edition 768pp Hodder Arnold 9780340967591 0340967595 [Formula: see text].

PubMed

2010-02-10

John Clancy and Andrew McVicar give a fascinating insight into the homeostatic mechanism for health. The content focuses on the body's adaptive responses in health and the maladaptive processes in ill-health. In turn, these processes are linked to the knowledge required by healthcare professionals in restoring health or enhancing the quality of life until death.

Adolescent Changes in Homeostatic Regulation of EEG Activity in the Delta and Theta Frequency Bands during NREM Sleep

PubMed Central

Campbell, Ian G.; Darchia, Nato; Higgins, Lisa M.; Dykan, Igor V.; Davis, Nicole M.; de Bie, Evan; Feinberg, Irwin

2011-01-01

Study Objectives: Slow wave EEG activity in NREM sleep decreases by more than 60% between ages 10 and 20 years. Slow wave EEG activity also declines across NREM periods (NREMPs) within a night, and this decline is thought to represent the dynamics of sleep homeostasis. We used longitudinal data to determine whether these homeostatic dynamics change across adolescence. Design: All-night sleep EEG was recorded semiannually for 6 years. Setting: EEG was recorded with ambulatory recorders in the subjects' homes. Participants: Sixty-seven subjects in 2 cohorts, one starting at age 9 and one starting at age 12 years. Measurements and Results: For NREM delta (1-4 Hz) and theta (4-8 Hz) EEG, we tested whether the proportion of spectral energy contained in the first NREMP changes with age. We also tested for age changes in the parameters of the process S exponential decline. For both delta and theta, the proportion of energy in the first NREMP declined significantly across ages 9 to 18 years. Process S parameters SWA0 and TWA0, respectively, represent slow wave (delta) activity and theta wave activity at the beginning of the night. SWA0 and TWA0 declined significantly (P < 0.0001) across ages 9 to 18. Conclusions: These declines indicate that the intensity of the homeostatic or restorative processes at the beginning of sleep diminished across adolescence. We propose that this change in sleep regulation is caused by the synaptic pruning that occurs during adolescent brain maturation. Citation: Campbell IG; Darchia N; Higgins LM; Dykan IV; Davis NM; de Bie E; Feinberg I. Adolescent changes in homeostatic regulation of EEG activity in the delta and theta frequency bands during NREM sleep. SLEEP 2011;34(1):83-91. PMID:21203377

The Relative Contributions of the Homeostatic and Circadian Processes to Sleep Regulation under Conditions of Severe Sleep Restriction

PubMed Central

Paech, Gemma M.; Ferguson, Sally A.; Sargent, Charli; Kennaway, David J.; Roach, Gregory D.

2012-01-01

Study Objectives: To investigate the relative contributions of the homeostatic and circadian processes on sleep regulation under conditions of severe sleep restriction. Design: The 13-day laboratory based study consisted of 3 × 24-h baseline days (8 h sleep opportunity, 16 h wake) followed by 7 × 28-h forced desynchrony days (4.7 h sleep opportunity, 23.3 h wake). Setting: The study was conducted in a time isolation unit at the Centre for Sleep Research, University of South Australia. Participants: Fourteen healthy, nonsmoking males, aged 21.8 ± 3.8 (mean ± SD) years participated in the study. Interventions: N/A Measurements: Sleep was measured using standard polysomnography. Core body temperature (CBT) was recorded continuously using a rectal thermistor. Each epoch of sleep was assigned a circadian phase based on the CBT data (6 × 60-degree bins) and an elapsed time into sleep episode (2 × 140-min intervals). Results: The percentage of SWS decreased with elapsed time into the sleep episode. However, no change in the percentage of REM sleep was observed with sleep progression. Whilst there was a circadian modulation of REM sleep, the amplitude of the circadian variation was smaller than expected. Sleep efficiency remained high throughout the sleep episode and across all circadian phases. Conclusions: Previous forced desynchrony studies have demonstrated a strong circadian influence on sleep, in the absence of sleep restriction. The current study suggests that in the presence of high homeostatic pressure, the circadian modulation of sleep, in particular sleep efficiency and to a lesser extent, REM sleep, are reduced. Citation: Paech GM; Ferguson SA; Sargent C; Kennaway DJ; Roach GD. The relative contributions of the homeostatic and circadian processes to sleep regulation under conditions of severe sleep restriction. SLEEP 2012;35(7):941-948. PMID:22754040

Homeostatic regulation of adult hippocampal neurogenesis in aging rats: long-term effects of early exercise

PubMed Central

Merkley, Christina M.; Jian, Charles; Mosa, Adam; Tan, Yao-Fang; Wojtowicz, J. Martin

2014-01-01

Adult neurogenesis is highly responsive to environmental and physiological factors. The majority of studies to date have examined short-term consequences of enhancing or blocking neurogenesis but long-term changes remain less well understood. Current evidence for age-related declines in neurogenesis warrant further investigation into these long-term changes. In this report we address the hypothesis that early life experience, such as a period of voluntary running in juvenile rats, can alter properties of adult neurogenesis for the remainder of the animal's life. The results indicate that the number of proliferating and differentiating neuronal precursors is not altered in runners beyond the initial weeks post-running, suggesting homeostatic regulation of these processes. However, the rate of neuronal maturation and survival during a 4 week period after cell division was enhanced up to 11 months of age (the end of the study period). This study is the first to show that a transient period of physical activity at a young age promotes changes in neurogenesis that persist over the long-term, which is important for our understanding of the modulation of neurogenesis by exercise with age. Functional integration of adult-born neurons within the hippocampus that resist homeostatic regulation with aging, rather than the absolute number of adult-born neurons, may be an essential feature of adult neurogenesis that promotes the maintenance of neural plasticity in old age. PMID:25071426

Rejection triggers liver transplant tolerance: Involvement of mesenchyme-mediated immune control mechanisms in mice.

PubMed

Morita, Miwa; Joyce, Daniel; Miller, Charles; Fung, John J; Lu, Lina; Qian, Shiguang

2015-09-01

Liver tolerance was initially recognized by the spontaneous acceptance of liver allografts in many species. The underlying mechanisms are not completely understood. However, liver transplant (LT) tolerance absolutely requires interferon (IFN)-γ, a rejection-associated inflammatory cytokine. In this study, we investigated the rejection of liver allografts deficient in the IFN-γ receptor and reveal that the liver graft is equipped with machineries capable of counterattacking the host immune response through a mesenchyme-mediated immune control (MMIC) mechanism. MMIC is triggered by T effector (Tef) cell-derived IFN-γ that drives expression of B7-H1 on graft mesenchymal cells leading to Tef cell apoptosis. We describe the negative feedback loop between graft mesenchymal and Tef cells that ultimately results in LT tolerance. Comparable elevations of T-regulatory cells and myeloid-derived suppressor cells were observed in both rejection and tolerance groups and were not dependent on IFN-γ stimulation, suggesting a critical role of Tef cell elimination in tolerance induction. We identify potent MMIC activity in hepatic stellate cells and liver sinusoidal endothelial cells. MMIC is unlikely exclusive to the liver, given that spontaneous acceptance of kidney allografts has been reported, although less commonly, probably reflecting variance in MMIC activity. MMIC may represent an important homeostatic mechanism that supports peripheral tolerance and could be a target for the prevention and treatment of transplant rejection. This study highlights that the graft is an active participant in the equipoise between tolerance and rejection and warrants more attention in the search for tolerance biomarkers. © 2015 by the American Association for the Study of Liver Diseases.

Toll immune signal activates cellular immune response via eicosanoids.

PubMed

Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun

2018-07-01

Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

A homeostatic clock sets daughter centriole size in flies

PubMed Central

Aydogan, Mustafa G.; Steinacker, Thomas L.; Novak, Zsofia A.; Baumbach, Janina; Muschalik, Nadine

2018-01-01

Centrioles are highly structured organelles whose size is remarkably consistent within any given cell type. New centrioles are born when Polo-like kinase 4 (Plk4) recruits Ana2/STIL and Sas-6 to the side of an existing “mother” centriole. These two proteins then assemble into a cartwheel, which grows outwards to form the structural core of a new daughter. Here, we show that in early Drosophila melanogaster embryos, daughter centrioles grow at a linear rate during early S-phase and abruptly stop growing when they reach their correct size in mid- to late S-phase. Unexpectedly, the cartwheel grows from its proximal end, and Plk4 determines both the rate and period of centriole growth: the more active the centriolar Plk4, the faster centrioles grow, but the faster centriolar Plk4 is inactivated and growth ceases. Thus, Plk4 functions as a homeostatic clock, establishing an inverse relationship between growth rate and period to ensure that daughter centrioles grow to the correct size. PMID:29500190

Portable Immune-Assessment System

NASA Technical Reports Server (NTRS)

Pierson, Duane L.; Stowe, Raymond P.; Mishra, Saroj K.

1995-01-01

Portable immune-assessment system developed for use in rapidly identifying infections or contaminated environment. System combines few specific fluorescent reagents for identifying immune-cell dysfunction, toxic substances, buildup of microbial antigens or microbial growth, and potential identification of pathogenic microorganisms using fluorescent microplate reader linked to laptop computer. By using few specific dyes for cell metabolism, DNA/RNA conjugation, specific enzyme activity, or cell constituents, one makes immediate, onsite determination of person's health or of contamination of environment.

Massively Parallel RNA Sequencing Identifies a Complex Immune Gene Repertoire in the lophotrochozoan Mytilus edulis

PubMed Central

Philipp, Eva E. R.; Kraemer, Lars; Melzner, Frank; Poustka, Albert J.; Thieme, Sebastian; Findeisen, Ulrike; Schreiber, Stefan; Rosenstiel, Philip

2012-01-01

The marine mussel Mytilus edulis and its closely related sister species are distributed world-wide and play an important role in coastal ecology and economy. The diversification in different species and their hybrids, broad ecological distribution, as well as the filter feeding mode of life has made this genus an attractive model to investigate physiological and molecular adaptations and responses to various biotic and abiotic environmental factors. In the present study we investigated the immune system of Mytilus, which may contribute to the ecological plasticity of this species. We generated a large Mytilus transcriptome database from different tissues of immune challenged and stress treated individuals from the Baltic Sea using 454 pyrosequencing. Phylogenetic comparison of orthologous groups of 23 species demonstrated the basal position of lophotrochozoans within protostomes. The investigation of immune related transcripts revealed a complex repertoire of innate recognition receptors and downstream pathway members including transcripts for 27 toll-like receptors and 524 C1q domain containing transcripts. NOD-like receptors on the other hand were absent. We also found evidence for sophisticated TNF, autophagy and apoptosis systems as well as for cytokines. Gill tissue and hemocytes showed highest expression of putative immune related contigs and are promising tissues for further functional studies. Our results partly contrast with findings of a less complex immune repertoire in ecdysozoan and other lophotrochozoan protostomes. We show that bivalves are interesting candidates to investigate the evolution of the immune system from basal metazoans to deuterostomes and protostomes and provide a basis for future molecular work directed to immune system functioning in Mytilus. PMID:22448234

Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

PubMed

Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

2014-01-01

Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

Identifying Regulators of the Immune Response to Dying Cells | Center for Cancer Research

Cancer.gov

Cytotoxic T cells are responsible for carrying out antigen-mediated immune responses against virally-infected and malignant cells. In both cases, cytotoxic T cells are stimulated by interacting with antigen presenting cells, such as dendritic cells (DCs). Infected cells produce virus-specific antigens and pathogen associated molecular patterns, which are recognized by DCs and lead to robust T cell activation. Dead or dying uninfected cells, on the other hand, release damage associated molecular patterns, but their release does not always appear to be sufficient to induce cytotoxic T cell activity. Tim Greten, M.D., of CCR’s Medical Oncology Branch, and a group of international collaborators set out to understand how immune responses against dying cancer cells are regulated. These processes are likely to be important for improving the efficacy of cancer treatment vaccines, which induce an immune reaction against a patient’s cancer cells.

A Genetic Screen Identifies a Requirement for Cysteine-Rich-Receptor-Like Kinases in Rice NH1 (OsNPR1)-Mediated Immunity.

PubMed

Chern, Mawsheng; Xu, Qiufang; Bart, Rebecca S; Bai, Wei; Ruan, Deling; Sze-To, Wing Hoi; Canlas, Patrick E; Jain, Rashmi; Chen, Xuewei; Ronald, Pamela C

2016-05-01

Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases (CRK6 and CRK10), complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1 phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. These experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.

A genetic screen identifies a requirement for cysteine-rich–receptor-like kinases in rice NH1 (OsNPR1)-mediated immunity

DOE PAGES

Chern, Mawsheng; Xu, Qiufang; Bart, Rebecca S.; ...

2016-05-13

Systemic acquired resistance, mediated by the Arabidopsis NPR1 gene and the rice NH1 gene, confers broad-spectrum immunity to diverse pathogens. NPR1 and NH1 interact with TGA transcription factors to activate downstream defense genes. Despite the importance of this defense response, the signaling components downstream of NPR1/NH1 and TGA proteins are poorly defined. Here we report the identification of a rice mutant, snim1, which suppresses NH1-mediated immunity and demonstrate that two genes encoding previously uncharacterized cysteine-rich-receptor-like kinases ( CRK6 and CRK10), complement the snim1 mutant phenotype. Silencing of CRK6 and CRK10 genes individually in the parental genetic background recreates the snim1more » phenotype. We identified a rice mutant in the Kitaake genetic background with a frameshift mutation in crk10; this mutant also displays a compromised immune response highlighting the important role of crk10. We also show that elevated levels of NH1 expression lead to enhanced CRK10 expression and that the rice TGA2.1 protein binds to the CRK10 promoter. Furthermore, these experiments demonstrate a requirement for CRKs in NH1-mediated immunity and establish a molecular link between NH1 and induction of CRK10 expression.« less

The Algebra of Sleepiness: Investigating the Interaction of Homeostatic (S) and Circadian (C) Processes in Sleepiness Using Linear Metrics"

ERIC Educational Resources Information Center

Mairesse, Olivier; Hofmans, Joeri; Neu, Daniel; Dinis Monica de Oliveira, Armando Luis; Cluydts, Raymond; Theuns, Peter

2010-01-01

The present studies were conducted to contribute to the debate on the interaction between circadian (C) and homeostatic (S) processes in models of sleep regulation. The Two-Process Model of Sleep Regulation assumes a linear relationship between processes S and C. However, recent elaborations of the model, based on data from forced desynchrony…

Toward an understanding of immune cell sociology: real-time monitoring of cytokine secretion at the single-cell level.

PubMed

Shirasaki, Yoshitaka; Yamagishi, Mai; Shimura, Nanako; Hijikata, Atsushi; Ohara, Osamu

2013-01-01

The immune system is a very complex and dynamic cellular system, and its intricacies are considered akin to those of human society. Disturbance of homeostasis of the immune system results in various types of diseases; therefore, the homeostatic mechanism of the immune system has long been a subject of great interest in biology, and a lot of information has been accumulated at the cellular and the molecular levels. However, the sociological aspects of the immune system remain too abstract to address because of its high complexity, which mainly originates from a large number and variety of cell-cell interactions. As long-range interactions mediated by cytokines play a key role in the homeostasis of the immune system, cytokine secretion analyses, ranging from analyses of the micro level of individual cells to the macro level of a bulk of cell ensembles, provide us with a solid basis of a sociological viewpoint of the immune system. In this review, as the first step toward a comprehensive understanding of immune cell sociology, cytokine secretion of immune cells is surveyed with a special emphasis on the single-cell level, which has been overlooked but should serve as a basis of immune cell sociology. Now that it has become evident that large cell-to-cell variations in cytokine secretion exist at the single-cell level, we face a tricky yet interesting question: How is homeostasis maintained when the system is composed of intrinsically noisy agents? In this context, we discuss how the heterogeneity of cytokine secretion at the single-cell level affects our view of immune cell sociology. While the apparent inconsistency between homeostasis and cell-to-cell heterogeneity is difficult to address by a conventional reductive approach, comparison and integration of single-cell data with macroscopic data will offer us a new direction for the comprehensive understanding of immune cell sociology. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Identifying risk factors of immune reconstitution inflammatory syndrome in AIDS patients receiving highly active anti-retroviral therapy.

PubMed

He, Bo; Zheng, Yuhuang; Liu, Meng; Zhou, Guoqiang; Chen, Xia; Mamadou, Diallo; He, Yan; Zhou, Huaying; Chen, Zi

2013-01-01

Immune reconstitution inflammation syndrome typically occurs within days after patients undergo highly active anti-retroviral therapy and is a big hurdle for effective treatment of AIDS patients. In this study, we monitored immune reconstitution inflammation syndrome occurrence in 238 AIDS patients treated with highly active anti-retroviral therapy. Among them, immune reconstitution inflammation syndrome occurred in 47 cases (19.7%). Immune reconstitution inflammation syndrome patients had significantly higher rate of opportunistic infection (p<0.001) and persistently lower CD4(+) cell count (p<0.001) compared to the non-immune reconstitution inflammation syndrome patients. In contrast, no significant differences in HIV RNA loads were observed between the immune reconstitution inflammation syndrome group and non-immune reconstitution inflammation syndrome group. These data suggest that a history of opportunistic infection and CD4(+) cell counts at baseline may function as risk factors for immune reconstitution inflammation syndrome occurrence in AIDS patients as well as potential prognostic markers. These findings will improve the management of AIDS with highly active anti-retroviral therapy. Copyright © 2013 Elsevier Editora Ltda. All rights reserved.

Homeostatic plasticity shapes cell-type-specific wiring in the retina

PubMed Central

Tien, Nai-Wen; Soto, Florentina; Kerschensteiner, Daniel

2017-01-01

SUMMARY Convergent input from different presynaptic partners shapes the responses of postsynaptic neurons. Whether developing postsynaptic neurons establish connections with each presynaptic partner independently, or balance inputs to attain specific responses is unclear. Retinal ganglion cells (RGCs) receive convergent input from bipolar cell types with different contrast responses and temporal tuning. Here, using optogenetic activation and pharmacogenetic silencing, we found that type 6 bipolar cells (B6) dominate excitatory input to ONα-RGCs. We generated mice in which B6 cells were selectively removed from developing circuits (B6-DTA). In B6-DTA mice, ONα-RGCs adjusted connectivity with other bipolar cells in a cell-type-specific manner. They recruited new partners, increased synapses with some existing partners, and maintained constant input from others. Patch clamp recordings revealed that anatomical rewiring precisely preserved contrast- and temporal frequency response functions of ONα-RGCs, indicating that homeostatic plasticity shapes cell-type-specific wiring in the developing retina to stabilize visual information sent to the brain. PMID:28457596

Corruption of homeostatic mechanisms in the guanylyl cyclase C signaling pathway underlying colorectal tumorigenesis

PubMed Central

Waldman, Scott A

2010-01-01

Colon cancer, the second leading cause of cancer-related mortality worldwide, originates from the malignant transformation of intestinal epithelial cells. The intestinal epithelium undergoes a highly organized process of rapid regeneration along the crypt-villus axis, characterized by proliferation, migration, differentiation and apoptosis, whose coordination is essential to maintaining the mucosal barrier. Disruption of these homeostatic processes predisposes cells to mutations in tumor suppressors or oncogenes, whose dysfunction provides transformed cells an evolutionary growth advantage. While sequences of genetic mutations at different stages along the neoplastic continuum have been established, little is known of the events initiating tumorigenesis prior to adenomatous polyposis coli (APC) mutations. Here, we examine a role for the corruption of homeostasis induced by silencing novel tumor suppressors, including the intestine-specific transcription factor CDX2 and its gene target guanylyl cyclase C (GCC), as early events predisposing cells to mutations in APC and other sequential genes that initiate colorectal cancer. CDX2 and GCC maintain homeostatic regeneration in the intestine by restricting cell proliferation, promoting cell maturation and adhesion, regulating cell migration and defending the intestinal barrier and genomic integrity. Elimination of CDX2 or GCC promotes intestinal tumor initiation and growth in aged mice, mice carrying APC mutations or mice exposed to carcinogens. The roles of CDX2 and GCC in suppressing intestinal tumorigenesis, universal disruption in their signaling through silencing of hormones driving GCC, and the uniform overexpression of GCC by tumors underscore the potential value of oral replacement with GCC ligands as targeted prevention and therapy for colorectal cancer. PMID:20592492

Aging of immune system: Immune signature from peripheral blood lymphocyte subsets in 1068 healthy adults.

PubMed

Qin, Ling; Jing, Xie; Qiu, Zhifeng; Cao, Wei; Jiao, Yang; Routy, Jean-Pierre; Li, Taisheng

2016-05-01

Aging is a major risk factor for several conditions including neurodegenerative, cardiovascular diseases and cancer. Functional impairments in cellular pathways controlling genomic stability, and immune control have been identified. Biomarker of immune senescence is needed to improve vaccine response and to develop therapy to improve immune control. To identify phenotypic signature of circulating immune cells with aging, we enrolled 1068 Chinese healthy volunteers ranging from 18 to 80 years old. The decreased naïve CD4+ and CD8+ T cells, increased memory CD4+ or CD8+ T cells, loss of CD28 expression on T cells and reverse trend of CD38 and HLA-DR, were significant for aging of immune system. Conversely, the absolute counts and percentage of NK cells and CD19+B cells maintained stable in aging individuals. The Chinese reference ranges of absolute counts and percentage of peripheral lymphocyte in this study might be useful for future clinical evaluation.

Proteomic Analysis of Kveim Reagent Identifies Targets of Cellular Immunity in Sarcoidosis

PubMed Central

Parker, Robert; Siddiqui, Nazneen; Potiphar, Lee; Goldin, Rob; Timms, John F.; Wells, Athol U.; Kon, Onn M.; Wickremasinghe, Melissa; Mitchell, Donald; Weeks, Mark E.; Lalvani, Ajit

2017-01-01

or alpha-actinin-4. Conclusions Stimulation with both Kveim reagent and vimentin induces a specific pro-inflammatory cytokine secretion from sarcoidosis PBMCs. Further investigation of cellular immune responses to Kveim-specific proteins may identify novel biomarkers to assist the diagnosis of sarcoidosis. PMID:28114394

Neutral dynamics and cell renewal of colonic crypts in homeostatic regime

NASA Astrophysics Data System (ADS)

Fendrik, A. J.; Romanelli, L.; Rotondo, E.

2018-05-01

The self renewal process in colonic crypts is the object of several studies. We present here a new compartment model with the following characteristics: (a) we distinguish different classes of cells: stem cells, six generations of transit amplifying cells and the differentiated cells; (b) in order to take into account the monoclonal character of crypts in homeostatic regimes we include symmetric divisions of the stem cells. We first consider the dynamic differential equations that describe the evolution of the mean values of the populations, but the small observed value of the total number of cells involved plus the huge dispersion of experimental data found in the literature leads us to study the stochastic discrete process. This analysis allows us to study fluctuations, the neutral drift that leads to monoclonality, and the effects of the fixation of mutant clones.

Transposon mutagenesis of probiotic Lactobacillus casei identifies asnH, an asparagine synthetase gene involved in its immune-activating capacity.

PubMed

Ito, Masahiro; Kim, Yun-Gi; Tsuji, Hirokazu; Takahashi, Takuya; Kiwaki, Mayumi; Nomoto, Koji; Danbara, Hirofumi; Okada, Nobuhiko

2014-01-01

Lactobacillus casei ATCC 27139 enhances host innate immunity, and the J1 phage-resistant mutants of this strain lose the activity. A transposon insertion mutant library of L. casei ATCC 27139 was constructed, and nine J1 phage-resistant mutants out of them were obtained. Cloning and sequencing analyses identified three independent genes that were disrupted by insertion of the transposon element: asnH, encoding asparagine synthetase, and dnaJ and dnaK, encoding the molecular chaperones DnaJ and DnaK, respectively. Using an in vivo mouse model of Listeria infection, only asnH mutant showed deficiency in their ability to enhance host innate immunity, and complementation of the mutation by introduction of the wild-type asnH in the mutant strain recovered the immuno-augmenting activity. AsnH protein exhibited asparagine synthetase activity when the lysozyme-treated cell wall extracts of L. casei ATCC 27139 was added as substrate. The asnH mutants lost the thick and rigid peptidoglycan features that are characteristic to the wild-type cells, indicating that AsnH of L. casei is involved in peptidoglycan biosynthesis. These results indicate that asnH is required for the construction of the peptidoglycan composition involved in the immune-activating capacity of L. casei ATCC 27139.

Combinations of stroke neurorehabilitation to facilitate motor recovery: perspectives on Hebbian plasticity and homeostatic metaplasticity

PubMed Central

Takeuchi, Naoyuki; Izumi, Shin-Ichi

2015-01-01

Motor recovery after stroke involves developing new neural connections, acquiring new functions, and compensating for impairments. These processes are related to neural plasticity. Various novel stroke rehabilitation techniques based on basic science and clinical studies of neural plasticity have been developed to aid motor recovery. Current research aims to determine whether using combinations of these techniques can synergistically improve motor recovery. When different stroke neurorehabilitation therapies are combined, the timing of each therapeutic program must be considered to enable optimal neural plasticity. Synchronizing stroke rehabilitation with voluntary neural and/or muscle activity can lead to motor recovery by targeting Hebbian plasticity. This reinforces the neural connections between paretic muscles and the residual motor area. Homeostatic metaplasticity, which stabilizes the activity of neurons and neural circuits, can either augment or reduce the synergic effect depending on the timing of combination therapy and types of neurorehabilitation that are used. Moreover, the possibility that the threshold and degree of induced plasticity can be altered after stroke should be noted. This review focuses on the mechanisms underlying combinations of neurorehabilitation approaches and their future clinical applications. We suggest therapeutic approaches for cortical reorganization and maximal functional gain in patients with stroke, based on the processes of Hebbian plasticity and homeostatic metaplasticity. Few of the possible combinations of stroke neurorehabilitation have been tested experimentally; therefore, further studies are required to determine the appropriate combination for motor recovery. PMID:26157374

Cellular and Molecular Mechanisms of REM Sleep Homeostatic Drive: A Plausible Component for Behavioral Plasticity

PubMed Central

Datta, Subimal; Oliver, Michael D.

2017-01-01

Homeostatic regulation of REM sleep drive, as measured by an increase in the number of REM sleep transitions, plays a key role in neuronal and behavioral plasticity (i.e., learning and memory). Deficits in REM sleep homeostatic drive (RSHD) are implicated in the development of many neuropsychiatric disorders. Yet, the cellular and molecular mechanisms underlying this RSHD remain to be incomplete. To further our understanding of this mechanism, the current study was performed on freely moving rats to test a hypothesis that a positive interaction between extracellular-signal-regulated kinase 1 and 2 (ERK1/2) activity and brain-derived neurotrophic factor (BDNF) signaling in the pedunculopontine tegmentum (PPT) is a causal factor for the development of RSHD. Behavioral results of this study demonstrated that a short period (<90 min) of selective REM sleep restriction (RSR) exhibited a strong RSHD. Molecular analyses revealed that this increased RSHD increased phosphorylation and activation of ERK1/2 and BDNF expression in the PPT. Additionally, pharmacological results demonstrated that the application of the ERK1/2 activation inhibitor U0126 into the PPT prevented RSHD and suppressed BDNF expression in the PPT. These results, for the first time, suggest that the positive interaction between ERK1/2 and BDNF in the PPT is a casual factor for the development of RSHD. These findings provide a novel direction in understanding how RSHD-associated specific molecular changes can facilitate neuronal plasticity and memory processing. PMID:28959190

Immune drug discovery from venoms.

PubMed

Jimenez, Rocio; Ikonomopoulou, Maria P; Lopez, J Alejandro; Miles, John J

2018-01-01

This review catalogues recent advances in knowledge on venoms as standalone therapeutic agents or as blueprints for drug design, with an emphasis on venom-derived compounds that affects the immune system. We discuss venoms and venom-derived compounds that affect total immune cell numbers, immune cell proliferation, immune cell migration, immune cell phenotype and cytokine secretion. Identifying novel compounds that 'tune' the system, up-regulating the immune response during infectious disease and cancer and down-regulating the immune response during autoimmunity, will greatly expand the tool kit of human immunotherapeutics. Targeting these pathways may also open therapeutic options that alleviate symptoms of envenomation. Finally, combining recent advances in venomics with progress in low cost, high-throughput screening platforms will no doubt yield hundreds of prototype immune modulating compounds in the coming years. Copyright © 2017 Elsevier Ltd. All rights reserved.

Serum and cerebrospinal fluid immune mediators in children with autistic disorder: a longitudinal study.

PubMed

Pardo, Carlos A; Farmer, Cristan A; Thurm, Audrey; Shebl, Fatma M; Ilieva, Jorjetta; Kalra, Simran; Swedo, Susan

2017-01-01

The causes of autism likely involve genetic and environmental factors that influence neurobiological changes and the neurological and behavioral features of the disorder. Immune factors and inflammation are hypothesized pathogenic influences, but have not been examined longitudinally. In a cohort of 104 participants with autism, we performed an assessment of immune mediators such as cytokines, chemokines, or growth factors in serum and cerebrospinal fluid ( n  = 67) to determine potential influences of such mediators in autism. As compared with 54 typically developing controls, we found no evidence of differences in the blood profile of immune mediators supportive of active systemic inflammation mechanisms in participants with autism. Some modulators of immune function (e.g., EGF and soluble CD40 ligand) were increased in the autism group; however, no evidence of group differences in traditional markers of active inflammation (e.g., IL-6, TNFα, IL-1β) were observed in the serum. Further, within-subject stability (measured by estimated intraclass correlations) of most analytes was low, indicating that a single measurement is not a reliable prospective indicator of concentration for most analytes. Additionally, in participants with autism, there was little correspondence between the blood and CSF profiles of cytokines, chemokines, and growth factors, suggesting that peripheral markers may not optimally reflect the immune status of the central nervous system. Although the relatively high fraction of intrathecal production of selected chemokines involved in monocyte/microglia function may suggest a possible relationship with the homeostatic role of microglia, control data are needed for further interpretation of its relevance in autism. These longitudinal observations fail to provide support for the hypothesized role of disturbances in the expression of circulating cytokines and chemokines as an indicator of systemic inflammation in autism. Clinical

Essential role of the cAMP-cAMP response-element binding protein pathway in opiate-induced homeostatic adaptations of locus coeruleus neurons.

PubMed

Cao, Jun-Li; Vialou, Vincent F; Lobo, Mary Kay; Robison, Alfred J; Neve, Rachael L; Cooper, Donald C; Nestler, Eric J; Han, Ming-Hu

2010-09-28

Excessive inhibition of brain neurons in primary or slice cultures can induce homeostatic intrinsic plasticity, but the functional role and underlying molecular mechanisms of such plasticity are poorly understood. Here, we developed an ex vivo locus coeruleus (LC) slice culture system and successfully recapitulated the opiate-induced homeostatic adaptation in electrical activity of LC neurons seen in vivo. We investigated the mechanisms underlying this adaptation in LC slice cultures by use of viral-mediated gene transfer and genetic mutant mice. We found that short-term morphine treatment of slice cultures almost completely abolished the firing of LC neurons, whereas chronic morphine treatment increased LC neuronal excitability as revealed during withdrawal. This increased excitability was mediated by direct activation of opioid receptors and up-regulation of the cAMP pathway and accompanied by increased cAMP response-element binding protein (CREB) activity. Overexpression of a dominant negative CREB mutant blocked the increase in LC excitability induced by morphine- or cAMP-pathway activation. Knockdown of CREB in slice cultures from floxed CREB mice similarly decreased LC excitability. Furthermore, the ability of morphine or CREB overexpression to up-regulate LC firing was blocked by knockout of the CREB target adenylyl cyclase 8. Together, these findings provide direct evidence that prolonged exposure to morphine induces homeostatic plasticity intrinsic to LC neurons, involving up-regulation of the cAMP-CREB signaling pathway, which then enhances LC neuronal excitability.

The homeostatic and circadian sleep recovery responses after total sleep deprivation in mice.

PubMed

Dispersyn, Garance; Sauvet, Fabien; Gomez-Merino, Danielle; Ciret, Sylvain; Drogou, Catherine; Leger, Damien; Gallopin, Thierry; Chennaoui, Mounir

2017-10-01

Many studies on sleep deprivation effects lack data regarding the recovery period. We investigated the 2-day homeostatic and circadian sleep recovery response to 24 h of total sleep deprivation (TSD) induced by brief rotation of an activity wheel. Eight mice were implanted with telemetry transmitters (DSI F40-EET) that recorded simultaneously their electroencephalography (EEG), locomotor activity and temperature during 24 h of baseline (BSL), TSD and 2 days of recovery (D1 and D2). In a second experiment, two groups of five non-implanted mice underwent TSD or ad libitum sleep, after which they were killed, adrenal glands were weighed and blood was collected for analysis of corticosterone concentration. During TSD mice were awake at least 97% of the time, with a consecutive sleep rebound during D1 that persisted during D2. This was characterized by increases of non-rapid eye movement (NREM) sleep (44.2 ± 6.9% for D1 and 43.0 ± 7.7% for D2 versus 33.8 ± 9.2% for BSL) and the relative delta band power (179.2 ± 34.4% for D1 and 81.9 ± 11.2% for D2). Greater NREM and REM sleep amounts were observed during the 'light' periods. Temperature and locomotor activity characteristics were unchanged during D1 and D2 versus BSL. In non-implanted mice, corticosterone levels as well as adrenal gland and overall body weights did not differ between TSD and ad libitum sleep groups. In conclusion, 24 h of TSD in an activity wheel without stress responses influence homeostatic sleep regulation with no effect on the circadian regulation over at least 2 days of recovery in mice. © 2017 European Sleep Research Society.

New translational perspectives for blood-based biomarkers of PTSD: From glucocorticoid to immune mediators of stress susceptibility

PubMed Central

Daskalakis, Nikolaos P.; Cohen, Hagit; Nievergelt, Caroline M.; Baker, Dewleen G.; Buxbaum, Joseph D.; Russo, Scott J.; Yehuda, Rachel

2016-01-01

Although biological systems have evolved to promote stress-resilience, there is variation in stress-responses. Understanding the biological basis of such individual differences has implications for understanding Posttraumatic Stress Disorder (PTSD) etiology, which is a maladaptive response to trauma occurring only in a subset of vulnerable individuals. PTSD involves failure to reinstate physiological homeostasis after traumatic events and is due to either intrinsic or trauma-related alterations in physiological systems across the body. Master homeostatic regulators that circulate and operate throughout the organism, such as stress hormones (e.g., glucocorticoids) and immune mediators (e.g., cytokines), are at the crossroads of peripheral and central susceptibility pathways and represent promising functional biomarkers of stress-response and target for novel therapeutics. PMID:27481726

Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China.

PubMed

Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

2015-01-01

This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%- vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage.

Inverse targeting —An effective immunization strategy

NASA Astrophysics Data System (ADS)

Schneider, C. M.; Mihaljev, T.; Herrmann, H. J.

2012-05-01

We propose a new method to immunize populations or computer networks against epidemics which is more efficient than any continuous immunization method considered before. The novelty of our method resides in the way of determining the immunization targets. First we identify those individuals or computers that contribute the least to the disease spreading measured through their contribution to the size of the largest connected cluster in the social or a computer network. The immunization process follows the list of identified individuals or computers in inverse order, immunizing first those which are most relevant for the epidemic spreading. We have applied our immunization strategy to several model networks and two real networks, the Internet and the collaboration network of high-energy physicists. We find that our new immunization strategy is in the case of model networks up to 14%, and for real networks up to 33% more efficient than immunizing dynamically the most connected nodes in a network. Our strategy is also numerically efficient and can therefore be applied to large systems.

Optimization of Biomathematical Model Predictions for Cognitive Performance Impairment in Individuals: Accounting for Unknown Traits and Uncertain States in Homeostatic and Circadian Processes

PubMed Central

Van Dongen, Hans P. A.; Mott, Christopher G.; Huang, Jen-Kuang; Mollicone, Daniel J.; McKenzie, Frederic D.; Dinges, David F.

2007-01-01

Current biomathematical models of fatigue and performance do not accurately predict cognitive performance for individuals with a priori unknown degrees of trait vulnerability to sleep loss, do not predict performance reliably when initial conditions are uncertain, and do not yield statistically valid estimates of prediction accuracy. These limitations diminish their usefulness for predicting the performance of individuals in operational environments. To overcome these 3 limitations, a novel modeling approach was developed, based on the expansion of a statistical technique called Bayesian forecasting. The expanded Bayesian forecasting procedure was implemented in the two-process model of sleep regulation, which has been used to predict performance on the basis of the combination of a sleep homeostatic process and a circadian process. Employing the two-process model with the Bayesian forecasting procedure to predict performance for individual subjects in the face of unknown traits and uncertain states entailed subject-specific optimization of 3 trait parameters (homeostatic build-up rate, circadian amplitude, and basal performance level) and 2 initial state parameters (initial homeostatic state and circadian phase angle). Prior information about the distribution of the trait parameters in the population at large was extracted from psychomotor vigilance test (PVT) performance measurements in 10 subjects who had participated in a laboratory experiment with 88 h of total sleep deprivation. The PVT performance data of 3 additional subjects in this experiment were set aside beforehand for use in prospective computer simulations. The simulations involved updating the subject-specific model parameters every time the next performance measurement became available, and then predicting performance 24 h ahead. Comparison of the predictions to the subjects' actual data revealed that as more data became available for the individuals at hand, the performance predictions became

Use of exposure history to identify patterns of immunity to pneumonia in bighorn sheep (Ovis canadensis)

USGS Publications Warehouse

Plowright, Raina K.; Manlove, Kezia; Cassirer, E. Frances; Besser, Thomas H.; Hudson, Peter J.

2013-01-01

Individual host immune responses to infectious agents drive epidemic behavior and are therefore central to understanding and controlling infectious diseases. However, important features of individual immune responses, such as the strength and longevity of immunity, can be challenging to characterize, particularly if they cannot be replicated or controlled in captive environments. Our research on bighorn sheep pneumonia elucidates how individual bighorn sheep respond to infection with pneumonia pathogens by examining the relationship between exposure history and survival in situ. Pneumonia is a poorly understood disease that has impeded the recovery of bighorn sheep (Ovis canadensis) following their widespread extirpation in the 1900s. We analyzed the effects of pneumonia-exposure history on survival of 388 radio-collared adults and 753 ewe-lamb pairs. Results from Cox proportional hazards models suggested that surviving ewes develop protective immunity after exposure, but previous exposure in ewes does not protect their lambs during pneumonia outbreaks. Paradoxically, multiple exposures of ewes to pneumonia were associated with diminished survival of their offspring during pneumonia outbreaks. Although there was support for waning and boosting immunity in ewes, models with consistent immunizing exposure were similarly supported. Translocated animals that had not previously been exposed were more likely to die of pneumonia than residents. These results suggest that pneumonia in bighorn sheep can lead to aging populations of immune adults with limited recruitment. Recovery is unlikely to be enhanced by translocating nai¨ve healthy animals into or near populations infected with pneumonia pathogens.

Use of Exposure History to Identify Patterns of Immunity to Pneumonia in Bighorn Sheep (Ovis canadensis)

PubMed Central

Plowright, Raina K.; Manlove, Kezia; Cassirer, E. Frances; Cross, Paul C.; Besser, Thomas E.; Hudson, Peter J.

2013-01-01

Individual host immune responses to infectious agents drive epidemic behavior and are therefore central to understanding and controlling infectious diseases. However, important features of individual immune responses, such as the strength and longevity of immunity, can be challenging to characterize, particularly if they cannot be replicated or controlled in captive environments. Our research on bighorn sheep pneumonia elucidates how individual bighorn sheep respond to infection with pneumonia pathogens by examining the relationship between exposure history and survival in situ. Pneumonia is a poorly understood disease that has impeded the recovery of bighorn sheep (Ovis canadensis) following their widespread extirpation in the 1900s. We analyzed the effects of pneumonia-exposure history on survival of 388 radio-collared adults and 753 ewe-lamb pairs. Results from Cox proportional hazards models suggested that surviving ewes develop protective immunity after exposure, but previous exposure in ewes does not protect their lambs during pneumonia outbreaks. Paradoxically, multiple exposures of ewes to pneumonia were associated with diminished survival of their offspring during pneumonia outbreaks. Although there was support for waning and boosting immunity in ewes, models with consistent immunizing exposure were similarly supported. Translocated animals that had not previously been exposed were more likely to die of pneumonia than residents. These results suggest that pneumonia in bighorn sheep can lead to aging populations of immune adults with limited recruitment. Recovery is unlikely to be enhanced by translocating naïve healthy animals into or near populations infected with pneumonia pathogens. PMID:23637929

Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System.

PubMed

Withers, David R; Hepworth, Matthew R

2017-01-01

The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of "exogenous" signals, such as dietary metabolites and commensal microbes, and "endogenous" host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a "communications hub" in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell-cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases.

Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System

PubMed Central

Withers, David R.; Hepworth, Matthew R.

2017-01-01

The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of “exogenous” signals, such as dietary metabolites and commensal microbes, and “endogenous” host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a “communications hub” in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell–cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases. PMID:29085366

Homeostatic plasticity for single node delay-coupled reservoir computing.

PubMed

Toutounji, Hazem; Schumacher, Johannes; Pipa, Gordon

2015-06-01

Supplementing a differential equation with delays results in an infinite-dimensional dynamical system. This property provides the basis for a reservoir computing architecture, where the recurrent neural network is replaced by a single nonlinear node, delay-coupled to itself. Instead of the spatial topology of a network, subunits in the delay-coupled reservoir are multiplexed in time along one delay span of the system. The computational power of the reservoir is contingent on this temporal multiplexing. Here, we learn optimal temporal multiplexing by means of a biologically inspired homeostatic plasticity mechanism. Plasticity acts locally and changes the distances between the subunits along the delay, depending on how responsive these subunits are to the input. After analytically deriving the learning mechanism, we illustrate its role in improving the reservoir's computational power. To this end, we investigate, first, the increase of the reservoir's memory capacity. Second, we predict a NARMA-10 time series, showing that plasticity reduces the normalized root-mean-square error by more than 20%. Third, we discuss plasticity's influence on the reservoir's input-information capacity, the coupling strength between subunits, and the distribution of the readout coefficients.

Sleep Health: Reciprocal Regulation of Sleep and Innate Immunity

PubMed Central

Irwin, Michael R; Opp, Mark R

2017-01-01

Sleep disturbances including insomnia independently contribute to risk of inflammatory disorders and major depressive disorder. This review and overview provides an integrated understanding of the reciprocal relationships between sleep and the innate immune system and considers the role of sleep in the nocturnal regulation of the inflammatory biology dynamics; the impact of insomnia complaints, extremes of sleep duration, and experimental sleep deprivation on genomic, cellular, and systemic markers of inflammation; and the influence of sleep complaints and insomnia on inflammaging and molecular processes of cellular aging. Clinical implications of this research include discussion of the contribution of sleep disturbance to depression and especially inflammation-related depressive symptoms. Reciprocal action of inflammatory mediators on the homeostatic regulation of sleep continuity and sleep macrostructure, and the potential of interventions that target insomnia to reverse inflammation, are also reviewed. Together, interactions between sleep and inflammatory biology mechanisms underscore the implications of sleep disturbance for inflammatory disease risk, and provide a map to guide the development of treatments that modulate inflammation, improve sleep, and promote sleep health. PMID:27510422

Homeostatic study of the effects of sportswear color on the contest outcome

NASA Astrophysics Data System (ADS)

Yuan, Jian-Qin; Liu, Timon Cheng-Yi; Wu, Ren-Le; Ruan, Chang-Xiong; He, Li-Mei; Liu, Song-Hao

2008-12-01

There are effects of sportswear color on the contest outcome. It has been explained from the psychological and perceptual viewpoints, respectively. It was studied by integrating the homeostatic theory of exercise training and autonomic nervous model of color vision in this paper. It was found that the effects of sportswear color on the contest outcome depend on autonomic nervous homeostasis (ANH). Color can be classified into hot color such as red, orange and yellow and cold color such as green, blue and violet. If the athletes have been in ANH, there are no effects of sportswear color on the contest outcome. If the autonomic nervous system is far from ANH due to exercise induced fatigue, wearing cold color had no predominance for cold-hot matches, and wearing white had no predominance for white-color matches.

Identification of cutoff points for Homeostatic Model Assessment for Insulin Resistance index in adolescents: systematic review

PubMed Central

de Andrade, Maria Izabel Siqueira; Oliveira, Juliana Souza; Leal, Vanessa Sá; da Lima, Niedja Maria Silva; Costa, Emília Chagas; de Aquino, Nathalia Barbosa; de Lira, Pedro Israel Cabral

2016-01-01

Abstract Objective: To identify cutoff points of the Homeostatic Model Assessment for Insulin Resistance (HOMA-IR) index established for adolescents and discuss their applicability for the diagnosis of insulin resistance in Brazilian adolescents. Data source: A systematic review was performed in the PubMed, Lilacs and SciELO databases, using the following descriptors: "adolescents", "insulin resistance" and "Receiver Operating Characteristics Curve". Original articles carried out with adolescents published between 2005 and 2015 in Portuguese, English or Spanish languages, which included the statistical analysis using Receiver Operating Characteristics Curve to determine the index cutoff (HOMA-IR) were included. Data synthesis: A total of 184 articles were identified and after the study phases were applied, seven articles were selected for the review. All selected studies established their cutoffs using a Receiver Operating Characteristics Curve, with the lowest observed cutoff of 1.65 for girls and 1.95 for boys and the highest of 3.82 for girls and 5.22 for boys. Of the studies analyzed, one proposed external validity, recommending the use of the HOMA-IR cutoff>2.5 for both genders. Conclusions: The HOMA-IR index constitutes a reliable method for the detection of insulin resistance in adolescents, as long as it uses cutoffs that are more adequate for the reality of the study population, allowing early diagnosis of insulin resistance and enabling multidisciplinary interventions aiming at health promotion of this population. PMID:26559605

[Identification of cutoff points for Homeostatic Model Assessment for Insulin Resistance index in adolescents: systematic review].

PubMed

Andrade, Maria Izabel Siqueira de; Oliveira, Juliana Souza; Leal, Vanessa Sá; Lima, Niedja Maria da Silva; Costa, Emília Chagas; Aquino, Nathalia Barbosa de; Lira, Pedro Israel Cabral de

2016-06-01

To identify cutoff points of the Homeostatic Model Assessment for Insulin Resistance (HOMA-IR) index established for adolescents and discuss their applicability for the diagnosis of insulin resistance in Brazilian adolescents. A systematic review was performed in the PubMed, Lilacs and SciELO databases, using the following descriptors: "Adolescents", "insulin resistance" and "ROC curve". Original articles carried out with adolescents published between 2005 and 2015 in Portuguese, English or Spanish languages, which included the statistical analysis using ROC curve to determine the index cutoff (HOMA-IR) were included. A total of 184 articles were identified and after the study phases were applied, seven articles were selected for the review. All selected studies established their cutoffs using a ROC curve, with the lowest observed cutoff of 1.65 for girls and 1.95 for boys and the highest of 3.82 for girls and 5.22 for boys. Of the studies analyzed, one proposed external validity, recommending the use of the HOMA-IR cutoff >2.5 for both genders. The HOMA-IR index constitutes a reliable method for the detection of insulin resistance in adolescents, as long as it uses cutoffs that are more adequate for the reality of the study population, allowing early diagnosis of insulin resistance and enabling multidisciplinary interventions aiming at health promotion of this population. Copyright © 2015 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

[Humoral immune diseases: Cutaneous vasculitis and auto-immune bullous dermatoses].

PubMed

Wechsler, Janine

2018-02-01

Humoral immunity is the cause of multiple diseases related to antibodies (IgA, IgG, IgM) produced by the patient. Two groups of diseases are identified. The first group is related to circulating antigen-antibody complexes. The antigens are various. They are often unknown. These immune complexes cause a vascular inflammation due to the complement fixation. Consequently, this group is dominated by inflammatory vasculitis. In the second group, the pathology is due to the fixation in situ of antibodies to a target antigen of the skin that is no more recognized by the patient. This group is represented by the auto-immune bullous dermatoses. Copyright © 2017. Published by Elsevier Masson SAS.

Cross-Modulation of Homeostatic Responses to Temperature, Oxygen and Carbon Dioxide in C. elegans

PubMed Central

Kodama-Namba, Eiji; Fenk, Lorenz A.; Bretscher, Andrew J.; Gross, Einav; Busch, K. Emanuel; de Bono, Mario

2013-01-01

Different interoceptive systems must be integrated to ensure that multiple homeostatic insults evoke appropriate behavioral and physiological responses. Little is known about how this is achieved. Using C. elegans, we dissect cross-modulation between systems that monitor temperature, O2 and CO2. CO2 is less aversive to animals acclimated to 15°C than those grown at 22°C. This difference requires the AFD neurons, which respond to both temperature and CO2 changes. CO2 evokes distinct AFD Ca2+ responses in animals acclimated at 15°C or 22°C. Mutants defective in synaptic transmission can reprogram AFD CO2 responses according to temperature experience, suggesting reprogramming occurs cell autonomously. AFD is exquisitely sensitive to CO2. Surprisingly, gradients of 0.01% CO2/second evoke very different Ca2+ responses from gradients of 0.04% CO2/second. Ambient O2 provides further contextual modulation of CO2 avoidance. At 21% O2 tonic signalling from the O2-sensing neuron URX inhibits CO2 avoidance. This inhibition can be graded according to O2 levels. In a natural wild isolate, a switch from 21% to 19% O2 is sufficient to convert CO2 from a neutral to an aversive cue. This sharp tuning is conferred partly by the neuroglobin GLB-5. The modulatory effects of O2 on CO2 avoidance involve the RIA interneurons, which are post-synaptic to URX and exhibit CO2-evoked Ca2+ responses. Ambient O2 and acclimation temperature act combinatorially to modulate CO2 responsiveness. Our work highlights the integrated architecture of homeostatic responses in C. elegans. PMID:24385919

Circadian and ultradian components of hunger in human non-homeostatic meal-to-meal eating.

PubMed

Wuorinen, Elizabeth C; Borer, Katarina T

2013-10-02

A unifying physiological explanation of the urge to initiate eating is still not available as human hunger in meal-to-meal eating may not be under homeostatic control. We hypothesized that a central circadian and a gastrointestinal ultradian timing mechanism coordinate non-deprivation meal-to-meal eating. We examined hunger as a function of time of day, inter-meal (IM) energy expenditure (EE), and concentrations of proposed hunger-controlling hormones ghrelin, leptin, and insulin. In two crossover studies, 10 postmenopausal women, BMI 23-26 kg/m(2) engaged in exercise (EX) and sedentary (SED) trials. Weight maintenance meals were provided at 6h intervals with an ad libitum meal at 13 h in study 1 and 21 h snack in study 2. EE during IM intervals was measured by indirect calorimetry and included EX EE of 801 kcal in study 1, and 766-1,051 kcal in study 2. Hunger was assessed with a visual analog scale and blood was collected for hormonal determination. Hunger displayed a circadian variation with acrophase at 13 and 19 h and was unrelated to preceding EE. Hunger was suppressed by EX between 10 and 16 h and bore no relationship to either EE during preceding IM intervals or changes in leptin, insulin, and ghrelin; however leptin reflected IM energy changes and ghrelin and insulin, prandial events. During non-deprivation meal-to-meal eating, hunger appears to be under non-homeostatic central circadian control as it is unrelated to EE preceding meals or concentrations of proposed appetite-controlling hormones. Gastrointestinal meal processing appears to intermittently suppress this control and entrain an ultradian hunger pattern. © 2013 Elsevier Inc. All rights reserved.

Pro-oxidant Induced DNA Damage in Human Lymphoblastoid Cells: Homeostatic Mechanisms of Genotoxic Tolerance

PubMed Central

Seager, Anna L.

2012-01-01

Oxidative stress contributes to many disease etiologies including ageing, neurodegeneration, and cancer, partly through DNA damage induction (genotoxicity). Understanding the i nteractions of free radicals with DNA is fundamental to discern mutation risks. In genetic toxicology, regulatory authorities consider that most genotoxins exhibit a linear relationship between dose and mutagenic response. Yet, homeostatic mechanisms, including DNA repair, that allow cells to tolerate low levels of genotoxic exposure exist. Acceptance of thresholds for genotoxicity has widespread consequences in terms of understanding cancer risk and regulating human exposure to chemicals/drugs. Three pro-oxidant chemicals, hydrogen peroxide (H2O2), potassium bromate (KBrO3), and menadione, were examined for low dose-response curves in human lymphoblastoid cells. DNA repair and antioxidant capacity were assessed as possible threshold mechanisms. H2O2 and KBrO3, but not menadione, exhibited thresholded responses, containing a range of nongenotoxic low doses. Levels of the DNA glycosylase 8-oxoguanine glycosylase were unchanged in response to pro- oxidant stress. DNA repair–focused gene expression arrays reported changes in ATM and BRCA1, involved in double-strand break repair, in response to low-dose pro-oxidant exposure; however, these alterations were not substantiated at the protein level. Determination of oxidatively induced DNA damage in H2O2-treated AHH-1 cells reported accumulation of thymine glycol above the genotoxic threshold. Further, the H2O2 dose-response curve was shifted by modulating the antioxidant glutathione. Hence, observed pro- oxidant thresholds were due to protective capacities of base excision repair enzymes and antioxidants against DNA damage, highlighting the importance of homeostatic mechanisms in “genotoxic tolerance.” PMID:22539617

Immune Cells in Blood Recognize Tumors

Cancer.gov

NCI scientists have developed a novel strategy for identifying immune cells circulating in the blood that recognize specific proteins on tumor cells, a finding they believe may have potential implications for immune-based therapies.

[The interactions of functional systems at the homeostatic level in normal children and adolescents and in a radioecologically unfavorable environment].

PubMed

Glazachev, O S; Sudakov, K V

1999-01-01

In the article theoretical and application development of one of postulates of the Anokhin's theory of functional systems--the principle of multiparametric interaction is attempted in study of singularities of intersystem relationships of a number of leading functional homeostatic systems in a developing adolescent's organism living in radioecological unfavorable conditions and during rehabilitational procedures with application of interval dosed normobaric hypoxia. On the basis of a dynamic research of parameters cardiorespiratory and vegetative-humoral homeostasis is established, that the acclimatization of a children's organism to the factors of ecological and social risk in regions under small doses of radionuclides contamination is exhibited in reorganization of multiparametric relations of functional systems: a) increase of "rigidity" of intrasystem links separate cardiovascular effectors, b) of maximum activation sympathetic, pituitary-adrenal and pituitary-thyroid axes of a system stress-response, c) lack of intersystem consolidation of cardiorespiratory functional systems at a level of useful adaptive results. Thus character of interaction of homeostatic functional systems, their stability depend on personal combination of typological singularities in "the integral constitution" of the child-types of a vegetative regulation, somatic constitution, versions of emotional uneasiness. Principally important that it is revealed the capability of a correction in intersystem relations of homeostatic parameters, in particular, with the use of interval normobaric hypoxia of training (IHT). Hypoxic indorsements rendering the influence first of all through an exterior link of a functional system of breathing is carry on to recovery of integration of functional systems defining a homeostasis for children as at a level useful adaptive results. Thus the role initially high neurohumoral activity in achievement of best values cerebral, peripheral blood flow, lung

Time course of the induction of homeostatic plasticity generated by repeated transcranial direct current stimulation of the human motor cortex.

PubMed

Fricke, K; Seeber, A A; Thirugnanasambandam, N; Paulus, W; Nitsche, M A; Rothwell, J C

2011-03-01

Several mechanisms have been proposed that control the amount of plasticity in neuronal circuits and guarantee dynamic stability of neuronal networks. Homeostatic plasticity suggests that the ease with which a synaptic connection is facilitated/suppressed depends on the previous amount of network activity. We describe how such homeostatic-like interactions depend on the time interval between two conditioning protocols and on the duration of the preconditioning protocol. We used transcranial direct current stimulation (tDCS) to produce short-lasting plasticity in the motor cortex of healthy humans. In the main experiment, we compared the aftereffect of a single 5-min session of anodal or cathodal tDCS with the effect of a 5-min tDCS session preceded by an identical 5-min conditioning session administered 30, 3, or 0 min beforehand. Five-minute anodal tDCS increases excitability for about 5 min. The same duration of cathodal tDCS reduces excitability. Increasing the duration of tDCS to 10 min prolongs the duration of the effects. If two 5-min periods of tDCS are applied with a 30-min break between them, the effect of the second period of tDCS is identical to that of 5-min stimulation alone. If the break is only 3 min, then the second session has the opposite effect to 5-min tDCS given alone. Control experiments show that these shifts in the direction of plasticity evolve during the 10 min after the first tDCS session and depend on the duration of the first tDCS but not on intracortical inhibition and facilitation. The results are compatible with a time-dependent "homeostatic-like" rule governing the response of the human motor cortex to plasticity probing protocols.

Comparative assessment of immunization coverage of migrant children between national immunization program vaccines and non-national immunization program vaccines in East China

PubMed Central

Hu, Yu; Luo, Shuying; Tang, Xuewen; Lou, Linqiao; Chen, Yaping; Guo, Jing

2015-01-01

This study aimed to describe the disparities in immunization coverage between National Immunization Program (NIP) vaccines and non-NIP vaccines in Yiwu and to identify potential determinants. A face-to-face interview-based questionnaire survey among 423 migrant children born from 1 June 2010 to 31 May 2013 was conducted. Immunization coverage was estimated according to the vaccines scheduled at different age, the birth cohorts, and socio- demographic characteristics. Single-level logistic regression analysis was applied to identify the determinants of coverage of non-NIP vaccines. We found that NIP vaccines recorded higher immunization coverage compared with non-NIP vaccines (87.9100%– vs 0%-74.8%). Among the non-NIP vaccines, varicella vaccine (VarV) recorded the highest coverage of 85.4%, which was introduced in 1998; while 7-valent pneumococcal conjugate vaccine(PCV7) recorded the lowest coverage of 0% for primary series, which was introduced recently. Lower coverage rate of non-NIP vaccines was significantly associated with more siblings in household, shorter duration of living in the surveyed areas, lower family income, mother with a job, mother with poor awareness of vaccination, and mother with lower education level. We found the immunization coverage rate of non-NIP vaccines was significant lower than that of NIP vaccines. Expansion of NIP to include non-NIP vaccines can provide better protection against the vaccine preventable diseases through increased immunization coverage. PMID:25760670

A novel ex vivo immunoproteomic approach characterising Fasciola hepatica tegumental antigens identified using immune antibody from resistant sheep.

PubMed

Cameron, Timothy C; Cooke, Ira; Faou, Pierre; Toet, Hayley; Piedrafita, David; Young, Neil; Rathinasamy, Vignesh; Beddoe, Travis; Anderson, Glenn; Dempster, Robert; Spithill, Terry W

2017-08-01

A more thorough understanding of the immunological interactions between Fasciola spp. and their hosts is required if we are to develop new immunotherapies to control fasciolosis. Deeper knowledge of the antigens that are the target of the acquired immune responses of definitive hosts against both Fasciola hepatica and Fasciola gigantica will potentially identify candidate vaccine antigens. Indonesian Thin Tail sheep express a high level of acquired immunity to infection by F. gigantica within 4weeks of infection and antibodies in Indonesian Thin Tail sera can promote antibody-dependent cell-mediated cytotoxicity against the surface tegument of juvenile F. gigantica in vitro. Given the high protein sequence similarity between F. hepatica and F. gigantica, we hypothesised that antibody from F. gigantica-infected sheep could be used to identify the orthologous proteins in the tegument of F. hepatica. Purified IgG from the sera of F. gigantica-infected Indonesian Thin Tail sheep collected pre-infection and 4weeks p.i. were incubated with live adult F. hepatica ex vivo and the immunosloughate (immunoprecipitate) formed was isolated and analysed via liquid chromatography-electrospray ionisation-tandem mass spectrometry to identify proteins involved in the immune response. A total of 38 proteins were identified at a significantly higher abundance in the immunosloughate using week 4 IgG, including eight predicted membrane proteins, 20 secreted proteins, nine proteins predicted to be associated with either the lysosomes, the cytoplasm or the cytoskeleton and one protein with an unknown cellular localization. Three of the membrane proteins are transporters including a multidrug resistance protein, an amino acid permease and a glucose transporter. Interestingly, a total of 21 of the 38 proteins matched with proteins recently reported to be associated with the proposed small exosome-like extracellular vesicles of adult F. hepatica, suggesting that the Indonesian Thin Tail week

Thymic Stromal Lymphopoietin: To Cut a Long Story Short.

PubMed

Tsilingiri, Katerina; Fornasa, Giulia; Rescigno, Maria

2017-03-01

Thymic stromal lymphopoietin (TSLP) was identified more than 20 years ago as a secreted factor of a mouse thymic stromal cell line; later, a human orthologue was also identified. The signaling pathway triggered by TSLP has been extensively studied, and upregulation of the cytokine itself is linked to the pathogenesis of numerous Th2-related diseases, including atopic dermatitis, asthma, allergic responses, as well as certain types of cancers. On the other hand, TSLP mediates several immune homeostatic functions in both the gut and the thymus. Thus, a paradox occurs; why is TSLP homeostatic in certain tissues and a hallmark of exacerbated Th2 responses in the aforementioned pathologies? We and others have recently shown that in humans a novel isoform exists; this is a shorter isoform of TSLP whose expression is constitutive and controlled by a separate promoter. Short TSLP isoform mediates the homeostatic functions, whereas the long isoform is expressed at low/undetectable level at steady state and upregulated during inflammation in several tissues. Here we review the most recent data concerning the differential expression of the 2 isoforms and provide a potential explanation to the paradox. TSLP is regarded as a promising target for treatment of relevant pathologies, with a number of clinical trials already underway. It is important to design new strategies aimed at leaving intact the homeostatic effects of the short isoform while targeting the inflammatory effects of the long isoform.

Wide screening of phage-displayed libraries identifies immune targets in planta.

PubMed

Rioja, Cristina; Van Wees, Saskia C; Charlton, Keith A; Pieterse, Corné M J; Lorenzo, Oscar; García-Sánchez, Susana

2013-01-01

Microbe-Associated Molecular Patterns and virulence effectors are recognized by plants as a first step to mount a defence response against potential pathogens. This recognition involves a large family of extracellular membrane receptors and other immune proteins located in different sub-cellular compartments. We have used phage-display technology to express and select for Arabidopsis proteins able to bind bacterial pathogens. To rapidly identify microbe-bound phage, we developed a monitoring method based on microarrays. This combined strategy allowed for a genome-wide screening of plant proteins involved in pathogen perception. Two phage libraries for high-throughput selection were constructed from cDNA of plants infected with Pseudomonas aeruginosa PA14, or from combined samples of the virulent isolate DC3000 of Pseudomonas syringae pv. tomato and its avirulent variant avrRpt2. These three pathosystems represent different degrees in the specificity of plant-microbe interactions. Libraries cover up to 2 × 10(7) different plant transcripts that can be displayed as functional proteins on the surface of T7 bacteriophage. A number of these were selected in a bio-panning assay for binding to Pseudomonas cells. Among the selected clones we isolated the ethylene response factor ATERF-1, which was able to bind the three bacterial strains in competition assays. ATERF-1 was rapidly exported from the nucleus upon infiltration of either alive or heat-killed Pseudomonas. Moreover, aterf-1 mutants exhibited enhanced susceptibility to infection. These findings suggest that ATERF-1 contains a microbe-recognition domain with a role in plant defence. To identify other putative pathogen-binding proteins on a genome-wide scale, the copy number of selected-vs.-total clones was compared by hybridizing phage cDNAs with Arabidopsis microarrays. Microarray analysis revealed a set of 472 candidates with significant fold change. Within this set defence-related genes, including well

Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay

PubMed Central

Ni, Julie Z.; Grate, Leslie; Donohue, John Paul; Preston, Christine; Nobida, Naomi; O’Brien, Georgeann; Shiue, Lily; Clark, Tyson A.; Blume, John E.; Ares, Manuel

2007-01-01

Many alternative splicing events create RNAs with premature stop codons, suggesting that alternative splicing coupled with nonsense-mediated decay (AS-NMD) may regulate gene expression post-transcriptionally. We tested this idea in mice by blocking NMD and measuring changes in isoform representation using splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons whose inclusion renders the transcript sensitive to NMD. A genomic search for additional examples identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes that encode splicing activators and are unexpectedly enriched in the so-called “ultraconserved” elements in the mammalian lineage. Further analysis show that NMD of mRNAs for splicing activators such as SR proteins is triggered by splicing activation events, whereas NMD of the mRNAs for negatively acting hnRNP proteins is triggered by splicing repression, a polarity consistent with widespread homeostatic control of splicing regulator gene expression. We suggest that the extreme genomic conservation surrounding these regulatory splicing events within splicing factor genes demonstrates the evolutionary importance of maintaining tightly tuned homeostasis of RNA-binding protein levels in the vertebrate cell. PMID:17369403

A targeted boost-and-sort immunization strategy using Escherichia coli BamA identifies rare growth inhibitory antibodies.

PubMed

Vij, Rajesh; Lin, Zhonghua; Chiang, Nancy; Vernes, Jean-Michel; Storek, Kelly M; Park, Summer; Chan, Joyce; Meng, Y Gloria; Comps-Agrar, Laetitia; Luan, Peng; Lee, Sophia; Schneider, Kellen; Bevers, Jack; Zilberleyb, Inna; Tam, Christine; Koth, Christopher M; Xu, Min; Gill, Avinash; Auerbach, Marcy R; Smith, Peter A; Rutherford, Steven T; Nakamura, Gerald; Seshasayee, Dhaya; Payandeh, Jian; Koerber, James T

2018-05-08

Outer membrane proteins (OMPs) in Gram-negative bacteria are essential for a number of cellular functions including nutrient transport and drug efflux. Escherichia coli BamA is an essential component of the OMP β-barrel assembly machinery and a potential novel antibacterial target that has been proposed to undergo large (~15 Å) conformational changes. Here, we explored methods to isolate anti-BamA monoclonal antibodies (mAbs) that might alter the function of this OMP and ultimately lead to bacterial growth inhibition. We first optimized traditional immunization approaches but failed to identify mAbs that altered cell growth after screening >3000 hybridomas. We then developed a "targeted boost-and-sort" strategy that combines bacterial cell immunizations, purified BamA protein boosts, and single hybridoma cell sorting using amphipol-reconstituted BamA antigen. This unique workflow improves the discovery efficiency of FACS + mAbs by >600-fold and enabled the identification of rare anti-BamA mAbs with bacterial growth inhibitory activity in the presence of a truncated lipopolysaccharide layer. These mAbs represent novel tools for dissecting the BamA-mediated mechanism of β-barrel folding and our workflow establishes a new template for the efficient discovery of novel mAbs against other highly dynamic membrane proteins.

Hoxb4 overexpression in CD4 memory phenotype T cells increases the central memory population upon homeostatic proliferation.

PubMed

Frison, Héloïse; Giono, Gloria; Thébault, Paméla; Fournier, Marilaine; Labrecque, Nathalie; Bijl, Janet J

2013-01-01

Memory T cell populations allow a rapid immune response to pathogens that have been previously encountered and thus form the basis of success in vaccinations. However, the molecular pathways underlying the development and maintenance of these cells are only starting to be unveiled. Memory T cells have the capacity to self renew as do hematopoietic stem cells, and overlapping gene expression profiles suggested that these cells might use the same self-renewal pathways. The transcription factor Hoxb4 has been shown to promote self-renewal divisions of hematopoietic stem cells resulting in an expansion of these cells. In this study we investigated whether overexpression of Hoxb4 could provide an advantage to CD4 memory phenotype T cells in engrafting the niche of T cell deficient mice following adoptive transfer. Competitive transplantation experiments demonstrated that CD4 memory phenotype T cells derived from mice transgenic for Hoxb4 contributed overall less to the repopulation of the lymphoid organs than wild type CD4 memory phenotype T cells after two months. These proportions were relatively maintained following serial transplantation in secondary and tertiary mice. Interestingly, a significantly higher percentage of the Hoxb4 CD4 memory phenotype T cell population expressed the CD62L and Ly6C surface markers, characteristic for central memory T cells, after homeostatic proliferation. Thus Hoxb4 favours the maintenance and increase of the CD4 central memory phenotype T cell population. These cells are more stem cell like and might eventually lead to an advantage of Hoxb4 T cells after subjecting the cells to additional rounds of proliferation.

The immune system

PubMed Central

2016-01-01

All organisms are connected in a complex web of relationships. Although many of these are benign, not all are, and everything alive devotes significant resources to identifying and neutralizing threats from other species. From bacteria through to primates, the presence of some kind of effective immune system has gone hand in hand with evolutionary success. This article focuses on mammalian immunity, the challenges that it faces, the mechanisms by which these are addressed, and the consequences that arise when it malfunctions. PMID:27784777

Cytokines in the host response to Candida vaginitis: Identifying a role for non-classical immune mediators, S100 alarmins

PubMed Central

Yano, Junko; Noverr, Mairi C.; Fidel, Paul L.

2011-01-01

Vulvovaginal candidiasis (VVC), caused by Candida albicans, affects a significant number of women during their reproductive years. More than two decades of research have been focused on the mechanisms associated with susceptibility or resistance to symptomatic infection. Adaptive immunity by Th1-type CD4+ T cells and downstream cytokine responses are considered the predominant host defense mechanisms against mucosal Candida infections. However, numerous clinical and animal studies have indicated no or limited protective role of cells and cytokines of the Th1 or Th2 lineage against vaginal infection. The role for Th17 is only now begun to be investigated in-depth for VVC with results already showing significant controversy. On the other hand, a clinical live-challenge study and an established animal model have shown that a symptomatic condition is intimately associated with the vaginal infiltration of polymorphonuclear leukocytes (PMNs) but with no effect on vaginal fungal burden. Subsequent studies identified S100A8 and S100A9 Alarmins as key chemotactic mediators of the acute PMN response. These chemotactic danger signals appear to be secreted by vaginal epithelial cells upon interaction and early adherence of Candida. Thus, instead of a putative immunodeficiency against Candida involving classical immune cells and cytokines of the adaptive response, the pathological inflammation in VVC is now considered a consequence of a non-productive innate response initiated by non-classical immune mediators. PMID:22182685

A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition.

PubMed

Mak, Milena P; Tong, Pan; Diao, Lixia; Cardnell, Robert J; Gibbons, Don L; William, William N; Skoulidis, Ferdinandos; Parra, Edwin R; Rodriguez-Canales, Jaime; Wistuba, Ignacio I; Heymach, John V; Weinstein, John N; Coombes, Kevin R; Wang, Jing; Byers, Lauren Averett

2016-02-01

We previously demonstrated the association between epithelial-to-mesenchymal transition (EMT) and drug response in lung cancer using an EMT signature derived in cancer cell lines. Given the contribution of tumor microenvironments to EMT, we extended our investigation of EMT to patient tumors from 11 cancer types to develop a pan-cancer EMT signature. Using the pan-cancer EMT signature, we conducted an integrated, global analysis of genomic and proteomic profiles associated with EMT across 1,934 tumors including breast, lung, colon, ovarian, and bladder cancers. Differences in outcome and in vitro drug response corresponding to expression of the pan-cancer EMT signature were also investigated. Compared with the lung cancer EMT signature, the patient-derived, pan-cancer EMT signature encompasses a set of core EMT genes that correlate even more strongly with known EMT markers across diverse tumor types and identifies differences in drug sensitivity and global molecular alterations at the DNA, RNA, and protein levels. Among those changes associated with EMT, pathway analysis revealed a strong correlation between EMT and immune activation. Further supervised analysis demonstrated high expression of immune checkpoints and other druggable immune targets, such as PD1, PD-L1, CTLA4, OX40L, and PD-L2, in tumors with the most mesenchymal EMT scores. Elevated PD-L1 protein expression in mesenchymal tumors was confirmed by IHC in an independent lung cancer cohort. This new signature provides a novel, patient-based, histology-independent tool for the investigation of EMT and offers insights into potential novel therapeutic targets for mesenchymal tumors, independent of cancer type, including immune checkpoints. ©2015 American Association for Cancer Research.

ICOS regulates the pool of group 2 innate lymphoid cells under homeostatic and inflammatory conditions in mice.

PubMed

Paclik, Daniela; Stehle, Christina; Lahmann, Annette; Hutloff, Andreas; Romagnani, Chiara

2015-10-01

Group 2 innate lymphoid cells (ILC2s) are innate effectors playing an important role in the defense against helminthic infections and in the pathogenesis of allergic inflammation. Cytokines have been identified as the major stimuli driving ILC2 activation and expansion. Conversely, it is unclear whether costimulatory molecules contribute to regulation of ILC2 functions. ILC2s display high expression of inducible T-cell costimulator (ICOS), which belongs to the CD28 superfamily, and which has been shown to control late effector T-cell functions, and is of utmost importance for the humoral immune response. However, the biological function of ICOS expression on ILC2s is unknown. Here, we show that ICOS signaling in mice regulates ILC2 homeostasis independently of T cells and B cells, by promoting proliferation and accumulation of mature ILC2s in lung and intestine. In a model of IL-33-induced airway inflammation, ICOS controls ILC2 activation and eosinophil infiltration in the lung. Our data identify a role of ICOS in innate immunity and indicate that not only cytokines, but also costimulatory pathways such as those involving ICOS, can contribute to regulate the ILC2 pool. Thus, ICOS costimulation blockade, which is currently under clinical evaluation for inhibiting the humoral immune response, could also target innate inflammatory circuits. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mucosal immunity to poliovirus.

PubMed

Ogra, Pearay L; Okayasu, Hiromasa; Czerkinsky, Cecil; Sutter, Roland W

2011-10-01

The Global Polio Eradication Initiative (GPEI) currently based on use of oral poliovirus vaccine (OPV) has identified suboptimal immunogenicity of this vaccine as a major impediment to eradication, with a failure to induce protection against paralytic poliomyelitis in certain population segments in some parts of the world. The Mucosal Immunity and Poliovirus Vaccines: Impact on Wild Poliovirus Infection, Transmission and Vaccine Failure conference was organized to obtain a better understanding of the current status of global control of poliomyelitis and identify approaches to improve the immune responsiveness and effectiveness of the orally administered poliovirus vaccines in order to accelerate the global eradication of paralytic poliomyelitis.

Network intrusion detection by the coevolutionary immune algorithm of artificial immune systems with clonal selection

NASA Astrophysics Data System (ADS)

Salamatova, T.; Zhukov, V.

2017-02-01

The paper presents the application of the artificial immune systems apparatus as a heuristic method of network intrusion detection for algorithmic provision of intrusion detection systems. The coevolutionary immune algorithm of artificial immune systems with clonal selection was elaborated. In testing different datasets the empirical results of evaluation of the algorithm effectiveness were achieved. To identify the degree of efficiency the algorithm was compared with analogs. The fundamental rules based of solutions generated by this algorithm are described in the article.

Anthrax Lethal Factor as an Immune Target in Humans and Transgenic Mice and the Impact of HLA Polymorphism on CD4+ T Cell Immunity

PubMed Central

Ascough, Stephanie; Ingram, Rebecca J.; Chu, Karen K.; Reynolds, Catherine J.; Musson, Julie A.; Doganay, Mehmet; Metan, Gökhan; Ozkul, Yusuf; Baillie, Les; Sriskandan, Shiranee; Moore, Stephen J.; Gallagher, Theresa B.; Dyson, Hugh; Williamson, E. Diane; Robinson, John H.; Maillere, Bernard; Boyton, Rosemary J.; Altmann, Daniel M.

2014-01-01

Bacillus anthracis produces a binary toxin composed of protective antigen (PA) and one of two subunits, lethal factor (LF) or edema factor (EF). Most studies have concentrated on induction of toxin-specific antibodies as the correlate of protective immunity, in contrast to which understanding of cellular immunity to these toxins and its impact on infection is limited. We characterized CD4+ T cell immunity to LF in a panel of humanized HLA-DR and DQ transgenic mice and in naturally exposed patients. As the variation in antigen presentation governed by HLA polymorphism has a major impact on protective immunity to specific epitopes, we examined relative binding affinities of LF peptides to purified HLA class II molecules, identifying those regions likely to be of broad applicability to human immune studies through their ability to bind multiple alleles. Transgenics differing only in their expression of human HLA class II alleles showed a marked hierarchy of immunity to LF. Immunogenicity in HLA transgenics was primarily restricted to epitopes from domains II and IV of LF and promiscuous, dominant epitopes, common to all HLA types, were identified in domain II. The relevance of this model was further demonstrated by the fact that a number of the immunodominant epitopes identified in mice were recognized by T cells from humans previously infected with cutaneous anthrax and from vaccinated individuals. The ability of the identified epitopes to confer protective immunity was demonstrated by lethal anthrax challenge of HLA transgenic mice immunized with a peptide subunit vaccine comprising the immunodominant epitopes that we identified. PMID:24788397

Pharmacists as immunizers: a survey of community pharmacists' willingness to administer adult immunizations.

PubMed

Edwards, Nicholas; Gorman Corsten, Erin; Kiberd, Mathew; Bowles, Susan; Isenor, Jennifer; Slayter, Kathryn; McNeil, Shelly

2015-04-01

Adult immunization rates worldwide fall below desired targets. Pharmacists are highly accessible healthcare providers with the potential to increase immunization rates among adults by administering vaccines in their practice setting. To determine the attitudes of community-based Canadian pharmacists with respect to expanding their scope of practice to include administration of immunizations. An internet-based survey was emailed to community pharmacists across Canada. The survey was piloted through focus groups for qualitative feedback, tested for content validity, and test-retest reliability prior to dissemination. There were 495 responses to the survey. The majority (88 %) agreed that pharmacists as immunizers would increase public access, improve rates (84 %), and be acceptable to the public (72 %). However, only 68 % agreed that pharmacists should be permitted to immunize. The majority of respondents (90 %) agreed that certification in vaccine administration should be required for pharmacists to administer vaccines. Pharmacists identified education, reimbursement, and negative interactions with other providers as barriers to pharmacists administering vaccines. Canadian pharmacists are willing to expand their scope of practice to include immunization. However, implementation requires professional development and certification in vaccine administration.

Extraordinary GU-rich single-strand RNA identified from SARS coronavirus contributes an excessive innate immune response.

PubMed

Li, Yan; Chen, Ming; Cao, Hongwei; Zhu, Yuanfeng; Zheng, Jiang; Zhou, Hong

2013-02-01

A dangerous cytokine storm occurs in the SARS involving in immune disorder, but many aspects of the pathogenetic mechanism remain obscure since its outbreak. To deeply reveal the interaction of host and SARS-CoV, based on the basic structural feature of pathogen-associated molecular pattern, we created a new bioinformatics method for searching potential pathogenic molecules and identified a set of SARS-CoV specific GU-rich ssRNA fragments with a high-density distribution in the genome. In vitro experiments, the result showed the representative SARS-CoV ssRNAs had powerful immunostimulatory activities to induce considerable level of pro-inflammatory cytokine TNF-a, IL-6 and IL-12 release via the TLR7 and TLR8, almost 2-fold higher than the strong stimulatory ssRNA40 that was found previously from other virus. Moreover, SARS-CoV ssRNA was able to cause acute lung injury in mice with a high mortality rate in vivo experiment. It suggests that SARS-CoV specific GU-rich ssRNA plays a very important role in the cytokine storm associated with a dysregulation of the innate immunity. This study not only presents new evidence about the immunopathologic damage caused by overactive inflammation during the SARS-CoV infection, but also provides a useful clue for a new therapeutic strategy. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Immunization delivery in British Columbia

PubMed Central

Omura, John; Buxton, Jane; Kaczorowski, Janusz; Catterson, Jason; Li, Jane; Derban, Andrea; Hasselback, Paul; Machin, Shelagh; Linekin, Michelle; Morgana, Tamsin; O’Briain, Barra; Scheifele, David; Dawar, Meena

2014-01-01

Abstract Objective To explore the experiences of family physicians and pediatricians delivering immunizations, including perceived barriers and supports. Design Qualitative study using focus groups. Setting Ten cities throughout British Columbia. Participants A total of 46 family physicians or general practitioners, 10 pediatricians, and 2 residents. Methods A semistructured dialogue guide was used by a trained facilitator to explore participants’ experiences and views related to immunization delivery in British Columbia. Verbatim transcriptions were independently coded by 2 researchers. Key themes were analyzed and identified in an iterative manner using interpretive description. Main findings Physicians highly valued vaccine delivery. Factors facilitating physician-delivered immunizations included strong beliefs in the value of vaccines and having adequate information. Identified barriers included the large time commitment and insufficient communication about program changes, new vaccines, and the adult immunization program in general. Some physicians reported good relationships with local public health, while others reported the opposite experience, and this varied by geographic location. Conclusion These findings suggest that physicians are supportive of delivering vaccines. However, there are opportunities to improve the sustainability of physician-delivered immunizations. While compensation schemes remain under the purview of the provincial governments, local public health authorities can address the information needs of physicians. PMID:24627403

Homeostatic signature of anabolic steroids in cattle using 1H-13C HMBC NMR metabonomics.

PubMed

Dumas, Marc-Emmanuel; Canlet, Cécile; Vercauteren, Joseph; André, François; Paris, Alain

2005-01-01

We used metabonomics to discriminate the urinary signature of different anabolic steroid treatments in cattle having different physiological backgrounds (age, sex, and race). (1)H-(13)C heteronuclear multiple bonding connectivity NMR spectroscopy and multivariate statistical methods reveal that metabolites such as trimethylamine-N-oxide, dimethylamine, hippurate, creatine, creatinine, and citrate characterize the biological fingerprint of anabolic treatment. These urinary biomarkers suggest an overall homeostatic adaptation in nitrogen and energy metabolism. From results obtained in this study, it is now possible to consider metabonomics as a complementary method usable to improve doping control strategies to detect fraudulent anabolic treatment in cattle since the oriented global metabolic response provides helpful discrimination.

Predictors of childhood immunization completion in a rural population.

PubMed

Gore, P; Madhavan, S; Curry, D; McClung, G; Castiglia, M; Rosenbluth, S A; Smego, R A

1999-04-01

Despite the availability of effective vaccines, immunization rates among two-year old children continue to be low in many areas of the United States including rural West Virginia. The goal of this study was to identify barriers to childhood immunization in rural West Virginia and determine factors that were important in the completion of the childhood immunization schedule. A telephone survey was used to collect data from a randomly selected sample of 316 mothers, of two-year olds, from 18 rural counties of West Virginia. Results indicated that two-thirds or 65% of the children in the study sample had completed their recommended immunizations by two years of age. Immunization barriers identified in this study include: living in health professional shortage areas, lack of health insurance, negative beliefs and attitudes regarding childhood immunizations, problems accessing the immunization clinic, and a perception of inadequate support from the immunization clinic. Results of the structural equation modeling, using LISREL-8, indicated that 20% of the variation in immunization completion (R2 = 0.197) was explained by attitude towards immunization and perceived support received from the immunization clinic. Furthermore, 42% of the variation in attitude towards immunization (R2 = 0.419) was explained by immunization-related beliefs, and 28% of the variation in immunization-related beliefs (the R2 = 0.277) was explained by general problems faced during immunization and perceived clinic support. The study concluded that positive immunization-related beliefs and attitudes, support from the immunization clinic, and ease of the immunization seeking process are important factors in the timely completion of the childhood immunization schedule.

Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

PubMed Central

Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

Autophagy in the regulation of pathogen replication and adaptive immunity

PubMed Central

Randow, Felix; Münz, Christian

2012-01-01

Autophagy is an evolutionary conserved homeostatic process by which cells deliver cytoplasmic material for degradation into lysosomes. Autophagy may have evolved as a nutrient-providing homeostatic pathway induced upon starvation, but with the acquisition of cargo-receptors autophagy has become an important cellular defence mechanism as well as a generator of antigenic peptides for MHC presentation. We propose that autophagy efficiently protects against microbes encountering the cytosolic environment accidentally, for example upon phagosomal damage, while pathogens routinely accessing the host cytosol have evolved to avoid or even benefit from autophagy. PMID:22796170

Parental hesitation in immunizing children in Utah.

PubMed

Luthy, Karlen E; Beckstrand, Renea L; Callister, Lynn Clark

2010-01-01

To determine why parents in a Utah community hesitated in immunizing their children. Cross-sectional descriptive study. Data were collected from a convenience sample of 86 parents of under-immunized children in the county health department and local pediatric and family practice offices. Participants were asked to complete an immunization hesitancy survey including questions regarding why parents hesitated to immunize their children, parental concerns regarding immunizations, and what advice they would give to a friend or family member who had concerns about childhood vaccines. Parents could also write in any other comment, concern, or suggestion they had regarding childhood immunizations. 2 major themes were identified: concerns regarding immunization safety and lack of perceived need. The most commonly reported concerns regarding immunization safety included autism, immune system overload, and other adverse reactions. Many parents did not recognize the need for childhood immunizations, especially multiple immunizations given simultaneously on a strict timeline. The manner in which immunization information is shared with hesitant parents can be particularly important. There is a need for health care providers to assess and increase parental knowledge regarding immunizations.

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

PubMed

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Multipotent Adult Progenitor Cells Suppress T Cell Activation in In Vivo Models of Homeostatic Proliferation in a Prostaglandin E2-Dependent Manner

PubMed Central

Carty, Fiona; Corbett, Jennifer M.; Cunha, João Paulo M. C. M.; Reading, James L.; Tree, Timothy I. M.; Ting, Anthony E.; Stubblefield, Samantha R.; English, Karen

2018-01-01

Lymphodepletion strategies are used in the setting of transplantation (including bone marrow, hematopoietic cell, and solid organ) to create space or to prevent allograft rejection and graft versus host disease. Following lymphodepletion, there is an excess of IL-7 available, and T cells that escape depletion respond to this cytokine undergoing accelerated proliferation. Moreover, this environment promotes the skew of T cells to a Th1 pro-inflammatory phenotype. Existing immunosuppressive regimens fail to control this homeostatic proliferative (HP) response, and thus the development of strategies to successfully control HP while sparing T cell reconstitution (providing a functioning immune system) represents a significant unmet need in patients requiring lymphodepletion. Multipotent adult progenitor cells (MAPC®) have the capacity to control T cell proliferation and Th1 cytokine production. Herein, this study shows that MAPC cells suppressed anti-thymocyte globulin-induced cytokine production but spared T cell reconstitution in a pre-clinical model of lymphodepletion. Importantly, MAPC cells administered intraperitoneally were efficacious in suppressing interferon-γ production and in promoting the expansion of regulatory T cells in the lymph nodes. MAPC cells administered intraperitoneally accumulated in the omentum but were not present in the spleen suggesting a role for soluble factors. MAPC cells suppressed lymphopenia-induced cytokine production in a prostaglandin E2-dependent manner. This study suggests that MAPC cell therapy may be useful as a novel strategy to target lymphopenia-induced pathogenic T cell responses in lymphodepleted patients. PMID:29740426

Transcriptome analysis to identify genes for peptides and proteins involved in immunity and reproduction from male accessory glands and ejaculatory duct of Bactrocera dorsalis.

PubMed

Wei, Dong; Tian, Chuan-Bei; Liu, Shi-Huo; Wang, Tao; Smagghe, Guy; Jia, Fu-Xian; Dou, Wei; Wang, Jin-Jun

2016-06-01

In the male reproductive system of insects, the male accessory glands and ejaculatory duct (MAG/ED) are important organs and their primary function is to enhance the fertility of spermatozoa. Proteins secreted by the MAG/ED are also known to induce post-mating changes and immunity responses in the female insect. To understand the gene expression profile in the MAG/ED of the oriental fruit fly Bactrocera dorsalis (Hendel), that is an important pest in fruits, we performed an Illumina-based deep sequencing of mRNA. This yielded 54,577,630 clean reads corresponding to 4.91Gb total nucleotides that were assembled and clustered to 30,669 unigenes (average 645bp). Among them, 20,419 unigenes were functionally annotated to known proteins/peptides in Gene Orthology, Clusters of Orthologous Groups, Kyoto Encyclopedia of Genes and Genomes pathway databases. Typically, many genes were involved in immunity and these included microbial recognition proteins and antimicrobial peptides. Subsequently, the inducible expression of these immunity-related genes was confirmed by qRT-PCR analysis when insects were challenged with immunity-inducible factors, suggesting their function in guaranteeing fertilization success. Besides, we identified some important reproductive genes such as juvenile hormone- and ecdysteroid-related genes in this de novo assembly. In conclusion, this transcriptomic sequencing of B. dorsalis MAG/ED provides insights to facilitate further functional research of reproduction, immunity and molecular evolution of reproductive proteins in this important agricultural pest. Copyright © 2015 Elsevier Inc. All rights reserved.

Innate immunity in vertebrates: an overview.

PubMed

Riera Romo, Mario; Pérez-Martínez, Dayana; Castillo Ferrer, Camila

2016-06-01

Innate immunity is a semi-specific and widely distributed form of immunity, which represents the first line of defence against pathogens. This type of immunity is critical to maintain homeostasis and prevent microbe invasion, eliminating a great variety of pathogens and contributing with the activation of the adaptive immune response. The components of innate immunity include physical and chemical barriers, humoral and cell-mediated components, which are present in all jawed vertebrates. The understanding of innate defence mechanisms in non-mammalian vertebrates is the key to comprehend the general picture of vertebrate innate immunity and its evolutionary history. This is also essential for the identification of new molecules with applications in immunopharmacology and immunotherapy. In this review, we describe and discuss the main elements of vertebrate innate immunity, presenting core findings in this field and identifying areas that need further investigation. © 2016 John Wiley & Sons Ltd.

Candidate immune biomarkers for radioimmunotherapy.

PubMed

Levy, Antonin; Nigro, Giulia; Sansonetti, Philippe J; Deutsch, Eric

2017-08-01

Newly available immune checkpoint blockers (ICBs), capable to revert tumor immune tolerance, are revolutionizing the anticancer armamentarium. Recent evidence also established that ionizing radiation (IR) could produce antitumor immune responses, and may as well synergize with ICBs. Multiple radioimmunotherapy combinations are thenceforth currently assessed in early clinical trials. Past examples have highlighted the need for treatment personalization, and there is an unmet need to decipher immunological biomarkers that could allow selecting patients who could benefit from these promising but expensive associations. Recent studies have identified potential predictive and prognostic immune assays at the cellular (tumor microenvironment composition), genomic (mutational/neoantigen load), and peripheral blood levels. Within this review, we collected the available evidence regarding potential personalized immune biomarker-directed radiation therapy strategies that might be used for patient selection in the era of radioimmunotherapy. Copyright © 2017. Published by Elsevier B.V.

Inborn Errors in Immunity

PubMed Central

Lionakis, M.S.; Hajishengallis, G.

2015-01-01

In recent years, the study of genetic defects arising from inborn errors in immunity has resulted in the discovery of new genes involved in the function of the immune system and in the elucidation of the roles of known genes whose importance was previously unappreciated. With the recent explosion in the field of genomics and the increasing number of genetic defects identified, the study of naturally occurring mutations has become a powerful tool for gaining mechanistic insight into the functions of the human immune system. In this concise perspective, we discuss emerging evidence that inborn errors in immunity constitute real-life models that are indispensable both for the in-depth understanding of human biology and for obtaining critical insights into common diseases, such as those affecting oral health. In the field of oral mucosal immunity, through the study of patients with select gene disruptions, the interleukin-17 (IL-17) pathway has emerged as a critical element in oral immune surveillance and susceptibility to inflammatory disease, with disruptions in the IL-17 axis now strongly linked to mucosal fungal susceptibility, whereas overactivation of the same pathways is linked to inflammatory periodontitis. PMID:25900229

Ecdysone triggered PGRP-LC expression controls Drosophila innate immunity.

PubMed

Rus, Florentina; Flatt, Thomas; Tong, Mei; Aggarwal, Kamna; Okuda, Kendi; Kleino, Anni; Yates, Elisabeth; Tatar, Marc; Silverman, Neal

2013-05-29

Throughout the animal kingdom, steroid hormones have been implicated in the defense against microbial infection, but how these systemic signals control immunity is unclear. Here, we show that the steroid hormone ecdysone controls the expression of the pattern recognition receptor PGRP-LC in Drosophila, thereby tightly regulating innate immune recognition and defense against bacterial infection. We identify a group of steroid-regulated transcription factors as well as two GATA transcription factors that act as repressors and activators of the immune response and are required for the proper hormonal control of PGRP-LC expression. Together, our results demonstrate that Drosophila use complex mechanisms to modulate innate immune responses, and identify a transcriptional hierarchy that integrates steroid signalling and immunity in animals.

Circadian and Homeostatic Regulation of Structural Synaptic Plasticity in Hypocretin Neurons

PubMed Central

Appelbaum, Lior; Wang, Gordon; Yokogawa, Tohei; Skariah, Gemini M; Smith, Stephen J; Mourrain, Philippe; Mignot, Emmanuel

2010-01-01

Summary Neurons exhibit rhythmic activity that ultimately affects behavior such as sleep. In living zebrafish larvae, we used time-lapse two-photon imaging of the presynaptic marker synaptophysin (SYP) in hypocretin/orexin (HCRT) neurons to determine the dynamics of synaptic modifications during the day and night. We observed circadian rhythmicity in synapse number in HCRT axons. This rhythm is regulated primarily by the circadian clock but is also affected by sleep deprivation. Furthermore, NPTX2, a protein implicated in AMPA receptor clustering, was found to modulate circadian synaptic changes. In zebrafish, nptx2b is rhythmic gene that is mostly expressed in hypothalamic and pineal gland cells. Arrhythmic transgenic nptx2b overexpression (hcrt:NPTX2b) increases synapse number and abolishes rhythmicity in HCRT axons. Finally, hcrt:NPTX2b fish are resistant to the sleep-promoting effects of melatonin. This behavioral effect is consistent with NPTX2b-mediated increased activity of HCRT circuitry. These data provide real-time in vivo evidence of circadian and homeostatic regulation of structural synaptic plasticity. PMID:20920793

Circadian and homeostatic regulation of structural synaptic plasticity in hypocretin neurons.

PubMed

Appelbaum, Lior; Wang, Gordon; Yokogawa, Tohei; Skariah, Gemini M; Smith, Stephen J; Mourrain, Philippe; Mignot, Emmanuel

2010-10-06

Neurons exhibit rhythmic activity that ultimately affects behavior such as sleep. In living zebrafish larvae, we used time-lapse two-photon imaging of the presynaptic marker synaptophysin in hypocretin/orexin (HCRT) neurons to determine the dynamics of synaptic modifications during the day and night. We observed circadian rhythmicity in synapse number in HCRT axons. This rhythm is regulated primarily by the circadian clock but is also affected by sleep deprivation. Furthermore, NPTX2, a protein implicated in AMPA receptor clustering, modulates circadian synaptic changes. In zebrafish, nptx2b is a rhythmic gene that is mostly expressed in hypothalamic and pineal gland cells. Arrhythmic transgenic nptx2b overexpression (hcrt:NPTX2b) increases synapse number and abolishes rhythmicity in HCRT axons. Finally, hcrt:NPTX2b fish are resistant to the sleep-promoting effects of melatonin. This behavioral effect is consistent with NPTX2b-mediated increased activity of HCRT circuitry. These data provide real-time in vivo evidence of circadian and homeostatic regulation of structural synaptic plasticity. Copyright © 2010 Elsevier Inc. All rights reserved.

Imaging of Homeostatic, Neoplastic, and Injured Tissues by HA-Based Probes

PubMed Central

Veiseh, Mandana; Breadner, Daniel; Ma, Jenny; Akentieva, Natalia; Savani, Rashmin C; Harrison, Rene; Mikilus, David; Collis, Lisa; Gustafson, Stefan; Lee, Ting-Yim; Koropatnick, James; Luyt, Leonard G.; Bissell, Mina J.; Turley, Eva A.

2013-01-01

An increase in hyaluronan (HA) synthesis, cellular uptake, and metabolism occurs during the remodeling of tissue microenvironments following injury and during disease processes such as cancer. We hypothesized that multimodality HA-based probes selectively target and detectably accumulate at sites of high HA metabolism, thus providing a flexible imaging strategy for monitoring disease and repair processes. Kinetic analyses confirmed favorable available serum levels of the probe following intravenous (i.v.) or subcutaneous (s.c.) injection. Nuclear (technetium-HA, 99mTc-HA, and iodine-HA, 125I-HA), optical (fluorescent Texas Red-HA, TR-HA), and magnetic resonance (gadolinium-HA, Gd-HA) probes imaged liver (99mTc-HA), breast cancer cells/xenografts (TR-HA, Gd-HA), and vascular injury (125I-HA, TR-HA). Targeting of HA probes to these sites appeared to result from selective HA receptor-dependent localization. Our results suggest that HA-based probes, which do not require polysaccharide backbone modification to achieve favorable half-life and distribution, can detect elevated HA metabolism in homeostatic, injured, and diseased tissues. PMID:22066590

Correlates of Protective Cellular Immunity Revealed by Analysis of Population-Level Immune Escape Pathways in HIV-1

PubMed Central

Brumme, Chanson J.; Martin, Eric; Listgarten, Jennifer; Brockman, Mark A.; Le, Anh Q.; Chui, Celia K. S.; Cotton, Laura A.; Knapp, David J. H. F.; Riddler, Sharon A.; Haubrich, Richard; Nelson, George; Pfeifer, Nico; DeZiel, Charles E.; Heckerman, David; Apps, Richard; Carrington, Mary; Mallal, Simon; Harrigan, P. Richard; John, Mina

2012-01-01

HLA class I-associated polymorphisms identified at the population level mark viral sites under immune pressure by individual HLA alleles. As such, analysis of their distribution, frequency, location, statistical strength, sequence conservation, and other properties offers a unique perspective from which to identify correlates of protective cellular immunity. We analyzed HLA-associated HIV-1 subtype B polymorphisms in 1,888 treatment-naïve, chronically infected individuals using phylogenetically informed methods and identified characteristics of HLA-associated immune pressures that differentiate protective and nonprotective alleles. Over 2,100 HLA-associated HIV-1 polymorphisms were identified, approximately one-third of which occurred inside or within 3 residues of an optimally defined cytotoxic T-lymphocyte (CTL) epitope. Differential CTL escape patterns between closely related HLA alleles were common and increased with greater evolutionary distance between allele group members. Among 9-mer epitopes, mutations at HLA-specific anchor residues represented the most frequently detected escape type: these occurred nearly 2-fold more frequently than expected by chance and were computationally predicted to reduce peptide-HLA binding nearly 10-fold on average. Characteristics associated with protective HLA alleles (defined using hazard ratios for progression to AIDS from natural history cohorts) included the potential to mount broad immune selection pressures across all HIV-1 proteins except Nef, the tendency to drive multisite and/or anchor residue escape mutations within known CTL epitopes, and the ability to strongly select mutations in conserved regions within HIV's structural and functional proteins. Thus, the factors defining protective cellular immune responses may be more complex than simply targeting conserved viral regions. The results provide new information to guide vaccine design and immunogenicity studies. PMID:23055555

Orosensory and Homeostatic Functions of the Insular Taste Cortex.

PubMed

de Araujo, Ivan E; Geha, Paul; Small, Dana M

2012-03-01

The gustatory aspect of the insular cortex is part of the brain circuit that controls ingestive behaviors based on chemosensory inputs. However, the sensory properties of foods are not restricted to taste and should also include salient features such as odor, texture, temperature, and appearance. Therefore, it is reasonable to hypothesize that specialized circuits within the central taste pathways must be involved in representing several other oral sensory modalities in addition to taste. In this review, we evaluate current evidence indicating that the insular gustatory cortex functions as an integrative circuit, with taste-responsive regions also showing heightened sensitivity to olfactory, somatosensory, and even visual stimulation. We also review evidence for modulation of taste-responsive insular areas by changes in physiological state, with taste-elicited neuronal responses varying according to the nutritional state of the organism. We then examine experimental support for a functional map within the insular cortex that might reflect the various sensory and homeostatic roles associated with this region. Finally, we evaluate the potential role of the taste insular cortex in weight-gain susceptibility. Taken together, the current experimental evidence favors the view that the insular gustatory cortex functions as an orosensory integrative system that not only enables the formation of complex flavor representations but also mediates their modulation by the internal state of the body, playing therefore a central role in food intake regulation.

C/EBPβ regulates homeostatic and oncogenic gastric cell proliferation.

PubMed

Regalo, Goncalo; Förster, Susann; Resende, Carlos; Bauer, Bianca; Fleige, Barbara; Kemmner, Wolfgang; Schlag, Peter M; Meyer, Thomas F; Machado, José C; Leutz, Achim

2016-12-01

Cancer of the stomach is among the leading causes of death from cancer worldwide. The transcription factor C/EBPβ is frequently overexpressed in gastric cancer and associated with the suppression of the differentiation marker TFF1. We show that the murine C/EBPβ knockout stomach displays unbalanced homeostasis and reduced cell proliferation and that tumorigenesis of human gastric cancer xenograft is inhibited by knockdown of C/EBPβ. Cross-species comparison of gene expression profiles between C/EBPβ-deficient murine stomach and human gastric cancer revealed a subset of tumors with a C/EBPβ signature. Within this signature, the RUNX1t1 tumor suppressor transcript was down-regulated in 38 % of gastric tumor samples. The RUNX1t1 promoter was frequently hypermethylated and ectopic expression of RUNX1t1 in gastric cancer cells inhibited proliferation and enhanced TFF1 expression. These data suggest that the tumor suppressor activity of both RUNX1t1 and TFF1 are mechanistically connected to C/EBPβ and that cross-regulation between C/EBPβ-RUNX1t1-TFF1 plays an important role in gastric carcinogenesis. C/EBPβ controls proliferation and differentiation balance in the stomach. Homeostatic differentiation/proliferation balance is altered in gastric cancer. RUNX1t1 is a C/EBPβ-associated tumor suppressor. RUNX1t1 negatively regulates C/EBPβ pro-oncogenic functions.

Innate immunity in rice

PubMed Central

Chen, Xuewei; Ronald, Pamela C.

2011-01-01

Advances in studies of rice innate immunity have led to the identification and characterization of host sensors encoding receptor kinases that perceive conserved microbial signatures. The non-RD domain, a newly recognized hallmark of these receptor kinases is highly expanded in rice (Oryza sativa) compared with Arabidopsis (Arabidopsis thaliana). Researchers have also identified a diverse array of microbial effectors from bacterial and fungal pathogens that triggers immune responses upon perception. These include both, effectors that indirectly target host Nucleotide binding site/Leucine rice repeat (NBS-LRR) proteins and transcription activator-like (TAL) effectors that directly bind promoters of host genes. Here we review the recognition and signaling events that govern rice innate immunity. PMID:21602092

A whole organism screen identifies novel regulators of fat storage

PubMed Central

Lemieux, George A.; Liu, Jason; Mayer, Nasima; Bainton, Roland J.; Ashrafi, Kaveh; Werb, Zena

2011-01-01

The regulation of energy homeostasis integrates diverse biological processes ranging from behavior to metabolism and is linked fundamentally to numerous disease states. To identify new molecules that can bypass homeostatic compensatory mechanisms of energy balance in intact animals, we screened for small molecule modulators of C. elegans fat content. We report on several molecules that modulate fat storage without obvious deleterious effects on feeding, growth, and reproduction. A subset of these compounds also altered fat storage in mammalian and insect cell culture. We found that one of the newly identified compounds exerts its effects in C. elegans through a pathway that requires novel functions of an AMP-activated kinase catalytic subunit and a transcription factor previously unassociated with fat regulation. Thus, our strategy identifies small molecules that are effective within the context of intact animals and reveals relationships between new pathways that operate across phyla to influence energy homeostasis. PMID:21390037

Hyper-homeostatic learning of anticipatory hunger in rats.

PubMed

Jarvandi, Soghra; Booth, David A; Thibault, Louise

2007-11-23

Anticipatory hunger is a learnt increase in intake of food having a flavour or texture that predicts a long fast. This learning was studied in rats trained on a single food or a choice between protein-rich and carbohydrate-rich foods, presented for 1.5 h after 3 h without maintenance food at the start of the dark phase. Eight training cycles provided a pseudo-random sequence of 3 h and 10 h post-prandial fasts with a day on maintenance food between each training fast. The measure of anticipatory hunger is the difference over one 4-day cycle between the intake of test food having an odour predictive of the longer fast (TL) and intake of food with an odour cuing to the shorter fast (TS). Previous experiments showed that conditioning of preference for the odour before the shorter fast competes with learning to avoid hunger during the longer fast (anticipatory hunger), generating a cubic or quartic contrast. TL minus TS showed a strong cubic trend over 8 training cycles with both single and choice meals. There was a switch from preference for the short-fast odour at cycle 2 (TL-TS=-0.86 g) to a peak of anticipatory hunger at cycle 6 (TL-TS=1.57 g). We conclude that anticipatory hunger is learnt when a choice is given between protein-rich and carbohydrate-rich foods as well as on a single food. In addition, since anticipatory hunger extinguishes itself, such learning improves on negative-feedback homeostasis with a feed-forward "hyper-homeostatic" mechanism.

Determinants of maternal immunization in developing countries.

PubMed

Pathirana, Jayani; Nkambule, Jerome; Black, Steven

2015-06-12

Maternal immunization is an effective intervention to protect newborns and young infants from infections when their immune response is immature. Tetanus toxoid vaccination of pregnant women is the most widely implemented maternal vaccine in developing countries where neonatal mortality is the highest. We identified barriers to maternal tetanus vaccination in developing African and Asian countries to identify means of improving maternal immunization platforms in these countries. We categorized barriers into health system, health care provider and patient barriers to maternal tetanus immunization and conducted a literature review on each category. Due to limited literature from Africa, we conducted a pilot survey of health care providers in Malawi on barriers they experience in immunizing pregnant women. The major barriers of the health system are due to inadequate financial and human resources which translate to inadequate vaccination services delivery and logistics management. Health care providers are limited by poor attendance of Antenatal Care and inadequate knowledge on vaccinating pregnant women. Patient barriers are due to lack of education and knowledge on pregnancy immunization and socioeconomic factors such as low income and high parity. There are several factors that affect maternal tetanus immunization. Increasing knowledge in health care providers and patients, increasing antenatal care attendance and outreach activities will aid the uptake of maternal immunization. Health system barriers are more difficult to address requiring an improvement of overall immunization services. Further analyses of maternal immunization specific barriers and the means of addressing them are required to strengthen the existing program and provide a more efficient delivery system for additional maternal vaccines. Copyright © 2015 Elsevier Ltd. All rights reserved.

Complement anaphylatoxins as immune regulators in cancer.

PubMed

Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

2014-08-01

The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

A Tumor Profile in Primary Immune Deficiencies Challenges the Cancer Immune Surveillance Concept.

PubMed

Satgé, Daniel

2018-01-01

Under the concept of cancer immune surveillance, individuals with primary immune deficiencies would be expected to develop many more malignancies and show an excess of all types of cancers, compared to people with a normal immune system. A review of the nine most frequent and best-documented human conditions with primary immune deficiency reveals a 1.6- to 2.3-fold global increase of cancer in the largest epidemiological studies. However, the spectrum of cancer types with higher frequencies is narrow, limited mainly to lymphoma, digestive tract cancers, and virus-induced cancers. Increased lymphoma is also reported in animal models of immune deficiency. Overstimulation of leukocytes, chronic inflammation, and viruses explain this tumor profile. This raises the question of cancers being foreign organisms or tissues. Organisms, such as bacteria, viruses, and parasites as well as non-compatible grafts are seen as foreign (non-self) and identified and destroyed or rejected by the body (self). As cancer cells rarely show strong (and unique) surface antibodies, their recognition and elimination by the immune system is theoretically questionable, challenging the immune surveillance concept. In the neonatal period, the immune system is weak, but spontaneous regression and good outcomes occur for some cancers, suggesting that non-immune factors are effective in controlling cancer. The idea of cancer as a group of cells that must be destroyed and eliminated appears instead as a legacy of methods and paradigms in microbiological medicine. As an alternative approach, cancer cells could be considered part of the body and could be controlled by an embryonic and neonatal environment.

Influence of health providers on pediatrics' immunization rate.

PubMed

Al-lela, Omer Q B; Baidi Bahari, Mohd; Al-abbassi, Mustafa G; Salih, Muhannad R M; Basher, Amena Y

2012-12-01

To identify the immunization providers' characteristics associated with immunization rate in children younger than 2 years. A cohort and a cluster sampling design were implemented; 528 children between 18 and 70 months of age were sampled in five public health clinics in Mosul-Iraq. Providers' characterizations were obtained. Immunization rate for the children was assessed. Risk factors for partial immunization were explored using both bivariate analyses and multi-level logistic regression models. Less than half of the children had one or more than one missed dose, considered as partial immunization cases. The study found significant association of immunization rate with provider's type. Two factors were found that strongly impacted on immunization rate in the presence of other factors: birthplace and immunization providers' type.

Chronobiology of the neuroimmunoendocrine system and aging.

PubMed

Mate, Ianire; Madrid, Juan Antonio; De la Fuente, Mónica

2014-01-01

The health maintenance depends on the preservation of the homeostatic systems, such as nervous, endocrine and immune system, and a proper communication between them. In this regard, the circadian system, which promotes a better physiological system functions and thus well being, could be considered part of that homeostatic complex, since the neuroimmunoendocrine system possesses circadian patterns in most variables, as well as circannual or seasonal variations. With aging, an impairment of the homeostatic systems occurs and an alteration of circadian system regulation has been demonstrated. In the immune system, several function parameters, which are good markers of health and of the rate of aging, change not only with age (immunosenescence) but also throughout the day and year. Indeed, with advancing age there is a modification of immune cell circadian function especially in lymphocytes. Moreover, immune functions at early afternoon correspond to more aged values than at morning, especially in mature subjects (60-79 years of age). In addition, these mature men and women showed a significant impaired immune cell function, which is especially remarkable in the winter. It is noteworthy the role of immunomodulatory hormones, such as melatonin, in the regulation of biological rhythms and their involvement in the aging process. Furthermore, the evidence of a neuroimmune regulation of the circadian system and its disturbance with aging, highlights the importance of proinflammatory cytokines in this complex cross-talk. The biological rhythms disruption with age and some diseases (jet lag, cancer and seasonal affective disorder), could contribute increasing the immune system impairment and consequently the loss of health.

Protective and destructive immunity in the periodontium: Part 1--innate and humoral immunity and the periodontium.

PubMed

Teng, Y-T A

2006-03-01

Based on the results of recent research in the field, the present paper will discuss the protective and destructive aspects of the innate vs. adaptive (humoral and cell-mediated) immunity associated with the bacterial virulent factors or antigenic determinants during periodontal pathogenesis. Attention will be focused on: (i) the Toll-like receptors (TLR), the innate immune repertoire for recognizing the unique molecular patterns of microbial components that trigger innate and adaptive immunity for effective host defenses, in some general non-oral vs. periodontal microbial infections; (ii) T-cell-mediated immunity, Th-cytokines, and osteoclastogenesis in periodontal disease progression; and (iii) some molecular techniques developed and used to identify critical microbial virulence factors or antigens associated with host immunity (using Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis as the model species). Therefore, further understanding of the molecular interactions and mechanisms associated with the host's innate and adaptive immune responses will facilitate the development of new and innovative therapeutics for future periodontal treatments.

Intraindividual Increase of Homeostatic Sleep Pressure Across Acute and Chronic Sleep Loss: A High-Density EEG Study.

PubMed

Maric, Angelina; Lustenberger, Caroline; Werth, Esther; Baumann, Christian R; Poryazova, Rositsa; Huber, Reto

2017-09-01

To compare intraindividually the effects of acute sleep deprivation (ASD) and chronic sleep restriction (CSR) on the homeostatic increase in slow wave activity (SWA) and to relate it to impairments in basic cognitive functioning, that is, vigilance. The increase in SWA after ASD (40 hours of wakefulness) and after CSR (seven nights with time in bed restricted to 5 hours per night) relative to baseline sleep was assessed in nine healthy, male participants (age = 18-26 years) by high-density electroencephalography. The SWA increase during the initial part of sleep was compared between the two conditions of sleep loss. The increase in SWA was related to the increase in lapses of vigilance in the psychomotor vigilance task (PVT) during the preceding days. While ASD induced a stronger increase in initial SWA than CSR, the increase was globally correlated across the two conditions in most electrodes. The increase in initial SWA was positively associated with the increase in PVT lapses. The individual homeostatic response in SWA is globally preserved across acute and chronic sleep loss, that is, individuals showing a larger increase after ASD also do so after CSR and vice versa. Furthermore, the increase in SWA is globally correlated to vigilance impairments after sleep loss over both conditions. Thus, the increase in SWA might therefore provide a physiological marker for individual differences in performance impairments after sleep loss. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

Homeostatic maintenance of ponderosa pine gas exchange in response to stand density changes.

PubMed

McDowell, Nate G; Adams, Henry D; Bailey, John D; Hess, Marcey; Kolb, Thomas E

2006-06-01

Homeostatic maintenance of gas exchange optimizes carbon gain per water loss. Homeostasis is regulated by short-term physiological and long-term structural mechanisms, both of which may respond to changes in resource availability associated with competition. Therefore, stand density regulation via silvicultural manipulations may facilitate growth and survival through mechanisms operating at both short and long timescales. We investigated the responses of ponderosa pine (Pinus ponderosa) to stand basal area manipulations in Arizona, USA. Stand basal area was manipulated to seven replicated levels in 1962 and was maintained for four decades by decadal thinning. We measured basal area increment (BAI) to assess the response and sustainability of wood growth, carbon isotope discrimination (A) inferred from annual rings to assess the response of crown gas exchange, and ratios of leaf area to sapwood area (A(l):A(s)) to assess longer term structural acclimation. Basal area treatments increased soil water potential (r2 = 0.99) but did not affect photosynthetic capacity. BAI increased within two years of thinning, and the 40-year mean BAI was negatively correlated with stand basal area (r2 = 0.98). delta was negatively correlated with stand basal area for years 5 through 12 after thinning (r2 = 0.90). However, delta was relatively invariant with basal area for the period 13-40 years after initial thinning despite maintenance of treatment basal areas via repeated decadal thinnings. Independent gas exchange measurements verified that the ratio of photosynthesis to stomatal conductance was invariant with basal area, but absolute values of both were elevated at lower basal areas. A(l):A(s) was negatively correlated with basal area (r2 = 0.93). We hypothesize that increased A(l):A(s) is a homeostatic response to increased water availability that maximizes water-use efficiency and whole-tree carbon uptake. Elevated A(l):A(s) of trees at low basal areas was associated with greater

TUNING IMMUNE TOLERANCE WITH VASOACTIVE INTESTINAL PEPTIDE: A NEW THERAPEUTIC APPROACH FOR IMMUNE DISORDERS

PubMed Central

POZO, DAVID; GONZALEZ-REY, ELENA; CHORNY, ALEJO; ANDERSON, PER; VARELA, NIEVES; DELGADO, MARIO

2007-01-01

The induction of immune tolerance is essential for the maintenance of immune homeostasis and to limit the occurrence of exacerbated inflammatory and autoimmune conditions. Multiple mechanisms act together to ensure self-tolerance, including central clonal deletion, cytokine deviation and induction of regulatory T cells. Identifying the factors that regulate these processes is crucial for the development of new therapies of autoimmune diseases and transplantation. The vasoactive intestinal peptide (VIP) is a well-characterized endogenous anti-inflammatory neuropeptide with therapeutic potential for a variety of immune disorders. Here we examine the latest research findings, which indicate that VIP participates in maintaining immune tolerance in two distinct ways: by regulating the balance between pro-inflammatory and anti-inflammatory factors, and by inducing the emergence of regulatory T cells with suppressive activity against autoreactive T-cell effectors. PMID:17521775

Homeostatic regulation of protein intake: in search of a mechanism

PubMed Central

Reed, Scott D.; Henagan, Tara M.

2012-01-01

Free-living organisms must procure adequate nutrition by negotiating an environment in which both the quality and quantity of food vary markedly. Recent decades have seen marked progress in our understanding of neural regulation of feeding behavior. However, this progress has occurred largely in the context of energy intake, despite the fact that food intake is influenced by more than just the energy content of the diet. A large number of behavioral studies indicate that both the quantity and quality of dietary protein can markedly influence food intake. High-protein diets tend to reduce intake, low-protein diets tend to increase intake, and rodent models seem to self-select between diets in order to meet protein requirements and avoid diets that are imbalanced in amino acids. Recent work suggests that the amino acid leucine regulates food intake by altering mTOR and AMPK signaling in the hypothalamus, while activation of GCN2 within the anterior piriform cortex contributes to the detection and avoidance of amino acid-imbalanced diets. This review focuses on the role that these and other signaling systems may play in mediating the homeostatic regulation of protein balance, and in doing so, highlights our lack of knowledge regarding the physiological and neurobiological mechanisms that might underpin such a regulatory phenomenon. PMID:22319049

Early Short-Term Antiretroviral Therapy Is Associated with a Reduced Prevalence of CD8+FoxP3+ T Cells in Simian Immunodeficiency Virus-Infected Controller Rhesus Macaques

PubMed Central

George, Jeffy; Cofano, Egidio Brocca; Lybarger, Elizabeth; Louder, Mark; Lafont, Bernard A.P.; Mascola, John R.; Robert-Guroff, Marjorie

2011-01-01

Abstract Regulatory T cells contain a mix of CD4 and CD8 T cell subsets that can suppress immune activation and at the same time suppress immune responses, thereby contributing to disease progression. Recent studies have shown that an increased prevalence of CD8+FoxP3+ T regulatory cells was associated with immune suppression and diminished viral control in simian immunodeficiency virus (SIV)-infected rhesus macaques. Preventing an increase in the prevalence of CD8 T regulatory subsets is likely to lead to a better long-term outcome. Here we show that short-term antiretroviral therapy initiated within 1 week after SIV infection was associated with lower viral set point and immune activation after withdrawal of therapy as compared to untreated animals. Early short-term treated controller animals were found to have better SIV-specific immune responses and a significantly lower prevalence of immunosuppressive CD8+FoxP3+ T cells. Lower levels of CD8+FoxP3+ T cells coincided with preservation of CD4+FoxP3+ T cells at homeostatic levels, and significantly correlated with lower immune activation, suggesting a role for viral infection-driven immune activation in the expansion of CD8+FoxP3+ T cells. Interestingly, initiation of continuous therapy later in infection did not reduce the increased prevalence of CD8+FoxP3+ T cells to homeostatic levels. Taken together, our results suggest that early antiretroviral therapy preserves the integrity of the immune system leading to a lower viral set point in controller animals, and prevents alterations in the homeostatic balance between CD4+ and CD8+ T regulatory cells that could aid in better long-term outcome. PMID:21142402

Identifying Immune Drivers of Gulf War Illness Using a Novel Daily Sampling Approach

DTIC Science & Technology

2015-10-01

rescheduled to allow time to complete data collection from the 35 participants that will be enrolled at UAB). Task 2: Submission of Documents for...collection During the 25-day immune monitoring phase, blood was collected by trained phlebotomists or research nurses at Parkitny et al. BMC Immunology

Good news–bad news: the Yin and Yang of immune privilege in the eye

PubMed Central

Forrester, John V.; Xu, Heping

2012-01-01

The eye and the brain are prototypical tissues manifesting immune privilege (IP) in which immune responses to foreign antigens, particularly alloantigens are suppressed, and even completely inhibited. Explanations for this phenomenon are numerous and mostly reflect our evolving understanding of the molecular and cellular processes underpinning immunological responses generally. IP is now viewed as a property of many tissues and the level of expression of IP varies not only with the tissue but with the nature of the foreign antigen and changes in the limited conditions under which privilege can operate as a mechanism of immunological tolerance. As a result, IP functions normally as a homeostatic mechanism preserving normal function in tissues, particularly those with highly specialized function and limited capacity for renewal such as the eye and brain. However, IP is relatively easily bypassed in the face of a sufficiently strong immunological response, and the privileged tissues may be at greater risk of collateral damage because its natural defenses are more easily breached than in a fully immunocompetent tissue which rapidly rejects foreign antigen and restores integrity. This two-edged sword cuts its swathe through the eye: under most circumstances, IP mechanisms such as blood–ocular barriers, intraocular immune modulators, induction of T regulatory cells, lack of lymphatics, and other properties maintain tissue integrity; however, when these are breached, various degrees of tissue damage occur from severe tissue destruction in retinal viral infections and other forms of uveoretinal inflammation, to less severe inflammatory responses in conditions such as macular degeneration. Conversely, ocular IP and tumor-related IP can combine to permit extensive tumor growth and increased risk of metastasis thus threatening the survival of the host. PMID:23230433

Immune Monitoring for CMV in Transplantation.

PubMed

Yong, Michelle K; Lewin, Sharon R; Manuel, Oriol

2018-03-14

Immune monitoring to determine when and how the recovery of cytomegalovirus (CMV)-specific T-cells occurs post-transplantation may help clinicians to risk stratify individuals at risk of complications from CMV. We aimed to review all recent clinical studies using CMV immune monitoring in the pre- and post-transplant setting including the use of recently developed standardized assays (Quantiferon-CMV and the CMV ELISPOT) to better understand in whom, when, and how immune monitoring is best used. Pre-transplant assessment of CMV immunity in solid-organ transplant recipients where CMV seropositive recipients had undetectable cell-mediated responses despite past immunity has shown that they are at a much higher risk of developing CMV reactivation. Post-transplant CMV immune monitoring can guide (shorten or prolong) the duration of antiviral prophylaxis, identify recipients at risk of post-prophylaxis CMV disease, and predict recurrent CMV reactivation. Thus, CMV immune monitoring, in addition to current clinical and DNA-based monitoring for CMV, has the potential to be incorporated into routine clinical care to better improve CMV management in both the stem and solid-organ transplant population.

Child Immunization: Prevention Is the Best Medicine. Nutrition, Health and Safety.

ERIC Educational Resources Information Center

Klein, Tanna

1999-01-01

Argues that immunizations are the most powerful and most effective way to prevent childhood infectious diseases. Presents immunization rates in Missouri and describes recent state legislation adding tetanus and pertussis to required immunizations for school attendance. Identifies factors contributing to Missouri's low preschool immunization level.…

Researching routine immunization-do we know what we don't know?

PubMed

Clements, C John; Watkins, Margaret; de Quadros, Ciro; Biellik, Robin; Hadler, James; McFarland, Deborah; Steinglass, Robert; Luman, Elizabeth; Hennessey, Karen; Dietz, Vance

2011-11-03

The Expanded Programme on Immunization (EPI), launched in 1974, has developed and implemented a range of strategies and practices over the last three decades to ensure that children and adults receive the vaccines they need to help protect them against vaccine-preventable diseases. Many of these strategies have been implemented, resulting in immunization coverage exceeding 80% among children one year of age in many countries. Yet millions of infants remain under-immunized or unimmunized, particularly in poorer countries. In November 2009, a panel of external experts met at the United States Centers for Disease Control and Prevention (CDC) to review and identify areas of research required to strengthen routine service delivery in developing countries. Research opportunities were identified utilizing presentations emphasizing existing research, gaps in knowledge and key questions. Panel members prioritized the topics, as did other meeting participants. Several hundred research topics covering a wide range were identified by the panel members and participants. However there were relatively few topics for which there was a consensus that immediate investment in research is warranted. The panel identified 28 topics as priorities. 18 topics were identified as priorities by at least 50% of non-panel participants; of these, five were also identified as priorities by the panel. Research needs included identifying the best ways to increase coverage with existing vaccines and introduce new vaccines, integrate other services with immunizations, and finance immunization programmes. There is an enormous range of research that could be undertaken to support routine immunization. However, implementation of strategic plans, rather than additional research will have the greatest impact on raising immunization coverage and preventing disease, disability, and death from vaccine-preventable diseases. The panel emphasized the importance of tying operational research to programmatic

Exosomes and Homeostatic Synaptic Plasticity Are Linked to Each other and to Huntington's, Parkinson's, and Other Neurodegenerative Diseases by Database-Enabled Analyses of Comprehensively Curated Datasets

PubMed Central

Wang, James K. T.; Langfelder, Peter; Horvath, Steve; Palazzolo, Michael J.

2017-01-01

Huntington's disease (HD) is a progressive and autosomal dominant neurodegeneration caused by CAG expansion in the huntingtin gene (HTT), but the pathophysiological mechanism of mutant HTT (mHTT) remains unclear. To study HD using systems biological methodologies on all published data, we undertook the first comprehensive curation of two key PubMed HD datasets: perturbation genes that impact mHTT-driven endpoints and therefore are putatively linked causally to pathogenic mechanisms, and the protein interactome of HTT that reflects its biology. We perused PubMed articles containing co-citation of gene IDs and MeSH terms of interest to generate mechanistic gene sets for iterative enrichment analyses and rank ordering. The HD Perturbation database of 1,218 genes highly overlaps the HTT Interactome of 1,619 genes, suggesting links between normal HTT biology and mHTT pathology. These two HD datasets are enriched for protein networks of key genes underlying two mechanisms not previously implicated in HD nor in each other: exosome synaptic functions and homeostatic synaptic plasticity. Moreover, proteins, possibly including HTT, and miRNA detected in exosomes from a wide variety of sources also highly overlap the HD datasets, suggesting both mechanistic and biomarker links. Finally, the HTT Interactome highly intersects protein networks of pathogenic genes underlying Parkinson's, Alzheimer's and eight non-HD polyglutamine diseases, ALS, and spinal muscular atrophy. These protein networks in turn highly overlap the exosome and homeostatic synaptic plasticity gene sets. Thus, we hypothesize that HTT and other neurodegeneration pathogenic genes form a large interlocking protein network involved in exosome and homeostatic synaptic functions, particularly where the two mechanisms intersect. Mutant pathogenic proteins cause dysfunctions at distinct points in this network, each altering the two mechanisms in specific fashion that contributes to distinct disease pathologies

Exosomes and Homeostatic Synaptic Plasticity Are Linked to Each other and to Huntington's, Parkinson's, and Other Neurodegenerative Diseases by Database-Enabled Analyses of Comprehensively Curated Datasets.

PubMed

Wang, James K T; Langfelder, Peter; Horvath, Steve; Palazzolo, Michael J

2017-01-01

Huntington's disease (HD) is a progressive and autosomal dominant neurodegeneration caused by CAG expansion in the huntingtin gene ( HTT ), but the pathophysiological mechanism of mutant HTT (mHTT) remains unclear. To study HD using systems biological methodologies on all published data, we undertook the first comprehensive curation of two key PubMed HD datasets: perturbation genes that impact mHTT-driven endpoints and therefore are putatively linked causally to pathogenic mechanisms, and the protein interactome of HTT that reflects its biology. We perused PubMed articles containing co-citation of gene IDs and MeSH terms of interest to generate mechanistic gene sets for iterative enrichment analyses and rank ordering. The HD Perturbation database of 1,218 genes highly overlaps the HTT Interactome of 1,619 genes, suggesting links between normal HTT biology and mHTT pathology. These two HD datasets are enriched for protein networks of key genes underlying two mechanisms not previously implicated in HD nor in each other: exosome synaptic functions and homeostatic synaptic plasticity. Moreover, proteins, possibly including HTT, and miRNA detected in exosomes from a wide variety of sources also highly overlap the HD datasets, suggesting both mechanistic and biomarker links. Finally, the HTT Interactome highly intersects protein networks of pathogenic genes underlying Parkinson's, Alzheimer's and eight non-HD polyglutamine diseases, ALS, and spinal muscular atrophy. These protein networks in turn highly overlap the exosome and homeostatic synaptic plasticity gene sets. Thus, we hypothesize that HTT and other neurodegeneration pathogenic genes form a large interlocking protein network involved in exosome and homeostatic synaptic functions, particularly where the two mechanisms intersect. Mutant pathogenic proteins cause dysfunctions at distinct points in this network, each altering the two mechanisms in specific fashion that contributes to distinct disease pathologies

Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.

PubMed

Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier

2009-03-23

Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

The habenula as a novel link between the homeostatic and hedonic pathways in cancer-associated weight loss: a pilot study.

PubMed

Maldonado, Maria; Molfese, David L; Viswanath, Humsini; Curtis, Kaylah; Jones, Ashley; Hayes, Teresa G; Marcelli, Marco; Mediwala, Sanjay; Baldwin, Philip; Garcia, Jose M; Salas, Ramiro

2018-06-01

Little is known about the brain mechanisms underlying cancer-associated weight loss (C-WL) in humans despite this condition negatively affecting their quality of life and survival. We tested the hypothesis that patients with C-WL have abnormal connectivity in homeostatic and hedonic brain pathways together with altered brain activity during food reward. In 12 patients with cancer and 12 healthy controls, resting-state functional connectivity (RSFC, resting brain activity observed through changes in blood flow in the brain which creates a blood oxygen level-dependent signal that can be measured using functional magnetic resonance imaging) was used to compare three brain regions hypothesized to play a role in C-WL: the hypothalamus (homeostatic), the nucleus accumbens (hedonic), and the habenula (an important regulator of reward). In addition, the brain reward response to juice was studied. Participants included 12 patients with histological diagnosis of incurable cancer (solid tumours), a European Cooperative Oncology Group performance status of 0-2, and a ≥5% involuntary body weight loss from pre-illness over the previous 6 months and 12 non-cancer controls matched for age, sex, and race. RSFC between the hypothalamus, nucleus accumbens, and habenula and brain striatum activity as measured by functional MRI during juice reward delivery events were the main outcome measures. After adjusting for BMI and compared with matched controls, patients with C-WL were found to have reduced RSFC between the habenula and hypothalamus (P = 0.04) and between the habenula and nucleus accumbens (P = 0.014). Patients with C-WL also had reduced juice reward responses in the striatum compared with controls. In patients with C-WL, reduced connectivity between both homeostatic and hedonic brain regions and the habenula and reduced juice reward were observed. Further research is needed to establish the relevance of the habenula and striatum in C-WL. Published 2018. This article is

The Concordance of Parent and Child Immunization.

PubMed

Robison, Steve G; Osborn, Andrew W

2017-05-01

A substantial body of work has related survey-based parental vaccine hesitancy to noncompliant childhood immunization. However little attention has been paid to the connection between parents' own immunization behavior and the immunizations their children receive. Using the Oregon ALERT Immunization Information System, we identified adult caregiver-child pairs for children between 9 months and 17 years of age. The likelihood of adult-child concordance of influenza immunization per influenza season from 2010-2011 through 2014-2015 was assessed. The utility of adult immunization as a predictor was also assessed for other, noninfluenza recommended immunizations for children and adolescents. A total of 450 687 matched adult caregiver-child pairs were included in the study. The children of immunizing adults were 2.77 times more likely to also be immunized for seasonal influenza across all seasons (95% confidence interval, 2.74-2.79), with similar results applying within each season. Adult immunization status was also significantly associated with the likelihood of children and adolescents getting other noninfluenza immunizations, such as the human papillomavirus vaccine (HPV). When adults improved their own behavior from nonimmunizing to immunizing across influenza seasons, their children if not immunized in the previous season were 5.44 times (95% confidence interval, 5.35-5.53) more likely to become immunized for influenza. Children's likelihood of following immunization recommendations is associated with the immunization behavior of their parents. Encouraging parental immunization is a potential tool for increasing children's immunization rates. Copyright © 2017 by the American Academy of Pediatrics.

Brain-derived neurotrophic factor--a major player in stimulation-induced homeostatic metaplasticity of human motor cortex?

PubMed

Mastroeni, Claudia; Bergmann, Til Ole; Rizzo, Vincenzo; Ritter, Christoph; Klein, Christine; Pohlmann, Ines; Brueggemann, Norbert; Quartarone, Angelo; Siebner, Hartwig Roman

2013-01-01

Repetitive transcranial magnetic stimulation (rTMS) of the human motor hand area (M1HAND) can induce lasting changes in corticospinal excitability as indexed by a change in amplitude of the motor-evoked potential. The plasticity-inducing effects of rTMS in M1HAND show substantial inter-individual variability which has been partially attributed to the val(66)met polymorphism in the brain-derived neurotrophic factor (BDNF) gene. Here we used theta burst stimulation (TBS) to examine whether the BDNF val(66)met genotype can be used to predict the expression of TBS-induced homeostatic metaplasticity in human M1HAND. TBS is a patterned rTMS protocol with intermittent TBS (iTBS) usually inducing a lasting increase and continuous TBS (cTBS) a lasting decrease in corticospinal excitability. In three separate sessions, healthy val(66)met (n = 12) and val(66)val (n = 17) carriers received neuronavigated cTBS followed by cTBS (n = 27), cTBS followed by iTBS (n = 29), and iTBS followed by iTBS (n = 28). Participants and examiner were blinded to the genotype at the time of examination. As expected, the first TBS intervention induced a decrease (cTBS) and increase (iTBS) in corticospinal excitability, respectively, at the same time priming the after effects caused by the second TBS intervention in a homeostatic fashion. Critically, val(66)met carriers and val(66)val carriers showed very similar response patterns to cTBS and iTBS regardless of the order of TBS interventions. Since none of the observed TBS effects was modulated by the BDNF val(66)met polymorphism, our results do not support the notion that the BDNF val(66)met genotype is a major player with regard to TBS-induced plasticity and metaplasticity in the human M1HAND.

Persistent inflammation in HIV infection: established concepts, new perspectives.

PubMed

Nasi, Milena; Pinti, Marcello; Mussini, Cristina; Cossarizza, Andrea

2014-10-01

Immune activation is now considered a main driving force for the progressive immune failure in HIV infection. During the early phases of infection, a rapid depletion of gastrointestinal CD4+ T cells occurs that is followed by a deterioration of the gut epithelium and by the subsequent translocation of microbial products into the blood. Activation of innate immunity results in massive production of proinflammatory cytokines, which can trigger activation induced cell death phenomena among T lymphocytes. Moreover, persistent antigenic stimulation and inflammatory status causes immune exhaustion. The chronic immune activation also damages lymphoid tissue architecture, so contributing to the impairment of immune reconstitution. Recently, new mechanisms were identified, so opening new perspective on the innate immune sensing in HIV-1 infection. Cell death is followed by the release of molecules containing "damage-associated molecular patterns", that trigger a potent innate immune response through the engagement of Toll-like receptors. Then, also different types of HIV-related nucleic acids can act as potent stimulators of innate immunity. All these events contribute to the loss of T cell homeostatic regulation and to the failure of adaptive immunity. Copyright © 2014 Elsevier B.V. All rights reserved.

Turing mechanism for homeostatic control of synaptic density during C. elegans growth

NASA Astrophysics Data System (ADS)

Brooks, Heather A.; Bressloff, Paul C.

2017-07-01

We propose a mechanism for the homeostatic control of synapses along the ventral cord of Caenorhabditis elegans during development, based on a form of Turing pattern formation on a growing domain. C. elegans is an important animal model for understanding cellular mechanisms underlying learning and memory. Our mathematical model consists of two interacting chemical species, where one is passively diffusing and the other is actively trafficked by molecular motors, which switch between forward and backward moving states (bidirectional transport). This differs significantly from the standard mechanism for Turing pattern formation based on the interaction between fast and slow diffusing species. We derive evolution equations for the chemical concentrations on a slowly growing one-dimensional domain, and use numerical simulations to demonstrate the insertion of new concentration peaks as the length increases. Taking the passive component to be the protein kinase CaMKII and the active component to be the glutamate receptor GLR-1, we interpret the concentration peaks as sites of new synapses along the length of C. elegans, and thus show how the density of synaptic sites can be maintained.

Higher Frontal EEG Synchronization in Young Women with Major Depression: A Marker for Increased Homeostatic Sleep Pressure?

PubMed Central

Birchler-Pedross, Angelina; Frey, Sylvia; Chellappa, Sarah Laxhmi; Götz, Thomas; Brunner, Patrick; Knoblauch, Vera; Wirz-Justice, Anna; Cajochen, Christian

2011-01-01

Study Objectives: Major depressive disorder (MDD) is often associated with disturbances in circadian and/or sleep-wake dependent processes, which both regulate daytime energy and sleepiness levels. Design: Analysis of continuous electroencephalographic (EEG) recordings during 40 h of extended wakefulness under constant routine conditions. Artifact-free EEG samples derived from 12 locations were subjected to spectral analysis. Additionally, half-hourly ratings of subjective tension and sleepiness levels and salivary melatonin measurements were collected. Setting: Centre for Chronobiology, Psychiatric Hospitals of the University of Basel, Switzerland. Participants: Eight young healthy women and 8 young untreated women with MDD. Interventions: N/A. Measurements and Results: MDD women exhibited higher frontal low-frequency (FLA) EEG activity (0.5-5.0 Hz) during extended wakefulness than controls, particularly during the night. Enhanced FLA was paralleled by higher levels of subjective sleepiness and tension. In MDD women, overall FLA levels correlated positively with depression scores. The timing of melatonin onset did not significantly differ between the two groups, but the nocturnal secretion of salivary melatonin was significantly attenuated in MDD women. Conclusions: Our data imply that young women with MDD live on a higher homeostatic sleep pressure level, as indexed by enhanced FLA during wakefulness. Its positive correlation with depression scores indicates a possible functional relationship. High FLA could reflect a use-dependent phenomenon in depression (enhanced cognitive rumination or tension) and/or an attenuated circadian arousal signal. Citation: Birchler-Pedross A; Frey S; Chellappa SL; Götz T; Brunner P; Knoblauch V; Wirz-Justice A; Cajochen C. Higher frontal EEG synchronization in young women with major depression: a marker for increased homeostatic sleep pressure? SLEEP 2011;34(12):1699-1706. PMID:22131608

Identifying Regulators of the Immune Response to Dying Cells | Center for Cancer Research

Cancer.gov

Cytotoxic T cells are responsible for carrying out antigen-mediated immune responses against virally-infected and malignant cells. In both cases, cytotoxic T cells are stimulated by interacting with antigen presenting cells, such as dendritic cells (DCs). Infected cells produce virus-specific antigens and pathogen associated molecular patterns, which are recognized by DCs and

Pregnancy outcomes of women with failure to retain rubella immunity.

PubMed

Schwartzenburg, Christopher J; Gilmandyar, Dzhamala; Thornburg, Loralei L; Hackney, David N

2014-12-01

We sought to explore the clinical variables associated with the loss of rubella immunity during pregnancy and to determine if these changes are linked to obstetrical complications. This is a case-control study in which women were identified whose rubella antibody titers were equivocal or non-immune and compared to those who had retained immunity. Two hundred and eighty-five cases were identified and compared to the same number of controls using Student's t test, Mann-Whitney U-test or Fisher's exact test. Univariate and multivariate logistic regressions were employed. Subjects with diminished immunity were more likely to have public insurance and higher gravidity with a trend toward increased tobacco use. Diminished rubella immunity was not associated with adverse obstetrical outcomes, including preterm birth and pre-eclampsia and is likely not a risk factor for these pregnancy outcomes. While no adverse pregnancy outcomes were associated with a loss of rubella immunity, women with greater number of pregnancies appear to lose their immunity to rubella. This relationship needs to be explored further and if proven, revaccination prior to pregnancy may need to be addressed.

Immune function during space flight

NASA Technical Reports Server (NTRS)

Sonnenfeld, Gerald; Shearer, William T.

2002-01-01

It is very likely that the human immune system will be altered in astronauts exposed to the conditions of long-term space flight: isolation, containment, microgravity, radiation, microbial contamination, sleep disruption, and insufficient nutrition. In human and animal subjects flown in space, there is evidence of immune compromise, reactivation of latent virus infection, and possible development of a premalignant or malignant condition. Moreover, in ground-based space flight model investigations, there is evidence of immune compromise and reactivation of latent virus infection. All of these observations in space flight itself or in ground-based models of space flight have a strong resonance in a wealth of human pathologic conditions involving the immune system where reactivated virus infections and cancer appear as natural consequences. The clinical conditions of Epstein-Barr-driven lymphomas in transplant patients and Kaposi's sarcoma in patients with autoimmune deficiency virus come easily to mind in trying to identify these conditions. With these thoughts in mind, it is highly appropriate, indeed imperative, that careful investigations of human immunity, infection, and cancer be made by space flight researchers.

Characterization of Heterogeneity in Childhood Immunization Coverage in Central Florida Using Immunization Registry Data.

PubMed

Thompson, Kimberly M; Logan, Grace E

2016-07-01

Despite high vaccine coverage in the United States in general, and in the State of Florida specifically, some children miss scheduled vaccines due to health system failures or vaccine refusal by their parents. Recent experiences with outbreaks in the United States suggest that geographic clustering of un(der)vaccinated populations represent a threat to the elimination status of some vaccine-preventable diseases. Immunization registries continue to expand and play an important role in efforts to track vaccine coverage and use. Using nearly 700,000 de-identified immunization records from the Florida Department of Health immunization information system (Florida SHOTS™) for children born during 2003-2014, we explored heterogeneity and potential clustering of un(der)vaccinated children in six counties in central Florida-Brevard, Lake, Orange, Oseola, Polk, and Seminole-that represent a high-risk area for importation due to family tourist attractions in the area. By zip code, we mapped the population density, the percent of children with religious exemptions, the percent of children on track or overdue for each vaccine series without and with exemptions, and the numbers of children with no recorded dose of each vaccine. Overall, we found some heterogeneity in coverage among the counties and zip codes, but relatively consistent and high coverage. We found that some children with an exemption in the system received the vaccines we analyzed, but exemption represents a clear risk factor for un(der)immunization. We identified many challenges associated with using immunization registry data for spatial analysis and potential opportunities to improve registries to better support future analyses. © 2015 Society for Risk Analysis.

A bibliometric analysis of childhood immunization research productivity in Africa since the onset of the Expanded Program on Immunization in 1974

PubMed Central

2013-01-01

Background The implementation of strategic immunization plans whose development is informed by available locally-relevant research evidence should improve immunization coverage and prevent disease, disability and death in Africa. In general, health research helps to answer questions, generate the evidence required to guide policy and identify new tools. However, factors that influence the publication of immunization research in Africa are not known. We, therefore, undertook this study to fill this research gap by providing insights into factors associated with childhood immunization research productivity on the continent. We postulated that research productivity influences immunization coverage. Methods We conducted a bibliometric analysis of childhood immunization research output from Africa, using research articles indexed in PubMed as a surrogate for total research productivity. We used zero-truncated negative binomial regression models to explore the factors associated with research productivity. Results We identified 1,641 articles on childhood immunization indexed in PubMed between 1974 and 2010 with authors from Africa, which represent only 8.9% of the global output. Five countries (South Africa, Nigeria, The Gambia, Egypt and Kenya) contributed 48% of the articles. After controlling for population and gross domestic product, The Gambia, Guinea-Bissau and Sao Tome and Principe were the most productive countries. In univariable analyses, the country's gross domestic product, total health expenditure, private health expenditure, and research and development expenditure had a significant positive association with increased research productivity. Immunization coverage, adult literacy rate, human development index and physician density had no significant association. In the multivarable model, only private health expenditure maintained significant statistical association with the number of immunization articles. Conclusions Immunization research productivity in

Antimicrobial and Attractant Roles for Chemerin in the Oral Cavity during Inflammatory Gum Disease

PubMed Central

Godlewska, Urszula; Brzoza, Piotr; Sroka, Aneta; Majewski, Pawel; Jentsch, Holger; Eckert, Martin; Eick, Sigrun; Potempa, Jan; Zabel, Brian A.; Cichy, Joanna

2017-01-01

Periodontal inflammation is one of the most common chronic inflammatory conditions in humans. Despite recent advances in identifying and characterizing oral microbiota dysbiosis in the pathogenesis of gum disease, just how host factors maintain a healthy homeostatic oral microbial community or prevent the development of a pathogenic oral microbiota remains poorly understood. An important determinant of microbiota fate is local antimicrobial proteins. Here, we report that chemoattractant protein chemerin, which we recently identified as a potent endogenous antimicrobial agent in body barriers such as the skin, is present in the oral cavity under homeostatic and inflammatory conditions. Chemerin and a chemerin-derived antimicrobial peptide are bactericidal against select bacteria strategically positioned in dental biofilm. Gingival crevicular samples from patients with gingivitis but not periodontitis contain abundant bioactive chemerin capable of inducing CMKLR1-dependent leukocyte migration. Gingipains secreted by the periodontopathogen P. gingivalis inactivate chemerin. Together, these data suggest that as an antimicrobial agent and leukocyte chemoattractant, chemerin likely contributes to antimicrobial immune defense in the oral cavity. PMID:28424689

Antimicrobial and Attractant Roles for Chemerin in the Oral Cavity during Inflammatory Gum Disease.

PubMed

Godlewska, Urszula; Brzoza, Piotr; Sroka, Aneta; Majewski, Pawel; Jentsch, Holger; Eckert, Martin; Eick, Sigrun; Potempa, Jan; Zabel, Brian A; Cichy, Joanna

2017-01-01

Periodontal inflammation is one of the most common chronic inflammatory conditions in humans. Despite recent advances in identifying and characterizing oral microbiota dysbiosis in the pathogenesis of gum disease, just how host factors maintain a healthy homeostatic oral microbial community or prevent the development of a pathogenic oral microbiota remains poorly understood. An important determinant of microbiota fate is local antimicrobial proteins. Here, we report that chemoattractant protein chemerin, which we recently identified as a potent endogenous antimicrobial agent in body barriers such as the skin, is present in the oral cavity under homeostatic and inflammatory conditions. Chemerin and a chemerin-derived antimicrobial peptide are bactericidal against select bacteria strategically positioned in dental biofilm. Gingival crevicular samples from patients with gingivitis but not periodontitis contain abundant bioactive chemerin capable of inducing CMKLR1-dependent leukocyte migration. Gingipains secreted by the periodontopathogen P. gingivalis inactivate chemerin. Together, these data suggest that as an antimicrobial agent and leukocyte chemoattractant, chemerin likely contributes to antimicrobial immune defense in the oral cavity.

Shaping eosinophil identity in the tissue contexts of development, homeostasis, and disease.

PubMed

Abdala-Valencia, Hiam; Coden, Mackenzie E; Chiarella, Sergio E; Jacobsen, Elizabeth A; Bochner, Bruce S; Lee, James J; Berdnikovs, Sergejs

2018-04-14

Eosinophils play homeostatic roles in different tissues and are found in several organs at a homeostatic baseline, though their tissue numbers increase significantly in development and disease. The morphological, phenotypical, and functional plasticity of recruited eosinophils are influenced by the dynamic tissue microenvironment changes between homeostatic, morphogenetic, and disease states. Activity of the epithelial-mesenchymal interface, extracellular matrix, hormonal inputs, metabolic state of the environment, as well as epithelial and mesenchymal-derived innate cytokines and growth factors all have the potential to regulate the attraction, retention, in situ hematopoiesis, phenotype, and function of eosinophils. This review examines the reciprocal relationship between eosinophils and such tissue factors, specifically addressing: (1) tissue microenvironments associated with the presence and activity of eosinophils; (2) non-immune tissue ligands regulatory for eosinophil accumulation, hematopoiesis, phenotype, and function (with an emphasis on the extracellular matrix and epithelial-mesenchymal interface); (3) the contribution of eosinophils to regulating tissue biology; (4) eosinophil phenotypic heterogeneity in different tissue microenvironments, classifying eosinophils as progenitors, steady state eosinophils, and Type 1 and 2 activated phenotypes. An appreciation of eosinophil regulation by non-immune tissue factors is necessary for completing the picture of eosinophil immune activation and understanding the functional contribution of these cells to development, homeostasis, and disease. ©2018 Society for Leukocyte Biology.

Pilot projects and nation-wide immunization in India.

PubMed

Haxton, D

1984-01-01

These studies identify possibilities for expanding immunization coverage in India and show that there have been positive experiences in going to scale with immunizationation at the district level. Reasons for success are discussed. The promotion of social awareness and participation through all available channels is of central importance. Continuing attention should be directed to vaccine supply and distribution systems, program management and manpower training, especially at the community level. There are many opportunities for extending involvement in immunization efforts and broad-spectrum programs beyond the confines of the health system, and for flexibility in program organization. Planning must incorporate political commitment as well as the provision of adequate financial resources. India launched the Expanded Program on Immunization (EPI) in 1978. 6 diseases are currently on the official schedule for progressive nation-wide immunization: tuberculosis, poliomyelitis, whooping cough, diptheria, tetanus and typhoid. The experiences of 3 efforts in Dewas, in Bidar, (2 rural areas), and in Delhi (an urban area) are covered. Immunization coverage before the intensive efforts did not exceed 30%. Major elements of program organization were: nonhealth sector political and administrative involvement from the state; multisectoral planning committees at different levels; household surveys to identify children to be immunized; training sessions for each category of workers; and strengthening the cold chain. Factors in operational design and implementation include: vaccination posts in the community; selection of acceptable vaccination days; reminders the day before vaccination; collection of children; immunization cards as a device for informing about next round; counteraction of side-effects; follow-up of drop-outs; monitoring for corrective action involving all participants; and formal evaluation by local medical colleges. Intensive immunization in the 3 pilot sites

Genome-wide imputation study identifies novel HLA locus for pulmonary fibrosis and potential role for auto-immunity in fibrotic idiopathic interstitial pneumonia.

PubMed

Fingerlin, Tasha E; Zhang, Weiming; Yang, Ivana V; Ainsworth, Hannah C; Russell, Pamela H; Blumhagen, Rachel Z; Schwarz, Marvin I; Brown, Kevin K; Steele, Mark P; Loyd, James E; Cosgrove, Gregory P; Lynch, David A; Groshong, Steve; Collard, Harold R; Wolters, Paul J; Bradford, Williamson Z; Kossen, Karl; Seiwert, Scott D; du Bois, Roland M; Garcia, Christine Kim; Devine, Megan S; Gudmundsson, Gunnar; Isaksson, Helgi J; Kaminski, Naftali; Zhang, Yingze; Gibson, Kevin F; Lancaster, Lisa H; Maher, Toby M; Molyneaux, Philip L; Wells, Athol U; Moffatt, Miriam F; Selman, Moises; Pardo, Annie; Kim, Dong Soon; Crapo, James D; Make, Barry J; Regan, Elizabeth A; Walek, Dinesha S; Daniel, Jerry J; Kamatani, Yoichiro; Zelenika, Diana; Murphy, Elissa; Smith, Keith; McKean, David; Pedersen, Brent S; Talbert, Janet; Powers, Julia; Markin, Cheryl R; Beckman, Kenneth B; Lathrop, Mark; Freed, Brian; Langefeld, Carl D; Schwartz, David A

2016-06-07

Fibrotic idiopathic interstitial pneumonias (fIIP) are a group of fatal lung diseases with largely unknown etiology and without definitive treatment other than lung transplant to prolong life. There is strong evidence for the importance of both rare and common genetic risk alleles in familial and sporadic disease. We have previously used genome-wide single nucleotide polymorphism data to identify 10 risk loci for fIIP. Here we extend that work to imputed genome-wide genotypes and conduct new RNA sequencing studies of lung tissue to identify and characterize new fIIP risk loci. We performed genome-wide genotype imputation association analyses in 1616 non-Hispanic white (NHW) cases and 4683 NHW controls followed by validation and replication (878 cases, 2017 controls) genotyping and targeted gene expression in lung tissue. Following meta-analysis of the discovery and replication populations, we identified a novel fIIP locus in the HLA region of chromosome 6 (rs7887 P meta  = 3.7 × 10(-09)). Imputation of classic HLA alleles identified two in high linkage disequilibrium that are associated with fIIP (DRB1*15:01 P = 1.3 × 10(-7) and DQB1*06:02 P = 6.1 × 10(-8)). Targeted RNA-sequencing of the HLA locus identified 21 genes differentially expressed between fibrotic and control lung tissue (Q < 0.001), many of which are involved in immune and inflammatory response regulation. In addition, the putative risk alleles, DRB1*15:01 and DQB1*06:02, are associated with expression of the DQB1 gene among fIIP cases (Q < 1 × 10(-16)). We have identified a genome-wide significant association between the HLA region and fIIP. Two HLA alleles are associated with fIIP and affect expression of HLA genes in lung tissue, indicating that the potential genetic risk due to HLA alleles may involve gene regulation in addition to altered protein structure. These studies reveal the importance of the HLA region for risk of fIIP and a basis for the potential

Influenza immunizations in the elderly: a continuous quality improvement project.

PubMed

Juma, A; Evans, M F; Bloom, J

2000-08-01

As part of the continuous quality improvement program at The Toronto Hospital's Department of Family & Community Medicine (TTH-DFCM), it was considered necessary to examine the structures, processes and outcomes of influenza immunization for the elderly. The study sought to (a) document the current influenza immunization process; (b) quantify influenza immunization rates for elderly patients during two consecutive immunization seasons (1996 and 1997), and compare these rates across physician teams, attending staff vs. residents, patient gender, and patient age groups; (c) compare influenza immunization rates with other centers; and (d) identify barriers and propose solutions to improve influenza immunization rates in the elderly. Evaluation Formative Research. A computerized roster of 15,000 patients at The Toronto Hospital, Department of Family and Community Medicine, a University of Toronto academic teaching center. Active patients age 65 years and over. Influenza immunization. Physician Teams, Physician status, Patient gender, and Patient age group. Immunization rates of attendees increased from 75.4% to 78.7%; over 3% increase from 1996 to 1997. Major subgroups which benefited from increased immunization rates were patients in the Blue team, patients age 70-74 years, and female patients. This study presents a rigorous examination of the components of the influenza immunization program, and demonstrates improved immunization rates over a two-year period. Suggestions for future action have been identified. The study design can also serve as a model for future clinical quality improvement projects.

Constant light suppresses production of Met-enkephalin-containing peptides in cultured splenic macrophages and impairs primary immune response in rats.

PubMed

Valdés-Tovar, Marcela; Escobar, Carolina; Solís-Chagoyán, Héctor; Asai, Miguel; Benítez-King, Gloria

2015-03-01

The light-dark cycle is an environmental factor that influences immune physiology, and so, variations of the photoperiod length result in altered immune responsivity. Macrophage physiology comprises a spectrum of functions that goes from host defense to immune down-regulation, in addition to their homeostatic activities. Macrophages also play a key role in the transition from innate to adaptive immune responses. Met-enkephalin (MEnk) has been recognized as a modulator of macrophage physiology acting in an autocrine or paracrine fashion to influence macrophage activation, phenotype polarization and production of cytokines that would enhance lymphocyte activation at early stages of an immune response. Previously it was shown that splenic MEnk tissue content is reduced in rats exposed to constant light. In this work, we explored whether production of Met-enkephalin-containing peptides (MECPs) in cultured splenic macrophages is affected by exposure of rats to a constant light regime. In addition, we explored whether primary immune response was impaired under this condition. We found that in rats, 15 days in constant light was sufficient to disrupt their general activity rhythm. Splenic MEnk content oscillations and levels were also blunted throughout a 24-h period in animals subjected to constant light. In agreement, de novo synthesis of MECPs evaluated through incorporation of (35)S-methionine was reduced in splenic macrophages from rats exposed to constant light. Moreover, MECPs immunocytochemistry showed a decrease in the intracellular content and lack of granule-like deposits in this condition. Furthermore, we found that primary T-dependent antibody response was compromised in rats exposed to constant light. In those animals, pharmacologic treatment with MEnk increased IFN-γ-secreting cells. Also, IL-2 secretion from antigen-stimulated splenocytes was reduced after incubation with naloxone, suggesting that immune-derived opioid peptides and stimulation of opioid

Immune response

MedlinePlus

Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...

Identifying Immune Drivers of Gulf War Illness Using a Novel Daily Sampling Approach

DTIC Science & Technology

2016-10-01

for Public Release ; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release ; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14...Gulf War Illness, cytokines , microglia, daily, immune, phlebotomy, fibromyalgia 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER

Learning and retrieval behavior in recurrent neural networks with pre-synaptic dependent homeostatic plasticity

NASA Astrophysics Data System (ADS)

Mizusaki, Beatriz E. P.; Agnes, Everton J.; Erichsen, Rubem; Brunnet, Leonardo G.

2017-08-01

The plastic character of brain synapses is considered to be one of the foundations for the formation of memories. There are numerous kinds of such phenomenon currently described in the literature, but their role in the development of information pathways in neural networks with recurrent architectures is still not completely clear. In this paper we study the role of an activity-based process, called pre-synaptic dependent homeostatic scaling, in the organization of networks that yield precise-timed spiking patterns. It encodes spatio-temporal information in the synaptic weights as it associates a learned input with a specific response. We introduce a correlation measure to evaluate the precision of the spiking patterns and explore the effects of different inhibitory interactions and learning parameters. We find that large learning periods are important in order to improve the network learning capacity and discuss this ability in the presence of distinct inhibitory currents.

Chemokine Receptor Expression on Normal Blood CD56+ NK-Cells Elucidates Cell Partners That Comigrate during the Innate and Adaptive Immune Responses and Identifies a Transitional NK-Cell Population

PubMed Central

Queirós, Maria Luís; Gonçalves, Marta; Fonseca, Sónia; Moura, João

2015-01-01

Studies of chemokine receptors (CKR) in natural killer- (NK-) cells have already been published, but only a few gave detailed information on its differential expression on blood NK-cell subsets. We report on the expression of the inflammatory and homeostatic CKR on normal blood CD56+low CD16+ and CD56+high  CD16−/+low NK-cells. Conventional CD56+low and CD56+high NK-cells present in the normal PB do express CKR for inflammatory cytokines, although with different patterns CD56+low NK-cells are mainly CXCR1/CXCR2+ and CXCR3/CCR5−/+, whereas mostly CD56+high NK-cells are CXCR1/CXCR2− and CXCR3/CCR5+. Both NK-cell subsets have variable CXCR4 expression and are CCR4− and CCR6−. The CKR repertoire of the CD56+low NK-cells approaches to that of neutrophils, whereas the CKR repertoire of the CD56+high NK-cells mimics that of Th1+ T cells, suggesting that these cells are prepared to migrate into inflamed tissues at different phases of the immune response. In addition, we describe a subpopulation of NK-cells with intermediate levels of CD56 expression, which we named CD56+int NK-cells. These NK-cells are CXCR3/CCR5+, they have intermediate levels of expression of CD16, CD62L, CD94, and CD122, and they are CD57− and CD158a−. In view of their phenotypic features, we hypothesize that they correspond to a transitional stage, between the well-known CD56+high and CD56+low NK-cells populations. PMID:26543875

Prenatal Tdap immunization and risk of maternal and newborn adverse events.

PubMed

Layton, J Bradley; Butler, Anne M; Li, Dongmei; Boggess, Kim A; Weber, David J; McGrath, Leah J; Becker-Dreps, Sylvia

2017-07-24

Many countries recommend combined tetanus toxoid, reduced diphtheria toxoid and acellular pertussis immunization (Tdap) during pregnancy to stimulate transplacental transmission of pertussis antibodies to newborns. The immune system can be altered during pregnancy, potentially resulting in differing immunization risks in pregnant women. The safety of widespread Tdap immunization during pregnancy needs to be established. Our objective was to assess whether prenatal Tdap immunization was associated with adverse birth outcomes, and to evaluate the effect of timing of Tdap administration on these outcomes. We identified pregnancies at delivery in a large insurance claims database (2010-2014). Tdap immunization was categorized as optimal prenatal (27+weeks), early prenatal (<27weeks), postpartum (≤7days post-delivery), or none. Medical claims were searched to identify maternal adverse immunization reactions (e.g. anaphylaxis, fever, Guillian-Barre syndrome [GBS]), adverse birth outcomes (e.g. preeclampsia/eclampsia, premature rupture or membranes, chorioamnionitis) and newborn outcomes (e.g. respiratory distress, pulmonary hypertension, neonatal jaundice). Women with optimal or early prenatal Tdap were compared to those not immunized in pregnancy, using propensity score-weighted log-binomial regression and Cox proportional hazards models to estimate risk ratios (RR) and hazard ratios (HR). We identified 1,079,034 deliveries and 677,075 linked newborns; 11.5% were immunized optimally and 2.3% immunized early. There were 1 case of post-immunization anaphylaxis, and 12 cases of maternal encephalopathy (all post- delivery); there were no cases of GBS. Optimally-timed immunization was associated with small increased relative risks of: chorioamnionitis [RR=1.11, (95% CI: 1.07-1.15), overall risk=2.8%], and postpartum hemorrhage [RR=1.23 (95% DI: 1.18-1.28), overall risk=2.4%]; however, these relative increases corresponded to low absolute risk increases. Tdap was not

Homeostatic maintenance via degradation and repair of elastic fibers under tension

NASA Astrophysics Data System (ADS)

Alves, Calebe; Araújo, Ascanio D.; Oliveira, Cláudio L. N.; Imsirovic, Jasmin; Bartolák-Suki, Erzsébet; Andrade, José S.; Suki, Béla

2016-06-01

Cellular maintenance of the extracellular matrix requires an effective regulation that balances enzymatic degradation with the repair of collagen fibrils and fibers. Here, we investigate the long-term maintenance of elastic fibers under tension combined with diffusion of general degradative and regenerative particles associated with digestion and repair processes. Computational results show that homeostatic fiber stiffness can be achieved by assuming that cells periodically probe fiber stiffness to adjust the production and release of degradative and regenerative particles. However, this mechanism is unable to maintain a homogeneous fiber. To account for axial homogeneity, we introduce a robust control mechanism that is locally governed by how the binding affinity of particles is modulated by mechanical forces applied to the ends of the fiber. This model predicts diameter variations along the fiber that are in agreement with the axial distribution of collagen fibril diameters obtained from scanning electron microscopic images of normal rat thoracic aorta. The model predictions match the experiments only when the applied force on the fiber is in the range where the variance of local stiffness along the fiber takes a minimum value. Our model thus predicts that the biophysical properties of the fibers play an important role in the long-term regulatory maintenance of these fibers.

Creatine supplementation reduces sleep need and homeostatic sleep pressure in rats.

PubMed

Dworak, Markus; Kim, Tae; Mccarley, Robert W; Basheer, Radhika

2017-06-01

Sleep has been postulated to promote brain energy restoration. It is as yet unknown if increasing the energy availability within the brain reduces sleep need. The guanidine amino acid creatine (Cr) is a well-known energy booster in cellular energy homeostasis. Oral Cr-monohydrate supplementation (CS) increases exercise performance and has been shown to have substantial effects on cognitive performance, neuroprotection and circadian rhythms. The effect of CS on cellular high-energy molecules and sleep-wake behaviour is unclear. Here, we examined the sleep-wake behaviour and brain energy metabolism before and after 4-week-long oral administration of CS in the rat. CS decreased total sleep time and non-rapid eye movement (NREM) sleep significantly during the light (inactive) but not during the dark (active) period. NREM sleep and NREM delta activity were decreased significantly in CS rats after 6 h of sleep deprivation. Biochemical analysis of brain energy metabolites showed a tendency to increase in phosphocreatine after CS, while cellular adenosine triphosphate (ATP) level decreased. Microdialysis analysis showed that the sleep deprivation-induced increase in extracellular adenosine was attenuated after CS. These results suggest that CS reduces sleep need and homeostatic sleep pressure in rats, thereby indicating its potential in the treatment of sleep-related disorders. © 2017 European Sleep Research Society.

A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure

NASA Astrophysics Data System (ADS)

Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

2016-05-01

Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

A systems biology pipeline identifies new immune and disease related molecular signatures and networks in human cells during microgravity exposure.

PubMed

Mukhopadhyay, Sayak; Saha, Rohini; Palanisamy, Anbarasi; Ghosh, Madhurima; Biswas, Anupriya; Roy, Saheli; Pal, Arijit; Sarkar, Kathakali; Bagh, Sangram

2016-05-17

Microgravity is a prominent health hazard for astronauts, yet we understand little about its effect at the molecular systems level. In this study, we have integrated a set of systems-biology tools and databases and have analysed more than 8000 molecular pathways on published global gene expression datasets of human cells in microgravity. Hundreds of new pathways have been identified with statistical confidence for each dataset and despite the difference in cell types and experiments, around 100 of the new pathways are appeared common across the datasets. They are related to reduced inflammation, autoimmunity, diabetes and asthma. We have identified downregulation of NfκB pathway via Notch1 signalling as new pathway for reduced immunity in microgravity. Induction of few cancer types including liver cancer and leukaemia and increased drug response to cancer in microgravity are also found. Increase in olfactory signal transduction is also identified. Genes, based on their expression pattern, are clustered and mathematically stable clusters are identified. The network mapping of genes within a cluster indicates the plausible functional connections in microgravity. This pipeline gives a new systems level picture of human cells under microgravity, generates testable hypothesis and may help estimating risk and developing medicine for space missions.

Hallmarks of response to immune checkpoint blockade

PubMed Central

Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A

2017-01-01

Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159

Brain-Derived Neurotrophic Factor – A Major Player in Stimulation-Induced Homeostatic Metaplasticity of Human Motor Cortex?

PubMed Central

Rizzo, Vincenzo; Ritter, Christoph; Klein, Christine; Pohlmann, Ines; Brueggemann, Norbert; Quartarone, Angelo; Siebner, Hartwig Roman

2013-01-01

Repetitive transcranial magnetic stimulation (rTMS) of the human motor hand area (M1HAND) can induce lasting changes in corticospinal excitability as indexed by a change in amplitude of the motor-evoked potential. The plasticity-inducing effects of rTMS in M1HAND show substantial inter-individual variability which has been partially attributed to the val66met polymorphism in the brain-derived neurotrophic factor (BDNF) gene. Here we used theta burst stimulation (TBS) to examine whether the BDNF val66met genotype can be used to predict the expression of TBS-induced homeostatic metaplasticity in human M1HAND. TBS is a patterned rTMS protocol with intermittent TBS (iTBS) usually inducing a lasting increase and continuous TBS (cTBS) a lasting decrease in corticospinal excitability. In three separate sessions, healthy val66met (n = 12) and val66val (n = 17) carriers received neuronavigated cTBS followed by cTBS (n = 27), cTBS followed by iTBS (n = 29), and iTBS followed by iTBS (n = 28). Participants and examiner were blinded to the genotype at the time of examination. As expected, the first TBS intervention induced a decrease (cTBS) and increase (iTBS) in corticospinal excitability, respectively, at the same time priming the after effects caused by the second TBS intervention in a homeostatic fashion. Critically, val66met carriers and val66val carriers showed very similar response patterns to cTBS and iTBS regardless of the order of TBS interventions. Since none of the observed TBS effects was modulated by the BDNF val66met polymorphism, our results do not support the notion that the BDNF val66met genotype is a major player with regard to TBS-induced plasticity and metaplasticity in the human M1HAND. PMID:23469118

Bidirectional Homeostatic Regulation of a Depression-Related Brain State by Gamma-Aminobutyric Acidergic Deficits and Ketamine Treatment.

PubMed

Ren, Zhen; Pribiag, Horia; Jefferson, Sarah J; Shorey, Matthew; Fuchs, Thomas; Stellwagen, David; Luscher, Bernhard

2016-09-15

Major depressive disorder is increasingly recognized to involve functional deficits in both gamma-aminobutyric acid (GABA)ergic and glutamatergic synaptic transmission. To elucidate the relationship between these phenotypes, we used GABAA receptor γ2 subunit heterozygous (γ2(+/-)) mice, which we previously characterized as a model animal with construct, face, and predictive validity for major depressive disorder. To assess possible consequences of GABAergic deficits on glutamatergic transmission, we quantitated the cell surface expression of N-methyl-D-aspartate (NMDA)-type and alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)-type glutamate receptors and the function of synapses in the hippocampus and medial prefrontal cortex of γ2(+/-) mice. We also analyzed the effects of an acute dose of the experimental antidepressant ketamine on all these parameters in γ2(+/-) versus wild-type mice. Modest defects in GABAergic synaptic transmission of γ2(+/-) mice resulted in a strikingly prominent homeostatic-like reduction in the cell surface expression of NMDA-type and AMPA-type glutamate receptors, along with prominent functional impairment of glutamatergic synapses in the hippocampus and medial prefrontal cortex. A single subanesthetic dose of ketamine normalized glutamate receptor expression and synaptic function of γ2(+/-) mice to wild-type levels for a prolonged period, along with antidepressant-like behavioral consequences selectively in γ2(+/-) mice. The GABAergic synapses of γ2(+/-) mice were potentiated by ketamine in parallel but only in the medial prefrontal cortex. Depressive-like brain states that are caused by GABAergic deficits involve a homeostatic-like reduction of glutamatergic transmission that is reversible by an acute, subanesthetic dose of ketamine, along with regionally selective potentiation of GABAergic synapses. The data merge the GABAergic and glutamatergic deficit hypotheses of major depressive disorder. Copyright © 2016

Adoptive T-cell therapy for cancer: The era of engineered T cells.

PubMed

Bonini, Chiara; Mondino, Anna

2015-09-01

Tumors originate from a number of genetic events that deregulate homeostatic mechanisms controlling normal cell behavior. The immune system, devoted to patrol the organism against pathogenic events, can identify transformed cells, and in several cases cause their elimination. It is however clear that several mechanisms encompassing both central and peripheral tolerance limit antitumor immunity, often resulting into progressive diseases. Adoptive T-cell therapy with either allogeneic or autologous T cells can transfer therapeutic immunity. To date, genetic engineering of T cells appears to be a powerful tool for shaping tumor immunity. In this review, we discuss the most recent achievements in the areas of suicide gene therapy, and TCR-modified T cells and chimeric antigen receptor gene-modified T cells. We provide an overview of current strategies aimed at improving the safety and efficacy of these approaches, with an outlook on prospective developments. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of humoral immunity profiles to identify heart recipients at risk for development of severe infections: A multicenter prospective study.

PubMed

Sarmiento, Elizabeth; Jaramillo, Maria; Calahorra, Leticia; Fernandez-Yañez, Juan; Gomez-Sanchez, Miguel; Crespo-Leiro, Maria G; Paniagua, Maria; Almenar, Luis; Cebrian, Monica; Rabago, Gregorio; Levy, Beltran; Segovia, Javier; Gomez-Bueno, Manuel; Lopez, Javier; Mirabet, Sonia; Navarro, Joaquin; Rodriguez-Molina, Juan Jose; Fernandez-Cruz, Eduardo; Carbone, Javier

2017-05-01

New biomarkers are necessary to improve detection of the risk of infection in heart transplantation. We performed a multicenter study to evaluate humoral immunity profiles that could better enable us to identify heart recipients at risk of severe infections. We prospectively analyzed 170 adult heart recipients at 8 centers in Spain. Study points were before transplantation and 7 and 30 days after transplantation. Immune parameters included IgG, IgM, IgA and complement factors C3 and C4, and titers of specific antibody to pneumococcal polysaccharide antigens (anti-PPS) and to cytomegalovirus (CMV). To evaluate potential immunologic mechanisms leading to IgG hypogammaglobulinemia, before heart transplantation we assessed serum B-cell activating factor (BAFF) levels using enzyme-linked immunoassay. The clinical follow-up period lasted 6 months. Clinical outcome was need for intravenous anti-microbials for therapy of infection. During follow-up, 53 patients (31.2%) developed at least 1 severe infection. We confirmed that IgG hypogammaglobulinemia at Day 7 (defined as IgG <600 mg/dl) is a risk factor for infection in general, bacterial infections in particular, and CMV disease. At Day 7 after transplantation, the combination of IgG <600 mg/dl + C3 <80 mg/dl was more strongly associated with the outcome (adjusted odds ratio 7.40; 95% confidence interval 1.48 to 37.03; p = 0.014). We found that quantification of anti-CMV antibody titers and lower anti-PPS antibody concentrations were independent predictors of CMV disease and bacterial infections, respectively. Higher pre-transplant BAFF levels were a risk factor of acute cellular rejection. Early immunologic monitoring of humoral immunity profiles proved useful for the identification of heart recipients who are at risk of severe infection. Copyright © 2017 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

The Unfolded Protein Response Plays a Predominant Homeostatic Role in Response to Mitochondrial Stress in Pancreatic Stellate Cells

PubMed Central

Su, Hsin-Yuan; Waldron, Richard T.; Gong, Raymond; Ramanujan, V. Krishnan; Pandol, Stephen J.; Lugea, Aurelia

2016-01-01

Activated pancreatic stellate cells (PaSC) are key participants in the stroma of pancreatic cancer, secreting extracellular matrix proteins and inflammatory mediators. Tumors are poorly vascularized, creating metabolic stress conditions in cancer and stromal cells that necessitate adaptive homeostatic cellular programs. Activation of autophagy and the endoplasmic reticulum unfolded protein response (UPR) have been described in hepatic stellate cells, but the role of these processes in PaSC responses to metabolic stress is unknown. We reported that the PI3K/mTOR pathway, which AMPK can regulate through multiple inputs, modulates PaSC activation and fibrogenic potential. Here, using primary and immortalized mouse PaSC, we assess the relative contributions of AMPK/mTOR signaling, autophagy and the UPR to cell fate responses during metabolic stress induced by mitochondrial dysfunction. The mitochondrial uncoupler rottlerin at low doses (0.5–2.5 μM) was added to cells cultured in 10% FBS complete media. Mitochondria rapidly depolarized, followed by altered mitochondrial dynamics and decreased cellular ATP levels. This mitochondrial dysfunction elicited rapid, sustained AMPK activation, mTOR pathway inhibition, and blockade of autophagic flux. Rottlerin treatment also induced rapid, sustained PERK/CHOP UPR signaling. Subsequently, high doses (>5 μM) induced loss of cell viability and cell death. Interestingly, AMPK knock-down using siRNA did not prevent rottlerin-induced mTOR inhibition, autophagy, or CHOP upregulation, suggesting that AMPK is dispensable for these responses. Moreover, CHOP genetic deletion, but not AMPK knock-down, prevented rottlerin-induced apoptosis and supported cell survival, suggesting that UPR signaling is a major modulator of cell fate in PaSC during metabolic stress. Further, short-term rottlerin treatment reduced both PaSC fibrogenic potential and IL-6 mRNA expression. In contrast, expression levels of the angiogenic factors HGF and VEGF�

Homeostatic Changes in GABA and Acetylcholine Muscarinic Receptors on GABAergic Neurons in the Mesencephalic Reticular Formation following Sleep Deprivation

PubMed Central

2017-01-01

Abstract We have examined whether GABAergic neurons in the mesencephalic reticular formation (RFMes), which are believed to inhibit the neurons in the pons that generate paradoxical sleep (PS or REMS), are submitted to homeostatic regulation under conditions of sleep deprivation (SD) by enforced waking during the day in mice. Using immunofluorescence, we investigated first, by staining for c-Fos, whether GABAergic RFMes neurons are active during SD and then, by staining for receptors, whether their activity is associated with homeostatic changes in GABAA or acetylcholine muscarinic type 2 (AChM2) receptors (Rs), which evoke inhibition. We found that a significantly greater proportion of the GABAergic neurons were positively stained for c-Fos after SD (∼27%) as compared to sleep control (SC; ∼1%) and sleep recovery (SR; ∼6%), suggesting that they were more active during waking with SD and less active or inactive during sleep with SC and SR. The density of GABAARs and AChM2Rs on the plasma membrane of the GABAergic neurons was significantly increased after SD and restored to control levels after SR. We conclude that the density of these receptors is increased on RFMes GABAergic neurons during presumed enhanced activity with SD and is restored to control levels during presumed lesser or inactivity with SR. Such increases in GABAAR and AChM2R with sleep deficits would be associated with increased susceptibility of the wake-active GABAergic neurons to inhibition from GABAergic and cholinergic sleep-active neurons and to thus permitting the onset of sleep and PS with muscle atonia. PMID:29302615

Immune and regulatory functions of neutrophils in inflammatory bone loss

PubMed Central

Hajishengallis, George; Moutsopoulos, Niki M.; Hajishengallis, Evlambia; Chavakis, Triantafyllos

2016-01-01

Although historically viewed as merely anti-microbial effectors in acute infection or injury, neutrophils are now appreciated to be functionally versatile with critical roles also in chronic inflammation. Periodontitis, a chronic inflammatory disease that destroys the tooth-supporting gums and bone, is particularly affected by alterations in neutrophil numbers or function, as revealed by observations in monogenic disorders and relevant mouse models. Besides being a significant debilitating disease and health burden in its own right, periodontitis is thus an attractive model to dissect uncharted neutrophil-associated (patho)physiological pathways. Here, we summarize recent evidence that neutrophils can contribute to inflammatory bone loss not only through the typical bystander injury dogma but intriguingly also through their absence from the affected tissue, where they normally perform important immunomodulatory functions. Moreover, we discuss recent advances in the interactions of neutrophils with the vascular endothelium and – upon extravasation – with bacteria, and how the dysregulation of these interactions leads to inflammatory tissue damage. Overall, neutrophils have both protective and destructive roles in periodontitis, as they are involved in both the maintenance of periodontal tissue homeostasis and the induction of inflammatory bone loss. This highlights the importance of developing approaches that promote or sustain a fine balance between homeostatic immunity and inflammatory pathology. PMID:26936034

Immune Response in Thyroid Cancer: Widening the Boundaries

PubMed Central

Ward, Laura Sterian

2014-01-01

The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.

PubMed

Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M

2013-04-16

Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.

Integrated analysis of HPV-mediated immune alterations in cervical cancer.

PubMed

Chen, Long; Luan, Shaohong; Xia, Baoguo; Liu, Yansheng; Gao, Yuan; Yu, Hongyan; Mu, Qingling; Zhang, Ping; Zhang, Weina; Zhang, Shengmiao; Wei, Guopeng; Yang, Min; Li, Ke

2018-05-01

Human papillomavirus (HPV) infection is the primary cause of cervical cancer. HPV-mediated immune alterations are known to play crucial roles in determining viral persistence and host cell transformation. We sought to thoroughly understand HPV-directed immune alterations in cervical cancer by exploring publically available datasets. 130 HPV positive and 7 HPV negative cervical cancer cases from The Cancer Genome Atlas were compared for differences in gene expression levels and functional enrichment. Analyses for copy number variation (CNV) and genetic mutation were conducted for differentially expressed immune genes. Kaplan-Meier analysis was performed to assess survival and relapse differences across cases with or without alterations of the identified immune signature genes. Genes up-regulated in HPV positive cervical cancer were enriched for various gene ontology terms of immune processes (P=1.05E-14~1.00E-05). Integrated analysis of the differentially expressed immune genes identified 9 genes that displayed either CNV, genetic mutation and/or gene expression changes in at least 10% of the cases of HPV positive cervical cancer. Genomic amplification may cause elevated levels of these genes in some HPV positive cases. Finally, patients with alterations in at least one of the nine signature genes overall had earlier relapse compared to those without any alterations. The altered expression of either TFRC or MMP13 may indicate poor survival for a subset of cervical cancer patients (P=1.07E-07). We identified a novel immune gene signature for HPV positive cervical cancer that is potentially associated with early relapse of cervical cancer. Copyright © 2018. Published by Elsevier Inc.

Noradrenaline and alpha-adrenergic signaling induce the hsp70 gene promoter in mollusc immune cells.

PubMed

Lacoste, A; De Cian, M C; Cueff, A; Poulet, S A

2001-10-01

Expression of heat shock proteins (hsp) is a homeostatic mechanism induced in both prokaryotic and eukaryotic cells in response to metabolic and environmental insults. A growing body of evidence suggests that in mammals, the hsp response is integrated with physiological responses through neuroendocrine signaling. In the present study, we have examined the effect of noradrenaline (NA) on the hsp70 response in mollusc immune cells. Oyster and abalone hemocytes transfected with a gene construct containing a gastropod hsp70 gene promoter linked to the luciferase reporter-gene were exposed to physiological concentrations of NA, or to various alpha- and beta-adrenoceptor agonists and antagonists. Results show that NA and alpha-adrenergic stimulations induced the expression of luciferase in transfected mollusc immunocytes. Furthermore, exposure of hemocytes to NA or to the alpha-adrenoceptor agonist phenylephrine (PE) resulted in the expression of the inducible isoform of the hsp70 protein. Pertussis toxin (PTX), the phospholipase C (PLC) inhibitor U73122, the protein kinase C (PKC) inhibitor calphostin C, the Ca(2+)-dependent PKC inhibitor Gö 6976 and the phosphatidylinositol 3-kinase (PI 3-kinase) inhibitor LY294002 blocked the PE-mediated induction of the hsp70 gene promoter. These results suggest that alpha-adrenergic signaling induces the transcriptionnal upregulation of hsp70 in mollusc hemocytes through a PTX-sensitive G-protein, PLC, Ca(2+)-dependent PKC and PI 3-kinase. Thus, a functional link exists between neuroendocrine signaling and the hsp70 response in mollusc immune cells.

Adenosine A(3) receptor agonist acts as a homeostatic regulator of bone marrow hematopoiesis.

PubMed

Hofer, Michal; Pospísil, Milan; Znojil, Vladimír; Holá, Jirina; Vacek, Antonín; Streitová, Denisa

2007-07-01

The present study was performed to define the optimum conditions of the stimulatory action of the adenosine A(3) receptor agonist, N(6)-(3-iodobenzyl)adenosine-5'-N-methyluronamide (IB-MECA), on bone marrow hematopoiesis in mice. Effects of 2-day treatment with IB-MECA given at single doses of 200nmol/kg twice daily were investigated in normal mice and in mice whose femoral bone marrow cells were either depleted or regenerating after pretreatment with the cytotoxic drug 5-fluorouracil. Morphological criteria were used to determine the proliferation state of the granulocytic and erythroid cell systems. Significant negative correlation between the control proliferation state and the increase of cell proliferation after IB-MECA treatment irrespective of the cell lineage investigated was found. The results suggest the homeostatic character of the induced stimulatory effects and the need to respect the functional state of the target tissue when investigating effects of adenosine receptor agonists under in vivo conditions.

Long-Term Homeostatic Properties Complementary to Hebbian Rules in CuPc-Based Multifunctional Memristor

NASA Astrophysics Data System (ADS)

Wang, Laiyuan; Wang, Zhiyong; Lin, Jinyi; Yang, Jie; Xie, Linghai; Yi, Mingdong; Li, Wen; Ling, Haifeng; Ou, Changjin; Huang, Wei

2016-10-01

Most simulations of neuroplasticity in memristors, which are potentially used to develop artificial synapses, are confined to the basic biological Hebbian rules. However, the simplex rules potentially can induce excessive excitation/inhibition, even collapse of neural activities, because they neglect the properties of long-term homeostasis involved in the frameworks of realistic neural networks. Here, we develop organic CuPc-based memristors of which excitatory and inhibitory conductivities can implement both Hebbian rules and homeostatic plasticity, complementary to Hebbian patterns and conductive to the long-term homeostasis. In another adaptive situation for homeostasis, in thicker samples, the overall excitement under periodic moderate stimuli tends to decrease and be recovered under intense inputs. Interestingly, the prototypes can be equipped with bio-inspired habituation and sensitization functions outperforming the conventional simplified algorithms. They mutually regulate each other to obtain the homeostasis. Therefore, we develop a novel versatile memristor with advanced synaptic homeostasis for comprehensive neural functions.

An Evolutionarily Conserved Innate Immunity Protein Interaction Network*

PubMed Central

De Arras, Lesly; Seng, Amara; Lackford, Brad; Keikhaee, Mohammad R.; Bowerman, Bruce; Freedman, Jonathan H.; Schwartz, David A.; Alper, Scott

2013-01-01

The innate immune response plays a critical role in fighting infection; however, innate immunity also can affect the pathogenesis of a variety of diseases, including sepsis, asthma, cancer, and atherosclerosis. To identify novel regulators of innate immunity, we performed comparative genomics RNA interference screens in the nematode Caenorhabditis elegans and mouse macrophages. These screens have uncovered many candidate regulators of the response to lipopolysaccharide (LPS), several of which interact physically in multiple species to form an innate immunity protein interaction network. This protein interaction network contains several proteins in the canonical LPS-responsive TLR4 pathway as well as many novel interacting proteins. Using RNAi and overexpression studies, we show that almost every gene in this network can modulate the innate immune response in mouse cell lines. We validate the importance of this network in innate immunity regulation in vivo using available mutants in C. elegans and mice. PMID:23209288

An immune clock of human pregnancy

PubMed Central

Aghaeepour, Nima; Ganio, Edward A.; Mcilwain, David; Tsai, Amy S.; Tingle, Martha; Van Gassen, Sofie; Gaudilliere, Dyani K.; Baca, Quentin; McNeil, Leslie; Okada, Robin; Ghaemi, Mohammad S.; Furman, David; Wong, Ronald J.; Winn, Virginia D.; Druzin, Maurice L.; El-Sayed, Yaser Y.; Quaintance, Cecele; Gibbs, Ronald; Darmstadt, Gary L.; Shaw, Gary M.; Stevenson, David K.; Tibshirani, Robert; Nolan, Garry P.; Lewis, David B.; Angst, Martin S.; Gaudilliere, Brice

2017-01-01

The maintenance of pregnancy relies on finely tuned immune adaptations. We demonstrate that these adaptations are precisely timed, reflecting an immune clock of pregnancy in women delivering at term. Using mass cytometry, the abundance and functional responses of all major immune cell subsets were quantified in serial blood samples collected throughout pregnancy. Cell signaling–based Elastic Net, a regularized regression method adapted from the elastic net algorithm, was developed to infer and prospectively validate a predictive model of interrelated immune events that accurately captures the chronology of pregnancy. Model components highlighted existing knowledge and revealed previously unreported biology, including a critical role for the interleukin-2–dependent STAT5ab signaling pathway in modulating T cell function during pregnancy. These findings unravel the precise timing of immunological events occurring during a term pregnancy and provide the analytical framework to identify immunological deviations implicated in pregnancy-related pathologies. PMID:28864494

Effectiveness of a citywide patient immunization navigator program on improving adolescent immunizations and preventive care visit rates.

PubMed

Szilagyi, Peter G; Humiston, Sharon G; Gallivan, Sarah; Albertin, Christina; Sandler, Martha; Blumkin, Aaron

2011-06-01

To assess the impact of a tiered patient immunization navigator intervention (immunization tracking, reminder/recall, and outreach) on improving immunization and preventive care visit rates in urban adolescents. Randomized clinical trial allocating adolescents (aged 11-15 years) to intervention vs standard of care control. Eight primary care practices. Population-based sample of adolescents (N = 7546). Immunization navigators at each practice implemented a tiered protocol: immunization tracking, telephone or mail reminder/recall, and home visits if participants remained unimmunized or behind on preventive care visits. Immunization rates at study end. Secondary outcomes were preventive care visit rates during the previous 12 months and costs. The intervention and control groups were similar at baseline for demographics (mean age, 13.5 years; 63% black, 14% white, and 23% Hispanic adolescents; and 74% receiving Medicaid), immunization rates, and preventive care visit rates. Immunization rates at the end of the study were 44.7% for the intervention group and 32.4% for the control group (adjusted risk ratio, 1.4; 95% confidence interval, 1.3-1.5); preventive care visit rates were 68.0% for the intervention group and 55.2% for the control group (1.2; 1.2-1.3). Findings were similar across practices, sexes, ages, and insurance providers. The number needed to treat for immunizations and preventive care visits was 9. The intervention cost was $3.81 per adolescent per month; the cost per additional adolescent fully vaccinated was $465, and the cost per additional adolescent receiving a preventive care visit was $417. A tiered tracking, reminder/recall, and outreach intervention improved immunization and preventive care visit rates in urban adolescents. clinicaltrials.gov Identifier: NCT00581347.

Exercise‐induced homeostatic perturbations provoked by singles tennis match play with reference to development of fatigue

PubMed Central

Mendez‐Villanueva, Alberto; Fernandez‐Fernandez, Jaime; Bishop, David

2007-01-01

This review addresses metabolic, neural, mechanical and thermal alterations during tennis match play with special focus on associations with fatigue. Several studies have provided a link between fatigue and the impairment of tennis skills proficiency. A tennis player's ability to maintain skilled on‐court performance and/or optimal muscle function during a demanding match can be compromised as a result of several homeostatic perturbations, for example hypoglycaemia, muscle damage and hyperthermia. Accordingly, an important physiological requirement to succeed at competitive level might be the player's ability to resist fatigue. However, research evidence on this topic is limited and it is unclear to what extent players experience fatigue during high‐level tennis match play and what the physiological mechanisms are that are likely to contribute to the deterioration in performance. PMID:17957005

Compensatory plasticity at an identified synapse tunes a visuomotor pathway.

PubMed

Rogers, Stephen M; Krapp, Holger G; Burrows, Malcolm; Matheson, Thomas

2007-04-25

We characterized homeostatic plasticity at an identified sensory-motor synapse in an insect, which maintains constant levels of motor drive as locusts transform from their solitarious phase to their gregarious swarming phase. The same mechanism produces behaviorally relevant changes in response timing that can be understood in the context of an animal's altered behavioral state. For individual animals of either phase, different looming objects elicited different spiking responses in a visual looming detector interneuron, descending contralateral movement detector (DCMD), yet its synaptic drive to a leg motoneuron, fast extensor tibiae (FETi), always had the same maximum amplitude. Gregarious locust DCMDs produced more action potentials and had higher firing frequencies, but individual postsynaptic potentials (PSPs) elicited in FETi were half the amplitude of those in solitarious locusts. A model suggested that this alone could not explain the similarity in overall amplitude, and we show that facilitation increased the maximum compound PSP amplitude in gregarious animals. There was the same linear relationship between times of peak DCMD firing before collision and the size/velocity of looming objects in both phases. The DCMD-FETi synapse transformed this relationship nonlinearly, such that peak amplitudes of compound PSPs occurred disproportionately earlier for smaller/faster objects. Furthermore, the peak PSP amplitude occurred earlier in gregarious than in solitarious locusts, indicating a differential tuning. Homeostatic modulation of the amplitude, together with a nonlinear synaptic transformation of timing, acted together to tune the DCMD-FETi system so that swarming gregarious locusts respond earlier to small moving objects, such as conspecifics, than solitarious locusts.

Identification and Validation of Ifit1 as an Important Innate Immune Bottleneck

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDermott, Jason E.; Vartanian, Keri B.; Mitchell, Hugh D.

The innate immune system plays important roles in a number of disparate processes. Foremost, innate immunity is a first responder to invasion by pathogens and triggers early defensive responses and recruits the adaptive immune system. The innate immune system also responds to endogenous damage signals that arise from tissue injury. Recently it has been found that innate immunity plays an important role in neuroprotection against ischemic stroke through the activation of the primary innate immune receptors, Toll-like receptors (TLRs). Using several large-scale transcriptomic data sets from mouse and mouse macrophage studies we identified targets predicted to be important in controllingmore » innate immune processes initiated by TLR activation. Targets were identified as genes with high betweenness centrality, so-called bottlenecks, in networks inferred from statistical associations between gene expression patterns. A small set of putative bottlenecks were identified in each of the data sets investigated including interferon-stimulated genes (Ifit1, Ifi47, Tgtp and Oasl2) as well as genes uncharacterized in immune responses (Axud1 and Ppp1r15a). We further validated one of these targets, Ifit1, in mouse macrophages by showing that silencing it suppresses induction of predicted downstream genes by lipopolysaccharide (LPS)-mediated TLR4 activation through an unknown direct or indirect mechanism. Our study demonstrates the utility of network analysis for identification of interesting targets related to innate immune function, and highlights that Ifit1 can exert a positive regulatory effect on downstream genes.« less

Isolation of circulating immune complexes using Raji cells. Separation of antigens from immune complexes and production of antiserum.

PubMed Central

Theofilopoulos, A N; Eisenberg, R A; Dixon, F J

1978-01-01

Raji cells were used for the isolation of complement-fixing antigen-antibody complexes from serum. Immune complexes bound to these cells were radiolabeled at the cell surface with lactoperoxidase. The complexes were then eluted from the cells with isotonic citrate buffer pH 3.2 or recovered by immunoprecipitation of cell lysates. The antigen and antibody moieties of the complexes were isolated by dissociating sucrose density gradient centrifugation or by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A variety of preformed immune complexes were successfully isolated from serum with this approach. In addition, these techniques were used to isolate and identify the antigens in immune complexes in the serum of rabbits with chronic serum sickness and rats with Moloney virus-induced sarcomas. Methods were also developed for the production of antisera against the antigenic moiety of immune complexes isolated from serum. Repeated challenge of rabbits with whole Raji cells with bound complexes or eluates from such cells resulted in antibody production against the antigens of the immune complexes, although reactivity against cellular and serum components was also elicited. Monospecific antisera against the antigens in immune complexes were produced by immunizing rabbits with the alum-precipitated antigen isolated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. These techniques may be useful in isolating antigens in immune complex-associated diseases of unknown etiology. Images PMID:659616

Global Immunizations: Health Promotion and Disease Prevention Worldwide.

PubMed

Macintosh, Janelle L B; Eden, Lacey M; Luthy, Karlen E; Schouten, Aimee E

Immunizations are one of the most important health interventions of the 20th century, yet people in many areas of the world do not receive adequate immunizations. Approximately 3 million people worldwide die every year from vaccine-preventable diseases; about half of these deaths are young children and infants. Global travel is more common; diseases that were once localized now can be found in communities around the world. Multiple barriers to immunizations have been identified. Healthcare access, cost, and perceptions of safety and trust in healthcare are factors that have depressed global immunization rates. Several global organizations have focused on addressing these barriers as part of their efforts to increase immunization rates. The Bill and Melinda Gates Foundation, The World Health Organization, and the United Nations Children's Emergency Fund each have a part of their organization that is concentrated on immunizations. Maternal child nurses worldwide can assist in increasing immunization rates. Nurses can participate in outreach programs to ease the burden of patients and families in accessing immunizations. Nurses can work with local and global organizations to make immunizations more affordable. Nurses can improve trust and knowledge about immunizations in their local communities. Nurses are a powerful influence in the struggle to increase immunization rates, which is a vital aspect of global health promotion and disease prevention.

Induction of innate immunity in control of mucosal transmission of HIV.

PubMed

Wang, Yufei; Lehner, Thomas

2011-09-01

To present evidence of the role of innate mucosal immunity and to harness this arm of immunity in protection against HIV infection. Dendritic cells, monocytes, natural killer (NK) cells and γδ T cells are critical in innate immunity, which is mediated by Toll-like receptor (TLR) and recently identified stress pathways. Complement factors, cytokines and chemokines have diverse functions usually affecting HIV infection indirectly. A novel group of innate intracellular HIV restriction factors has been identified - APOBEC3G, TRIM5α and tetherin - all of which are upregulated by type I interferons and some by vaccination and TLR agonists. Whereas innate immunity conventionally lacks memory, recent evidence suggests that some of the cells and intracellular factors may express immunological memory-like features. Innate mucosal immunity may provide early effective control of HIV transmission and replication. Some vaccines can enhance innate immune factors, such as APOBEC3G and control HIV during the eclipse period, allowing full weight of neutralizing and/or cytotoxic T cells to develop and prevent mucosal HIV infection. The next generation of vaccines should be designed to target both innate and adaptive immune memory responses.

Innate immune memory in the brain shapes neurological disease hallmarks.

PubMed

Wendeln, Ann-Christin; Degenhardt, Karoline; Kaurani, Lalit; Gertig, Michael; Ulas, Thomas; Jain, Gaurav; Wagner, Jessica; Häsler, Lisa M; Wild, Katleen; Skodras, Angelos; Blank, Thomas; Staszewski, Ori; Datta, Moumita; Centeno, Tonatiuh Pena; Capece, Vincenzo; Islam, Md Rezaul; Kerimoglu, Cemil; Staufenbiel, Matthias; Schultze, Joachim L; Beyer, Marc; Prinz, Marco; Jucker, Mathias; Fischer, André; Neher, Jonas J

2018-04-01

Innate immune memory is a vital mechanism of myeloid cell plasticity that occurs in response to environmental stimuli and alters subsequent immune responses. Two types of immunological imprinting can be distinguished-training and tolerance. These are epigenetically mediated and enhance or suppress subsequent inflammation, respectively. Whether immune memory occurs in tissue-resident macrophages in vivo and how it may affect pathology remains largely unknown. Here we demonstrate that peripherally applied inflammatory stimuli induce acute immune training and tolerance in the brain and lead to differential epigenetic reprogramming of brain-resident macrophages (microglia) that persists for at least six months. Strikingly, in a mouse model of Alzheimer's pathology, immune training exacerbates cerebral β-amyloidosis and immune tolerance alleviates it; similarly, peripheral immune stimulation modifies pathological features after stroke. Our results identify immune memory in the brain as an important modifier of neuropathology.

Convergent genetic and expression data implicate immunity in Alzheimer's disease

PubMed Central

Jones, Lesley; Lambert, Jean-Charles; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Vedernikov, Alexey; Escott-Price, Valentina; Stone, Timothy; Richards, Alexander; Bellenguez, Céline; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Gerrish, Amy; Jun, Gyungah; DeStefano, Anita L; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Jones, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letteneur, Luc; Kornhuber, Johanes; Tárraga, Lluís; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Emilsson, Valur; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Kehoe, Pat; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleὀ, Alberti; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick; Hardy, John; Naranjo, Maria Candida Deniz; Razquin, Cristina; Bosco, Paola; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Mancuso, Michelangelo; Moebus, Susanne; Mecocci, Patrizia; del Zompo, Maria; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Bullido, Maria; Panza, Francesco; Caffarra, Paolo; Nacmias, Benedetta; Gilbert, John R; Mayhaus, Manuel; Jessen, Frank; Dichgans, Martin; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alavarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee FAG; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John SK; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Pastor, Pau; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Farrer, Lindsay A; van Duijn, Cornelia M; Van Broekhoven, Christine; Ramirez, Alfredo; Schellenberg, Gerard D; Seshadri, Sudha; Amouyel, Philippe; Holmans, Peter A

2015-01-01

Background Late–onset Alzheimer's disease (AD) is heritable with 20 genes showing genome wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease we extended these genetic data in a pathway analysis. Methods The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. Results ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (p = 3.27×10-12 after multiple testing correction for pathways), regulation of endocytosis (p = 1.31×10-11), cholesterol transport (p = 2.96 × 10-9) and proteasome-ubiquitin activity (p = 1.34×10-6). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected p 0.002 – 0.05). Conclusions The immune response, regulation of endocytosis, cholesterol transport and protein ubiquitination represent prime targets for AD therapeutics. PMID:25533204

Convergent genetic and expression data implicate immunity in Alzheimer's disease.

PubMed

2015-06-01

Late-onset Alzheimer's disease (AD) is heritable with 20 genes showing genome-wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease, we extended these genetic data in a pathway analysis. The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (P = 3.27 × 10(-12) after multiple testing correction for pathways), regulation of endocytosis (P = 1.31 × 10(-11)), cholesterol transport (P = 2.96 × 10(-9)), and proteasome-ubiquitin activity (P = 1.34 × 10(-6)). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected P = .002-.05). The immune response, regulation of endocytosis, cholesterol transport, and protein ubiquitination represent prime targets for AD therapeutics. Copyright © 2015. Published by Elsevier Inc.

The ZntA-like NpunR4017 plays a key role in maintaining homeostatic levels of zinc in Nostoc punctiforme.

PubMed

Hudek, L; Bräu, L; Michalczyk, A A; Neilan, B A; Meeks, J C; Ackland, M L

2015-12-01

Analysis of cellular response to zinc exposure provides insights into how organisms maintain homeostatic levels of zinc that are essential, while avoiding potentially toxic cytosolic levels. Using the cyanobacterium Nostoc punctiforme as a model, qRT-PCR analyses established a profile of the changes in relative mRNA levels of the ZntA-like zinc efflux transporter NpunR4017 in response to extracellular zinc. In cells treated with 18 μM of zinc for 1 h, NpunR4017 mRNA levels increased by up to 1300 % above basal levels. The accumulation and retention of radiolabelled (65)Zn by NpunR4107-deficient and overexpressing strains were compared to wild-type levels. Disruption of NpunR4017 resulted in a significant increase in zinc accumulation up to 24 % greater than the wild type, while cells overexpressing NpunR4107 accumulated 22 % less than the wild type. Accumulation of (65)Zn in ZntA(-) Escherichia coli overexpressing NpunR4017 was reduced by up to 21 %, indicating the capacity for NpunR4017 to compensate for the loss of ZntA. These findings establish the newly identified NpunR4017 as a zinc efflux transporter and a key transporter for maintaining zinc homeostasis in N. punctiforme.

Immunization safety in US print media, 1995-2005.

PubMed

Hussain, Hamidah; Omer, Saad B; Manganello, Jennifer A; Kromm, Elizabeth Edsall; Carter, Terrell C; Kan, Lilly; Stokley, Shannon; Halsey, Neal A; Salmon, Daniel A

2011-05-01

To identify and describe vaccine safety in US newspaper articles. Articles (1147) from 44 states and Washington, DC, between January 1, 1995, and July 15, 2005, were identified by using the search terms "immunize or vaccine" and "adverse events or safety or exemption or danger or risk or damage or injury or side effect" and were coded by using a standardized data-collection instrument. The mean number of vaccine-safety articles per state was 26. Six (not mutually exclusive) topics were identified: vaccine-safety concerns (46%); vaccine policy (44%); vaccines are safe (20%); immunizations are required (10%); immunizations are not required (8%); and state/school exemption (8%). Three spikes in the number of newspaper articles about vaccine-safety issues were observed: in 1999 regarding rotavirus vaccine and in 2002 and 2003 regarding smallpox vaccine. Excluding articles that referred to rotavirus and smallpox vaccines, 37% of the articles had a negative take-home message. Ongoing monitoring of news on vaccine safety may help the content and framing of vaccine-safety messages.

Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism

PubMed Central

Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang

2013-01-01

Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972

Ageing and the immune system: focus on macrophages.

PubMed

Linehan, E; Fitzgerald, D C

2015-03-01

A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.

Single-cell transcriptome analysis of fish immune cells provides insight into the evolution of vertebrate immune cell types

PubMed Central

Ferreira, Lauren; Macaulay, Iain C.; Stubbington, Michael J.T.

2017-01-01

The immune system of vertebrate species consists of many different cell types that have distinct functional roles and are subject to different evolutionary pressures. Here, we first analyzed conservation of genes specific for all major immune cell types in human and mouse. Our results revealed higher gene turnover and faster evolution of trans-membrane proteins in NK cells compared with other immune cell types, and especially T cells, but similar conservation of nuclear and cytoplasmic protein coding genes. To validate these findings in a distant vertebrate species, we used single-cell RNA sequencing of lck:GFP cells in zebrafish and obtained the first transcriptome of specific immune cell types in a nonmammalian species. Unsupervised clustering and single-cell TCR locus reconstruction identified three cell populations, T cells, a novel type of NK-like cells, and a smaller population of myeloid-like cells. Differential expression analysis uncovered new immune-cell–specific genes, including novel immunoglobulin-like receptors, and neofunctionalization of recently duplicated paralogs. Evolutionary analyses confirmed the higher gene turnover of trans-membrane proteins in NK cells compared with T cells in fish species, suggesting that this is a general property of immune cell types across all vertebrates. PMID:28087841

Mining the human gut microbiota for effector strains that shape the immune system

PubMed Central

Ahern, Philip P.; Faith, Jeremiah J.; Gordon, Jeffrey I.

2014-01-01

Summary The gut microbiota co-develops with the immune system beginning at birth. Mining the microbiota for bacterial strains responsible for shaping the structure and dynamic operations of the innate and adaptive arms of the immune system represents a formidable combinatorial problem but one that needs to be overcome to advance mechanistic understanding of microbial community-immune system co-regulation, and in order to develop new diagnostic and therapeutic approaches that promote health. Here, we discuss a scalable, less biased approach for identifying effector strains in complex microbial communities that impact immune function. The approach begins by identifying uncultured human fecal microbiota samples that transmit immune phenotypes to germ-free mice. Clonally-arrayed sequenced collections of bacterial strains are constructed from representative donor microbiota. If the collection transmits phenotypes, effector strains are identified by testing randomly generated subsets with overlapping membership in individually-housed germ-free animals. Detailed mechanistic studies of effector strain-host interactions can then be performed. PMID:24950201

Immunization, urbanization and slums - a systematic review of factors and interventions.

PubMed

Crocker-Buque, Tim; Mindra, Godwin; Duncan, Richard; Mounier-Jack, Sandra

2017-06-08

In 2014, over half (54%) of the world's population lived in urban areas and this proportion will increase to 66% by 2050. This urbanizing trend has been accompanied by an increasing number of people living in urban poor communities and slums. Lower immunization coverage is found in poorer urban dwellers in many contexts. This study aims to identify factors associated with immunization coverage in poor urban areas and slums, and to identify interventions to improve coverage. We conducted a systematic review, searching Medline, Embase, Global Health, CINAHL, Web of Science and The Cochrane Database with broad search terms for studies published between 2000 and 2016. Of 4872 unique articles, 327 abstracts were screened, leading to 63 included studies: 44 considering factors and 20 evaluating interventions (one in both categories) in 16 low or middle-income countries. A wide range of socio-economic characteristics were associated with coverage in different contexts. Recent rural-urban migration had a universally negative effect. Parents commonly reported lack of awareness of immunization importance and difficulty accessing services as reasons for under-immunization of their children. Physical distance to clinics and aspects of service quality also impacted uptake. We found evidence of effectiveness for interventions involving multiple components, especially if they have been designed with community involvement. Outreach programmes were effective where physical distance was identified as a barrier. Some evidence was found for the effective use of SMS (text) messaging services, community-based education programmes and financial incentives, which warrant further evaluation. No interventions were identified that provided services to migrants from rural areas. Different factors affect immunization coverage in different urban poor and slum contexts. Immunization services should be designed in collaboration with slum-dwelling communities, considering the local context

Immunity to tumour antigens.

PubMed

Li, Geng; Ali, Selman A; McArdle, Stephanie E B; Mian, Shahid; Ahmad, Murrium; Miles, Amanda; Rees, Robert C

2005-01-01

During the last decade, a large number of human tumour antigens have been identified. These antigens are classified as tumour-specific shared antigens, tissue-specific differentiation antigens, overexpressed antigens, tumour antigens resulting from mutations, viral antigens and fusion proteins. Antigens recognised by effectors of immune system are potential targets for antigen-specific cancer immunotherapy. However, most tumour antigens are self-proteins and are generally of low immunogenicity and the immune response elicited towards these tumour antigens is not always effective. Strategies to induce and enhance the tumour antigen-specific response are needed. This review will summarise the approaches to discovery of tumour antigens, the current status of tumour antigens, and their potential application to cancer treatment.

Immune Antibodies and Helminth Products Drive CXCR2-Dependent Macrophage-Myofibroblast Crosstalk to Promote Intestinal Repair

PubMed Central

Esser-von Bieren, Julia; Volpe, Beatrice; Sutherland, Duncan B.; Bürgi, Jérôme; Verbeek, J. Sjef; Marsland, Benjamin J.; Urban, Joseph F.; Harris, Nicola L.

2015-01-01

Helminth parasites can cause considerable damage when migrating through host tissues, thus making rapid tissue repair imperative to prevent bleeding and bacterial dissemination particularly during enteric infection. However, how protective type 2 responses targeted against these tissue-disruptive multicellular parasites might contribute to homeostatic wound healing in the intestine has remained unclear. Here, we observed that mice lacking antibodies (Aid-/-) or activating Fc receptors (Fcrg-/-) displayed impaired intestinal repair following infection with the murine helminth Heligmosomoides polygyrus bakeri (Hpb), whilst transfer of immune serum could partially restore chemokine production and rescue wound healing in Aid-/- mice. Impaired healing was associated with a reduced expression of CXCR2 ligands (CXCL2/3) by macrophages (MΦ) and myofibroblasts (MF) within intestinal lesions. Whilst antibodies and helminths together triggered CXCL2 production by MΦ in vitro via surface FcR engagement, chemokine secretion by intestinal MF was elicited by helminths directly via Fcrg-chain/dectin2 signaling. Blockade of CXCR2 during Hpb challenge infection reproduced the delayed wound repair observed in helminth infected Aid-/- and Fcrg-/- mice. Finally, conditioned media from human MΦ stimulated with infective larvae of the helminth Ascaris suum together with immune serum, promoted CXCR2-dependent scratch wound closure by human MF in vitro. Collectively our findings suggest that helminths and antibodies instruct a chemokine driven MΦ-MF crosstalk to promote intestinal repair, a capacity that may be harnessed in clinical settings of impaired wound healing. PMID:25806513

Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

PubMed

Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

2015-06-23

F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

U.S. Immunization program adult immunization activities and resources.

PubMed

Woods, LaDora O; Bridges, Carolyn B; Graitcer, Samuel B; Lamont, Brock

2016-04-02

Adults are recommended to receive vaccines based on their age, medical conditions, prior vaccinations, occupation and lifestyle. However, adult immunization coverage is low in the United States and lags substantially below Healthy People 2020 goals. To assess activities and resources designated for adult immunization programs by state and local health department immunization programs in the United States, we analyzed 2012 and 2013 data from the Centers for Disease Control and Prevention's (CDC) Program Annual Reports and Progress Assessments (PAPA) survey of CDC-funded immunization programs. Fifty-six of 64 funded US immunization programs' responses were included in the analysis. Eighty-two percent of (n = 46) programs reported having a designated adult immunization coordinator in 2012 and 73% (n = 41) in 2013. Of the 46 coordinators reported in 2012, 30% (n = 14) spent more than 50% of their time on adult immunization activities, and only 24% (n = 10) of the 41 adult coordinators in 2013 spent more than 50% of their time on adult immunization activities. In 2012, 23% (n = 13) of the 56 programs had a separate immunization coalition for adults and 68% (n = 38) included adult issues in their overall immunization program coalition. In 2013, 25% (n = 14) had a separate adult immunization coalition while 57% (n = 32) incorporated adult immunizations into their overall immunization program coalition. The results indicate substantial variation across the US in public health infrastructure to support adult immunizations. Continued assessment of adult immunization resources and activities will be important in improving adult immunization coverage levels though program support. With many programs having limited resources dedicated to improving adult immunization rates in the in US, efforts by the health departments to collaborate with providers and other partners in their jurisdictions to increase awareness, increase the use of proven strategies to improve vaccination of

U.S. Immunization program adult immunization activities and resources

PubMed Central

Woods, LaDora O.; Bridges, Carolyn B.; Graitcer, Samuel B.; Lamont, Brock

2016-01-01

ABSTRACT Adults are recommended to receive vaccines based on their age, medical conditions, prior vaccinations, occupation and lifestyle. However, adult immunization coverage is low in the United States and lags substantially below Healthy People 2020 goals. To assess activities and resources designated for adult immunization programs by state and local health department immunization programs in the United States, we analyzed 2012 and 2013 data from the Centers for Disease Control and Prevention's (CDC) Program Annual Reports and Progress Assessments (PAPA) survey of CDC-funded immunization programs. Fifty-six of 64 funded US immunization programs' responses were included in the analysis. Eighty-two percent of (n = 46) programs reported having a designated adult immunization coordinator in 2012 and 73% (n = 41) in 2013. Of the 46 coordinators reported in 2012, 30% (n = 14) spent more than 50% of their time on adult immunization activities, and only 24% (n = 10) of the 41 adult coordinators in 2013 spent more than 50% of their time on adult immunization activities. In 2012, 23% (n = 13) of the 56 programs had a separate immunization coalition for adults and 68% (n = 38) included adult issues in their overall immunization program coalition. In 2013, 25% (n = 14) had a separate adult immunization coalition while 57% (n = 32) incorporated adult immunizations into their overall immunization program coalition. The results indicate substantial variation across the US in public health infrastructure to support adult immunizations. Continued assessment of adult immunization resources and activities will be important in improving adult immunization coverage levels though program support. With many programs having limited resources dedicated to improving adult immunization rates in the in US, efforts by the health departments to collaborate with providers and other partners in their jurisdictions to increase awareness, increase the use of proven strategies to improve

Homeostatic Changes in GABA and Acetylcholine Muscarinic Receptors on GABAergic Neurons in the Mesencephalic Reticular Formation following Sleep Deprivation.

PubMed

Toossi, Hanieh; Del Cid-Pellitero, Esther; Jones, Barbara E

2017-01-01

We have examined whether GABAergic neurons in the mesencephalic reticular formation (RFMes), which are believed to inhibit the neurons in the pons that generate paradoxical sleep (PS or REMS), are submitted to homeostatic regulation under conditions of sleep deprivation (SD) by enforced waking during the day in mice. Using immunofluorescence, we investigated first, by staining for c-Fos, whether GABAergic RFMes neurons are active during SD and then, by staining for receptors, whether their activity is associated with homeostatic changes in GABA A or acetylcholine muscarinic type 2 (AChM2) receptors (Rs), which evoke inhibition. We found that a significantly greater proportion of the GABAergic neurons were positively stained for c-Fos after SD (∼27%) as compared to sleep control (SC; ∼1%) and sleep recovery (SR; ∼6%), suggesting that they were more active during waking with SD and less active or inactive during sleep with SC and SR. The density of GABA A Rs and AChM2Rs on the plasma membrane of the GABAergic neurons was significantly increased after SD and restored to control levels after SR. We conclude that the density of these receptors is increased on RFMes GABAergic neurons during presumed enhanced activity with SD and is restored to control levels during presumed lesser or inactivity with SR. Such increases in GABA A R and AChM2R with sleep deficits would be associated with increased susceptibility of the wake-active GABAergic neurons to inhibition from GABAergic and cholinergic sleep-active neurons and to thus permitting the onset of sleep and PS with muscle atonia.

A mathematical model of cancer stem cell driven tumor initiation: implications of niche size and loss of homeostatic regulatory mechanisms.

PubMed

Gentry, Sara N; Jackson, Trachette L

2013-01-01

Hierarchical organized tissue structures, with stem cell driven cell differentiation, are critical to the homeostatic maintenance of most tissues, and this underlying cellular architecture is potentially a critical player in the development of a many cancers. Here, we develop a mathematical model of mutation acquisition to investigate how deregulation of the mechanisms preserving stem cell homeostasis contributes to tumor initiation. A novel feature of the model is the inclusion of both extrinsic and intrinsic chemical signaling and interaction with the niche to control stem cell self-renewal. We use the model to simulate the effects of a variety of types and sequences of mutations and then compare and contrast all mutation pathways in order to determine which ones generate cancer cells fastest. The model predicts that the sequence in which mutations occur significantly affects the pace of tumorigenesis. In addition, tumor composition varies for different mutation pathways, so that some sequences generate tumors that are dominated by cancerous cells with all possible mutations, while others are primarily comprised of cells that more closely resemble normal cells with only one or two mutations. We are also able to show that, under certain circumstances, healthy stem cells diminish due to the displacement by mutated cells that have a competitive advantage in the niche. Finally, in the event that all homeostatic regulation is lost, exponential growth of the cancer population occurs in addition to the depletion of normal cells. This model helps to advance our understanding of how mutation acquisition affects mechanisms that influence cell-fate decisions and leads to the initiation of cancers.

The role of the immune system in kidney disease.

PubMed

Tecklenborg, J; Clayton, D; Siebert, S; Coley, S M

2018-05-01

The immune system and the kidneys are closely linked. In health the kidneys contribute to immune homeostasis, while components of the immune system mediate many acute forms of renal disease and play a central role in progression of chronic kidney disease. A dysregulated immune system can have either direct or indirect renal effects. Direct immune-mediated kidney diseases are usually a consequence of autoantibodies directed against a constituent renal antigen, such as collagen IV in anti-glomerular basement membrane disease. Indirect immune-mediated renal disease often follows systemic autoimmunity with immune complex formation, but can also be due to uncontrolled activation of the complement pathways. Although the range of mechanisms of immune dysregulation leading to renal disease is broad, the pathways leading to injury are similar. Loss of immune homeostasis in renal disease results in perpetual immune cell recruitment and worsening damage to the kidney. Uncoordinated attempts at tissue repair, after immune-mediated disease or non-immune mediated injury, result in fibrosis of structures important for renal function, leading eventually to kidney failure. As renal disease often manifests clinically only when substantial damage has already occurred, new diagnostic methods and indeed treatments must be identified to inhibit further progression and promote appropriate tissue repair. Studying cases in which immune homeostasis is re-established may reveal new treatment possibilities. © 2018 British Society for Immunology.

Country Immunization Information System Assessments - Kenya, 2015 and Ghana, 2016.

PubMed

Scott, Colleen; Clarke, Kristie E N; Grevendonk, Jan; Dolan, Samantha B; Ahmed, Hussein Osman; Kamau, Peter; Ademba, Peter Aswani; Osadebe, Lynda; Bonsu, George; Opare, Joseph; Diamenu, Stanley; Amenuvegbe, Gregory; Quaye, Pamela; Osei-Sarpong, Fred; Abotsi, Francis; Ankrah, Joseph Dwomor; MacNeil, Adam

2017-11-10

The collection, analysis, and use of data to measure and improve immunization program performance are priorities for the World Health Organization (WHO), global partners, and national immunization programs (NIPs). High quality data are essential for evidence-based decision-making to support successful NIPs. Consistent recording and reporting practices, optimal access to and use of health information systems, and rigorous interpretation and use of data for decision-making are characteristics of high-quality immunization information systems. In 2015 and 2016, immunization information system assessments (IISAs) were conducted in Kenya and Ghana using a new WHO and CDC assessment methodology designed to identify root causes of immunization data quality problems and facilitate development of plans for improvement. Data quality challenges common to both countries included low confidence in facility-level target population data (Kenya = 50%, Ghana = 53%) and poor data concordance between child registers and facility tally sheets (Kenya = 0%, Ghana = 3%). In Kenya, systemic challenges included limited supportive supervision and lack of resources to access electronic reporting systems; in Ghana, challenges included a poorly defined subdistrict administrative level. Data quality improvement plans (DQIPs) based on assessment findings are being implemented in both countries. IISAs can help countries identify and address root causes of poor immunization data to provide a stronger evidence base for future investments in immunization programs.

Immunization Information System and Informatics to Promote Immunizations: Perspective From Minnesota Immunization Information Connection.

PubMed

Muscoplat, Miriam Halstead; Rajamani, Sripriya

2017-01-01

The vision for management of immunization information is availability of real-time consolidated data and services for all ages, to clinical, public health, and other stakeholders. This is being executed through Immunization Information Systems (IISs), which are population-based and confidential computerized systems present in most US states and territories. Immunization Information Systems offer many functionalities, such as immunization assessment reports, client follow-up, reminder/recall feature, vaccine management tools, state-supplied vaccine ordering, comprehensive immunization history, clinical decision support/vaccine forecasting and recommendations, data processing, and data exchange. This perspective article will present various informatics tools in an IIS, in the context of the Minnesota Immunization Information Connection.

Barriers to immunization among children of migrant workers from Myanmar living in Tak province, Thailand.

PubMed Central

Plugge, Emma; Suwanjatuporn, Suporn; Sombatrungjaroen, Suteera; Nosten, François

2011-01-01

Abstract Problem Immunization is a cost-effective means of improving child survival but implementation of programmes in low- and middle-income countries is variable. Children of migrants are less likely to be immunized. Approach The qualitative study aimed to identify barriers to the successful implementation of migrant immunization programmes in Tak province, Thailand. We ran a total of 53 focus groups involving 371 participants in three sites. Local setting Tak province in Thailand borders Myanmar and has an estimated 200 000 migrants from Myanmar. Vaccine-preventable diseases are a documented cause of morbidity in this population but there is no systematic or coordinated immunization programme in the area. Relevant changes As a result of the findings, the subsequent immunization campaign targeted children in school to overcome those barriers of distance to immunization services, fear of arrest, not remembering immunization appointments, and the disruption of parental work. The campaigns also included immunization education for both parents and teachers. Lessons learnt Migrant parents identified similar barriers to accessing childhood immunization programmes as migrant populations elsewhere in the world, although a unique barrier identified by parents from Myanmar was “fear of arrest”. The subsequent school-based strategy to overcome these barriers appears to be effective. PMID:21734767

How do plants achieve immunity? Defence without specialized immune cells.

PubMed

Spoel, Steven H; Dong, Xinnian

2012-01-25

Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.

Action on low immunization uptake.

PubMed

Azubuike, M C; Ehiri, J E

1998-01-01

Despite a number of initiatives and campaigns over the years, immunization coverage in most parts of Nigeria remains low. That low coverage contributes to high morbidity and mortality levels among children. Poor transport, an ineffective cold chain, shortages of trained manpower, and inadequate community support and involvement are some of the factors which explain the underutilization of the immunization service. Aba is a city of approximately 500,000 people in eastern Nigeria in which the majority of inhabitants are traders. Aba's primary health care committee decided that immunization centers should be established in or near main trading areas to accommodate traders who did not want to leave their goods in order to take their children to primary care facilities for immunization. Traders' representatives helped to identify 8 suitable locations for vaccination sites in 3 shopping centers, the local authority provided financial and political support, and the state government gave technical and logistical assistance. The project began in September 1990 and was publicized through the traders' networks, which also helped to mobilize the relevant resources. Since many trading families were reached for the first time at the special centers, immunization coverage improved significantly for the 6 vaccine-preventable childhood diseases. Moreover, the project gave health workers the opportunity to deliver other services and counseling on matters of public health importance.

Orchestration of Angiogenesis by Immune Cells

PubMed Central

Bruno, Antonino; Pagani, Arianna; Pulze, Laura; Albini, Adriana; Dallaglio, Katiuscia; Noonan, Douglas M.; Mortara, Lorenzo

2014-01-01

It is widely accepted that the tumor microenvironment (TUMIC) plays a major role in cancer and is indispensable for tumor progression. The TUMIC involves many “players” going well beyond the malignant-transformed cells, including stromal, immune, and endothelial cells (ECs). The non-malignant cells can acquire tumor-promoting functions during carcinogenesis. In particular, these cells can “orchestrate” the “symphony” of the angiogenic switch, permitting the creation of new blood vessels that allows rapid expansion and progression toward malignancy. Considerable attention within the context of tumor angiogenesis should focus not only on the ECs, representing a fundamental unit, but also on immune cells and on the inflammatory tumor infiltrate. Immune cells infiltrating tumors typically show a tumor-induced polarization associated with attenuation of anti-tumor functions and generation of pro-tumor activities, among these angiogenesis. Here, we propose a scenario suggesting that the angiogenic switch is an immune switch arising from the pro-angiogenic polarization of immune cells. This view links immunity, inflammation, and angiogenesis to tumor progression. Here, we review the data in the literature and seek to identify the “conductors” of this “orchestra.” We also suggest that interrupting the immune → inflammation → angiogenesis → tumor progression process can delay or prevent tumor insurgence and malignant disease. PMID:25072019

Residual right portal branch flow after first-step ALPPS: artifact or homeostatic response?

PubMed

De Carlis, Luciano; Sguinzi, Raffaella; De Carlis, Riccardo; Di Sandro, Stefano; Mangoni, Jacopo; Aseni, Paolo; Giacomoni, Alessandro; Vanzulli, Angelo

2014-09-01

Mutual interactions between portal vein and hepatic artery can be documented during hepatobiliary surgery. Associating Liver Partition and Portal Vein Ligation for Staged Hepatectomy (ALPPS) is a recently introduced surgical technique which can also represent a unique living human model to investigate intrahepatic blood circulation. We report three consecutive cases in which a residual right portal branch flow was clearly detectable after first-step ALPPS, and try to further investigate this unexpected finding with intraoperative clamping tests. Every patient was evaluated with CT scan 7 days after first-step ALPPS and Intraoperative Doppler Ultrasonography (IOUS) at both steps of the procedure. In every patient, CT scan and second-step IOUS demonstrated a clear hepatopetal flow distally to the divided right portal branch. The flow was present after right biliary duct clamping and stopped after right total hilar clamping as well as after right hepatic artery occlusion. Neither cross-portal circulation between the two hemilivers nor trans-sinusoidal backflow from the hepatic veins can explain these findings, which are rather consistent with a refilling of the occluded portal branch through the opening of intrahepatic arterioportal shunts (APS). APS could represent the simplest homeostatic mechanism that regulate intrahepatic blood flow.

Helminth Infections Decrease Host Susceptibility to Immune-Mediated Diseases

PubMed Central

Weinstock, Joel V; Elliott, David E.

2014-01-01

Helminthic infection has become rare in highly industrialized nations. Concurrent with the decline in helminthic infection is an increase in prevalence of inflammatory disease. Removal of helminths from our environment and their powerful effects on host immunity may have contributed to this increase. Several different helminth species can abrogate disease in murine models of inflammatory bowel disease, type 1 diabetes, multiple sclerosis and other conditions. Helminths evoke immune regulatory pathways often involving dendritic cells, Tregs and macrophages that help control disease. Cytokines such as IL4, IL10 and TGFβ have a role. Notable is helminthic modulatory effect on innate immunity, which impedes development of aberrant adaptive immunity. Investigators are identifying key helminth-derived immune modulatory molecules that may have therapeutic utility in the control of inflammatory disease. PMID:25240019

Antifibrotic Therapy in Simian Immunodeficiency Virus Infection Preserves CD4+ T-Cell Populations and Improves Immune Reconstitution With Antiretroviral Therapy

PubMed Central

Estes, Jacob D.; Reilly, Cavan; Trubey, Charles M.; Fletcher, Courtney V.; Cory, Theodore J.; Piatak, Michael; Russ, Samuel; Anderson, Jodi; Reimann, Thomas G.; Star, Robert; Smith, Anthony; Tracy, Russell P.; Berglund, Anna; Schmidt, Thomas; Coalter, Vicky; Chertova, Elena; Smedley, Jeremy; Haase, Ashley T.; Lifson, Jeffrey D.; Schacker, Timothy W.

2015-01-01

Even with prolonged antiretroviral therapy (ART), many human immunodeficiency virus-infected individuals have <500 CD4+ T cells/µL, and CD4+ T cells in lymphoid tissues remain severely depleted, due in part to fibrosis of the paracortical T-cell zone (TZ) that impairs homeostatic mechanisms required for T-cell survival. We therefore used antifibrotic therapy in simian immunodeficiency virus-infected rhesus macaques to determine whether decreased TZ fibrosis would improve reconstitution of peripheral and lymphoid CD4+ T cells. Treatment with the antifibrotic drug pirfenidone preserved TZ architecture and was associated with significantly larger populations of CD4+ T cells in peripheral blood and lymphoid tissues. Combining pirfenidone with an ART regimen was associated with greater preservation of CD4+ T cells than ART alone and was also associated with higher pirfenidone concentrations. These data support a potential role for antifibrotic drug treatment as adjunctive therapy with ART to improve immune reconstitution. PMID:25246534

miR-34 Modulates Innate Immunity and Ecdysone Signaling in Drosophila.

PubMed

Xiong, Xiao-Peng; Kurthkoti, Krishna; Chang, Kung-Yen; Li, Jian-Liang; Ren, Xingjie; Ni, Jian-Quan; Rana, Tariq M; Zhou, Rui

2016-11-01

microRNAs are endogenous small regulatory RNAs that modulate myriad biological processes by repressing target gene expression in a sequence-specific manner. Here we show that the conserved miRNA miR-34 regulates innate immunity and ecdysone signaling in Drosophila. miR-34 over-expression activates antibacterial innate immunity signaling both in cultured cells and in vivo, and flies over-expressing miR-34 display improved survival and pathogen clearance upon Gram-negative bacterial infection; whereas miR-34 knockout animals are defective in antibacterial defense. In particular, miR-34 achieves its immune-stimulatory function, at least in part, by repressing the two novel target genes Dlg1 and Eip75B. In addition, our study reveals a mutual repression between miR-34 expression and ecdysone signaling, and identifies miR-34 as a node in the intricate interplay between ecdysone signaling and innate immunity. Lastly, we identify cis-regulatory genomic elements and trans-acting transcription factors required for optimal ecdysone-mediated repression of miR-34. Taken together, our study enriches the repertoire of immune-modulating miRNAs in animals, and provides new insights into the interplay between steroid hormone signaling and innate immunity.

Immunization Attitudes and Beliefs Among Parents: Beyond a Dichotomous Perspective

ERIC Educational Resources Information Center

Gust, Deborah; Brown, Cedric; Sheedy, Kristine; Hibbs, Beth; Weaver, Donna; Nowak, Glen

2005-01-01

Objective: To better understand differences among parents in their attitudes, beliefs, and behaviors regarding childhood immunizations and health-related issues. Methods: Forty-four survey variables assessing attitudes and beliefs about immunizations and health were analyzed. The K-means clusters technique was used to identify homogeneous groups…

Single-cell transcriptome analysis of fish immune cells provides insight into the evolution of vertebrate immune cell types.

PubMed

Carmona, Santiago J; Teichmann, Sarah A; Ferreira, Lauren; Macaulay, Iain C; Stubbington, Michael J T; Cvejic, Ana; Gfeller, David

2017-03-01

The immune system of vertebrate species consists of many different cell types that have distinct functional roles and are subject to different evolutionary pressures. Here, we first analyzed conservation of genes specific for all major immune cell types in human and mouse. Our results revealed higher gene turnover and faster evolution of trans -membrane proteins in NK cells compared with other immune cell types, and especially T cells, but similar conservation of nuclear and cytoplasmic protein coding genes. To validate these findings in a distant vertebrate species, we used single-cell RNA sequencing of lck:GFP cells in zebrafish and obtained the first transcriptome of specific immune cell types in a nonmammalian species. Unsupervised clustering and single-cell TCR locus reconstruction identified three cell populations, T cells, a novel type of NK-like cells, and a smaller population of myeloid-like cells. Differential expression analysis uncovered new immune-cell-specific genes, including novel immunoglobulin-like receptors, and neofunctionalization of recently duplicated paralogs. Evolutionary analyses confirmed the higher gene turnover of trans -membrane proteins in NK cells compared with T cells in fish species, suggesting that this is a general property of immune cell types across all vertebrates. © 2017 Carmona et al.; Published by Cold Spring Harbor Laboratory Press.

Immune Cell Metabolism in Systemic Lupus Erythematosus.

PubMed

Choi, Seung-Chul; Titov, Anton A; Sivakumar, Ramya; Li, Wei; Morel, Laurence

2016-11-01

Cellular metabolism represents a newly identified checkpoint of effector functions in the immune system. A solid body of work has characterized the metabolic requirements of normal T cells during activation and differentiation into polarized effector subsets. Similar studies have been initiated to characterize the metabolic requirements for B cells and myeloid cells. Only a few studies though have characterized the metabolism of immune cells in the context of autoimmune diseases. Here, we review what is known on the altered metabolic patterns of CD4 + T cells, B cells, and myeloid cells in lupus patients and lupus-prone mice and how they contribute to lupus pathogenesis. We also discuss how defects in immune metabolism in lupus can be targeted therapeutically.

Pathogenesis and treatment of immune-mediated neuropathies.

PubMed

Lehmann, Helmar C; Meyer Zu Horste, Gerd; Kieseier, Bernd C; Hartung, Hans-Peter

2009-07-01

Immune-mediated neuropathies represent a heterogeneous spectrum of peripheral nerve disorders that can be classified according to time course, predominant involvement of motor/sensory fibers, distribution of deficits and paraclinical parameters such as electrophysiology and serum antibodies. In the last few years, significant advances have been achieved in elucidating underlying pathomechanisms, which made it possible to identify potential therapeutic targets. In this review, we discuss the latest development in pathogenesis and treatment of immune-mediated neuropathies.

Improving immunization in Afghanistan: results from a cross-sectional community-based survey to assess routine immunization coverage.

PubMed

Mugali, Raveesha R; Mansoor, Farooq; Parwiz, Sardar; Ahmad, Fazil; Safi, Najibullah; Higgins-Steele, Ariel; Varkey, Sherin

2017-04-04

Despite progress in recent years, Afghanistan is lagging behind in realizing the full potential of immunization. The country is still endemic for polio transmission and measles outbreaks continue to occur. In spite of significant reductions over the past decade, the mortality rate of children under 5 years of age continues to remain high at 91 per 1000 live births. The study was a descriptive community-based cross sectional household survey. The survey aimed to estimate the levels of immunization coverage at national and province levels. Specific objectives are to: establish valid baseline information to monitor progress of the immunization program; identify reasons why children are not immunized; and make recommendations to enhance access and quality of immunization services in Afghanistan. The survey was carried out in all 34 provinces of the country, with a sample of 6125 mothers of children aged 12-23 months. Nationally, 51% of children participating in the survey received all doses of each antigen irrespective of the recommended date of immunization or recommended interval between doses. About 31% of children were found to be partially vaccinated. Reasons for partial vaccination included: place to vaccinate child too far (23%), not aware of the need of vaccination (17%), no faith in vaccination (16%), mother was too busy (15%), and fear of side effects (11%). The innovative mechanism of contracting out delivery of primary health care services in Afghanistan, including immunization, to non-governmental organizations is showing some positive results in quickly increasing coverage of essential interventions, including routine immunization. Much ground still needs to be covered with proper planning and management of resources in order to improve the immunization coverage in Afghanistan and increase survival and health status of its children.

Private provider participation in statewide immunization registries

PubMed Central

Clark, Sarah J; Cowan, Anne E; Bartlett, Diana L

2006-01-01

Background Population-based registries have been promoted as an effective method to improve childhood immunization rates, yet rates of registry participation in the private sector are low. We sought to describe, through a national overview, the perspectives of childhood immunization providers in private practice regarding factors associated with participation or non-participation in immunization registries. Methods Two mailed surveys, one for 264 private practices identified as registry non-participants and the other for 971 identified as registry participants, from 15 of the 31 states with population-based statewide immunization registries. Frequency distributions were calculated separately for non-participants and participants regarding the physician-reported factors that influenced decisions related to registry participation. Pearson chi-square tests of independence were used to assess associations among categorical variables. Results Overall response rate was 62% (N = 756). Among non-participants, easy access to records of vaccines provided at other sites (N = 101, 68%) and printable immunization records (N = 82, 55%) were most often cited as "very important" potential benefits of a registry, while the most commonly cited barriers to participation were too much cost/staff time (N = 36, 38%) and that the practice has its own system for recording and monitoring immunizations (N = 35, 37%). Among registry participants, most reported using the registry to input data on vaccines administered (N = 326, 87%) and to review immunization records of individual patients (N = 302, 81%). A minority reported using it to assess their practice's immunization coverage (N = 110, 29%) or generate reminder/recall notices (N = 54, 14%). Few participants reported experiencing "significant" problems with the registry; the most often cited was cost/staff time to use the registry (N = 71, 20%). Conclusion Most registry participants report active participation with few problems. The

Health care worker influenza immunization rates: the missing pieces of the puzzle.

PubMed

Quach, Susan; Pereira, Jennifer A; Heidebrecht, Christine L; Kwong, Jeffrey C; Guay, Maryse; Crowe, Lois; Quan, Sherman; Bettinger, Julie A

2013-08-01

Immunization rates are used to assess the level of protection against influenza, but limited data exist on how such rates are measured in health care organizations. We conducted key informant interviews with campaign planners to learn about processes for collecting immunization data, including barriers and facilitating factors for measuring and reporting rates. We conducted telephone interviews with 23 influenza immunization program planners across Canada working in 7 acute care hospitals, 6 continuing care facilities, and 8 public health organizations in 2012. We used content analysis to examine the interview data. The methods used to collect immunization data varied by the size and type of health care organization. Immunization data from different personnel groups were included in immunization rate calculations depending on the local public health reporting requirements and the organization's size. Challenges associated with collecting immunization data and calculating rates included lack of resources for identifying personnel immunized off-site, tracking personnel who declined immunization, identifying non-payroll staff, and interpreting unclear public health reporting requirements. Support from other vaccine providers, public health, employers, and professional and external bodies is needed to provide the necessary information and resources to calculate accurate and complete rates. Further work is needed to refine and standardize the collection of HCW influenza immunization data so that it may be used for surveillance and quality assessment purposes. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

High-Density Genotyping of Immune Loci in Koreans and Europeans Identifies Eight New Rheumatoid Arthritis Risk Loci

PubMed Central

Kim, Kwangwoo; Bang, So-Young; Lee, Hye-Soon; Cho, Soo-Kyung; Choi, Chan-Bum; Sung, Yoon-Kyoung; Kim, Tae-Hwan; Jun, Jae-Bum; Yoo, Dae Hyun; Kang, Young Mo; Kim, Seong-Kyu; Suh, Chang-Hee; Shim, Seung-Cheol; Lee, Shin-Seok; Lee, Jisoo; Chung, Won Tae; Choe, Jung-Yoon; Shin, Hyoung Doo; Lee, Jong-Young; Han, Bok-Ghee; Nath, Swapan K.; Eyre, Steve; Bowes, John; Pappas, Dimitrios A.; Kremer, Joel M.; Gonzalez-Gay, Miguel A; Rodriguez-Rodriguez, Luis; Ärlestig, Lisbeth; Okada, Yukinori; Diogo, Dorothée; Liao, Katherine P.; Karlson, Elizabeth W.; Raychaudhuri, Soumya; Rantapää-Dahlqvist, Solbritt; Martin, Javier; Klareskog, Lars; Padyukov, Leonid; Gregersen, Peter K.; Worthington, Jane; Greenberg, Jeffrey D.; Plenge, Robert M.; Bae, Sang-Cheol

2015-01-01

Objective A highly polygenic etiology and high degree of allele-sharing between ancestries have been well-elucidated in genetic studies of rheumatoid arthritis. Recently, the high-density genotyping array Immunochip for immune disease loci identified 14 new rheumatoid arthritis risk loci among individuals of European ancestry. Here, we aimed to identify new rheumatoid arthritis risk loci using Korean-specific Immunochip data. Methods We analyzed Korean rheumatoid arthritis case-control samples using the Immunochip and GWAS array to search for new risk alleles of rheumatoid arthritis with anti-citrullinated peptide antibodies. To increase power, we performed a meta-analysis of Korean data with previously published European Immunochip and GWAS data, for a total sample size of 9,299 Korean and 45,790 European case-control samples. Results We identified 8 new rheumatoid arthritis susceptibility loci (TNFSF4, LBH, EOMES, ETS1–FLI1, COG6, RAD51B, UBASH3A and SYNGR1) that passed a genome-wide significance threshold (p<5×10−8), with evidence for three independent risk alleles at 1q25/TNFSF4. The risk alleles from the 7 new loci except for the TNFSF4 locus (monomorphic in Koreans), together with risk alleles from previously established RA risk loci, exhibited a high correlation of effect sizes between ancestries. Further, we refined the number of SNPs that represent potentially causal variants through a trans-ethnic comparison of densely genotyped SNPs. Conclusion This study demonstrates the advantage of dense-mapping and trans-ancestral analysis for identification of potentially causal SNPs. In addition, our findings support the importance of T cells in the pathogenesis and the fact of frequent overlap of risk loci among diverse autoimmune diseases. PMID:24532676

High-density genotyping of immune loci in Koreans and Europeans identifies eight new rheumatoid arthritis risk loci.

PubMed

Kim, Kwangwoo; Bang, So-Young; Lee, Hye-Soon; Cho, Soo-Kyung; Choi, Chan-Bum; Sung, Yoon-Kyoung; Kim, Tae-Hwan; Jun, Jae-Bum; Yoo, Dae Hyun; Kang, Young Mo; Kim, Seong-Kyu; Suh, Chang-Hee; Shim, Seung-Cheol; Lee, Shin-Seok; Lee, Jisoo; Chung, Won Tae; Choe, Jung-Yoon; Shin, Hyoung Doo; Lee, Jong-Young; Han, Bok-Ghee; Nath, Swapan K; Eyre, Steve; Bowes, John; Pappas, Dimitrios A; Kremer, Joel M; Gonzalez-Gay, Miguel A; Rodriguez-Rodriguez, Luis; Ärlestig, Lisbeth; Okada, Yukinori; Diogo, Dorothée; Liao, Katherine P; Karlson, Elizabeth W; Raychaudhuri, Soumya; Rantapää-Dahlqvist, Solbritt; Martin, Javier; Klareskog, Lars; Padyukov, Leonid; Gregersen, Peter K; Worthington, Jane; Greenberg, Jeffrey D; Plenge, Robert M; Bae, Sang-Cheol

2015-03-01

A highly polygenic aetiology and high degree of allele-sharing between ancestries have been well elucidated in genetic studies of rheumatoid arthritis. Recently, the high-density genotyping array Immunochip for immune disease loci identified 14 new rheumatoid arthritis risk loci among individuals of European ancestry. Here, we aimed to identify new rheumatoid arthritis risk loci using Korean-specific Immunochip data. We analysed Korean rheumatoid arthritis case-control samples using the Immunochip and genome-wide association studies (GWAS) array to search for new risk alleles of rheumatoid arthritis with anticitrullinated peptide antibodies. To increase power, we performed a meta-analysis of Korean data with previously published European Immunochip and GWAS data for a total sample size of 9299 Korean and 45,790 European case-control samples. We identified eight new rheumatoid arthritis susceptibility loci (TNFSF4, LBH, EOMES, ETS1-FLI1, COG6, RAD51B, UBASH3A and SYNGR1) that passed a genome-wide significance threshold (p<5×10(-8)), with evidence for three independent risk alleles at 1q25/TNFSF4. The risk alleles from the seven new loci except for the TNFSF4 locus (monomorphic in Koreans), together with risk alleles from previously established RA risk loci, exhibited a high correlation of effect sizes between ancestries. Further, we refined the number of single nucleotide polymorphisms (SNPs) that represent potentially causal variants through a trans-ethnic comparison of densely genotyped SNPs. This study demonstrates the advantage of dense-mapping and trans-ancestral analysis for identification of potentially causal SNPs. In addition, our findings support the importance of T cells in the pathogenesis and the fact of frequent overlap of risk loci among diverse autoimmune diseases. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Using information technology to improve adult immunization delivery in an integrated urban health system.

PubMed

Swenson, Carolyn J; Appel, Alicia; Sheehan, Moira; Hammer, Anne; Fenner, Zita; Phibbs, Stephanie; Harbrecht, Marjie; Main, Deborah S

2012-01-01

Adult immunizations prevent morbidity and mortality yet coverage remains suboptimal, in part due to missed opportunities. Clinical decision support systems (CDSSs) can improve immunization rates when integrated into routine work flow, implemented wherever care is delivered, and used by staff who can act on the recommendation. An adult immunization improvement project was undertaken in a large integrated, safety-net health care system. A CDSS was developed to query patient records and identify patients eligible for pneumococcal, influenza, or tetanus immunization and then generate a statement that recommends immunization or indicates a previous refusal. A new agency policy authorized medical assistants and nurses in clinics, and nurses in the hospital, to use the CDSS as a standing order. Immunization delivery work flow was standardized, and staff received feedback on immunization rates. The CDSS identified more patients than a typical paper standing order and can be easily modified to incorporate changes in vaccine indications. The intervention led to a 10% improvement in immunization rates in adults 65 years of age or older and in younger adults with diabetes or chronic obstructive pulmonary disease. Overall, the improvements were sustained beyond the project period. The CDSS was expanded to encompass additional vaccines. Interdepartmental collaboration was critical to identify needs, challenges, and solutions. Implementing the standing order policy in clinics and the hospital usually allowed immunizations to be taken out of the hands of clinicians. As an on-demand tool, CDSS must be used at each patient encounter to avoid missed opportunities. Staff retraining accompanied by ongoing assessment of immunization rates, work flow, and missed opportunities to immunize patients are critical to sustain and enhance improvements.

Immune checkpoint inhibitor-related myocarditis.

PubMed

Tajiri, Kazuko; Aonuma, Kazutaka; Sekine, Ikuo

2018-01-01

Immune checkpoint inhibitors have demonstrated significant clinical benefit in many cancers. The clinical benefit afforded by these treatments can be accompanied by a unique and distinct spectrum of adverse events. Recently, several fatal cases of immune checkpoint inhibitor-related myocarditis were reported. Although its frequency is comparatively lower than that of other immune-related adverse events, myocarditis can lead to circulatory collapse and lethal ventricular arrhythmia. Immune checkpoints, cytotoxic T-lymphocyte antigen 4 (CTLA-4) and programmed cell death protein 1 (PD-1), play important roles in establishing peripheral tolerance to the heart. Evidence from studies using genetically engineered mouse models suggests that CTLA-4 signaling terminates proliferation and promotes anergy during the primary response to cardiac self-peptide recognition. PD-1 signaling restrains autoreactive T cells that enter the peripheral tissues and recognize cardiac-peptide, maintaining them in an anergic state. Patients affected by immune checkpoint inhibitor-related myocarditis often experience rapid onset of profound hemodynamic compromise progressing to cardiogenic shock. Early diagnosis is mandatory to address specific therapy and correct the timing of circulatory support. However, the diagnosis of myocarditis is challenging due to the heterogeneity of clinical presentations. Owing to its early onset, nonspecific symptomatology and fulminant progression, especially when these drugs are used in combination, oncologists should be vigilant for immune checkpoint inhibitor-related myocarditis. With many questions yet to be answered, from basic immune biology to clinical management, future research should aim to optimize the use of these drugs by identifying predictive biomarkers of either a response to therapy or the risks of myocarditis development. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Achieving Remission in Gulf War Illness: A Simulation-Based Approach to Treatment Design.

PubMed

Craddock, Travis J A; Del Rosario, Ryan R; Rice, Mark; Zysman, Joel P; Fletcher, Mary Ann; Klimas, Nancy G; Broderick, Gordon

2015-01-01

Gulf War Illness (GWI) is a chronic multi-symptom disorder affecting up to one-third of the 700,000 returning veterans of the 1991 Persian Gulf War and for which there is no known cure. GWI symptoms span several of the body's principal regulatory systems and include debilitating fatigue, severe musculoskeletal pain, cognitive and neurological problems. Using computational models, our group reported previously that GWI might be perpetuated at least in part by natural homeostatic regulation of the neuroendocrine-immune network. In this work, we attempt to harness these regulatory dynamics to identify treatment courses that might produce lasting remission. Towards this we apply a combinatorial optimization scheme to the Monte Carlo simulation of a discrete ternary logic model that represents combined hypothalamic-pituitary-adrenal (HPA), gonadal (HPG), and immune system regulation in males. In this work we found that no single intervention target allowed a robust return to normal homeostatic control. All combined interventions leading to a predicted remission involved an initial inhibition of Th1 inflammatory cytokines (Th1Cyt) followed by a subsequent inhibition of glucocorticoid receptor function (GR). These first two intervention events alone ended in stable and lasting return to the normal regulatory control in 40% of the simulated cases. Applying a second cycle of this combined treatment improved this predicted remission rate to 2 out of 3 simulated subjects (63%). These results suggest that in a complex illness such as GWI, a multi-tiered intervention strategy that formally accounts for regulatory dynamics may be required to reset neuroendocrine-immune homeostasis and support extended remission.

Artificial Immune System Approaches for Aerospace Applications

NASA Technical Reports Server (NTRS)

KrishnaKumar, Kalmanje; Koga, Dennis (Technical Monitor)

2002-01-01

Artificial Immune Systems (AIS) combine a priori knowledge with the adapting capabilities of biological immune system to provide a powerful alternative to currently available techniques for pattern recognition, modeling, design, and control. Immunology is the science of built-in defense mechanisms that are present in all living beings to protect against external attacks. A biological immune system can be thought of as a robust, adaptive system that is capable of dealing with an enormous variety of disturbances and uncertainties. Biological immune systems use a finite number of discrete "building blocks" to achieve this adaptiveness. These building blocks can be thought of as pieces of a puzzle which must be put together in a specific way-to neutralize, remove, or destroy each unique disturbance the system encounters. In this paper, we outline AIS models that are immediately applicable to aerospace problems and identify application areas that need further investigation.

Comprehensive Genetic Dissection of the Hemocyte Immune Response in the Malaria Mosquito Anopheles gambiae

PubMed Central

Lombardo, Fabrizio; Ghani, Yasmeen; Kafatos, Fotis C.; Christophides, George K.

2013-01-01

Reverse genetics in the mosquito Anopheles gambiae by RNAi mediated gene silencing has led in recent years to an advanced understanding of the mosquito immune response against infections with bacteria and malaria parasites. We developed RNAi screens in An. gambiae hemocyte-like cells using a library of double-stranded RNAs targeting 109 genes expressed highly or specifically in mosquito hemocytes to identify novel regulators of the hemocyte immune response. Assays included phagocytosis of bacterial bioparticles, expression of the antimicrobial peptide CEC1, and basal and induced expression of the mosquito complement factor LRIM1. A cell viability screen was also carried out to assess dsRNA cytotoxicity and to identify genes involved in cell growth and survival. Our results identify 22 novel immune regulators, including proteins putatively involved in phagosome assembly and maturation (Ca2+ channel, v-ATPase and cyclin-dependent protein kinase), pattern recognition (fibrinogen-domain lectins and Nimrod), immune modulation (peptidase and serine protease homolog), immune signaling (Eiger and LPS-induced factor), cell adhesion and communication (Laminin B1 and Ninjurin) and immune homeostasis (Lipophorin receptor). The development of robust functional cell-based assays paves the way for genome-wide functional screens to study the mosquito immune response to infections with human pathogens. PMID:23382679

Variability in Immunization Practices for Preterm Infants.

PubMed

Gopal, Srirupa Hari; Edwards, Kathryn M; Creech, Buddy; Weitkamp, Joern-Hendrik

2018-06-08

 The Advisory Committee on Immunization Practices and the American Academy of Pediatrics (AAP) recommend the same immunization schedule for preterm and term infants. However, significant delays in vaccination of premature infants have been reported.  The objective of this study was to assess the variability of immunization practices in preterm infants.  We conducted an online survey of 2,443 neonatologists in the United States, who are members of the Section for Neonatal-Perinatal Medicine of the AAP. Questions were targeted at immunization practices in the neonatal intensive care unit (NICU).  Of the 420 responses (17%) received, 55% of providers administer the first vaccine at >2-month chronological age. Most providers (83%) surveyed reported delaying vaccines in the setting of clinical illness. Sixty percent reported increasing frequency of apnea-bradycardia events following immunization. More than half administer the initial vaccines over several days despite lack of supporting data. Reported considerations in delaying or spreading out 2-month vaccines were clinical instability, provider preference, lower gestational age, and lower birth weight.  This survey substantiates the variability of immunizations practices in the NICU and identifies reasons for this variability. Future studies should inform better practice guidance for immunization of preterm NICU patients based on vaccine safety and effectiveness. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

The development of the immune tissues in marsupial pouch young.

PubMed

Borthwick, Casey R; Young, Lauren J; Old, Julie M

2014-07-01

Current knowledge of the development of the marsupial immune system, particularly in the context of lymphoid tissue development and the appearance of lymphocytes, has been examined and limitations identified. While primary lymphoid tissues like the thymus have been extensively studied, secondary lymphoid tissues such as the spleen and lymph nodes have been examined to a lesser extent, partly due to the difficulty of macroscopically identifying these structures, particularly in very small neonates. In addition, little research has been conducted on the mucosal-associated lymphoid tissues; tissues that directly trap antigens and play an important role in the maturity of adaptive immune responses. Research on the development of the marsupial immune tissues to date serves as a solid foundation for further research, particularly on the mechanisms behind the development of the immune system of marsupials. With the recent sequencing and annotation of whole marsupial genomes, the current wealth of sequence data will be essential in the development of marsupial specific reagents, including antibodies, that are required to widen our specific knowledge of the complex marsupial immune system and its development. © 2014 Wiley Periodicals, Inc.

Immune checkpoint therapy in liver cancer.

PubMed

Xu, Feng; Jin, Tianqiang; Zhu, Yuwen; Dai, Chaoliu

2018-05-29

Immune checkpoints include stimulatory and inhibitory checkpoint molecules. In recent years, inhibitory checkpoints, including cytotoxic T lymphocyte-associated antigen 4 (CTLA-4), programmed cell death protein-1 (PD-1), and programmed cell death ligand 1 (PD-L1), have been identified to suppress anti-tumor immune responses in solid tumors. Novel drugs targeting immune checkpoints have succeeded in cancer treatment. Specific PD-1 blockades were approved for treatment of melanoma in 2014 and for treatment of non-small-cell lung cancer in 2015 in the United States, European Union, and Japan. Preclinical and clinical studies show immune checkpoint therapy provides survival benefit for greater numbers of patients with liver cancer, including hepatocellular carcinoma and cholangiocarcinoma, two main primary liver cancers. The combination of anti-PD-1/PD-L1 with anti-CTLA-4 antibodies is being evaluated in phase 1, 2 or 3 trials, and the results suggest that an anti-PD-1 antibody combined with locoregional therapy or other molecular targeted agents is an effective treatment strategy for HCC. In addition, studies on activating co-stimulatory receptors to enhance anti-tumor immune responses have increased our understanding regarding this immunotherapy in liver cancer. Epigenetic modulations of checkpoints for improving the tumor microenvironment also expand our knowledge of potential therapeutic targets in improving the tumor microenvironment and restoring immune recognition and immunogenicity. In this review, we summarize current knowledge and recent developments in immune checkpoint-based therapies for the treatment of hepatocellular carcinoma and cholangiocarcinoma and attempt to clarify the mechanisms underlying its effects.

Homeostatic Proliferation and IL-7R Alpha Expression Do Not Correlate with Enhanced T Cell Proliferation and Protection in Chronic Mouse Malaria

PubMed Central

Stephens, Robin; Seddon, Benedict; Langhorne, Jean

2011-01-01

While chronic infection has been shown to enhance protection from disease caused by several pathogens, the mechanisms are not known. The gamma-c family of cytokines IL-7, IL-2, and IL-15 are implicated in homeostatic proliferation, which is thought to maintain T cell memory. However in chronic infection, prolonged antigen exposure itself may contribute to lymphocyte survival. We have previously observed that chronic malaria infection enhances protection to re-infection, as well as enhancing B cell responses. Here, we show that chronic Plasmodium chabaudi malaria infection in mice enhances the expansion of CD4+ T cells in a second infection, and that this correlates with increased expression of the IL-2/15 Receptor beta (CD122) on memory T cells, as well as increasing IL-2 producers on re-infection. IL-2 has been recently linked to improved secondary proliferation, while the role of IL-7 in maintenance of CD4+ memory cells has been demonstrated in homeostatic proliferation, but its role in protective memory populations in infectious disease protective has not been fully investigated. Increased IL-7Rα (CD127) expression correlated, as previously reported with increased turnover of CD4 memory cells, however, this was not linked to protection or enhanced response to rechallenge, These data support the idea that antigen or IL-2 production resulting from chronic stimulation may play a role in an enhanced secondary T cell response. PMID:22039531

The influence of the microbiota on the immune response to transplantation

PubMed Central

Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa

2015-01-01

Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985

Association of variants in innate immune genes with asthma and eczema

PubMed Central

Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.

2012-01-01

Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

Antitumor immunity and cancer stem cells.

PubMed

Schatton, Tobias; Frank, Markus H

2009-09-01

Self-renewing cancer stem cells (CSC) capable of spawning more differentiated tumor cell progeny are required for tumorigenesis and neoplastic progression of leukemias and several solid cancers. The mechanisms by which CSC cause tumor initiation and growth are currently unknown. Recent findings that suggest a negative correlation between degrees of host immunocompetence and rates of cancer development raise the possibility that only a restricted minority of malignant cells, namely CSC, may possess the phenotypic and functional characteristics to evade host antitumor immunity. In human malignant melanoma, a highly immunogenic cancer, we recently identified malignant melanoma initiating cells (MMIC), a novel type of CSC, based on selective expression of the chemoresistance mediator ABCB5. Here we present evidence of a relative immune privilege of ABCB5(+) MMIC, suggesting refractoriness to current immunotherapeutic treatment strategies. We discuss our findings in the context of established immunomodulatory functions of physiologic stem cells and in relation to mechanisms responsible for the downregulation of immune responses against tumors. We propose that the MMIC subset might be responsible for melanoma immune evasion and that immunomodulation might represent one mechanism by which CSC advance tumorigenic growth and resistance to immunotherapy. Accordingly, the possibility of an MMIC-driven tumor escape from immune-mediated rejection has important implications for current melanoma immunotherapy.

Antitumor Immunity and Cancer Stem Cells

PubMed Central

Schatton, Tobias; Frank, Markus H.

2010-01-01

Self-renewing cancer stem cells (CSC) capable of spawning more differentiated tumor cell progeny are required for tumorigenesis and neoplastic progression of leukemias and several solid cancers. The mechanisms by which CSC cause tumor initiation and growth are currently unknown. Recent findings that suggest a negative correlation between degrees of host immunocompetence and rates of cancer development raise the possibility that only a restricted minority of malignant cells, namely CSC, may possess the phenotypic and functional characteristics to evade host antitumor immunity. In human malignant melanoma, a highly immunogenic cancer, we recently identified malignant melanoma initiating cells (MMIC), a novel type of CSC, based on selective expression of the chemoresistance mediator ABCB5. Here we present evidence of a relative immune privilege of ABCB5+ MMIC, suggesting refractoriness to current immunotherapeutic treatment strategies. We discuss our findings in the context of established immunomodulatory functions of physiologic stem cells and in relation to mechanisms responsible for the downregulation of immune responses against tumors. We propose that the MMIC subset might be responsible for melanoma immune evasion and that immunomodulation might represent one mechanism by which CSC advance tumorigenic growth and resistance to immunotherapy. Accordingly, the possibility of an MMIC-driven tumor escape from immune-mediated rejection has important implications for current melanoma immunotherapy. PMID:19796244

Impact of pharmacists providing immunizations on adolescent influenza immunization.

PubMed

Robison, Steve G

2016-01-01

To determine if the Oregon law change in 2011 to allow pharmacists to immunize adolescents 11 to 17 years of age increased influenza immunizations or changed existing immunization venues. With the use of Oregon's ALERT Immunization Information System (IIS), 2 measures of impact were developed. First, the change in adolescent age 11-17 influenza immunizations before (2007-2010) and after (2011-2014) the pharmacy law change was evaluated against a reference cohort (aged 7-10) not affected by the law. Community pharmacies were also compared with other types of influenza immunization sites within one of the study influenza seasons (2013-2014). From 2007 to 2014, adolescent influenza immunizations at community pharmacies increased from 36 to 6372 per year. After the 2011 pharmacy law change, adolescents aged 11 to 17 were more likely to receive an influenza immunization compared with the reference population (odds ratio, 1.21; 95% CI, 1.19-1.22). Analysis of the 2013-2014 influenza season suggests that community pharmacies immunized a different population of adolescents than other providers. The 2011 change in Oregon law allowed pharmacists to increase the total of influenza immunizations given to adolescents. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

WEALTH-BASED INEQUALITY IN CHILD IMMUNIZATION IN INDIA: A DECOMPOSITION APPROACH.

PubMed

Debnath, Avijit; Bhattacharjee, Nairita

2018-05-01

SummaryDespite years of health and medical advancement, children still suffer from infectious diseases that are vaccine preventable. India reacted in 1978 by launching the Expanded Programme on Immunization in an attempt to reduce the incidence of vaccine-preventable diseases (VPDs). Although the nation has made remarkable progress over the years, there is significant variation in immunization coverage across different socioeconomic strata. This study attempted to identify the determinants of wealth-based inequality in child immunization using a new, modified method. The present study was based on 11,001 eligible ever-married women aged 15-49 and their children aged 12-23 months. Data were from the third District Level Household and Facility Survey (DLHS-3) of India, 2007-08. Using an approximation of Erreyger's decomposition technique, the study identified unequal access to antenatal care as the main factor associated with inequality in immunization coverage in India.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Integrated Immune

NASA Technical Reports Server (NTRS)

Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece

2010-01-01

This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

Role of Innate Immunity in Neonatal Infection

PubMed Central

Cuenca, Alex G; Wynn, James L; Moldawer, Lyle L; Levy, Ofer

2014-01-01

Newborns are at increased risk of infection due to genetic, epigenetic, and environmental factors. Herein we examine the roles of the neonatal innate immune system in host defense against bacterial and viral infections. Full-term newborns express a distinct innate immune system biased towards TH2/TH17-polarizing and anti-inflammatory cytokine production with relative impairment in TH1-polarizing cytokine production that leaves them particularly vulnerable to infection with intracellular pathogens. In addition to these distinct features, preterm newborns also have fragile skin, impaired TH17-polarizing cytokine production and deficient expression of complement and of antimicrobial proteins and peptides (APPs) that likely contribute to susceptibility to pyogenic bacteria. Ongoing research is identifying APPs, including bacterial/permeability-increasing protein and lactoferrin, as well as pattern recognition receptor (PRR) agonists that may serve to enhance protective newborn and infant immune responses as stand alone immune response modifiers or vaccine adjuvants. PMID:23297181

Innate Lymphoid Cells in Tumor Immunity.

PubMed

van Beek, Jasper J P; Martens, Anne W J; Bakdash, Ghaith; de Vries, I Jolanda M

2016-02-25

Innate lymphoid cells (ILCs) are a group of immune cells of the lymphoid lineage that do not possess antigen specificity. The group includes natural killer (NK) cells, lymphoid tissue inducer (LTi) cells and the recently identified ILC1s, ILC2s and ILC3s. Although the role of NK cells in the context of cancer has been well established, the involvement of other ILC subsets in cancer progression and resistance is just emerging. Here, we review the literature on the role of the different ILC subsets in tumor immunity and discuss its implications for cancer treatment and monitoring.

Innate Lymphoid Cells in Tumor Immunity

PubMed Central

van Beek, Jasper J. P.; Martens, Anne W. J.; Bakdash, Ghaith; de Vries, I. Jolanda M.

2016-01-01

Innate lymphoid cells (ILCs) are a group of immune cells of the lymphoid lineage that do not possess antigen specificity. The group includes natural killer (NK) cells, lymphoid tissue inducer (LTi) cells and the recently identified ILC1s, ILC2s and ILC3s. Although the role of NK cells in the context of cancer has been well established, the involvement of other ILC subsets in cancer progression and resistance is just emerging. Here, we review the literature on the role of the different ILC subsets in tumor immunity and discuss its implications for cancer treatment and monitoring. PMID:28536374

Cytomegalovirus shapes long-term immune reconstitution after allogeneic stem cell transplantation

PubMed Central

Itzykson, Raphael; Robin, Marie; Moins-Teisserenc, Helene; Delord, Marc; Busson, Marc; Xhaard, Aliénor; de Fontebrune, Flore Sicre; de Latour, Régis Peffault; Toubert, Antoine; Socié, Gérard

2015-01-01

Immune reconstitution after allogeneic stem cell transplantation is a dynamic and complex process depending on the recipient and donor characteristics, on the modalities of transplantation, and on the occurrence of graft-versus-host disease. Multivariate methods widely used for gene expression profiling can simultaneously analyze the patterns of a great number of biological variables on a heterogeneous set of patients. Here we use these methods on flow cytometry assessment of up to 25 lymphocyte populations to analyze the global pattern of long-term immune reconstitution after transplantation. Immune patterns were most distinct from healthy controls at six months, and had not yet fully recovered as long as two years after transplant. The two principal determinants of variability were linked to the balance of B and CD8+ T cells and of natural killer and B cells, respectively. Recipient’s cytomegalovirus serostatus, cytomegalovirus replication, and chronic graft-versus-host disease were the main factors shaping the immune pattern one year after transplant. We identified a complex signature of under- and over-representation of immune populations dictated by recipient’s cytomegalovirus seropositivity. Finally, we identified dimensions of variance in immune patterns as significant predictors of long-term non-relapse mortality, independently of chronic graft-versus-host disease. PMID:25261095

miR-34 Modulates Innate Immunity and Ecdysone Signaling in Drosophila

PubMed Central

Xiong, Xiao-Peng; Chang, Kung-Yen; Ren, Xingjie; Ni, Jian-Quan; Rana, Tariq M.; Zhou, Rui

2016-01-01

microRNAs are endogenous small regulatory RNAs that modulate myriad biological processes by repressing target gene expression in a sequence-specific manner. Here we show that the conserved miRNA miR-34 regulates innate immunity and ecdysone signaling in Drosophila. miR-34 over-expression activates antibacterial innate immunity signaling both in cultured cells and in vivo, and flies over-expressing miR-34 display improved survival and pathogen clearance upon Gram-negative bacterial infection; whereas miR-34 knockout animals are defective in antibacterial defense. In particular, miR-34 achieves its immune-stimulatory function, at least in part, by repressing the two novel target genes Dlg1 and Eip75B. In addition, our study reveals a mutual repression between miR-34 expression and ecdysone signaling, and identifies miR-34 as a node in the intricate interplay between ecdysone signaling and innate immunity. Lastly, we identify cis-regulatory genomic elements and trans-acting transcription factors required for optimal ecdysone-mediated repression of miR-34. Taken together, our study enriches the repertoire of immune-modulating miRNAs in animals, and provides new insights into the interplay between steroid hormone signaling and innate immunity. PMID:27893816

Demonstration of the feasibility of emergency department immunization against influenza and pneumococcus.

PubMed

Slobodkin, D; Zielske, P G; Kitlas, J L; McDermott, M F; Miller, S; Rydman, R

1998-11-01

To demonstrate the feasibility of systematic immunization against influenza and pneumococcus in a public emergency department. This was a demonstration project conducted from October 21, 1996, through December 2, 1996, at Cook County Hospital, an inner-city hospital with a 1996 adult ED census of 120,449. Seventy-eight percent of patients are uninsured; 92% are people of color; 73% deny having a primary physician. Only 15% have emergency complaints. Nurses received standing orders that all nonemergency adult patients meeting Centers for Disease Control and Prevention criteria for high risk should be offered immunization against influenza and pneumococcus at triage. Cash prizes were offered to nurses appropriately immunizing the most patients. The date of immunization was entered into the computerized patient registration system, available to all providers within the county system. From November 4 through November 18, an extra nurse was assigned to triage to test for improvement in immunization rates. A time-motion study determined the time required per immunization on the basis of a convenience sample of 8 nurses drawn from all 3 shifts. Only 3% of identified high-risk patients reported previous pneumococcal immunization. Despite extreme variation in nurse performance, 2,631 patients (24% of patients triaged) were screened, and 716 high-risk patients were identified (27% of patients screened). A total of 1234 patients were immunized against influenza, and 241 patients were appropriately immunized against pneumococcus. Sixty-one percent of high-risk patients with no contraindication to influenza immunization were immunized against influenza. Thirty-five percent of high-risk patients not previously immunized against pneumococcus were immunized against pneumococcus. Immunizations per shift per triage nurse varied from 0 to 24. Median time for all activities related to immunization was 4 minutes (range, 2 to 10 minutes). There was no increase in immunization rates with

Age-related regulation of genes: slow homeostatic changes and age-dimension technology

NASA Astrophysics Data System (ADS)

Kurachi, Kotoku; Zhang, Kezhong; Huo, Jeffrey; Ameri, Afshin; Kuwahara, Mitsuhiro; Fontaine, Jean-Marc; Yamamoto, Kei; Kurachi, Sumiko

2002-11-01

Through systematic studies of pro- and anti-blood coagulation factors, we have determined molecular mechanisms involving two genetic elements, age-related stability element (ASE), GAGGAAG and age-related increase element (AIE), a unique stretch of dinucleotide repeats (AIE). ASE and AIE are essential for age-related patterns of stable and increased gene expression patterns, respectively. Such age-related gene regulatory mechanisms are also critical for explaining homeostasis in various physiological reactions as well as slow homeostatic changes in them. The age-related increase expression of the human factor IX (hFIX) gene requires the presence of both ASE and AIE, which apparently function additively. The anti-coagulant factor protein C (hPC) gene uses an ASE (CAGGAG) to produce age-related stable expression. Both ASE sequences (G/CAGAAG) share consensus sequence of the transcriptional factor PEA-3 element. No other similar sequences, including another PEA-3 consensus sequence, GAGGATG, function in conferring age-related gene regulation. The age-regulatory mechanisms involving ASE and AIE apparently function universally with different genes and across different animal species. These findings have led us to develop a new field of research and applications, which we named “age-dimension technology (ADT)”. ADT has exciting potential for modifying age-related expression of genes as well as associated physiological processes, and developing novel, more effective prophylaxis or treatments for age-related diseases.

A screen for immunity genes evolving under positive selection in Drosophila.

PubMed

Jiggins, F M; Kim, K W

2007-05-01

Genes involved in the immune system tend to have higher rates of adaptive evolution than other genes in the genome, probably because they are coevolving with pathogens. We have screened a sample of Drosophila genes to identify those evolving under positive selection. First, we identified rapidly evolving immunity genes by comparing 140 loci in Drosophila erecta and D. yakuba. Secondly, we resequenced 23 of the fastest evolving genes from the independent species pair D. melanogaster and D. simulans, and identified those under positive selection using a McDonald-Kreitman test. There was strong evidence of adaptive evolution in two serine proteases (persephone and spirit) and a homolog of the Anopheles serpin SRPN6, and weaker evidence in another serine protease and the death domain protein dFADD. These results add to mounting evidence that immune signalling pathway molecules often evolve rapidly, possibly because they are sites of host-parasite coevolution.

Innate Immunity against Leishmania Infections

PubMed Central

Gurung, Prajwal; Kanneganti, Thirumala-Devi

2015-01-01

Leishmaniasis is a major health problem that affects more than 300 million people throughout the world. The morbidity associated with the disease causes serious economic burden in Leishmania endemic regions. Despite the morbidity and economic burden associated with Leishmaniasis, this disease rarely gets noticed and is still categorized under neglected tropical diseases. The lack of research combined with the ability of Leishmania to evade immune recognition has rendered our efforts to design therapeutic treatments or vaccines challenging. Herein, we review the literature on Leishmania from innate immune perspective and discuss potential problems as well as solutions and future directions that could aid in identifying novel therapeutic targets to eliminate this parasite. PMID:26249747

Assessing immune competence in pigs by immunization with tetanus toxoid.

PubMed

Gimsa, U; Tuchscherer, A; Gimsa, J; Tuchscherer, M

2018-01-01

Immune competence can be tested by challenging organisms with a set of infectious agents. However, disease control requirements impose restrictions on the infliction of infections upon domestic pigs. Alternatively, vaccinations induce detectable immune responses that reflect immune competence. Here, we tested this approach with tetanus toxoid (TT) in young domestic pigs. To optimize the vaccination protocol, we immunized the pigs with a commercial TT vaccine at the age of 21 or 35 days. Booster immunizations were performed either 14 or 21 days later. TT-specific antibodies in plasma as well as lymphoproliferative responses were determined both 7 and 14 days after booster immunization using ELISA and lymphocyte transformation tests, respectively. In addition, general IgG and IgM plasma concentrations and mitogen-induced proliferation were measured. The highest TT-specific antibody responses were detected when blood samples were collected 1 week after a booster immunization conducted 21 days after primary immunization. The pigs' age at primary immunization did not have a significant influence on TT-specific antibody responses. Similarly, the TT-specific proliferative responses were highest when blood samples were collected 1 week after booster immunization, while age and time of primary and booster immunization were irrelevant in our setup. While general IgG and IgM plasma levels were highly age dependent, there were no significant age effects for TT-specific immune responses. In addition, mitogen-induced proliferation was independent of immunization as well as blood sampling protocols. In summary, our model of TT vaccination provides an interesting approach for the assessment of immune competence in young pigs. The detected vaccination effects were not biased by age, even though our data were acquired from immune systems that were under development during our tests.

Selective programming of CCR10+ innate lymphoid cells in skin-draining lymph nodes for cutaneous homeostatic regulation

PubMed Central

Yang, Jie; Hu, Shaomin; Zhao, Luming; Kaplan, Daniel H.; Perdew, Gary H.; Xiong, Na

2016-01-01

Innate lymphoid cells (ILCs) are preferentially localized into barrier tissues where they function in tissue protection but can also contribute to inflammatory diseases. The mechanisms regulating the establishment of ILCs in barrier tissues are poorly understood. Here we show that under steady-state conditions ILCs in skin-draining lymph nodes (sLNs) were continuously activated to acquire regulatory properties and high expression of the chemokine receptor CCR10 for localization into the skin. CCR10+ ILCs promoted the homeostasis of skin-resident T cells and reciprocally, their establishment in the skin required T cell-regulated homeostatic environments. Foxn1-expressing CD207+ dendritic cells were required for the proper generation of CCR10+ ILCs. These observations reveal mechanisms underlying the specific programming and priming of skin-homing CCR10+ ILCs in the sLNs. PMID:26523865

Sovereign immunity in Virginia : an overview.

DOT National Transportation Integrated Search

1981-01-01

This report was designed primarily to apprise persons in state agencies of the law of sovereign immunity in Virginia, to comment on the likelihood of this law being changed, and to identify the possible sources of such change. The report addresses th...

Integrated Circuit Immunity

NASA Technical Reports Server (NTRS)

Sketoe, J. G.; Clark, Anthony

2000-01-01

This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

Transcriptome landscape of a bacterial pathogen under plant immunity.

PubMed

Nobori, Tatsuya; Velásquez, André C; Wu, Jingni; Kvitko, Brian H; Kremer, James M; Wang, Yiming; He, Sheng Yang; Tsuda, Kenichi

2018-03-27

Plant pathogens can cause serious diseases that impact global agriculture. The plant innate immunity, when fully activated, can halt pathogen growth in plants. Despite extensive studies into the molecular and genetic bases of plant immunity against pathogens, the influence of plant immunity in global pathogen metabolism to restrict pathogen growth is poorly understood. Here, we developed RNA sequencing pipelines for analyzing bacterial transcriptomes in planta and determined high-resolution transcriptome patterns of the foliar bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana with a total of 27 combinations of plant immunity mutants and bacterial strains. Bacterial transcriptomes were analyzed at 6 h post infection to capture early effects of plant immunity on bacterial processes and to avoid secondary effects caused by different bacterial population densities in planta We identified specific "immune-responsive" bacterial genes and processes, including those that are activated in susceptible plants and suppressed by plant immune activation. Expression patterns of immune-responsive bacterial genes at the early time point were tightly linked to later bacterial growth levels in different host genotypes. Moreover, we found that a bacterial iron acquisition pathway is commonly suppressed by multiple plant immune-signaling pathways. Overexpression of a P. syringae sigma factor gene involved in iron regulation and other processes partially countered bacterial growth restriction during the plant immune response triggered by AvrRpt2. Collectively, this study defines the effects of plant immunity on the transcriptome of a bacterial pathogen and sheds light on the enigmatic mechanisms of bacterial growth inhibition during the plant immune response.

Host genetics affect microbial ecosystems via host immunity.

PubMed

El Kafsi, Hela; Gorochov, Guy; Larsen, Martin

2016-10-01

Genetic evolution of multicellular organisms has occurred in response to environmental challenges, including competition for nutrients, climate change, physical and chemical stressors, and pathogens. However, fitness of an organism is dependent not only on defense efficacy, but also on the ability to take advantage of symbiotic organisms. Indeed, microbes not only encompass pathogenicity, but also enable efficient nutrient uptake from diets nondegradable by the host itself. Moreover, microbes play important roles in the development of host immunity. Here we review associations between specific host genes and variance in microbiota composition and compare with interactions between microbes and host immunity. Recent genome-wide association studies reveal that symbiosis between host and microbiota is the exquisite result of genetic coevolution. Moreover, a subset of microbes from human and mouse microbiota have been identified to interact with humoral and cellular immunity. Interestingly, microbes associated with both host genetics and host immunity are taxonomically related. Most involved are Bifidobacterium, Lactobacillus, and Akkermansia, which are dually associated with both host immunity and host genetics. We conclude that future therapeutics targeting microbiota in the context of chronic inflammatory diseases need to consider both immune and genetic host features associated with microbiota homeostasis.

Innate immune reconstitution with suppression of HIV-1.

PubMed

Scully, Eileen P; Lockhart, Ainsley; Garcia-Beltran, Wilfredo; Palmer, Christine D; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M; Chang, J Judy; Bosch, Ronald J; Altfeld, Marcus

2016-03-17

Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4 + T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses.

Innate immune reconstitution with suppression of HIV-1

PubMed Central

Scully, Eileen P.; Garcia-Beltran, Wilfredo; Palmer, Christine D.; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M.; Bosch, Ronald J.

2016-01-01

Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4+ T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses. PMID:27158667

The Arabidopsis immune adaptor SRFR1 interacts with TCP transcription factors that redundantly contribute to effector-triggered immunity.

PubMed

Kim, Sang Hee; Son, Geon Hui; Bhattacharjee, Saikat; Kim, Hye Jin; Nam, Ji Chul; Nguyen, Phuong Dung T; Hong, Jong Chan; Gassmann, Walter

2014-06-01

The plant immune system must be tightly controlled both positively and negatively to maintain normal plant growth and health. We previously identified SUPPRESSOR OF rps4-RLD1 (SRFR1) as a negative regulator specifically of effector-triggered immunity. SRFR1 is localized in both a cytoplasmic microsomal compartment and in the nucleus. Its TPR domain has sequence similarity to TPR domains of transcriptional repressors in other organisms, suggesting that SRFR1 may negatively regulate effector-triggered immunity via transcriptional control. We show here that excluding SRFR1 from the nucleus prevented complementation of the srfr1 phenotype. To identify transcription factors that interact with SRFR1, we screened an Arabidopsis transcription factor prey library by yeast two-hybrid assay and isolated six class I members of the TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factor family. Specific interactions were verified in planta. Although single or double T-DNA mutant tcp8, tcp14 or tcp15 lines were not more susceptible to bacteria expressing AvrRps4, the triple tcp8 tcp14 tcp15 mutant displayed decreased effector-triggered immunity mediated by the resistance genes RPS2, RPS4, RPS6 and RPM1. In addition, expression of PATHOGENESIS-RELATED PROTEIN2 was attenuated in srfr1-4 tcp8-1 tcp14-5 tcp15-3 plants compared to srfr1-4 plants. To date, TCP transcription factors have been implicated mostly in developmental processes. Our data indicate that one function of a subset of TCP proteins is to regulate defense gene expression in antagonism to SRFR1, and suggest a mechanism for an intimate connection between plant development and immunity. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Immune mediators in the brain and peripheral tissues in autism spectrum disorder

PubMed Central

Estes, Myka L.; McAllister, A. Kimberley

2017-01-01

Increasing evidence points to a central role for immune dysregulation in autism spectrum disorder (ASD). Several ASD risk genes encode components of the immune system and many maternal immune system-related risk factors — including autoimmunity, infection and fetal reactive antibodies — are associated with ASD. In addition, there is evidence of ongoing immune dysregulation in individuals with ASD and animal models of this disorder. Recently, several molecular signalling pathways have been identified that link immune activation to ASD phenotypes, including pathways downstream of cytokines, hepatocyte growth factor receptor (MET), MHCI molecules, microglia and complement factors. These findings indicate that the immune system is a point of convergence for various ASD-related genetic and environmental risk factors. PMID:26189694

The first invertebrate NFIL3 transcription factor with role in immune defense identified from the Hong Kong oyster, Crassostrea hongkongensis.

PubMed

Li, Jun; Zhang, Yang; Zhang, Yuehuan; Mao, Fan; Xiang, Zhiming; Xiao, Shu; Ma, Haitao; Yu, Ziniu

2017-11-01

NFIL3 (nuclear factor interleukin 3-regulated) is a basic leucine zipper type transcription factor that mediates a variety of immune responses in vertebrates. However, the sequence information and function of NFIL3 homologs in invertebrates, especially mollusks, remains unknown. In the present study, the first NFIL3 homolog was identified in a marine mollusk, Crassostrea hongkongensis (designated as ChNFIL3), followed by its functional characterization. The full-length cDNA of ChNFIL3 is 2221 bp and consists of an open reading frame (ORF) of 1536 bp that encodes a polypeptide of 551 amino acids. Simple Modular Architecture Research Tool (SMART) analysis indicated that ChNFIL3 has two basic leucin zipper domains, similar to the other known NFIL3 family proteins. Tissue distribution analysis of NFIL3 in this mollusk revealed high expression in digestive glands and hemocytes. A significant induction in the mRNA level of ChNFIL3 was observed following bacterial stimulation. ChNFIL3 was found to be localized in the nucleus and over expression of ChNIFL3 led to upregulation of transcriptional activity of an NF-κB reporter gene in HEK 293T cells, indicating its role in innate immunity. Furthermore, addition of exogenous recombinant ChNFIL3 proteins resulted in enhanced mRNA level of hemocyte interleukin 17 in vitro. In conclusion, our findings revealed that NFIL3 in molluscs, plays a conserved role in host defense, similar to its mammalian homolog. Copyright © 2017 Elsevier Ltd. All rights reserved.

Immunization Program

Science.gov Websites

Department home page Immunizations Search: Search Toggle navigation Medical Services Disease Control Facebook Contacts CoverageRates Diseases Immunization Homepage Immunization Honor Roll HPV NDIIS Medical Providers

[Immunization delay determinants: a study in a place attended by Family Health Strategy].

PubMed

Tertuliano, Gisele Cristina; Stein, Airton Tetelbom

2011-02-01

It is relevant to understand every aspect, regarding to strategies that will determine immunization coverage. Thus the main objective in this research is to identify the prevalence of depressive symptoms as well as low immunization uptake, identifying the caretakers' profile, considering his/her level of education, social-demographic character, marital status and also knowledge about immunization in which a Beck Inventory questionnaire was applied to the children's caretakers. Children's age ranged from 0 to 5 years and the number of subjects was 339 enrolled in a group of Family Health Strategy at the city of Cachoeirinha, in the state of Rio Grande do Sul, Brazil. The depression symptoms prevalence was 38.6%. The association between depression symptoms and the low immunization uptake was not statistical significant (OR=1.0, CI 95%, 0.62-1.73). The low immunization uptake rate was 23.3%. The high prevalence of depressive symptoms between mothers and the high percentage of immunization delay means the need of social help and the search of better effectivity of primary attention in health.

An immune-related lncRNA signature for patients with anaplastic gliomas.

PubMed

Wang, Wen; Zhao, Zheng; Yang, Fan; Wang, Haoyuan; Wu, Fan; Liang, Tingyu; Yan, Xiaoyan; Li, Jiye; Lan, Qing; Wang, Jiangfei; Zhao, Jizong

2018-01-01

We investigated immune-related long non-coding RNAs (lncRNAs) that may be exploited as potential therapeutic targets in anaplastic gliomas. We obtained 572 lncRNAs and 317 immune genes from the Chinese Glioma Genome Atlas microarray and constructed immune-related lncRNAs co-expression networks to identify immune-related lncRNAs. Two additional datasets (GSE16011, REMBRANDT) were used for validation. Gene set enrichment analysis and principal component analysis were used for functional annotation. Immune-lncRNAs co-expression networks were constructed. Nine immune-related lncRNAs (SNHG8, PGM5-AS1, ST20-AS1, LINC00937, AGAP2-AS1, MIR155HG, TUG1, MAPKAPK5-AS1, and HCG18) signature was identified in patients with anaplastic gliomas. Patients in the low-risk group showed longer overall survival (OS) and progression-free survival than those in the high-risk group (P < 0.0001; P < 0.0001). Additionally, patients in the high-risk group displayed no-deletion of chromosomal arms 1p and/or 19q, isocitrate dehydrogenase wild-type, classical and mesenchymal TCGA subtype, G3 CGGA subtype, and lower Karnofsky performance score (KPS). Moreover, the signature was an independent factor and was significantly associated with the OS (P = 0.000, hazard ratio (HR) = 1.434). These findings were further validated in two additional datasets (GSE16011, REMBRANDT). Low-risk and high-risk groups displayed different immune status based on principal components analysis. Our results showed that the nine immune-related lncRNAs signature has prognostic value for anaplastic gliomas.

Next-generation sequencing identifies deregulation of microRNAs involved in both innate and adaptive immune response in ALK+ ALCL.

PubMed

Steinhilber, Julia; Bonin, Michael; Walter, Michael; Fend, Falko; Bonzheim, Irina; Quintanilla-Martinez, Leticia

2015-01-01

Anaplastic large cell lymphoma (ALCL) is divided into two systemic diseases according to the expression of the anaplastic lymphoma kinase (ALK). We investigated the differential expression of miRNAs between ALK+ ALCL, ALK- ALCL cells and normal T-cells using next generation sequencing (NGS). In addition, a C/EBPβ-dependent miRNA profile was generated. The data were validated in primary ALCL cases. NGS identified 106 miRNAs significantly differentially expressed between ALK+ and ALK- ALCL and 228 between ALK+ ALCL and normal T-cells. We identified a signature of 56 miRNAs distinguishing ALK+ ALCL, ALK- ALCL and T-cells. The top candidates significant differentially expressed between ALK+ and ALK- ALCL included 5 upregulated miRNAs: miR-340, miR-203, miR-135b, miR-182, miR-183; and 7 downregulated: miR-196b, miR-155, miR-146a, miR-424, miR-503, miR-424*, miR-542-3p. The miR-17-92 cluster was also upregulated in ALK+ cells. Additionally, we identified a signature of 3 miRNAs significantly regulated by the transcription factor C/EBPβ, which is specifically overexpressed in ALK+ ALCL, including the miR-181 family. Of interest, miR-181a, which regulates T-cell differentiation and modulates TCR signalling strength, was significantly downregulated in ALK+ ALCL cases. In summary, our data reveal a miRNA signature linking ALK+ ALCL to a deregulated immune response and may reflect the abnormal TCR antigen expression known in ALK+ ALCL.

Genetic selection of cattle for improved immunity and health.

PubMed

Mallard, Bonnie A; Emam, Mehdi; Paibomesai, Marlene; Thompson-Crispi, Kathleen; Wagter-Lesperance, Lauraine

2015-02-01

The immune system is a sensing structure composed of tissues and molecules that are well integrated with the neuroendocrine system. This integrate system ensures non-self from self-discrimination. In this capacity the immune system provides detection and protection from a wide range of pathogens. In mammals, the immune system is regulated by several thousand genes (8-9% of the genome) which indicate its high genetic priority as a critical fitness trait providing survival of the species. Identifying and selectively breeding livestock with the inherent ability to make superior immune responses can reduce disease occurrence, improve milk quality and increase farm profitability. Healthier animals also may be expected to demonstrate improvements in other traits, including reproductive fitness. Using the University of Guelph's patented High Immune Response technology it is possible to classify animals as high, average, or low responders based on their genetic estimated breeding value for immune responsiveness. High responders have the inherent ability to produce more balanced and robust immune responses compared with average or low responders. High responders dairy cattle essentially have about one-half the disease occurrence of low responders, and can pass their superior immune response genes on to future generations thereby accumulating health benefits within the dairy herd.

Integrated Immune Experiment

NASA Technical Reports Server (NTRS)

Crucian, Brian

2009-01-01

This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

Molecular Profiling of Phagocytic Immune Cells in Anopheles gambiae Reveals Integral Roles for Hemocytes in Mosquito Innate Immunity*

PubMed Central

Smith, Ryan C.; King, Jonas G.; Tao, Dingyin; Zeleznik, Oana A.; Brando, Clara; Thallinger, Gerhard G.; Dinglasan, Rhoel R.

2016-01-01

The innate immune response is highly conserved across all eukaryotes and has been studied in great detail in several model organisms. Hemocytes, the primary immune cell population in mosquitoes, are important components of the mosquito innate immune response, yet critical aspects of their biology have remained uncharacterized. Using a novel method of enrichment, we isolated phagocytic granulocytes and quantified their proteomes by mass spectrometry. The data demonstrate that phagocytosis, blood-feeding, and Plasmodium falciparum infection promote dramatic shifts in the proteomic profiles of An. gambiae granulocyte populations. Of interest, large numbers of immune proteins were induced in response to blood feeding alone, suggesting that granulocytes have an integral role in priming the mosquito immune system for pathogen challenge. In addition, we identify several granulocyte proteins with putative roles as membrane receptors, cell signaling, or immune components that when silenced, have either positive or negative effects on malaria parasite survival. Integrating existing hemocyte transcriptional profiles, we also compare differences in hemocyte transcript and protein expression to provide new insight into hemocyte gene regulation and discuss the potential that post-transcriptional regulation may be an important component of hemocyte gene expression. These data represent a significant advancement in mosquito hemocyte biology, providing the first comprehensive proteomic profiling of mosquito phagocytic granulocytes during homeostasis blood-feeding, and pathogen challenge. Together, these findings extend current knowledge to further illustrate the importance of hemocytes in shaping mosquito innate immunity and their principal role in defining malaria parasite survival in the mosquito host. PMID:27624304

Addressing immunization registry population inflation in adolescent immunization rates.

PubMed

Robison, Steve G

2015-01-01

While U.S. adolescent immunization rates are available annually at national and state levels, finding pockets of need may require county or sub-county information. Immunization information systems (IISs) are one tool for assessing local immunization rates. However, the presence of IIS records dating back to early childhood and challenges in capturing mobility out of IIS areas typically leads to denominator inflation. We examined the feasibility of weighting adolescent immunization records by length of time since last report to produce more accurate county adolescent counts and immunization rates. We compared weighted and unweighted adolescent denominators from the Oregon ALERT IIS, along with county-level Census Bureau estimates, with school enrollment counts from Oregon's annual review of seventh-grade school immunization compliance for public and private schools. Adolescent immunization rates calculated using weighted data, for the state as a whole, were also checked against comparable National Immunization Survey (NIS) rates. Weighting individual records by the length of time since last activity substantially improved the fit of IIS data to county populations for adolescents. A nonlinear logarithmic (ogive) weight produced the best fit to the school count data of all examined estimates. Overall, the ogive weighted results matched NIS adolescent rates for Oregon. The problem of mobility-inflated counts of teenagers can be addressed by weighting individual records based on time since last immunization. Well-populated IISs can rely on their own data to produce adolescent immunization rates and find pockets of need.

Homeostatic effect of laughter on diabetic cardiovascular complications: The myth turned to fact.

PubMed

Noureldein, Mohamed H; Eid, Assaad A

2018-01-01

Laughter has been used for centuries to alleviate pain in morbid conditions. It was not until 1976 that scientists thought about laughter as a form of therapy that can modulate hormonal and immunological parameters that affect the outcome of many serious diseases. Moreover, laughter therapy was shown to be beneficial in type 2 diabetes mellitus (T2DM) by delaying the onset of many diabetic complications. Laughter is also described to influence the cardiovascular and endothelial functions and thus may protect against diabetic cardiovascular complications. In this review, we outline the different biochemical, physiological and immunological mechanisms by which laughter may influence the overall state of wellbeing and enhance disease prognosis. We also focus on the biological link between laughter therapy and diabetic cardiovascular complications as well as the underlying mechanisms involved in T2DM. Reviewing all the essential databases for "laughter" and "type 2 diabetes mellitus". Although laughter therapy is still poorly investigated, recent studies show that laughter may retard the onset of diabetic complications, enhance cardiovascular functions and rectify homeostatic abnormalities associated with T2DM. Laughter therapy is effective in delaying diabetic complications and should be used as an adjuvant therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Metabolic Induction of Trained Immunity through the Mevalonate Pathway.

PubMed

Bekkering, Siroon; Arts, Rob J W; Novakovic, Boris; Kourtzelis, Ioannis; van der Heijden, Charlotte D C C; Li, Yang; Popa, Calin D; Ter Horst, Rob; van Tuijl, Julia; Netea-Maier, Romana T; van de Veerdonk, Frank L; Chavakis, Triantafyllos; Joosten, Leo A B; van der Meer, Jos W M; Stunnenberg, Henk; Riksen, Niels P; Netea, Mihai G

2018-01-11

Innate immune cells can develop long-term memory after stimulation by microbial products during infections or vaccinations. Here, we report that metabolic signals can induce trained immunity. Pharmacological and genetic experiments reveal that activation of the cholesterol synthesis pathway, but not the synthesis of cholesterol itself, is essential for training of myeloid cells. Rather, the metabolite mevalonate is the mediator of training via activation of IGF1-R and mTOR and subsequent histone modifications in inflammatory pathways. Statins, which block mevalonate generation, prevent trained immunity induction. Furthermore, monocytes of patients with hyper immunoglobulin D syndrome (HIDS), who are mevalonate kinase deficient and accumulate mevalonate, have a constitutive trained immunity phenotype at both immunological and epigenetic levels, which could explain the attacks of sterile inflammation that these patients experience. Unraveling the role of mevalonate in trained immunity contributes to our understanding of the pathophysiology of HIDS and identifies novel therapeutic targets for clinical conditions with excessive activation of trained immunity. Copyright © 2017 Elsevier Inc. All rights reserved.

Changes in Nutritional Status Impact Immune Cell Metabolism and Function.

PubMed

Alwarawrah, Yazan; Kiernan, Kaitlin; MacIver, Nancie J

2018-01-01

Immune cell function and metabolism are closely linked. Many studies have now clearly demonstrated that alterations in cellular metabolism influence immune cell function and that, conversely, immune cell function determines the cellular metabolic state. Less well understood, however, are the effects of systemic metabolism or whole organism nutritional status on immune cell function and metabolism. Several studies have demonstrated that undernutrition is associated with immunosuppression, which leads to both increased susceptibility to infection and protection against several types of autoimmune disease, whereas overnutrition is associated with low-grade, chronic inflammation that increases the risk of metabolic and cardiovascular disease, promotes autoreactivity, and disrupts protective immunity. Here, we review the effects of nutritional status on immunity and highlight the effects of nutrition on circulating cytokines and immune cell populations in both human studies and mouse models. As T cells are critical members of the immune system, which direct overall immune response, we will focus this review on the influence of systemic nutritional status on T cell metabolism and function. Several cytokines and hormones have been identified which mediate the effects of nutrition on T cell metabolism and function through the expression and action of key regulatory signaling proteins. Understanding how T cells are sensitive to both inadequate and overabundant nutrients may enhance our ability to target immune cell metabolism and alter immunity in both malnutrition and obesity.

EDA-Fibronectin Originating from Osteoblasts Inhibits the Immune Response against Cancer

PubMed Central

Rossnagl, Stephanie; Altrock, Eva; Sens, Carla; Kraft, Sabrina; Rau, Katrin; Giese, Thomas; Samstag, Yvonne; Nakchbandi, Inaam A.

2016-01-01

Osteoblasts lining the inner surface of bone support hematopoietic stem cell differentiation by virtue of proximity to the bone marrow. The osteoblasts also modify their own differentiation by producing various isoforms of fibronectin (FN). Despite evidence for immune regulation by osteoblasts, there is limited knowledge of how osteoblasts modulate cells of the immune system. Here, we show that extra domain A (EDA)-FN produced by osteoblasts increases arginase production in myeloid-derived cells, and we identify α5β1 as the mediating receptor. In different mouse models of cancer, osteoblasts or EDA-FN was found to up-regulate arginase-1 expression in myeloid-derived cells, resulting in increased cancer growth. This harmful effect can be reduced by interfering with the integrin α5β1 receptor or inhibiting arginase. Conversely, in tissue injury, the expression of arginase-1 is normally beneficial as it dampens the immune response to allow wound healing. We show that EDA-FN protects against excessive fibrotic tissue formation in a liver fibrosis model. Our results establish an immune regulatory function for EDA-FN originating from the osteoblasts and identify new avenues for enhancing the immune reaction against cancer. PMID:27653627

Parasitoid wasp venom SERCA regulates Drosophila calcium levels and inhibits cellular immunity.

PubMed

Mortimer, Nathan T; Goecks, Jeremy; Kacsoh, Balint Z; Mobley, James A; Bowersock, Gregory J; Taylor, James; Schlenke, Todd A

2013-06-04

Because parasite virulence factors target host immune responses, identification and functional characterization of these factors can provide insight into poorly understood host immune mechanisms. The fruit fly Drosophila melanogaster is a model system for understanding humoral innate immunity, but Drosophila cellular innate immune responses remain incompletely characterized. Fruit flies are regularly infected by parasitoid wasps in nature and, following infection, flies mount a cellular immune response culminating in the cellular encapsulation of the wasp egg. The mechanistic basis of this response is largely unknown, but wasps use a mixture of virulence proteins derived from the venom gland to suppress cellular encapsulation. To gain insight into the mechanisms underlying wasp virulence and fly cellular immunity, we used a joint transcriptomic/proteomic approach to identify venom genes from Ganaspis sp.1 (G1), a previously uncharacterized Drosophila parasitoid species, and found that G1 venom contains a highly abundant sarco/endoplasmic reticulum calcium ATPase (SERCA) pump. Accordingly, we found that fly immune cells termed plasmatocytes normally undergo a cytoplasmic calcium burst following infection, and that this calcium burst is required for activation of the cellular immune response. We further found that the plasmatocyte calcium burst is suppressed by G1 venom in a SERCA-dependent manner, leading to the failure of plasmatocytes to become activated and migrate toward G1 eggs. Finally, by genetically manipulating plasmatocyte calcium levels, we were able to alter fly immune success against G1 and other parasitoid species. Our characterization of parasitoid wasp venom proteins led us to identify plasmatocyte cytoplasmic calcium bursts as an important aspect of fly cellular immunity.

Vaccines and the infant's immune system--what nurses need to know.

PubMed

Heurter, Helen; Langman, Eileen

2005-01-01

Vaccines prevent serious infections by stimulating the immune system to identify and destroy invading organisms rapidly before they have a chance to cause disease. Armed with the scientific facts to refute current misconceptions surrounding vaccines and the infant's immune system, nurses can provide parents with the answers they need.

Skin immune sentinels in health and disease

PubMed Central

Nestle, Frank O.; Di Meglio, Paola; Qin, Jian-Zhong; Nickoloff, Brian J.

2010-01-01

Human skin and its immune cells provide essential protection of the human body from injury and infection. Recent studies reinforce the importance of keratinocytes as sensors of danger through alert systems such as the inflammasome. In addition, newly identified CD103+ dendritic cells are strategically positioned for cross-presentation of skin-tropic pathogens and accumulating data highlight a key role of tissue-resident rather than circulating T cells in skin homeostasis and pathology. This Review focuses on recent progress in dissecting the functional role of skin immune cells in skin disease. PMID:19763149

Skin immune sentinels in health and disease.

PubMed

Nestle, Frank O; Di Meglio, Paola; Qin, Jian-Zhong; Nickoloff, Brian J

2009-10-01

Human skin and its immune cells provide essential protection of the human body from injury and infection. Recent studies reinforce the importance of keratinocytes as sensors of danger through alert systems such as the inflammasome. In addition, newly identified CD103(+) dendritic cells are strategically positioned for cross-presentation of skin-tropic pathogens and accumulating data highlight a key role of tissue-resident rather than circulating T cells in skin homeostasis and pathology. This Review focuses on recent progress in dissecting the functional role of skin immune cells in skin disease.

Survey of Innate Immune Responses to Burkholderia pseudomallei in Human Blood Identifies a Central Role for Lipopolysaccharide

PubMed Central

Chantratita, Narisara; Tandhavanant, Sarunporn; Myers, Nicolle D.; Seal, Sudeshna; Arayawichanont, Arkhom; Kliangsa-ad, Aroonsri; Hittle, Lauren E.; Ernst, Robert K.; Emond, Mary J.; Wurfel, Mark M.; Day, Nicholas P. J.; Peacock, Sharon J.; West, T. Eoin

2013-01-01

B. pseudomallei is a gram-negative bacterium that causes the tropical infection melioidosis. In northeast Thailand, mortality from melioidosis approaches 40%. As exemplified by the lipopolysaccharide-Toll-like receptor 4 interaction, innate immune responses to invading bacteria are precipitated by activation of host pathogen recognition receptors by pathogen associated molecular patterns. Human melioidosis is characterized by up-regulation of pathogen recognition receptors and pro-inflammatory cytokine release. In contrast to many gram-negative pathogens, however, the lipopolysaccharide of B. pseudomallei is considered only weakly inflammatory. We conducted a study in 300 healthy Thai subjects to investigate the ex vivo human blood response to various bacterial pathogen associated molecular patterns, including lipopolysaccharide from several bacteria, and to two heat-killed B. pseudomallei isolates. We measured cytokine levels after stimulation of fresh whole blood with a panel of stimuli. We found that age, sex, and white blood cell count modulate the innate immune response to B. pseudomallei. We further observed that, in comparison to other stimuli, the innate immune response to B. pseudomallei is most highly correlated with the response to lipopolysaccharide. The magnitude of cytokine responses induced by B. pseudomallei lipopolysaccharide was significantly greater than those induced by lipopolysaccharide from Escherichia coli and comparable to many responses induced by lipopolysaccharide from Salmonella minnesota despite lower amounts of lipid A in the B. pseudomallei lipopolysaccharide preparation. In human monocytes stimulated with B. pseudomallei, addition of polymyxin B or a TLR4/MD-2 neutralizing antibody inhibited the majority of TNF-α production. Challenging existing views, our data indicate that the innate immune response to B. pseudomallei in human blood is largely driven by lipopolysaccharide, and that the response to B. pseudomallei

Expression Dynamics of Innate Immunity in Influenza Virus-Infected Swine

PubMed Central

Montoya, María; Foni, Emanuela; Solórzano, Alicia; Razzuoli, Elisabetta; Baratelli, Massimiliano; Bilato, Dania; Córdoba, Lorena; del Burgo, Maria Angeles Martín; Martinez, Jorge; Martinez-Orellana, Pamela; Chiapponi, Chiara; Perlin, David S.; del Real, Gustavo; Amadori, Massimo

2017-01-01

The current circulating swine influenza virus (IV) subtypes in Europe (H1N1, H1N2, and H3N2) are associated with clinical outbreaks of disease. However, we showed that pigs could be susceptible to other IV strains that are able to cross the species barrier. In this work, we extended our investigations into whether different IV strains able to cross the species barrier might give rise to different innate immune responses that could be associated with pathological lesions. For this purpose, we used the same samples collected in a previous study of ours, in which healthy pigs had been infected with a H3N2 Swine IV and four different H3N8 IV strains circulating in different animal species. Pigs had been clinically inspected and four subjects/group were sacrificed at 3, 6, and 21 days post infection. In the present study, all groups but mock exhibited antibody responses to IV nucleoprotein protein. Pulmonary lesions and high-titered viral replication were observed in pigs infected with the swine-adapted virus. Interestingly, pigs infected with avian and seal H3N8 strains also showed moderate lesions and viral replication, whereas equine and canine IVs did not cause overt pathological signs, and replication was barely detectable. Swine IV infection induced interferon (IFN)-alpha and interleukin-6 responses in bronchoalveolar fluids (BALF) at day 3 post infection, as opposed to the other non-swine-adapted virus strains. However, IFN-alpha responses to the swine-adapted virus were not associated with an increase of the local, constitutive expression of IFN-alpha genes. Remarkably, the Equine strain gave rise to a Serum Amyloid A response in BALF despite little if any replication. Each virus strain could be associated with expression of cytokine genes and/or proteins after infection. These responses were observed well beyond the period of virus replication, suggesting a prolonged homeostatic imbalance of the innate immune system. PMID:28484702

A gene associated with social immunity in the burying beetle Nicrophorus vespilloides

PubMed Central

Palmer, William J.; Duarte, Ana; Schrader, Matthew; Day, Jonathan P.; Kilner, Rebecca; Jiggins, Francis M.

2016-01-01

Some group-living species exhibit social immunity, where the immune response of one individual can protect others in the group from infection. In burying beetles, this is part of parental care. Larvae feed on vertebrate carcasses which their parents smear with exudates that inhibit microbial growth. We have sequenced the transcriptome of the burying beetle Nicrophorus vespilloides and identified six genes that encode lysozymes—a type of antimicrobial enzyme that has previously been implicated in social immunity in burying beetles. When females start breeding and producing antimicrobial anal exudates, we found that the expression of one of these genes was increased by approximately 1000 times to become one of the most abundant transcripts in the transcriptome. Females varied considerably in the antimicrobial properties of their anal exudates, and this was strongly correlated with the expression of this lysozyme. We conclude that we have likely identified a gene encoding a key effector molecule in social immunity and that it was recruited during evolution from a function in personal immunity. PMID:26817769

Design principles of paradoxical signaling in the immune system

NASA Astrophysics Data System (ADS)

Hart, Yuval

A widespread feature of cell-cell signaling systems is paradoxical pleiotropy: the same secreted signaling molecule can induce opposite effects in the responding cells. For example, the cytokine IL-2 can promote proliferation and death of T-cells. The role of such paradoxical signaling remains unclear. We suggest that this mechanism provides homeostatic concentration of cells, independent of initial conditions. The crux of the paradoxical mechanism is the combination of a positive and a negative feedback loops creating two stable states - an OFF state and an ON state. Experimentally, we found that CD4 + cells grown in culture with a 30-fold difference in initial concentrations reached a homeostatic concentration nearly independent of initial cell levels (ON-state). Below an initial threshold, cell density decayed to extinction (OFF-state). Mathematical modeling explained the observed cell and cytokine dynamics and predicted conditions that shifted cell fate from homeostasis to the OFF-state. We suggest that paradoxical signaling provides cell circuits with specific dynamical features that are robust to environmental perturbations.

A review of the immune molecules in the sea cucumber.

PubMed

Xue, Zhuang; Li, Hui; Wang, Xiuli; Li, Xia; Liu, Yang; Sun, Jing; Liu, Cenjie

2015-05-01

It is very important to identify and characterize the immune-related genes that respond to pathogens. Until recently, only some of the immune-related genes in sea cucumbers had been characterized. Their expression patterns after pathogen challenges have been analyzed via expressed sequence tag libraries, microarray studies and proteomic approaches. These genes include lectins, antimicrobial peptides, lysozyme, enzymes, clotting protein, pattern recognition proteins, Toll receptors, complement C3 and other humoral factors that might participate in the innate immune system of sea cucumbers. Although the participation of some of these immune molecules in the sea cucumber's innate immune defense against invading pathogens has been demonstrated, the functions of many of the molecules remain unclear. This review focuses on the discovery and functional characterization of the immune-related molecules from the sea cucumber for the first time and provides new insights into the immune mechanisms of the sea cucumber, which opens new possibilities for developing drugs for novel anti-bacterial and antiviral applications in fisheries. Copyright © 2015 Elsevier Ltd. All rights reserved.

Parent opinions about use of text messaging for immunization reminders.

PubMed

Ahlers-Schmidt, Carolyn Rose; Chesser, Amy K; Paschal, Angelia M; Hart, Traci A; Williams, Katherine S; Yaghmai, Beryl; Shah-Haque, Sapna

2012-06-06

remaining 37.5% (73/200) regarded barriers; however, no barriers could be identified by 26% of participants (13/50). Parents made 172 comments regarding preferred content of text-message immunization reminders. The most frequently discussed topics were date due (50/172, 29%), general reminder (26/172, 26%), and child's name (21/172, 12%). Most parents were satisfied with traditional communication; however, few had experienced any alternative forms of communication regarding immunizations. Benefits of receiving text messages for immunization reminders far outweighed the barriers identified by parents. Few barriers identified were text specific. Those that were, centered on cost if parents did not have unlimited texting plans.

Impact of the raising immunizations safely and effectively (RISE) program on healthcare worker influenza immunization rates in long term care settings.

PubMed

Nace, David A; Handler, Steven M; Hoffman, Erika L; Perera, Subashan

2012-11-01

National influenza immunization rates for healthcare workers (HCW) in long-term care (LTC) remain unacceptably low. This poses a serious public health threat to residents. Prior work has suggested high staff turnover rates as a contributing factor to low immunization rates. There is a critical need to identify and deploy successful models of HCW influenza immunization programs to LTC facilities. This report describes one potential model that has been successfully initiated in a network of LTC facilities. All facilities served by a single regional LTC pharmacy were invited to participate in a HCW influenza immunization program. This voluntary immunization program began in 2005 and continues to the present. As part of the program, the pharmacy promoted organizational change by assuming oversight and control of HCW immunization policies and processes for all facilities. Primary and secondary outcomes are the number of facilities reaching HCW influenza immunization rates of 60% and 80%. Fourteen of the 16 LTC facilities participated. Facilities were diverse and included both nursing and assisted living facilities; unionized and nonunionized facilities; and urban, suburban, and rural facilities. The pharmacy provided educational and communication materials, centralized data collection using a standardized definition for HCW immunization rates, and facility feedback. All 14 LTC facilities achieved the primary goal of 60% and nearly two thirds reached the secondary goal of 80%. Twenty percent reached the new Healthy People 2020 goal of 90%. It is possible for LTC facilities to improve HCW immunization rates using a pharmacy based, voluntary HCW influenza immunization approach. Such an approach may help attenuate the negative influence of staff turnover on HCW immunizations. Attainment of the new Health People 2020 goals still remains a challenge and may require mandatory programs. Copyright © 2012 American Medical Directors Association, Inc. Published by Elsevier Inc

The Immune Landscape of Cancer.

PubMed

Thorsson, Vésteinn; Gibbs, David L; Brown, Scott D; Wolf, Denise; Bortone, Dante S; Ou Yang, Tai-Hsien; Porta-Pardo, Eduard; Gao, Galen F; Plaisier, Christopher L; Eddy, James A; Ziv, Elad; Culhane, Aedin C; Paull, Evan O; Sivakumar, I K Ashok; Gentles, Andrew J; Malhotra, Raunaq; Farshidfar, Farshad; Colaprico, Antonio; Parker, Joel S; Mose, Lisle E; Vo, Nam Sy; Liu, Jianfang; Liu, Yuexin; Rader, Janet; Dhankani, Varsha; Reynolds, Sheila M; Bowlby, Reanne; Califano, Andrea; Cherniack, Andrew D; Anastassiou, Dimitris; Bedognetti, Davide; Rao, Arvind; Chen, Ken; Krasnitz, Alexander; Hu, Hai; Malta, Tathiane M; Noushmehr, Houtan; Pedamallu, Chandra Sekhar; Bullman, Susan; Ojesina, Akinyemi I; Lamb, Andrew; Zhou, Wanding; Shen, Hui; Choueiri, Toni K; Weinstein, John N; Guinney, Justin; Saltz, Joel; Holt, Robert A; Rabkin, Charles E; Lazar, Alexander J; Serody, Jonathan S; Demicco, Elizabeth G; Disis, Mary L; Vincent, Benjamin G; Shmulevich, Llya

2018-04-17

We performed an extensive immunogenomic analysis of more than 10,000 tumors comprising 33 diverse cancer types by utilizing data compiled by TCGA. Across cancer types, we identified six immune subtypes-wound healing, IFN-γ dominant, inflammatory, lymphocyte depleted, immunologically quiet, and TGF-β dominant-characterized by differences in macrophage or lymphocyte signatures, Th1:Th2 cell ratio, extent of intratumoral heterogeneity, aneuploidy, extent of neoantigen load, overall cell proliferation, expression of immunomodulatory genes, and prognosis. Specific driver mutations correlated with lower (CTNNB1, NRAS, or IDH1) or higher (BRAF, TP53, or CASP8) leukocyte levels across all cancers. Multiple control modalities of the intracellular and extracellular networks (transcription, microRNAs, copy number, and epigenetic processes) were involved in tumor-immune cell interactions, both across and within immune subtypes. Our immunogenomics pipeline to characterize these heterogeneous tumors and the resulting data are intended to serve as a resource for future targeted studies to further advance the field. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Risk factors for delayed immunization among children in an HMO.

PubMed

Lieu, T A; Black, S B; Ray, P; Chellino, M; Shinefield, H R; Adler, N E

1994-10-01

Improving the timely delivery of childhood immunizations has become a national imperative. This study aimed to identify nonfinancial predictors of delayed immunization among patients with good financial access to preventive care. This prospective cohort study used telephone interviews and a computerized immunization tracking system to evaluate 13-month-old children (n = 530) in a regional group-model health maintenance organization. More than one third of parents interviewed did not know when the next immunization was due. Thirteen percent were late for the measles-mumps-rubella immunization, recommended at 15 months of age, by 90 days or more. Independent predictors of delayed immunization included having a larger number of children (odds ratio [OR] = 1.4, P < .01), not having a regular doctor (OR = 2.9, P < .05), not knowing when the shot was due (OR = 2.0, P < .01), and not worrying about the risks of shots (OR = 1.4, P < .05). Financial access alone does not guarantee timely childhood immunization. In managed care settings, which may cover increasing numbers of children under health care reform, interventions are needed to better inform parents of when immunizations are due.

Sovereign immunity: Principles and application in medical malpractice.

PubMed

Suk, Michael

2012-05-01

Tort law seeks accountability when parties engage in negligent conduct, and aims to compensate the victims of such conduct. An exception to this general rule governing medical negligence is the doctrine of sovereign immunity. Historically, individuals acting under the authority of the government or other sovereign entity had almost complete protection against tort liability. This article addressed the following: (1) the development of sovereign immunity in law, (2) the lasting impact of the Federal Tort Claims Act on sovereign immunity, and (3) the contemporary application of sovereign immunity to medical malpractice, using case examples from Virginia and Florida. I performed an Internet search to identify sources that addressed the concept of sovereign immunity, followed by a focused search for relevant articles in PubMed and LexisNexis, literature databases for medical and legal professionals, respectively. Historically, sovereign liability conferred absolute immunity from lawsuits in favor of the sovereign (ie, the government). Practical considerations in our democratic system have contributed to an evolution of this doctrine. Understanding sovereign immunity and its contemporary application are of value for any physician interested in the debate concerning medical malpractice in the United States. Under certain circumstances, physicians working as employees of the federal or state government may be protected against individual liability if the government is substituted as the defendant.

Immune complexome analysis reveals the specific and frequent presence of immune complex antigens in lung cancer patients: A pilot study.

PubMed

Ohyama, Kaname; Yoshimi, Haruka; Aibara, Nozomi; Nakamura, Yoichi; Miyata, Yasuyoshi; Sakai, Hideki; Fujita, Fumihiko; Imaizumi, Yoshitaka; Chauhan, Anil K; Kishikawa, Naoya; Kuroda, Naotaka

2017-01-15

Cancer immunotherapies such as antibodies targeting T cell checkpoints, or adaptive tumor-infiltrating lymphocyte (TIL) transfer, have been developed to boost the endogenous immune response against human malignancies. However, activation of T cells by such antibodies can lead to the risk of autoimmune diseases. Also, the selection of tumor-reactive T cells for TIL relies on information regarding mutated antigens in tumors and does not reflect other factors involved in protein antigenicity. It is therefore essential to engineer therapeutic interventions by which T cell reactivity against tumor cells is selectively enhanced (i.e., "focused cancer immunotherapy") based on tumor antigens that are specifically expressed in the tumor of a certain cancer and in many patients with this cancer. Immune complexes (ICs) are the direct and stable products of immunological recognition by humoral immunity. Here, we searched for tumor-specific IC antigens in each of five cancers (lung (n = 28), colon (n = 20), bladder (n = 20), renal cell (n = 15) and malignant lymphoma (n = 9)), by using immune complexome analysis that comprehensively identifies and profiles the constituent antigens in ICs. This analysis indicated that gelsolin and inter-alpha-trypsin inhibitor heavy chains were specifically and frequently detected (at a frequency higher than 80%), and that phosphoproteins (VENTX, VCIP135) were also specifically present in the ICs of lung cancer patients. Immune complexome analysis successfully identified several tumor-specific IC antigens with high detection frequency in lung cancer patients. These specific antigens are required to validate the clinical benefit by further analysis using a large number of patients. © 2016 UICC.

The flip side of immune surveillance: immune dependency.

PubMed

Prehn, Richmond T; Prehn, Liisa M

2008-04-01

The growths of many and perhaps all tumors may be stimulated rather than inhibited by a quantitatively low level of immunity. The reason tumors have antigens may be that tumors do not develop in vivo in the absence of at least a minimal immune reaction; in this sense, cancer may be considered an autoimmune disease. This review, based largely on the work of our own laboratory, outlines the data showing that the titration of anti-tumor immunity exhibits the phenomenon of hormesis, i.e. the dose-response curve is non-linear such that low levels of immunity are generally stimulatory but larger quantities of the same immune reactants may inhibit tumor growth. Evidence is also reviewed that suggests that the immune response may vary qualitatively and quantitatively during progression, such that there seems to be, during oncogenesis, a very low level of immune reaction that aids initial tumor growth, followed by a larger reaction that may cause remission of early neoplasms, followed, if the neoplasm survives, by a relative immunologic tolerance to the tumor that may be dependent, at least in part, on suppressor cells. This knowledge may help to explain some clinical observations concerning the relationships among tumor types and the organ distribution of metastases.

Hepatitis B Virus Infection and Immunizations among Asian American College Students: Infection, Exposure, and Immunity Rates

ERIC Educational Resources Information Center

Lee, Haeok; Kiang, Peter; Watanabe, Paul; Halon, Patricia; Shi, Ling; Church, Daniel R.

2013-01-01

Objectives: To evaluate the prevalence of hepatitis B virus (HBV) infection, exposure, and immunity among Asian American college students as a basis for evaluating HBV screening and vaccination policy. Participants and Methods: Self-identified Asian American college students aged 18 years or older were examined. Serological tests of HBV surface…

Effector T Helper Cell Subsets in Inflammatory Bowel Diseases

PubMed Central

Imam, Tanbeena; Park, Sungtae; Kaplan, Mark H.; Olson, Matthew R.

2018-01-01

The gastrointestinal tract is a site of high immune challenge, as it must maintain a delicate balance between tolerating luminal contents and generating an immune response toward pathogens. CD4+ T cells are key in mediating the host protective and homeostatic responses. Yet, CD4+ T cells are also known to be the main drivers of inflammatory bowel disease (IBD) when this balance is perturbed. Many subsets of CD4+ T cells have been identified as players in perpetuating chronic intestinal inflammation. Over the last few decades, understanding of how each subset of Th cells plays a role has dramatically increased. Simultaneously, this has allowed development of therapeutic innovation targeting specific molecules rather than broad immunosuppressive agents. Here, we review the emerging evidence of how each subset functions in promoting and sustaining the chronic inflammation that characterizes IBD.

Predictive Virtual Infection Modeling of Fungal Immune Evasion in Human Whole Blood.

PubMed

Prauße, Maria T E; Lehnert, Teresa; Timme, Sandra; Hünniger, Kerstin; Leonhardt, Ines; Kurzai, Oliver; Figge, Marc Thilo

2018-01-01

Bloodstream infections by the human-pathogenic fungi Candida albicans and Candida glabrata increasingly occur in hospitalized patients and are associated with high mortality rates. The early immune response against these fungi in human blood comprises a concerted action of humoral and cellular components of the innate immune system. Upon entering the blood, the majority of fungal cells will be eliminated by innate immune cells, i.e., neutrophils and monocytes. However, recent studies identified a population of fungal cells that can evade the immune response and thereby may disseminate and cause organ dissemination, which is frequently observed during candidemia. In this study, we investigate the so far unresolved mechanism of fungal immune evasion in human whole blood by testing hypotheses with the help of mathematical modeling. We use a previously established state-based virtual infection model for whole-blood infection with C. albicans to quantify the immune response and identified the fungal immune-evasion mechanism. While this process was assumed to be spontaneous in the previous model, we now hypothesize that the immune-evasion process is mediated by host factors and incorporate such a mechanism in the model. In particular, we propose, based on previous studies that the fungal immune-evasion mechanism could possibly arise through modification of the fungal surface by as of yet unknown proteins that are assumed to be secreted by activated neutrophils. To validate or reject any of the immune-evasion mechanisms, we compared the simulation of both immune-evasion models for different infection scenarios, i.e., infection of whole blood with either C. albicans or C. glabrata under non-neutropenic and neutropenic conditions. We found that under non-neutropenic conditions, both immune-evasion models fit the experimental data from whole-blood infection with C. albicans and C. glabrata . However, differences between the immune-evasion models could be observed for the

Predictive Virtual Infection Modeling of Fungal Immune Evasion in Human Whole Blood

PubMed Central

Prauße, Maria T. E.; Lehnert, Teresa; Timme, Sandra; Hünniger, Kerstin; Leonhardt, Ines; Kurzai, Oliver; Figge, Marc Thilo

2018-01-01

Bloodstream infections by the human-pathogenic fungi Candida albicans and Candida glabrata increasingly occur in hospitalized patients and are associated with high mortality rates. The early immune response against these fungi in human blood comprises a concerted action of humoral and cellular components of the innate immune system. Upon entering the blood, the majority of fungal cells will be eliminated by innate immune cells, i.e., neutrophils and monocytes. However, recent studies identified a population of fungal cells that can evade the immune response and thereby may disseminate and cause organ dissemination, which is frequently observed during candidemia. In this study, we investigate the so far unresolved mechanism of fungal immune evasion in human whole blood by testing hypotheses with the help of mathematical modeling. We use a previously established state-based virtual infection model for whole-blood infection with C. albicans to quantify the immune response and identified the fungal immune-evasion mechanism. While this process was assumed to be spontaneous in the previous model, we now hypothesize that the immune-evasion process is mediated by host factors and incorporate such a mechanism in the model. In particular, we propose, based on previous studies that the fungal immune-evasion mechanism could possibly arise through modification of the fungal surface by as of yet unknown proteins that are assumed to be secreted by activated neutrophils. To validate or reject any of the immune-evasion mechanisms, we compared the simulation of both immune-evasion models for different infection scenarios, i.e., infection of whole blood with either C. albicans or C. glabrata under non-neutropenic and neutropenic conditions. We found that under non-neutropenic conditions, both immune-evasion models fit the experimental data from whole-blood infection with C. albicans and C. glabrata. However, differences between the immune-evasion models could be observed for the

The Role of the Immune System Beyond the Fight Against Infection.

PubMed

Sattler, Susanne

2017-01-01

The immune system was identified as a protective factor during infectious diseases over a century ago. Current definitions and textbook information are still largely influenced by these early observations, and the immune system is commonly presented as a defence machinery. However, host defence is only one manifestation of the immune system's overall function in the maintenance of tissue homeostasis and system integrity. In fact, the immune system is integral part of fundamental physiological processes such as development, reproduction and wound healing, and a close crosstalk between the immune system and other body systems such as metabolism, the central nervous system and the cardiovascular system is evident. Research and medical professionals in an expanding range of areas start to recognise the implications of the immune system in their respective fields.This chapter provides a brief historical perspective on how our understanding of the immune system has evolved from a defence system to an overarching surveillance machinery to maintain tissue integrity. Current perspectives on the non-defence functions of classical immune cells and factors will also be discussed.

Control of adaptive immunity by the innate immune system.

PubMed

Iwasaki, Akiko; Medzhitov, Ruslan

2015-04-01

Microbial infections are recognized by the innate immune system both to elicit immediate defense and to generate long-lasting adaptive immunity. To detect and respond to vastly different groups of pathogens, the innate immune system uses several recognition systems that rely on sensing common structural and functional features associated with different classes of microorganisms. These recognition systems determine microbial location, viability, replication and pathogenicity. Detection of these features by recognition pathways of the innate immune system is translated into different classes of effector responses though specialized populations of dendritic cells. Multiple mechanisms for the induction of immune responses are variations on a common design principle wherein the cells that sense infections produce one set of cytokines to induce lymphocytes to produce another set of cytokines, which in turn activate effector responses. Here we discuss these emerging principles of innate control of adaptive immunity.

HLA Immune Function Genes in Autism

PubMed Central

Torres, Anthony R.; Westover, Jonna B.; Rosenspire, Allen J.

2012-01-01

The human leukocyte antigen (HLA) genes on chromosome 6 are instrumental in many innate and adaptive immune responses. The HLA genes/haplotypes can also be involved in immune dysfunction and autoimmune diseases. It is now becoming apparent that many of the non-antigen-presenting HLA genes make significant contributions to autoimmune diseases. Interestingly, it has been reported that autism subjects often have associations with HLA genes/haplotypes, suggesting an underlying dysregulation of the immune system mediated by HLA genes. Genetic studies have only succeeded in identifying autism-causing genes in a small number of subjects suggesting that the genome has not been adequately interrogated. Close examination of the HLA region in autism has been relatively ignored, largely due to extraordinary genetic complexity. It is our proposition that genetic polymorphisms in the HLA region, especially in the non-antigen-presenting regions, may be important in the etiology of autism in certain subjects. PMID:22928105

Friends and foes of tuberculosis: modulation of protective immunity.

PubMed

Brighenti, Susanna; Joosten, Simone A

2018-05-27

Protective immunity in tuberculosis (TB) is subject of debate in the TB research community, as this is key to fully understand TB pathogenesis and to develop new promising tools for TB diagnosis and prognosis as well as a more efficient TB vaccine. IFN-γ producing CD4 + T cells are key in TB control, but may not be sufficient to provide protection. Additional subsets have been identified that contribute to protection such as multifunctional and cytolytic T cell subsets, including classical and non-classical T cells as well as novel innate immune cell subsets resulting from trained immunity. However, to define protective immune responses against TB, the complexity of balancing TB immunity also has to be considered. In this review, insights in effector cell immunity and how this is modulated by regulatory cells, associated comorbidities and the host microbiome is discussed. We systematically map how different suppressive immune cell subsets may affect effector cell responses at the local site of infection. We also dissect how common co-morbidities such as HIV, helminthes and diabetes may bias protective TB immunity towards pathogenic and regulatory responses. Finally, also the composition and diversity of the microbiome in the lung and gut could affect host TB immunity. Understanding these various aspects of the immunological balance in the human host is fundamental to prevent TB infection and disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The Complex Contributions of Genetics and Nutrition to Immunity in Drosophila melanogaster

PubMed Central

Unckless, Robert L.; Rottschaefer, Susan M.; Lazzaro, Brian P.

2015-01-01

Both malnutrition and undernutrition can lead to compromised immune defense in a diversity of animals, and “nutritional immunology” has been suggested as a means of understanding immunity and determining strategies for fighting infection. The genetic basis for the effects of diet on immunity, however, has been largely unknown. In the present study, we have conducted genome-wide association mapping in Drosophila melanogaster to identify the genetic basis for individual variation in resistance, and for variation in immunological sensitivity to diet (genotype-by-environment interaction, or GxE). D. melanogaster were reared for several generations on either high-glucose or low-glucose diets and then infected with Providencia rettgeri, a natural bacterial pathogen of D. melanogaster. Systemic pathogen load was measured at the peak of infection intensity, and several indicators of nutritional status were taken from uninfected flies reared on each diet. We find that dietary glucose level significantly alters the quality of immune defense, with elevated dietary glucose resulting in higher pathogen loads. The quality of immune defense is genetically variable within the sampled population, and we find genetic variation for immunological sensitivity to dietary glucose (genotype-by-diet interaction). Immune defense was genetically correlated with indicators of metabolic status in flies reared on the high-glucose diet, and we identified multiple genes that explain variation in immune defense, including several that have not been previously implicated in immune response but which are confirmed to alter pathogen load after RNAi knockdown. Our findings emphasize the importance of dietary composition to immune defense and reveal genes outside the conventional “immune system” that can be important in determining susceptibility to infection. Functional variation in these genes is segregating in a natural population, providing the substrate for evolutionary response to