Sample records for identify specific differences

  1. Learning contextual gene set interaction networks of cancer with condition specificity

    PubMed Central

    2013-01-01

    Background Identifying similarities and differences in the molecular constitutions of various types of cancer is one of the key challenges in cancer research. The appearances of a cancer depend on complex molecular interactions, including gene regulatory networks and gene-environment interactions. This complexity makes it challenging to decipher the molecular origin of the cancer. In recent years, many studies reported methods to uncover heterogeneous depictions of complex cancers, which are often categorized into different subtypes. The challenge is to identify diverse molecular contexts within a cancer, to relate them to different subtypes, and to learn underlying molecular interactions specific to molecular contexts so that we can recommend context-specific treatment to patients. Results In this study, we describe a novel method to discern molecular interactions specific to certain molecular contexts. Unlike conventional approaches to build modular networks of individual genes, our focus is to identify cancer-generic and subtype-specific interactions between contextual gene sets, of which each gene set share coherent transcriptional patterns across a subset of samples, termed contextual gene set. We then apply a novel formulation for quantitating the effect of the samples from each subtype on the calculated strength of interactions observed. Two cancer data sets were analyzed to support the validity of condition-specificity of identified interactions. When compared to an existing approach, the proposed method was much more sensitive in identifying condition-specific interactions even in heterogeneous data set. The results also revealed that network components specific to different types of cancer are related to different biological functions than cancer-generic network components. We found not only the results that are consistent with previous studies, but also new hypotheses on the biological mechanisms specific to certain cancer types that warrant further investigations. Conclusions The analysis on the contextual gene sets and characterization of networks of interaction composed of these sets discovered distinct functional differences underlying various types of cancer. The results show that our method successfully reveals many subtype-specific regions in the identified maps of biological contexts, which well represent biological functions that can be connected to specific subtypes. PMID:23418942

  2. Knowledge-Assisted Approach to Identify Pathways with Differential Dependencies | Office of Cancer Genomics

    Cancer.gov

    We have previously developed a statistical method to identify gene sets enriched with condition-specific genetic dependencies. The method constructs gene dependency networks from bootstrapped samples in one condition and computes the divergence between distributions of network likelihood scores from different conditions. It was shown to be capable of sensitive and specific identification of pathways with phenotype-specific dysregulation, i.e., rewiring of dependencies between genes in different conditions.

  3. Genetic Factors in Systemic Lupus Erythematosus: Contribution to Disease Phenotype

    PubMed Central

    Ceccarelli, Fulvia; Perricone, Carlo; Borgiani, Paola; Ciccacci, Cinzia; Rufini, Sara; Cipriano, Enrica; Alessandri, Cristiano; Spinelli, Francesca Romana; Sili Scavalli, Antonio; Novelli, Giuseppe; Valesini, Guido; Conti, Fabrizio

    2015-01-01

    Genetic factors exert an important role in determining Systemic Lupus Erythematosus (SLE) susceptibility, interplaying with environmental factors. Several genetic studies in various SLE populations have identified numerous susceptibility loci. From a clinical point of view, SLE is characterized by a great heterogeneity in terms of clinical and laboratory manifestations. As widely demonstrated, specific laboratory features are associated with clinical disease subset, with different severity degree. Similarly, in the last years, an association between specific phenotypes and genetic variants has been identified, allowing the possibility to elucidate different mechanisms and pathways accountable for disease manifestations. However, except for Lupus Nephritis (LN), no studies have been designed to identify the genetic variants associated with the development of different phenotypes. In this review, we will report data currently known about this specific association. PMID:26798662

  4. Analysis of evolutionary conservation patterns and their influence on identifying protein functional sites.

    PubMed

    Fang, Chun; Noguchi, Tamotsu; Yamana, Hayato

    2014-10-01

    Evolutionary conservation information included in position-specific scoring matrix (PSSM) has been widely adopted by sequence-based methods for identifying protein functional sites, because all functional sites, whether in ordered or disordered proteins, are found to be conserved at some extent. However, different functional sites have different conservation patterns, some of them are linear contextual, some of them are mingled with highly variable residues, and some others seem to be conserved independently. Every value in PSSMs is calculated independently of each other, without carrying the contextual information of residues in the sequence. Therefore, adopting the direct output of PSSM for prediction fails to consider the relationship between conservation patterns of residues and the distribution of conservation scores in PSSMs. In order to demonstrate the importance of combining PSSMs with the specific conservation patterns of functional sites for prediction, three different PSSM-based methods for identifying three kinds of functional sites have been analyzed. Results suggest that, different PSSM-based methods differ in their capability to identify different patterns of functional sites, and better combining PSSMs with the specific conservation patterns of residues would largely facilitate the prediction.

  5. Tissue Non-Specific Genes and Pathways Associated with Diabetes: An Expression Meta-Analysis.

    PubMed

    Mei, Hao; Li, Lianna; Liu, Shijian; Jiang, Fan; Griswold, Michael; Mosley, Thomas

    2017-01-21

    We performed expression studies to identify tissue non-specific genes and pathways of diabetes by meta-analysis. We searched curated datasets of the Gene Expression Omnibus (GEO) database and identified 13 and five expression studies of diabetes and insulin responses at various tissues, respectively. We tested differential gene expression by empirical Bayes-based linear method and investigated gene set expression association by knowledge-based enrichment analysis. Meta-analysis by different methods was applied to identify tissue non-specific genes and gene sets. We also proposed pathway mapping analysis to infer functions of the identified gene sets, and correlation and independent analysis to evaluate expression association profile of genes and gene sets between studies and tissues. Our analysis showed that PGRMC1 and HADH genes were significant over diabetes studies, while IRS1 and MPST genes were significant over insulin response studies, and joint analysis showed that HADH and MPST genes were significant over all combined data sets. The pathway analysis identified six significant gene sets over all studies. The KEGG pathway mapping indicated that the significant gene sets are related to diabetes pathogenesis. The results also presented that 12.8% and 59.0% pairwise studies had significantly correlated expression association for genes and gene sets, respectively; moreover, 12.8% pairwise studies had independent expression association for genes, but no studies were observed significantly different for expression association of gene sets. Our analysis indicated that there are both tissue specific and non-specific genes and pathways associated with diabetes pathogenesis. Compared to the gene expression, pathway association tends to be tissue non-specific, and a common pathway influencing diabetes development is activated through different genes at different tissues.

  6. Many Routes to an Antibody Heavy-Chain CDR3: Necessary, Yet Insufficient, for Specific Binding

    DOE PAGES

    D'Angelo, Sara; Ferrara, Fortunato; Naranjo, Leslie; ...

    2018-03-08

    Because of its great potential for diversity, the immunoglobulin heavy-chain complementarity-determining region 3 (HCDR3) is taken as an antibody molecule’s most important component in conferring binding activity and specificity. For this reason, HCDR3s have been used as unique identifiers to investigate adaptive immune responses in vivo and to characterize in vitro selection outputs where display systems were employed. Here, we show that many different HCDR3s can be identified within a target-specific antibody population after in vitro selection. For each identified HCDR3, a number of different antibodies bearing differences elsewhere can be found. In such selected populations, all antibodies with themore » same HCDR3 recognize the target, albeit at different affinities. In contrast, within unselected populations, the majority of antibodies with the same HCDR3 sequence do not bind the target. In one HCDR3 examined in depth, all target-specific antibodies were derived from the same VDJ rearrangement, while non-binding antibodies with the same HCDR3 were derived from many different V and D gene rearrangements. Careful examination of previously published in vivo datasets reveals that HCDR3s shared between, and within, different individuals can also originate from rearrangements of different V and D genes, with up to 26 different rearrangements yielding the same identical HCDR3 sequence. On the basis of these observations, we conclude that the same HCDR3 can be generated by many different rearrangements, but that specific target binding is an outcome of unique rearrangements and VL pairing: the HCDR3 is necessary, albeit insufficient, for specific antibody binding.« less

  7. Many Routes to an Antibody Heavy-Chain CDR3: Necessary, Yet Insufficient, for Specific Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Angelo, Sara; Ferrara, Fortunato; Naranjo, Leslie

    Because of its great potential for diversity, the immunoglobulin heavy-chain complementarity-determining region 3 (HCDR3) is taken as an antibody molecule’s most important component in conferring binding activity and specificity. For this reason, HCDR3s have been used as unique identifiers to investigate adaptive immune responses in vivo and to characterize in vitro selection outputs where display systems were employed. Here, we show that many different HCDR3s can be identified within a target-specific antibody population after in vitro selection. For each identified HCDR3, a number of different antibodies bearing differences elsewhere can be found. In such selected populations, all antibodies with themore » same HCDR3 recognize the target, albeit at different affinities. In contrast, within unselected populations, the majority of antibodies with the same HCDR3 sequence do not bind the target. In one HCDR3 examined in depth, all target-specific antibodies were derived from the same VDJ rearrangement, while non-binding antibodies with the same HCDR3 were derived from many different V and D gene rearrangements. Careful examination of previously published in vivo datasets reveals that HCDR3s shared between, and within, different individuals can also originate from rearrangements of different V and D genes, with up to 26 different rearrangements yielding the same identical HCDR3 sequence. On the basis of these observations, we conclude that the same HCDR3 can be generated by many different rearrangements, but that specific target binding is an outcome of unique rearrangements and VL pairing: the HCDR3 is necessary, albeit insufficient, for specific antibody binding.« less

  8. Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology.

    PubMed

    Liu, Tao; Sims, David; Baum, Buzz

    2009-01-01

    In recent years RNAi screening has proven a powerful tool for dissecting gene functions in animal cells in culture. However, to date, most RNAi screens have been performed in a single cell line, and results then extrapolated across cell types and systems. Here, to dissect generic and cell type-specific mechanisms underlying cell morphology, we have performed identical kinome RNAi screens in six different Drosophila cell lines, derived from two distinct tissues of origin. This analysis identified a core set of kinases required for normal cell morphology in all lines tested, together with a number of kinases with cell type-specific functions. Most significantly, the screen identified a role for minibrain (mnb/DYRK1A), a kinase associated with Down's syndrome, in the regulation of actin-based protrusions in CNS-derived cell lines. This cell type-specific requirement was not due to the peculiarities in the morphology of CNS-derived cells and could not be attributed to differences in mnb expression. Instead, it likely reflects differences in gene expression that constitute the cell type-specific functional context in which mnb/DYRK1A acts. Using parallel RNAi screens and gene expression analyses across cell types we have identified generic and cell type-specific regulators of cell morphology, which include mnb/DYRK1A in the regulation of protrusion morphology in CNS-derived cell lines. This analysis reveals the importance of using different cell types to gain a thorough understanding of gene function across the genome and, in the case of kinases, the difficulties of using the differential gene expression to predict function.

  9. Mining the Immune Cell Proteome to Identify Ovarian Cancer-Specific Biomarkers

    DTIC Science & Technology

    2012-03-01

    data and are in the process of identifying gene signatures that can be used as biomarkers for the identification of ovarian cancer-specific biomarkers...groups. The groups showed significant difference in age as well as gestational age, which is expected when considering the disease process . Isolation of...MUC4 in intracellular signaling.32 Oligosaccharides attached to the extracellular domains of mucins have also been shown to interact with different

  10. Gender differences in developmental dyscalculia depend on diagnostic criteria.

    PubMed

    Devine, Amy; Soltész, Fruzsina; Nobes, Alison; Goswami, Usha; Szűcs, Dénes

    2013-10-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender differences. In the current study, 1004 British primary school children completed mathematics and reading assessments. The prevalence of DD and gender ratio were estimated in this sample using different criteria. When using absolute thresholds, the prevalence of DD was the same for both genders regardless of the cutoff criteria applied, however gender differences emerged when using a mathematics-reading discrepancy definition. Correlations between mathematics performance and the control measures selected to identify a specific learning difficulty affect both prevalence estimates and whether a gender difference is in fact identified. Educational implications are discussed.

  11. Ethnic dependent differences in diagnostic accuracy of glycated hemoglobin (HbA1c) in Canadian adults.

    PubMed

    Booth, Ronald A; Jiang, Ying; Morrison, Howard; Orpana, Heather; Rogers Van Katwyk, Susan; Lemieux, Chantal

    2018-02-01

    Previous studies have shown varying sensitivity and specificity of hemoglobin A1c (HbA1c) to identify diabetes and prediabetes, compared to 2-h oral glucose tolerance testing (OGTT) and fasting plasma glucose (FPG), in different ethnic groups. Within the Canadian population, the ability of HbA1c to identify prediabetes and diabetes in First Nations, Métis and Inuit, East and South Asian ethnic groups has yet to be determined. We collected demographic, lifestyle information, biochemical results of glycemic status (FPG, OGTT, and HbA1c) from an ethnically diverse Canadian population sample, which included a purposeful sampling of First Nations, Métis, Inuit, South Asian and East Asian participants. Sensitivity and specificity using Canadian Diabetes Association (CDA) recommended cut-points varied between ethnic groups, with greater variability for identification of prediabetes than diabetes. Dysglycemia (prediabetes and diabetes) was identified with a sensitivity and specificity ranging from 47.1% to 87.5%, respectively in Caucasians to 24.1% and 88.8% in Inuit. Optimal HbA1c ethnic-specific cut-points for dysglycemia and diabetes were determined by receiver operating characteristic (ROC) curve analysis. Our sample showed broad differences in the ability of HbA1c to identify dysglycemia or diabetes in different ethnic groups. Optimal cut-points for dysglycemia or diabetes in all ethnic groups were substantially lower than CDA recommendations. Utilization of HbA1c as the sole biochemical diagnostic marker may produce varying degrees of false negative results depending on the ethnicity of screened individuals. Further research is necessary to identify and validate optimal ethnic specific cut-points used for diabetic screening in the Canadian population. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  12. Strain/species identification in metagenomes using genome-specific markers

    PubMed Central

    Tu, Qichao; He, Zhili; Zhou, Jizhong

    2014-01-01

    Shotgun metagenome sequencing has become a fast, cheap and high-throughput technology for characterizing microbial communities in complex environments and human body sites. However, accurate identification of microorganisms at the strain/species level remains extremely challenging. We present a novel k-mer-based approach, termed GSMer, that identifies genome-specific markers (GSMs) from currently sequenced microbial genomes, which were then used for strain/species-level identification in metagenomes. Using 5390 sequenced microbial genomes, 8 770 321 50-mer strain-specific and 11 736 360 species-specific GSMs were identified for 4088 strains and 2005 species (4933 strains), respectively. The GSMs were first evaluated against mock community metagenomes, recently sequenced genomes and real metagenomes from different body sites, suggesting that the identified GSMs were specific to their targeting genomes. Sensitivity evaluation against synthetic metagenomes with different coverage suggested that 50 GSMs per strain were sufficient to identify most microbial strains with ≥0.25× coverage, and 10% of selected GSMs in a database should be detected for confident positive callings. Application of GSMs identified 45 and 74 microbial strains/species significantly associated with type 2 diabetes patients and obese/lean individuals from corresponding gastrointestinal tract metagenomes, respectively. Our result agreed with previous studies but provided strain-level information. The approach can be directly applied to identify microbial strains/species from raw metagenomes, without the effort of complex data pre-processing. PMID:24523352

  13. Comparing the effectiveness of using generic and specific search terms in electronic databases to identify health outcomes for a systematic review: a prospective comparative study of literature search methods

    PubMed Central

    MacLean, Alice; Sweeting, Helen; Hunt, Kate

    2012-01-01

    Objective To compare the effectiveness of systematic review literature searches that use either generic or specific terms for health outcomes. Design Prospective comparative study of two electronic literature search strategies. The ‘generic’ search included general terms for health such as ‘adolescent health’, ‘health status’, ‘morbidity’, etc. The ‘specific’ search focused on terms for a range of specific illnesses, such as ‘headache’, ‘epilepsy’, ‘diabetes mellitus’, etc. Data sources The authors searched Medline, Embase, the Cumulative Index to Nursing and Allied Health Literature, PsycINFO and the Education Resources Information Center for studies published in English between 1992 and April 2010. Main outcome measures Number and proportion of studies included in the systematic review that were identified from each search. Results The two searches tended to identify different studies. Of 41 studies included in the final review, only three (7%) were identified by both search strategies, 21 (51%) were identified by the generic search only and 17 (41%) were identified by the specific search only. 5 of the 41 studies were also identified through manual searching methods. Studies identified by the two ELS differed in terms of reported health outcomes, while each ELS uniquely identified some of the review's higher quality studies. Conclusions Electronic literature searches (ELS) are a vital stage in conducting systematic reviews and therefore have an important role in attempts to inform and improve policy and practice with the best available evidence. While the use of both generic and specific health terms is conventional for many reviewers and information scientists, there are also reviews that rely solely on either generic or specific terms. Based on the findings, reliance on only the generic or specific approach could increase the risk of systematic reviews missing important evidence and, consequently, misinforming decision makers. However, future research should test the generalisability of these findings. PMID:22734117

  14. Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach

    PubMed Central

    Mayer, Kimberly M; Shanklin, John

    2007-01-01

    Background The large amount of available sequence information for the plant acyl-ACP thioesterases (TEs) made it possible to use a bioinformatics-guided approach to identify amino acid residues involved in substrate specificity. The Conserved Property Difference Locator (CPDL) program allowed the identification of putative specificity-determining residues that differ between the FatA and FatB TE classes. Six of the FatA residue differences identified by CPDL were incorporated into the FatB-like parent via site-directed mutagenesis and the effect of each on TE activity was determined. Variants were expressed in E. coli strain K27 that allows determination of enzyme activity by GCMS analysis of fatty acids released into the medium. Results Substitutions at four of the positions (74, 86, 141, and 174) changed substrate specificity to varying degrees while changes at the remaining two positions, 110 and 221, essentially inactivated the thioesterase. The effects of substitutions at positions 74, 141, and 174 (3-MUT) or 74, 86, 141, 174 (4-MUT) were not additive with respect to specificity. Conclusion Four of six putative specificity determining positions in plant TEs, identified with the use of CPDL, were validated experimentally; a novel colorimetric screen that discriminates between active and inactive TEs is also presented. PMID:17201914

  15. Gender differences in developmental dyscalculia depend on diagnostic criteria

    PubMed Central

    Devine, Amy; Soltész, Fruzsina; Nobes, Alison; Goswami, Usha; Szűcs, Dénes

    2013-01-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender differences. In the current study, 1004 British primary school children completed mathematics and reading assessments. The prevalence of DD and gender ratio were estimated in this sample using different criteria. When using absolute thresholds, the prevalence of DD was the same for both genders regardless of the cutoff criteria applied, however gender differences emerged when using a mathematics-reading discrepancy definition. Correlations between mathematics performance and the control measures selected to identify a specific learning difficulty affect both prevalence estimates and whether a gender difference is in fact identified. Educational implications are discussed. PMID:27667904

  16. Lineage-Specific Changes in Biomarkers in Great Apes and Humans.

    PubMed

    Ronke, Claudius; Dannemann, Michael; Halbwax, Michel; Fischer, Anne; Helmschrodt, Christin; Brügel, Mathias; André, Claudine; Atencia, Rebeca; Mugisha, Lawrence; Scholz, Markus; Ceglarek, Uta; Thiery, Joachim; Pääbo, Svante; Prüfer, Kay; Kelso, Janet

    2015-01-01

    Although human biomedical and physiological information is readily available, such information for great apes is limited. We analyzed clinical chemical biomarkers in serum samples from 277 wild- and captive-born great apes and from 312 healthy human volunteers as well as from 20 rhesus macaques. For each individual, we determined a maximum of 33 markers of heart, liver, kidney, thyroid and pancreas function, hemoglobin and lipid metabolism and one marker of inflammation. We identified biomarkers that show differences between humans and the great apes in their average level or activity. Using the rhesus macaques as an outgroup, we identified human-specific differences in the levels of bilirubin, cholinesterase and lactate dehydrogenase, and bonobo-specific differences in the level of apolipoprotein A-I. For the remaining twenty-nine biomarkers there was no evidence for lineage-specific differences. In fact, we find that many biomarkers show differences between individuals of the same species in different environments. Of the four lineage-specific biomarkers, only bilirubin showed no differences between wild- and captive-born great apes. We show that the major factor explaining the human-specific difference in bilirubin levels may be genetic. There are human-specific changes in the sequence of the promoter and the protein-coding sequence of uridine diphosphoglucuronosyltransferase 1 (UGT1A1), the enzyme that transforms bilirubin and toxic plant compounds into water-soluble, excretable metabolites. Experimental evidence that UGT1A1 is down-regulated in the human liver suggests that changes in the promoter may be responsible for the human-specific increase in bilirubin. We speculate that since cooking reduces toxic plant compounds, consumption of cooked foods, which is specific to humans, may have resulted in relaxed constraint on UGT1A1 which has in turn led to higher serum levels of bilirubin in humans.

  17. Lineage-Specific Changes in Biomarkers in Great Apes and Humans

    PubMed Central

    Ronke, Claudius; Dannemann, Michael; Halbwax, Michel; Fischer, Anne; Helmschrodt, Christin; Brügel, Mathias; André, Claudine; Atencia, Rebeca; Mugisha, Lawrence; Scholz, Markus; Ceglarek, Uta; Thiery, Joachim; Pääbo, Svante; Prüfer, Kay; Kelso, Janet

    2015-01-01

    Although human biomedical and physiological information is readily available, such information for great apes is limited. We analyzed clinical chemical biomarkers in serum samples from 277 wild- and captive-born great apes and from 312 healthy human volunteers as well as from 20 rhesus macaques. For each individual, we determined a maximum of 33 markers of heart, liver, kidney, thyroid and pancreas function, hemoglobin and lipid metabolism and one marker of inflammation. We identified biomarkers that show differences between humans and the great apes in their average level or activity. Using the rhesus macaques as an outgroup, we identified human-specific differences in the levels of bilirubin, cholinesterase and lactate dehydrogenase, and bonobo-specific differences in the level of apolipoprotein A-I. For the remaining twenty-nine biomarkers there was no evidence for lineage-specific differences. In fact, we find that many biomarkers show differences between individuals of the same species in different environments. Of the four lineage-specific biomarkers, only bilirubin showed no differences between wild- and captive-born great apes. We show that the major factor explaining the human-specific difference in bilirubin levels may be genetic. There are human-specific changes in the sequence of the promoter and the protein-coding sequence of uridine diphosphoglucuronosyltransferase 1 (UGT1A1), the enzyme that transforms bilirubin and toxic plant compounds into water-soluble, excretable metabolites. Experimental evidence that UGT1A1 is down-regulated in the human liver suggests that changes in the promoter may be responsible for the human-specific increase in bilirubin. We speculate that since cooking reduces toxic plant compounds, consumption of cooked foods, which is specific to humans, may have resulted in relaxed constraint on UGT1A1 which has in turn led to higher serum levels of bilirubin in humans. PMID:26247603

  18. [Differences and similarities between the competencies of a nursing supervisor and an advanced clinical nurse specialist].

    PubMed

    del Barrio-Linares, M; Pumar-Méndez, M J

    2015-01-01

    With the aim of contributing to the development of a more specific professional regulation, the present study was to identify differences and similarities between the competencies of the nursing supervisor and clinical nurse specialist in an intensive care unit. A critical analysis of the literature published between 2003 and 2013 was conducted, identified through systematic searches in electronic databases, health management and practitioner journals and reference lists of the 17 items included. «Management and administration» and «direct clinical practice» were identified as specific competencies of nursing supervisor and clinical nurse specialist respectively. «Collaboration», «leadership» and «research» emerged as competencies shared by both profiles, but with different a operationalization way of conducting it. These findings imply that regulation, education and implementation of these profiles must address their specific skills as the distinctive approach taken in operationalizing shared. Copyright © 2014 Elsevier España, S.L.U. y SEEIUC. All rights reserved.

  19. Assessing health-related quality of life in gynecologic oncology: a systematic review of questionnaires and their ability to detect clinically important differences and change.

    PubMed

    Luckett, Tim; King, Madeleine; Butow, Phyllis; Friedlander, Michael; Paris, Tim

    2010-05-01

    Researchers wishing to assess the health-related quality of life (HRQoL) of women with gynecologic cancers have a range of questionnaires to choose from. In general, disease-, treatment-, or symptom-specific questionnaires are assumed to be better able to identify between-group differences (sensitivity) and changes over time (responsiveness) than are cancer-specific or generic questionnaires. However, little work has tested this assumption in oncology. We set out to (a) identify all multidimensional HRQoL questionnaires used in studies with women with gynecologic cancer and (b) evaluate their track records in identifying minimal clinically important differences (MCIDs), with a view to making recommendations. We searched MEDLINE using the term quality of life and each gynecologic cancer type, as well as the names of identified questionnaires. We used 10% of the scale range as the threshold for an MCID. We identified 1 generic (SF-36/SF-12), 3 cancer-specific (European Organisation for the Research and Treatment of Cancer Quality of Life Questionnaire [EORTC QLQ] C30, Functional Assessment of Cancer Therapy-General [FACT-G], and short-form Cancer Rehabilitation Evaluation System [CARES-SF]), and 1 disease-specific (QOL-Ovarian Cancer Patient Version) HRQoL questionnaires and 5 disease-specific (QLQ-OV28, FACT-O for ovarian, QLQ-CX24, FACT-Cx for cervical and FACT-V for vulvar), 1 treatment-specific (FACT and Gynecologic Oncology Group-Ntx for neurotoxicity), and 2 symptom-specific (FACT-Anemia and Functional Assessment of Chronic Illness and Therapy [FACIT]-Fatigue) modules. Twenty-seven articles reported results from 26 studies in which an MCID had been identified. The FACIT's anemia and fatigue subscales were more sensitive, and the neurotoxicity subscale more sensitive and responsive than the FACT-G on at least 1 comparison. However, we found no evidence for superior performance by the FACT-G compared with the SF-36 or EORTC and FACIT disease-specific modules versus the QLQ-C30 and FACT-G. There was also little evidence to favor EORTC versus FACIT questionnaires or vice versa. The evidence we reviewed offered little support for the hypothesis that disease-, symptom-, or treatment-specific instruments are more sensitive and responsive than cancer-specific or generic questionnaires. However, conclusions were limited by the small number of head-to-head comparisons available. We summarize the clinical contexts in which each instrument identified an MCID to inform choice of questionnaire(s), sample size calculations, and interpretation of results in future studies.

  20. A Novel Feature-Map Based ICA Model for Identifying the Individual, Intra/Inter-Group Brain Networks across Multiple fMRI Datasets.

    PubMed

    Wang, Nizhuan; Chang, Chunqi; Zeng, Weiming; Shi, Yuhu; Yan, Hongjie

    2017-01-01

    Independent component analysis (ICA) has been widely used in functional magnetic resonance imaging (fMRI) data analysis to evaluate functional connectivity of the brain; however, there are still some limitations on ICA simultaneously handling neuroimaging datasets with diverse acquisition parameters, e.g., different repetition time, different scanner, etc. Therefore, it is difficult for the traditional ICA framework to effectively handle ever-increasingly big neuroimaging datasets. In this research, a novel feature-map based ICA framework (FMICA) was proposed to address the aforementioned deficiencies, which aimed at exploring brain functional networks (BFNs) at different scales, e.g., the first level (individual subject level), second level (intragroup level of subjects within a certain dataset) and third level (intergroup level of subjects across different datasets), based only on the feature maps extracted from the fMRI datasets. The FMICA was presented as a hierarchical framework, which effectively made ICA and constrained ICA as a whole to identify the BFNs from the feature maps. The simulated and real experimental results demonstrated that FMICA had the excellent ability to identify the intergroup BFNs and to characterize subject-specific and group-specific difference of BFNs from the independent component feature maps, which sharply reduced the size of fMRI datasets. Compared with traditional ICAs, FMICA as a more generalized framework could efficiently and simultaneously identify the variant BFNs at the subject-specific, intragroup, intragroup-specific and intergroup levels, implying that FMICA was able to handle big neuroimaging datasets in neuroscience research.

  1. A site specific model and analysis of the neutral somatic mutation rate in whole-genome cancer data.

    PubMed

    Bertl, Johanna; Guo, Qianyun; Juul, Malene; Besenbacher, Søren; Nielsen, Morten Muhlig; Hornshøj, Henrik; Pedersen, Jakob Skou; Hobolth, Asger

    2018-04-19

    Detailed modelling of the neutral mutational process in cancer cells is crucial for identifying driver mutations and understanding the mutational mechanisms that act during cancer development. The neutral mutational process is very complex: whole-genome analyses have revealed that the mutation rate differs between cancer types, between patients and along the genome depending on the genetic and epigenetic context. Therefore, methods that predict the number of different types of mutations in regions or specific genomic elements must consider local genomic explanatory variables. A major drawback of most methods is the need to average the explanatory variables across the entire region or genomic element. This procedure is particularly problematic if the explanatory variable varies dramatically in the element under consideration. To take into account the fine scale of the explanatory variables, we model the probabilities of different types of mutations for each position in the genome by multinomial logistic regression. We analyse 505 cancer genomes from 14 different cancer types and compare the performance in predicting mutation rate for both regional based models and site-specific models. We show that for 1000 randomly selected genomic positions, the site-specific model predicts the mutation rate much better than regional based models. We use a forward selection procedure to identify the most important explanatory variables. The procedure identifies site-specific conservation (phyloP), replication timing, and expression level as the best predictors for the mutation rate. Finally, our model confirms and quantifies certain well-known mutational signatures. We find that our site-specific multinomial regression model outperforms the regional based models. The possibility of including genomic variables on different scales and patient specific variables makes it a versatile framework for studying different mutational mechanisms. Our model can serve as the neutral null model for the mutational process; regions that deviate from the null model are candidates for elements that drive cancer development.

  2. A method for identifying color vision deficiency malingering.

    PubMed

    Pouw, Andrew; Karanjia, Rustum; Sadun, Alfredo

    2017-03-01

    To propose a new test to identify color vision deficiency malingering. An online survey was distributed to 130 truly color vision deficient participants and 160 participants willing to simulate color vision deficiency. The survey contained three sets of six color-adjusted versions of the standard Ishihara color plates each, as well as one set of six control plates. The plates that best discriminated both participant groups were selected for a "balanced" test emphasizing both sensitivity and specificity. A "specific" test that prioritized high specificity was also created by selecting from these plates. Statistical measures of the test (sensitivity, specificity, and Youden index) were assessed at each possible cut-off threshold, and a receiver operating characteristic (ROC) function with its area under the curve (AUC) charted. The redshift plate set was identified as having the highest difference of means between groups (-58%, CI: -64 to -52%), as well as the widest gap between group modes. Statistical measures of the "balanced" test show an optimal cut-off of at least two incorrectly identified plates to suggest malingering (Youden index: 0.773, sensitivity: 83.3%, specificity: 94.0%, AUC of ROC 0.918). The "specific" test was able to identify color vision deficiency simulators with a specificity of 100% when using a cut-off of at least two incorrectly identified plates (Youden index 0.599, sensitivity 59.9%, specificity 100%, AUC of ROC 0.881). Our proposed test for identifying color vision deficiency malingering demonstrates a high degree of reliability with AUCs of 0.918 and 0.881 for the "balanced" and "specific" tests, respectively. A cut-off threshold of at least two missed plates on the "specific" test was able to identify color vision deficiency simulators with 100% specificity.

  3. Dimensional Integration of Assessment Outcomes with Intervention Services for Children with Specific Learning Disabilities

    ERIC Educational Resources Information Center

    Decker, Scott

    2012-01-01

    This article reviews critical issues with integrating different procedures for identifying children with specific learning disabilities permitted in the federal regulations of the 2004 Individual With Disabilities Education Act 2004. Theoretical differences between behavioral approaches that focus on recording behavioral responses based on…

  4. Identification of LukPQ, a novel, equid-adapted leukocidin of Staphylococcus aureus

    PubMed Central

    Koop, Gerrit; Vrieling, Manouk; Storisteanu, Daniel M. L.; Lok, Laurence S. C.; Monie, Tom; van Wigcheren, Glenn; Raisen, Claire; Ba, Xiaoliang; Gleadall, Nicholas; Hadjirin, Nazreen; Timmerman, Arjen J.; Wagenaar, Jaap A.; Klunder, Heleen M.; Fitzgerald, J. Ross; Zadoks, Ruth; Paterson, Gavin K.; Torres, Carmen; Waller, Andrew S.; Loeffler, Anette; Loncaric, Igor; Hoet, Armando E.; Bergström, Karin; De Martino, Luisa; Pomba, Constança; de Lencastre, Hermínia; Ben Slama, Karim; Gharsa, Haythem; Richardson, Emily J.; Chilvers, Edwin R.; de Haas, Carla; van Kessel, Kok; van Strijp, Jos A. G.; Harrison, Ewan M.; Holmes, Mark A.

    2017-01-01

    Bicomponent pore-forming leukocidins are a family of potent toxins secreted by Staphylococcus aureus, which target white blood cells preferentially and consist of an S- and an F-component. The S-component recognizes a receptor on the host cell, enabling high-affinity binding to the cell surface, after which the toxins form a pore that penetrates the cell lipid bilayer. Until now, six different leukocidins have been described, some of which are host and cell specific. Here, we identify and characterise a novel S. aureus leukocidin; LukPQ. LukPQ is encoded on a 45 kb prophage (ΦSaeq1) found in six different clonal lineages, almost exclusively in strains cultured from equids. We show that LukPQ is a potent and specific killer of equine neutrophils and identify equine-CXCRA and CXCR2 as its target receptors. Although the S-component (LukP) is highly similar to the S-component of LukED, the species specificity of LukPQ and LukED differs. By forming non-canonical toxin pairs, we identify that the F-component contributes to the observed host tropism of LukPQ, thereby challenging the current paradigm that leukocidin specificity is driven solely by the S-component. PMID:28106142

  5. Further Evidence on Field Differences in Consensus from the NSF Peer Review Studies.

    ERIC Educational Resources Information Center

    Hargens, Lowell L.

    1988-01-01

    Cole, Simon, and Cole identify the following variables that may affect scholarly journal rejection rates: (1) field-specific publication norms; (2) diffuseness of journal structures; and (3) differences in training practices. However, they do not explain why the variables they identify covary across disciplines. (BJV)

  6. Identification of Gifted Children among the American Indian Population: An Inservice Model.

    ERIC Educational Resources Information Center

    Florey, Janice E.; And Others

    An inservice training program designed to help teachers identify culturally different gifted students is described in this report, which provides specific information about identifying gifted Native Americans. Introductory material summarizes some research on the learning and behavioral characteristics of Native Americans as they differ from the…

  7. Diagnosis & Treatment of Dystonia

    PubMed Central

    Jinnah, H. A.

    2014-01-01

    Synopsis The dystonias are a group of disorders characterized by excessive involuntary muscle contractions leading to abnormal postures and/or repetitive movements. There are many different clinical manifestations and many different causes. A careful assessment of the clinical manifestations is helpful for identifying syndromic patterns that focus diagnostic testing on potential causes. If a cause can be identified, specific etiology-based treatments may be available. However, in the majority of cases, a specific cause cannot be identified, and treatments are based on symptoms. Treatment options include counseling and education, oral medications, botulinum toxin injections, and several surgical procedures. A substantial reduction in symptoms and improved quality of life can be achieved in the majority of patients by combining these various options. PMID:25432724

  8. VASP-E: Specificity Annotation with a Volumetric Analysis of Electrostatic Isopotentials

    PubMed Central

    Chen, Brian Y.

    2014-01-01

    Algorithms for comparing protein structure are frequently used for function annotation. By searching for subtle similarities among very different proteins, these algorithms can identify remote homologs with similar biological functions. In contrast, few comparison algorithms focus on specificity annotation, where the identification of subtle differences among very similar proteins can assist in finding small structural variations that create differences in binding specificity. Few specificity annotation methods consider electrostatic fields, which play a critical role in molecular recognition. To fill this gap, this paper describes VASP-E (Volumetric Analysis of Surface Properties with Electrostatics), a novel volumetric comparison tool based on the electrostatic comparison of protein-ligand and protein-protein binding sites. VASP-E exploits the central observation that three dimensional solids can be used to fully represent and compare both electrostatic isopotentials and molecular surfaces. With this integrated representation, VASP-E is able to dissect the electrostatic environments of protein-ligand and protein-protein binding interfaces, identifying individual amino acids that have an electrostatic influence on binding specificity. VASP-E was used to examine a nonredundant subset of the serine and cysteine proteases as well as the barnase-barstar and Rap1a-raf complexes. Based on amino acids established by various experimental studies to have an electrostatic influence on binding specificity, VASP-E identified electrostatically influential amino acids with 100% precision and 83.3% recall. We also show that VASP-E can accurately classify closely related ligand binding cavities into groups with different binding preferences. These results suggest that VASP-E should prove a useful tool for the characterization of specific binding and the engineering of binding preferences in proteins. PMID:25166865

  9. Intimate partner violence (IPV): The validity of an IPV screening instrument utilized among pregnant women in Tanzania and Vietnam

    PubMed Central

    Rasch, Vibeke; Van, Toan Ngo; Nguyen, Hanh Thi Thuy; Manongi, Rachel; Mushi, Declare; Meyrowitsch, Dan W.; Gammeltoft, Tine; Wu, Chun Sen

    2018-01-01

    Background Intimate partner violence (IPV) is a global problem that affects one-third of all women. The present study aims to develop and determine the validity of a screening instrument for the detection of IPV in pregnant women in Tanzania and Vietnam and to determine the minimum number of questions needed to identify IPV. Method An IPV screening instrument based on eight questions was tested on 1,116 Tanzanian and 1,309 Vietnamese women who attended antenatal care before 24 gestational weeks. The women were re-interviewed during their 30th-34th gestational week where the World Health Organization (WHO) IPV questionnaire was used as the gold standard. In all, 255 combinations of eight different questions were first tested on the Tanzanian study population where sensitivity, specificity, positive predictive value, negative predictive value and accuracy were calculated. In the evaluation of the performance of the question combinations, different IPV types and the frequency of abusive acts were considered. The question combinations that performed best in Tanzania were subsequently evaluated in the Vietnamese study population. Results In Tanzania, a combination of three selected questions including one question on emotional IPV, one on physical IPV and one on sexual IPV was found to be most effective in identifying women who are exposed to at least one type of IPV during pregnancy (sensitivity = .80; specificity = .74). The performance of the identified combination was slightly less effective in Vietnam (sensitivity = .74; specificity = .68). Focusing on different IPV types, the best performance was found for exposure to physical IPV in both Tanzania (sensitivity = .93; specificity = .70) and Vietnam (sensitivity = .96; specificity = .55). In both countries, the sensitivity increased with the frequency of abuse whereas the specificity decreased. Conclusion By asking pregnant women three simple questions we were able to identify women who were exposed to IPV during pregnancy in two different countries. The question combination performed best in assessing physical IPV where it identified 93% and 96% of Vietnamese and Tanzanian women, respectively, who were exposed to physical IPV. PMID:29389954

  10. A Transcriptome Derived Female-Specific Marker from the Invasive Western Mosquitofish (Gambusia affinis)

    PubMed Central

    Lamatsch, Dunja K.; Adolfsson, Sofia; Senior, Alistair M.; Christiansen, Guntram; Pichler, Maria; Ozaki, Yuichi; Smeds, Linnea; Schartl, Manfred; Nakagawa, Shinichi

    2015-01-01

    Sex-specific markers are a prerequisite for understanding reproductive biology, genetic factors involved in sex differences, mechanisms of sex determination, and ultimately the evolution of sex chromosomes. The Western mosquitofish, Gambusia affinis, may be considered a model species for sex-chromosome evolution, as it displays female heterogamety (ZW/ZZ), and is also ecologically interesting as a worldwide invasive species. Here, de novo RNA-sequencing on the gonads of sexually mature G. affinis was used to identify contigs that were highly transcribed in females but not in males (i.e., transcripts with ovary-specific expression). Subsequently, 129 primer pairs spanning 79 contigs were tested by PCR to identify sex-specific transcripts. Of those primer pairs, one female-specific DNA marker was identified, Sanger sequenced and subsequently validated in 115 fish. Sequence analyses revealed a high similarity between the identified sex-specific marker and the 3´ UTR of the aminomethyl transferase (amt) gene of the closely related platyfish (Xiphophorus maculatus). This is the first time that RNA-seq has been used to successfully characterize a sex-specific marker in a fish species in the absence of a genome map. Additionally, the identified sex-specific marker represents one of only a handful of such markers in fishes. PMID:25707007

  11. Task Analysis - Its Relation to Content Analysis.

    ERIC Educational Resources Information Center

    Gagne, Robert M.

    Task analysis is a procedure having the purpose of identifying different kinds of performances which are outcomes of learning, in order to make possible the specification of optimal instructional conditions for each kind of outcome. Task analysis may be related to content analysis in two different ways: (1) it may be used to identify the probably…

  12. Differentiation of ileostomy from colostomy procedures: assessing the accuracy of current procedural terminology codes and the utility of natural language processing.

    PubMed

    Vo, Elaine; Davila, Jessica A; Hou, Jason; Hodge, Krystle; Li, Linda T; Suliburk, James W; Kao, Lillian S; Berger, David H; Liang, Mike K

    2013-08-01

    Large databases provide a wealth of information for researchers, but identifying patient cohorts often relies on the use of current procedural terminology (CPT) codes. In particular, studies of stoma surgery have been limited by the accuracy of CPT codes in identifying and differentiating ileostomy procedures from colostomy procedures. It is important to make this distinction because the prevalence of complications associated with stoma formation and reversal differ dramatically between types of stoma. Natural language processing (NLP) is a process that allows text-based searching. The Automated Retrieval Console is an NLP-based software that allows investigators to design and perform NLP-assisted document classification. In this study, we evaluated the role of CPT codes and NLP in differentiating ileostomy from colostomy procedures. Using CPT codes, we conducted a retrospective study that identified all patients undergoing a stoma-related procedure at a single institution between January 2005 and December 2011. All operative reports during this time were reviewed manually to abstract the following variables: formation or reversal and ileostomy or colostomy. Sensitivity and specificity for validation of the CPT codes against the mastery surgery schedule were calculated. Operative reports were evaluated by use of NLP to differentiate ileostomy- from colostomy-related procedures. Sensitivity and specificity for identifying patients with ileostomy or colostomy procedures were calculated for CPT codes and NLP for the entire cohort. CPT codes performed well in identifying stoma procedures (sensitivity 87.4%, specificity 97.5%). A total of 664 stoma procedures were identified by CPT codes between 2005 and 2011. The CPT codes were adequate in identifying stoma formation (sensitivity 97.7%, specificity 72.4%) and stoma reversal (sensitivity 74.1%, specificity 98.7%), but they were inadequate in identifying ileostomy (sensitivity 35.0%, specificity 88.1%) and colostomy (75.2% and 80.9%). NLP performed with greater sensitivity, specificity, and accuracy than CPT codes in identifying stoma procedures and stoma types. Major differences where NLP outperformed CPT included identifying ileostomy (specificity 95.8%, sensitivity 88.3%, and accuracy 91.5%) and colostomy (97.6%, 90.5%, and 92.8%, respectively). CPT codes can identify effectively patients who have had stoma procedures and are adequate in distinguishing between formation and reversal; however, CPT codes cannot differentiate ileostomy from colostomy. NLP can be used to differentiate between ileostomy- and colostomy-related procedures. The role of NLP in conjunction with electronic medical records in data retrieval warrants further investigation. Published by Mosby, Inc.

  13. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection.

    PubMed Central

    Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A

    1995-01-01

    In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493

  14. Identification and substrate prediction of new Fragaria x ananassa aquaporins and expression in different tissues and during strawberry fruit development.

    PubMed

    Merlaen, Britt; De Keyser, Ellen; Van Labeke, Marie-Christine

    2018-01-01

    The newly identified aquaporin coding sequences presented here pave the way for further insights into the plant-water relations in the commercial strawberry ( Fragaria x ananassa ). Aquaporins are water channel proteins that allow water to cross (intra)cellular membranes. In Fragaria x ananassa , few of them have been identified hitherto, hampering the exploration of the water transport regulation at cellular level. Here, we present new aquaporin coding sequences belonging to different subclasses: plasma membrane intrinsic proteins subtype 1 and subtype 2 (PIP1 and PIP2) and tonoplast intrinsic proteins (TIP). The classification is based on phylogenetic analysis and is confirmed by the presence of conserved residues. Substrate-specific signature sequences (SSSSs) and specificity-determining positions (SDPs) predict the substrate specificity of each new aquaporin. Expression profiling in leaves, petioles and developing fruits reveals distinct patterns, even within the same (sub)class. Expression profiles range from leaf-specific expression over constitutive expression to fruit-specific expression. Both upregulation and downregulation during fruit ripening occur. Substrate specificity and expression profiles suggest that functional specialization exists among aquaporins belonging to a different but also to the same (sub)class.

  15. Systematic discovery of mutation-specific synthetic lethals by mining pan-cancer human primary tumor data

    NASA Astrophysics Data System (ADS)

    Sinha, Subarna; Thomas, Daniel; Chan, Steven; Gao, Yang; Brunen, Diede; Torabi, Damoun; Reinisch, Andreas; Hernandez, David; Chan, Andy; Rankin, Erinn B.; Bernards, Rene; Majeti, Ravindra; Dill, David L.

    2017-05-01

    Two genes are synthetically lethal (SL) when defects in both are lethal to a cell but a single defect is non-lethal. SL partners of cancer mutations are of great interest as pharmacological targets; however, identifying them by cell line-based methods is challenging. Here we develop MiSL (Mining Synthetic Lethals), an algorithm that mines pan-cancer human primary tumour data to identify mutation-specific SL partners for specific cancers. We apply MiSL to 12 different cancers and predict 145,891 SL partners for 3,120 mutations, including known mutation-specific SL partners. Comparisons with functional screens show that MiSL predictions are enriched for SLs in multiple cancers. We extensively validate a SL interaction identified by MiSL between the IDH1 mutation and ACACA in leukaemia using gene targeting and patient-derived xenografts. Furthermore, we apply MiSL to pinpoint genetic biomarkers for drug sensitivity. These results demonstrate that MiSL can accelerate precision oncology by identifying mutation-specific targets and biomarkers.

  16. RNA-Seq analysis of isolate- and growth phase-specific differences in the global transcriptomes of enteropathogenic Escherichia coli prototype isolates

    PubMed Central

    Hazen, Tracy H.; Daugherty, Sean C.; Shetty, Amol; Mahurkar, Anup A.; White, Owen; Kaper, James B.; Rasko, David A.

    2015-01-01

    Enteropathogenic Escherichia coli (EPEC) are a leading cause of diarrheal illness among infants in developing countries. E. coli isolates classified as typical EPEC are identified by the presence of the locus of enterocyte effacement (LEE) and the bundle-forming pilus (BFP), and absence of the Shiga-toxin genes, while the atypical EPEC also encode LEE but do not encode BFP or Shiga-toxin. Comparative genomic analyses have demonstrated that EPEC isolates belong to diverse evolutionary lineages and possess lineage- and isolate-specific genomic content. To investigate whether this genomic diversity results in significant differences in global gene expression, we used an RNA sequencing (RNA-Seq) approach to characterize the global transcriptomes of the prototype typical EPEC isolates E2348/69, B171, C581-05, and the prototype atypical EPEC isolate E110019. The global transcriptomes were characterized during laboratory growth in two different media and three different growth phases, as well as during adherence of the EPEC isolates to human cells using in vitro tissue culture assays. Comparison of the global transcriptomes during these conditions was used to identify isolate- and growth phase-specific differences in EPEC gene expression. These analyses resulted in the identification of genes that encode proteins involved in survival and metabolism that were coordinately expressed with virulence factors. These findings demonstrate there are isolate- and growth phase-specific differences in the global transcriptomes of EPEC prototype isolates, and highlight the utility of comparative transcriptomics for identifying additional factors that are directly or indirectly involved in EPEC pathogenesis. PMID:26124752

  17. Evaluation of chromogenic media and seminested PCR in the identification of Candida species

    PubMed Central

    Daef, Enas; Moharram, Ahmed; Eldin, Salwa Seif; Elsherbiny, Nahla; Mohammed, Mona

    2014-01-01

    Identification of Candida cultured from various clinical specimens to the species level is increasingly necessary for clinical laboratories. Although sn PCR identifies the species within hours but its cost-effectiveness is to be considered. So there is always a need for media which help in the isolation and identification at the species level. The study aimed to evaluate the performance of different chromogenic media and to compare the effectiveness of the traditional phenotypic methods vs. seminested polymerase chain reaction (sn PCR) for identification of Candida species. One hundred and twenty seven Candida strains isolated from various clinical specimens were identified by conventional methods, four different chromogenic media and sn PCR. HiCrome Candida Differential and CHROMagar Candida media showed comparably high sensitivities and specificities in the identification of C. albicans, C. tropicalis, C. glabrata and C. krusei. CHROMagar Candida had an extra advantage of identifying all C. parapsilosis isolates. CHROMagar-Pal’s medium identified C. albicans, C. tropicalis and C. krusei with high sensitivities and specificities, but couldn’t identify C. glabrata or C. parapsilosis. It was the only medium that identified C. dubliniensis with a sensitivity and specificity of 100%. Biggy agar showed the least sensitivities and specificities. The overall concordance of the snPCR compared to the conventional tests including CHROMAgar Candida in the identification of Candida species was 97.5%. The use of CHROMAgar Candida medium is an easy and accurate method for presumptive identification of the most commonly encountered Candida spp. PMID:24948942

  18. Sex-dependent difference in the effect of metformin on colorectal cancer-specific mortality of diabetic colorectal cancer patients

    PubMed Central

    Park, Jung Won; Lee, Jin Ha; Park, Ye Hyun; Park, Soo Jung; Cheon, Jae Hee; Kim, Won Ho; Kim, Tae Il

    2017-01-01

    AIM To assess factors associated with the higher effect of metformin on mortality in diabetic colorectal cancer (CRC) patients, since the factors related to the effectiveness of metformin have not been identified yet. METHODS Between January 2000 and December 2010, 413 patients diagnosed with both stage 3/4 CRC and diabetes mellitus were identified. Patients’ demographics and clinical characteristics were analyzed. The effect of metformin on CRC-specific mortality and the interactions between metformin and each adjusted factor were evaluated. RESULTS Total follow-up duration was median 50 mo (range: 1-218 mo). There were 85 deaths (45.9%) and 72 CRC-specific deaths (38.9%) among 185 patients who used metformin, compared to 130 total deaths (57.0%) and 107 CRC-specific deaths (46.9%) among 228 patients who did not use metformin. In multivariate analysis, survival benefit associated with metformin administration was identified (HR = 0.985, 95%CI: 0.974-0.997, P = 0.012). Interaction test between metformin and sex after adjustment for relevant factors revealed that female CRC patients taking metformin exhibited a significantly lower CRC-specific mortality rate than male CRC patients taking metformin (HR = 0.369, 95%CI: 0.155-0.881, P = 0.025). Furthermore, subgroup analysis revealed significant differences in CRC-specific mortality between the metformin and non-metformin groups in female patients (HR = 0.501, 95%CI: 0.286-0.879, P = 0.013) but not male patients (HR = 0.848, 95%CI: 0.594-1.211, P = 0.365). There were no significant interactions between metformin and other adjusted factors on CRC-specific mortality. CONCLUSION We showed a strong sex-dependent difference in the effect of metformin on CRC-specific mortality in advanced stage CRC patients with diabetes. PMID:28811714

  19. Quantifying site-specific physical heterogeneity within an estuarine seascape

    USGS Publications Warehouse

    Kennedy, Cristina G.; Mather, Martha E.; Smith, Joseph M.

    2017-01-01

    Quantifying physical heterogeneity is essential for meaningful ecological research and effective resource management. Spatial patterns of multiple, co-occurring physical features are rarely quantified across a seascape because of methodological challenges. Here, we identified approaches that measured total site-specific heterogeneity, an often overlooked aspect of estuarine ecosystems. Specifically, we examined 23 metrics that quantified four types of common physical features: (1) river and creek confluences, (2) bathymetric variation including underwater drop-offs, (3) land features such as islands/sandbars, and (4) major underwater channel networks. Our research at 40 sites throughout Plum Island Estuary (PIE) provided solutions to two problems. The first problem was that individual metrics that measured heterogeneity of a single physical feature showed different regional patterns. We solved this first problem by combining multiple metrics for a single feature using a within-physical feature cluster analysis. With this approach, we identified sites with four different types of confluences and three different types of underwater drop-offs. The second problem was that when multiple physical features co-occurred, new patterns of total site-specific heterogeneity were created across the seascape. This pattern of total heterogeneity has potential ecological relevance to structure-oriented predators. To address this second problem, we identified sites with similar types of total physical heterogeneity using an across-physical feature cluster analysis. Then, we calculated an additive heterogeneity index, which integrated all physical features at a site. Finally, we tested if site-specific additive heterogeneity index values differed for across-physical feature clusters. In PIE, the sites with the highest additive heterogeneity index values were clustered together and corresponded to sites where a fish predator, adult striped bass (Morone saxatilis), aggregated in a related acoustic tracking study. In summary, we have shown general approaches to quantifying site-specific heterogeneity.

  20. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  1. Assessment of indexing trends with specific and general terms for herbal medicine.

    PubMed

    Bartol, Tomaz

    2012-12-01

    Concepts for medicinal plants are represented by a variety of associated general terms with specific indexing patterns in databases, which may not consistently reflect growth of records. The objectives of this study are to assess the development in databases by identifying general terms that describe herbal medicine with optimal retrieval recall and to identify possible special trends in co-occurrence of specific and general concepts. Different search strategies are tested in cab abstracts, medline and web of science. Specific terms (Origanum and Salvia) are employed. Relevant general terms (e.g. 'Plants, Medicinal', Phytotherapy, Herbal drugs) are identified, along with indexing trends and co-occurrences. Growth trends, in specific (narrower) terms, are similar among databases. General terms, however, exhibit dissimilar trends, sometimes almost opposing one another. Co-occurrence of specific and general terms is changing over time. General terms may not denote definite development of trends as the use of terms differs amongst databases, making it difficult to correctly assess possible numbers of relevant records. Perceived increase can, sometimes, be attributed to an increased occurrence of a more general term alongside the specific one. Thesaurus-controlled databases may yield more hits, because of 'up-posted' (broader) terms. Use of broader terms is helpful as it enhances retrieval of relevant documents. © 2012 The authors. Health Information and Libraries Journal © 2012 Health Libraries Group.

  2. Race Differences in Patterns of Risky Behavior and Associated Risk Factors in Adolescence.

    PubMed

    Childs, Kristina K; Ray, James V

    2017-05-01

    Using data from the National Longitudinal Study of Adolescent Health (Add Health), this study expands on previous research by (a) examining differences across race in patterns or "subgroups" of adolescents based on nine self-reported behaviors (e.g., delinquency, substance use, risky sexual practices) and (b) comparing the risk factors (e.g., peer association, parenting, neighborhood cohesion), both within and across the race-specific subgroups, related to membership into the identified latent classes. The data used in this study include respondents aged 13 to 17 who participated in Waves 1 and 2 of the Add Health in-home interview. Latent class analysis (LCA) identified key differences in the number and characteristics of the latent classes across the racial subgroups. In addition, both similarities and differences in the risk factors for membership into the latent classes were identified across and within the race-specific subgroups. Implications for understanding risky behavior in adolescence, as well as directions for future research, are discussed.

  3. Subcellular proteome profiles of different latex fractions revealed washed solutions from rubber particles contain crucial enzymes for natural rubber biosynthesis.

    PubMed

    Wang, Dan; Sun, Yong; Chang, Lili; Tong, Zheng; Xie, Quanliang; Jin, Xiang; Zhu, Liping; He, Peng; Li, Hongbin; Wang, Xuchu

    2018-06-30

    Rubber particle (RP) is a specific organelle for natural rubber biosynthesis (NRB) and storage in rubber tree Hevea brasiliensis. NRB is processed by RP membrane-localized proteins, which were traditionally purified by repeated washing. However, we noticed many proteins in the discarded washing solutions (WS) from RP. Here, we compared the proteome profiles of WS, C-serum (CS) and RP by 2-DE, and identified 233 abundant proteins from WS by mass spectrometry. Many spots on 2-DE gels were identified as different protein species. We further performed shotgun analysis of CS, WS and RP and identified 1837, 1799 and 1020 unique proteins, respectively. Together with 2-DE, we finally identified 1825 proteins from WS, 246 were WS-specific. These WS-specific proteins were annotated in Gene Ontology, indicating most abundant pathways are organic substance metabolic process, protein degradation, primary metabolic process, and energy metabolism. Protein-protein interaction analysis revealed these WS-specific proteins are mainly involved in ribosomal metabolism, proteasome system, vacuolar protein sorting and endocytosis. Label free and Western blotting revealed many WS-specific proteins and protein complexes are crucial for NRB initiation. These findings not only deepen our understanding of WS proteome, but also provide new evidences on the roles of RP membrane proteins in NRB. Natural rubber is stored in rubber particle from the rubber tree. Rubber particles were traditionally purified by repeated washing, but many proteins were identified from the washing solutions (WS). We obtained the first visualization proteome profiles with 1825 proteins from WS, including 246 WS-specific ones. These WS proteins contain almost all enzymes for polyisoprene initiation and may play important roles in rubber biosynthesis. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Plasma sex steroid binding in Chiroptera.

    PubMed

    Kwiecinski, G G; Damassa, D A; Gustafson, A W; Armao, M E

    1987-04-01

    Plasma steroid binding was examined in samples obtained from seven species of bats representing four different families. A specific sex steroid-binding protein (SBP) was identified by steady-state polyacrylamide gel electrophoresis in representatives of two families, the phyllostomids and the vespertilionids. In these species, as in primates, SBP not only exhibited high affinity for the androgens testosterone and dihydrotestosterone (DHT), but also for estradiol. A specific SBP was not identified in the tropical American vampire bat or in the two species of pteropodids examined. In all species examined, except for the vampire bat, a specific corticosteroid-binding globulin (CBG) was also identified. In addition to binding glucocorticoids, CBG in these species appeared to bind androgens as well.

  5. Identification of cancer genes that are independent of dominant proliferation and lineage programs

    PubMed Central

    Selfors, Laura M.; Stover, Daniel G.; Harris, Isaac S.; Brugge, Joan S.; Coloff, Jonathan L.

    2017-01-01

    Large, multidimensional cancer datasets provide a resource that can be mined to identify candidate therapeutic targets for specific subgroups of tumors. Here, we analyzed human breast cancer data to identify transcriptional programs associated with tumors bearing specific genetic driver alterations. Using an unbiased approach, we identified thousands of genes whose expression was enriched in tumors with specific genetic alterations. However, expression of the vast majority of these genes was not enriched if associations were analyzed within individual breast tumor molecular subtypes, across multiple tumor types, or after gene expression was normalized to account for differences in proliferation or tumor lineage. Together with linear modeling results, these findings suggest that most transcriptional programs associated with specific genetic alterations in oncogenes and tumor suppressors are highly context-dependent and are predominantly linked to differences in proliferation programs between distinct breast cancer subtypes. We demonstrate that such proliferation-dependent gene expression dominates tumor transcriptional programs relative to matched normal tissues. However, we also identified a relatively small group of cancer-associated genes that are both proliferation- and lineage-independent. A subset of these genes are attractive candidate targets for combination therapy because they are essential in breast cancer cell lines, druggable, enriched in stem-like breast cancer cells, and resistant to chemotherapy-induced down-regulation. PMID:29229826

  6. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

    2012-01-01

    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  7. Real-space analysis of radiation-induced specific changes with independent component analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borek, Dominika; Bromberg, Raquel; Hattne, Johan

    A method of analysis is presented that allows for the separation of specific radiation-induced changes into distinct components in real space. The method relies on independent component analysis (ICA) and can be effectively applied to electron density maps and other types of maps, provided that they can be represented as sets of numbers on a grid. Here, for glucose isomerase crystals, ICA was used in a proof-of-concept analysis to separate temperature-dependent and temperature-independent components of specific radiation-induced changes for data sets acquired from multiple crystals across multiple temperatures. ICA identified two components, with the temperature-independent component being responsible for themore » majority of specific radiation-induced changes at temperatures below 130 K. The patterns of specific temperature-independent radiation-induced changes suggest a contribution from the tunnelling of electron holes as a possible explanation. In the second case, where a group of 22 data sets was collected on a single thaumatin crystal, ICA was used in another type of analysis to separate specific radiation-induced effects happening on different exposure-level scales. Here, ICA identified two components of specific radiation-induced changes that likely result from radiation-induced chemical reactions progressing with different rates at different locations in the structure. In addition, ICA unexpectedly identified the radiation-damage state corresponding to reduced disulfide bridges rather than the zero-dose extrapolated state as the highest contrast structure. The application of ICA to the analysis of specific radiation-induced changes in real space and the data pre-processing for ICA that relies on singular value decomposition, which was used previously in data space to validate a two-component physical model of X-ray radiation-induced changes, are discussed in detail. This work lays a foundation for a better understanding of protein-specific radiation chemistries and provides a framework for analysing effects of specific radiation damage in crystallographic and cryo-EM experiments.« less

  8. Jasmonate signaling in plant stress responses and development - active and inactive compounds.

    PubMed

    Wasternack, Claus; Strnad, Miroslav

    2016-09-25

    Jasmonates (JAs) are lipid-derived signals mediating plant responses to biotic and abiotic stresses and in plant development. Following the elucidation of each step in their biosynthesis and the important components of perception and signaling, several activators, repressors and co-repressors have been identified which contribute to fine-tuning the regulation of JA-induced gene expression. Many of the metabolic reactions in which JA participates, such as conjugation with amino acids, glucosylation, hydroxylation, carboxylation, sulfation and methylation, lead to numerous compounds with different biological activities. These metabolites may be highly active, partially active in specific processes or inactive. Hydroxylation, carboxylation and sulfation inactivate JA signaling. The precursor of JA biosynthesis, 12-oxo-phytodienoic acid (OPDA), has been identified as a JA-independent signaling compound. An increasing number of OPDA-specific processes is being identified. To conclude, the numerous JA compounds and their different modes of action allow plants to respond specifically and flexibly to alterations in the environment. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Sex-specific microRNA expression networks in an acute mouse model of ozone-induced lung inflammation.

    PubMed

    Fuentes, Nathalie; Roy, Arpan; Mishra, Vikas; Cabello, Noe; Silveyra, Patricia

    2018-05-08

    Sex differences in the incidence and prognosis of respiratory diseases have been reported. Studies have shown that women are at increased risk of adverse health outcomes from air pollution than men, but sex-specific immune gene expression patterns and regulatory networks have not been well studied in the lung. MicroRNAs (miRNAs) are environmentally sensitive posttranscriptional regulators of gene expression that may mediate the damaging effects of inhaled pollutants in the lung, by altering the expression of innate immunity molecules. Male and female mice of the C57BL/6 background were exposed to 2 ppm of ozone or filtered air (control) for 3 h. Female mice were also exposed at different stages of the estrous cycle. Following exposure, lungs were harvested and total RNA was extracted. We used PCR arrays to study sex differences in the expression of 84 miRNAs predicted to target inflammatory and immune genes. We identified differentially expressed miRNA signatures in the lungs of male vs. female exposed to ozone. In silico pathway analyses identified sex-specific biological networks affected by exposure to ozone that ranged from direct predicted gene targeting to complex interactions with multiple intermediates. We also identified differences in miRNA expression and predicted regulatory networks in females exposed to ozone at different estrous cycle stages. Our results indicate that both sex and hormonal status can influence lung miRNA expression in response to ozone exposure, indicating that sex-specific miRNA regulation of inflammatory gene expression could mediate differential pollution-induced health outcomes in men and women.

  10. Large-scale integrative network-based analysis identifies common pathways disrupted by copy number alterations across cancers

    PubMed Central

    2013-01-01

    Background Many large-scale studies analyzed high-throughput genomic data to identify altered pathways essential to the development and progression of specific types of cancer. However, no previous study has been extended to provide a comprehensive analysis of pathways disrupted by copy number alterations across different human cancers. Towards this goal, we propose a network-based method to integrate copy number alteration data with human protein-protein interaction networks and pathway databases to identify pathways that are commonly disrupted in many different types of cancer. Results We applied our approach to a data set of 2,172 cancer patients across 16 different types of cancers, and discovered a set of commonly disrupted pathways, which are likely essential for tumor formation in majority of the cancers. We also identified pathways that are only disrupted in specific cancer types, providing molecular markers for different human cancers. Analysis with independent microarray gene expression datasets confirms that the commonly disrupted pathways can be used to identify patient subgroups with significantly different survival outcomes. We also provide a network view of disrupted pathways to explain how copy number alterations affect pathways that regulate cell growth, cycle, and differentiation for tumorigenesis. Conclusions In this work, we demonstrated that the network-based integrative analysis can help to identify pathways disrupted by copy number alterations across 16 types of human cancers, which are not readily identifiable by conventional overrepresentation-based and other pathway-based methods. All the results and source code are available at http://compbio.cs.umn.edu/NetPathID/. PMID:23822816

  11. Implications of method specific creatinine adjustments on General Medical Services chronic kidney disease classification

    PubMed Central

    Reynolds, Timothy M; Twomey, Patrick J

    2007-01-01

    Aims To evaluate the impact of different equations for calculation of estimated glomerular filtration rate (eGFR) on general practitioner (GP) workload. Methods Retrospective evaluation of routine workload data from a district general hospital chemical pathology laboratory serving a GP patient population of approximately 250 000. The most recent serum creatinine result from 80 583 patients was identified and used for the evaluation. eGFR was calculated using one of three different variants of the four‐parameter Modification of Diet in Renal Disease (MDRD) equation. Results The original MDRD equation (eGFR186) and the modified equation with assay‐specific data (eGFR175corrected) both identified similar numbers of patients with stage 4 and stage 5 chronic kidney disease (ChKD), but the modified equation without assay specific data (eGFR175) resulted in a significant increase in stage 4 ChKD. For stage 3 ChKD the eGFR175 identified 28.69% of the population, the eGFR186 identified 21.35% of the population and the eGFR175corrected identified 13.6% of the population. Conclusions Depending on the choice of equation there can be very large changes in the proportions of patients identified with the different stages of ChKD. Given that according to the General Medical Services Quality Framework, all patients with ChKD stages 3–5 should be included on a practice renal registry, and receive relevant drug therapy, this could have significant impacts on practice workload and drug budgets. It is essential that practices work with their local laboratories. PMID:17761741

  12. Comparative transcriptome analysis of different chemotypes elucidates withanolide biosynthesis pathway from medicinal plant Withania somnifera

    PubMed Central

    Gupta, Parul; Goel, Ridhi; Agarwal, Aditya Vikram; Asif, Mehar Hasan; Sangwan, Neelam Singh; Sangwan, Rajender Singh; Trivedi, Prabodh Kumar

    2015-01-01

    Withania somnifera is one of the most valuable medicinal plants synthesizing secondary metabolites known as withanolides. Despite pharmaceutical importance, limited information is available about the biosynthesis of withanolides. Chemo-profiling of leaf and root tissues of Withania suggest differences in the content and/or nature of withanolides in different chemotypes. To identify genes involved in chemotype and/or tissue-specific withanolide biosynthesis, we established transcriptomes of leaf and root tissues of distinct chemotypes. Genes encoding enzymes for intermediate steps of terpenoid backbone biosynthesis with their alternatively spliced forms and paralogous have been identified. Analysis suggests differential expression of large number genes among leaf and root tissues of different chemotypes. Study also identified differentially expressing transcripts encoding cytochrome P450s, glycosyltransferases, methyltransferases and transcription factors which might be involved in chemodiversity in Withania. Virus induced gene silencing of the sterol ∆7-reductase (WsDWF5) involved in the synthesis of 24-methylene cholesterol, withanolide backbone, suggests role of this enzyme in biosynthesis of withanolides. Information generated, in this study, provides a rich resource for functional analysis of withanolide-specific genes to elucidate chemotype- as well as tissue-specific withanolide biosynthesis. This genomic resource will also help in development of new tools for functional genomics and breeding in Withania. PMID:26688389

  13. Sex-specific nonlinear associations between serum lipids and different domains of cognitive function in middle to older age individuals.

    PubMed

    Lu, Yanhui; An, Yu; Yu, Huanling; Che, Fengyuan; Zhang, Xiaona; Rong, Hongguo; Xi, Yuandi; Xiao, Rong

    2017-08-01

    To examine how serum lipids relates to specific cognitive ability domains between the men and women in Chinese middle to older age individuals. A complete lipid panel was obtained from 1444 individuals, ages 50-65, who also underwent a selection of cognitive tests. Participants were 584 men and 860 women from Linyi city, Shandong province. Multiple linear regression analyses examined serum lipids level as quadratic predictors of sex-specific measure of performance in different cognitive domains, which were adjusted for sociodemographic and lifestyle characteristics. In men, a significant quadratic effect of total cholesterol (TC) was identified for Digit Symbol (B = -0.081, P = 0.044) and also quadratic effect of low density lipoprotein-cholesterol (LDL-C) was identified for Trail Making Test B (B = -0.082, P = 0.045). Differently in women, there were significant quadratic associations between high density lipoprotein-cholesterol (HDL-C) and multiple neuropsychological tests. The nonlinear lipid-cognition associations differed between men and women and were specific to certain cognitive domains and might be of potential relevance for prevention and therapy of cognitive decline.

  14. Sex differences in gut microbiota in patients with major depressive disorder.

    PubMed

    Chen, Jian-Jun; Zheng, Peng; Liu, Yi-Yun; Zhong, Xiao-Gang; Wang, Hai-Yang; Guo, Yu-Jie; Xie, Peng

    2018-01-01

    Our previous studies found that disturbances in gut microbiota might have a causative role in the onset of major depressive disorder (MDD). The aim of this study was to investigate whether there were sex differences in gut microbiota in patients with MDD. First-episode drug-naïve MDD patients and healthy controls were included. 16S rRNA gene sequences extracted from the fecal samples of the included subjects were analyzed. Principal-coordinate analysis and partial least squares-discriminant analysis were used to assess whether there were sex-specific gut microbiota. A random forest algorithm was used to identify the differential operational taxonomic units. Linear discriminant-analysis effect size was further used to identify the dominant sex-specific phylotypes responsible for the differences between MDD patients and healthy controls. In total, 57 and 74 differential operational taxonomic units responsible for separating female and male MDD patients from their healthy counterparts were identified. Compared with their healthy counterparts, increased Actinobacteria and decreased Bacteroidetes levels were found in female and male MDD patients, respectively. The most differentially abundant bacterial taxa in female and male MDD patients belonged to phyla Actinobacteria and Bacteroidia, respectively. Meanwhile, female and male MDD patients had different dominant phylotypes. These results demonstrated that there were sex differences in gut microbiota in patients with MDD. The suitability of Actinobacteria and Bacteroidia as the sex-specific biomarkers for diagnosing MDD should be further explored.

  15. Identification of TPIT and other novel autoantigens in lymphocytic hypophysitis; immunoscreening of a pituitary cDNA library and development of immunoprecipitation assays

    PubMed Central

    Smith, Casey Jo Anne; Bensing, Sophie; Burns, Christine; Robinson, Phillip J; Kasperlik-Zaluska, Anna A; Scott, Rodney J; Kämpe, Olle; Crock, Patricia A

    2012-01-01

    Background Lymphocytic hypophysitis is an organ-specific autoimmune disease of the pituitary gland. A specific and sensitive serological test currently does not exist to aid in the diagnosis. Objective To identify target autoantigens in lymphocytic hypophysitis and develop a diagnostic assay for these proteins. Design/methods A pituitary cDNA expression library was immunoscreened using sera from four patients with lymphocytic hypophysitis. Relevant cDNA clones from screening, along with previously identified autoantigens pituitary gland-specific factor 1a and 2 (PGSF1a and PGSF2) and neuron-specific enolase (NSE) were tested in an in vitro transcription and translation immunoprecipitation assay. The corticotroph-specific transcription factor, TPIT, was investigated separately as a candidate autoantigen. Results Significantly positive autoantibody reactivity against TPIT was found in 9/86 hypophysitis patients vs 1/90 controls (P=0.018). The reactivity against TPIT was not specific for lymphocytic hypophysitis with autoantibodies detectable in the sera from patients with other autoimmune endocrine diseases. Autoantibodies were also detected against chromodomain-helicase-DNA binding protein 8, presynaptic cytomatrix protein (piccolo), Ca2+-dependent secretion activator, PGSF2 and NSE in serum samples from patients with lymphocytic hypophysitis, but at a frequency that did not differ from healthy controls. Importantly, 8/86 patients with lymphocytic hypophysitis had autoantibodies against any two autoantigens in comparison with 0/90 controls (P=0.0093). Conclusions TPIT, a corticotroph-specific transcription factor, was identified as a target autoantigen in 10.5% of patients with lymphocytic hypophysitis. Further autoantigens related to vesicle processing were also identified as potential autoantigens with different immunoreactivity patterns in patients and controls. PMID:22193973

  16. Identification of sex-specific urinary biomarkers for major depressive disorder by combined application of NMR- and GC-MS-based metabonomics.

    PubMed

    Zheng, P; Chen, J-J; Zhou, C-J; Zeng, L; Li, K-W; Sun, L; Liu, M-L; Zhu, D; Liang, Z-H; Xie, P

    2016-11-15

    Women are more vulnerable to major depressive disorder (MDD) than men. However, molecular biomarkers of sex differences are limited. Here we combined gas chromatography-mass spectrometry (GC-MS)- and nuclear magnetic resonance (NMR)-based metabonomics to investigate sex differences of urinary metabolite markers in MDD, and further explore their potential of diagnosing MDD. Consequently, the metabolite signatures of women and men MDD subjects were significantly different from of that in their respective healthy controls (HCs). Twenty seven women and 36 men related differentially expressed metabolites were identified in MDD. Fourteen metabolites were changed in both women and men MDD subjects. Significantly, the women-specific (m-Hydroxyphenylacetate, malonate, glycolate, hypoxanthine, isobutyrate and azelaic acid) and men-specific (tyrosine, N-acetyl-d-glucosamine, N-methylnicotinamide, indoxyl sulfate, citrate and succinate) marker panels were further identified, which could differentiate men and women MDD patients from their respective HCs with higher accuracy than previously reported sex-nonspecific marker panels. Our findings demonstrate that men and women MDD patients have distinct metabonomic signatures and sex-specific biomarkers have promising values in diagnosing MDD.

  17. Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.

    PubMed

    Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu

    2017-08-01

    Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.

  18. Genes contributing to the development of alcoholism: an overview.

    PubMed

    Edenberg, Howard J

    2012-01-01

    Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.

  19. Real-Time PCR for the Detection and Quantification of Geodermatophilaceae from Stone Samples and Identification of New Members of the Genus Blastococcus†

    PubMed Central

    Salazar, Oscar; Valverde, Aranzazu; Genilloud, Olga

    2006-01-01

    Real-time PCR (RT-PCR) technology was used for the specific detection and quantification of members of the family Geodermatophilaceae in stone samples. Differences in the nucleotide sequences of the 16S rRNA gene region were used to design a pair of family-specific primers that were used to detect and quantify by RT-PCR DNA from members of this family in stone samples from different geographical origins in Spain. These primers were applied later to identify by PCR-specific amplification new members of the family Geodermatophilaceae isolated from the same stone samples. The diversity and taxonomic position of the wild-type strains identified from ribosomal sequence analysis suggest the presence of a new lineage within the genus Blastococcus. PMID:16391063

  20. Disease Specific Productivity of American Cancer Hospitals

    PubMed Central

    Goldstein, Jeffery A.; Prasad, Vinay

    2015-01-01

    Context Research-oriented cancer hospitals in the United States treat and study patients with a range of diseases. Measures of disease specific research productivity, and comparison to overall productivity, are currently lacking. Hypothesis Different institutions are specialized in research of particular diseases. Objective To report disease specific productivity of American cancer hospitals, and propose a summary measure. Method We conducted a retrospective observational survey of the 50 highest ranked cancer hospitals in the 2013 US News and World Report rankings. We performed an automated search of PubMed and Clinicaltrials.gov for published reports and registrations of clinical trials (respectively) addressing specific cancers between 2008 and 2013. We calculated the summed impact factor for the publications. We generated a summary measure of productivity based on the number of Phase II clinical trials registered and the impact factor of Phase II clinical trials published for each institution and disease pair. We generated rankings based on this summary measure. Results We identified 6076 registered trials and 6516 published trials with a combined impact factor of 44280.4, involving 32 different diseases over the 50 institutions. Using a summary measure based on registered and published clinical trails, we ranked institutions in specific diseases. As expected, different institutions were highly ranked in disease-specific productivity for different diseases. 43 institutions appeared in the top 10 ranks for at least 1 disease (vs 10 in the overall list), while 6 different institutions were ranked number 1 in at least 1 disease (vs 1 in the overall list). Conclusion Research productivity varies considerably among the sample. Overall cancer productivity conceals great variation between diseases. Disease specific rankings identify sites of high academic productivity, which may be of interest to physicians, patients and researchers. PMID:25781329

  1. Disease specific productivity of american cancer hospitals.

    PubMed

    Goldstein, Jeffery A; Prasad, Vinay

    2015-01-01

    Research-oriented cancer hospitals in the United States treat and study patients with a range of diseases. Measures of disease specific research productivity, and comparison to overall productivity, are currently lacking. Different institutions are specialized in research of particular diseases. To report disease specific productivity of American cancer hospitals, and propose a summary measure. We conducted a retrospective observational survey of the 50 highest ranked cancer hospitals in the 2013 US News and World Report rankings. We performed an automated search of PubMed and Clinicaltrials.gov for published reports and registrations of clinical trials (respectively) addressing specific cancers between 2008 and 2013. We calculated the summed impact factor for the publications. We generated a summary measure of productivity based on the number of Phase II clinical trials registered and the impact factor of Phase II clinical trials published for each institution and disease pair. We generated rankings based on this summary measure. We identified 6076 registered trials and 6516 published trials with a combined impact factor of 44280.4, involving 32 different diseases over the 50 institutions. Using a summary measure based on registered and published clinical trails, we ranked institutions in specific diseases. As expected, different institutions were highly ranked in disease-specific productivity for different diseases. 43 institutions appeared in the top 10 ranks for at least 1 disease (vs 10 in the overall list), while 6 different institutions were ranked number 1 in at least 1 disease (vs 1 in the overall list). Research productivity varies considerably among the sample. Overall cancer productivity conceals great variation between diseases. Disease specific rankings identify sites of high academic productivity, which may be of interest to physicians, patients and researchers.

  2. Analysis of Technical Specifications of the Egyptian and French Electronic Storybooks (e-Storybook)

    ERIC Educational Resources Information Center

    Atta, Mohammed Mahmoud; Abd El Wahab, Shaimaa Mahmoud

    2015-01-01

    This research aims at analysing technical specifications in a sample of Egyptian and French electronic storybooks (e-storybooks), to identify similarities and differences in technical specifications of children's e-storybooks and create a verified analysis list to be used for evaluation of e-storybooks. For this purpose, 32 e-storybooks in CD…

  3. Specification Search for Identifying the Correct Mean Trajectory in Polynomial Latent Growth Models

    ERIC Educational Resources Information Center

    Kim, Minjung; Kwok, Oi-Man; Yoon, Myeongsun; Willson, Victor; Lai, Mark H. C.

    2016-01-01

    This study investigated the optimal strategy for model specification search under the latent growth modeling (LGM) framework, specifically on searching for the correct polynomial mean or average growth model when there is no a priori hypothesized model in the absence of theory. In this simulation study, the effectiveness of different starting…

  4. Using NLP to identify cancer cases in imaging reports drawn from radiology information systems.

    PubMed

    Patrick, Jon; Asgari, Pooyan; Li, Min; Nguyen, Dung

    2013-01-01

    A Natural Language processing (NLP) classifier has been developed for the Victorian and NSW Cancer Registries with the purpose of automatically identifying cancer reports from imaging services, transmitting them to the Registries and then extracting pertinent cancer information. Large scale trials conducted on over 40,000 reports show the sensitivity for identifying reportable cancer reports is above 98% with a specificity above 96%. Detection of tumour stream, report purpose, and a variety of extracted content is generally above 90% specificity. The differences between report layout and authoring strategies across imaging services appear to require different classifiers to retain this high level of accuracy. Linkage of the imaging data with existing registry records (hospital and pathology reports) to derive stage and recurrence of cancer has commenced and shown very promising results.

  5. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  6. Optimizing Telehealth Strategies for Subspecialty Care: Recommendations from Rural Pediatricians

    PubMed Central

    Demirci, Jill R.; Bogen, Debra L.; Mehrotra, Ateev; Miller, Elizabeth

    2015-01-01

    Abstract Background: Telehealth offers strategies to improve access to subspecialty care for children in rural communities. Rural pediatrician experiences and preferences regarding the use of these telehealth strategies for children's subspecialty care needs are not known. We elicited rural pediatrician experiences and preferences regarding different pediatric subspecialty telehealth strategies. Materials and Methods: Seventeen semistructured telephone interviews were conducted with rural pediatricians from 17 states within the United States. Interviewees were recruited by e-mails to a pediatric rural health listserv and to rural pediatricians identified through snowball sampling. Themes were identified through thematic analysis of interview transcripts. Institutional Review Board approval was obtained. Results: Rural pediatricians identified several telehealth strategies to improve access to subspecialty care, including physician access hotlines, remote electronic medical record access, electronic messaging systems, live video telemedicine, and telehealth triage systems. Rural pediatricians provided recommendations for optimizing the utility of each of these strategies based on their experiences with different systems. Rural pediatricians preferred specific telehealth strategies for specific clinical contexts, resulting in a proposed framework describing the complementary role of different telehealth strategies for pediatric subspecialty care. Finally, rural pediatricians identified additional benefits associated with the use of telehealth strategies and described a desire for telehealth systems that enhanced (rather than replaced) personal relationships between rural pediatricians and subspecialists. Conclusions: Rural pediatricians described complementary roles for different subspecialty care telehealth strategies. Additionally, rural pediatricians provided recommendations for optimizing individual telehealth strategies. Input from rural pediatricians will be crucial for optimizing specific telehealth strategies and designing effective telehealth systems. PMID:25919585

  7. Sex-specific differences in transcriptome profiles of brain and muscle tissue of the tropical gar.

    PubMed

    Cribbin, Kayla M; Quackenbush, Corey R; Taylor, Kyle; Arias-Rodriguez, Lenin; Kelley, Joanna L

    2017-04-07

    The tropical gar (Atractosteus tropicus) is the southernmost species of the seven extant species of gar fishes in the world. In Mexico and Central America, the species is an important food source due to its nutritional quality and low price. Despite its regional importance and increasing concerns about overexploitation and habitat degradation, basic genetic information on the tropical gar is lacking. Determining genetic information on the tropical gar is important for the sustainable management of wild populations, implementation of best practices in aquaculture settings, evolutionary studies of ancient lineages, and an understanding of sex-specific gene expression. In this study, the transcriptome of the tropical gar was sequenced and assembled de novo using tissues from three males and three females using Illumina sequencing technology. Sex-specific and highly differentially expressed transcripts in brain and muscle tissues between adult males and females were subsequently identified. The transcriptome was assembled de novo resulting in 80,611 transcripts with a contig N50 of 3,355 base pairs and over 168 kilobases in total length. Male muscle, brain, and gonad as well as female muscle and brain were included in the assembly. The assembled transcriptome was annotated to identify the putative function of expressed transcripts using Trinotate and SwissProt, a database of well-annotated proteins. The brain and muscle datasets were then aligned to the assembled transcriptome to identify transcripts that were differentially expressed between males and females. The contrast between male and female brain identified 109 transcripts from 106 genes that were significantly differentially expressed. In the muscle comparison, 82 transcripts from 80 genes were identified with evidence for significant differential expression. Almost all genes identified as differentially expressed were sex-specific. The differentially expressed transcripts were enriched for genes involved in cellular functioning, signaling, immune response, and tissue-specific functions. This study identified differentially expressed transcripts between male and female gar in muscle and brain tissue. The majority of differentially expressed transcripts had sex-specific expression. Expanding on these findings to other developmental stages, populations, and species may lead to the identification of genetic factors contributing to the skewed sex ratio seen in the tropical gar and of sex-specific differences in expression in other species. Finally, the transcriptome assembly will open future research avenues on tropical gar development, cell function, environmental resistance, and evolution in the context of other early vertebrates.

  8. Immunohistochemical differentiation of atypical hyperplasia vs. carcinoma in situ of the breast.

    PubMed

    Masood, S; Sim, S J; Lu, L

    1992-01-01

    The distinction between atypical hyperplasia and carcinoma in situ in breast lesions can be difficult. The identification of myoepithelial cell layers may be helpful in establishing a diagnosis of proliferative breast disease vs. intraepithelial neoplasia. We reviewed pathologic material on 20 cases of atypical hyperplasia and 29 cases of carcinoma in situ. Immunohistochemical stains were employed against muscle-specific actin, S-100 protein, and cytokeratin to identify myoepithelial cells and to recognize different staining patterns. In atypical hyperplasia, muscle-specific actin staining identified myoepithelial cells in fine branching fibrovascular layers or as scattered cells between other proliferating cells. This pattern was absent in carcinoma in situ. S-100 protein showed more positive staining in atypical hyperplasia than in carcinoma in situ with patterns distinct from muscle-specific actin. Immunostaining for cytokeratin demonstrated distinctly different patterns between the two lesions. This study suggests that muscle-specific actin, S-100 protein, and cytokeratin in combination may assist in distinguishing proliferative breast disease with atypia from carcinoma in situ.

  9. Differentiating Pathway-Specific From Nonspecific Effects in High-Throughput Toxicity Data: A Foundation for Prioritizing Adverse Outcome Pathway Development.

    PubMed

    Fay, Kellie A; Villeneuve, Daniel L; Swintek, Joe; Edwards, Stephen W; Nelms, Mark D; Blackwell, Brett R; Ankley, Gerald T

    2018-06-01

    The U.S. Environmental Protection Agency's ToxCast program has screened thousands of chemicals for biological activity, primarily using high-throughput in vitro bioassays. Adverse outcome pathways (AOPs) offer a means to link pathway-specific biological activities with potential apical effects relevant to risk assessors. Thus, efforts are underway to develop AOPs relevant to pathway-specific perturbations detected in ToxCast assays. Previous work identified a "cytotoxic burst" (CTB) phenomenon wherein large numbers of the ToxCast assays begin to respond at or near test chemical concentrations that elicit cytotoxicity, and a statistical approach to defining the bounds of the CTB was developed. To focus AOP development on the molecular targets corresponding to ToxCast assays indicating pathway-specific effects, we conducted a meta-analysis to identify which assays most frequently respond at concentrations below the CTB. A preliminary list of potentially important, target-specific assays was determined by ranking assays by the fraction of chemical hits below the CTB compared with the number of chemicals tested. Additional priority assays were identified using a diagnostic-odds-ratio approach which gives greater ranking to assays with high specificity but low responsivity. Combined, the two prioritization methods identified several novel targets (e.g., peripheral benzodiazepine and progesterone receptors) to prioritize for AOP development, and affirmed the importance of a number of existing AOPs aligned with ToxCast targets (e.g., thyroperoxidase, estrogen receptor, aromatase). The prioritization approaches did not appear to be influenced by inter-assay differences in chemical bioavailability. Furthermore, the outcomes were robust based on a variety of different parameters used to define the CTB.

  10. The Influence of Age and Sex on Genetic Associations with Adult Body Size and Shape: A Large-Scale Genome-Wide Interaction Study.

    PubMed

    Winkler, Thomas W; Justice, Anne E; Graff, Mariaelisa; Barata, Llilda; Feitosa, Mary F; Chu, Su; Czajkowski, Jacek; Esko, Tõnu; Fall, Tove; Kilpeläinen, Tuomas O; Lu, Yingchang; Mägi, Reedik; Mihailov, Evelin; Pers, Tune H; Rüeger, Sina; Teumer, Alexander; Ehret, Georg B; Ferreira, Teresa; Heard-Costa, Nancy L; Karjalainen, Juha; Lagou, Vasiliki; Mahajan, Anubha; Neinast, Michael D; Prokopenko, Inga; Simino, Jeannette; Teslovich, Tanya M; Jansen, Rick; Westra, Harm-Jan; White, Charles C; Absher, Devin; Ahluwalia, Tarunveer S; Ahmad, Shafqat; Albrecht, Eva; Alves, Alexessander Couto; Bragg-Gresham, Jennifer L; de Craen, Anton J M; Bis, Joshua C; Bonnefond, Amélie; Boucher, Gabrielle; Cadby, Gemma; Cheng, Yu-Ching; Chiang, Charleston W K; Delgado, Graciela; Demirkan, Ayse; Dueker, Nicole; Eklund, Niina; Eiriksdottir, Gudny; Eriksson, Joel; Feenstra, Bjarke; Fischer, Krista; Frau, Francesca; Galesloot, Tessel E; Geller, Frank; Goel, Anuj; Gorski, Mathias; Grammer, Tanja B; Gustafsson, Stefan; Haitjema, Saskia; Hottenga, Jouke-Jan; Huffman, Jennifer E; Jackson, Anne U; Jacobs, Kevin B; Johansson, Åsa; Kaakinen, Marika; Kleber, Marcus E; Lahti, Jari; Mateo Leach, Irene; Lehne, Benjamin; Liu, Youfang; Lo, Ken Sin; Lorentzon, Mattias; Luan, Jian'an; Madden, Pamela A F; Mangino, Massimo; McKnight, Barbara; Medina-Gomez, Carolina; Monda, Keri L; Montasser, May E; Müller, Gabriele; Müller-Nurasyid, Martina; Nolte, Ilja M; Panoutsopoulou, Kalliope; Pascoe, Laura; Paternoster, Lavinia; Rayner, Nigel W; Renström, Frida; Rizzi, Federica; Rose, Lynda M; Ryan, Kathy A; Salo, Perttu; Sanna, Serena; Scharnagl, Hubert; Shi, Jianxin; Smith, Albert Vernon; Southam, Lorraine; Stančáková, Alena; Steinthorsdottir, Valgerdur; Strawbridge, Rona J; Sung, Yun Ju; Tachmazidou, Ioanna; Tanaka, Toshiko; Thorleifsson, Gudmar; Trompet, Stella; Pervjakova, Natalia; Tyrer, Jonathan P; Vandenput, Liesbeth; van der Laan, Sander W; van der Velde, Nathalie; van Setten, Jessica; van Vliet-Ostaptchouk, Jana V; Verweij, Niek; Vlachopoulou, Efthymia; Waite, Lindsay L; Wang, Sophie R; Wang, Zhaoming; Wild, Sarah H; Willenborg, Christina; Wilson, James F; Wong, Andrew; Yang, Jian; Yengo, Loïc; Yerges-Armstrong, Laura M; Yu, Lei; Zhang, Weihua; Zhao, Jing Hua; Andersson, Ehm A; Bakker, Stephan J L; Baldassarre, Damiano; Banasik, Karina; Barcella, Matteo; Barlassina, Cristina; Bellis, Claire; Benaglio, Paola; Blangero, John; Blüher, Matthias; Bonnet, Fabrice; Bonnycastle, Lori L; Boyd, Heather A; Bruinenberg, Marcel; Buchman, Aron S; Campbell, Harry; Chen, Yii-Der Ida; Chines, Peter S; Claudi-Boehm, Simone; Cole, John; Collins, Francis S; de Geus, Eco J C; de Groot, Lisette C P G M; Dimitriou, Maria; Duan, Jubao; Enroth, Stefan; Eury, Elodie; Farmaki, Aliki-Eleni; Forouhi, Nita G; Friedrich, Nele; Gejman, Pablo V; Gigante, Bruna; Glorioso, Nicola; Go, Alan S; Gottesman, Omri; Gräßler, Jürgen; Grallert, Harald; Grarup, Niels; Gu, Yu-Mei; Broer, Linda; Ham, Annelies C; Hansen, Torben; Harris, Tamara B; Hartman, Catharina A; Hassinen, Maija; Hastie, Nicholas; Hattersley, Andrew T; Heath, Andrew C; Henders, Anjali K; Hernandez, Dena; Hillege, Hans; Holmen, Oddgeir; Hovingh, Kees G; Hui, Jennie; Husemoen, Lise L; Hutri-Kähönen, Nina; Hysi, Pirro G; Illig, Thomas; De Jager, Philip L; Jalilzadeh, Shapour; Jørgensen, Torben; Jukema, J Wouter; Juonala, Markus; Kanoni, Stavroula; Karaleftheri, Maria; Khaw, Kay Tee; Kinnunen, Leena; Kittner, Steven J; Koenig, Wolfgang; Kolcic, Ivana; Kovacs, Peter; Krarup, Nikolaj T; Kratzer, Wolfgang; Krüger, Janine; Kuh, Diana; Kumari, Meena; Kyriakou, Theodosios; Langenberg, Claudia; Lannfelt, Lars; Lanzani, Chiara; Lotay, Vaneet; Launer, Lenore J; Leander, Karin; Lindström, Jaana; Linneberg, Allan; Liu, Yan-Ping; Lobbens, Stéphane; Luben, Robert; Lyssenko, Valeriya; Männistö, Satu; Magnusson, Patrik K; McArdle, Wendy L; Menni, Cristina; Merger, Sigrun; Milani, Lili; Montgomery, Grant W; Morris, Andrew P; Narisu, Narisu; Nelis, Mari; Ong, Ken K; Palotie, Aarno; Pérusse, Louis; Pichler, Irene; Pilia, Maria G; Pouta, Anneli; Rheinberger, Myriam; Ribel-Madsen, Rasmus; Richards, Marcus; Rice, Kenneth M; Rice, Treva K; Rivolta, Carlo; Salomaa, Veikko; Sanders, Alan R; Sarzynski, Mark A; Scholtens, Salome; Scott, Robert A; Scott, William R; Sebert, Sylvain; Sengupta, Sebanti; Sennblad, Bengt; Seufferlein, Thomas; Silveira, Angela; Slagboom, P Eline; Smit, Jan H; Sparsø, Thomas H; Stirrups, Kathleen; Stolk, Ronald P; Stringham, Heather M; Swertz, Morris A; Swift, Amy J; Syvänen, Ann-Christine; Tan, Sian-Tsung; Thorand, Barbara; Tönjes, Anke; Tremblay, Angelo; Tsafantakis, Emmanouil; van der Most, Peter J; Völker, Uwe; Vohl, Marie-Claude; Vonk, Judith M; Waldenberger, Melanie; Walker, Ryan W; Wennauer, Roman; Widén, Elisabeth; Willemsen, Gonneke; Wilsgaard, Tom; Wright, Alan F; Zillikens, M Carola; van Dijk, Suzanne C; van Schoor, Natasja M; Asselbergs, Folkert W; de Bakker, Paul I W; Beckmann, Jacques S; Beilby, John; Bennett, David A; Bergman, Richard N; Bergmann, Sven; Böger, Carsten A; Boehm, Bernhard O; Boerwinkle, Eric; Boomsma, Dorret I; Bornstein, Stefan R; Bottinger, Erwin P; Bouchard, Claude; Chambers, John C; Chanock, Stephen J; Chasman, Daniel I; Cucca, Francesco; Cusi, Daniele; Dedoussis, George; Erdmann, Jeanette; Eriksson, Johan G; Evans, Denis A; de Faire, Ulf; Farrall, Martin; Ferrucci, Luigi; Ford, Ian; Franke, Lude; Franks, Paul W; Froguel, Philippe; Gansevoort, Ron T; Gieger, Christian; Grönberg, Henrik; Gudnason, Vilmundur; Gyllensten, Ulf; Hall, Per; Hamsten, Anders; van der Harst, Pim; Hayward, Caroline; Heliövaara, Markku; Hengstenberg, Christian; Hicks, Andrew A; Hingorani, Aroon; Hofman, Albert; Hu, Frank; Huikuri, Heikki V; Hveem, Kristian; James, Alan L; Jordan, Joanne M; Jula, Antti; Kähönen, Mika; Kajantie, Eero; Kathiresan, Sekar; Kiemeney, Lambertus A L M; Kivimaki, Mika; Knekt, Paul B; Koistinen, Heikki A; Kooner, Jaspal S; Koskinen, Seppo; Kuusisto, Johanna; Maerz, Winfried; Martin, Nicholas G; Laakso, Markku; Lakka, Timo A; Lehtimäki, Terho; Lettre, Guillaume; Levinson, Douglas F; Lind, Lars; Lokki, Marja-Liisa; Mäntyselkä, Pekka; Melbye, Mads; Metspalu, Andres; Mitchell, Braxton D; Moll, Frans L; Murray, Jeffrey C; Musk, Arthur W; Nieminen, Markku S; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J; Oostra, Ben A; Palmer, Lyle J; Pankow, James S; Pasterkamp, Gerard; Pedersen, Nancy L; Pedersen, Oluf; Penninx, Brenda W; Perola, Markus; Peters, Annette; Polašek, Ozren; Pramstaller, Peter P; Psaty, Bruce M; Qi, Lu; Quertermous, Thomas; Raitakari, Olli T; Rankinen, Tuomo; Rauramaa, Rainer; Ridker, Paul M; Rioux, John D; Rivadeneira, Fernando; Rotter, Jerome I; Rudan, Igor; den Ruijter, Hester M; Saltevo, Juha; Sattar, Naveed; Schunkert, Heribert; Schwarz, Peter E H; Shuldiner, Alan R; Sinisalo, Juha; Snieder, Harold; Sørensen, Thorkild I A; Spector, Tim D; Staessen, Jan A; Stefania, Bandinelli; Thorsteinsdottir, Unnur; Stumvoll, Michael; Tardif, Jean-Claude; Tremoli, Elena; Tuomilehto, Jaakko; Uitterlinden, André G; Uusitupa, Matti; Verbeek, André L M; Vermeulen, Sita H; Viikari, Jorma S; Vitart, Veronique; Völzke, Henry; Vollenweider, Peter; Waeber, Gérard; Walker, Mark; Wallaschofski, Henri; Wareham, Nicholas J; Watkins, Hugh; Zeggini, Eleftheria; Chakravarti, Aravinda; Clegg, Deborah J; Cupples, L Adrienne; Gordon-Larsen, Penny; Jaquish, Cashell E; Rao, D C; Abecasis, Goncalo R; Assimes, Themistocles L; Barroso, Inês; Berndt, Sonja I; Boehnke, Michael; Deloukas, Panos; Fox, Caroline S; Groop, Leif C; Hunter, David J; Ingelsson, Erik; Kaplan, Robert C; McCarthy, Mark I; Mohlke, Karen L; O'Connell, Jeffrey R; Schlessinger, David; Strachan, David P; Stefansson, Kari; van Duijn, Cornelia M; Hirschhorn, Joel N; Lindgren, Cecilia M; Heid, Iris M; North, Kari E; Borecki, Ingrid B; Kutalik, Zoltán; Loos, Ruth J F

    2015-10-01

    Genome-wide association studies (GWAS) have identified more than 100 genetic variants contributing to BMI, a measure of body size, or waist-to-hip ratio (adjusted for BMI, WHRadjBMI), a measure of body shape. Body size and shape change as people grow older and these changes differ substantially between men and women. To systematically screen for age- and/or sex-specific effects of genetic variants on BMI and WHRadjBMI, we performed meta-analyses of 114 studies (up to 320,485 individuals of European descent) with genome-wide chip and/or Metabochip data by the Genetic Investigation of Anthropometric Traits (GIANT) Consortium. Each study tested the association of up to ~2.8M SNPs with BMI and WHRadjBMI in four strata (men ≤50y, men >50y, women ≤50y, women >50y) and summary statistics were combined in stratum-specific meta-analyses. We then screened for variants that showed age-specific effects (G x AGE), sex-specific effects (G x SEX) or age-specific effects that differed between men and women (G x AGE x SEX). For BMI, we identified 15 loci (11 previously established for main effects, four novel) that showed significant (FDR<5%) age-specific effects, of which 11 had larger effects in younger (<50y) than in older adults (≥50y). No sex-dependent effects were identified for BMI. For WHRadjBMI, we identified 44 loci (27 previously established for main effects, 17 novel) with sex-specific effects, of which 28 showed larger effects in women than in men, five showed larger effects in men than in women, and 11 showed opposite effects between sexes. No age-dependent effects were identified for WHRadjBMI. This is the first genome-wide interaction meta-analysis to report convincing evidence of age-dependent genetic effects on BMI. In addition, we confirm the sex-specificity of genetic effects on WHRadjBMI. These results may provide further insights into the biology that underlies weight change with age or the sexually dimorphism of body shape.

  11. The Influence of Age and Sex on Genetic Associations with Adult Body Size and Shape: A Large-Scale Genome-Wide Interaction Study

    PubMed Central

    Feitosa, Mary F.; Chu, Su; Czajkowski, Jacek; Esko, Tõnu; Fall, Tove; Kilpeläinen, Tuomas O.; Lu, Yingchang; Mägi, Reedik; Mihailov, Evelin; Pers, Tune H.; Rüeger, Sina; Teumer, Alexander; Ehret, Georg B.; Ferreira, Teresa; Heard-Costa, Nancy L.; Karjalainen, Juha; Lagou, Vasiliki; Mahajan, Anubha; Neinast, Michael D.; Prokopenko, Inga; Simino, Jeannette; Teslovich, Tanya M.; Jansen, Rick; Westra, Harm-Jan; White, Charles C.; Absher, Devin; Ahluwalia, Tarunveer S.; Ahmad, Shafqat; Albrecht, Eva; Alves, Alexessander Couto; Bragg-Gresham, Jennifer L.; de Craen, Anton J. M.; Bis, Joshua C.; Bonnefond, Amélie; Boucher, Gabrielle; Cadby, Gemma; Cheng, Yu-Ching; Chiang, Charleston W. K.; Delgado, Graciela; Demirkan, Ayse; Dueker, Nicole; Eklund, Niina; Eiriksdottir, Gudny; Eriksson, Joel; Feenstra, Bjarke; Fischer, Krista; Frau, Francesca; Galesloot, Tessel E.; Geller, Frank; Goel, Anuj; Gorski, Mathias; Grammer, Tanja B.; Gustafsson, Stefan; Haitjema, Saskia; Hottenga, Jouke-Jan; Huffman, Jennifer E.; Jackson, Anne U.; Jacobs, Kevin B.; Johansson, Åsa; Kaakinen, Marika; Kleber, Marcus E.; Lahti, Jari; Leach, Irene Mateo; Lehne, Benjamin; Liu, Youfang; Lo, Ken Sin; Lorentzon, Mattias; Luan, Jian'an; Madden, Pamela A. F.; Mangino, Massimo; McKnight, Barbara; Medina-Gomez, Carolina; Monda, Keri L.; Montasser, May E.; Müller, Gabriele; Müller-Nurasyid, Martina; Nolte, Ilja M.; Panoutsopoulou, Kalliope; Pascoe, Laura; Paternoster, Lavinia; Rayner, Nigel W.; Renström, Frida; Rizzi, Federica; Rose, Lynda M.; Ryan, Kathy A.; Salo, Perttu; Sanna, Serena; Scharnagl, Hubert; Shi, Jianxin; Smith, Albert Vernon; Southam, Lorraine; Stančáková, Alena; Steinthorsdottir, Valgerdur; Strawbridge, Rona J.; Sung, Yun Ju; Tachmazidou, Ioanna; Tanaka, Toshiko; Thorleifsson, Gudmar; Trompet, Stella; Pervjakova, Natalia; Tyrer, Jonathan P.; Vandenput, Liesbeth; van der Laan, Sander W; van der Velde, Nathalie; van Setten, Jessica; van Vliet-Ostaptchouk, Jana V.; Verweij, Niek; Vlachopoulou, Efthymia; Waite, Lindsay L.; Wang, Sophie R.; Wang, Zhaoming; Wild, Sarah H.; Willenborg, Christina; Wilson, James F.; Wong, Andrew; Yang, Jian; Yengo, Loïc; Yerges-Armstrong, Laura M.; Yu, Lei; Zhang, Weihua; Zhao, Jing Hua; Andersson, Ehm A.; Bakker, Stephan J. L.; Baldassarre, Damiano; Banasik, Karina; Barcella, Matteo; Barlassina, Cristina; Bellis, Claire; Benaglio, Paola; Blangero, John; Blüher, Matthias; Bonnet, Fabrice; Bonnycastle, Lori L.; Boyd, Heather A.; Bruinenberg, Marcel; Buchman, Aron S; Campbell, Harry; Chen, Yii-Der Ida; Chines, Peter S.; Claudi-Boehm, Simone; Cole, John; Collins, Francis S.; de Geus, Eco J. C.; de Groot, Lisette C. P. G. M.; Dimitriou, Maria; Duan, Jubao; Enroth, Stefan; Eury, Elodie; Farmaki, Aliki-Eleni; Forouhi, Nita G.; Friedrich, Nele; Gejman, Pablo V.; Gigante, Bruna; Glorioso, Nicola; Go, Alan S.; Gottesman, Omri; Gräßler, Jürgen; Grallert, Harald; Grarup, Niels; Gu, Yu-Mei; Broer, Linda; Ham, Annelies C.; Hansen, Torben; Harris, Tamara B.; Hartman, Catharina A.; Hassinen, Maija; Hastie, Nicholas; Hattersley, Andrew T.; Heath, Andrew C.; Henders, Anjali K.; Hernandez, Dena; Hillege, Hans; Holmen, Oddgeir; Hovingh, Kees G; Hui, Jennie; Husemoen, Lise L.; Hutri-Kähönen, Nina; Hysi, Pirro G.; Illig, Thomas; De Jager, Philip L.; Jalilzadeh, Shapour; Jørgensen, Torben; Jukema, J. Wouter; Juonala, Markus; Kanoni, Stavroula; Karaleftheri, Maria; Khaw, Kay Tee; Kinnunen, Leena; Kittner, Steven J.; Koenig, Wolfgang; Kolcic, Ivana; Kovacs, Peter; Krarup, Nikolaj T.; Kratzer, Wolfgang; Krüger, Janine; Kuh, Diana; Kumari, Meena; Kyriakou, Theodosios; Langenberg, Claudia; Lannfelt, Lars; Lanzani, Chiara; Lotay, Vaneet; Launer, Lenore J.; Leander, Karin; Lindström, Jaana; Linneberg, Allan; Liu, Yan-Ping; Lobbens, Stéphane; Luben, Robert; Lyssenko, Valeriya; Männistö, Satu; Magnusson, Patrik K.; McArdle, Wendy L.; Menni, Cristina; Merger, Sigrun; Milani, Lili; Montgomery, Grant W.; Morris, Andrew P.; Narisu, Narisu; Nelis, Mari; Ong, Ken K.; Palotie, Aarno; Pérusse, Louis; Pichler, Irene; Pilia, Maria G.; Pouta, Anneli; Rheinberger, Myriam; Ribel-Madsen, Rasmus; Richards, Marcus; Rice, Kenneth M.; Rice, Treva K.; Rivolta, Carlo; Salomaa, Veikko; Sanders, Alan R.; Sarzynski, Mark A.; Scholtens, Salome; Scott, Robert A.; Scott, William R.; Sebert, Sylvain; Sengupta, Sebanti; Sennblad, Bengt; Seufferlein, Thomas; Silveira, Angela; Slagboom, P. Eline; Smit, Jan H.; Sparsø, Thomas H.; Stirrups, Kathleen; Stolk, Ronald P.; Stringham, Heather M.; Swertz, Morris A; Swift, Amy J.; Syvänen, Ann-Christine; Tan, Sian-Tsung; Thorand, Barbara; Tönjes, Anke; Tremblay, Angelo; Tsafantakis, Emmanouil; van der Most, Peter J.; Völker, Uwe; Vohl, Marie-Claude; Vonk, Judith M.; Waldenberger, Melanie; Walker, Ryan W.; Wennauer, Roman; Widén, Elisabeth; Willemsen, Gonneke; Wilsgaard, Tom; Wright, Alan F.; Zillikens, M. Carola; van Dijk, Suzanne C.; van Schoor, Natasja M.; Asselbergs, Folkert W.; de Bakker, Paul I. W.; Beckmann, Jacques S.; Beilby, John; Bennett, David A.; Bergman, Richard N.; Bergmann, Sven; Böger, Carsten A.; Boehm, Bernhard O.; Boerwinkle, Eric; Boomsma, Dorret I.; Bornstein, Stefan R.; Bottinger, Erwin P.; Bouchard, Claude; Chambers, John C.; Chanock, Stephen J.; Chasman, Daniel I.; Cucca, Francesco; Cusi, Daniele; Dedoussis, George; Erdmann, Jeanette; Eriksson, Johan G.; Evans, Denis A.; de Faire, Ulf; Farrall, Martin; Ferrucci, Luigi; Ford, Ian; Franke, Lude; Franks, Paul W.; Froguel, Philippe; Gansevoort, Ron T.; Gieger, Christian; Grönberg, Henrik; Gudnason, Vilmundur; Gyllensten, Ulf; Hall, Per; Hamsten, Anders; van der Harst, Pim; Hayward, Caroline; Heliövaara, Markku; Hengstenberg, Christian; Hicks, Andrew A; Hingorani, Aroon; Hofman, Albert; Hu, Frank; Huikuri, Heikki V.; Hveem, Kristian; James, Alan L.; Jordan, Joanne M.; Jula, Antti; Kähönen, Mika; Kajantie, Eero; Kathiresan, Sekar; Kiemeney, Lambertus A. L. M.; Kivimaki, Mika; Knekt, Paul B.; Koistinen, Heikki A.; Kooner, Jaspal S.; Koskinen, Seppo; Kuusisto, Johanna; Maerz, Winfried; Martin, Nicholas G; Laakso, Markku; Lakka, Timo A.; Lehtimäki, Terho; Lettre, Guillaume; Levinson, Douglas F.; Lind, Lars; Lokki, Marja-Liisa; Mäntyselkä, Pekka; Melbye, Mads; Metspalu, Andres; Mitchell, Braxton D.; Moll, Frans L.; Murray, Jeffrey C.; Musk, Arthur W.; Nieminen, Markku S.; Njølstad, Inger; Ohlsson, Claes; Oldehinkel, Albertine J.; Oostra, Ben A.; Palmer, Lyle J; Pankow, James S.; Pasterkamp, Gerard; Pedersen, Nancy L.; Pedersen, Oluf; Penninx, Brenda W.; Perola, Markus; Peters, Annette; Polašek, Ozren; Pramstaller, Peter P.; Psaty, Bruce M.; Qi, Lu; Quertermous, Thomas; Raitakari, Olli T.; Rankinen, Tuomo; Rauramaa, Rainer; Ridker, Paul M.; Rioux, John D.; Rivadeneira, Fernando; Rotter, Jerome I.; Rudan, Igor; den Ruijter, Hester M.; Saltevo, Juha; Sattar, Naveed; Schunkert, Heribert; Schwarz, Peter E. H.; Shuldiner, Alan R.; Sinisalo, Juha; Snieder, Harold; Sørensen, Thorkild I. A.; Spector, Tim D.; Staessen, Jan A.; Stefania, Bandinelli; Thorsteinsdottir, Unnur; Stumvoll, Michael; Tardif, Jean-Claude; Tremoli, Elena; Tuomilehto, Jaakko; Uitterlinden, André G.; Uusitupa, Matti; Verbeek, André L. M.; Vermeulen, Sita H.; Viikari, Jorma S.; Vitart, Veronique; Völzke, Henry; Vollenweider, Peter; Waeber, Gérard; Walker, Mark; Wallaschofski, Henri; Wareham, Nicholas J.; Watkins, Hugh; Zeggini, Eleftheria; Chakravarti, Aravinda; Clegg, Deborah J.; Cupples, L. Adrienne; Gordon-Larsen, Penny; Jaquish, Cashell E.; Rao, D. C.; Abecasis, Goncalo R.; Assimes, Themistocles L.; Barroso, Inês; Berndt, Sonja I.; Boehnke, Michael; Deloukas, Panos; Fox, Caroline S.; Groop, Leif C.; Hunter, David J.; Ingelsson, Erik; Kaplan, Robert C.; McCarthy, Mark I.; Mohlke, Karen L.; O'Connell, Jeffrey R.; Schlessinger, David; Strachan, David P.; Stefansson, Kari; van Duijn, Cornelia M.; Hirschhorn, Joel N.; Lindgren, Cecilia M.; Heid, Iris M.; North, Kari E.; Borecki, Ingrid B.; Kutalik, Zoltán; Loos, Ruth J. F.

    2015-01-01

    Genome-wide association studies (GWAS) have identified more than 100 genetic variants contributing to BMI, a measure of body size, or waist-to-hip ratio (adjusted for BMI, WHRadjBMI), a measure of body shape. Body size and shape change as people grow older and these changes differ substantially between men and women. To systematically screen for age- and/or sex-specific effects of genetic variants on BMI and WHRadjBMI, we performed meta-analyses of 114 studies (up to 320,485 individuals of European descent) with genome-wide chip and/or Metabochip data by the Genetic Investigation of Anthropometric Traits (GIANT) Consortium. Each study tested the association of up to ~2.8M SNPs with BMI and WHRadjBMI in four strata (men ≤50y, men >50y, women ≤50y, women >50y) and summary statistics were combined in stratum-specific meta-analyses. We then screened for variants that showed age-specific effects (G x AGE), sex-specific effects (G x SEX) or age-specific effects that differed between men and women (G x AGE x SEX). For BMI, we identified 15 loci (11 previously established for main effects, four novel) that showed significant (FDR<5%) age-specific effects, of which 11 had larger effects in younger (<50y) than in older adults (≥50y). No sex-dependent effects were identified for BMI. For WHRadjBMI, we identified 44 loci (27 previously established for main effects, 17 novel) with sex-specific effects, of which 28 showed larger effects in women than in men, five showed larger effects in men than in women, and 11 showed opposite effects between sexes. No age-dependent effects were identified for WHRadjBMI. This is the first genome-wide interaction meta-analysis to report convincing evidence of age-dependent genetic effects on BMI. In addition, we confirm the sex-specificity of genetic effects on WHRadjBMI. These results may provide further insights into the biology that underlies weight change with age or the sexually dimorphism of body shape. PMID:26426971

  12. Treatment and Outcome for Children with Esophageal Atresia from a Gender Perspective.

    PubMed

    Ekselius, Julia; Salö, Martin; Arnbjörnsson, Einar; Stenström, Pernilla

    2017-01-01

    Besides the incidence of esophageal atresia (EA) being higher in males, no other gender-specific differences in EA have been reported. The aim of this study was to search for gender-specific differences in EA. A retrospective study was conducted at a tertiary center for pediatric surgery. The medical charts of infants born with EA were reviewed. 20 girls were identified, and 20 boys were selected as matched controls with respect to concomitant malformations. Their treatment and outcome were evaluated. Polyhydramnios was more common in pregnancies with boys, 40%, versus girls, 10%, with EA ( p < 0.01). In total, 36 (90%) children had patent ductus arteriosus, without any gender difference (18 and 18, resp., p =1). The distribution of days at the different levels of care was not equally distributed between boys and girls. Boys with EA had significantly more postoperative days (median 5 days) in the ward than girls (median 5 and 2 days, resp., p =0.04). No other gender-specific differences in surgical treatment, complications, or symptoms at follow-up were identified. Polyhydramnios appears to be more frequent in pregnancies with boys than girls with EA. In this study, boys have longer stays than girls at the pediatric surgery ward.

  13. Biodiversity of mannose-specific adhesion in Lactobacillus plantarum revisited: strain-specific domain composition of the mannose-adhesin.

    PubMed

    Gross, G; Snel, J; Boekhorst, J; Smits, M A; Kleerebezem, M

    2010-03-01

    Recently, we have identified the mannose-specific adhesin encoding gene (msa) of Lactobacillus plantarum. In the current study, structure and function of this potentially probiotic effector gene were further investigated, exploring genetic diversity of msa in L. plantarum in relation to mannose adhesion capacity. The results demonstrate that there is considerable variation in quantitative in vitro mannose adhesion capacity, which is paralleled by msa gene sequence variation. The msa genes of different L. plantarum strains encode proteins with variable domain composition. Construction of L. plantarum 299v mutant strains revealed that the msa gene product is the key-protein for mannose adhesion, also in a strain with high mannose adhering capacity. However, no straightforward correlation between adhesion capacity and domain composition of Msa in L. plantarum could be identified. Nevertheless, differences in Msa sequences in combination with variable genetic background of specific bacterial strains appears to determine mannose adhesion capacity and potentially affects probiotic properties. These findings exemplify the strain-specificity of probiotic characteristics and illustrate the need for careful and molecular selection of new candidate probiotics.

  14. ANTHROPOMETRY TO IDENTIFY HIGH VISCERAL FAT AREA IN POSTMENOPAUSAL WOMEN.

    PubMed

    Gondim Pitanga, Francisco José; Seara Pitanga, Cristiano Penas; Calçada Dias Gabriel, Ronaldo Eugénio; Cristina Beck, Carmem; Rodrigues Moreira, Maria Helena

    2015-12-01

    the evaluation of the body fat distribution by anthropometry can serve to identify excess visceral fat. This diagnosis will enable implementation of specific measures to both prevent and treat excess visceral fat in postmenopausal women. the aim of this study was to analyze different anthropometric indicators and identify the best cutoff points to discriminate subjects with high visceral fat area (HVFA) in postmenopausal women. cross-sectional study with a sample of 255 postmenopausal women. Different Receiver Operating Characteristic (ROC) curves were constructed and the areas under them compared in terms of the conicity index (C-index), body mass index (BMI), waist-to-hip ratio (WHR), waist circumference (WC), weight-to-height ratio (WHtR) and HVFA. Sensitivity and specificity identified the best cutoff points between the different anthropometric indicators in order to discriminate subjects with HVFA. The confidence interval was set at 95%. statistically significant areas under the ROC curve were found for all anthropometric indicators analyzed. The following cutoff points, with their respective sensitivities and specificities to discriminate subjects with HVFA, were suggested: C-index (1.19; 75.00%- 74.77%); BMI (27.3 kg/m2; 81.08%-80.37%); WHR (0.98; 90.54%-83.18%); WC (85 cm; 85.14%-81.31%); and WHtR (0.55; 80.41%-80.37%). these results demonstrate that anthropometric indicators identify HVFA well in postmenopausal women and can be used instead of more sophisticated exams to detect high levels of visceral fat. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  15. Sex Differences in Proximal Control of the Knee Joint

    PubMed Central

    Mendiguchia, Jurdan; Ford, Kevin R.; Quatman, Carmen E.; Alentorn-Geli, Eduard; Hewett, Timothy E.

    2014-01-01

    Following the onset of maturation, female athletes have a significantly higher risk for anterior cruciate ligament (ACL) injury compared with male athletes. While multiple sex differences in lower-extremity neuromuscular control and biomechanics have been identified as potential risk factors for ACL injury in females, the majority of these studies have focused specifically on the knee joint. However, increasing evidence in the literature indicates that lumbopelvic (core) control may have a large effect on knee-joint control and injury risk. This review examines the published evidence on the contributions of the trunk and hip to knee-joint control. Specifically, the sex differences in potential proximal controllers of the knee as risk factors for ACL injury are identified and discussed. Sex differences in trunk and hip biomechanics have been identified in all planes of motion (sagittal, coronal and transverse). Essentially, female athletes show greater lateral trunk displacement, altered trunk and hip flexion angles, greater ranges of trunk motion, and increased hip adduction and internal rotation during sport manoeuvres, compared with their male counterparts. These differences may increase the risk of ACL injury among female athletes. Prevention programmes targeted towards trunk and hip neuromuscular control may decrease the risk for ACL injuries. PMID:21688868

  16. Drosophila Cancer Models Identify Functional Differences between Ret Fusions.

    PubMed

    Levinson, Sarah; Cagan, Ross L

    2016-09-13

    We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient's treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Identification of Single- and Multiple-Class Specific Signature Genes from Gene Expression Profiles by Group Marker Index

    PubMed Central

    Tsai, Yu-Shuen; Aguan, Kripamoy; Pal, Nikhil R.; Chung, I-Fang

    2011-01-01

    Informative genes from microarray data can be used to construct prediction model and investigate biological mechanisms. Differentially expressed genes, the main targets of most gene selection methods, can be classified as single- and multiple-class specific signature genes. Here, we present a novel gene selection algorithm based on a Group Marker Index (GMI), which is intuitive, of low-computational complexity, and efficient in identification of both types of genes. Most gene selection methods identify only single-class specific signature genes and cannot identify multiple-class specific signature genes easily. Our algorithm can detect de novo certain conditions of multiple-class specificity of a gene and makes use of a novel non-parametric indicator to assess the discrimination ability between classes. Our method is effective even when the sample size is small as well as when the class sizes are significantly different. To compare the effectiveness and robustness we formulate an intuitive template-based method and use four well-known datasets. We demonstrate that our algorithm outperforms the template-based method in difficult cases with unbalanced distribution. Moreover, the multiple-class specific genes are good biomarkers and play important roles in biological pathways. Our literature survey supports that the proposed method identifies unique multiple-class specific marker genes (not reported earlier to be related to cancer) in the Central Nervous System data. It also discovers unique biomarkers indicating the intrinsic difference between subtypes of lung cancer. We also associate the pathway information with the multiple-class specific signature genes and cross-reference to published studies. We find that the identified genes participate in the pathways directly involved in cancer development in leukemia data. Our method gives a promising way to find genes that can involve in pathways of multiple diseases and hence opens up the possibility of using an existing drug on other diseases as well as designing a single drug for multiple diseases. PMID:21909426

  18. Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data

    PubMed Central

    2013-01-01

    Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200

  19. SUMMA and Model Mimicry: Understanding Differences Among Land Models

    NASA Astrophysics Data System (ADS)

    Nijssen, B.; Nearing, G. S.; Ou, G.; Clark, M. P.

    2016-12-01

    Model inter-comparison and model ensemble experiments suffer from an inability to explain the mechanisms behind differences in model outcomes. We can clearly demonstrate that the models are different, but we cannot necessarily identify the reasons why, because most models exhibit myriad differences in process representations, model parameterizations, model parameters and numerical solution methods. This inability to identify the reasons for differences in model performance hampers our understanding and limits model improvement, because we cannot easily identify the most promising paths forward. We have developed the Structure for Unifying Multiple Modeling Alternatives (SUMMA) to allow for controlled experimentation with model construction, numerical techniques, and parameter values and therefore isolate differences in model outcomes to specific choices during the model development process. In developing SUMMA, we recognized that hydrologic models can be thought of as individual instantiations of a master modeling template that is based on a common set of conservation equations for energy and water. Given this perspective, SUMMA provides a unified approach to hydrologic modeling that integrates different modeling methods into a consistent structure with the ability to instantiate alternative hydrologic models at runtime. Here we employ SUMMA to revisit a previous multi-model experiment and demonstrate its use for understanding differences in model performance. Specifically, we implement SUMMA to mimic the spread of behaviors exhibited by the land models that participated in the Protocol for the Analysis of Land Surface Models (PALS) Land Surface Model Benchmarking Evaluation Project (PLUMBER) and draw conclusions about the relative performance of specific model parameterizations for water and energy fluxes through the soil-vegetation continuum. SUMMA's ability to mimic the spread of model ensembles and the behavior of individual models can be an important tool in focusing model development and improvement efforts.

  20. Accommodative Lag by Autorefraction and Two Dynamic Retinoscopy Methods

    PubMed Central

    2008-01-01

    Purpose To evaluate two clinical procedures, MEM and Nott retinoscopy, for detecting accommodative lags 1.00 diopter (D) or greater in children as identified by an open-field autorefractor. Methods 168 children 8 to <12 years old with low myopia, normal visual acuity, and no strabismus participated as part of an ancillary study within the screening process for a randomized trial. Accommodative response to a 3.00 D demand was first assessed by MEM and Nott retinoscopy, viewing binocularly with spherocylindrical refractive error corrected, with testing order randomized and each performed by a different masked examiner. The response was then determined viewing monocularly with spherical equivalent refractive error corrected, using an open-field autorefractor, which was the gold standard used for eligibility for the clinical trial. Sensitivity and specificity for accommodative lags of 1.00 D or more were calculated for each retinoscopy method compared to the autorefractor. Results 116 (69%) of the 168 children had accommodative lag of 1.00 D or more by autorefraction. MEM identified 66 children identified by autorefraction for a sensitivity of 57% (95% CI = 47% to 66%) and a specificity of 63% (95% CI = 49% to 76%). Nott retinoscopy identified 35 children for a sensitivity of 30% (95% CI = 22% to 39%) and a specificity of 81% (95% CI = 67% to 90%). Analysis of receiver operating characteristic (ROC) curves constructed for MEM and for Nott retinoscopy failed to reveal alternate cut points that would improve the combination of sensitivity and specificity for identifying accommodative lag ≥ 1.00 D as defined by autorefraction. Conclusions Neither MEM nor Nott retinoscopy provided adequate sensitivity and specificity to identify myopic children with accommodative lag ≥ 1.00 D as determined by autorefraction. A variety of methodological differences between the techniques may contribute to the modest to poor agreement. PMID:19214130

  1. Developmental trajectories of paediatric headache - sex-specific analyses and predictors.

    PubMed

    Isensee, Corinna; Fernandez Castelao, Carolin; Kröner-Herwig, Birgit

    2016-01-01

    Headache is the most common pain disorder in children and adolescents and is associated with diverse dysfunctions and psychological symptoms. Several studies evidenced sex-specific differences in headache frequency. Until now no study exists that examined sex-specific patterns of change in paediatric headache across time and included pain-related somatic and (socio-)psychological predictors. Latent Class Growth Analysis (LCGA) was used in order to identify different trajectory classes of headache across four annual time points in a population-based sample (n = 3 227; mean age 11.34 years; 51.2 % girls). In multinomial logistic regression analyses the influence of several predictors on the class membership was examined. For girls, a four-class model was identified as the best fitting model. While the majority of girls reported no (30.5 %) or moderate headache frequencies (32.5 %) across time, one class with a high level of headache days (20.8 %) and a class with an increasing headache frequency across time (16.2 %) were identified. For boys a two class model with a 'no headache class' (48.6 %) and 'moderate headache class' (51.4 %) showed the best model fit. Regarding logistic regression analyses, migraine and parental headache proved to be stable predictors across sexes. Depression/anxiety was a significant predictor for all pain classes in girls. Life events, dysfunctional stress coping and school burden were also able to differentiate at least between some classes in both sexes. The identified trajectories reflect sex-specific differences in paediatric headache, as seen in the number and type of classes extracted. The documented risk factors can deliver ideas for preventive actions and considerations for treatment programmes.

  2. Knee joint biomechanics and neuromuscular control during gait before and after total knee arthroplasty are sex-specific.

    PubMed

    Astephen Wilson, Janie L; Dunbar, Michael J; Hubley-Kozey, Cheryl L

    2015-01-01

    The future of total knee arthroplasty (TKA) surgery will involve planning that incorporates more patient-specific characteristics. Despite known biological, morphological, and functional differences between men and women, there has been little investigation into knee joint biomechanical and neuromuscular differences between men and women with osteoarthritis, and none that have examined sex-specific biomechanical and neuromuscular responses to TKA surgery. The objective of this study was to examine sex-associated differences in knee kinematics, kinetics and neuromuscular patterns during gait before and after TKA. Fifty-two patients with end-stage knee OA (28 women, 24 men) underwent gait and neuromuscular analysis within the week prior to and one year after surgery. A number of sex-specific differences were identified which suggest a different manifestation of end-stage knee OA between the sexes. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Morphometry Based on Effective and Accurate Correspondences of Localized Patterns (MEACOLP)

    PubMed Central

    Wang, Hu; Ren, Yanshuang; Bai, Lijun; Zhang, Wensheng; Tian, Jie

    2012-01-01

    Local features in volumetric images have been used to identify correspondences of localized anatomical structures for brain morphometry. However, the correspondences are often sparse thus ineffective in reflecting the underlying structures, making it unreliable to evaluate specific morphological differences. This paper presents a morphometry method (MEACOLP) based on correspondences with improved effectiveness and accuracy. A novel two-level scale-invariant feature transform is used to enhance the detection repeatability of local features and to recall the correspondences that might be missed in previous studies. Template patterns whose correspondences could be commonly identified in each group are constructed to serve as the basis for morphometric analysis. A matching algorithm is developed to reduce the identification errors by comparing neighboring local features and rejecting unreliable matches. The two-sample t-test is finally adopted to analyze specific properties of the template patterns. Experiments are performed on the public OASIS database to clinically analyze brain images of Alzheimer's disease (AD) and normal controls (NC). MEACOLP automatically identifies known morphological differences between AD and NC brains, and characterizes the differences well as the scaling and translation of underlying structures. Most of the significant differences are identified in only a single hemisphere, indicating that AD-related structures are characterized by strong anatomical asymmetry. In addition, classification trials to differentiate AD subjects from NC confirm that the morphological differences are reliably related to the groups of interest. PMID:22540000

  4. Improving a complex finite-difference ground water flow model through the use of an analytic element screening model

    USGS Publications Warehouse

    Hunt, R.J.; Anderson, M.P.; Kelson, V.A.

    1998-01-01

    This paper demonstrates that analytic element models have potential as powerful screening tools that can facilitate or improve calibration of more complicated finite-difference and finite-element models. We demonstrate how a two-dimensional analytic element model was used to identify errors in a complex three-dimensional finite-difference model caused by incorrect specification of boundary conditions. An improved finite-difference model was developed using boundary conditions developed from a far-field analytic element model. Calibration of a revised finite-difference model was achieved using fewer zones of hydraulic conductivity and lake bed conductance than the original finite-difference model. Calibration statistics were also improved in that simulated base-flows were much closer to measured values. The improved calibration is due mainly to improved specification of the boundary conditions made possible by first solving the far-field problem with an analytic element model.This paper demonstrates that analytic element models have potential as powerful screening tools that can facilitate or improve calibration of more complicated finite-difference and finite-element models. We demonstrate how a two-dimensional analytic element model was used to identify errors in a complex three-dimensional finite-difference model caused by incorrect specification of boundary conditions. An improved finite-difference model was developed using boundary conditions developed from a far-field analytic element model. Calibration of a revised finite-difference model was achieved using fewer zones of hydraulic conductivity and lake bed conductance than the original finite-difference model. Calibration statistics were also improved in that simulated base-flows were much closer to measured values. The improved calibration is due mainly to improved specification of the boundary conditions made possible by first solving the far-field problem with an analytic element model.

  5. Interventions for improving adherence to iron chelation therapy in people with sickle cell disease or thalassaemia

    PubMed Central

    Fortin, Patricia M; Madgwick, Karen V; Trivella, Marialena; Hopewell, Sally; Doree, Carolyn; Estcourt, Lise J

    2016-01-01

    This is the protocol for a review and there is no abstract. The objectives are as follows: To identify and assess the effectiveness of interventions to improve adherence to iron chelation therapy compared to standard care in people with SCD or thalassaemia including: identifying and assessing the effectiveness of different types of interventions (psychological and psychosocial, educational, medication interventions, or multi-component interventions);identifying and assessing the effectiveness of interventions specific to different age groups (children, adolescents, adults). PMID:27713668

  6. Authentication of an endangered herb Changium smyrnioides from different producing areas based on rDNA ITS sequences and allele-specific PCR.

    PubMed

    Sun, Xiaoqin; Wei, Yanglian; Qin, Minjian; Guo, Qiaosheng; Guo, Jianlin; Zhou, Yifeng; Hang, Yueyu

    2012-03-01

    The rDNA ITS region of 18 samples of Changium smyrnioides from 7 areas and of 2 samples of Chuanminshen violaceum were sequenced and analyzed. The amplified ITS region of the samples, including a partial sequence of ITS1 and complete sequences of 5.8S and ITS2, had a total length of 555 bp. After complete alignment, there were 49 variable sites, of which 45 were informative, when gaps were treated as missing data. Samples of C. smyrnioides from different locations could be identified exactly based on the variable sites. The maximum parsimony (MP) and neighbor joining (NJ) tree constructed from the ITS sequences based on Kumar's two-parameter model showed that the genetic distances of the C. smyrnioides samples from different locations were not always related to their geographical distances. A specific primer set for Allele-specific PCR authentication of C. violaceum from Jurong of Jiangsu was designed based on the SNP in the ITS sequence alignment. C. violaceum from the major genuine producing area in Jurong of Jiangsu could be identified exactly and quickly by Allele-specific PCR.

  7. Development of the Patient-specific Cardiovascular Modeling System Using Immersed Boundary Technique

    NASA Astrophysics Data System (ADS)

    Tay, Wee-Beng; Lin, Liang-Yu; Tseng, Wen-Yih; Tseng, Yu-Heng

    2010-05-01

    A computational fluid dynamics (CFD) based, patient-specific cardiovascular modeling system is under-developed. The system can identify possible diseased conditions and facilitate physicians' diagnosis at early stage through the hybrid CFD simulation and time-resolved magnetic resonance imaging (MRI). The CFD simulation is initially based on the three-dimensional heart model developed by McQueen and Peskin, which can simultaneously compute fluid motions and elastic boundary motions using the immersed boundary method. We extend and improve the three-dimensional heart model for the clinical application by including the patient-specific hemodynamic information. The flow features in the ventricles and their responses are investigated under different inflow and outflow conditions during diastole and systole phases based on the quasi-realistic heart model, which takes advantage of the observed flow scenarios. Our results indicate distinct differences between the two groups of participants, including the vortex formation process in the left ventricle (LV), as well as the flow rate distributions at different identified sources such as the aorta, vena cava and pulmonary veins/artery. We further identify some key parameters which may affect the vortex formation in the LV. Thus it is hypothesized that disease-related dysfunctions in intervals before complete heart failure can be observed in the dynamics of transmitral blood flow during early LV diastole.

  8. Differences in the Policies, Programs, and Practices (PPPs) and Combination of PPPs across Turnaround, Moderately Improving, and Not Improving Schools

    ERIC Educational Resources Information Center

    Herman, Rebecca; Huberman, Mette

    2012-01-01

    The TALPS study aims to build on the existing research base to develop promising methodologies to identify chronically low-performing and turnaround schools, as well as to identify promising strategies for turning around chronically low-performing schools. By looking specifically at schools identified as turnaround, in comparison to nonturnaround…

  9. The Relationship Between Research by Women and Women's Experiential Roles

    ERIC Educational Resources Information Center

    Mead, Margaret

    1978-01-01

    Anthropological models can be used to study gender differences and identify biologically given differences, experientially given differences, and socially created differences in men and women. Research on gender-specific behavior should always be done by both men and women in cross-cultural contexts to correct for prejudice, bias, and myopia.…

  10. Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice

    PubMed Central

    Garg, Rohini; Tyagi, Akhilesh K.; Jain, Mukesh

    2012-01-01

    Hormones exert pleiotropic effects on plant growth and development throughout the life cycle. Many of these effects are mediated at molecular level via altering gene expression. In this study, we investigated the exogenous effect of plant hormones, including auxin, cytokinin, abscisic acid, ethylene, salicylic acid and jasmonic acid, on the transcription of rice genes at whole genome level using microarray. Our analysis identified a total of 4171 genes involved in several biological processes, whose expression was altered significantly in the presence of different hormones. Further, 28% of these genes exhibited overlapping transcriptional responses in the presence of any two hormones, indicating crosstalk among plant hormones. In addition, we identified genes showing only a particular hormone-specific response, which can be used as hormone-specific markers. The results of this study will facilitate further studies in hormone biology in rice. PMID:22827941

  11. Sex- and Tissue-specific Functions of Drosophila Doublesex Transcription Factor Target Genes

    PubMed Central

    Clough, Emily; Jimenez, Erin; Kim, Yoo-Ah; Whitworth, Cale; Neville, Megan C.; Hempel, Leonie; Pavlou, Hania J.; Chen, Zhen-Xia; Sturgill, David; Dale, Ryan; Smith, Harold E.; Przytycka, Teresa M.; Goodwin, Stephen F.; Van Doren, Mark; Oliver, Brian

    2014-01-01

    Primary sex determination “switches” evolve rapidly, but Doublesex (DSX) related transcription factors (DMRTs) act downstream of these switches to control sexual development in most animal species. Drosophila dsx encodes female- and male-specific isoforms (DSXF and DSXM), but little is known about how dsx controls sexual development, whether DSXF and DSXM bind different targets, or how DSX proteins direct different outcomes in diverse tissues. We undertook genome-wide analyses to identify DSX targets using in vivo occupancy, binding site prediction, and evolutionary conservation. We find that DSXF and DSXM bind thousands of the same targets in multiple tissues in both sexes, yet these targets have sex- and tissue-specific functions. Interestingly, DSX targets show considerable overlap with targets identified for mouse DMRT1. DSX targets include transcription factors and signaling pathway components providing for direct and indirect regulation of sex-biased expression. PMID:25535918

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, Gary L.; Dubinsky, Eric A.

    Herein are described 1058 different bacterial taxa that were unique to either human, grazing mammal, or bird fecal wastes. These identified taxa can serve as specific identifier taxa for these sources in environmental waters. Two field tests in marine waters demonstrate the capacity of phylogenetic microarray analysis to track multiple sources with one test.

  13. Identifying the role of pre-and postsynaptic GABAB receptors in behavior

    PubMed Central

    Kasten, Chelsea R.; Boehm, Stephen L.

    2015-01-01

    Although many reviews exist characterizing the molecular differences of GABAB receptor isoforms, there is no current review of the in vivo effects of these isoforms. The current review focuses on whether the GABAB1a and GABAB1b isoforms contribute differentially to behaviors in isoform knockout mice. The roles of these receptors have primarily been characterized in cognitive, anxiety, and depressive phenotypes. Currently, the field supports a role of GABAB1a in memory maintenance and protection against an anhedonic phenotype, whereas GABAB1b appears to be involved in memory formation and a susceptibility to developing an anhedonic phenotype. Although GABAB receptors have been strongly implicated in drug abuse phenotypes, no isoform-specific work has been done in this field. Future directions include developing site-specific isoform knockdown to identify the role of different brain regions in behavior, as well as identifying how these isoforms are involved in development of behavioral phenotypes. PMID:26283074

  14. Sex-dependent genetic effects on immune responses to a parasitic nematode.

    PubMed

    Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K

    2014-03-14

    Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of future studies.

  15. Trunk sway measures of postural stability during clinical balance tests in patients with chronic whiplash injury symptoms.

    PubMed

    Sjöström, Henrik; Allum, John H J; Carpenter, Mark G; Adkin, Allan L; Honegger, Flurin; Ettlin, Thierry

    2003-08-01

    Trunk sway occurring during clinical stance and gait tasks was compared between a group of subjects with a chronic whiplash injury, resulting from an automobile collision, and a normal collective. To examine if population specific trunk sway patterns for stance and gait could be identified for chronic whiplash injury patients. Our previous work has established that it is possible to identify specific patterns of stance and gait deficits for vestibular loss (both acute and compensated) patients and those with Parkinson's disease. Our question was whether it was possible to use the same stance and gait tasks to identify patterns of trunk sway differences with respect to those of healthy subjects and individuals with a chronic whiplash injury. Twenty-five subjects with history of whiplash injury and 170 healthy age-matched control subjects participated in the study. Trunk sway angular displacements in chronic whiplash patients were assessed for a number of stance and gait tasks similar to those of the Tinetti and Clinical Test of Sensory Interaction and Balance (CTSIB) protocols. We used a lightweight, easy-to-attach, body-worn apparatus to measure trunk angular displacements and velocities in the roll (lateral) and the pitch (forward-backward) planes. Data analysis revealed several significant differences between the two groups. A pattern could be identified, showing greater trunk sway for stance tasks and for complex gait tasks that required task-specific gaze control such as walking up and down stairs. Trunk sway was less, however, for simple gait tasks that demanded large head movements but no task-specific gaze control, such as walking while rotating the head. Subjects who have a chronic whiplash injury show a characteristic pattern of trunk sway that is different from that of other patient groups with balance disorders. Balance was most unstable during gait involving task-specific head movements which possibly enhance a pathologic vestibulo-cervical interaction.

  16. Matrix assisted laser desorption ionization mass spectrometry imaging identifies markers of ageing and osteoarthritic cartilage

    PubMed Central

    2014-01-01

    Introduction Cartilage protein distribution and the changes that occur in cartilage ageing and disease are essential in understanding the process of cartilage ageing and age related diseases such as osteoarthritis. The aim of this study was to investigate the peptide profiles in ageing and osteoarthritic (OA) cartilage sections using matrix assisted laser desorption ionization mass spectrometry imaging (MALDI-MSI). Methods The distribution of proteins in young, old and OA equine cartilage was compared following tryptic digestion of cartilage slices and MALDI-MSI undertaken with a MALDI SYNAPT™ HDMS system. Protein identification was undertaken using database searches following multivariate analysis. Peptide intensity differences between young, ageing and OA cartilage were imaged with Biomap software. Analysis of aggrecanase specific cleavage patterns of a crude cartilage proteoglycan extract were used to validate some of the differences in peptide intensity identified. Immunohistochemistry studies validated the differences in protein abundance. Results Young, old and OA equine cartilage was discriminated based on their peptide signature using discriminant analysis. Proteins including aggrecan core protein, fibromodulin, and cartilage oligomeric matrix protein were identified and localised. Fibronectin peptides displayed a stronger intensity in OA cartilage. Age-specific protein markers for collectin-43 and cartilage oligomeric matrix protein were identified. In addition potential fibromodulin and biglycan peptides targeted for degradation in OA were detected. Conclusions MALDI-MSI provided a novel platform to study cartilage ageing and disease enabling age and disease specific peptides in cartilage to be elucidated and spatially resolved. PMID:24886698

  17. Enhancing the Value of Population-Based Risk Scores for Institutional-Level Use.

    PubMed

    Raza, Sajjad; Sabik, Joseph F; Rajeswaran, Jeevanantham; Idrees, Jay J; Trezzi, Matteo; Riaz, Haris; Javadikasgari, Hoda; Nowicki, Edward R; Svensson, Lars G; Blackstone, Eugene H

    2016-07-01

    We hypothesized that factors associated with an institution's residual risk unaccounted for by population-based models may be identifiable and used to enhance the value of population-based risk scores for quality improvement. From January 2000 to January 2010, 4,971 patients underwent aortic valve replacement (AVR), either isolated (n = 2,660) or with concomitant coronary artery bypass grafting (AVR+CABG; n = 2,311). Operative mortality and major morbidity and mortality predicted by The Society of Thoracic Surgeons (STS) risk models were compared with observed values. After adjusting for patients' STS score, additional and refined risk factors were sought to explain residual risk. Differences between STS model coefficients (risk-factor strength) and those specific to our institution were calculated. Observed operative mortality was less than predicted for AVR (1.6% [42 of 2,660] vs 2.8%, p < 0.0001) and AVR+CABG (2.6% [59 of 2,311] vs 4.9%, p < 0.0001). Observed major morbidity and mortality was also lower than predicted for isolated AVR (14.6% [389 of 2,660] vs 17.5%, p < 0.0001) and AVR+CABG (20.0% [462 of 2,311] vs 25.8%, p < 0.0001). Shorter height, higher bilirubin, and lower albumin were identified as additional institution-specific risk factors, and body surface area, creatinine, glomerular filtration rate, blood urea nitrogen, and heart failure across all levels of functional class were identified as refined risk-factor variables associated with residual risk. In many instances, risk-factor strength differed substantially from that of STS models. Scores derived from population-based models can be enhanced for institutional level use by adjusting for institution-specific additional and refined risk factors. Identifying these and measuring differences in institution-specific versus population-based risk-factor strength can identify areas to target for quality improvement initiatives. Copyright © 2016 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  18. Emergence of differentially regulated pathways associated with the development of regional specificity in chicken skin.

    PubMed

    Chang, Kai-Wei; Huang, Nancy A; Liu, I-Hsuan; Wang, Yi-Hui; Wu, Ping; Tseng, Yen-Tzu; Hughes, Michael W; Jiang, Ting Xin; Tsai, Mong-Hsun; Chen, Chien-Yu; Oyang, Yen-Jen; Lin, En-Chung; Chuong, Cheng-Ming; Lin, Shau-Ping

    2015-01-23

    Regional specificity allows different skin regions to exhibit different characteristics, enabling complementary functions to make effective use of the integumentary surface. Chickens exhibit a high degree of regional specificity in the skin and can serve as a good model for when and how these regional differences begin to emerge. We used developing feather and scale regions in embryonic chickens as a model to gauge the differences in their molecular pathways. We employed cosine similarity analysis to identify the differentially regulated and co-regulated genes. We applied low cell techniques for expression validation and chromatin immunoprecipitation (ChIP)-based enhancer identification to overcome limited cell availabilities from embryonic chicken skin. We identified a specific set of genes demonstrating a high correlation as being differentially expressed during feather and scale development and maturation. Some members of the WNT, TGF-beta/BMP, and Notch family known to be involved in feathering skin differentiation were found to be differentially regulated. Interestingly, we also found genes along calcium channel pathways that are differentially regulated. From the analysis of differentially regulated pathways, we used calcium signaling pathways as an example for further verification. Some voltage-gated calcium channel subunits, particularly CACNA1D, are expressed spatio-temporally in the skin epithelium. These calcium signaling pathway members may be involved in developmental decisions, morphogenesis, or epithelial maturation. We further characterized enhancers associated with histone modifications, including H3K4me1, H3K27ac, and H3K27me3, near calcium channel-related genes and identified signature intensive hotspots that may be correlated with certain voltage-gated calcium channel genes. We demonstrated the applicability of cosine similarity analysis for identifying novel regulatory pathways that are differentially regulated during development. Our study concerning the effects of signaling pathways and histone signatures on enhancers suggests that voltage-gated calcium signaling may be involved in early skin development. This work lays the foundation for studying the roles of these gene pathways and their genomic regulation during the establishment of skin regional specificity.

  19. Set-specific capture can be reduced by preemptively occupying a limited-capacity focus of attention.

    PubMed

    Moore, Katherine Sledge; Weissman, Daniel H

    2011-01-01

    Recent work has shown that contingent attentional capture effects can be especially large when multiple attentional sets for color guide visual search (Moore & Weissman, 2010). In particular, this research suggests that detecting a target-colored (e.g., orange) distractor leads the corresponding attentional set (e.g., identify orange letters) to enter a limited-capacity focus of attention in working memory, where it remains briefly while the distractor is being attended. Consequently, the ability to identify a differently-colored (e.g., green) target 100-300 ms later is impaired because the appropriate set (e.g., identify green letters) cannot also enter the focus of attention. In two experiments, we investigated whether such set-specific capture can be reduced by preemptively occupying the focus of attention. As predicted, a target-colored central distractor presented 233 ms before a target-colored peripheral distractor eliminated set-specific capture arising from the peripheral distractor. Moreover, this effect was observed only when the central distractor's color (e.g., orange) (a) matched a different set than the upcoming peripheral distractor's color (e.g., green) and (b) matched the same set as the upcoming central target's color (e.g., orange). We conclude that the same working memory limitations that give rise to set-specific capture can be preemptively exploited to reduce it.

  20. Identifying Gender-Specific Developmental Trajectories of Nonviolent and Violent Delinquency from Adolescence to Young Adulthood

    PubMed Central

    Zheng, Yao; Cleveland, H. Harrington

    2013-01-01

    Most research examining gender differences in developmental trajectories of antisocial behavior does not consider subtypes of antisocial behavior and is difficult to generalize due to small nonrepresentative samples. The current study investigated gender difference in developmental trajectories from adolescence to young adulthood while addressing those limitations. Analyses were limited to respondents ages 15 and 16 in wave 1 (16–17 in wave 2, and 21–22 in wave 3) of the National Longitudinal Study of Adolescent Health (n = 6244, 49.5% males). Self-report nonviolent and violent delinquencies were simultaneously entered into latent class analysis. Four latent classes were identified: low, desister, decliner, and chronic (male-only). In addition to finding a male-specific chronic class, gender differences included differences in levels of nonviolent and violent delinquency between synonymous classes of males and females, and differences in prevalence of classes across genders. Neighborhood disadvantage and family support predicted trajectories. PMID:23375843

  1. Perceived Relational Support in Adolescence: Dimensions, Configurations, and Adolescent Adjustment.

    ERIC Educational Resources Information Center

    Scholte, Ron H. J.; van Lieshout, Cornelis F. M.; van Aken, Marcel A. G.

    2001-01-01

    Examined characteristics of perceived relational support from four key providers for 12- to 18-year-olds. Variable-centered factor analyses yielded five support dimensions, three specific to providers and two specific to provisions. Person-centered factor analyses identified five types of adolescents with different configurations of perceived…

  2. Temporal Assessment of the Impact of Exposure to Cow Feces in Two Watersheds by Multiple Host-Specific PCR Assays

    EPA Science Inventory

    Exposure to feces in two watersheds with different management histories was assessed by tracking cattle feces bacterial populations using multiple host-specific PCR assays. In addition, environmental factors affecting the occurrence of these markers were identified. Each assay wa...

  3. Temporal Assessment of the Impact of Exposure to Cow Feces inTwo Watersheds by Multiple Host-Specific PCR Assays

    EPA Science Inventory

    Fecal exposure in two watersheds with different management histories was assessed by tracking cattle fecal bacterial populations using multiple host-specific PCR assays. In addition, environmental factors affecting the occurrence of these markers were identified. Each assay was t...

  4. Genomic features separating ten strains of Neorhizobium galegae with different symbiotic phenotypes.

    PubMed

    Österman, Janina; Mousavi, Seyed Abdollah; Koskinen, Patrik; Paulin, Lars; Lindström, Kristina

    2015-05-02

    The symbiotic phenotype of Neorhizobium galegae, with strains specifically fixing nitrogen with either Galega orientalis or G. officinalis, has made it a target in research on determinants of host specificity in nitrogen fixation. The genomic differences between representative strains of the two symbiovars are, however, relatively small. This introduced a need for a dataset representing a larger bacterial population in order to make better conclusions on characteristics typical for a subset of the species. In this study, we produced draft genomes of eight strains of N. galegae having different symbiotic phenotypes, both with regard to host specificity and nitrogen fixation efficiency. These genomes were analysed together with the previously published complete genomes of N. galegae strains HAMBI 540T and HAMBI 1141. The results showed that the presence of an additional rpoN sigma factor gene in the symbiosis gene region is a characteristic specific to symbiovar orientalis, required for nitrogen fixation. Also the nifQ gene was shown to be crucial for functional symbiosis in both symbiovars. Genome-wide analyses identified additional genes characteristic of strains of the same symbiovar and of strains having similar plant growth promoting properties on Galega orientalis. Many of these genes are involved in transcriptional regulation or in metabolic functions. The results of this study confirm that the only symbiosis-related gene that is present in one symbiovar of N. galegae but not in the other is an rpoN gene. The specific function of this gene remains to be determined, however. New genes that were identified as specific for strains of one symbiovar may be involved in determining host specificity, while others are defined as potential determinant genes for differences in efficiency of nitrogen fixation.

  5. Identifying States along the Hematopoietic Stem Cell Differentiation Hierarchy with Single Cell Specificity via Raman Spectroscopy.

    PubMed

    Ilin, Yelena; Choi, Ji Sun; Harley, Brendan A C; Kraft, Mary L

    2015-11-17

    A major challenge for expanding specific types of hematopoietic cells ex vivo for the treatment of blood cell pathologies is identifying the combinations of cellular and matrix cues that direct hematopoietic stem cells (HSC) to self-renew or differentiate into cell populations ex vivo. Microscale screening platforms enable minimizing the number of rare HSCs required to screen the effects of numerous cues on HSC fate decisions. These platforms create a strong demand for label-free methods that accurately identify the fate decisions of individual hematopoietic cells at specific locations on the platform. We demonstrate the capacity to identify discrete cells along the HSC differentiation hierarchy via multivariate analysis of Raman spectra. Notably, cell state identification is accurate for individual cells and independent of the biophysical properties of the functionalized polyacrylamide gels upon which these cells are cultured. We report partial least-squares discriminant analysis (PLS-DA) models of single cell Raman spectra enable identifying four dissimilar hematopoietic cell populations across the HSC lineage specification. Successful discrimination was obtained for a population enriched for long-term repopulating HSCs (LT-HSCs) versus their more differentiated progeny, including closely related short-term repopulating HSCs (ST-HSCs) and fully differentiated lymphoid (B cells) and myeloid (granulocytes) cells. The lineage-specific differentiation states of cells from these four subpopulations were accurately identified independent of the stiffness of the underlying biomaterial substrate, indicating subtle spectral variations that discriminated these populations were not masked by features from the culture substrate. This approach enables identifying the lineage-specific differentiation stages of hematopoietic cells on biomaterial substrates of differing composition and may facilitate correlating hematopoietic cell fate decisions with the extrinsic cues that elicited them.

  6. Identification of tissue-specific cell death using methylation patterns of circulating DNA

    PubMed Central

    Lehmann-Werman, Roni; Neiman, Daniel; Zemmour, Hai; Moss, Joshua; Magenheim, Judith; Vaknin-Dembinsky, Adi; Rubertsson, Sten; Nellgård, Bengt; Blennow, Kaj; Zetterberg, Henrik; Spalding, Kirsty; Haller, Michael J.; Wasserfall, Clive H.; Schatz, Desmond A.; Greenbaum, Carla J.; Dorrell, Craig; Grompe, Markus; Zick, Aviad; Hubert, Ayala; Maoz, Myriam; Fendrich, Volker; Bartsch, Detlef K.; Golan, Talia; Ben Sasson, Shmuel A.; Zamir, Gideon; Razin, Aharon; Cedar, Howard; Shapiro, A. M. James; Glaser, Benjamin; Shemer, Ruth; Dor, Yuval

    2016-01-01

    Minimally invasive detection of cell death could prove an invaluable resource in many physiologic and pathologic situations. Cell-free circulating DNA (cfDNA) released from dying cells is emerging as a diagnostic tool for monitoring cancer dynamics and graft failure. However, existing methods rely on differences in DNA sequences in source tissues, so that cell death cannot be identified in tissues with a normal genome. We developed a method of detecting tissue-specific cell death in humans based on tissue-specific methylation patterns in cfDNA. We interrogated tissue-specific methylome databases to identify cell type-specific DNA methylation signatures and developed a method to detect these signatures in mixed DNA samples. We isolated cfDNA from plasma or serum of donors, treated the cfDNA with bisulfite, PCR-amplified the cfDNA, and sequenced it to quantify cfDNA carrying the methylation markers of the cell type of interest. Pancreatic β-cell DNA was identified in the circulation of patients with recently diagnosed type-1 diabetes and islet-graft recipients; oligodendrocyte DNA was identified in patients with relapsing multiple sclerosis; neuronal/glial DNA was identified in patients after traumatic brain injury or cardiac arrest; and exocrine pancreas DNA was identified in patients with pancreatic cancer or pancreatitis. This proof-of-concept study demonstrates that the tissue origins of cfDNA and thus the rate of death of specific cell types can be determined in humans. The approach can be adapted to identify cfDNA derived from any cell type in the body, offering a minimally invasive window for diagnosing and monitoring a broad spectrum of human pathologies as well as providing a better understanding of normal tissue dynamics. PMID:26976580

  7. Predictors of Student Retention in Colleges of Agriculture.

    ERIC Educational Resources Information Center

    Dyer, James E.; Breja, Lisa M.; Wittler, Penny S. Haase

    The primary purpose of this study was to identify those factors that most accurately predict a student's intention to complete a degree in a college of agriculture. Specific research objectives were to identify similarities and differences of college of agriculture freshmen from predominately urban backgrounds, as compared to those in an…

  8. A Bifactor Approach to Model Multifaceted Constructs in Statistical Mediation Analysis

    ERIC Educational Resources Information Center

    Gonzalez, Oscar; MacKinnon, David P.

    2018-01-01

    Statistical mediation analysis allows researchers to identify the most important mediating constructs in the causal process studied. Identifying specific mediators is especially relevant when the hypothesized mediating construct consists of multiple related facets. The general definition of the construct and its facets might relate differently to…

  9. Resource Allocation in British Universities. SRHE Monograph 56.

    ERIC Educational Resources Information Center

    Shattock, Michael, Ed.; Rigby, Gwynneth, Ed.

    The ways that British universities allocate their resources are discussed, with attention to different styles, techniques, and decison-making structures. Since the purpose is to describe institutional models of resource allocation, specific universities are not identified by name. After identifying the sources of income and the breakdown of…

  10. Transcriptomic profiling of Melon necrotic spot virus-infected melon plants revealed virus strain and plant cultivar-specific alterations.

    PubMed

    Gómez-Aix, Cristina; Pascual, Laura; Cañizares, Joaquín; Sánchez-Pina, María Amelia; Aranda, Miguel A

    2016-06-07

    Viruses are among the most destructive and difficult to control plant pathogens. Melon (Cucumis melo L.) has become the model species for the agriculturally important Cucurbitaceae family. Approaches that take advantage of recently developed genomic tools in melon have been extremely useful for understanding viral pathogenesis and can contribute to the identification of target genes for breeding new resistant cultivars. In this work, we have used a recently described melon microarray for transcriptome profiling of two melon cultivars infected with two strains of Melon necrotic spot virus (MNSV) that only differ on their 3'-untranslated regions. Melon plant tissues from the cultivars Tendral or Planters Jumbo were locally infected with either MNSV-Mα5 or MNSV-Mα5/3'264 and analysed in a time-course experiment. Principal component and hierarchical clustering analyses identified treatment (healthy vs. infected) and sampling date (3 vs. 5 dpi) as the primary and secondary variables, respectively. Out of 7566 and 7074 genes deregulated by MNSV-Mα5 and MNSV-Mα5/3'264, 1851 and 1356, respectively, were strain-specific. Likewise, MNSV-Mα5/3'264 specifically deregulated 2925 and 1618 genes in Tendral and Planters Jumbo, respectively. The GO categories that were significantly affected were clearly different for the different virus/host combinations. Grouping genes according to their patterns of expression allowed for the identification of two groups that were specifically deregulated by MNSV-Mα5/3'264 with respect to MNSV-Mα5 in Tendral, and one group that was antagonistically regulated in Planters Jumbo vs. Tendral after MNSV-Mα5/3'264 infection. Genes in these three groups belonged to diverse functional classes, and no obvious regulatory commonalities were identified. When data on MNSV-Mα5/Tendral infections were compared to equivalent data on cucumber mosaic virus or watermelon mosaic virus infections, cytokinin-O-glucosyltransferase2 was identified as the only gene that was deregulated by all three viruses, with infection dynamics correlating with the amplitude of transcriptome remodeling. Strain-specific changes, as well as cultivar-specific changes, were identified by profiling the transcriptomes of plants from two melon cultivars infected with two MNSV strains. No obvious regulatory features shared among deregulated genes have been identified, pointing toward regulation through differential functional pathways.

  11. Resolving the biodiversity paradox

    Treesearch

    James S. Clark; Mike Dieta; Sukhendu Chakraborty; Pankaj K.Ibeanez Agarwal; Shannon LaDeau; Mike Wolosin

    2007-01-01

    The paradox of biodiversity involves three elements, (i) mathematical models predict that species must differ in specific ways in order to coexist as stable ecological communities, (ii) such differences are difficult to identify, yet (iii) there is widespread evidence of stability in natural communities.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schwab, Ryan S.; Ihnatovych, Ivanna; Yunus, Sharifah Z.S.A.

    Myosin IC is a single headed member of the myosin superfamily that localizes to the cytoplasm and the nucleus, where it is involved in transcription by RNA polymerases I and II, intranuclear transport, and nuclear export. In mammalian cells, three isoforms of myosin IC are expressed that differ only in the addition of short isoform-specific N-terminal peptides. Despite the high sequence homology, the isoforms show differences in cellular distribution, in localization to nuclear substructures, and in their interaction with nuclear proteins through yet unknown mechanisms. In this study, we used EGFP-fusion constructs that express truncated or mutated versions of myosinmore » IC isoforms to detect regions that are involved in isoform-specific localization. We identified two nucleolar localization signals (NoLS). One NoLS is located in the myosin IC isoform B specific N-terminal peptide, the second NoLS is located upstream of the neck region within the head domain. We demonstrate that both NoLS are functional and necessary for nucleolar localization of specifically myosin IC isoform B. Our data provide a first mechanistic explanation for the observed functional differences between the myosin IC isoforms and are an important step toward our understanding of the underlying mechanisms that regulate the various and distinct functions of myosin IC isoforms. - Highlights: ► Two NoLS have been identified in the myosin IC isoform B sequence. ► Both NoLS are necessary for myosin IC isoform B specific nucleolar localization. ► First mechanistic explanation of functional differences between the isoforms.« less

  13. Patterns of Childhood Abuse and Neglect in a Representative German Population Sample

    PubMed Central

    Schilling, Christoph; Weidner, Kerstin; Brähler, Elmar; Glaesmer, Heide; Häuser, Winfried; Pöhlmann, Karin

    2016-01-01

    Background Different types of childhood maltreatment, like emotional abuse, emotional neglect, physical abuse, physical neglect and sexual abuse are interrelated because of their co-occurrence. Different patterns of childhood abuse and neglect are associated with the degree of severity of mental disorders in adulthood. The purpose of this study was (a) to identify different patterns of childhood maltreatment in a representative German community sample, (b) to replicate the patterns of childhood neglect and abuse recently found in a clinical German sample, (c) to examine whether participants reporting exposure to specific patterns of child maltreatment would report different levels of psychological distress, and (d) to compare the results of the typological approach and the results of a cumulative risk model based on our data set. Methods In a cross-sectional survey conducted in 2010, a representative random sample of 2504 German participants aged between 14 and 92 years completed the Childhood Trauma Questionnaire (CTQ). General anxiety and depression were assessed by standardized questionnaires (GAD-2, PHQ-2). Cluster analysis was conducted with the CTQ-subscales to identify different patterns of childhood maltreatment. Results Three different patterns of childhood abuse and neglect could be identified by cluster analysis. Cluster one showed low values on all CTQ-scales. Cluster two showed high values in emotional and physical neglect. Only cluster three showed high values in physical and sexual abuse. The three patterns of childhood maltreatment showed different degrees of depression (PHQ-2) and anxiety (GAD-2). Cluster one showed lowest levels of psychological distress, cluster three showed highest levels of mental distress. Conclusion The results show that different types of childhood maltreatment are interrelated and can be grouped into specific patterns of childhood abuse and neglect, which are associated with differing severity of psychological distress in adulthood. The results correspond to those recently found in a German clinical sample and support a typological approach in the research of maltreatment. While cumulative risk models focus on the number of maltreatment types, the typological approach takes the number as well as the severity of the maltreatment types into account. Thus, specific patterns of maltreatment can be examined with regard to specific long-term psychological consequences. PMID:27442446

  14. Application of Gene Expression Trajectories Initiated from ErbB Receptor Activation Highlights the Dynamics of Divergent Promoter Usage.

    PubMed

    Carbajo, Daniel; Magi, Shigeyuki; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Arner, Erik; Forrest, Alistair R R; Carninci, Piero; Hayashizaki, Yoshihide; Daub, Carsten O; Okada-Hatakeyama, Mariko; Mar, Jessica C

    2015-01-01

    Understanding how cells use complex transcriptional programs to alter their fate in response to specific stimuli is an important question in biology. For the MCF-7 human breast cancer cell line, we applied gene expression trajectory models to identify the genes involved in driving cell fate transitions. We modified trajectory models to account for the scenario where cells were exposed to different stimuli, in this case epidermal growth factor and heregulin, to arrive at different cell fates, i.e. proliferation and differentiation respectively. Using genome-wide CAGE time series data collected from the FANTOM5 consortium, we identified the sets of promoters that were involved in the transition of MCF-7 cells to their specific fates versus those with expression changes that were generic to both stimuli. Of the 1,552 promoters identified, 1,091 had stimulus-specific expression while 461 promoters had generic expression profiles over the time course surveyed. Many of these stimulus-specific promoters mapped to key regulators of the ERK (extracellular signal-regulated kinases) signaling pathway such as FHL2 (four and a half LIM domains 2). We observed that in general, generic promoters peaked in their expression early on in the time course, while stimulus-specific promoters tended to show activation of their expression at a later stage. The genes that mapped to stimulus-specific promoters were enriched for pathways that control focal adhesion, p53 signaling and MAPK signaling while generic promoters were enriched for cell death, transcription and the cell cycle. We identified 162 genes that were controlled by an alternative promoter during the time course where a subset of 37 genes had separate promoters that were classified as stimulus-specific and generic. The results of our study highlighted the degree of complexity involved in regulating a cell fate transition where multiple promoters mapping to the same gene can demonstrate quite divergent expression profiles.

  15. Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes).

    PubMed

    Kukekova, Anna V; Johnson, Jennifer L; Teiling, Clotilde; Li, Lewyn; Oskina, Irina N; Kharlamova, Anastasiya V; Gulevich, Rimma G; Padte, Ravee; Dubreuil, Michael M; Vladimirova, Anastasiya V; Shepeleva, Darya V; Shikhevich, Svetlana G; Sun, Qi; Ponnala, Lalit; Temnykh, Svetlana V; Trut, Lyudmila N; Acland, Gregory M

    2011-10-03

    Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information.

  16. Sequence comparison of prefrontal cortical brain transcriptome from a tame and an aggressive silver fox (Vulpes vulpes)

    PubMed Central

    2011-01-01

    Background Two strains of the silver fox (Vulpes vulpes), with markedly different behavioral phenotypes, have been developed by long-term selection for behavior. Foxes from the tame strain exhibit friendly behavior towards humans, paralleling the sociability of canine puppies, whereas foxes from the aggressive strain are defensive and exhibit aggression to humans. To understand the genetic differences underlying these behavioral phenotypes fox-specific genomic resources are needed. Results cDNA from mRNA from pre-frontal cortex of a tame and an aggressive fox was sequenced using the Roche 454 FLX Titanium platform (> 2.5 million reads & 0.9 Gbase of tame fox sequence; >3.3 million reads & 1.2 Gbase of aggressive fox sequence). Over 80% of the fox reads were assembled into contigs. Mapping fox reads against the fox transcriptome assembly and the dog genome identified over 30,000 high confidence fox-specific SNPs. Fox transcripts for approximately 14,000 genes were identified using SwissProt and the dog RefSeq databases. An at least 2-fold expression difference between the two samples (p < 0.05) was observed for 335 genes, fewer than 3% of the total number of genes identified in the fox transcriptome. Conclusions Transcriptome sequencing significantly expanded genomic resources available for the fox, a species without a sequenced genome. In a very cost efficient manner this yielded a large number of fox-specific SNP markers for genetic studies and provided significant insights into the gene expression profile of the fox pre-frontal cortex; expression differences between the two fox samples; and a catalogue of potentially important gene-specific sequence variants. This result demonstrates the utility of this approach for developing genomic resources in species with limited genomic information. PMID:21967120

  17. Symptom-specific course trajectories and their determinants in primary care patients with Major Depressive Disorder: Evidence for two etiologically distinct prototypes.

    PubMed

    Wardenaar, K J; Monden, R; Conradi, H J; de Jonge, P

    2015-07-01

    The course-heterogeneity of Major Depressive Disorder (MDD) hampers development of better prognostic models. Although latent class growth analyses (LCGA) have been used to explain course-heterogeneity, such analyses have failed to also account for symptom-heterogeneity of depressive symptoms. Therefore, the aim was to identify more specific data-driven subgroups based on patterns of course-trajectories on different depressive symptom domains. In primary care MDD patients (n=205), the presence of the MDD criterion symptoms was determined for each week during a year. Weekly 'mood/cognition' (MC) and 'somatic' (SOM) scores were computed and parallel processes-LCGA (PP-LCGA) was used to identify subgroups based on the course on these domains. The classes׳ associations with baseline predictors and 2-/3-year outcomes were investigated. PP-LCGA identified four classes: quick recovery, persisting SOM, persisting MC, and persisting SOM+MC (chronic). Persisting SOM was specifically predicted by higher baseline somatic symptomatology and somatization, and was associated with more somatic depressive symptomatology at long-term follow-up. Persisting MC was specifically predicted by higher depressive severity, thinking insufficiencies, neuroticism, loneliness and lower self-esteem, and was associated with lower mental health related quality of life and more mood/cognitive depressive symptomatology at follow-up. The sample was small and contained only primary care MDD patients. The weekly depression assessments were collected retrospectively at 3-month intervals. The results indicate that there are two specific prototypes of depression, characterized by either persisting MC or persisting SOM, which have different sets of associated prognostic factors and long-term outcomes, and could have different etiological mechanisms. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. The Evolution of Host Specialization in the Vertebrate Gut Symbiont Lactobacillus reuteri

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frese, Steven A.; Benson, Andrew K.; Tannock, Gerald W.

    Recent research has provided mechanistic insight into the important contributions of the gut microbiota to vertebrate biology, but questions remain about the evolutionary processes that have shaped this symbiosis. In the present study, we showed in experiments with gnotobiotic mice that the evolution of Lactobacillus reuteri with rodents resulted in the emergence of host specialization. To identify genomic events marking adaptations to the murine host, we compared the genome of the rodent isolate L. reuteri 100-23 with that of the human isolate L. reuteri F275, and we identified hundreds of genes that were specific to each strain. In order tomore » differentiate true host-specific genome content from strain-level differences, comparative genome hybridizations were performed to query 57 L. reuteri strains originating from six different vertebrate hosts in combination with genome sequence comparisons of nine strains encompassing five phylogenetic lineages of the species. This approach revealed that rodent strains, although showing a high degree of genomic plasticity, possessed a specific genome inventory that was rare or absent in strains from other vertebrate hosts. The distinct genome content of L. reuteri lineages reflected the niche characteristics in the gastrointestinal tracts of their respective hosts, and inactivation of seven out of eight representative rodent-specific genes in L. reuteri 100-23 resulted in impaired ecological performance in the gut of mice. The comparative genomic analyses suggested fundamentally different trends of genome evolution in rodent and human L. reuteri populations, with the former possessing a large and adaptable pan-genome while the latter being subjected to a process of reductive evolution. In conclusion, this study provided experimental evidence and a molecular basis for the evolution of host specificity in a vertebrate gut symbiont, and it identified genomic events that have shaped this process.« less

  19. Latent Gammaherpesvirus 68 Infection Induces Distinct Transcriptional Changes in Different Organs

    PubMed Central

    Canny, Susan P.; Goel, Gautam; Reese, Tiffany A.; Zhang, Xin; Xavier, Ramnik

    2014-01-01

    Previous studies identified a role for latent herpesvirus infection in cross-protection against infection and exacerbation of chronic inflammatory diseases. Here, we identified more than 500 genes differentially expressed in spleens, livers, or brains of mice latently infected with gammaherpesvirus 68 and found that distinct sets of genes linked to different pathways were altered in the spleen compared to those in the liver. Several of the most differentially expressed latency-specific genes (e.g., the gamma interferon [IFN-γ], Cxcl9, and Ccl5 genes) are associated with known latency-specific phenotypes. Chronic herpesvirus infection, therefore, significantly alters the transcriptional status of host organs. We speculate that such changes may influence host physiology, the status of the immune system, and disease susceptibility. PMID:24155394

  20. Characterization of Foodborne Strains of Staphylococcus aureus by Shotgun Proteomics: Functional Networks, Virulence Factors and Species-Specific Peptide Biomarkers

    PubMed Central

    Carrera, Mónica; Böhme, Karola; Gallardo, José M.; Barros-Velázquez, Jorge; Cañas, Benito; Calo-Mata, Pilar

    2017-01-01

    In the present work, we applied a shotgun proteomics approach for the fast and easy characterization of 20 different foodborne strains of Staphylococcus aureus (S. aureus), one of the most recognized foodborne pathogenic bacteria. A total of 644 non-redundant proteins were identified and analyzed via an easy and rapid protein sample preparation procedure. The results allowed the differentiation of several proteome datasets from the different strains (common, accessory, and unique datasets), which were used to determine relevant functional pathways and differentiate the strains into different Euclidean hierarchical clusters. Moreover, a predicted protein-protein interaction network of the foodborne S. aureus strains was created. The whole confidence network contains 77 nodes and 769 interactions. Most of the identified proteins were surface-associated proteins that were related to pathways and networks of energy, lipid metabolism and virulence. Twenty-seven virulence factors were identified, and most of them corresponded to autolysins, N-acetylmuramoyl-L-alanine amidases, phenol-soluble modulins, extracellular fibrinogen-binding proteins and virulence factor EsxA. Potential species-specific peptide biomarkers were screened. Twenty-one species-specific peptide biomarkers, belonging to eight different proteins (nickel-ABC transporter, N-acetylmuramoyl-L-alanine amidase, autolysin, clumping factor A, gram-positive signal peptide YSIRK, cysteine protease/staphopain, transcriptional regulator MarR, and transcriptional regulator Sar-A), were proposed to identify S. aureus. These results constitute the first major dataset of peptides and proteins of foodborne S. aureus strains. This repository may be useful for further studies, for the development of new therapeutic treatments for S. aureus food intoxications and for microbial source-tracking in foodstuffs. PMID:29312172

  1. Mechanisms of gender-related outcome differences after carotid endarterectomy.

    PubMed

    den Hartog, Anne G; Algra, Ale; Moll, Frans L; de Borst, Gert J

    2010-10-01

    Large randomized trials have confirmed a difference in outcome after carotid endarterectomy (CEA) between men and women. In this review, we aimed to provide an overview of the gender-specific characteristics causing these perioperative and long-term outcome differences between men and women after CEA. A systematic search strategy with the synonyms of 'gender' and 'carotid endarterectomy' was conducted from PubMed and EMBASE databases. Only 11 relevant studies specifically discussing gender-specific related characteristics and their influence on outcome after CEA could be identified. Due to the limited number of included studies, pooling of findings was impossible, and results are presented in a descriptive manner. Each included study described only one possible gender-specific factor. Differences in carotid artery diameter, sex hormones, sensitivity for antiplatelet therapy, plaque morphology, occurrence of microembolic signals, and restenosis rate have all been suggested as gender-specific characteristics influencing outcome after CEA. Higher embolic potential in women and relatively stable female plaque morphology are the best-described factors influencing the difference in outcomes between men and women. However, the overall evidence for outcome differences by gender-specific characteristics in the literature is limited. Copyright © 2010 Society for Vascular Surgery. Published by Mosby, Inc. All rights reserved.

  2. Regional homogeneity of resting-state brain abnormalities in bipolar and unipolar depression.

    PubMed

    Liu, Chun-Hong; Ma, Xin; Wu, Xia; Zhang, Yu; Zhou, Fu-Chun; Li, Feng; Tie, Chang-Le; Dong, Jie; Wang, Yong-Jun; Yang, Zhi; Wang, Chuan-Yue

    2013-03-05

    Bipolar disorder patients experiencing a depressive episode (BD-dep) without an observed history of mania are often misdiagnosed and are consequently treated as having unipolar depression (UD), leading to inadequate treatment and poor outcomes. An essential solution to this problem is to identify objective biological markers that distinguish BD-dep and UD patients at an early stage. However, studies directly comparing the brain dysfunctions associated with BD-dep and UD are rare. More importantly, the specificity of the differences in brain activity between these mental disorders has not been examined. With whole-brain regional homogeneity analysis and region-of-interest (ROI) based receiver operating characteristic (ROC) analysis, we aimed to compare the resting-state brain activity of BD-dep and UD patients. Furthermore, we examined the specific differences and whether these differences were attributed to the brain abnormality caused by BD-dep, UD, or both. Twenty-one bipolar and 21 unipolar depressed patients, as well as 26 healthy subjects matched for gender, age, and educational levels, participated in the study. We compared the differences in the regional homogeneity (ReHo) of the BD-dep and UD groups and further identified their pathophysiological abnormality. In the brain regions showing a difference between the BD-dep and UD groups, we further conducted receptive operation characteristic (ROC) analyses to confirm the effectiveness of the identified difference in classifying the patients. We observed ReHo differences between the BD-dep and UD groups in the right ventrolateral middle frontal gyrus, right dorsal anterior insular, right ventral anterior insular, right cerebellum posterior gyrus, right posterior cingulate cortex, right parahippocampal gyrus, and left cerebellum anterior gyrus. Further ROI comparisons and ROC analysis on these ROIs showed that the right parahippocampal gyrus reflected abnormality specific to the BD-dep group, while the right middle frontal gyrus, the right dorsal anterior insular, the right cerebellum posterior gyrus, and the right posterior cingulate cortex showed abnormality specific to the UD group. We found brain regions showing resting state ReHo differences and examined their sensitivity and specificity, suggesting a potential neuroimaging biomarker to distinguish between BD-dep and UD patients. We further clarified the pathophysiological abnormality of these regions for each of the two patient populations. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Identifying Stress Transcription Factors Using Gene Expression and TF-Gene Association Data

    PubMed Central

    Wu, Wei-Sheng; Chen, Bor-Sen

    2007-01-01

    Unicellular organisms such as yeasts have evolved to survive environmental stresses by rapidly reorganizing the genomic expression program to meet the challenges of harsh environments. The complex adaptation mechanisms to stress remain to be elucidated. In this study, we developed Stress Transcription Factor Identification Algorithm (STFIA), which integrates gene expression and TF-gene association data to identify the stress transcription factors (TFs) of six kinds of stresses. We identified some general stress TFs that are in response to various stresses, and some specific stress TFs that are in response to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs may be sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the adaptation mechanisms to different stresses may have a bow-tie structure. Second, there may exist extensive regulatory cross-talk among different stress responses. In conclusion, this study proposes a network of the regulators of stress responses and their mechanism of action. PMID:20066130

  4. Probability of identifying different salmonella serotypes in poultry samples

    USDA-ARS?s Scientific Manuscript database

    Recent work has called attention to the unequal competitive abilities of different Salmonella serotypes in standard broth culture and plating media. Such serotypes include Enteritidis and Typhimurium that are specifically targeted in some regulatory and certification programs because they cause a l...

  5. Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

    PubMed

    Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

    2014-01-01

    Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

  6. Use of ProteinChip technology for identifying biomarkers of parasitic diseases: the example of porcine cysticercosis (Taenia solium).

    PubMed

    Deckers, N; Dorny, P; Kanobana, K; Vercruysse, J; Gonzalez, A E; Ward, B; Ndao, M

    2008-12-01

    Taenia solium cysticercosis is a significant public health problem in endemic countries. The current serodiagnostic techniques are not able to differentiate between infections with viable cysts and infections with degenerated cysts. The objectives of this study were to identify specific novel biomarkers of these different disease stages in the serum of experimentally infected pigs using ProteinChip technology (Bio-Rad) and to validate these biomarkers by analyzing serum samples from naturally infected pigs. In the experimental sample set 30 discriminating biomarkers (p<0.05) were found, 13 specific for the viable phenotype, 9 specific for the degenerated phenotype and 8 specific for the infected phenotype (either viable or degenerated cysts). Only 3 of these biomarkers were also significant in the field samples; however, the peak profiles were not consistent among the two sample sets. Five biomarkers discovered in the sera from experimentally infected pigs were identified as clusterin, lecithin-cholesterol acyltransferase, vitronectin, haptoglobin and apolipoprotein A-I.

  7. Strain-specific variations in cation content and transport in mouse erythrocytes

    PubMed Central

    Rivera, Alicia; Zee, Robert Y. L.; Alper, Seth L.; Peters, Luanne L.

    2013-01-01

    Studies of ion transport pathophysiology in hematological disorders and tests of possible new therapeutic agents for these disorders have been carried out in various mouse models because of close functional similarities between mouse and human red cells. We have explored strain-specific differences in erythrocyte membrane physiology in 10 inbred mouse strains by determining erythrocyte contents of Na+, K+, and Mg2+, and erythrocyte transport of ions via the ouabain-sensitive Na-K pump, the amiloride-sensitive Na-H exchanger (NHE1), the volume and chloride-dependent K-Cl cotransporter (KCC), and the charybdotoxin-sensitive Gardos channel (KCNN4). Our data reveal substantial strain-specific and sex-specific differences in both ion content and trans-membrane ion transport in mouse erythrocytes. These differences demonstrate the feasibility of identifying specific quantitative trait loci for erythroid ion transport and content in genetically standardized inbred mouse strains. PMID:23482811

  8. Strain-specific variations in cation content and transport in mouse erythrocytes.

    PubMed

    Rivera, Alicia; Zee, Robert Y L; Alper, Seth L; Peters, Luanne L; Brugnara, Carlo

    2013-05-01

    Studies of ion transport pathophysiology in hematological disorders and tests of possible new therapeutic agents for these disorders have been carried out in various mouse models because of close functional similarities between mouse and human red cells. We have explored strain-specific differences in erythrocyte membrane physiology in 10 inbred mouse strains by determining erythrocyte contents of Na(+), K(+), and Mg(2+), and erythrocyte transport of ions via the ouabain-sensitive Na-K pump, the amiloride-sensitive Na-H exchanger (NHE1), the volume and chloride-dependent K-Cl cotransporter (KCC), and the charybdotoxin-sensitive Gardos channel (KCNN4). Our data reveal substantial strain-specific and sex-specific differences in both ion content and trans-membrane ion transport in mouse erythrocytes. These differences demonstrate the feasibility of identifying specific quantitative trait loci for erythroid ion transport and content in genetically standardized inbred mouse strains.

  9. Epigenetic regulation of depot-specific gene expression in adipose tissue.

    PubMed

    Gehrke, Sandra; Brueckner, Bodo; Schepky, Andreas; Klein, Johannes; Iwen, Alexander; Bosch, Thomas C G; Wenck, Horst; Winnefeld, Marc; Hagemann, Sabine

    2013-01-01

    In humans, adipose tissue is distributed in subcutaneous abdominal and subcutaneous gluteal depots that comprise a variety of functional differences. Whereas energy storage in gluteal adipose tissue has been shown to mediate a protective effect, an increase of abdominal adipose tissue is associated with metabolic disorders. However, the molecular basis of depot-specific characteristics is not completely understood yet. Using array-based analyses of transcription profiles, we identified a specific set of genes that was differentially expressed between subcutaneous abdominal and gluteal adipose tissue. To investigate the role of epigenetic regulation in depot-specific gene expression, we additionally analyzed genome-wide DNA methylation patterns in abdominal and gluteal depots. By combining both data sets, we identified a highly significant set of depot-specifically expressed genes that appear to be epigenetically regulated. Interestingly, the majority of these genes form part of the homeobox gene family. Moreover, genes involved in fatty acid metabolism were also differentially expressed. Therefore we suppose that changes in gene expression profiles might account for depot-specific differences in lipid composition. Indeed, triglycerides and fatty acids of abdominal adipose tissue were more saturated compared to triglycerides and fatty acids in gluteal adipose tissue. Taken together, our results uncover clear differences between abdominal and gluteal adipose tissue on the gene expression and DNA methylation level as well as in fatty acid composition. Therefore, a detailed molecular characterization of adipose tissue depots will be essential to develop new treatment strategies for metabolic syndrome associated complications.

  10. Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species.

    PubMed

    Vallée, Maud; Gravel, Catherine; Palin, Marie-France; Reghenas, Hélène; Stothard, Paul; Wishart, David S; Sirard, Marc-André

    2005-07-01

    The main objective of the present study was to identify novel oocyte-specific genes in three different species: bovine, mouse, and Xenopus laevis. To achieve this goal, two powerful technologies were combined: a polymerase chain reaction (PCR)-based cDNA subtraction, and cDNA microarrays. Three subtractive libraries consisting of 3456 clones were established and enriched for oocyte-specific transcripts. Sequencing analysis of the positive insert-containing clones resulted in the following classification: 53% of the clones corresponded to known cDNAs, 26% were classified as uncharacterized cDNAs, and a final 9% were classified as novel sequences. All these clones were used for cDNA microarray preparation. Results from these microarray analyses revealed that in addition to already known oocyte-specific genes, such as GDF9, BMP15, and ZP, known genes with unknown function in the oocyte were identified, such as a MLF1-interacting protein (MLF1IP), B-cell translocation gene 4 (BTG4), and phosphotyrosine-binding protein (xPTB). Furthermore, 15 novel oocyte-specific genes were validated by reverse transcription-PCR to confirm their preferential expression in the oocyte compared to somatic tissues. The results obtained in the present study confirmed that microarray analysis is a robust technique to identify true positives from the suppressive subtractive hybridization experiment. Furthermore, obtaining oocyte-specific genes from three species simultaneously allowed us to look at important genes that are conserved across species. Further characterization of these novel oocyte-specific genes will lead to a better understanding of the molecular mechanisms related to the unique functions found in the oocyte.

  11. Phonological Processing in Children with Specific Language Impairment with and without Reading Difficulties

    ERIC Educational Resources Information Center

    Loucas, Tom; Baird, Gillian; Simonoff, Emily; Slonims, Vicky

    2016-01-01

    Background: Specific language impairment (SLI) is heterogeneous and identifying subgroups within it may help explain the aetiology of the condition. Phonological processing abilities distinguish between children with SLI who do and do not have reading decoding impairments (RDIs). Aims: To probe different levels of phonological processing in…

  12. Identifying Learning Patterns of Children at Risk for Specific Reading Disability

    ERIC Educational Resources Information Center

    Barbot, Baptiste; Krivulskaya, Suzanna; Hein, Sascha; Reich, Jodi; Thuma, Philip E.; Grigorenko, Elena L.

    2016-01-01

    Differences in learning patterns of vocabulary acquisition in children at risk (+SRD) and not at risk (-SRD) for Specific Reading Disability (SRD) were examined using a microdevelopmental paradigm applied to the multi-trial Foreign Language Learning Task (FLLT; Baddeley et al., 1995). The FLLT was administered to 905 children from rural…

  13. Coupling Genetics and Proteomics To Identify Aphid Proteins Associated with Vector-Specific Transmission of Polerovirus (Luteoviridae)▿

    PubMed Central

    Yang, Xiaolong; Thannhauser, T. W.; Burrows, Mary; Cox-Foster, Diana; Gildow, Fred E.; Gray, Stewart M.

    2008-01-01

    Cereal yellow dwarf virus-RPV (CYDV-RPV) is transmitted specifically by the aphids Rhopalosiphum padi and Schizaphis graminum in a circulative nonpropagative manner. The high level of vector specificity results from the vector aphids having the functional components of the receptor-mediated endocytotic pathways to allow virus to transverse the gut and salivary tissues. Studies of F2 progeny from crosses of vector and nonvector genotypes of S. graminum showed that virus transmission efficiency is a heritable trait regulated by multiple genes acting in an additive fashion and that gut- and salivary gland-associated factors are not genetically linked. Utilizing two-dimensional difference gel electrophoresis to compare the proteomes of vector and nonvector parental and F2 genotypes, four aphid proteins (S4, S8, S29, and S405) were specifically associated with the ability of S. graminum to transmit CYDV-RPV. The four proteins were coimmunoprecipitated with purified RPV, indicating that the aphid proteins are capable of binding to virus. Analysis by mass spectrometry identified S4 as a luciferase and S29 as a cyclophilin, both of which have been implicated in macromolecular transport. Proteins S8 and S405 were not identified from available databases. Study of this unique genetic system coupled with proteomic analysis indicated that these four virus-binding aphid proteins were specifically inherited and conserved in different generations of vector genotypes and suggests that they play a major role in regulating polerovirus transmission. PMID:17959668

  14. Coupling genetics and proteomics to identify aphid proteins associated with vector-specific transmission of polerovirus (luteoviridae).

    PubMed

    Yang, Xiaolong; Thannhauser, T W; Burrows, Mary; Cox-Foster, Diana; Gildow, Fred E; Gray, Stewart M

    2008-01-01

    Cereal yellow dwarf virus-RPV (CYDV-RPV) is transmitted specifically by the aphids Rhopalosiphum padi and Schizaphis graminum in a circulative nonpropagative manner. The high level of vector specificity results from the vector aphids having the functional components of the receptor-mediated endocytotic pathways to allow virus to transverse the gut and salivary tissues. Studies of F(2) progeny from crosses of vector and nonvector genotypes of S. graminum showed that virus transmission efficiency is a heritable trait regulated by multiple genes acting in an additive fashion and that gut- and salivary gland-associated factors are not genetically linked. Utilizing two-dimensional difference gel electrophoresis to compare the proteomes of vector and nonvector parental and F(2) genotypes, four aphid proteins (S4, S8, S29, and S405) were specifically associated with the ability of S. graminum to transmit CYDV-RPV. The four proteins were coimmunoprecipitated with purified RPV, indicating that the aphid proteins are capable of binding to virus. Analysis by mass spectrometry identified S4 as a luciferase and S29 as a cyclophilin, both of which have been implicated in macromolecular transport. Proteins S8 and S405 were not identified from available databases. Study of this unique genetic system coupled with proteomic analysis indicated that these four virus-binding aphid proteins were specifically inherited and conserved in different generations of vector genotypes and suggests that they play a major role in regulating polerovirus transmission.

  15. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  16. Layer-specific chromatin accessibility landscapes reveal regulatory networks in adult mouse visual cortex

    PubMed Central

    Gray, Lucas T; Yao, Zizhen; Nguyen, Thuc Nghi; Kim, Tae Kyung; Zeng, Hongkui; Tasic, Bosiljka

    2017-01-01

    Mammalian cortex is a laminar structure, with each layer composed of a characteristic set of cell types with different morphological, electrophysiological, and connectional properties. Here, we define chromatin accessibility landscapes of major, layer-specific excitatory classes of neurons, and compare them to each other and to inhibitory cortical neurons using the Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq). We identify a large number of layer-specific accessible sites, and significant association with genes that are expressed in specific cortical layers. Integration of these data with layer-specific transcriptomic profiles and transcription factor binding motifs enabled us to construct a regulatory network revealing potential key layer-specific regulators, including Cux1/2, Foxp2, Nfia, Pou3f2, and Rorb. This dataset is a valuable resource for identifying candidate layer-specific cis-regulatory elements in adult mouse cortex. DOI: http://dx.doi.org/10.7554/eLife.21883.001 PMID:28112643

  17. Effective stakeholder participation in setting research priorities using a Global Evidence Mapping approach.

    PubMed

    Clavisi, Ornella; Bragge, Peter; Tavender, Emma; Turner, Tari; Gruen, Russell L

    2013-05-01

    We present a multistep process for identifying priority research areas in rehabilitation and long-term care of traumatic brain-injured (TBI) patients. In particular, we aimed to (1) identify which stakeholders should be involved; (2) identify what methods are appropriate; (3) examine different criteria for the generation of research priority areas; and (4) test the feasibility of linkage and exchange among researchers, decision makers, and other potential users of the research. Potential research questions were identified and developed using an initial scoping meeting and preliminary literature search, followed by a facilitated mapping workshop and an online survey. Identified research questions were then prioritized against specific criteria (clinical importance, novelty, and controversy). Existing evidence was then mapped to the high-priority questions using usual processes for search, screening, and selection. A broad range of stakeholders were then brought together at a forum to identify priority research themes for future research investment. Using clinical and research leaders, smaller targeted planning workshops prioritized specific research projects for each of the identified themes. Twenty-six specific questions about TBI rehabilitation were generated, 14 of which were high priority. No one method identified all high-priority questions. Methods that relied solely on the views of clinicians and researchers identified fewer high-priority questions compared with methods that used broader stakeholder engagement. Evidence maps of these high-priority questions yielded a number of evidence gaps. Priority questions and evidence maps were then used to inform a research forum, which identified 12 priority themes for future research. Our research demonstrates the value of a multistep and multimethod process involving many different types of stakeholders for prioritizing research to improve the rehabilitation outcomes of people who have suffered TBI. Enhancing stakeholder representation can be augmented using a combination of methods and a process of linkage and exchange. This process can inform decisions about prioritization of research areas. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Working Notes from the 1992 AAAI Workshop on Automating Software Design. Theme: Domain Specific Software Design

    NASA Technical Reports Server (NTRS)

    Keller, Richard M. (Editor); Barstow, David; Lowry, Michael R.; Tong, Christopher H.

    1992-01-01

    The goal of this workshop is to identify different architectural approaches to building domain-specific software design systems and to explore issues unique to domain-specific (vs. general-purpose) software design. Some general issues that cut across the particular software design domain include: (1) knowledge representation, acquisition, and maintenance; (2) specialized software design techniques; and (3) user interaction and user interface.

  19. Differences in health insurance and health service utilization among Asian Americans: method for using the NHIS to identify unique patterns between ethnic groups.

    PubMed

    Ruy, Hosihn; Young, Wendy B; Kwak, Hoil

    2002-01-01

    The purpose of this study is to outline a method to identify the characteristics of socioeconomic variables in determining the differences in health insurance coverage and health services utilization patterns for different ethnic groups, using the behavioural model of health service utilization. A sample drawn from Asian American adult respondents to the 1992, 1993, and 1994 National Health Interview Surveys (NHIS) in the USA formed the data set. The results showed Asian Americans as not being homogeneous. There were distinctly different demographic and socioeconomic characteristics between six Asian American ethnic groups that affect health insurance coverage and health service utilization. The study method is useful for constructing health policy and services to address the general public need without adversely affecting smaller minority groups. Secondary analysis of well-constructed national data sets such as the specific Asian ethnic groups in NHIS, offers a rich method for predicting the differential impact of specific health policies on various ethnic groups.

  20. Butterfly Larval Host Plant use in a Tropical Urban Context: Life History Associations, Herbivory, and Landscape Factors

    PubMed Central

    Tiple, Ashish D.; Khurad, Arun M.; Dennis, Roger L. H.

    2011-01-01

    This study examines butterfly larval host plants, herbivory and related life history attributes within Nagpur City, India. The larval host plants of 120 butterfly species are identified and their host specificity, life form, biotope, abundance and perennation recorded; of the 126 larval host plants, most are trees (49), with fewer herbs (43), shrubs (22), climbers (7) and stem parasites (2). They include 89 wild, 23 cultivated, 11 wild/cultivated and 3 exotic plant species; 78 are perennials, 43 annuals and 5 biannuals. Plants belonging to Poaceae and Fabaceae are most widely used by butterfly larvae. In addition to distinctions in host plant family affiliation, a number of significant differences between butterfly families have been identified in host use patterns: for life forms, biotopes, landforms, perennation, host specificity, egg batch size and ant associations. These differences arising from the development of a butterfly resource database have important implications for conserving butterfly species within the city area. Differences in overall butterfly population sizes within the city relate mainly to the number of host plants used, but other influences, including egg batch size and host specificity are identified. Much of the variation in population size is unaccounted for and points to the need to investigate larval host plant life history and strategies as population size is not simply dependent on host plant abundance. PMID:21864159

  1. Seizure semiology identifies patients with bilateral temporal lobe epilepsy.

    PubMed

    Loesch, Anna Mira; Feddersen, Berend; Tezer, F Irsel; Hartl, Elisabeth; Rémi, Jan; Vollmar, Christian; Noachtar, Soheyl

    2015-01-01

    Laterality in temporal lobe epilepsy is usually defined by EEG and imaging results. We investigated whether the analysis of seizure semiology including lateralizing seizure phenomena identifies bilateral independent temporal lobe seizure onset. We investigated the seizure semiology in 17 patients in whom invasive EEG-video-monitoring documented bilateral temporal seizure onset. The results were compared to 20 left and 20 right consecutive temporal lobe epilepsy (TLE) patients who were seizure free after anterior temporal lobe resection. The seizure semiology was analyzed using the semiological seizure classification with particular emphasis on the sequence of seizure phenomena over time and lateralizing seizure phenomena. Statistical analysis included chi-square test or Fisher's exact test. Bitemporal lobe epilepsy patients had more frequently different seizure semiology (100% vs. 40%; p<0.001) and significantly more often lateralizing seizure phenomena pointing to bilateral seizure onset compared to patients with unilateral TLE (67% vs. 11%; p<0.001). The sensitivity of identical vs. different seizure semiology for the identification of bilateral TLE was high (100%) with a specificity of 60%. Lateralizing seizure phenomena had a low sensitivity (59%) but a high specificity (89%). The combination of lateralizing seizure phenomena and different seizure semiology showed a high specificity (94%) but a low sensitivity (59%). The analysis of seizure semiology including lateralizing seizure phenomena adds important clinical information to identify patients with bilateral TLE. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

    PubMed Central

    Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

    2014-01-01

    Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

  3. Genome Comparison of Human and Non-Human Malaria Parasites Reveals Species Subset-Specific Genes Potentially Linked to Human Disease

    PubMed Central

    Frech, Christian; Chen, Nansheng

    2011-01-01

    Genes underlying important phenotypic differences between Plasmodium species, the causative agents of malaria, are frequently found in only a subset of species and cluster at dynamically evolving subtelomeric regions of chromosomes. We hypothesized that chromosome-internal regions of Plasmodium genomes harbour additional species subset-specific genes that underlie differences in human pathogenicity, human-to-human transmissibility, and human virulence. We combined sequence similarity searches with synteny block analyses to identify species subset-specific genes in chromosome-internal regions of six published Plasmodium genomes, including Plasmodium falciparum, Plasmodium vivax, Plasmodium knowlesi, Plasmodium yoelii, Plasmodium berghei, and Plasmodium chabaudi. To improve comparative analysis, we first revised incorrectly annotated gene models using homology-based gene finders and examined putative subset-specific genes within syntenic contexts. Confirmed subset-specific genes were then analyzed for their role in biological pathways and examined for molecular functions using publicly available databases. We identified 16 genes that are well conserved in the three primate parasites but not found in rodent parasites, including three key enzymes of the thiamine (vitamin B1) biosynthesis pathway. Thirteen genes were found to be present in both human parasites but absent in the monkey parasite P. knowlesi, including genes specifically upregulated in sporozoites or gametocytes that could be linked to parasite transmission success between humans. Furthermore, we propose 15 chromosome-internal P. falciparum-specific genes as new candidate genes underlying increased human virulence and detected a currently uncharacterized cluster of P. vivax-specific genes on chromosome 6 likely involved in erythrocyte invasion. In conclusion, Plasmodium species harbour many chromosome-internal differences in the form of protein-coding genes, some of which are potentially linked to human disease and thus promising leads for future laboratory research. PMID:22215999

  4. A subtype specific function for the extracellular domain of neuroligin 1 in hippocampal LTP

    PubMed Central

    Shipman, Seth L.; Nicoll, Roger A.

    2014-01-01

    Summary At neuronal excitatory synapses, two major subtypes of the synaptic adhesion molecule neuroligin are present. These subtypes, neuroligin 1 and neuroligin 3, have roles in synaptogenesis and synaptic maintenance that appear largely overlapping. In this study we combine electrophysiology with molecular deletion and replacement of these proteins to identify similarities and differences between these subtypes. In doing so, we identify a subtype specific role in LTP for neuroligin 1 in young CA1, which persists into adulthood in the dentate gyrus. As neuroligin 3 showed no requirement for LTP, we constructed chimeric proteins of the two excitatory neuroligin subtypes to identify the molecular determinants particular to the unique function of neuroligin 1. Using in vivo molecular replacement experiments, we find that these unique functions depend on a region in its extracellular domain containing the B site splice insertion previously shown to determine specificity of neurexin binding. PMID:23083734

  5. Genome-wide oxidative bisulfite sequencing identifies sex-specific methylation differences in the human placenta

    PubMed Central

    Johnson, Michelle D; Dopierala, Justyna

    2018-01-01

    ABSTRACT DNA methylation is an important regulator of gene function. Fetal sex is associated with the risk of several specific pregnancy complications related to placental function. However, the association between fetal sex and placental DNA methylation remains poorly understood. We carried out whole-genome oxidative bisulfite sequencing in the placentas of two healthy female and two healthy male pregnancies generating an average genome depth of coverage of 25x. Most highly ranked differentially methylated regions (DMRs) were located on the X chromosome but we identified a 225 kb sex-specific DMR in the body of the CUB and Sushi Multiple Domains 1 (CSMD1) gene on chromosome 8. The sex-specific differential methylation pattern observed in this region was validated in additional placentas using in-solution target capture. In a new RNA-seq data set from 64 female and 67 male placentas, CSMD1 mRNA was 1.8-fold higher in male than in female placentas (P value = 8.5 × 10−7, Mann-Whitney test). Exon-level quantification of CSMD1 mRNA from these 131 placentas suggested a likely placenta-specific CSMD1 isoform not detected in the 21 somatic tissues analyzed. We show that the gene body of an autosomal gene, CSMD1, is differentially methylated in a sex- and placental-specific manner, displaying sex-specific differences in placental transcript abundance. PMID:29376485

  6. Sexual dimorphic floral development in dioecious plants revealed by transcriptome, phytohormone, and DNA methylation analysis in Populus tomentosa.

    PubMed

    Song, Yuepeng; Ma, Kaifeng; Ci, Dong; Chen, Qingqing; Tian, Jiaxing; Zhang, Deqiang

    2013-12-01

    Dioecious plants have evolved sex-specific floral development mechanisms. However, the precise gene expression patterns in dioecious plant flower development remain unclear. Here, we used andromonoecious poplar, an exceptional model system, to eliminate the confounding effects of genetic background of dioecious plants. Comparative transcriptome and physiological analysis allowed us to characterize sex-specific development of female and male flowers. Transcriptome analysis identified genes significantly differentially expressed between the sexes, including genes related to floral development, phytohormone synthesis and metabolism, and DNA methylation. Correlation analysis revealed a significant correlation between phytohormone signaling and gene expression, identifying specific phytohormone-responsive genes and their cis-regulatory elements. Two genes related to DNA methylation, METHYLTRANSFERASE1 (MET1) and DECREASED DNA METHYLATION 1 (DDM1), which are located in the sex determination region of Chromosome XIX, have differential expression between female and male flowers. A time-course analysis revealed that MET1 and DDM1 expression may produce different DNA methylation levels in female and male flowers. Understanding the interactions of phytohormone signaling, DNA methylation and target gene expression should lead to a better understanding of sexual differences in floral development. Thus, this study identifies a set of candidate genes for further studies of poplar sexual dimorphism and relates sex-specific floral development to physiological and epigenetic changes.

  7. Set-specific capture can be reduced by preemptively occupying a limited-capacity focus of attention

    PubMed Central

    Moore, Katherine Sledge; Weissman, Daniel H.

    2011-01-01

    Recent work has shown that contingent attentional capture effects can be especially large when multiple attentional sets for color guide visual search (Moore & Weissman, 2010). In particular, this research suggests that detecting a target-colored (e.g., orange) distractor leads the corresponding attentional set (e.g., identify orange letters) to enter a limited-capacity focus of attention in working memory, where it remains briefly while the distractor is being attended. Consequently, the ability to identify a differently-colored (e.g., green) target 100–300 ms later is impaired because the appropriate set (e.g., identify green letters) cannot also enter the focus of attention. In two experiments, we investigated whether such set-specific capture can be reduced by preemptively occupying the focus of attention. As predicted, a target-colored central distractor presented 233 ms before a target-colored peripheral distractor eliminated set-specific capture arising from the peripheral distractor. Moreover, this effect was observed only when the central distractor’s color (e.g., orange) (a) matched a different set than the upcoming peripheral distractor’s color (e.g., green) and (b) matched the same set as the upcoming central target’s color (e.g., orange). We conclude that the same working memory limitations that give rise to set-specific capture can be preemptively exploited to reduce it. PMID:21779149

  8. Genome-wide identification of long non-coding RNA genes and their association with insecticide resistance and metamorphosis in diamondback moth, Plutella xylostella.

    PubMed

    Liu, Feiling; Guo, Dianhao; Yuan, Zhuting; Chen, Chen; Xiao, Huamei

    2017-11-20

    Long non-coding RNA (lncRNA) is a class of noncoding RNA >200 bp in length that has essential roles in regulating a variety of biological processes. Here, we constructed a computational pipeline to identify lncRNA genes in the diamondback moth (Plutella xylostella), a major insect pest of cruciferous vegetables. In total, 3,324 lncRNAs corresponding to 2,475 loci were identified from 13 RNA-Seq datasets, including samples from parasitized, insecticide-resistant strains and different developmental stages. The identified P. xylostella lncRNAs had shorter transcripts and fewer exons than protein-coding genes. Seven out of nine randomly selected lncRNAs were validated by strand-specific RT-PCR. In total, 54-172 lncRNAs were specifically expressed in the insecticide resistant strains, among which one lncRNA was located adjacent to the sodium channel gene. In addition, 63-135 lncRNAs were specifically expressed in different developmental stages, among which three lncRNAs overlapped or were located adjacent to the metamorphosis-associated genes. These lncRNAs were either strongly or weakly co-expressed with their overlapping or neighboring mRNA genes. In summary, we identified thousands of lncRNAs and presented evidence that lncRNAs might have key roles in conferring insecticide resistance and regulating the metamorphosis development in P. xylostella.

  9. Participant Interaction in Asynchronous Learning Environments: Evaluating Interaction Analysis Methods

    ERIC Educational Resources Information Center

    Blanchette, Judith

    2012-01-01

    The purpose of this empirical study was to determine the extent to which three different objective analytical methods--sequence analysis, surface cohesion analysis, and lexical cohesion analysis--can most accurately identify specific characteristics of online interaction. Statistically significant differences were found in all points of…

  10. Identification of Skeletal Muscle Satellite Cells by Immunofluorescence with Pax7 and Laminin Antibodies.

    PubMed

    Feng, Xuesong; Naz, Faiza; Juan, Aster H; Dell'Orso, Stefania; Sartorelli, Vittorio

    2018-04-19

    Immunofluorescence is an effective method that helps to identify different cell types on tissue sections. In order to study the desired cell population, antibodies for specific cell markers are applied on tissue sections. In adult skeletal muscle, satellite cells (SCs) are stem cells that contribute to muscle repair and regeneration. Therefore, it is important to visualize and trace the satellite cell population under different physiological conditions. In resting skeletal muscle, SCs reside between the basal lamina and myofiber plasma membrane. A commonly used marker for identifying SCs on the myofibers or in cell culture is the paired box protein Pax7. In this article, an optimized Pax7 immunofluorescence protocol on skeletal muscle sections is presented that minimizes non-specific staining and background. Another antibody that recognizes a protein (laminin) of the basal lamina was also added to help identify SCs. Similar protocols can also be used to perform double or triple labeling with Pax7 and antibodies for additional proteins of interest.

  11. Avoiding the Difference Fixation: Identity Categories, Markers of Difference, and the Teaching of Writing

    ERIC Educational Resources Information Center

    Kerschbaum, Stephanie L.

    2012-01-01

    In this essay, the author aims to show how a specific focus on interactionally emergent and rhetorically negotiated elements of a communicative situation can enrich the study of difference in composition research. She develops this argument by first identifying two strategies used by writing researchers when forwarding new understandings of…

  12. [Studies on HPLC fingerprint chromatogram of Folium Fici Microcarpa].

    PubMed

    Fang, Zhi-Jian; Dai, Zhen; Li, Shu-Yuan

    2008-10-01

    To establish a sensitive and specific method for quality control of Folium Fici Microcarpa, HPLC method was applied for studies on the fingerprint chromatogram of Folium Fici Microcarpa. Isovitexin was used as reference substance to evaluate the chromatogram of 10 samples from different regions and 12 samples collected in different months. The result revealed that all the chromatographic peaks were seperated efficiently. There were 17 common peaks showed in the fingerprint chromatogram. The method of fingerprint chromatogram with characteristic and specificity will be used to identify the quality and evaluate different origins and collection period of Folium Fici Microcarpa.

  13. Maintenance Training Equipment: Design Specification Based on Instructional System Development. Revision

    DTIC Science & Technology

    1984-12-01

    model pr, vides a method for communicating a specific training equipment design to the procurement office after A"~- ISD ana lysis has est~blished a...maintenance trainer has been identified. The model provides a method by which a training equipment design can be communicated to the System Project Office...ensure * ase of development of procurement specifications and consistency between different documented designs. A completed application of this maodel

  14. Past Tense Production in Children with and without Specific Language Impairment across Germanic Languages: A Meta-Analysis

    ERIC Educational Resources Information Center

    Krok, Windi C.; Leonard, Laurence B.

    2015-01-01

    Purpose: This study examined the extent to which children with specific language impairment (SLI) across Germanic languages differ from their typically developing (TD) peers in the use of past tense morphology. Method: A systematic literature search identified empirical studies examining regular and/or irregular past tense production by English…

  15. Is there a differential strength of specific HLA mismatches in kidney transplants?

    PubMed

    Sasaki, N; Idica, A; Terasaki, P

    2008-05-01

    In this article we attempted to identify whether there is a specific mismatched antigen that might be detrimental to kidney transplant outcome. The frequency of function versus failure of transplant cases was tallied within subpopulations among a subset of the 2006 United Network for Organ Sharing transplant dataset. We examined 7998 cadaveric and 11,420 living donor kidney transplants that were mismatched for a single class I antigen. When tested by five different criteria, the results were relatively similar for the HLA class I, A- and B-locus mismatches. HLA A1 was identified as the single most dominant immunogenic mismatch. However, when the P values were multiplied by 68, the number of comparisons, A1 was only marginally significant. We concluded that at least for class I specificities, the 68 specificities were about equal immunogenicity in kidney transplantation.

  16. An Ecological Systems Approach to Bullying Behaviors among Middle School Students in the United States

    ERIC Educational Resources Information Center

    Lee, Chang-Hun

    2011-01-01

    The aim of this study is to identify an ecological prediction model of bullying behaviors. Based on an ecological systems theory, this study identifies significant factors influencing bullying behaviors at different levels of middle and high school. These levels include the microsystem, mesosystem, exosystem, and macrosystem. More specifically,…

  17. An Examination of High School Graduates Who Identify Teachers as Influential in Their Choice of College

    ERIC Educational Resources Information Center

    Mozie-Ross, Yvette D.

    2011-01-01

    This exploratory study contributes to what is known about the college choice process by providing a quantitative comparative analysis to determine how high school graduates who identify teachers as influential in their choice of college differ from graduates who do not. Specifically, this study answers the following research question: How do…

  18. The Human Lexinome: Genes of Language and Reading

    ERIC Educational Resources Information Center

    Gibson, Christopher J.; Gruen, Jeffrey R.

    2008-01-01

    Within the human genome, genetic mapping studies have identified 10 regions of different chromosomes, known as DYX loci, in genetic linkage with dyslexia, and two, known as SLI loci, in genetic linkage with Specific Language Impairment (SLI). Further genetic studies have identified four dyslexia genes within the DYX loci: "DYX1C1" on 15q,…

  19. Identifying Students' Expectancy-Value Beliefs: A Latent Class Analysis Approach to Analyzing Middle School Students' Science Self-Perceptions

    ERIC Educational Resources Information Center

    Phelan, Julia; Ing, Marsha; Nylund-Gibson, Karen; Brown, Richard S.

    2017-01-01

    This study extends current research by organizing information about students' expectancy-value achievement motivation, in a way that helps parents and teachers identify specific entry points to encourage and support students' science aspirations. This study uses latent class analysis to describe underlying differences in ability beliefs, task…

  20. Culture, morality and individual differences: comparability and incomparability across species.

    PubMed

    Saucier, Gerard

    2018-04-19

    Major routes to identifying individual differences (in diverse species) include studies of behaviour patterns as represented in language and neurophysiology. But results from these approaches appear not to converge on some major dimensions. Identifying dimensions of human variation least applicable to non-human species may help to partition human-specific individual differences of recent evolutionary origin from those shared across species. Human culture includes learned, enforced social-norm systems that are symbolically reinforced and referenced in displays signalling adherence. At a key juncture in human evolution bullying aggression and deception-based cheating apparently became censured in the language of a moral community, enabling mutual observation coordinated in gossip, associated with external sanctions. That still-conserved cultural paradigm moralistically regulates selfish advantage-taking, with shared semantics and explicit rules. Ethics and moral codes remain critical and universal components of human culture and have a stronger imprint in language than most aspects of the currently popular Big-Five taxonomy, a model that sets out five major lines of individual-differences variation in human personality. In other species (e.g. chimpanzees), human observers might see apparent individual differences in morality-relevant traits, but not because the animals have human-analogue sanctioning systems. Removing the moral dimension of personality and other human-specific manifestations (e.g. religion) may aid in identifying those other bases of individual differences more ubiquitous across species.This article is part of the theme issue 'Diverse perspectives on diversity: multi-disciplinary approaches to taxonomies of individual differences'. © 2018 The Author(s).

  1. Transcriptomic basis for drought-resistance in Brassica napus L.

    NASA Astrophysics Data System (ADS)

    Wang, Pei; Yang, Cuiling; Chen, Hao; Song, Chunpeng; Zhang, Xiao; Wang, Daojie

    2017-01-01

    Based on transcriptomic data from four experimental settings with drought-resistant and drought-sensitive cultivars under drought and well-watered conditions, statistical analysis revealed three categories encompassing 169 highly differentially expressed genes (DEGs) in response to drought in Brassica napus L., including 37 drought-resistant cultivar-related genes, 35 drought-sensitive cultivar-related genes and 97 cultivar non-specific ones. We provide evidence that the identified DEGs were fairly uniformly distributed on different chromosomes and their expression patterns are variety specific. Except commonly enriched in response to various stimuli or stresses, different categories of DEGs show specific enrichment in certain biological processes or pathways, which indicated the possibility of functional differences among the three categories. Network analysis revealed relationships among the 169 DEGs, annotated biological processes and pathways. The 169 DEGs can be classified into different functional categories via preferred pathways or biological processes. Some pathways might simultaneously involve a large number of shared DEGs, and these pathways are likely to cross-talk and have overlapping biological functions. Several members of the identified DEGs fit to drought stress signal transduction pathway in Arabidopsis thaliana. Finally, quantitative real-time PCR validations confirmed the reproducibility of the RNA-seq data. These investigations are profitable for the improvement of crop varieties through transgenic engineering.

  2. Collective network routing

    DOEpatents

    Hoenicke, Dirk

    2014-12-02

    Disclosed are a unified method and apparatus to classify, route, and process injected data packets into a network so as to belong to a plurality of logical networks, each implementing a specific flow of data on top of a common physical network. The method allows to locally identify collectives of packets for local processing, such as the computation of the sum, difference, maximum, minimum, or other logical operations among the identified packet collective. Packets are injected together with a class-attribute and an opcode attribute. Network routers, employing the described method, use the packet attributes to look-up the class-specific route information from a local route table, which contains the local incoming and outgoing directions as part of the specifically implemented global data flow of the particular virtual network.

  3. Identifying physical activity gender differences among youth

    USDA-ARS?s Scientific Manuscript database

    Physical activity (PA) is an important part of a healthy lifestyle and reduces risk of certain chronic diseases. Many youth do not currently meet PA guidelines; evidence suggests that girls are less active than boys are at all ages. PA differences need to be understood, so that gender-specific inter...

  4. Module 4: Text Versions | State, Local, and Tribal Governments | NREL

    Science.gov Websites

    own or finance a system. We'll help you understand the different financing types available to local often specific to a particular segment of the market with different amounts of incentives, different system size caps, and different total funds or aggregate capacity. The customer can identify if solar PV

  5. Human Health Concenrs of the Metalworking Fluid Components

    NASA Astrophysics Data System (ADS)

    Gerulová, Kristína; Buranská, Eva; Soldán, Maroš

    2017-06-01

    The exploration of 209 available Material safety data sheets of 85 straight oils, 46 emulsions, 51 semi-synthetics and 27 synthetics was carried out to provide a report on the most used components defined as dangerous substances. As many as 217 of different substances of which 15 were identified as biocides, 17 as corrosion inhibitors or neutralizing agent, 17 were lubricity improvers and 38 different base fluids, lubricity solvents or surfactants, while 93 substances were not identified specifically and 37 substances occurred only once. This article is focused on the list of biocides, neutralizing agents and corrosion inhibitors identified in all types of MWFs and their possible health effects.

  6. European Population Genetic Substructure: Further Definition of Ancestry Informative Markers for Distinguishing Among Diverse European Ethnic Groups

    PubMed Central

    Tian, Chao; Kosoy, Roman; Nassir, Rami; Lee, Annette; Villoslada, Pablo; Klareskog, Lars; Hammarström, Lennart; Garchon, Henri-Jean; Pulver, Ann E.; Ransom, Michael; Gregersen, Peter K.; Seldin, Michael F.

    2009-01-01

    The definition of European population genetic substructure and its application to understanding complex phenotypes is becoming increasingly important. In the current study using over 4000 subjects genotyped for 300 thousand SNPs we provide further insight into relationships among European population groups and identify sets of SNP ancestry informative markers (AIMs) for application in genetic studies. In general, the graphical description of these principal components analyses (PCA) of diverse European subjects showed a strong correspondence to the geographical relationships of specific countries or regions of origin. Clearer separation of different ethnic and regional populations was observed when northern and southern European groups were considered separately and the PCA results were influenced by the inclusion or exclusion of different self-identified population groups including Ashkenazi Jewish, Sardinian and Orcadian ethnic groups. SNP AIM sets were identified that could distinguish the regional and ethnic population groups. Moreover, the studies demonstrated that most allele frequency differences between different European groups could be effectively controlled in analyses using these AIM sets. The European substructure AIMs should be widely applicable to ongoing studies to confirm and delineate specific disease susceptibility candidate regions without the necessity to perform additional genome-wide SNP studies in additional subject sets. PMID:19707526

  7. European population genetic substructure: further definition of ancestry informative markers for distinguishing among diverse European ethnic groups.

    PubMed

    Tian, Chao; Kosoy, Roman; Nassir, Rami; Lee, Annette; Villoslada, Pablo; Klareskog, Lars; Hammarström, Lennart; Garchon, Henri-Jean; Pulver, Ann E; Ransom, Michael; Gregersen, Peter K; Seldin, Michael F

    2009-01-01

    The definition of European population genetic substructure and its application to understanding complex phenotypes is becoming increasingly important. In the current study using over 4,000 subjects genotyped for 300,000 single-nucleotide polymorphisms (SNPs), we provide further insight into relationships among European population groups and identify sets of SNP ancestry informative markers (AIMs) for application in genetic studies. In general, the graphical description of these principal components analyses (PCA) of diverse European subjects showed a strong correspondence to the geographical relationships of specific countries or regions of origin. Clearer separation of different ethnic and regional populations was observed when northern and southern European groups were considered separately and the PCA results were influenced by the inclusion or exclusion of different self-identified population groups including Ashkenazi Jewish, Sardinian, and Orcadian ethnic groups. SNP AIM sets were identified that could distinguish the regional and ethnic population groups. Moreover, the studies demonstrated that most allele frequency differences between different European groups could be controlled effectively in analyses using these AIM sets. The European substructure AIMs should be widely applicable to ongoing studies to confirm and delineate specific disease susceptibility candidate regions without the necessity of performing additional genome-wide SNP studies in additional subject sets.

  8. Statistical Methods for Identifying Sequence Motifs Affecting Point Mutations

    PubMed Central

    Zhu, Yicheng; Neeman, Teresa; Yap, Von Bing; Huttley, Gavin A.

    2017-01-01

    Mutation processes differ between types of point mutation, genomic locations, cells, and biological species. For some point mutations, specific neighboring bases are known to be mechanistically influential. Beyond these cases, numerous questions remain unresolved, including: what are the sequence motifs that affect point mutations? How large are the motifs? Are they strand symmetric? And, do they vary between samples? We present new log-linear models that allow explicit examination of these questions, along with sequence logo style visualization to enable identifying specific motifs. We demonstrate the performance of these methods by analyzing mutation processes in human germline and malignant melanoma. We recapitulate the known CpG effect, and identify novel motifs, including a highly significant motif associated with A→G mutations. We show that major effects of neighbors on germline mutation lie within ±2 of the mutating base. Models are also presented for contrasting the entire mutation spectra (the distribution of the different point mutations). We show the spectra vary significantly between autosomes and X-chromosome, with a difference in T→C transition dominating. Analyses of malignant melanoma confirmed reported characteristic features of this cancer, including statistically significant strand asymmetry, and markedly different neighboring influences. The methods we present are made freely available as a Python library https://bitbucket.org/pycogent3/mutationmotif. PMID:27974498

  9. Exploration of Analysis Methods for Diagnostic Imaging Tests: Problems with ROC AUC and Confidence Scores in CT Colonography

    PubMed Central

    Mallett, Susan; Halligan, Steve; Collins, Gary S.; Altman, Doug G.

    2014-01-01

    Background Different methods of evaluating diagnostic performance when comparing diagnostic tests may lead to different results. We compared two such approaches, sensitivity and specificity with area under the Receiver Operating Characteristic Curve (ROC AUC) for the evaluation of CT colonography for the detection of polyps, either with or without computer assisted detection. Methods In a multireader multicase study of 10 readers and 107 cases we compared sensitivity and specificity, using radiological reporting of the presence or absence of polyps, to ROC AUC calculated from confidence scores concerning the presence of polyps. Both methods were assessed against a reference standard. Here we focus on five readers, selected to illustrate issues in design and analysis. We compared diagnostic measures within readers, showing that differences in results are due to statistical methods. Results Reader performance varied widely depending on whether sensitivity and specificity or ROC AUC was used. There were problems using confidence scores; in assigning scores to all cases; in use of zero scores when no polyps were identified; the bimodal non-normal distribution of scores; fitting ROC curves due to extrapolation beyond the study data; and the undue influence of a few false positive results. Variation due to use of different ROC methods exceeded differences between test results for ROC AUC. Conclusions The confidence scores recorded in our study violated many assumptions of ROC AUC methods, rendering these methods inappropriate. The problems we identified will apply to other detection studies using confidence scores. We found sensitivity and specificity were a more reliable and clinically appropriate method to compare diagnostic tests. PMID:25353643

  10. Exploration of analysis methods for diagnostic imaging tests: problems with ROC AUC and confidence scores in CT colonography.

    PubMed

    Mallett, Susan; Halligan, Steve; Collins, Gary S; Altman, Doug G

    2014-01-01

    Different methods of evaluating diagnostic performance when comparing diagnostic tests may lead to different results. We compared two such approaches, sensitivity and specificity with area under the Receiver Operating Characteristic Curve (ROC AUC) for the evaluation of CT colonography for the detection of polyps, either with or without computer assisted detection. In a multireader multicase study of 10 readers and 107 cases we compared sensitivity and specificity, using radiological reporting of the presence or absence of polyps, to ROC AUC calculated from confidence scores concerning the presence of polyps. Both methods were assessed against a reference standard. Here we focus on five readers, selected to illustrate issues in design and analysis. We compared diagnostic measures within readers, showing that differences in results are due to statistical methods. Reader performance varied widely depending on whether sensitivity and specificity or ROC AUC was used. There were problems using confidence scores; in assigning scores to all cases; in use of zero scores when no polyps were identified; the bimodal non-normal distribution of scores; fitting ROC curves due to extrapolation beyond the study data; and the undue influence of a few false positive results. Variation due to use of different ROC methods exceeded differences between test results for ROC AUC. The confidence scores recorded in our study violated many assumptions of ROC AUC methods, rendering these methods inappropriate. The problems we identified will apply to other detection studies using confidence scores. We found sensitivity and specificity were a more reliable and clinically appropriate method to compare diagnostic tests.

  11. Application of DNA markers to identify the individual-specific hosts of tsetse feeding on cattle.

    PubMed

    Torr, S J; Wilson, P J; Schofield, S; Mangwiro, T N; Akber, S; White, B N

    2001-03-01

    Primer sets for five different ungulate loci were used to obtain individual microsatellite DNA profiles for 29 Mashona cattle from a herd in Zimbabwe. There were 3-13 alleles for each locus and, using the entire suite of five loci, each animal within the herd, including closely related individuals, could be unequivocally distinguished. Wild-caught Glossina pallidipes Austen (Diptera: Glossinidae) were fed on specific cattle and the bloodmeal was profiled 0.5-72 h after feeding. The individual specific sources of the bloodmeals, including mixe meals produced by allowing tsetse to feed on two different cattle, were reliabl identified up to 24 h after feeding. The technique was used in field studies of hos selection by G. pallidipes and G. morsitans morsitans Westwood (Diptera Glossinidae) attracted to pairs of cattle. When the pair comprised an adult and a calf, 100% of meals were from the adult. For some pairs of adult cattle, tsetse were biased significantly towards feeding on one animal, whereas for other pairs there was no such bias. In general, feeding was greater on the animal known to have lower rate of host defensive behaviour. Results suggest that relatively slight differences in the inherent defensive behaviour of cattle produce large difference in host-specific feeding rates when the hosts are adjacent. For flies attracted to pair of cattle, < 2% contained blood from both hosts. The DNA profiling technique will be useful in studying the epidemiology of vector-borne diseases of livestock.

  12. Individualized Prediction of Reading Comprehension Ability Using Gray Matter Volume.

    PubMed

    Cui, Zaixu; Su, Mengmeng; Li, Liangjie; Shu, Hua; Gong, Gaolang

    2018-05-01

    Reading comprehension is a crucial reading skill for learning and putatively contains 2 key components: reading decoding and linguistic comprehension. Current understanding of the neural mechanism underlying these reading comprehension components is lacking, and whether and how neuroanatomical features can be used to predict these 2 skills remain largely unexplored. In the present study, we analyzed a large sample from the Human Connectome Project (HCP) dataset and successfully built multivariate predictive models for these 2 skills using whole-brain gray matter volume features. The results showed that these models effectively captured individual differences in these 2 skills and were able to significantly predict these components of reading comprehension for unseen individuals. The strict cross-validation using the HCP cohort and another independent cohort of children demonstrated the model generalizability. The identified gray matter regions contributing to the skill prediction consisted of a wide range of regions covering the putative reading, cerebellum, and subcortical systems. Interestingly, there were gender differences in the predictive models, with the female-specific model overestimating the males' abilities. Moreover, the identified contributing gray matter regions for the female-specific and male-specific models exhibited considerable differences, supporting a gender-dependent neuroanatomical substrate for reading comprehension.

  13. The MLL recombinome of acute leukemias in 2017.

    PubMed

    Meyer, C; Burmeister, T; Gröger, D; Tsaur, G; Fechina, L; Renneville, A; Sutton, R; Venn, N C; Emerenciano, M; Pombo-de-Oliveira, M S; Barbieri Blunck, C; Almeida Lopes, B; Zuna, J; Trka, J; Ballerini, P; Lapillonne, H; De Braekeleer, M; Cazzaniga, G; Corral Abascal, L; van der Velden, V H J; Delabesse, E; Park, T S; Oh, S H; Silva, M L M; Lund-Aho, T; Juvonen, V; Moore, A S; Heidenreich, O; Vormoor, J; Zerkalenkova, E; Olshanskaya, Y; Bueno, C; Menendez, P; Teigler-Schlegel, A; Zur Stadt, U; Lentes, J; Göhring, G; Kustanovich, A; Aleinikova, O; Schäfer, B W; Kubetzko, S; Madsen, H O; Gruhn, B; Duarte, X; Gameiro, P; Lippert, E; Bidet, A; Cayuela, J M; Clappier, E; Alonso, C N; Zwaan, C M; van den Heuvel-Eibrink, M M; Izraeli, S; Trakhtenbrot, L; Archer, P; Hancock, J; Möricke, A; Alten, J; Schrappe, M; Stanulla, M; Strehl, S; Attarbaschi, A; Dworzak, M; Haas, O A; Panzer-Grümayer, R; Sedék, L; Szczepański, T; Caye, A; Suarez, L; Cavé, H; Marschalek, R

    2018-02-01

    Chromosomal rearrangements of the human MLL/KMT2A gene are associated with infant, pediatric, adult and therapy-induced acute leukemias. Here we present the data obtained from 2345 acute leukemia patients. Genomic breakpoints within the MLL gene and the involved translocation partner genes (TPGs) were determined and 11 novel TPGs were identified. Thus, a total of 135 different MLL rearrangements have been identified so far, of which 94 TPGs are now characterized at the molecular level. In all, 35 out of these 94 TPGs occur recurrently, but only 9 specific gene fusions account for more than 90% of all illegitimate recombinations of the MLL gene. We observed an age-dependent breakpoint shift with breakpoints localizing within MLL intron 11 associated with acute lymphoblastic leukemia and younger patients, while breakpoints in MLL intron 9 predominate in AML or older patients. The molecular characterization of MLL breakpoints suggests different etiologies in the different age groups and allows the correlation of functional domains of the MLL gene with clinical outcome. This study provides a comprehensive analysis of the MLL recombinome in acute leukemia and demonstrates that the establishment of patient-specific chromosomal fusion sites allows the design of specific PCR primers for minimal residual disease analyses for all patients.

  14. Using genome wide association studies to identify common QTL regions in three different genetic backgrounds based on Iberian pig breed.

    PubMed

    Martínez-Montes, Ángel M; Fernández, Almudena; Muñoz, María; Noguera, Jose Luis; Folch, Josep M; Fernández, Ana I

    2018-01-01

    One of the major limitation for the application of QTL results in pig breeding and QTN identification has been the limited number of QTL effects validated in different animal material. The aim of the current work was to validate QTL regions through joint and specific genome wide association and haplotype analyses for growth, fatness and premier cut weights in three different genetic backgrounds, backcrosses based on Iberian pigs, which has a major role in the analysis due to its high productive relevance. The results revealed nine common QTL regions, three segregating in all three backcrosses on SSC1, 0-3 Mb, for body weight, on SSC2, 3-9 Mb, for loin bone-in weight, and on SSC7, 3 Mb, for shoulder weight, and six segregating in two of the three backcrosses, on SSC2, SSC4, SSC6 and SSC10 for backfat thickness, shoulder and ham weights. Besides, 18 QTL regions were specifically identified in one of the three backcrosses, five identified only in BC_LD, seven in BC_DU and six in BC_PI. Beyond identifying and validating QTL, candidate genes and gene variants within the most interesting regions have been explored using functional annotation, gene expression data and SNP identification from RNA-Seq data. The results allowed us to propose a promising list of candidate mutations, those identified in PDE10A, DHCR7, MFN2 and CCNY genes located within the common QTL regions and those identified near ssc-mir-103-1 considered PANK3 regulators to be further analysed.

  15. Microarray Detection Call Methodology as a Means to Identify and Compare Transcripts Expressed within Syncytial Cells from Soybean (Glycine max) Roots Undergoing Resistant and Susceptible Reactions to the Soybean Cyst Nematode (Heterodera glycines)

    PubMed Central

    Klink, Vincent P.; Overall, Christopher C.; Alkharouf, Nadim W.; MacDonald, Margaret H.; Matthews, Benjamin F.

    2010-01-01

    Background. A comparative microarray investigation was done using detection call methodology (DCM) and differential expression analyses. The goal was to identify genes found in specific cell populations that were eliminated by differential expression analysis due to the nature of differential expression methods. Laser capture microdissection (LCM) was used to isolate nearly homogeneous populations of plant root cells. Results. The analyses identified the presence of 13,291 transcripts between the 4 different sample types. The transcripts filtered down into a total of 6,267 that were detected as being present in one or more sample types. A comparative analysis of DCM and differential expression methods showed a group of genes that were not differentially expressed, but were expressed at detectable amounts within specific cell types. Conclusion. The DCM has identified patterns of gene expression not shown by differential expression analyses. DCM has identified genes that are possibly cell-type specific and/or involved in important aspects of plant nematode interactions during the resistance response, revealing the uniqueness of a particular cell population at a particular point during its differentiation process. PMID:20508855

  16. Genomic comparison of the closely-related Salmonella enterica serovars enteritidis, dublin and gallinarum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less

  17. Genomic comparison of the closely-related Salmonella enterica serovars enteritidis, dublin and gallinarum

    DOE PAGES

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; ...

    2015-06-03

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content betweenmore » strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. As a result, the loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars.« less

  18. Genomic Comparison of the Closely-Related Salmonella enterica Serovars Enteritidis, Dublin and Gallinarum

    PubMed Central

    Matthews, T. David; Schmieder, Robert; Silva, Genivaldo G. Z.; Busch, Julia; Cassman, Noriko; Dutilh, Bas E.; Green, Dawn; Matlock, Brian; Heffernan, Brian; Olsen, Gary J.; Farris Hanna, Leigh; Schifferli, Dieter M.; Maloy, Stanley; Dinsdale, Elizabeth A.; Edwards, Robert A.

    2015-01-01

    The Salmonella enterica serovars Enteritidis, Dublin, and Gallinarum are closely related but differ in virulence and host range. To identify the genetic elements responsible for these differences and to better understand how these serovars are evolving, we sequenced the genomes of Enteritidis strain LK5 and Dublin strain SARB12 and compared these genomes to the publicly available Enteritidis P125109, Dublin CT 02021853 and Dublin SD3246 genome sequences. We also compared the publicly available Gallinarum genome sequences from biotype Gallinarum 287/91 and Pullorum RKS5078. Using bioinformatic approaches, we identified single nucleotide polymorphisms, insertions, deletions, and differences in prophage and pseudogene content between strains belonging to the same serovar. Through our analysis we also identified several prophage cargo genes and pseudogenes that affect virulence and may contribute to a host-specific, systemic lifestyle. These results strongly argue that the Enteritidis, Dublin and Gallinarum serovars of Salmonella enterica evolve by acquiring new genes through horizontal gene transfer, followed by the formation of pseudogenes. The loss of genes necessary for a gastrointestinal lifestyle ultimately leads to a systemic lifestyle and niche exclusion in the host-specific serovars. PMID:26039056

  19. Content Validity of Patient-Reported Outcome Instruments used with Pediatric Patients with Facial Differences: A Systematic Review.

    PubMed

    Wickert, Natasha M; Wong Riff, Karen W Y; Mansour, Mark; Forrest, Christopher R; Goodacre, Timothy E E; Pusic, Andrea L; Klassen, Anne F

    2018-01-01

    Objective The aim of this systematic review was to identify patient-reported outcome (PRO) instruments used in research with children/youth with conditions associated with facial differences to identify the health concepts measured. Design MEDLINE, EMBASE, CINAHL, and PsycINFO were searched from 2004 to 2016 to identify PRO instruments used in acne vulgaris, birthmarks, burns, ear anomalies, facial asymmetries, and facial paralysis patients. We performed a content analysis whereby the items were coded to identify concepts and categorized as positive or negative content or phrasing. Results A total of 7,835 articles were screened; 6 generic and 11 condition-specific PRO instruments were used in 96 publications. Condition-specific instruments were for acne (four), oral health (two), dermatology (one), facial asymmetries (two), microtia (one), and burns (one). The PRO instruments provided 554 items (295 generic; 259 condition specific) that were sorted into 4 domains, 11 subdomains, and 91 health concepts. The most common domain was psychological (n = 224 items). Of the identified items, 76% had negative content or phrasing (e.g., "Because of the way my face looks I wish I had never been born"). Given the small number of items measuring facial appearance (n = 19) and function (n = 22), the PRO instruments reviewed lacked content validity for patients whose condition impacted facial function and/or appearance. Conclusions Treatments can change facial appearance and function. This review draws attention to a problem with content validity in existing PRO instruments. Our team is now developing a new PRO instrument called FACE-Q Kids to address this problem.

  20. Invertebrate-Based Water Quality Impairments and Associated Stressors Identified through the US Clean Water Act

    NASA Astrophysics Data System (ADS)

    Govenor, Heather; Krometis, Leigh Anne H.; Hession, W. Cully

    2017-10-01

    Macroinvertebrate community assessment is used in most US states to evaluate stream health under the Clean Water Act. While water quality assessment and impairment determinations are reported to the US Environmental Protection Agency, there is no national summary of biological assessment findings. The objective of this work was to determine the national extent of invertebrate-based impairments and to identify pollutants primarily responsible for those impairments. Evaluation of state data in the US Environmental Protection Agency's Assessment and Total Maximum Daily Load Tracking and Implementation System database revealed considerable differences in reporting approaches and terminologies including differences in if and how states report specific biological assessment findings. Only 15% of waters impaired for aquatic life could be identified as having impairments determined by biological assessments (e.g., invertebrates, fish, periphyton); approximately one-third of these were associated with macroinvertebrate bioassessment. Nearly 650 invertebrate-impaired waters were identified nationwide, and sediment was the most common pollutant in bedded (63%) and suspended (9%) forms. This finding is not unexpected, given previous work on the negative impacts of sediment on aquatic life, and highlights the need to more specifically identify the mechanisms driving sediment impairments in order to design effective remediation plans. It also reinforces the importance of efforts to derive sediment-specific biological indices and numerical sediment quality guidelines. Standardization of state reporting approaches and terminology would significantly increase the potential application of water quality assessment data, reveal national trends, and encourage sharing of best practices to facilitate the attainment of water quality goals.

  1. Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

    PubMed

    Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

    2018-01-30

    Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  2. Dementia-specific training for nursing home staff : A systematic literature review.

    PubMed

    Riesch, Julia; Meyer, Lucy; Lehr, Bosco; Severin, Thomas

    2017-08-22

    For people with dementia high-quality care is vital, since at present dementia cannot be cured. In nursing homes this care is provided by the staff, who therefore require dementia-specific training enabling them to improve the quality of life for people with dementia. This article compares existing dementia-specific training for nursing home staff with recommendations, based on the current state of research, by the Alzheimer's Association and the National Institute for Health and Care Excellence, and discusses the outcome of this training. A systematic review of the literature was conducted to identify studies addressing dementia-specific training. The electronic databases Embase, Medline, Cochrane, CINAHL, PsychINFO, PSYNDEX, and ScienceDirect were searched. The training topics most commonly considered were person-centered care, communicating with people affected by dementia, and information about dementia. The roles of different social and healthcare professionals, palliative care of people with dementia, and understanding family dynamics are least featured in the training. There are training concepts which focus not only on the transfer of knowledge but also on practical exercises. In general, the recommended topics were addressed in dementia-specific training concepts, but there is potential for optimization. Further research is needed to identify success criteria in dementia-specific training and identify the successful combination of theoretical knowledge and practical exercise.

  3. Specific Proteins in Nontuberculous Mycobacteria: New Potential Tools.

    PubMed

    Orduña, Patricia; Castillo-Rodal, Antonia I; Mercado, Martha E; Ponce de León, Samuel; López-Vidal, Yolanda

    2015-01-01

    Nontuberculous mycobacteria (NTM) have been isolated from water, soil, air, food, protozoa, plants, animals, and humans. Although most NTM are saprophytes, approximately one-third of NTM have been associated with human diseases. In this study, we did a comparative proteomic analysis among five NTM strains isolated from several sources. There were different numbers of protein spots from M. gordonae (1,264), M. nonchromogenicum type I (894), M. nonchromogenicum type II (935), M. peregrinum (806), and M. scrofulaceum/Mycobacterium mantenii (1,486) strains, respectively. We identified 141 proteins common to all strains and specific proteins to each NTM strain. A total of 23 proteins were selected for its identification. Two of the common proteins identified (short-chain dehydrogenase/reductase SDR and diguanylate cyclase) did not align with M. tuberculosis complex protein sequences, which suggest that these proteins are found only in the NTM strains. Some of the proteins identified as common to all strains can be used as markers of NTM exposure and for the development of new diagnostic tools. Additionally, the specific proteins to NTM strains identified may represent potential candidates for the diagnosis of diseases caused by these mycobacteria.

  4. A Penalized Robust Method for Identifying Gene-Environment Interactions

    PubMed Central

    Shi, Xingjie; Liu, Jin; Huang, Jian; Zhou, Yong; Xie, Yang; Ma, Shuangge

    2015-01-01

    In high-throughput studies, an important objective is to identify gene-environment interactions associated with disease outcomes and phenotypes. Many commonly adopted methods assume specific parametric or semiparametric models, which may be subject to model mis-specification. In addition, they usually use significance level as the criterion for selecting important interactions. In this study, we adopt the rank-based estimation, which is much less sensitive to model specification than some of the existing methods and includes several commonly encountered data and models as special cases. Penalization is adopted for the identification of gene-environment interactions. It achieves simultaneous estimation and identification and does not rely on significance level. For computation feasibility, a smoothed rank estimation is further proposed. Simulation shows that under certain scenarios, for example with contaminated or heavy-tailed data, the proposed method can significantly outperform the existing alternatives with more accurate identification. We analyze a lung cancer prognosis study with gene expression measurements under the AFT (accelerated failure time) model. The proposed method identifies interactions different from those using the alternatives. Some of the identified genes have important implications. PMID:24616063

  5. Audio-visual onset differences are used to determine syllable identity for ambiguous audio-visual stimulus pairs

    PubMed Central

    ten Oever, Sanne; Sack, Alexander T.; Wheat, Katherine L.; Bien, Nina; van Atteveldt, Nienke

    2013-01-01

    Content and temporal cues have been shown to interact during audio-visual (AV) speech identification. Typically, the most reliable unimodal cue is used more strongly to identify specific speech features; however, visual cues are only used if the AV stimuli are presented within a certain temporal window of integration (TWI). This suggests that temporal cues denote whether unimodal stimuli belong together, that is, whether they should be integrated. It is not known whether temporal cues also provide information about the identity of a syllable. Since spoken syllables have naturally varying AV onset asynchronies, we hypothesize that for suboptimal AV cues presented within the TWI, information about the natural AV onset differences can aid in speech identification. To test this, we presented low-intensity auditory syllables concurrently with visual speech signals, and varied the stimulus onset asynchronies (SOA) of the AV pair, while participants were instructed to identify the auditory syllables. We revealed that specific speech features (e.g., voicing) were identified by relying primarily on one modality (e.g., auditory). Additionally, we showed a wide window in which visual information influenced auditory perception, that seemed even wider for congruent stimulus pairs. Finally, we found a specific response pattern across the SOA range for syllables that were not reliably identified by the unimodal cues, which we explained as the result of the use of natural onset differences between AV speech signals. This indicates that temporal cues not only provide information about the temporal integration of AV stimuli, but additionally convey information about the identity of AV pairs. These results provide a detailed behavioral basis for further neuro-imaging and stimulation studies to unravel the neurofunctional mechanisms of the audio-visual-temporal interplay within speech perception. PMID:23805110

  6. Monoclonal Antibodies to Intracellular Stages of Cryptosporidium parvum Define Life Cycle Progression In Vitro.

    PubMed

    Wilke, Georgia; Ravindran, Soumya; Funkhouser-Jones, Lisa; Barks, Jennifer; Wang, Qiuling; VanDussen, Kelli L; Stappenbeck, Thaddeus S; Kuhlenschmidt, Theresa B; Kuhlenschmidt, Mark S; Sibley, L David

    2018-06-27

    Among the obstacles hindering Cryptosporidium research is the lack of an in vitro culture system that supports complete life development and propagation. This major barrier has led to a shortage of widely available anti- Cryptosporidium antibodies and a lack of markers for staging developmental progression. Previously developed antibodies against Cryptosporidium were raised against extracellular stages or recombinant proteins, leading to antibodies with limited reactivity across the parasite life cycle. Here we sought to create antibodies that recognize novel epitopes that could be used to define intracellular development. We identified a mouse epithelial cell line that supported C. parvum growth, enabling immunization of mice with infected cells to create a bank of monoclonal antibodies (MAbs) against intracellular parasite stages while avoiding the development of host-specific antibodies. From this bank, we identified 12 antibodies with a range of reactivities across the parasite life cycle. Importantly, we identified specific MAbs that can distinguish different life cycle stages, such as trophozoites, merozoites, type I versus II meronts, and macrogamonts. These MAbs provide valuable tools for the Cryptosporidium research community and will facilitate future investigation into parasite biology. IMPORTANCE Cryptosporidium is a protozoan parasite that causes gastrointestinal disease in humans and animals. Currently, there is a limited array of antibodies available against the parasite, which hinders imaging studies and makes it difficult to visualize the parasite life cycle in different culture systems. In order to alleviate this reagent gap, we created a library of novel antibodies against the intracellular life cycle stages of Cryptosporidium We identified antibodies that recognize specific life cycle stages in distinctive ways, enabling unambiguous description of the parasite life cycle. These MAbs will aid future investigation into Cryptosporidium biology and help illuminate growth differences between various culture platforms. Copyright © 2018 Wilke et al.

  7. Audio-visual onset differences are used to determine syllable identity for ambiguous audio-visual stimulus pairs.

    PubMed

    Ten Oever, Sanne; Sack, Alexander T; Wheat, Katherine L; Bien, Nina; van Atteveldt, Nienke

    2013-01-01

    Content and temporal cues have been shown to interact during audio-visual (AV) speech identification. Typically, the most reliable unimodal cue is used more strongly to identify specific speech features; however, visual cues are only used if the AV stimuli are presented within a certain temporal window of integration (TWI). This suggests that temporal cues denote whether unimodal stimuli belong together, that is, whether they should be integrated. It is not known whether temporal cues also provide information about the identity of a syllable. Since spoken syllables have naturally varying AV onset asynchronies, we hypothesize that for suboptimal AV cues presented within the TWI, information about the natural AV onset differences can aid in speech identification. To test this, we presented low-intensity auditory syllables concurrently with visual speech signals, and varied the stimulus onset asynchronies (SOA) of the AV pair, while participants were instructed to identify the auditory syllables. We revealed that specific speech features (e.g., voicing) were identified by relying primarily on one modality (e.g., auditory). Additionally, we showed a wide window in which visual information influenced auditory perception, that seemed even wider for congruent stimulus pairs. Finally, we found a specific response pattern across the SOA range for syllables that were not reliably identified by the unimodal cues, which we explained as the result of the use of natural onset differences between AV speech signals. This indicates that temporal cues not only provide information about the temporal integration of AV stimuli, but additionally convey information about the identity of AV pairs. These results provide a detailed behavioral basis for further neuro-imaging and stimulation studies to unravel the neurofunctional mechanisms of the audio-visual-temporal interplay within speech perception.

  8. Modified Acyl-ACP desaturase

    DOEpatents

    Cahoon, Edgar B.; Shanklin, John; Lindqvist, Ylva; Schneider, Gunter

    1999-03-30

    Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

  9. Modified acyl-ACP desaturase

    DOEpatents

    Cahoon, Edgar B.; Shanklin, John; Lindgvist, Ylva; Schneider, Gunter

    1998-01-06

    Disclosed is a methods for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity.

  10. Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.

    PubMed

    Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2015-12-11

    As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.

  11. Identifying Group-Specific Sequences for Microbial Communities Using Long k-mer Sequence Signatures

    PubMed Central

    Wang, Ying; Fu, Lei; Ren, Jie; Yu, Zhaoxia; Chen, Ting; Sun, Fengzhu

    2018-01-01

    Comparing metagenomic samples is crucial for understanding microbial communities. For different groups of microbial communities, such as human gut metagenomic samples from patients with a certain disease and healthy controls, identifying group-specific sequences offers essential information for potential biomarker discovery. A sequence that is present, or rich, in one group, but absent, or scarce, in another group is considered “group-specific” in our study. Our main purpose is to discover group-specific sequence regions between control and case groups as disease-associated markers. We developed a long k-mer (k ≥ 30 bps)-based computational pipeline to detect group-specific sequences at strain resolution free from reference sequences, sequence alignments, and metagenome-wide de novo assembly. We called our method MetaGO: Group-specific oligonucleotide analysis for metagenomic samples. An open-source pipeline on Apache Spark was developed with parallel computing. We applied MetaGO to one simulated and three real metagenomic datasets to evaluate the discriminative capability of identified group-specific markers. In the simulated dataset, 99.11% of group-specific logical 40-mers covered 98.89% disease-specific regions from the disease-associated strain. In addition, 97.90% of group-specific numerical 40-mers covered 99.61 and 96.39% of differentially abundant genome and regions between two groups, respectively. For a large-scale metagenomic liver cirrhosis (LC)-associated dataset, we identified 37,647 group-specific 40-mer features. Any one of the features can predict disease status of the training samples with the average of sensitivity and specificity higher than 0.8. The random forests classification using the top 10 group-specific features yielded a higher AUC (from ∼0.8 to ∼0.9) than that of previous studies. All group-specific 40-mers were present in LC patients, but not healthy controls. All the assembled 11 LC-specific sequences can be mapped to two strains of Veillonella parvula: UTDB1-3 and DSM2008. The experiments on the other two real datasets related to Inflammatory Bowel Disease and Type 2 Diabetes in Women consistently demonstrated that MetaGO achieved better prediction accuracy with fewer features compared to previous studies. The experiments showed that MetaGO is a powerful tool for identifying group-specific k-mers, which would be clinically applicable for disease prediction. MetaGO is available at https://github.com/VVsmileyx/MetaGO. PMID:29774017

  12. Black and White Children's Perceptions of the Intent and Values in Specific Adult and Child Oriented Television Commercials.

    ERIC Educational Resources Information Center

    Donohue, Thomas R.; And Others

    The purpose of this study was to identify the effect of television advertising on different types of children--specifically, the cognitive responses and extra-product expectations fostered by television commercials in both white and black children. The subjects, 52 middle-class white children and 30 inner-city black children ranging in age from…

  13. Atypical Sensory Processing in Adolescents with an Autism Spectrum Disorder and Their Non-Affected Siblings

    ERIC Educational Resources Information Center

    De la Marche, Wouter; Steyaert, Jean; Noens, Ilse

    2012-01-01

    Atypical sensory processing is common in autism spectrum disorders (ASD). Specific profiles have been proposed in different age groups, but no study has focused specifically on adolescents. Identifying traits of ASD that are shared by individuals with ASD and their non-affected family members can shed light on the genetic underpinnings of ASD.…

  14. DD3MAT - a code for yield criteria anisotropy parameters identification.

    NASA Astrophysics Data System (ADS)

    Barros, P. D.; Carvalho, P. D.; Alves, J. L.; Oliveira, M. C.; Menezes, L. F.

    2016-08-01

    This work presents the main strategies and algorithms adopted in the DD3MAT inhouse code, specifically developed for identifying the anisotropy parameters. The algorithm adopted is based on the minimization of an error function, using a downhill simplex method. The set of experimental values can consider yield stresses and r -values obtained from in-plane tension, for different angles with the rolling direction (RD), yield stress and r -value obtained for biaxial stress state, and yield stresses from shear tests performed also for different angles to RD. All these values can be defined for a specific value of plastic work. Moreover, it can also include the yield stresses obtained from in-plane compression tests. The anisotropy parameters are identified for an AA2090-T3 aluminium alloy, highlighting the importance of the user intervention to improve the numerical fit.

  15. Conceptual frameworks of individual work performance: a systematic review.

    PubMed

    Koopmans, Linda; Bernaards, Claire M; Hildebrandt, Vincent H; Schaufeli, Wilmar B; de Vet Henrica, C W; van der Beek, Allard J

    2011-08-01

    Individual work performance is differently conceptualized and operationalized in different disciplines. The aim of the current review was twofold: (1) identifying conceptual frameworks of individual work performance and (2) integrating these to reach a heuristic conceptual framework. A systematic review was conducted in medical, psychological, and management databases. Studies were selected independently by two researchers and included when they presented a conceptual framework of individual work performance. A total of 17 generic frameworks (applying across occupations) and 18 job-specific frameworks (applying to specific occupations) were identified. Dimensions frequently used to describe individual work performance were task performance, contextual performance, counterproductive work behavior, and adaptive performance. On the basis of the literature, a heuristic conceptual framework of individual work performance was proposed. This framework can serve as a theoretical basis for future research and practice.

  16. Intrinsic, identified, and controlled types of motivation for school subjects in young elementary school children.

    PubMed

    Guay, Frédéric; Chanal, Julien; Ratelle, Catherine F; Marsh, Herbert W; Larose, Simon; Boivin, Michel

    2010-12-01

    There are two approaches to the differential examination of school motivation. The first is to examine motivation towards specific school subjects (between school subject differentiation). The second is to examine school motivation as a multidimensional concept that varies in terms of not only intensity but also quality (within school subject differentiation). These two differential approaches have led to important discoveries and provided a better understanding of student motivational dynamics. However, little research has combined these two approaches. This study examines young elementary students' motivations across school subjects (writing, reading, and maths) from the stance of self-determination theory. First, we tested whether children self-report different levels of intrinsic, identified, and controlled motivation towards specific school subjects. Second, we verified whether children self-report differentiated types of motivation across school subjects. Participants were 425 French-Canadian children (225 girls, 200 boys) from three elementary schools. Children were in Grades 1 (N=121), 2 (N=126), and 3 (N=178). Results show that, for a given school subject, young elementary students self-report different levels of intrinsic, identified, and controlled motivation. Results also indicate that children self-report different levels of motivation types across school subjects. Our findings also show that most differentiation effects increase across grades. Some gender effects were also observed. These results highlight the importance of distinguishing among types of school motivation towards specific school subjects in the early elementary years.

  17. Impulsive suicide attempts: a systematic literature review of definitions, characteristics and risk factors.

    PubMed

    Rimkeviciene, Jurgita; O'Gorman, John; De Leo, Diego

    2015-01-15

    Extensive research on impulsive suicide attempts, but lack of agreement on the use of this term indicates the need for a systematic literature review of the area. The aim of this review was to examine definitions and likely correlates of impulsive attempts. A search of Medline, Psychinfo, Scopus, Proquest and Web of Knowledge databases was conducted. Additional articles were identified using the cross-referencing function of Google Scholar. 179 relevant papers were identified. Four different groups of research criteria used to assess suicide attempt impulsivity emerged: (a) time-related criteria, (b) absence of proximal planning/preparations, (c) presence of suicide plan in lifetime/previous year, and (d) other. Subsequent analysis used these criteria to compare results from different studies on 20 most researched hypotheses. Conclusions regarding the characteristics of impulsive attempts are more consistent than those on the risk factors specific to such attempts. No risk factors were identified that uniformly related to suicide attempt impulsivity across all criteria groups, but relationships emerged between separate criteria and specific characteristics of suicide attempters. Only published articles were included. Large inconsistencies in methods of the studies included in this review prevented comparison of effect sizes. The vast disparities in findings on risk factors for impulsive suicide attempts among different criteria groups suggest the need to address the methodological issues in defining suicide attempt impulsivity before further research into correlates of such attempts can effectively progress. Specific recommendations are offered for necessary research. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Genetic variation in Northern Thailand Hill Tribes: origins and relationships with social structure and linguistic differences

    PubMed Central

    Besaggio, Davide; Fuselli, Silvia; Srikummool, Metawee; Kampuansai, Jatupol; Castrì, Loredana; Tyler-Smith, Chris; Seielstad, Mark; Kangwanpong, Daoroong; Bertorelle, Giorgio

    2007-01-01

    Background Ethnic minorities in Northern Thailand, often referred to as Hill Tribes, are considered an ideal model to study the different genetic impact of sex-specific migration rates expected in matrilocal (women remain in their natal villages after the marriage and men move to their wife's village) and patrilocal societies (the opposite is true). Previous studies identified such differences, but little is known about the possible interaction with another cultural factor that may potentially affect genetic diversity, i.e. linguistic differences. In addition, Hill Tribes started to migrate to Thailand in the last centuries from different Northern areas, but the history of these migrations, the level of genetic legacy with their places of origin, and the possible confounding effects related to this migration history in the patterns of genetic diversity, have not been analysed yet. Using both original and published data on the Hill Tribes and several other Asian populations, we focused on all these aspects. Results Genetic variation within population at mtDNA is lower in matrilocal, compared to patrilocal, tribes. The opposite is true for Y-chromosome microsatellites within the Sino-Tibetan linguistic family, but Hmong-Mien speaking patrilocal groups have a genetic diversity very similar to the matrilocal samples. Population divergence ranges between 5% and 14% at mtDNA sequences, and between 5% and 36% at Y- chromosomes STRs, and follows the sex-specific differences expected in patrilocal and matrilocal tribes. On the average, about 2 men and 14 women, and 4 men and 4 women, are exchanged in patrilocal and matrilocal tribes every generation, respectively. Most of the Hill Tribes in Thailand seem to preserve a genetic legacy with their likely geographic origin, with children adoption probably affecting this pattern in one tribe. Conclusion Overall, the sex specific genetic signature of different postmarital habits of residence in the Hill Tribes is robust. However, specific perturbations related to linguistic differences, population specific traits, and the complex migratory history of these groups, can be identified. Additional studies in different populations are needed, especially to obtain more precise estimates of the migration parameters. PMID:17767728

  19. Genetic variation in Northern Thailand Hill Tribes: origins and relationships with social structure and linguistic differences.

    PubMed

    Besaggio, Davide; Fuselli, Silvia; Srikummool, Metawee; Kampuansai, Jatupol; Castrì, Loredana; Tyler-Smith, Chris; Seielstad, Mark; Kangwanpong, Daoroong; Bertorelle, Giorgio

    2007-08-16

    Ethnic minorities in Northern Thailand, often referred to as Hill Tribes, are considered an ideal model to study the different genetic impact of sex-specific migration rates expected in matrilocal (women remain in their natal villages after the marriage and men move to their wife's village) and patrilocal societies (the opposite is true). Previous studies identified such differences, but little is known about the possible interaction with another cultural factor that may potentially affect genetic diversity, i.e. linguistic differences. In addition, Hill Tribes started to migrate to Thailand in the last centuries from different Northern areas, but the history of these migrations, the level of genetic legacy with their places of origin, and the possible confounding effects related to this migration history in the patterns of genetic diversity, have not been analysed yet. Using both original and published data on the Hill Tribes and several other Asian populations, we focused on all these aspects. Genetic variation within population at mtDNA is lower in matrilocal, compared to patrilocal, tribes. The opposite is true for Y-chromosome microsatellites within the Sino-Tibetan linguistic family, but Hmong-Mien speaking patrilocal groups have a genetic diversity very similar to the matrilocal samples. Population divergence ranges between 5% and 14% at mtDNA sequences, and between 5% and 36% at Y-chromosomes STRs, and follows the sex-specific differences expected in patrilocal and matrilocal tribes. On the average, about 2 men and 14 women, and 4 men and 4 women, are exchanged in patrilocal and matrilocal tribes every generation, respectively. Most of the Hill Tribes in Thailand seem to preserve a genetic legacy with their likely geographic origin, with children adoption probably affecting this pattern in one tribe. Overall, the sex specific genetic signature of different postmarital habits of residence in the Hill Tribes is robust. However, specific perturbations related to linguistic differences, population specific traits, and the complex migratory history of these groups, can be identified. Additional studies in different populations are needed, especially to obtain more precise estimates of the migration parameters.

  20. Visualisation and interaction design solutions to address specific demands in shared home care.

    PubMed

    Scandurra, Isabella; Hägglund, Maria; Koch, Sabine

    2006-01-01

    When care professionals from different organisations are involved in patient care, their different views on the care process may not be meaningfully integrated. To use visualisation and interaction design solutions addressing the specific demands of shared care in order to support a collaborative work process. Participatory design, comprising interdisciplinary seminar series with real users and iterative prototyping, was applied. A set of interaction and visualisation design solutions to address care professionals' requirements in shared home care is presented, introducing support for identifying origin of information, holistic presentation of information, user group specific visualisation, avoiding cognitive overload, coordination of work and planning, and quick overviews. The design solutions are implemented in an integrated virtual health record system supporting cooperation and coordination in shared home care for the elderly. The described requirements are, however, generalized to comprise all shared care work. The presented design considerations allow healthcare professionals in different organizations to share patient data on mobile devices. Visualization and interaction design facilitates specific work situations and assists in handling specific demands in shared care. The user interface is adapted to different user groups with similar yet distinct needs. Consequently different views supporting cooperative work and presenting shared information in holistic overviews are developed.

  1. Loss of lager specific genes and subtelomeric regions define two different Saccharomyces cerevisiae lineages for Saccharomyces pastorianus Group I and II strains.

    PubMed

    Monerawela, Chandre; James, Tharappel C; Wolfe, Kenneth H; Bond, Ursula

    2015-03-01

    Lager yeasts, Saccharomyces pastorianus, are interspecies hybrids between S. cerevisiae and S. eubayanus and are classified into Group I and Group II clades. The genome of the Group II strain, Weihenstephan 34/70, contains eight so-called 'lager-specific' genes that are located in subtelomeric regions. We evaluated the origins of these genes through bioinformatic and PCR analyses of Saccharomyces genomes. We determined that four are of cerevisiae origin while four originate from S. eubayanus. The Group I yeasts contain all four S. eubayanus genes but individual strains contain only a subset of the cerevisiae genes. We identified S. cerevisiae strains that contain all four cerevisiae 'lager-specific' genes, and distinct patterns of loss of these genes in other strains. Analysis of the subtelomeric regions uncovered patterns of loss in different S. cerevisiae strains. We identify two classes of S. cerevisiae strains: ale yeasts (Foster O) and stout yeasts with patterns of 'lager-specific' genes and subtelomeric regions identical to Group I and II S. pastorianus yeasts, respectively. These findings lead us to propose that Group I and II S. pastorianus strains originate from separate hybridization events involving different S. cerevisiae lineages. Using the combined bioinformatic and PCR data, we describe a potential classification map for industrial yeasts. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  2. How healthcare states matter: comparing the introduction of clinical standards in Britain and Germany.

    PubMed

    Burau, Viola; Fenton, Laura

    2009-01-01

    This paper aims to identify variation in the introduction of New Public Management reforms in healthcare and how this variation is related to country-specific healthcare states. The analysis uses the introduction of clinical standards in Britain and Germany as cases. The two countries are characterised by interesting differences in relation to the institutional set-up of healthcare states and as such present ideal cases to explore the specific ways of how healthcare states filter clinical standards as tools of a generic managerialism. Both countries have introduced clinical standards but, importantly, the substantive nature of clinical standards differs, reflecting differences in initial institutional conditions. More specifically, in Britain clinical standards have taken the form of two parallel policies, which strengthen hierarchy-based governing and redefine professional self-regulation. In Germany, by contrast, clinical standards come in one single policy, which strengthens the hybrid of network- and hierarchy-based governing and to some extent also pure hierarchy-based forms of governing. First, with its cross-country comparative focus, the analysis is able to identify systematic variations across healthcare states and the specific ways in which they impact on the introduction of New Public Management. Second, with its focus on clinical standards, the analysis deals with the governance of medical practice as one of the central areas of healthcare states.

  3. Denominational Affiliation of Christian Colleges and Universities and Its Effect on Social Exclusion in the Workplace and Faculty Job Satisfaction

    ERIC Educational Resources Information Center

    Helms, Clinton Lewis

    2017-01-01

    There are over 500 institutions of higher education within the United States that identify with the Christian faith. A majority of these schools were founded by specific Christian denominations with which many are still affiliated. Faculty members within these institutions who identify with a Christian tradition or denomination different from the…

  4. A Comparative Needs Analysis of Supportive Services for Non-Handicapped and Handicapped Persons Seeking Post-Secondary Education from the Community College System.

    ERIC Educational Resources Information Center

    Graham, Gary L.; And Others

    This study was concerned with identifying the specific information needs and personal needs of handicapped students and comparing the selected needs with needs of general students. The study hypothesis was that there is no significant difference between identified needs of handicapped students and those of general students. The significance…

  5. Non-invasive assessment of parasitic nematode species diversity in wild Soay sheep using molecular markers.

    PubMed

    Wimmer, B; Craig, B H; Pilkington, J G; Pemberton, J M

    2004-04-01

    Considerable effort has been put into detecting and identifying parasitic nematodes in live ruminants, but to date most studies are limited to a small group of nematodes and/or to experimentally infected sheep. In this study, a PCR-based assay using species-specific primer pairs, located in the second internal transcribed spacer ribosomal DNA, was developed to identify nine different species from six different families of parasitic nematodes in a wild, unmanaged and naturally infected population of sheep. Each primer pair was tested for its specificity and sensitivity and it exclusively amplified the species it was designed for and exhibited a high degree of sensitivity. The method was applied to eggs and cultured larvae to identify the parasitic nematodes present in a pooled faecal sample from several host individuals with unknown parasite burden. To test detection reliability, a faecal sample from an individual with known parasite burden (through post-mortem analysis) was also examined. All species present could be correctly identified by PCR, but detecting very low levels and/or early stages of infection proved to be difficult. The method was also tested for its applicability to high through-put screening of faecal samples.

  6. Sex differences in the association between infant markers and later autistic traits.

    PubMed

    Bedford, Rachael; Jones, Emily J H; Johnson, Mark H; Pickles, Andrew; Charman, Tony; Gliga, Teodora

    2016-01-01

    Although it is well established that the prevalence of autism spectrum disorder (ASD) is higher in males than females, there is relatively little understanding of the underlying mechanisms and their developmental time course. Sex-specific protective or risk factors have often been invoked to explain these differences, but such factors are yet to be identified. We take a developmental approach, using a prospective sample of 104 infants at high and low familial risk for ASD, to characterise sex differences in infant markers known to predict emerging autism symptoms. We examine three markers previously shown to be associated with later autistic social-communication symptoms: the Autism Observation Scale for Infants (AOSI) total score, attention disengagement speed and gaze following behaviour. Our aim was to test whether sex differences were already present in these markers at 1 year of age, which would suggest sex-specific mechanisms of risk or protection. While no sex differences were found in any of the three markers investigated, we found sex differences in their relationship to 3-year autism traits; all three markers significantly predicted later autism traits only in the boys. Previously identified 'early autism markers' were associated with later autism symptoms only in boys. This suggests that there may be additional moderating risk or protective factors which remain to be identified. Our findings have important implications for prospective studies in terms of directly testing for the moderating effect of sex on emerging autistic traits.

  7. Dynamic Modularity of Host Protein Interaction Networks in Salmonella Typhi Infection

    PubMed Central

    Dhal, Paltu Kumar; Barman, Ranjan Kumar; Saha, Sudipto; Das, Santasabuj

    2014-01-01

    Background Salmonella Typhi is a human-restricted pathogen, which causes typhoid fever and remains a global health problem in the developing countries. Although previously reported host expression datasets had identified putative biomarkers and therapeutic targets of typhoid fever, the underlying molecular mechanism of pathogenesis remains incompletely understood. Methods We used five gene expression datasets of human peripheral blood from patients suffering from S. Typhi or other bacteremic infections or non-infectious disease like leukemia. The expression datasets were merged into human protein interaction network (PIN) and the expression correlation between the hubs and their interacting proteins was measured by calculating Pearson Correlation Coefficient (PCC) values. The differences in the average PCC for each hub between the disease states and their respective controls were calculated for studied datasets. The individual hubs and their interactors with expression, PCC and average PCC values were treated as dynamic subnetworks. The hubs that showed unique trends of alterations specific to S. Typhi infection were identified. Results We identified S. Typhi infection-specific dynamic subnetworks of the host, which involve 81 hubs and 1343 interactions. The major enriched GO biological process terms in the identified subnetworks were regulation of apoptosis and biological adhesions, while the enriched pathways include cytokine signalling in the immune system and downstream TCR signalling. The dynamic nature of the hubs CCR1, IRS2 and PRKCA with their interactors was studied in detail. The difference in the dynamics of the subnetworks specific to S. Typhi infection suggests a potential molecular model of typhoid fever. Conclusions Hubs and their interactors of the S. Typhi infection-specific dynamic subnetworks carrying distinct PCC values compared with the non-typhoid and other disease conditions reveal new insight into the pathogenesis of S. Typhi. PMID:25144185

  8. Sex-specific Linkage Scans in Opioid Dependence

    PubMed Central

    Yang, Bao-Zhu; Han, Shizhong; Kranzler, Henry R.; Palmer, Abraham A.; Gelernter, Joel

    2017-01-01

    Sex influences risk for opioid dependence (OD). We hypothesized that sex might interact with genetic loci that influence the risk for OD. Therefore we performed an analysis to identify sex-specific genomic susceptibility regions for OD using linkage. Over 6000 single nucleotide polymorphism (SNP) markers were genotyped for 1758 African- and European-American (AA and EA) individuals from 739 families, ascertained via affected sib-pairs with OD and/or cocaine dependence. Autosomewide non-parametric linkage scans, stratified by sex and population, were performed. We identified one significant linkage region, segregating with OD in EA men, at 71.1 cM on chromosome 4 (LOD=3.29; point-wise p=0.00005; empirical autosome-wide p=0.042), which significantly differed from the linkage signal at the same location in EA women (empirical p=0.002). Three suggestive linkage signals were identified at 181.3 cM on chromosome 7 (LOD=2.18), 104 cM on chromosome 11 (LOD=1.85), and 60.9 cM on chromosome 16 (LOD=1.93) in EA women. In AA men, four suggestive linkage signals were detected at 201.1 cM on chromosome 3 (LOD=2.32), 152.9 cM on chromosome 6 (LOD=1.86), 16.8 cM on chromosome 7 (LOD=1.95), and 36.1 cM on chromosome 17 (LOD=1.99). The significant region, mapping to 4q12-4q13.1, harbors several OD candidate genes with interconnected functionality, including VEGFR, CLOCK, PDCL2, NMU, NRSF, and IGFBP7. In conclusion, these results provide an evidence for the existence of sex-specific and population-specific differences in OD. Furthermore, these results provide positional information that will facilitate the use of targeted next-generation sequencing to search for genes that contribute to sex-specific differences in OD. PMID:27762075

  9. Sex-specific linkage scans in opioid dependence.

    PubMed

    Yang, Bao-Zhu; Han, Shizhong; Kranzler, Henry R; Palmer, Abraham A; Gelernter, Joel

    2017-04-01

    Sex influences risk for opioid dependence (OD). We hypothesized that sex might interact with genetic loci that influence the risk for OD. Therefore we performed an analysis to identify sex-specific genomic susceptibility regions for OD using linkage. Over 6,000 single nucleotide polymorphism (SNP) markers were genotyped for 1,758 African- and European-American (AA and EA) individuals from 739 families, ascertained via affected sib-pairs with OD and/or cocaine dependence. Autosomewide non-parametric linkage scans, stratified by sex and population, were performed. We identified one significant linkage region, segregating with OD in EA men, at 71.1 cM on chromosome 4 (LOD = 3.29; point-wise P = 0.00005; empirical autosome-wide P = 0.042), which significantly differed from the linkage signal at the same location in EA women (empirical P = 0.002). Three suggestive linkage signals were identified at 181.3 cM on chromosome 7 (LOD = 2.18), 104 cM on chromosome 11 (LOD = 1.85), and 60.9 cM on chromosome 16 (LOD = 1.93) in EA women. In AA men, four suggestive linkage signals were detected at 201.1 cM on chromosome 3 (LOD = 2.32), 152.9 cM on chromosome 6 (LOD = 1.86), 16.8 cM on chromosome 7 (LOD = 1.95), and 36.1 cM on chromosome 17 (LOD = 1.99). The significant region, mapping to 4q12-4q13.1, harbors several OD candidate genes with interconnected functionality, including VEGFR, CLOCK, PDCL2, NMU, NRSF, and IGFBP7. In conclusion, these results provide an evidence for the existence of sex-specific and population-specific differences in OD. Furthermore, these results provide positional information that will facilitate the use of targeted next-generation sequencing to search for genes that contribute to sex-specific differences in OD. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Mapping the Tail Fiber as the Receptor Binding Protein Responsible for Differential Host Specificity of Pseudomonas aeruginosa Bacteriophages PaP1 and JG004

    PubMed Central

    Le, Shuai; He, Xuesong; Tan, Yinling; Huang, Guangtao; Zhang, Lin; Lux, Renate; Shi, Wenyuan; Hu, Fuquan

    2013-01-01

    The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy. PMID:23874674

  11. Host-Specific Adaptation of HIV-1 Subtype B in the Japanese Population

    PubMed Central

    Chikata, Takayuki; Carlson, Jonathan M.; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q.; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L.

    2014-01-01

    ABSTRACT The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. IMPORTANCE Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele distributions differ among worldwide populations, the pattern and diversity of HLA-associated escape mutations are likely to be somewhat distinct to each race and region. HLA-associated polymorphisms (HLA-APs) in HIV-1 have previously been identified at the population level in European, North American, Australian, and African cohorts; however, large-scale analyses of HIV-1 clade B-specific HLA-APs in Asians are lacking. Differential intraclade HIV-1 adaptation to global populations can be investigated via comparative analyses of HLA-associated polymorphisms across ethnic groups, but such studies are rare. Here, we identify HLA-APs in a large Japanese HIV-1 clade B cohort using phylogenetically informed methods and observe that the majority of them had not been previously characterized in predominantly Caucasian populations. The results highlight HIV's unique adaptation to cellular immune pressures imposed by different global populations. PMID:24522911

  12. Host-specific adaptation of HIV-1 subtype B in the Japanese population.

    PubMed

    Chikata, Takayuki; Carlson, Jonathan M; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L; Takiguchi, Masafumi

    2014-05-01

    The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele distributions differ among worldwide populations, the pattern and diversity of HLA-associated escape mutations are likely to be somewhat distinct to each race and region. HLA-associated polymorphisms (HLA-APs) in HIV-1 have previously been identified at the population level in European, North American, Australian, and African cohorts; however, large-scale analyses of HIV-1 clade B-specific HLA-APs in Asians are lacking. Differential intraclade HIV-1 adaptation to global populations can be investigated via comparative analyses of HLA-associated polymorphisms across ethnic groups, but such studies are rare. Here, we identify HLA-APs in a large Japanese HIV-1 clade B cohort using phylogenetically informed methods and observe that the majority of them had not been previously characterized in predominantly Caucasian populations. The results highlight HIV's unique adaptation to cellular immune pressures imposed by different global populations.

  13. Pollen–pistil interactions and self-incompatibility in the Asteraceae: new insights from studies of Senecio squalidus (Oxford ragwort)

    PubMed Central

    Allen, Alexandra M.; Thorogood, Christopher J.; Hegarty, Matthew J.; Lexer, Christian; Hiscock, Simon J.

    2011-01-01

    Background Pollen–pistil interactions are an essential prelude to fertilization in angiosperms and determine compatibility/incompatibility. Pollen–pistil interactions have been studied at a molecular and cellular level in relatively few families. Self-incompatibility (SI) is the best understood pollen–pistil interaction at a molecular level where three different molecular mechanisms have been identified in just five families. Here we review studies of pollen–pistil interactions and SI in the Asteraceae, an important family that has been relatively understudied in these areas of reproductive biology. Scope We begin by describing the historical literature which first identified sporophytic SI (SSI) in species of Asteraceae, the SI system later identified and characterized at a molecular level in the Brassicaceae. Early structural and cytological studies in these two families suggested that pollen–pistil interactions and SSI were similar, if not the same. Recent cellular and molecular studies in Senecio squalidus (Oxford ragwort) have challenged this belief by revealing that despite sharing the same genetic system of SSI, the Brassicaceae and Asteraceae molecular mechanisms are different. Key cellular differences have also been highlighted in pollen–stigma interactions, which may arise as a consequence of the Asteraceae possessing a ‘semi-dry’ stigma, rather than the ‘dry’ stigma typical of the Brassicaceae. The review concludes with a summary of recent transcriptomic analyses aimed at identifying proteins regulating pollen–pistil interactions and SI in S. squalidus, and by implication the Asteraceae. The Senecio pistil transcriptome contains many novel pistil-specific genes, but also pistil-specific genes previously shown to play a role in pollen–pistil interactions in other species. Conclusions Studies in S. squalidus have shown that stigma structure and the molecular mechanism of SSI in the Asteraceae and Brassicaceae are different. The availability of a pool of pistil-specific genes for S. squalidus offers an opportunity to elucidate the molecular mechanisms of pollen–pistil interactions and SI in the Asteraceae. PMID:21752792

  14. Proteomic profiling for plasma biomarkers of tuberculosis progression.

    PubMed

    Liu, Qiuyue; Pan, Liping; Han, Fen; Luo, Baojian; Jia, Hongyan; Xing, Aiying; Li, Qi; Zhang, Zongde

    2018-06-05

    Severe pulmonary tuberculosis (STB) is a life‑threatening condition with high economic and social burden. The present study aimed to screen for distinct proteins in different stages of TB and identify biomarkers for a better understanding of TB progression and pathogenesis. Blood samples were obtained from 81 patients with STB, 80 with mild TB (MTB) and 50 healthy controls. Differentially expressed proteins were identified using liquid chromatography‑tandem mass spectrometry‑based label‑free quantitative proteomic analysis. Functional and pathway enrichment analyses were performed for the identified proteins. The expression of potential biomarkers was further validated by western blot analysis and enzyme‑linked immunosorbent assays. The accuracy, sensitivity and specificity for selected protein biomarkers in diagnosing STB were also evaluated. A total of 1,011 proteins were identified in all three groups, and 153 differentially expressed proteins were identified in patients with STB. These proteins were involved in 'cellular process', 'response to stimulus', 'apoptotic process', 'immune system process' and 'select metabolic process'. Significant differences in protein expression were detected in α‑1‑acid glycoprotein 2 (ORM2), interleukin‑36α (IL‑36α), S100 calcium binding protein A9 (S100‑A9), superoxide dismutase (SOD)1 in the STB group, compared with the MTB and control groups. The combination of plasma ORM2, IL‑36α, S100A9 and SOD1 levels achieved 90.00% sensitivity and 92.16% specificity to discriminate between patients with STB and MTB, and 89.66% sensitivity and 98.9% specificity to discriminate between patients with STB and healthy controls. ORM2, S100A9, IL‑36α and SOD1 were associated with the development of TB, and have the potential to distinguish between different stages of TB. Differential protein expression during disease progression may improve the current understanding of STB pathogenesis.

  15. Factors affecting the implementation of green specifications in construction.

    PubMed

    Lam, Patrick T I; Chan, Edwin H W; Poon, C S; Chau, C K; Chun, K P

    2010-01-01

    Green specifications constitute one of the important elements in green construction. New sustainability requirements and changing priorities in construction management have spurred the emerging green specifications to a faster pace of development. A cross-sectional survey has been conducted in Hong Kong in 2007 to identify principal factors leading to the success of preparing green specifications. Based on extensive construction management literature, 20 variables concerning sustainable construction were summarized. Using the Mann-Whitney U-test, the subtle differences between stakeholders in specifying construction work have been detected even with the high consistency of the responses among the groups. Moreover, five independent factors for successful specification of green construction have been categorized by factor analysis. They are related to (1) green technology and techniques, (2) reliability and quality of specification, (3) leadership and responsibility, (4) stakeholder involvement, and (5) guide and benchmarking systems. Whilst the first and fourth factors are generally more important, different stakeholder groups have different emphases. The results of the survey have been validated against established principles. 2009 Elsevier Ltd. All rights reserved.

  16. A Comparison of Perceptual Strategies Utilized by Expert and Novice Performers.

    ERIC Educational Resources Information Center

    Moore, John O.

    This paper reviews the literature comparing the perceptual strategies of expert and novice sport/skill performers in ball sports to specifically identify where differences exist. The following comparisons were made: (1) experts attend to fewer, somewhat different visual cues than beginners; (2) experts exhibit an ability to utilize advanced…

  17. Management Careers in Professional Sport and College/University Athletics: Results of a Survey Evaluation.

    ERIC Educational Resources Information Center

    Beitel, Patricia A.; And Others

    This study assessed the needs of management positions and obtained evaluations of sport management programs by management personnel from different sport program perspectives, i.e., professional sport and college/university athletics. Results of survey identified: (1) specific similarities and differences in the criteria for both hiring sport…

  18. The Relative Importance of Specific Self-Efficacy Sources in Pretraining Self-Efficacy Beliefs

    ERIC Educational Resources Information Center

    Howardson, Garett N.; Behrend, Tara S.

    2015-01-01

    Self-efficacy is clearly important for learning. Research identifying the most important sources of self-efficacy beliefs, however, has been somewhat limited to date in that different disciplines focus largely on different sources of self-efficacy. Whereas education researchers focus on Bandura's original sources of "enactive mastery,"…

  19. Creating Research Impact: The Roles of Research Users in Interactive Research Mobilisation

    ERIC Educational Resources Information Center

    Morton, Sarah

    2015-01-01

    An impact assessment of research into children's concerns about their families and relationships found many ways research had been used in different sectors by different actors. Specific impacts from the research were harder to identify. However, instances where there were clear impacts highlighted the ways research users had adapted research to…

  20. An Analysis of State Autism Educational Assessment Practices and Requirements

    ERIC Educational Resources Information Center

    Barton, Erin E.; Harris, Bryn; Leech, Nancy; Stiff, Lillian; Choi, Gounah; Joel, Tiffany

    2016-01-01

    States differ in the procedures and criteria used to identify ASD. These differences are likely to impact the prevalence and age of identification for children with ASD. The purpose of the current study was to examine the specific state variations in ASD identification and eligibility criteria requirements. We examined variations by state in…

  1. Group Comparisons of Mathematics Performance from a Cognitive Diagnostic Perspective

    ERIC Educational Resources Information Center

    Chen, Yi-Hsin; Ferron, John M.; Thompson, Marilyn S.; Gorin, Joanna S.; Tatsuoka, Kikumi K.

    2010-01-01

    Traditional comparisons of test score means identify group differences in broad academic areas, but fail to provide substantive description of how the groups differ on the specific cognitive attributes required for success in the academic area. The rule space method (RSM) allows for group comparisons at the cognitive attribute level, which…

  2. Purchase decision involvement: Event management segments and related event behavior

    Treesearch

    Rodney B. Warnick; David C. Bojanic

    2012-01-01

    The goal of this research was to examine the relationships between different levels of event purchase decision involvement (PDI) segments and their respective event behaviors (e.g., expenditures, travel behavior, event consumption and satisfaction). The specific purpose was to answer two major research questions: 1) Can PDI identify different levels or segments of...

  3. Identifying Gender-Specific Developmental Trajectories of Nonviolent and Violent Delinquency from Adolescence to Young Adulthood

    ERIC Educational Resources Information Center

    Zheng, Yao; Cleveland, H. Harrington

    2013-01-01

    Most research examining gender differences in developmental trajectories of antisocial behavior does not consider subtypes of antisocial behavior and is difficult to generalize due to small non-representative samples. The current study investigated gender difference in developmental trajectories from adolescence to young adulthood while addressing…

  4. An evidence map of yoga for low back pain.

    PubMed

    Goode, Adam P; Coeytaux, Remy R; McDuffie, Jennifer; Duan-Porter, Wei; Sharma, Poonam; Mennella, Hillary; Nagi, Avishek; Williams, John W

    2016-04-01

    Yoga is being increasingly studied as a treatment strategy for a variety of different clinical conditions, including low back pain (LBP). We set out to conduct an evidence map of yoga for the treatment, prevention and recurrence of acute or chronic low back pain (cLBP). We searched Medline, Cochrane Database of Systematic Reviews, EMBASE, Allied and Complementary Medicine Database and ClinicalTrials.gov for randomized controlled trials (RCT), systematic reviews or planned studies on the treatment or prevention of acute back pain or cLBP. Two independent reviewers screened papers for inclusion, extracted data and assessed the quality of included studies. Three eligible systematic reviews were identified that included 10 RCTs (n=956) that evaluated yoga for non-specific cLBP. We did not identify additional RCTs beyond those included in the systematic reviews. Our search of ClinicalTrials.gov identified one small (n=10) unpublished trial and one large (n=320) planned clinical trial. The most recent good quality systematic review indicated significant effects for short- and long-term pain reduction (n=6 trials; standardized mean difference [SMD] -0.48; 95% CI, -0.65 to -0.31; I(2)=0% and n=5; SMD -0.33; 95% CI, -0.59 to -0.07; I(2)=48%, respectively). Long-term effects for back specific disability were also identified (n=5; SMD -0.35; 95% CI, -0.55 to -0.15; I(2)=20%). No studies were identified evaluating yoga for prevention or treatment of acute LBP. Evidence suggests benefit of yoga in midlife adults with non-specific cLBP for short- and long-term pain and back-specific disability, but the effects of yoga for health-related quality of life, well- being and acute LBP are uncertain. Without additional studies, further systematic reviews are unlikely to be informative. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Modified acyl-ACP desaturase

    DOEpatents

    Cahoon, E.B.; Shanklin, J.; Lindgvist, Y.; Schneider, G.

    1998-01-06

    Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity. 1 fig.

  6. Modified Acyl-ACP desaturase

    DOEpatents

    Cahoon, E.B.; Shanklin, J.; Lindqvist, Y.; Schneider, G.

    1999-03-30

    Disclosed is a method for modifying the chain length and double bond positional specificities of a soluble plant fatty acid desaturase. More specifically, the method involves modifying amino acid contact residues in the substrate binding channel of the soluble fatty acid desaturase which contact the fatty acid. Specifically disclosed is the modification of an acyl-ACP desaturase. Amino acid contact residues which lie within the substrate binding channel are identified, and subsequently replaced with different residues to effect the modification of activity. 2 figs.

  7. [Design of primers to DNA of lactic acid bacteria].

    PubMed

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  8. Genome-wide identification of lineage-specific genes in Arabidopsis, Oryza and Populus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xiaohan; Jawdy, Sara; Tschaplinski, Timothy J

    2009-01-01

    Protein sequences were compared among Arabidopsis, Oryza and Populus to identify differential gene (DG) sets that are in one but not the other two genomes. The DG sets were screened against a plant transcript database, the NR protein database and six newly-sequenced genomes (Carica, Glycine, Medicago, Sorghum, Vitis and Zea) to identify a set of species-specific genes (SS). Gene expression, protein motif and intron number were examined. 192, 641 and 109 SS genes were identified in Arabidopsis, Oryza and Populus, respectively. Some SS genes were preferentially expressed in flowers, roots, xylem and cambium or up-regulated by stress. Six conserved motifsmore » in Arabidopsis and Oryza SS proteins were found in other distant lineages. The SS gene sets were enriched with intronless genes. The results reflect functional and/or anatomical differences between monocots and eudicots or between herbaceous and woody plants. The Populus-specific genes are candidates for carbon sequestration and biofuel research.« less

  9. Identification of osteosarcoma-related specific proteins in serum samples using surface-enhanced laser desorption/ionization-time-of-flight mass spectrometry.

    PubMed

    Gu, Jianli; Li, Jitian; Huang, Manyu; Zhang, Zhiyong; Li, Dongsheng; Song, Guoying; Ding, Xingpo; Li, Wuyin

    2014-01-01

    Osteosarcoma (OS) is the most common malignant bone tumor. To identify OS-related specific proteins for early diagnosis of OS, a novel approach, surface-enhanced laser desorption/ionization-time-of-flight mass spectrometry (SELDI-TOF-MS) to serum samples from 25 OS patients, 16 osteochondroma, and 26 age-matched normal human volunteers as controls, was performed. Two proteins showed a significantly different expression in OS serum samples from control groups. Proteomic profiles and external leave-one-out cross-validation analysis showed that the correct rate of allocation, the sensitivity, and the specificity of diagnosis were 100%. These two proteins were further identified by searching the EPO-KB database, and one of the proteins identified as Serine rich region profile is involved in various cellular signaling cascades and tumor genesis. The presence of these two proteins in OS patients but absence from premalignant and normal human controls implied that they can be potential biomarkers for early diagnosis of OS.

  10. New markers for tracking endoderm induction and hepatocyte differentiation from human pluripotent stem cells

    PubMed Central

    Holtzinger, Audrey; Streeter, Philip R.; Sarangi, Farida; Hillborn, Scott; Niapour, Maryam; Ogawa, Shinichiro; Keller, Gordon

    2015-01-01

    The efficient generation of hepatocytes from human pluripotent stem cells (hPSCs) requires the induction of a proper endoderm population, broadly characterized by the expression of the cell surface marker CXCR4. Strategies to identify and isolate endoderm subpopulations predisposed to the liver fate do not exist. In this study, we generated mouse monoclonal antibodies against human embryonic stem cell-derived definitive endoderm with the goal of identifying cell surface markers that can be used to track the development of this germ layer and its specification to a hepatic fate. Through this approach, we identified two endoderm-specific antibodies, HDE1 and HDE2, which stain different stages of endoderm development and distinct derivative cell types. HDE1 marks a definitive endoderm population with high hepatic potential, whereas staining of HDE2 tracks with developing hepatocyte progenitors and hepatocytes. When used in combination, the staining patterns of these antibodies enable one to optimize endoderm induction and hepatic specification from any hPSC line. PMID:26493401

  11. Assessing host-specificity of Escherichia coli using a supervised learning logic-regression-based analysis of single nucleotide polymorphisms in intergenic regions.

    PubMed

    Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F

    2015-11-01

    Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates displaying a unique coyote biomarker. Application of a supervised learning method, such as logic regression, to DNA sequence analysis at certain intergenic regions demonstrates that some E. coli strains may evolve to become host-specific. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Event-Specific Cannabis Use and Use-Related Impairment: The Relationship to Campus Traditions

    PubMed Central

    Buckner, Julia D.; Henslee, Amber M.; Jeffries, Emily R.

    2015-01-01

    Objective: Despite high rates of college cannabis use, little work has identified high-risk cannabis use events. For instance, Mardi Gras (MG) and St. Patrick’s Day (SPD) are characterized by more college drinking, yet it is unknown whether they are also related to greater cannabis use. Further, some campuses may have traditions that emphasize substance use during these events, whereas other campuses may not. Such campus differences may affect whether students use cannabis during specific events. The present study tested whether MG and SPD were related to more cannabis use at two campuses with different traditions regarding MG and SPD. Further, given that Campus A has specific traditions regarding MG whereas Campus B has specific traditions regarding SPD, cross-campus differences in event-specific use were examined. Method: Current cannabis-using undergraduates (N = 154) at two campuses completed an online survey of event-specific cannabis use and event-specific cannabis-related problems. Results: Participants used more cannabis during MG and SPD than during a typical weekday, typical day on which the holiday fell, and a holiday unrelated to cannabis use (Presidents’ Day). Among those who engaged in event-specific use, MG and SPD cannabis use was greater than typical weekend use. Campus differences were observed. For example, Campus A reported more cannabis-related problems during MG than SPD, whereas Campus B reported more problems during SPD than MG. Conclusions: Specific holidays were associated with more cannabis use and use-related problems. Observed between-campus differences indicate that campus traditions may affect event-specific cannabis use and use-related problems. PMID:25785793

  13. A strategy to identify linker-based modules for the allosteric regulation of antibody-antigen binding affinities of different scFvs

    PubMed Central

    Thie, Holger

    2017-01-01

    ABSTRACT Antibody single-chain variable fragments (scFvs) are used in a variety of applications, such as for research, diagnosis and therapy. Essential for these applications is the extraordinary specificity, selectivity and affinity of antibody paratopes, which can also be used for efficient protein purification. However, this use is hampered by the high affinity for the protein to be purified because harsh elution conditions, which may impair folding, integrity or viability of the eluted biomaterials, are typically required. In this study, we developed a strategy to obtain structural elements that provide allosteric modulation of the affinities of different antibody scFvs for their antigen. To identify suitable allosteric modules, a complete set of cyclic permutations of calmodulin variants was generated and tested for modulation of the affinity when substituting the linker between VH and VL. Modulation of affinity induced by addition of different calmodulin-binding peptides at physiologic conditions was demonstrated for 5 of 6 tested scFvs of different specificities and antigens ranging from cell surface proteins to haptens. In addition, a variety of different modulator peptides were tested. Different structural solutions were found in respect of the optimal calmodulin permutation, the optimal peptide and the allosteric effect for scFvs binding to different antigen structures. Significantly, effective linker modules were identified for scFvs with both VH-VL and VL-VH architecture. The results suggest that this approach may offer a rapid, paratope-independent strategy to provide allosteric regulation of affinity for many other antibody scFvs. PMID:28055297

  14. Investigating Evolutionary Conservation of Dendritic Cell Subset Identity and Functions

    PubMed Central

    Vu Manh, Thien-Phong; Bertho, Nicolas; Hosmalin, Anne; Schwartz-Cornil, Isabelle; Dalod, Marc

    2015-01-01

    Dendritic cells (DCs) were initially defined as mononuclear phagocytes with a dendritic morphology and an exquisite efficiency for naïve T-cell activation. DC encompass several subsets initially identified by their expression of specific cell surface molecules and later shown to excel in distinct functions and to develop under the instruction of different transcription factors or cytokines. Very few cell surface molecules are expressed in a specific manner on any immune cell type. Hence, to identify cell types, the sole use of a small number of cell surface markers in classical flow cytometry can be deceiving. Moreover, the markers currently used to define mononuclear phagocyte subsets vary depending on the tissue and animal species studied and even between laboratories. This has led to confusion in the definition of DC subset identity and in their attribution of specific functions. There is a strong need to identify a rigorous and consensus way to define mononuclear phagocyte subsets, with precise guidelines potentially applicable throughout tissues and species. We will discuss the advantages, drawbacks, and complementarities of different methodologies: cell surface phenotyping, ontogeny, functional characterization, and molecular profiling. We will advocate that gene expression profiling is a very rigorous, largely unbiased and accessible method to define the identity of mononuclear phagocyte subsets, which strengthens and refines surface phenotyping. It is uniquely powerful to yield new, experimentally testable, hypotheses on the ontogeny or functions of mononuclear phagocyte subsets, their molecular regulation, and their evolutionary conservation. We propose defining cell populations based on a combination of cell surface phenotyping, expression analysis of hallmark genes, and robust functional assays, in order to reach a consensus and integrate faster the huge but scattered knowledge accumulated by different laboratories on different cell types, organs, and species. PMID:26082777

  15. Primate TNF Promoters Reveal Markers of Phylogeny and Evolution of Innate Immunity

    PubMed Central

    Baena, Andres; Ligeiro, Filipa; Diop, Ousmane M.; Brieva, Claudia; Gagneux, Pascal; O'Brien, Stephen J.; Ryder, Oliver A.; Goldfeld, Anne E.

    2007-01-01

    Background Tumor necrosis factor (TNF) is a critical cytokine in the immune response whose transcriptional activation is controlled by a proximal promoter region that is highly conserved in mammals and, in particular, primates. Specific single nucleotide polymorphisms (SNPs) upstream of the proximal human TNF promoter have been identified, which are markers of human ancestry. Methodology/Principal findings Using a comparative genomics approach we show that certain fixed genetic differences in the TNF promoter serve as markers of primate speciation. We also demonstrate that distinct alleles of most human TNF promoter SNPs are identical to fixed nucleotides in primate TNF promoters. Furthermore, we identify fixed genetic differences within the proximal TNF promoters of Asian apes that do not occur in African ape or human TNF promoters. Strikingly, protein-DNA binding assays and gene reporter assays comparing these Asian ape TNF promoters to African ape and human TNF promoters demonstrate that, unlike the fixed differences that we define that are associated with primate phylogeny, these Asian ape-specific fixed differences impair transcription factor binding at an Sp1 site and decrease TNF transcription induced by bacterial stimulation of macrophages. Conclusions/significance Here, we have presented the broadest interspecies comparison of a regulatory region of an innate immune response gene to date. We have characterized nucleotide positions in Asian ape TNF promoters that underlie functional changes in cell type- and stimulus-specific activation of the TNF gene. We have also identified ancestral TNF promoter nucleotide states in the primate lineage that correspond to human SNP alleles. These findings may reflect evolution of Asian and African apes under a distinct set of infectious disease pressures involving the innate immune response and TNF. PMID:17637837

  16. A specific colorimetric assay for measuring transglutaminase 1 and factor XIII activities.

    PubMed

    Hitomi, Kiyotaka; Kitamura, Miyako; Alea, Mileidys Perez; Ceylan, Ismail; Thomas, Vincent; El Alaoui, Saïd

    2009-11-15

    Transglutaminase (TGase) is an enzyme that catalyzes both isopeptide cross-linking and incorporation of primary amines into proteins. Eight TGases have been identified in humans, and each of these TGases has a unique tissue distribution and physiological significance. Although several assays for TGase enzymatic activity have been reported, it has been difficult to establish an assay for discriminating each of these different TGase activities. Using a random peptide library, we recently identified the preferred substrate sequences for three major TGases: TGase 1, TGase 2, and factor XIII. In this study, we use these substrates in specific tests for measuring the activities of TGase 1 and factor XIII.

  17. Queen-specific volatile in a higher termite Nasutitermes takasagoensis (Isoptera: Termitidae).

    PubMed

    Himuro, Chihiro; Yokoi, Tomoyuki; Matsuura, Kenji

    2011-07-01

    In social insect colonies, queen-produced pheromones have important functions in social regulation. These substances influence the behavior and physiology of colony members. A queen-produced volatile that inhibits differentiation of new neotenic reproductives was recently identified in the lower termite Reticulitermes speratus. However, there are no known queen-specific volatiles of this type in any other termite species. Here, we report volatile compounds emitted by live queens of the higher termite Nasutitermes takasagoensis. We used headspace gas chromatography mass spectroscopy (HS GC-MS) to analyze volatiles emitted by live primary queens, workers, soldiers, alates, and eggs collected in a Japanese subtropical forest. Among 14 detected compounds, 7 were soldier-specific, 1 was alate-specific, 1 was egg-specific, and 1 was queen-specific. The queen-specific volatile was phenylethanol, which is different than the compound identified in R. speratus. The identification of this queen-specific volatile is the first step in determining its functions in higher termite social regulation. Comparisons of queen pheromone substances regulating caste differentiation among various termite taxa will contribute to a better understanding of the evolution of social systems in termites. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. A search for specificity in DNA-drug interactions.

    PubMed

    Cruciani, G; Goodford, P J

    1994-06-01

    The GRID force field and a principal component analysis have been used in order to predict the interactions of small chemical groups with all 64 different triplet sequences of B-DNA. Factors that favor binding to guanine-cytosine base pairs have been identified, and a dictionary of ligand groups and their locations is presented as a guide to the design of specific DNA ligands.

  19. Positional differences in the wound transcriptome of skin and oral mucosa

    PubMed Central

    2010-01-01

    Background When compared to skin, oral mucosal wounds heal rapidly and with reduced scar formation. Recent studies suggest that intrinsic differences in inflammation, growth factor production, levels of stem cells, and cellular proliferation capacity may underlie the exceptional healing that occurs in oral mucosa. The current study was designed to compare the transcriptomes of oral mucosal and skin wounds in order to identify critical differences in the healing response at these two sites using an unbiased approach. Results Using microarray analysis, we explored the differences in gene expression in skin and oral mucosal wound healing in a murine model of paired equivalent sized wounds. Samples were examined from days 0 to 10 and spanned all stages of the wound healing process. Using unwounded matched tissue as a control, filtering identified 1,479 probe sets in skin wounds yet only 502 probe sets in mucosal wounds that were significantly differentially expressed over time. Clusters of genes that showed similar patterns of expression were also identified in each wound type. Analysis of functionally related gene expression demonstrated dramatically different reactions to injury between skin and mucosal wounds. To explore whether site-specific differences might be derived from intrinsic differences in cellular responses at each site, we compared the response of isolated epithelial cells from skin and oral mucosa to a defined in vitro stimulus. When cytokine levels were measured, epithelial cells from skin produced significantly higher amounts of proinflammatory cytokines than cells from oral mucosa. Conclusions The results provide the first detailed molecular profile of the site-specific differences in the genetic response to injury in mucosa and skin, and suggest the divergent reactions to injury may derive from intrinsic differences in the cellular responses at each site. PMID:20704739

  20. Positional differences in the wound transcriptome of skin and oral mucosa.

    PubMed

    Chen, Lin; Arbieva, Zarema H; Guo, Shujuan; Marucha, Phillip T; Mustoe, Thomas A; DiPietro, Luisa A

    2010-08-12

    When compared to skin, oral mucosal wounds heal rapidly and with reduced scar formation. Recent studies suggest that intrinsic differences in inflammation, growth factor production, levels of stem cells, and cellular proliferation capacity may underlie the exceptional healing that occurs in oral mucosa. The current study was designed to compare the transcriptomes of oral mucosal and skin wounds in order to identify critical differences in the healing response at these two sites using an unbiased approach. Using microarray analysis, we explored the differences in gene expression in skin and oral mucosal wound healing in a murine model of paired equivalent sized wounds. Samples were examined from days 0 to 10 and spanned all stages of the wound healing process. Using unwounded matched tissue as a control, filtering identified 1,479 probe sets in skin wounds yet only 502 probe sets in mucosal wounds that were significantly differentially expressed over time. Clusters of genes that showed similar patterns of expression were also identified in each wound type. Analysis of functionally related gene expression demonstrated dramatically different reactions to injury between skin and mucosal wounds. To explore whether site-specific differences might be derived from intrinsic differences in cellular responses at each site, we compared the response of isolated epithelial cells from skin and oral mucosa to a defined in vitro stimulus. When cytokine levels were measured, epithelial cells from skin produced significantly higher amounts of proinflammatory cytokines than cells from oral mucosa. The results provide the first detailed molecular profile of the site-specific differences in the genetic response to injury in mucosa and skin, and suggest the divergent reactions to injury may derive from intrinsic differences in the cellular responses at each site.

  1. Stroke and myocardial infarction: a comparative systematic evaluation of gender-specific analysis, funding and authorship patterns in cardiovascular research.

    PubMed

    Oertelt-Prigione, Sabine; Wiedmann, Silke; Endres, Matthias; Nolte, Christian H; Regitz-Zagrosek, Vera; Heuschmann, Peter

    2011-01-01

    Major gender differences exist in cardiovascular diseases and lead to different outcomes in women and men. However, attention and incorporation of sex-/gender-specific research might vary among disciplines. We therefore conducted a systematic review comparing publication characteristics and trends between stroke and myocardial infarction (MI) with respect to sex- and gender-related aspects. A systematic literature search was performed in PubMed to identify gender-/sex-related articles published for stroke and MI between 1977 and 2008. A specifically designed text mining program was used, and all literature was rated by two independent investigators. Publications were classified according to type of research performed, publication year, funding, geographical location, and gender of first and last authors. 962 articles were retrieved and limited to 405 (42%) gender-relevant publications; 131 on stroke and 274 on MI. Type of performed research differed, especially in disease management, which received little attention (17%) in stroke, while representing the major focus in MI (40%). In both areas, clinical presentation received little attention (3 and 5%). Although publications progressively increased in both fields, an 8- to 10-year time gap emerged for stroke compared to MI. Last authors in both areas were predominantly men, but female last authorship is increasing more significantly over time in the field of stroke. Research on sex and gender differences in MI and stroke is largely underfunded, particularly by the EU. The data demonstrate how sex-/gender-specific research differs between specialties, most likely due to the diverse interest, funding opportunities and authorship distributions identified. Copyright © 2011 S. Karger AG, Basel.

  2. Comparability of outcome frameworks in medical education: Implications for framework development.

    PubMed

    Hautz, Stefanie C; Hautz, Wolf E; Feufel, Markus A; Spies, Claudia D

    2015-01-01

    Given the increasing mobility of medical students and practitioners, there is a growing need for harmonization of medical education and qualifications. Although several initiatives have sought to compare national outcome frameworks, this task has proven a challenge. Drawing on an analysis of existing outcome frameworks, we identify factors that hinder comparability and suggest ways of facilitating comparability during framework development and revisions. We searched MedLine, EmBase and the Internet for outcome frameworks in medical education published by national or governmental organizations. We analyzed these frameworks for differences and similarities that influence comparability. Of 1816 search results, 13 outcome frameworks met our inclusion criteria. These frameworks differ in five core features: history and origins, formal structure, medical education system, target audience and key terms. Many frameworks reference other frameworks without acknowledging these differences. Importantly, the level of detail of the outcomes specified differs both within and between frameworks. The differences identified explain some of the challenges involved in comparing outcome frameworks and medical qualifications. We propose a two-level model distinguishing between "core" competencies and culture-specific "secondary" competencies. This approach could strike a balance between local specifics and cross-national comparability of outcome frameworks and medical education.

  3. Molecular identification of nematode larvae different from those of the Trichinella genus detected by muscle digestion.

    PubMed

    Marucci, Gianluca; Interisano, Maria; La Rosa, Giuseppe; Pozio, Edoardo

    2013-05-20

    Although larvae of the genus Trichinella are the most common parasite species detected in vertebrate muscles using artificial digestion, nematode larvae belonging to other genera are sometimes detected and incorrectly identified as Trichinella. However, it is often very difficult to identify these larvae at the species, genus or family level using microscopy because of the absence of specific morphological characters or cuticle damage, and the only means of identification is PCR and sequencing of specific molecular markers (12S mtDNA; COI; 18S rDNA; and ITS1). From 2008 to 2011, 18 nematode isolates not belonging to the genus Trichinella were collected from different host species. Eleven of these isolates were successfully identified at the species, genus or superfamily level: larvae from two common kestrels, three hooded crows, a hen harrier and a domestic pig were identified as Toxocara cati; larvae from a badger were identified as Toxocara canis; larvae from a domestic pig were identified as a free-living nematode of the genus Panagrolaimus; larvae from a wild boar were identified as belonging to the Metastrongylus genus; and larvae from a rough-legged buzzard were identified as belonging to the superfamily Filarioidea. The recovery of nematodes belonging to genera other than Trichinella during routine meat inspection suggests that the persons performing the analyses need to be informed of the possibility of false positives and that a molecular-based identification system that allows for a rapid and reliable response must be adopted (i.e., a DNA barcoding-like system). Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Differences in X-chromosome transcriptional activity and cholesterol metabolism between placentae from swine breeds from Asian and Western origins.

    PubMed

    Bischoff, Steve R; Tsai, Shengdar Q; Hardison, Nicholas E; Motsinger-Reif, Alison A; Freking, Bradley A; Nonneman, Dan J; Rohrer, Gary A; Piedrahita, Jorge A

    2013-01-01

    To gain insight into differences in placental physiology between two swine breeds noted for their dissimilar reproductive performance, that is, the Chinese Meishan and white composite (WC), we examined gene expression profiles of placental tissues collected at 25, 45, 65, 85, and 105 days of gestation by microarrays. Using a linear mixed model, a total of 1,595 differentially expressed genes were identified between the two pig breeds using a false-discovery rate q-value ≤0.05. Among these genes, we identified breed-specific isoforms of XIST, a long non-coding RNA responsible X-chromosome dosage compensation in females. Additionally, we explored the interaction of placental gene expression and chromosomal location by DIGMAP and identified three Sus scrofa X chromosomal bands (Xq13, Xq21, Xp11) that represent transcriptionally active clusters that differ between Meishan and WC during placental development. Also, pathway analysis identified fundamental breed differences in placental cholesterol trafficking and its synthesis. Direct measurement of cholesterol confirmed that the cholesterol content was significantly higher in the Meishan versus WC placentae. Taken together, this work identifies key metabolic pathways that differ in the placentae of two swine breeds noted for differences in reproductive prolificacy.

  5. RBFOX2 Is an Important Regulator of Mesenchymal Tissue-Specific Splicing in both Normal and Cancer Tissues

    PubMed Central

    Venables, Julian P.; Brosseau, Jean-Philippe; Gadea, Gilles; Klinck, Roscoe; Prinos, Panagiotis; Beaulieu, Jean-François; Lapointe, Elvy; Durand, Mathieu; Thibault, Philippe; Tremblay, Karine; Rousset, François; Tazi, Jamal; Abou Elela, Sherif

    2013-01-01

    Alternative splicing provides a critical and flexible layer of regulation intervening in many biological processes to regulate the diversity of proteins and impact cell phenotype. To identify alternative splicing differences that distinguish epithelial from mesenchymal tissues, we have investigated hundreds of cassette exons using a high-throughput reverse transcription-PCR (RT-PCR) platform. Extensive changes in splicing were noted between epithelial and mesenchymal tissues in both human colon and ovarian tissues, with many changes from mostly one splice variant to predominantly the other. Remarkably, many of the splicing differences that distinguish normal mesenchymal from normal epithelial tissues matched those that differentiate normal ovarian tissues from ovarian cancer. Furthermore, because splicing profiling could classify cancer cell lines according to their epithelial/mesenchymal characteristics, we used these cancer cell lines to identify regulators for these specific splicing signatures. By knocking down 78 potential splicing factors in five cell lines, we provide an extensive view of the complex regulatory landscape associated with the epithelial and mesenchymal states, thus revealing that RBFOX2 is an important driver of mesenchymal tissue-specific splicing. PMID:23149937

  6. User interfaces for computational science: A domain specific language for OOMMF embedded in Python

    NASA Astrophysics Data System (ADS)

    Beg, Marijan; Pepper, Ryan A.; Fangohr, Hans

    2017-05-01

    Computer simulations are used widely across the engineering and science disciplines, including in the research and development of magnetic devices using computational micromagnetics. In this work, we identify and review different approaches to configuring simulation runs: (i) the re-compilation of source code, (ii) the use of configuration files, (iii) the graphical user interface, and (iv) embedding the simulation specification in an existing programming language to express the computational problem. We identify the advantages and disadvantages of different approaches and discuss their implications on effectiveness and reproducibility of computational studies and results. Following on from this, we design and describe a domain specific language for micromagnetics that is embedded in the Python language, and allows users to define the micromagnetic simulations they want to carry out in a flexible way. We have implemented this micromagnetic simulation description language together with a computational backend that executes the simulation task using the Object Oriented MicroMagnetic Framework (OOMMF). We illustrate the use of this Python interface for OOMMF by solving the micromagnetic standard problem 4. All the code is publicly available and is open source.

  7. A cultural accommodation model for cross-cultural psychotherapy: Illustrated with the case of Asian Americans.

    PubMed

    Leong, Frederick T; Lee, Szu-Hui

    2006-01-01

    As an extension of F. T. L. Leong's (1996) integrative model, this article presents the cultural accommodation model (CAM), an enhanced theoretical guide to effective cross-cultural clinical practice and research. Whereas F. T. L. Leong's model identifies the importance of integrating the universal, group, and individual dimensions, the CAM takes the next step by providing a theoretical guide to effective psychotherapy with culturally different clients by means of a cultural accommodation process. This model argues for the importance of selecting and applying culture-specific constructs when working with culturally diverse groups. The first step of the CAM is to identify cultural disparities that are often ignored and then accommodate them by using current culturally specific concepts. In this article, several different cultural "gaps" or culture-specific constructs of relevance to Asian Americans with strong scientific foundations are selected and discussed as they pertain to providing effective psychotherapy to this ethnic minority group. Finally, a case study is incorporated to illustrate application of the CAM. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  8. Sociodemographic and Psychiatric Diagnostic Predictors of 3-Year Incidence of DSM-IV Substance Use Disorders among Men and Women in the National Epidemiologic Survey on Alcohol and Related Conditions

    PubMed Central

    Goldstein, Risë B.; Smith, Sharon M.; Dawson, Deborah A.; Grant, Bridget F.

    2016-01-01

    Incidence rates of alcohol and drug use disorders (AUDs and DUDs) are consistently higher in men than women, but information on whether sociodemographic and psychiatric diagnostic predictors of AUD and DUD incidence differ by sex is limited. Using data from Waves 1 and 2 of the National Epidemiologic Survey on Alcohol and Related Conditions, sex-specific 3-year incidence rates of AUDs and DUDs among United States adults were compared by sociodemographic variables and baseline psychiatric disorders. Sex-specific logistic regression models estimated odds ratios for prediction of incident AUDs and DUDs, adjusting for potentially confounding baseline sociodemographic and diagnostic variables. Few statistically significant sex differences in predictive relationships were identified and those observed were generally modest. Prospective research is needed to identify predictors of incident DSM-5 AUDs and DUDs and their underlying mechanisms, including whether there is sex specificity by developmental phase, in the role of additional comorbidity in etiology and course, and in outcomes of prevention and treatment. PMID:26727008

  9. Using genome wide association studies to identify common QTL regions in three different genetic backgrounds based on Iberian pig breed

    PubMed Central

    Martínez-Montes, Ángel M.; Fernández, Almudena; Muñoz, María; Noguera, Jose Luis; Folch, Josep M.

    2018-01-01

    One of the major limitation for the application of QTL results in pig breeding and QTN identification has been the limited number of QTL effects validated in different animal material. The aim of the current work was to validate QTL regions through joint and specific genome wide association and haplotype analyses for growth, fatness and premier cut weights in three different genetic backgrounds, backcrosses based on Iberian pigs, which has a major role in the analysis due to its high productive relevance. The results revealed nine common QTL regions, three segregating in all three backcrosses on SSC1, 0–3 Mb, for body weight, on SSC2, 3–9 Mb, for loin bone-in weight, and on SSC7, 3 Mb, for shoulder weight, and six segregating in two of the three backcrosses, on SSC2, SSC4, SSC6 and SSC10 for backfat thickness, shoulder and ham weights. Besides, 18 QTL regions were specifically identified in one of the three backcrosses, five identified only in BC_LD, seven in BC_DU and six in BC_PI. Beyond identifying and validating QTL, candidate genes and gene variants within the most interesting regions have been explored using functional annotation, gene expression data and SNP identification from RNA-Seq data. The results allowed us to propose a promising list of candidate mutations, those identified in PDE10A, DHCR7, MFN2 and CCNY genes located within the common QTL regions and those identified near ssc-mir-103-1 considered PANK3 regulators to be further analysed. PMID:29522525

  10. A systematic literature review of diabetes self-management education features to improve diabetes education in women of Black African/Caribbean and Hispanic/Latin American ethnicity.

    PubMed

    Gucciardi, Enza; Chan, Vivian Wing-Sheung; Manuel, Lisa; Sidani, Souraya

    2013-08-01

    This systematic literature review aims to identify diabetes self-management education (DSME) features to improve diabetes education for Black African/Caribbean and Hispanic/Latin American women with Type 2 diabetes mellitus. We conducted a literature search in six health databases for randomized controlled trials and comparative studies. Success rates of intervention features were calculated based on effectiveness in improving glycosolated hemoglobin (HbA1c), anthropometrics, physical activity, or diet outcomes. Calculations of rate differences assessed whether an intervention feature positively or negatively affected an outcome. From 13 studies included in our analysis, we identified 38 intervention features in relation to their success with an outcome. Five intervention features had positive rate differences across at least three outcomes: hospital-based interventions, group interventions, the use of situational problem-solving, frequent sessions, and incorporating dietitians as interventionists. Six intervention features had high positive rate differences (i.e. ≥50%) on specific outcomes. Different DSME intervention features may influence broad and specific self-management outcomes for women of African/Caribbean and Hispanic/Latin ethnicity. With the emphasis on patient-centered care, patients and care providers can consider options based on DSME intervention features for its broad and specific impact on outcomes to potentially make programming more effective. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  11. Towards a scientific interpretation of the terroir concept: plasticity of the grape berry metabolome.

    PubMed

    Anesi, Andrea; Stocchero, Matteo; Dal Santo, Silvia; Commisso, Mauro; Zenoni, Sara; Ceoldo, Stefania; Tornielli, Giovanni Battista; Siebert, Tracey E; Herderich, Markus; Pezzotti, Mario; Guzzo, Flavia

    2015-08-07

    The definition of the terroir concept is one of the most debated issues in oenology and viticulture. The dynamic interaction among diverse factors including the environment, the grapevine plant and the imposed viticultural techniques means that the wine produced in a given terroir is unique. However, there is an increasing interest to define and quantify the contribution of individual factors to a specific terroir objectively. Here, we characterized the metabolome and transcriptome of berries from a single clone of the Corvina variety cultivated in seven different vineyards, located in three macrozones, over a 3-year trial period. To overcome the anticipated strong vintage effect, we developed statistical tools that allowed us to identify distinct terroir signatures in the metabolic composition of berries from each macrozone, and from different vineyards within each macrozone. We also identified non-volatile and volatile components of the metabolome which are more plastic and therefore respond differently to terroir diversity. We observed some relationships between the plasticity of the metabolome and transcriptome, allowing a multifaceted scientific interpretation of the terroir concept. Our experiments with a single Corvina clone in different vineyards have revealed the existence of a clear terroir-specific effect on the transcriptome and metabolome which persists over several vintages and allows each vineyard to be characterized by the unique profile of specific metabolites.

  12. Efficient elimination of nonstoichiometric enzyme inhibitors from HTS hit lists.

    PubMed

    Habig, Michael; Blechschmidt, Anke; Dressler, Sigmar; Hess, Barbara; Patel, Viral; Billich, Andreas; Ostermeier, Christian; Beer, David; Klumpp, Martin

    2009-07-01

    High-throughput screening often identifies not only specific, stoichiometrically binding inhibitors but also undesired compounds that unspecifically interfere with the targeted activity by nonstoichiometrically binding, unfolding, and/or inactivating proteins. In this study, the effect of such unwanted inhibitors on several different enzyme targets was assessed based on screening results for over a million compounds. In particular, the shift in potency on variation of enzyme concentration was used as a means to identify nonstoichiometric inhibitors among the screening hits. These potency shifts depended on both compound structure and target enzyme. The approach was confirmed by statistical analysis of thousands of dose-response curves, which showed that the potency of competitive and therefore clearly stoichiometric inhibitors was not affected by increasing enzyme concentration. Light-scattering measurements of thermal protein unfolding further verified that compounds that stabilize protein structure by stoichiometric binding show the same potency irrespective of enzyme concentration. In summary, measuring inhibitor IC(50) values at different enzyme concentrations is a simple, cost-effective, and reliable method to identify and eliminate compounds that inhibit a specific target enzyme via nonstoichiometric mechanisms.

  13. Multivariate Protein Signatures of Pre-Clinical Alzheimer's Disease in the Alzheimer's Disease Neuroimaging Initiative (ADNI) Plasma Proteome Dataset

    PubMed Central

    Johnstone, Daniel; Milward, Elizabeth A.; Berretta, Regina; Moscato, Pablo

    2012-01-01

    Background Recent Alzheimer's disease (AD) research has focused on finding biomarkers to identify disease at the pre-clinical stage of mild cognitive impairment (MCI), allowing treatment to be initiated before irreversible damage occurs. Many studies have examined brain imaging or cerebrospinal fluid but there is also growing interest in blood biomarkers. The Alzheimer's Disease Neuroimaging Initiative (ADNI) has generated data on 190 plasma analytes in 566 individuals with MCI, AD or normal cognition. We conducted independent analyses of this dataset to identify plasma protein signatures predicting pre-clinical AD. Methods and Findings We focused on identifying signatures that discriminate cognitively normal controls (n = 54) from individuals with MCI who subsequently progress to AD (n = 163). Based on p value, apolipoprotein E (APOE) showed the strongest difference between these groups (p = 2.3×10−13). We applied a multivariate approach based on combinatorial optimization ((α,β)-k Feature Set Selection), which retains information about individual participants and maintains the context of interrelationships between different analytes, to identify the optimal set of analytes (signature) to discriminate these two groups. We identified 11-analyte signatures achieving values of sensitivity and specificity between 65% and 86% for both MCI and AD groups, depending on whether APOE was included and other factors. Classification accuracy was improved by considering “meta-features,” representing the difference in relative abundance of two analytes, with an 8-meta-feature signature consistently achieving sensitivity and specificity both over 85%. Generating signatures based on longitudinal rather than cross-sectional data further improved classification accuracy, returning sensitivities and specificities of approximately 90%. Conclusions Applying these novel analysis approaches to the powerful and well-characterized ADNI dataset has identified sets of plasma biomarkers for pre-clinical AD. While studies of independent test sets are required to validate the signatures, these analyses provide a starting point for developing a cost-effective and minimally invasive test capable of diagnosing AD in its pre-clinical stages. PMID:22485168

  14. Autism and Overcoming Job Barriers: Comparing Job-Related Barriers and Possible Solutions in and outside of Autism-Specific Employment

    PubMed Central

    Lorenz, Timo; Frischling, Cora; Cuadros, Raphael; Heinitz, Kathrin

    2016-01-01

    The aim of this study was to discover how individuals with autism succeed in entering the job market. We therefore sought to identify expected and occurred barriers, keeping them from taking up and staying in employment as well as to identify the solutions used to overcome these barriers. Sixty-six employed individuals with autism–17 of them with autism-specific employment–participated in an online survey. Results showed a variety of possible barriers. Individuals in autism-specific employment named formality problems–problems with organizational and practical process-related aspects of the job entry–most frequently while individuals in non-autism-specific employment mentioned social problems–obstacles concerning communication and human interaction–most. In terms of solutions, both groups used their own resources as much as external help, but differed in their specific strategies. In addition, correlations of an autism-specific employment with general and occupational self-efficacy as well as life and job satisfaction were examined. Possible implications of the results are discussed with regard to problem solving behavior and the use of strengths. PMID:26766183

  15. Genes, Environments, and Sex Differences in Alcohol Research.

    PubMed

    Salvatore, Jessica E; Cho, Seung Bin; Dick, Danielle M

    2017-07-01

    The study of sex differences has been identified as one way to enhance scientific reproducibility, and the National Institutes of Health (NIH) have implemented a new policy to encourage the explicit examination of sex differences. Our goal here is to address sex differences in behavioral genetic research on alcohol outcomes. We review sex differences for alcohol outcomes and whether the source and magnitude of genetic influences on alcohol consumption and alcohol use disorder (AUD) are the same across sexes; describe common research designs for studying sex-specific gene-by-environment interaction (G × E) effects; and discuss the role of statistical power and theory when testing sex-specific genetic effects. There are robust sex differences for many alcohol outcomes. The weight of evidence suggests that the source and magnitude of genetic influences on alcohol consumption and AUD are the same across sexes. Whether there are sex-specific G × E effects has received less attention to date. The new NIH policy necessitates a systematic approach for studying sex-specific genetic effects in alcohol research. Researchers are encouraged to report power for tests of these effects and to use theory to develop testable hypotheses, especially for studies of G × E.

  16. Regional patterns of total nitrogen concentrations in the National Rivers and Streams Assessment

    USGS Publications Warehouse

    Omernik, James M.; Paulsen, Steven G.; Griffith, Glenn E.; Weber, Marc H.

    2016-01-01

    Patterns of nitrogen (N) concentrations in streams sampled by the National Rivers and Streams Assessment (NRSA) were examined semiquantitatively to identify regional differences in stream N levels. The data were categorized and analyzed by watershed size classes to reveal patterns of the concentrations that are consistent with the spatial homogeneity in natural and anthropogenic characteristics associated with regional differences in N levels. Ecoregions and mapped information on human activities including agricultural practices were used to determine the resultant regions. Marked differences in N levels were found among the nine aggregations of ecoregions used to report the results of the NRSA. We identified distinct regional patterns of stream N concentrations within the reporting regions that are associated with the characteristics of specific Level III ecoregions, groups of Level III ecoregions, groups of Level IV ecoregions, certain geographic characteristics within ecoregions, and/or particular watershed size classes. We described each of these regions and illustrated their areal extent and median and range in N concentrations. Understanding the spatial variability of nutrient concentrations in flowing waters and the apparent contributions that human and nonhuman factors have on different sizes of streams and rivers is critical to the development of effective water quality assessment and management plans. This semi-quantitative analysis is also intended to identify areas within which more detailed quantitative work can be conducted to determine specific regional factors associated with variations in stream N concentrations.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sardi, Maria; Rovinskiy, Nikolay; Zhang, Yaoping

    We report a major obstacle to sustainable lignocellulosic biofuel production is microbe inhibition by the combinatorial stresses in pretreated plant hydrolysate. Chemical biomass pretreatment releases a suite of toxins that interact with other stressors, including high osmolarity and temperature, which together can have poorly understood synergistic effects on cells. Improving tolerance in industrial strains has been hindered, in part because the mechanisms of tolerance reported in the literature often fail to recapitulate in other strain backgrounds. Here, we explored and then exploited variations in stress tolerance, toxin-induced transcriptomic responses, and fitness effects of gene overexpression in different Saccharomyces cerevisiae (yeast)more » strains to identify genes and processes linked to tolerance of hydrolysate stressors. Using six different S. cerevisiae strains that together maximized phenotypic and genetic diversity, first we explored transcriptomic differences between resistant and sensitive strains to identify common and strain-specific responses. This comparative analysis implicated primary cellular targets of hydrolysate toxins, secondary effects of defective defense strategies, and mechanisms of tolerance. Dissecting the responses to individual hydrolysate components across strains pointed to synergistic interactions between osmolarity, pH, hydrolysate toxins, and nutrient composition. By characterizing the effects of high-copy gene overexpression in three different strains, we revealed the breadth of the background-specific effects of gene fitness contributions in synthetic hydrolysate. Lastly, our approach identified new genes for engineering improved stress tolerance in diverse strains while illuminating the effects of genetic background on molecular mechanisms.« less

  18. Quantitative proteomic analysis reveals evolutionary divergence and species-specific peptides in the Alexandrium tamarense complex (Dinophyceae).

    PubMed

    Li, Cheng; Zhang, Yong; Xie, Zhang-Xian; He, Zhi-Ping; Lin, Lin; Wang, Da-Zhi

    2013-06-28

    The Alexandrium tamarense/catenella/fundyense complex is the major causative agent responsible for harmful algal blooms and paralytic shellfish poisoning around the world. However, taxonomy of the A. tamarense complex is contentious and the evolutionary relationships within the complex are unclear. This study compared protein profiles of the A. tamarense complex collected from different geographic regions using the two dimensional fluorescence difference gel electrophoresis (2-D DIGE) approach, and identified species-specific peptides using MALDI-TOF/TOF mass spectrometry. The results showed that three Alexandrium morphotypes presented significantly different protein expression patterns with about 30-40% shared proteins. However, ecotypes from different geographic regions within a species exhibited the same expression patterns, although a few proteins were altered in abundance. Several proteins, i.e. ribulose-1,5-bisphosphate carboxylase oxygenase form II, plastid protein NAP50, methionine S-adenosyltransferase, and peridinin-chlorophyll a-binding protein, were identified and presented different shift patterns in isoelectric point and/or molecular weight in the 2-D DIGE gels, indicating that amino acid mutation and/or posttranslational modification of these proteins had occurred. The species-specific peptide mass fingerprint and amino acid sequence of ribulose-1,5-bisphosphate carboxylase oxygenase were characterized in the A. tamarense complex, and amino acid substitution occurred among them. This study indicated that evolutionary divergence had occurred at the proteomic level in the A. tamarense complex, and that the species-specific peptides could be used as potential biomarkers to distinguish the three morphotypes. Scientific question: The Alexandrium tamarense/catenella/fundyense complex is the major causative agent responsible for harmful algal blooms and paralytic shellfish poisoning around the world. However, taxonomy of the A. tamarense complex is contentious and the evolutionary relationships within the complex are unclear, which has seriously impeded our understanding of Alexandrium-causing HABs and, consequently, the monitoring, mitigation and prevention. Technical significance: This study, for the first time, compared the global protein expression patterns of eight ecotypes from the A. tamarense complex and identified species-specific peptides using a quantitative proteomic approach combining 2-D DIGE and MALDI-TOF/TOF MS. This study demonstrated that the evolutionary divergence had occurred in the A. tamarense complex at the proteomic level, and the complex should be classified into three species, i.e. A. tamarense, A. catenella, and A. fundyense. Moreover, the species-specific peptide mass fingerprints could be used as potential biomarkers to distinguish the three morphotypes. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Identification of specific metabolites in culture supernatant of Mycobacterium tuberculosis using metabolomics: exploration of potential biomarkers

    PubMed Central

    Lau, Susanna KP; Lam, Ching-Wan; Curreem, Shirly OT; Lee, Kim-Chung; Lau, Candy CY; Chow, Wang-Ngai; Ngan, Antonio HY; To, Kelvin KW; Chan, Jasper FW; Hung, Ivan FN; Yam, Wing-Cheong; Yuen, Kwok-Yung; Woo, Patrick CY

    2015-01-01

    Although previous studies have reported the use of metabolomics for Mycobacterium species differentiation, little is known about the potential of extracellular metabolites of Mycobacterium tuberculosis (MTB) as specific biomarkers. Using an optimized ultrahigh performance liquid chromatography–electrospray ionization–quadruple time of flight–mass spectrometry (UHPLC–ESI–Q–TOF–MS) platform, we characterized the extracellular metabolomes of culture supernatant of nine MTB strains and nine non-tuberculous Mycobacterium (NTM) strains (four M. avium complex, one M. bovis Bacillus Calmette–Guérin (BCG), one M. chelonae, one M. fortuitum and two M. kansasii). Principal component analysis readily distinguished the metabolomes between MTB and NTM. Using multivariate and univariate analysis, 24 metabolites with significantly higher levels in MTB were identified. While seven metabolites were identified by tandem mass spectrometry (MS/MS), the other 17 metabolites were unidentified by MS/MS against database matching, suggesting that they may be potentially novel compounds. One metabolite was identified as dexpanthenol, the alcohol analog of pantothenic acid (vitamin B5), which was not known to be produced by bacteria previously. Four metabolites were identified as 1-tuberculosinyladenosine (1-TbAd), a product of the virulence-associated enzyme Rv3378c, and three previously undescribed derivatives of 1-TbAd. Two derivatives differ from 1-TbAd by the ribose group of the nucleoside while the other likely differs by the base. The remaining two metabolites were identified as a tetrapeptide, Val-His-Glu-His, and a monoacylglycerophosphoglycerol, phosphatidylglycerol (PG) (16∶0/0∶0), respectively. Further studies on the chemical structure and biosynthetic pathway of these MTB-specific metabolites would help understand their biological functions. Studies on clinical samples from tuberculosis patients are required to explore for their potential role as diagnostic biomarkers. PMID:26038762

  20. Regional differences in mitochondrial DNA methylation in human post-mortem brain tissue.

    PubMed

    Devall, Matthew; Smith, Rebecca G; Jeffries, Aaron; Hannon, Eilis; Davies, Matthew N; Schalkwyk, Leonard; Mill, Jonathan; Weedon, Michael; Lunnon, Katie

    2017-01-01

    DNA methylation is an important epigenetic mechanism involved in gene regulation, with alterations in DNA methylation in the nuclear genome being linked to numerous complex diseases. Mitochondrial DNA methylation is a phenomenon that is receiving ever-increasing interest, particularly in diseases characterized by mitochondrial dysfunction; however, most studies have been limited to the investigation of specific target regions. Analyses spanning the entire mitochondrial genome have been limited, potentially due to the amount of input DNA required. Further, mitochondrial genetic studies have been previously confounded by nuclear-mitochondrial pseudogenes. Methylated DNA Immunoprecipitation Sequencing is a technique widely used to profile DNA methylation across the nuclear genome; however, reads mapped to mitochondrial DNA are often discarded. Here, we have developed an approach to control for nuclear-mitochondrial pseudogenes within Methylated DNA Immunoprecipitation Sequencing data. We highlight the utility of this approach in identifying differences in mitochondrial DNA methylation across regions of the human brain and pre-mortem blood. We were able to correlate mitochondrial DNA methylation patterns between the cortex, cerebellum and blood. We identified 74 nominally significant differentially methylated regions ( p  < 0.05) in the mitochondrial genome, between anatomically separate cortical regions and the cerebellum in matched samples ( N  = 3 matched donors). Further analysis identified eight significant differentially methylated regions between the total cortex and cerebellum after correcting for multiple testing. Using unsupervised hierarchical clustering analysis of the mitochondrial DNA methylome, we were able to identify tissue-specific patterns of mitochondrial DNA methylation between blood, cerebellum and cortex. Our study represents a comprehensive analysis of the mitochondrial methylome using pre-existing Methylated DNA Immunoprecipitation Sequencing data to identify brain region-specific patterns of mitochondrial DNA methylation.

  1. Microbial communities in carbonate rocks-from soil via groundwater to rocks.

    PubMed

    Meier, Aileen; Singh, Manu K; Kastner, Anne; Merten, Dirk; Büchel, Georg; Kothe, Erika

    2017-09-01

    Microbial communities in soil, groundwater, and rock of two sites in limestone were investigated to determine community parameters differentiating habitats in two lithostratigraphic untis. Lower Muschelkalk and Middle Muschelkalk associated soils, groundwater, and rock samples showed different, but overlapping microbial communities linked to carbon fluxes. The microbial diversities in soil were highest, groundwater revealed overlapping taxa but lower diversity, and rock samples were predominantly characterized by endospore forming bacteria and few archaea. Physiological profiles could establish a differentiation between habitats (soil, groundwater, rock). From community analyses and physiological profiles, different element cycles in limestone could be identified for the three habitats. While in soil, nitrogen cycling was identified as specific determinant, in rock methanogenesis linked carbonate rock to atmospheric methane cycles. These patterns specifically allowed for delineation of lithostratigraphic connections to physiological parameters. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Parent Prevention Communication Profiles and Adolescent Substance Use: A Latent Profile Analysis and Growth Curve Model

    PubMed Central

    Choi, Hye Jeong; Miller-Day, Michelle; Shin, YoungJu; Hecht, Michael L.; Pettigrew, Jonathan; Krieger, Janice L.; Lee, JeongKyu; Graham, John W.

    2017-01-01

    This current study identifies distinct parent prevention communication profiles and examines whether youth with different parental communication profiles have varying substance use trajectories over time. Eleven schools in two rural school districts in the Midwestern United States were selected, and 784 students were surveyed at three time points from the beginning of 7th grade to the end of 8th grade. A series of latent profile analyses were performed to identify discrete profiles/subgroups of substance-specific prevention communication (SSPC). The results revealed a 4-profile model of SSPC: Active-Open, Passive-Open, Active-Silent, and Passive-Silent. A growth curve model revealed different rates of lifetime substance use depending on the youth’s SSPC profile. These findings have implications for parenting interventions and tailoring messages for parents to fit specific SSPC profiles. PMID:29056872

  3. Sex differences in prenatal epigenetic programming of stress pathways.

    PubMed

    Bale, Tracy L

    2011-07-01

    Maternal stress experience is associated with neurodevelopmental disorders including schizophrenia and autism. Recent studies have examined mechanisms by which changes in the maternal milieu may be transmitted to the developing embryo and potentially translated into programming of the epigenome. Animal models of prenatal stress have identified important sex- and temporal-specific effects on offspring stress responsivity. As dysregulation of stress pathways is a common feature in most neuropsychiatric diseases, molecular and epigenetic analyses at the maternal-embryo interface, especially in the placenta, may provide unique insight into identifying much-needed predictive biomarkers. In addition, as most neurodevelopmental disorders present with a sex bias, examination of sex differences in the inheritance of phenotypic outcomes may pinpoint gene targets and specific windows of vulnerability in neurodevelopment, which have been disrupted. This review discusses the association and possible contributing mechanisms of prenatal stress in programming offspring stress pathway dysregulation and the importance of sex.

  4. Fusion of spectral and panchromatic images using false color mapping and wavelet integrated approach

    NASA Astrophysics Data System (ADS)

    Zhao, Yongqiang; Pan, Quan; Zhang, Hongcai

    2006-01-01

    With the development of sensory technology, new image sensors have been introduced that provide a greater range of information to users. But as the power limitation of radiation, there will always be some trade-off between spatial and spectral resolution in the image captured by specific sensors. Images with high spatial resolution can locate objects with high accuracy, whereas images with high spectral resolution can be used to identify the materials. Many applications in remote sensing require fusing low-resolution imaging spectral images with panchromatic images to identify materials at high resolution in clutter. A pixel-based false color mapping and wavelet transform integrated fusion algorithm is presented in this paper, the resulting images have a higher information content than each of the original images and retain sensor-specific image information. The simulation results show that this algorithm can enhance the visibility of certain details and preserve the difference of different materials.

  5. Can Physicians Identify Inappropriate Nuclear Stress Tests? An Examination of Inter-rater Reliability for the 2009 Appropriate Use Criteria for Radionuclide Imaging

    PubMed Central

    Ye, Siqin; Rabbani, LeRoy E.; Kelly, Christopher R.; Kelly, Maureen R.; Lewis, Matthew; Paz, Yehuda; Peck, Clara L.; Rao, Shaline; Bokhari, Sabahat; Weiner, Shepard D.; Einstein, Andrew J.

    2014-01-01

    Background We sought to determine inter-rater reliability of the 2009 Appropriate Use Criteria (AUC) for radionuclide imaging (RNI) and whether physicians at various levels of training can effectively identify nuclear stress tests with inappropriate indications. Methods and Results Four hundred patients were randomly selected from a consecutive cohort of patients undergoing nuclear stress testing at an academic medical center. Raters with different levels of training (including cardiology attending physicians, cardiology fellows, internal medicine hospitalists, and internal medicine interns) classified individual nuclear stress tests using the 2009 AUC. Consensus classification by two cardiologists was considered the operational gold standard, and sensitivity and specificity of individual raters for identifying inappropriate tests was calculated. Inter-rater reliability of the AUC was assessed using Cohen’s kappa statistics for pairs of different raters. The mean age of patients was 61.5 years; 214 (54%) were female. The cardiologists rated 256 (64%) of 400 NSTs as appropriate, 68 (18%) as uncertain, 55 (14%) as inappropriate; 21 (5%) tests were unable to be classified. Inter-rater reliability for non-cardiologist raters was modest (unweighted Cohen’s kappa, 0.51, 95% confidence interval, 0.45 to 0.55). Sensitivity of individual raters for identifying inappropriate tests ranged from 47% to 82%, while specificity ranged from 85% to 97%. Conclusions Inter-rater reliability for the 2009 AUC for RNI is modest, and there is considerable variation in the ability of raters at different levels of training to identify inappropriate tests. PMID:25563660

  6. Heaven and Earth - `Madonne col Bambino' and `Rustiques figulines'

    NASA Astrophysics Data System (ADS)

    Bouquillon, A.

    Analyses of the productions of della Robbia and Palissy, two masters of Renaissance ceramics in France and in Italy, have enlightened their contributions to the improvement of the glazed terracotta technique. Della Robbia used very homogeneous materials: marly clay for the bodies, and tin-opacified coloured glazes. The technique is here very robust and very mastered. Palissy used different types of clay with different colours and physical properties, associated with specific productions. So far, we have identified seven pastes. Concerning the glazes, he played with transparency and opacity, with lead glazes and with tin-opacified lead glazes. He added traditional colouring oxides as well as specific pigments (lead-tin yellow, haematite, etc.). The mixed-earth technique is specific to his palette. So, the materials used by both artists are completely different and illustrate their different philosophical approaches. To perform the different analyses, new methodologies have been developed: ICP/AES-MS, petrography and X-ray diffractometry for the bodies, PIXE and micro-PIXE, SEM coupled with EDS and Raman spectrometry for the glazes.

  7. Sex Differences in Childhood Sexual Abuse and Suicide-Related Behaviors

    ERIC Educational Resources Information Center

    Rhodes, Anne E.; Boyle, Michael H.; Tonmyr, Lil; Wekerle, Christine; Goodman, Deborah; Leslie, Bruce; Mironova, Polina; Bethell, Jennifer; Manion, Ian

    2011-01-01

    Child sexual abuse and suicide-related behaviors are associated, but it remains unclear if the strength of this association differs in boys and girls. In a systematic review of this association in children and youth, we identified 16 relevant studies, all cross-sectional surveys of students. The association is stronger in boys specific to suicide…

  8. Describing, Analysing and Judging Language Codes in Cinematic Discourse

    ERIC Educational Resources Information Center

    Richardson, Kay; Queen, Robin

    2012-01-01

    In this short commentary piece, the authors stand back from many of the specific details in the seven papers which constitute the special issue, and offer some observations which attempt to identify and assess points of similarity and difference amongst them, under a number of different general headings. To the extent that the "sociolinguistics of…

  9. A systematic review of patient reported outcome measures (PROMs) used in child and adolescent burn research.

    PubMed

    Griffiths, C; Armstrong-James, L; White, P; Rumsey, N; Pleat, J; Harcourt, D

    2015-03-01

    Patient reported outcome measures (PROMs) can identify important information about patient needs and therapeutic progress. The aim of this review was to identify the PROMs that are being used in child and adolescent burn care and to determine the quality of such scales. Computerised and manual bibliographic searches of Medline, Social Sciences Index, Cinahl, Psychinfo, Psycharticles, AMED, and HAPI, were used to identify English-language articles using English-language PROMs from January 2001 to March 2013. The psychometric quality of the PROMs was assessed. 23 studies met the entry criteria and identified 32 different PROMs (31 generic, 1 burns-specific). Overall, the psychometric quality of the PROMs was low; only two generic scales (the Perceived Stigmatisation Questionnaire and the Social Comfort Scale) and only one burns-specific scale (the Children Burn Outcomes Questionnaire for children aged 5-18) had psychometric evidence relevant to this population. The majority of PROMs did not have psychometric evidence for their use with child or adolescent burn patients. To appropriately identify the needs and treatment progress of child and adolescent burn patients, new burns-specific PROMs need to be developed and validated to reflect issues that are of importance to this population. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  10. Organized Sport Trajectories from Childhood to Adolescence and Health Associations.

    PubMed

    Howie, Erin K; McVeigh, Joanne A; Smith, Anne J; Straker, Leon M

    2016-07-01

    The purpose of this study was to identify unique organized sport trajectories from early childhood to late adolescence in an Australian pregnancy cohort, the Raine Study. Participation in organized sport was assessed at ages 5, 8, 10, 14, and 17 yr. Physical activity, body composition, and self-rated physical and mental health were assessed at the age of 20 yr. Latent class analysis was used to identify patterns of sport participation. To assess the internal validity of the trajectory classes, differences in health characteristics between trajectories were analyzed using generalized linear models. For girls, three trajectory classes were identified: consistent sport participators (47.5%), sport dropouts (34.3%), and sport nonparticipators (18.1%). For boys, three trajectory classes were identified: consistent sport participators (55.2%), sport dropouts (36.9%), and sport joiners (8.1%). For girls, there were overall differences across trajectory classes in lean body mass (P = 0.003), lean mass index (P = 0.06), and physical health (P = 0.004). For boys, there were differences across classes in physical activity (P = 0.018), percent body fat (P = 0.002), lean body mass (P < 0.001), lean mass index (P < 0.001), physical health (P = 0.06), and depression scores (P = 0.27). This study identified unique, sex-specific trajectories of organized sport participation. The differences in health outcomes between trajectory classes, such as participants with consistent sport participation having more preferable health outcomes at the age of 20 yr, support the internal validity of the trajectories. Strategies are needed to identify and encourage those in the dropout trajectory to maintain their participation and those in the nonparticipator or joiner trajectories to join sport earlier. Specifically, interventions to encourage early sport participation in girls and help nonparticipating boys to join sport during adolescence may help more children receive the benefits of sport participation.

  11. Deep Sequencing-guided Design of a High Affinity Dual Specificity Antibody to Target Two Angiogenic Factors in Neovascular Age-related Macular Degeneration* ♦

    PubMed Central

    Koenig, Patrick; Lee, Chingwei V.; Sanowar, Sarah; Wu, Ping; Stinson, Jeremy; Harris, Seth F.; Fuh, Germaine

    2015-01-01

    The development of dual targeting antibodies promises therapies with improved efficacy over mono-specific antibodies. Here, we engineered a Two-in-One VEGF/angiopoietin 2 antibody with dual action Fab (DAF) as a potential therapeutic for neovascular age-related macular degeneration. Crystal structures of the VEGF/angiopoietin 2 DAF in complex with its two antigens showed highly overlapping binding sites. To achieve sufficient affinity of the DAF to block both angiogenic factors, we turned to deep mutational scanning in the complementarity determining regions (CDRs). By mutating all three CDRs of each antibody chain simultaneously, we were able not only to identify affinity improving single mutations but also mutation pairs from different CDRs that synergistically improve both binding functions. Furthermore, insights into the cooperativity between mutations allowed us to identify fold-stabilizing mutations in the CDRs. The data obtained from deep mutational scanning reveal that the majority of the 52 CDR residues are utilized differently for the two antigen binding function and permit, for the first time, the engineering of several DAF variants with sub-nanomolar affinity against two structurally unrelated antigens. The improved variants show similar blocking activity of receptor binding as the high affinity mono-specific antibodies against these two proteins, demonstrating the feasibility of generating a dual specificity binding surface with comparable properties to individual high affinity mono-specific antibodies. PMID:26088137

  12. Early events of polyoma infection: adsorption, penetration and nuclear transport

    NASA Technical Reports Server (NTRS)

    Consigli, R. A.; Haynes, J. I. Jr; Chang, D.; Grenz, L.; Richter, D.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Polyoma virions have different attachment proteins which are responsible for hemagglutination of erythrocytes and attachment to cultured mouse kidney cells (MKC). Virion binding studies demonstrated that MKC possess specific (productive infection) and nonspecific (nonproductive) receptors. Empty polyoma capsids have hemagglutination activity and bind to non-specific MKC receptors, but they are not capable of competing for specific virion cell receptors or preventing productive infection. Isoelectric focusing of the virion major capsid protein, VP1, separated this protein into six species (A through F). These species had identical amino acid sequences, but differed in degree of modification (phosphorylation, acetylation, sulfation and hydroxylation). Evidence based upon precipitation with specific antisera supports the view that VP1 species E is required for specific adsorption and that D and F are required for hemagglutination. The virion attachment domain has been localized to an 18 kilodalton fragment of the C-terminal region of VP1. Monopinocytotic vesicles containing 125I-labeled polyoma virions were isolated from infected MKC. A crosslinker was used to bind the MKC cell receptor(s) covalently to VP1 attachment protein, and a new 120 kilodalton band was identified by SDS-PAGE. An anti-idiotype antibody prepared against a neutralizing polyoma monoclonal antiody was used to identify a putative 50 kilodalton receptor protein from a detergent extract of MKC, as well as from MKC membrane preparation.

  13. The MLL recombinome of acute leukemias in 2017

    PubMed Central

    Meyer, C; Burmeister, T; Gröger, D; Tsaur, G; Fechina, L; Renneville, A; Sutton, R; Venn, N C; Emerenciano, M; Pombo-de-Oliveira, M S; Barbieri Blunck, C; Almeida Lopes, B; Zuna, J; Trka, J; Ballerini, P; Lapillonne, H; De Braekeleer, M; Cazzaniga, G; Corral Abascal, L; van der Velden, V H J; Delabesse, E; Park, T S; Oh, S H; Silva, M L M; Lund-Aho, T; Juvonen, V; Moore, A S; Heidenreich, O; Vormoor, J; Zerkalenkova, E; Olshanskaya, Y; Bueno, C; Menendez, P; Teigler-Schlegel, A; zur Stadt, U; Lentes, J; Göhring, G; Kustanovich, A; Aleinikova, O; Schäfer, B W; Kubetzko, S; Madsen, H O; Gruhn, B; Duarte, X; Gameiro, P; Lippert, E; Bidet, A; Cayuela, J M; Clappier, E; Alonso, C N; Zwaan, C M; van den Heuvel-Eibrink, M M; Izraeli, S; Trakhtenbrot, L; Archer, P; Hancock, J; Möricke, A; Alten, J; Schrappe, M; Stanulla, M; Strehl, S; Attarbaschi, A; Dworzak, M; Haas, O A; Panzer-Grümayer, R; Sedék, L; Szczepański, T; Caye, A; Suarez, L; Cavé, H; Marschalek, R

    2018-01-01

    Chromosomal rearrangements of the human MLL/KMT2A gene are associated with infant, pediatric, adult and therapy-induced acute leukemias. Here we present the data obtained from 2345 acute leukemia patients. Genomic breakpoints within the MLL gene and the involved translocation partner genes (TPGs) were determined and 11 novel TPGs were identified. Thus, a total of 135 different MLL rearrangements have been identified so far, of which 94 TPGs are now characterized at the molecular level. In all, 35 out of these 94 TPGs occur recurrently, but only 9 specific gene fusions account for more than 90% of all illegitimate recombinations of the MLL gene. We observed an age-dependent breakpoint shift with breakpoints localizing within MLL intron 11 associated with acute lymphoblastic leukemia and younger patients, while breakpoints in MLL intron 9 predominate in AML or older patients. The molecular characterization of MLL breakpoints suggests different etiologies in the different age groups and allows the correlation of functional domains of the MLL gene with clinical outcome. This study provides a comprehensive analysis of the MLL recombinome in acute leukemia and demonstrates that the establishment of patient-specific chromosomal fusion sites allows the design of specific PCR primers for minimal residual disease analyses for all patients. PMID:28701730

  14. The use of dendrograms to describe the electrical activity of motoneurons underlying behaviors in leeches

    PubMed Central

    Juárez-Hernández, León J.; Bisson, Giacomo; Torre, Vincent

    2013-01-01

    The present manuscript aims at identifying patterns of electrical activity recorded from neurons of the leech nervous system, characterizing specific behaviors. When leeches are at rest, the electrical activity of neurons and motoneurons is poorly correlated. When leeches move their head and/or tail, in contrast, action potential (AP) firing becomes highly correlated. When the head or tail suckers detach, specific patterns of electrical activity are detected. During elongation and contraction the electrical activity of motoneurons in the Medial Anterior and Dorsal Posterior nerves increase, respectively, and several motoneurons are activated both during elongation and contraction. During crawling, swimming, and pseudo-swimming patterns of electrical activity are better described by the dendrograms of cross-correlations of motoneurons pairs. Dendrograms obtained from different animals exhibiting the same behavior are similar and by averaging these dendrograms we obtained a template underlying a given behavior. By using this template, the corresponding behavior is reliably identified from the recorded electrical activity. The analysis of dendrograms during different leech behavior reveals the fine orchestration of motoneurons firing specific to each stereotyped behavior. Therefore, dendrograms capture the subtle changes in the correlation pattern of neuronal networks when they become involved in different tasks or functions. PMID:24098274

  15. iTRAQ-Based Proteomics Analysis and Network Integration for Kernel Tissue Development in Maize

    PubMed Central

    Dong, Yongbin; Wang, Qilei; Du, Chunguang; Xiong, Wenwei; Li, Xinyu; Zhu, Sailan; Li, Yuling

    2017-01-01

    Grain weight is one of the most important yield components and a developmentally complex structure comprised of two major compartments (endosperm and pericarp) in maize (Zea mays L.), however, very little is known concerning the coordinated accumulation of the numerous proteins involved. Herein, we used isobaric tags for relative and absolute quantitation (iTRAQ)-based comparative proteomic method to analyze the characteristics of dynamic proteomics for endosperm and pericarp during grain development. Totally, 9539 proteins were identified for both components at four development stages, among which 1401 proteins were non-redundant, 232 proteins were specific in pericarp and 153 proteins were specific in endosperm. A functional annotation of the identified proteins revealed the importance of metabolic and cellular processes, and binding and catalytic activities for the tissue development. Three and 76 proteins involved in 49 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were integrated for the specific endosperm and pericarp proteins, respectively, reflecting their complex metabolic interactions. In addition, four proteins with important functions and different expression levels were chosen for gene cloning and expression analysis. Different concordance between mRNA level and the protein abundance was observed across different proteins, stages, and tissues as in previous research. These results could provide useful message for understanding the developmental mechanisms in grain development in maize. PMID:28837076

  16. [RAPD analysis of four species of Cuscuta in Shandong Province].

    PubMed

    Lin, Huibin; Lin, Jianqun; Lin, Jianqiang

    2003-01-01

    To explore the genome difference of four species of Cuscuta in different hosts. RAPD was used by 50 primers. Four species of genus Cuscuta can be identified by 8 primers. Both Cuscuta chinensis and C. australis from Subg. Grammica had 3 bands whose molecular weights were 1.3 kb, 1.45 kb and 1.53 kb respectively. C. japonica and C. lupuliformis from Subg. Monogyna had a 1.48 kb specific band. Cuscuta of same subgenus had similar RAPD result and close genetic relationship. Same species of Cuscuta in different hosts showed DNA polymorphism. It indicated that hosts can affect genome of Cuscuta to some extent. RAPD can be used to identify the species of Cuscuta or same Cuscuta in different hosts.

  17. The behavioral genetics of nonhuman primates: Status and prospects.

    PubMed

    Rogers, Jeffrey

    2018-01-01

    The complexity and diversity of primate behavior have long attracted the attention of ethologists, psychologists, behavioral ecologists, and neuroscientists. Recent studies have advanced our understanding of the nature of genetic influences on differences in behavior among individuals within species. A number of analyses have focused on the genetic analysis of behavioral reactions to specific experimental tests, providing estimates of the degree of genetic control over reactivity, and beginning to identify the genes involved. Substantial progress is also being made in identifying genetic factors that influence the structure and function of the primate brain. Most of the published studies on these topics have examined either cercopithecines or chimpanzees, though a few studies have addressed these questions in other primate species. One potentially important line of research is beginning to identify the epigenetic processes that influence primate behavior, thus revealing specific cellular and molecular mechanisms by which environmental experiences can influence gene expression or gene function relevant to behavior. This review summarizes many of these studies of non-human primate behavioral genetics. The primary focus is on analyses that address the nature of the genes and genetic processes that affect differences in behavior among individuals within non-human primate species. Analyses of between species differences and potential avenues for future research are also discussed. © 2018 American Association of Physical Anthropologists.

  18. Toward the Standardization of Mitochondrial Proteomics: The Italian Mitochondrial Human Proteome Project Initiative.

    PubMed

    Alberio, Tiziana; Pieroni, Luisa; Ronci, Maurizio; Banfi, Cristina; Bongarzone, Italia; Bottoni, Patrizia; Brioschi, Maura; Caterino, Marianna; Chinello, Clizia; Cormio, Antonella; Cozzolino, Flora; Cunsolo, Vincenzo; Fontana, Simona; Garavaglia, Barbara; Giusti, Laura; Greco, Viviana; Lucacchini, Antonio; Maffioli, Elisa; Magni, Fulvio; Monteleone, Francesca; Monti, Maria; Monti, Valentina; Musicco, Clara; Petrosillo, Giuseppe; Porcelli, Vito; Saletti, Rosaria; Scatena, Roberto; Soggiu, Alessio; Tedeschi, Gabriella; Zilocchi, Mara; Roncada, Paola; Urbani, Andrea; Fasano, Mauro

    2017-12-01

    The Mitochondrial Human Proteome Project aims at understanding the function of the mitochondrial proteome and its crosstalk with the proteome of other organelles. Being able to choose a suitable and validated enrichment protocol of functional mitochondria, based on the specific needs of the downstream proteomics analysis, would greatly help the researchers in the field. Mitochondrial fractions from ten model cell lines were prepared using three enrichment protocols and analyzed on seven different LC-MS/MS platforms. All data were processed using neXtProt as reference database. The data are available for the Human Proteome Project purposes through the ProteomeXchange Consortium with the identifier PXD007053. The processed data sets were analyzed using a suite of R routines to perform a statistical analysis and to retrieve subcellular and submitochondrial localizations. Although the overall number of identified total and mitochondrial proteins was not significantly dependent on the enrichment protocol, specific line to line differences were observed. Moreover, the protein lists were mapped to a network representing the functional mitochondrial proteome, encompassing mitochondrial proteins and their first interactors. More than 80% of the identified proteins resulted in nodes of this network but with a different ability in coisolating mitochondria-associated structures for each enrichment protocol/cell line pair.

  19. Seizures and EEG features in 74 patients with genetic-dysmorphic syndromes.

    PubMed

    Alfei, Enrico; Raviglione, Federico; Franceschetti, Silvana; D'Arrigo, Stefano; Milani, Donatella; Selicorni, Angelo; Riva, Daria; Zuffardi, Orsetta; Pantaleoni, Chiara; Binelli, Simona

    2014-12-01

    Epilepsy is one of the most common findings in chromosome aberrations. Types of seizures and severity may significantly vary both between different conditions and within the same aberration. Hitherto specific seizures and EEG patterns are identified for only few syndromes. We studied 74 patients with defined genetic-dysmorphic syndromes with and without epilepsy in order to assess clinical and electroencephalographic features, to compare our observation with already described electro-clinical phenotypes, and to identify putative electroencephalographic and/or seizure characteristics useful to address the diagnosis. In our population, 10 patients had chromosomal disorders, 19 microdeletion or microduplication syndromes, and 32 monogenic syndromes. In the remaining 13, syndrome diagnosis was assessed on clinical grounds. Our study confirmed the high incidence of epilepsy in genetic-dysmorphic syndromes. Moreover, febrile seizures and neonatal seizures had a higher incidence compared to general population. In addition, more than one third of epileptic patients had drug-resistant epilepsy. EEG study revealed poor background organization in 42 patients, an excess of diffuse rhythmic activities in beta, alpha or theta frequency bands in 34, and epileptiform patterns in 36. EEG was completely normal only in 20 patients. No specific electro-clinical pattern was identified, except for inv-dup15, Angelman, and Rett syndromes. Nevertheless some specific conditions are described in detail, because of notable differences from what previously reported. Regarding the diagnostic role of EEG, we found that--even without any epileptiform pattern--the generation of excessive rhythmic activities in different frequency bandwidths might support the diagnosis of a genetic syndrome. © 2014 Wiley Periodicals, Inc.

  20. Resting State Correlates of Subdimensions of Anxious Affect

    PubMed Central

    Bijsterbosch, Janine; Smith, Stephen; Forster, Sophie; John, Oliver P.; Bishop, Sonia J.

    2014-01-01

    Resting state fMRI may help identify markers of risk for affective disorder. Given the comorbidity of anxiety and depressive disorders and the heterogeneity of these disorders as defined by DSM, an important challenge is to identify alterations in resting state brain connectivity uniquely associated with distinct profiles of negative affect. The current study aimed to address this by identifying differences in brain connectivity specifically linked to cognitive and physiological profiles of anxiety, controlling for depressed affect. We adopted a two-stage multivariate approach. Hierarchical clustering was used to independently identify dimensions of negative affective style and resting state brain networks. Combining the clustering results, we examined individual differences in resting state connectivity uniquely associated with subdimensions of anxious affect, controlling for depressed affect. Physiological and cognitive subdimensions of anxious affect were identified. Physiological anxiety was associated with widespread alterations in insula connectivity, including decreased connectivity between insula subregions and between the insula and other medial frontal and subcortical networks. This is consistent with the insula facilitating communication between medial frontal and subcortical regions to enable control of physiological affective states. Meanwhile, increased connectivity within a frontoparietal–posterior cingulate cortex–precunous network was specifically associated with cognitive anxiety, potentially reflecting increased spontaneous negative cognition (e.g., worry). These findings suggest that physiological and cognitive anxiety comprise subdimensions of anxiety-related affect and reveal associated alterations in brain connectivity. PMID:24168223

  1. Testing Scientific Software: A Systematic Literature Review.

    PubMed

    Kanewala, Upulee; Bieman, James M

    2014-10-01

    Scientific software plays an important role in critical decision making, for example making weather predictions based on climate models, and computation of evidence for research publications. Recently, scientists have had to retract publications due to errors caused by software faults. Systematic testing can identify such faults in code. This study aims to identify specific challenges, proposed solutions, and unsolved problems faced when testing scientific software. We conducted a systematic literature survey to identify and analyze relevant literature. We identified 62 studies that provided relevant information about testing scientific software. We found that challenges faced when testing scientific software fall into two main categories: (1) testing challenges that occur due to characteristics of scientific software such as oracle problems and (2) testing challenges that occur due to cultural differences between scientists and the software engineering community such as viewing the code and the model that it implements as inseparable entities. In addition, we identified methods to potentially overcome these challenges and their limitations. Finally we describe unsolved challenges and how software engineering researchers and practitioners can help to overcome them. Scientific software presents special challenges for testing. Specifically, cultural differences between scientist developers and software engineers, along with the characteristics of the scientific software make testing more difficult. Existing techniques such as code clone detection can help to improve the testing process. Software engineers should consider special challenges posed by scientific software such as oracle problems when developing testing techniques.

  2. Accounting for cell lineage and sex effects in the identification of cell-specific DNA methylation using a Bayesian model selection algorithm.

    PubMed

    White, Nicole; Benton, Miles; Kennedy, Daniel; Fox, Andrew; Griffiths, Lyn; Lea, Rodney; Mengersen, Kerrie

    2017-01-01

    Cell- and sex-specific differences in DNA methylation are major sources of epigenetic variation in whole blood. Heterogeneity attributable to cell type has motivated the identification of cell-specific methylation at the CpG level, however statistical methods for this purpose have been limited to pairwise comparisons between cell types or between the cell type of interest and whole blood. We developed a Bayesian model selection algorithm for the identification of cell-specific methylation profiles that incorporates knowledge of shared cell lineage and allows for the identification of differential methylation profiles in one or more cell types simultaneously. Under the proposed methodology, sex-specific differences in methylation by cell type are also assessed. Using publicly available, cell-sorted methylation data, we show that 51.3% of female CpG markers and 61.4% of male CpG markers identified were associated with differential methylation in more than one cell type. The impact of cell lineage on differential methylation was also highlighted. An evaluation of sex-specific differences revealed differences in CD56+NK methylation, within both single and multi- cell dependent methylation patterns. Our findings demonstrate the need to account for cell lineage in studies of differential methylation and associated sex effects.

  3. Specific Proteins in Nontuberculous Mycobacteria: New Potential Tools

    PubMed Central

    Orduña, Patricia; Castillo-Rodal, Antonia I.; Mercado, Martha E.; Ponce de León, Samuel; López-Vidal, Yolanda

    2015-01-01

    Nontuberculous mycobacteria (NTM) have been isolated from water, soil, air, food, protozoa, plants, animals, and humans. Although most NTM are saprophytes, approximately one-third of NTM have been associated with human diseases. In this study, we did a comparative proteomic analysis among five NTM strains isolated from several sources. There were different numbers of protein spots from M. gordonae (1,264), M. nonchromogenicum type I (894), M. nonchromogenicum type II (935), M. peregrinum (806), and M. scrofulaceum/Mycobacterium mantenii (1,486) strains, respectively. We identified 141 proteins common to all strains and specific proteins to each NTM strain. A total of 23 proteins were selected for its identification. Two of the common proteins identified (short-chain dehydrogenase/reductase SDR and diguanylate cyclase) did not align with M. tuberculosis complex protein sequences, which suggest that these proteins are found only in the NTM strains. Some of the proteins identified as common to all strains can be used as markers of NTM exposure and for the development of new diagnostic tools. Additionally, the specific proteins to NTM strains identified may represent potential candidates for the diagnosis of diseases caused by these mycobacteria. PMID:26106621

  4. Single measure and gated screening approaches for identifying students at-risk for academic problems: Implications for sensitivity and specificity.

    PubMed

    Van Norman, Ethan R; Nelson, Peter M; Klingbeil, David A

    2017-09-01

    Educators need recommendations to improve screening practices without limiting students' instructional opportunities. Repurposing previous years' state test scores has shown promise in identifying at-risk students within multitiered systems of support. However, researchers have not directly compared the diagnostic accuracy of previous years' state test scores with data collected during fall screening periods to identify at-risk students. In addition, the benefit of using previous state test scores in conjunction with data from a separate measure to identify at-risk students has not been explored. The diagnostic accuracy of 3 types of screening approaches were tested to predict proficiency on end-of-year high-stakes assessments: state test data obtained during the previous year, data from a different measure administered in the fall, and both measures combined (i.e., a gated model). Extant reading and math data (N = 2,996) from 10 schools in the Midwest were analyzed. When used alone, both measures yielded similar sensitivity and specificity values. The gated model yielded superior specificity values compared with using either measure alone, at the expense of sensitivity. Implications, limitations, and ideas for future research are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  5. A microscopy-based screen employing multiplex genome sequencing identifies cargo-specific requirements for dynein velocity

    PubMed Central

    Tan, Kaeling; Roberts, Anthony J.; Chonofsky, Mark; Egan, Martin J.; Reck-Peterson, Samara L.

    2014-01-01

    The timely delivery of membranous organelles and macromolecules to specific locations within the majority of eukaryotic cells depends on microtubule-based transport. Here we describe a screening method to identify mutations that have a critical effect on intracellular transport and its regulation using mutagenesis, multicolor-fluorescence microscopy, and multiplex genome sequencing. This screen exploits the filamentous fungus Aspergillus nidulans, which has many of the advantages of yeast molecular genetics but uses long-range microtubule-based transport in a manner more similar to metazoan cells. Using this method, we identified seven mutants that represent novel alleles of components of the intracellular transport machinery: specifically, kinesin-1, cytoplasmic dynein, and the dynein regulators Lis1 and dynactin. The two dynein mutations identified in our screen map to dynein's AAA+ catalytic core. Single-molecule studies reveal that both mutations reduce dynein's velocity in vitro. In vivo these mutants severely impair the distribution and velocity of endosomes, a known dynein cargo. In contrast, another dynein cargo, the nucleus, is positioned normally in these mutants. These results reveal that different dynein functions have distinct stringencies for motor performance. PMID:24403603

  6. Biochemical and Structural Analysis of an Eis Family Aminoglycoside Acetyltransferase from Bacillus anthracis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Green, Keith D.; Biswas, Tapan; Chang, Changsoo

    Proteins from the enhanced intracellular survival (Eis) family are versatile acetyltransferases that acetylate amines at multiple positions of several aminoglycosides (AGs). Their upregulation confers drug resistance. Homologues of Eis are present in diverse bacteria, including many pathogens. Eis from Mycobacterium tuberculosis (Eis_Mtb) has been well characterized. In this study, we explored the AG specificity and catalytic efficiency of the Eis family protein from Bacillus anthracis (Eis_Ban). Kinetic analysis of specificity and catalytic efficiency of acetylation of six AGs indicates that Eis_Ban displays significant differences from Eis_Mtb in both substrate binding and catalytic efficiency. The number of acetylated amines was alsomore » different for several AGs, indicating a distinct regiospecificity of Eis_Ban. Furthermore, most recently identified inhibitors of Eis_Mtb did not inhibit Eis_Ban, underscoring the differences between these two enzymes. To explain these differences, we determined an Eis_Ban crystal structure. The comparison of the crystal structures of Eis_Ban and Eis_Mtb demonstrates that critical residues lining their respective substrate binding pockets differ substantially, explaining their distinct specificities. Our results suggest that acetyltransferases of the Eis family evolved divergently to garner distinct specificities while conserving catalytic efficiency, possibly to counter distinct chemical challenges. The unique specificity features of these enzymes can be utilized as tools for developing AGs with novel modifications and help guide specific AG treatments to avoid Eis-mediated resistance.« less

  7. Generation of Organ-conditioned Media and Applications for Studying Organ-specific Influences on Breast Cancer Metastatic Behavior.

    PubMed

    Piaseczny, Matthew M; Pio, Graciella M; Chu, Jenny E; Xia, Ying; Nguyen, Kim; Goodale, David; Allan, Alison

    2016-06-13

    Breast cancer preferentially metastasizes to the lymph node, bone, lung, brain and liver in breast cancer patients. Previous research efforts have focused on identifying factors inherent to breast cancer cells that are responsible for this observed metastatic pattern (termed organ tropism), however much less is known about factors present within specific organs that contribute to this process. This is in part because of a lack of in vitro model systems that accurately recapitulate the organ microenvironment. To address this, an ex vivo model system has been established that allows for the study of soluble factors present within different organ microenvironments. This model consists of generating conditioned media from organs (lymph node, bone, lung, and brain) isolated from normal athymic nude mice. The model system has been validated by demonstrating that different breast cancer cell lines display cell-line specific and organ-specific malignant behavior in response to organ-conditioned media that corresponds to their in vivo metastatic potential. This model system can be used to identify and evaluate specific organ-derived soluble factors that may play a role in the metastatic behavior of breast and other types of cancer cells, including influences on growth, migration, stem-like behavior, and gene expression, as well as the identification of potential new therapeutic targets for cancer. This is the first ex vivo model system that can be used to study organ-specific metastatic behavior in detail and evaluate the role of specific organ-derived soluble factors in driving the process of cancer metastasis.

  8. Attraction of female grapevine moth to common and specific olfactory cues from 2 host plants.

    PubMed

    Tasin, Marco; Bäckman, Anna-Carin; Anfora, Gianfranco; Carlin, Silvia; Ioriatti, Claudio; Witzgall, Peter

    2010-01-01

    In herbivorous insects with more than 1 host plant, attraction to host odor could conceptually be mediated by common compounds, by specific compounds released by each plant or by combinations of common and specific compounds. We have compared the attraction of female grapevine moth, Lobesia botrana, with specific and common (shared) odors from 2 different plants: a wild host (Daphne gnidium) and a recently colonized host (Vitis vinifera). Odor blends eliciting female attraction to V. vinifera have previously been identified. In this study, olfactory cues from D. gnidium were identified by electroantennographic detection and chemical analysis. The attraction of mated females to synthetic odor blends was then tested in a wind tunnel bioassay. Female attraction was elicited by a blend of compounds released by both from D. gnidium and V. vinifera and by 2 blends with the compounds released specifically from each host. However, more complete odor blends of the 2 plants elicited stronger attraction. The common compounds in combination with the specific compounds of D. gnidium were the most attractive blend. This blend was tested with the common compounds presented both in the ratio emitted by D. gnidium and by V. vinifera, but there was no difference in female attraction. Our findings suggest that specific as well as common plant odor cues play a role in L. botrana host recognition and that there is plasticity in attraction to partial blends. The results are discussed in relation to mechanisms behind host odor recognition and the evolution of insect-plant associations.

  9. Gene-Based Genome-Wide Association Analysis in European and Asian Populations Identified Novel Genes for Rheumatoid Arthritis.

    PubMed

    Zhu, Hong; Xia, Wei; Mo, Xing-Bo; Lin, Xiang; Qiu, Ying-Hua; Yi, Neng-Jun; Zhang, Yong-Hong; Deng, Fei-Yan; Lei, Shu-Feng

    2016-01-01

    Rheumatoid arthritis (RA) is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations. Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects). For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls. A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA), 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX) and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13) genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02) and HLA-DMA (P value = 4.70E-02) in plasma were significantly different in our in-house samples. Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA genes. The study not only greatly increases our understanding of genetic susceptibility to RA, but also provides important insights into the ethno-genetic homogeneity and heterogeneity of RA in both ethnicities.

  10. A parsimonious characterization of change in global age-specific and total fertility rates

    PubMed Central

    2018-01-01

    This study aims to understand trends in global fertility from 1950-2010 though the analysis of age-specific fertility rates. This approach incorporates both the overall level, as when the total fertility rate is modeled, and different patterns of age-specific fertility to examine the relationship between changes in age-specific fertility and fertility decline. Singular value decomposition is used to capture the variation in age-specific fertility curves while reducing the number of dimensions, allowing curves to be described nearly fully with three parameters. Regional patterns and trends over time are evident in parameter values, suggesting this method provides a useful tool for considering fertility decline globally. The second and third parameters were analyzed using model-based clustering to examine patterns of age-specific fertility over time and place; four clusters were obtained. A country’s demographic transition can be traced through time by membership in the different clusters, and regional patterns in the trajectories through time and with fertility decline are identified. PMID:29377899

  11. Motivation of restraint system usage among specific target groups of drivers and passengers

    DOT National Transportation Integrated Search

    1983-07-14

    Thirty focus groups were conducted in seven different cities. These focus groups were used to determine potentially effective motivational approaches, develop appropriate themes and general content of messages and, finally, to identify corresponding ...

  12. Cognitive predictors of children's development in mathematics achievement: A latent growth modeling approach.

    PubMed

    Xenidou-Dervou, Iro; Van Luit, Johannes E H; Kroesbergen, Evelyn H; Friso-van den Bos, Ilona; Jonkman, Lisa M; van der Schoot, Menno; van Lieshout, Ernest C D M

    2018-04-24

    Research has identified various domain-general and domain-specific cognitive abilities as predictors of children's individual differences in mathematics achievement. However, research into the predictors of children's individual growth rates, namely between-person differences in within-person change in mathematics achievement is scarce. We assessed 334 children's domain-general and mathematics-specific early cognitive abilities and their general mathematics achievement longitudinally across four time-points within the first and second grades of primary school. As expected, a constellation of multiple cognitive abilities contributed to the children's starting level of mathematical success. Specifically, latent growth modeling revealed that WM abilities, IQ, counting skills, nonsymbolic and symbolic approximate arithmetic and comparison skills explained individual differences in the children's initial status on a curriculum-based general mathematics achievement test. Surprisingly, however, only one out of all the assessed cognitive abilities was a unique predictor of the children's individual growth rates in mathematics achievement: their performance in the symbolic approximate addition task. In this task, children were asked to estimate the sum of two large numbers and decide if this estimated sum was smaller or larger compared to a third number. Our findings demonstrate the importance of multiple domain-general and mathematics-specific cognitive skills for identifying children at risk of struggling with mathematics and highlight the significance of early approximate arithmetic skills for the development of one's mathematical success. We argue the need for more research focus on explaining children's individual growth rates in mathematics achievement. © 2018 John Wiley & Sons Ltd.

  13. Student Conceptions of Ionic Bonding: Patterns of thinking across three European contexts

    NASA Astrophysics Data System (ADS)

    Taber, Keith S.; Tsaparlis, Georgios; Nakiboğlu, Canan

    2012-12-01

    Previous research has reported that students commonly develop alternative conceptions in the core topic of chemical bonding. Research in England has reported that students there commonly demonstrate an alternative 'molecular' conceptual framework for thinking about ionic bonding: in terms of the formation of molecule-like ions pairs through electron transfer, which are internally bonded, but not bonded to other ions. The present study reports the use of translated versions of a diagnostic instrument to elicit the conceptions of bonding in NaCl (commonly used as the teaching example of an ionic compound) from two samples of students setting out on university courses in Greece and Turkey. The study reports that students in these two contexts displayed high levels of support for statements based upon the alternative conceptual framework identified in the English context. Students commonly develop similar alternative conceptions of ionic bonding in these three different educational contexts. The study also found some quite large differences in the specific response patterns across these three contexts, some of which could reflect specific features of the different curriculum contexts. The study reinforces the cross-national nature of the challenge of effectively teaching the abstract models of chemistry at the submicroscopic level. It also provides intriguing suggestions that a close study of the interactions between specific curriculum contexts and specific patterns in students' thinking offers much potential for identifying particular aspects of subject pedagogy that either support or impede the learning of accepted scientific models.

  14. Applying Quality Function Deployment Model in Burn Unit Service Improvement.

    PubMed

    Keshtkaran, Ali; Hashemi, Neda; Kharazmi, Erfan; Abbasi, Mehdi

    2016-01-01

    Quality function deployment (QFD) is one of the most effective quality design tools. This study applies QFD technique to improve the quality of the burn unit services in Ghotbedin Hospital in Shiraz, Iran. First, the patients' expectations of burn unit services and their priorities were determined through Delphi method. Thereafter, burn unit service specifications were determined through Delphi method. Further, the relationships between the patients' expectations and service specifications and also the relationships between service specifications were determined through an expert group's opinion. Last, the final importance scores of service specifications were calculated through simple additive weighting method. The findings show that burn unit patients have 40 expectations in six different areas. These expectations are in 16 priority levels. Burn units also have 45 service specifications in six different areas. There are four-level relationships between the patients' expectations and service specifications and four-level relationships between service specifications. The most important burn unit service specifications have been identified in this study. The QFD model developed in the study can be a general guideline for QFD planners and executives.

  15. The Multiple Carbohydrate Binding Specificities of Helicobacter pylori

    NASA Astrophysics Data System (ADS)

    Teneberg, Susann

    Persistent colonization of the human stomach by Helicobacter pylori is a risk factor for the development of peptic ulcer disease and gastric cancer. Adhesion of microbes to the target tissue is an important determinant for successful initiation, establishment and maintenance of infection, and a variety of different candidate carbohydrate receptors for H. pylori have been identified. Here the different the binding specifities, and their potential role in adhesion to human gastric epithelium are described. Finally, recent findings on the roles of sialic acid binding SabA adhesin in interactions with human neutrophils and erythrocytes are discussed.

  16. Faculty-Specific Factors of Degree of HE Internationalization: An Evaluation of Four Faculties of a Post-1992 University in the United Kingdom

    ERIC Educational Resources Information Center

    Jiang, Nan; Carpenter, Victoria

    2013-01-01

    Purpose: The purpose of this paper is to investigate the difference in the process of higher education (HE) internationalization across faculties in a post-1992 university and to identify faculty-specific factors through evaluating the four faculties in the case study. Design/methodology/approach: A qualitative research is conducted in a post-1992…

  17. Adapt Design: A Methodology for Enabling Modular Design for Mission Specific SUAS

    DTIC Science & Technology

    2016-08-24

    ADAPT DESIGN: A METHODOLOGY FOR ENABLING MODULAR DESIGN FOR MISSION SPECIFIC SUAS Zachary C. Fisher David Locascio K. Daniel Cooksey...vehicle’s small scale. This paper considers a different approach to SUAS design aimed at addressing this issue. In this approach, a hybrid modular and...Two types of platforms have been identified: scalable platforms where variants are produced by varying scalable design variables, and modular

  18. Risk analysis for renewable energy projects due to constraints arising

    NASA Astrophysics Data System (ADS)

    Prostean, G.; Vasar, C.; Prostean, O.; Vartosu, A.

    2016-02-01

    Starting from the target of the European Union (EU) to use renewable energy in the area that aims a binding target of 20% renewable energy in final energy consumption by 2020, this article illustrates the identification of risks for implementation of wind energy projects in Romania, which could lead to complex technical implications, social and administrative. In specific projects analyzed in this paper were identified critical bottlenecks in the future wind power supply chain and reasonable time periods that may arise. Renewable energy technologies have to face a number of constraints that delayed scaling-up their production process, their transport process, the equipment reliability, etc. so implementing these types of projects requiring complex specialized team, the coordination of which also involve specific risks. The research team applied an analytical risk approach to identify major risks encountered within a wind farm project developed in Romania in isolated regions with different particularities, configured for different geographical areas (hill and mountain locations in Romania). Identification of major risks was based on the conceptual model set up for the entire project implementation process. Throughout this conceptual model there were identified specific constraints of such process. Integration risks were examined by an empirical study based on the method HAZOP (Hazard and Operability). The discussion describes the analysis of our results implementation context of renewable energy projects in Romania and creates a framework for assessing energy supply to any entity from renewable sources.

  19. HLA class I-restricted MYD88 L265P-derived peptides as specific targets for lymphoma immunotherapy

    PubMed Central

    Nelde, Annika; Walz, Juliane Sarah; Kowalewski, Daniel Johannes; Schuster, Heiko; Wolz, Olaf-Oliver; Peper, Janet Kerstin; Cardona Gloria, Yamel; Langerak, Anton W.; Muggen, Alice F.; Claus, Rainer; Bonzheim, Irina; Fend, Falko; Salih, Helmut Rainer; Kanz, Lothar; Rammensee, Hans-Georg; Stevanović, Stefan; Weber, Alexander N. R.

    2017-01-01

    ABSTRACT Genome sequencing has uncovered an array of recurring somatic mutations in different non-Hodgkin lymphoma (NHL) subtypes. If affecting protein-coding regions, such mutations may yield mutation-derived peptides that may be presented by HLA class I proteins and recognized by cytotoxic T cells. A recurring somatic and oncogenic driver mutation of the Toll-like receptor adaptor protein MYD88, Leu265Pro (L265P) was identified in up to 90% of different NHL subtype patients. We therefore screened the potential of MYD88L265P-derived peptides to elicit cytotoxic T cell responses as tumor-specific neoantigens. Based on in silico predictions, we identified potential MYD88L265P-containing HLA ligands for several HLA class I restrictions. A set of HLA class I MYD88L265P-derived ligands elicited specific cytotoxic T cell responses for HLA-B*07 and -B*15. These data highlight the potential of MYD88L265P mutation-specific peptide-based immunotherapy as a novel personalized treatment approach for patients with MYD88L265P+ NHLs that may complement pharmacological approaches targeting oncogenic MyD88 L265P signaling. PMID:28405493

  20. Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks

    PubMed Central

    Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain

    2015-01-01

    Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530

  1. Identifying Emotions on the Basis of Neural Activation

    PubMed Central

    Kassam, Karim S.; Markey, Amanda R.; Cherkassky, Vladimir L.; Loewenstein, George; Just, Marcel Adam

    2013-01-01

    We attempt to determine the discriminability and organization of neural activation corresponding to the experience of specific emotions. Method actors were asked to self-induce nine emotional states (anger, disgust, envy, fear, happiness, lust, pride, sadness, and shame) while in an fMRI scanner. Using a Gaussian Naïve Bayes pooled variance classifier, we demonstrate the ability to identify specific emotions experienced by an individual at well over chance accuracy on the basis of: 1) neural activation of the same individual in other trials, 2) neural activation of other individuals who experienced similar trials, and 3) neural activation of the same individual to a qualitatively different type of emotion induction. Factor analysis identified valence, arousal, sociality, and lust as dimensions underlying the activation patterns. These results suggest a structure for neural representations of emotion and inform theories of emotional processing. PMID:23840392

  2. Identifying Emotions on the Basis of Neural Activation.

    PubMed

    Kassam, Karim S; Markey, Amanda R; Cherkassky, Vladimir L; Loewenstein, George; Just, Marcel Adam

    2013-01-01

    We attempt to determine the discriminability and organization of neural activation corresponding to the experience of specific emotions. Method actors were asked to self-induce nine emotional states (anger, disgust, envy, fear, happiness, lust, pride, sadness, and shame) while in an fMRI scanner. Using a Gaussian Naïve Bayes pooled variance classifier, we demonstrate the ability to identify specific emotions experienced by an individual at well over chance accuracy on the basis of: 1) neural activation of the same individual in other trials, 2) neural activation of other individuals who experienced similar trials, and 3) neural activation of the same individual to a qualitatively different type of emotion induction. Factor analysis identified valence, arousal, sociality, and lust as dimensions underlying the activation patterns. These results suggest a structure for neural representations of emotion and inform theories of emotional processing.

  3. Differential signatures of bacterial and mammalian IMP dehydrogenase enzymes.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, R.; Evans, G.; Rotella, F.

    1999-06-01

    IMP dehydrogenase (IMPDH) is an essential enzyme of de novo guanine nucleotide synthesis. IMPDH inhibitors have clinical utility as antiviral, anticancer or immunosuppressive agents. The essential nature of this enzyme suggests its therapeutic applications may be extended to the development of antimicrobial agents. Bacterial IMPDH enzymes show bio- chemical and kinetic characteristics that are different than the mammalian IMPDH enzymes, suggesting IMPDH may be an attractive target for the development of antimicrobial agents. We suggest that the biochemical and kinetic differences between bacterial and mammalian enzymes are a consequence of the variance of specific, identifiable amino acid residues. Identification ofmore » these residues or combination of residues that impart this mammalian or bacterial enzyme signature is a prerequisite for the rational identification of agents that specifically target the bacterial enzyme. We used sequence alignments of IMPDH proteins to identify sequence signatures associated with bacterial or eukaryotic IMPDH enzymes. These selections were further refined to discern those likely to have a role in catalysis using information derived from the bacterial and mammalian IMPDH crystal structures and site-specific mutagenesis. Candidate bacterial sequence signatures identified by this process include regions involved in subunit interactions, the active site flap and the NAD binding region. Analysis of sequence alignments in these regions indicates a pattern of catalytic residues conserved in all enzymes and a secondary pattern of amino acid conservation associated with the major phylogenetic groups. Elucidation of the basis for this mammalian/bacterial IMPDH signature will provide insight into the catalytic mechanism of this enzyme and the foundation for the development of highly specific inhibitors.« less

  4. House-dust mite allergy: mapping of Dermatophagoides pteronyssinus allergens for dogs by two-dimensional immunoblotting.

    PubMed

    Martins, Luís Miguel Lourenço; Marques, Andreia Grilo; Pereira, Luísa Maria Dotti Silva; Goicoa, Ana; Semião-Santos, Saul José; Bento, Ofélia Pereira

    2015-04-01

    Specific immunotherapy has shown to be very useful for allergy control in dogs, with a common success rate ranging from 65% to 70%. However, this efficacy could probably be improved and the identification of individual allergomes, with the choice of more adequate molecular allergen pools for specific immunotherapy, being the strategy. To map Dermatophagoides pteronyssinus (Der p) allergens for mite-sensitized atopic dogs, for better understanding how individual allergograms may influence the response to house-dust mite immunotherapy. To identify the Der p mite allergome for dogs, 20 individuals allergic to dust-mites and sensitized to Der p, were selected. The extract from Der p was submitted to isoelectric focusing (IEF), one-dimensional (1-D) and two-dimensional (2-D) sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Separated proteins were blotted onto polyvinylidene difluoride (PVDF) membranes and immunoblottings were performed with patient sera. Allergen-bound specific IgE was detected. Eleven allergens were identified from isoelectric focusing (IEF), as well as from 1-D SDS PAGE. From 2-D SDS-PAGE, 24 spots were identified. Several similarities were found between dog and human allergograms and no absolute correlation between sensitization and allergy was observed either. As in humans, different individual allergograms do not seem to implicate different clinical patterns, but may influence the response to specific immunotherapy. The molecular epidemiology approach in veterinary allergy management, by the characterization of individual patients' allergoms and by choosing the best molecular allergen pool for each patient could also improve the efficacy of allergy immunotherapy.

  5. Evaluating barriers to adopting telemedicine worldwide: A systematic review.

    PubMed

    Scott Kruse, Clemens; Karem, Priyanka; Shifflett, Kelli; Vegi, Lokesh; Ravi, Karuna; Brooks, Matthew

    2018-01-01

    Introduction and objective Studies on telemedicine have shown success in reducing the geographical and time obstacles incurred in the receipt of care in traditional modalities with the same or greater effectiveness; however, there are several barriers that need to be addressed in order for telemedicine technology to spread. The aim of this review is to evaluate barriers to adopting telemedicine worldwide through the analysis of published work. Methods The authors conducted a systematic literature review by extracting the data from the Cumulative Index of Nursing and Allied Health Literature (CINAHL) and PubMed (MEDLINE) research databases. The reviewers in this study analysed 30 articles (nine from CINAHL and 21 from Medline) and identified barriers found in the literature. This review followed the checklist from Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) 2009. The reviewers organized the results into one table and five figures that depict the data in different ways, organized by: barrier, country-specific barriers, organization-specific barriers, patient-specific barriers, and medical-staff and programmer-specific barriers. Results The reviewers identified 33 barriers with a frequency of 100 occurrences through the 30 articles. The study identified the issues with technically challenged staff (11%), followed by resistance to change (8%), cost (8%), reimbursement (5%), age of patient (5%), and level of education of patient (5%). All other barriers occurred at or less than 4% of the time. Discussion and conclusions Telemedicine is not yet ubiquitous, and barriers vary widely. The top barriers are technology-specific and could be overcome through training, change-management techniques, and alternating delivery by telemedicine and personal patient-to-provider interaction. The results of this study identify several barriers that could be eliminated by focused policy. Future work should evaluate policy to identify which one to lever to maximize the results.

  6. Identifying key components for an effective case report poster: an observational study.

    PubMed

    Willett, Lisa L; Paranjape, Anuradha; Estrada, Carlos

    2009-03-01

    Residents demonstrate scholarly activity by presenting posters at academic meetings. Although recommendations from national organizations are available, evidence identifying which components are most important is not. To develop and test an evaluation tool to measure the quality of case report posters and identify the specific components most in need of improvement. Faculty evaluators reviewed case report posters and provided on-site feedback to presenters at poster sessions of four annual academic general internal medicine meetings. A newly developed ten-item evaluation form measured poster quality for specific components of content, discussion, and format (5-point Likert scale, 1 = lowest, 5 = highest). Evaluation tool performance, including Cronbach alpha and inter-rater reliability, overall poster scores, differences across meetings and evaluators and specific components of the posters most in need of improvement. Forty-five evaluators from 20 medical institutions reviewed 347 posters. Cronbach's alpha of the evaluation form was 0.84 and inter-rater reliability, Spearman's rho 0.49 (p < 0.001). The median score was 4.1 (Q1 -Q3, 3.7-4.6)(Q1 = 25th, Q3 = 75th percentile). The national meeting median score was higher than the regional meetings (4.4 vs, 4.0, P < 0.001). We found no difference in faculty scores. The following areas were identified as most needing improvement: clearly state learning objectives, tie conclusions to learning objectives, and use appropriate amount of words. Our evaluation tool provides empirical data to guide trainees as they prepare posters for presentation which may improve poster quality and enhance their scholarly productivity.

  7. Human Health Concenrs of Metalworking Fluid Components

    NASA Astrophysics Data System (ADS)

    Gerulová, Kristína; Buranská, Eva; Soldán, Maroš

    2017-06-01

    Exploration of 209 available Material safety data sheets of 85 straight oils, 46 emulsions, 51 semi-synthetics and 27 synthetics was carried out to provide a report on the most widely used components defined as dangerous substances. As many as 217 of different substances of which 15 were identified as biocides, 17 as corrosion inhibitors or neutralizing agent, 17 were lubricity improvers and 38 different base fluids, lubricity solvents or surfactants, while 93 substances were not identified specifically and 37 substances occurred only once. This article is focused on the list of base fluids in straight oils and their possible health effects.

  8. Molecular Analysis of the Caries Biofilm in Young Permanent Teeth

    DTIC Science & Technology

    2006-01-01

    caries has been the subject of much study. Dental caries results from acid production of bacteria in dental plaque. Clarke was the first to identify...genetically different from the probiotic counterparts, and identify specific oral bacteria distributed on various tooth surfaces. Understanding the...does your child like to have for snack foods ? (cookies, cereal, fruit, chips, candy, fruit snacks) How often do are they snacking on these foods

  9. Epigenetic transgenerational inheritance of somatic transcriptomes and epigenetic control regions

    PubMed Central

    2012-01-01

    Background Environmentally induced epigenetic transgenerational inheritance of adult onset disease involves a variety of phenotypic changes, suggesting a general alteration in genome activity. Results Investigation of different tissue transcriptomes in male and female F3 generation vinclozolin versus control lineage rats demonstrated all tissues examined had transgenerational transcriptomes. The microarrays from 11 different tissues were compared with a gene bionetwork analysis. Although each tissue transgenerational transcriptome was unique, common cellular pathways and processes were identified between the tissues. A cluster analysis identified gene modules with coordinated gene expression and each had unique gene networks regulating tissue-specific gene expression and function. A large number of statistically significant over-represented clusters of genes were identified in the genome for both males and females. These gene clusters ranged from 2-5 megabases in size, and a number of them corresponded to the epimutations previously identified in sperm that transmit the epigenetic transgenerational inheritance of disease phenotypes. Conclusions Combined observations demonstrate that all tissues derived from the epigenetically altered germ line develop transgenerational transcriptomes unique to the tissue, but common epigenetic control regions in the genome may coordinately regulate these tissue-specific transcriptomes. This systems biology approach provides insight into the molecular mechanisms involved in the epigenetic transgenerational inheritance of a variety of adult onset disease phenotypes. PMID:23034163

  10. Comparative genomic analysis of Helicobacter pylori from Malaysia identifies three distinct lineages suggestive of differential evolution

    PubMed Central

    Kumar, Narender; Mariappan, Vanitha; Baddam, Ramani; Lankapalli, Aditya K.; Shaik, Sabiha; Goh, Khean-Lee; Loke, Mun Fai; Perkins, Tim; Benghezal, Mohammed; Hasnain, Seyed E.; Vadivelu, Jamuna; Marshall, Barry J.; Ahmed, Niyaz

    2015-01-01

    The discordant prevalence of Helicobacter pylori and its related diseases, for a long time, fostered certain enigmatic situations observed in the countries of the southern world. Variation in H. pylori infection rates and disease outcomes among different populations in multi-ethnic Malaysia provides a unique opportunity to understand dynamics of host–pathogen interaction and genome evolution. In this study, we extensively analyzed and compared genomes of 27 Malaysian H. pylori isolates and identified three major phylogeographic lineages: hspEastAsia, hpEurope and hpSouthIndia. The analysis of the virulence genes within the core genome, however, revealed a comparable pathogenic potential of the strains. In addition, we identified four genes limited to strains of East-Asian lineage. Our analyses identified a few strain-specific genes encoding restriction modification systems and outlined 311 core genes possibly under differential evolutionary constraints, among the strains representing different ethnic groups. The cagA and vacA genes also showed variations in accordance with the host genetic background of the strains. Moreover, restriction modification genes were found to be significantly enriched in East-Asian strains. An understanding of these variations in the genome content would provide significant insights into various adaptive and host modulation strategies harnessed by H. pylori to effectively persist in a host-specific manner. PMID:25452339

  11. Source Identification of Human Biological Materials and Its Prospect in Forensic Science.

    PubMed

    Zou, K N; Gui, C; Gao, Y; Yang, F; Zhou, H G

    2016-06-01

    Source identification of human biological materials in crime scene plays an important role in reconstructing the crime process. Searching specific genetic markers to identify the source of different human biological materials is the emphasis and difficulty of the research work of legal medical experts in recent years. This paper reviews the genetic markers which are used for identifying the source of human biological materials and studied widely, such as DNA methylation, mRNA, microRNA, microflora and protein, etc. By comparing the principles and methods of source identification of human biological materials using different kinds of genetic markers, different source of human biological material owns suitable marker types and can be identified by detecting single genetic marker or combined multiple genetic markers. Though there is no uniform standard and method for identifying the source of human biological materials in forensic laboratories at present, the research and development of a series of mature and reliable methods for distinguishing different human biological materials play the role as forensic evidence which will be the future development direction. Copyright© by the Editorial Department of Journal of Forensic Medicine.

  12. Quantification of peptides released during in vitro digestion of cooked meat.

    PubMed

    Sayd, T; Chambon, C; Santé-Lhoutellier, V

    2016-04-15

    We aimed to identify and quantify the peptides generated during in vitro digestion of cooked meat by liquid chromatography coupled with high resolution mass spectrometer. A total of 940 non-redundant peptides in the gastric compartment and 989 non-redundant peptides in the intestinal compartment were quantified and identified. Among the 71 different proteins identified, 43 meat proteins were found in the two digestive compartments, 20 proteins were specific to the gastric compartment and 8 proteins to the intestinal compartment. In terms of estimation, the proteins involved in muscle contraction and structure were preferentially enzymatically hydrolyzed in the small intestine. The effect of cooking provided different but less clear patterns of digestion. To the best of our knowledge, this constitutes the highest number of peptides identified in beef meat digests and provides a comprehensive database for meat protein digestion associated with cooking conditions. Such quantitative and qualitative differences may have important nutritional consequences. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. On the identifiability of inertia parameters of planar Multi-Body Space Systems

    NASA Astrophysics Data System (ADS)

    Nabavi-Chashmi, Seyed Yaser; Malaek, Seyed Mohammad-Bagher

    2018-04-01

    This work describes a new formulation to study the identifiability characteristics of Serially Linked Multi-body Space Systems (SLMBSS). The process exploits the so called "Lagrange Formulation" to develop a linear form of Equations of Motion w.r.t the system Inertia Parameters (IPs). Having developed a specific form of regressor matrix, we aim to expedite the identification process. The new approach allows analytical as well as numerical identification and identifiability analysis for different SLMBSSs' configurations. Moreover, the explicit forms of SLMBSSs identifiable parameters are derived by analyzing the identifiability characteristics of the robot. We further show that any SLMBSS designed with Variable Configurations Joint allows all IPs to be identifiable through comparing two successive identification outcomes. This feature paves the way to design new class of SLMBSS for which accurate identification of all IPs is at hand. Different case studies reveal that proposed formulation provides fast and accurate results, as required by the space applications. Further studies might be necessary for cases where planar-body assumption becomes inaccurate.

  14. Exploring the experience of facilitating self-management with minority ethnic stroke survivors: a qualitative study of therapists' perceptions

    PubMed Central

    Jones, Fiona; Kilbride, Cherry; Victor, Christina

    2014-01-01

    Purpose: The utility of self-management with people from minority ethnic backgrounds has been questioned, resulting in the development of culturally specific tools. Yet, the use of stroke specific self-management programmes is underexplored in these high risk groups. This article presents the experience of stroke therapists in using a stroke specific self-management programme with stroke survivors from minority ethnic backgrounds. Methods: 26 stroke therapists with experience of using the self-management programme with stroke survivors from minority ethnic backgrounds participated in semi-structured interviews. These were audio recorded, transcribed verbatim and analysed thematically. Results: Three themes were identified. One questioned perceived differences in stroke survivors interaction with self-management based on ethnicity. The other themes contrasted with this view demonstrating two areas in which ethnic and cultural attributes were deemed to influence the self-management process both positively and negatively. Aspects of knowledge of health, illness and recovery, religion, family and the professionals themselves are highlighted. Conclusions: This study indicates that ethnicity should not be considered a limitation to the use of an individualized stroke specific self-management programme. However, it highlights potential facilitators and barriers, many of which relate to the capacity of the professional to effectively navigate cultural and ethnic differences. Implications for Rehabilitation Stroke therapists suggest that ethnicity should not be considered a barrier to successful engagement with a stroke specific self-management programme. Health, illness and recovery beliefs along with religion and the specific role of the family do however need to be considered to maximize the effectiveness of the programme. A number of the facilitators and barriers identified are not unique to stroke survivors from ethnic minority communities, nor shared by all. The therapists skills at negotiating identified barriers to self-management are highlighted as an area for further development. PMID:24670190

  15. Discovery of specific ligands for oral squamous carcinoma to develop anti-cancer drug loaded precise targeting nanotherapeutics.

    PubMed

    Yang, Fan; Liu, Ruiwu; Kramer, Randall; Xiao, Wenwu; Jordan, Richard; Lam, Kit S

    2012-12-01

    Oral squamous cell carcinoma has a low five-year survival rate, which may be due to late detection and a lack of effective tumor-specific therapies. Using a high throughput drug discovery strategy termed one-bead one-compound combinatorial library, the authors identified six compounds with high binding affinity to different human oral squamous cell carcinoma cell lines but not to normal cells. Current work is under way to develop these ligands to oral squamous cell carcinoma specific imaging probes or therapeutic agents.

  16. A parallel genome-wide RNAi screening strategy to identify host proteins important for entry of Marburg virus and H5N1 influenza virus.

    PubMed

    Cheng, Han; Koning, Katie; O'Hearn, Aileen; Wang, Minxiu; Rumschlag-Booms, Emily; Varhegyi, Elizabeth; Rong, Lijun

    2015-11-24

    Genome-wide RNAi screening has been widely used to identify host proteins involved in replication and infection of different viruses, and numerous host factors are implicated in the replication cycles of these viruses, demonstrating the power of this approach. However, discrepancies on target identification of the same viruses by different groups suggest that high throughput RNAi screening strategies need to be carefully designed, developed and optimized prior to the large scale screening. Two genome-wide RNAi screens were performed in parallel against the entry of pseudotyped Marburg viruses and avian influenza virus H5N1 utilizing an HIV-1 based surrogate system, to identify host factors which are important for virus entry. A comparative analysis approach was employed in data analysis, which alleviated systematic positional effects and reduced the false positive number of virus-specific hits. The parallel nature of the strategy allows us to easily identify the host factors for a specific virus with a greatly reduced number of false positives in the initial screen, which is one of the major problems with high throughput screening. The power of this strategy is illustrated by a genome-wide RNAi screen for identifying the host factors important for Marburg virus and/or avian influenza virus H5N1 as described in this study. This strategy is particularly useful for highly pathogenic viruses since pseudotyping allows us to perform high throughput screens in the biosafety level 2 (BSL-2) containment instead of the BSL-3 or BSL-4 for the infectious viruses, with alleviated safety concerns. The screening strategy together with the unique comparative analysis approach makes the data more suitable for hit selection and enables us to identify virus-specific hits with a much lower false positive rate.

  17. A strategy for evaluating pathway analysis methods.

    PubMed

    Yu, Chenggang; Woo, Hyung Jun; Yu, Xueping; Oyama, Tatsuya; Wallqvist, Anders; Reifman, Jaques

    2017-10-13

    Researchers have previously developed a multitude of methods designed to identify biological pathways associated with specific clinical or experimental conditions of interest, with the aim of facilitating biological interpretation of high-throughput data. Before practically applying such pathway analysis (PA) methods, we must first evaluate their performance and reliability, using datasets where the pathways perturbed by the conditions of interest have been well characterized in advance. However, such 'ground truths' (or gold standards) are often unavailable. Furthermore, previous evaluation strategies that have focused on defining 'true answers' are unable to systematically and objectively assess PA methods under a wide range of conditions. In this work, we propose a novel strategy for evaluating PA methods independently of any gold standard, either established or assumed. The strategy involves the use of two mutually complementary metrics, recall and discrimination. Recall measures the consistency of the perturbed pathways identified by applying a particular analysis method to an original large dataset and those identified by the same method to a sub-dataset of the original dataset. In contrast, discrimination measures specificity-the degree to which the perturbed pathways identified by a particular method to a dataset from one experiment differ from those identifying by the same method to a dataset from a different experiment. We used these metrics and 24 datasets to evaluate six widely used PA methods. The results highlighted the common challenge in reliably identifying significant pathways from small datasets. Importantly, we confirmed the effectiveness of our proposed dual-metric strategy by showing that previous comparative studies corroborate the performance evaluations of the six methods obtained by our strategy. Unlike any previously proposed strategy for evaluating the performance of PA methods, our dual-metric strategy does not rely on any ground truth, either established or assumed, of the pathways perturbed by a specific clinical or experimental condition. As such, our strategy allows researchers to systematically and objectively evaluate pathway analysis methods by employing any number of datasets for a variety of conditions.

  18. How to identify the key factors that affect driver perception of accident risk. A comparison between Italian and Spanish driver behavior.

    PubMed

    de Oña, Juan; de Oña, Rocio; Eboli, Laura; Forciniti, Carmen; Mazzulla, Gabriella

    2014-12-01

    Road crashes can be caused by different factors, including infrastructure, vehicles, and human variables. Many research studies have focused solely on identifying the key factors that cause road crashes. From these studies, it emerged that human factors have the most relevant impact on accident severity. More specifically, accident severity depends on several factors related directly to the driver, i.e., driving experience, driver's socio-economic characteristics, and driving behavior and attitudes. In this paper, we investigate driver behaviors and attitudes while driving and specifically focus on different methods for identifying the factors that most affect the driver's perception of accident risk. To this end, we designed and conducted a survey in two different European contexts: the city of Cosenza, which is located in the south of Italy, and the city of Granada, which is located in the south of Spain. Samples of drivers were contacted for their opinions on certain aspects of driving rules and attitudes while driving, and different types of questions were addressed to the drivers to assess their judgments of these aspects. Consequently, different methods of data analysis were applied to determine the aspects that heavily influence driver perception of accident risk. An experiment based on the stated preferences (SP) was carried out with the drivers, and the SP data were analyzed using an ordered probit (OP) model. Interesting findings emerged from different analyses of the data and from the comparisons among the data collected in the two different territorial contexts. We found that both Italian and Spanish drivers consider driving in an altered psychophysical state and violating the overtaking rules to be the most risky behaviors. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Planning for Integrating Teaching Technologies

    ERIC Educational Resources Information Center

    Aaron, Mandie; Dicks, Dennis; Ives, Cindy; Montgomery, Brenda

    2004-01-01

    Teaching technologies offer pedagogical advantages which vary with specific contexts. Successfully integrating them hinges on clearly identifying pedagogical goals, then planning for the many decisions that technological change demands. In examining different ways of organizing this process, we have applied planning tools from other…

  20. Differential Pathways to Violence and Self-Injurious Behavior: African American and White Girls in the Juvenile Justice System

    ERIC Educational Resources Information Center

    Holsinger, Kristi; Holsinger, Alexander M.

    2005-01-01

    Since the early 1990s, research, largely from a feminist perspective, has been devoted to identifying the "gender-specific needs" of delinquent girls. This article explores racial differences between girls and how these differences may affect the commission of violent behavior and self-injurious behavior. Self-report data were collected…

  1. Testing Models for the Contributions of Genes and Environment to Developmental Change in Adolescent Depression

    PubMed Central

    Eaves, Lindon J.; Maes, Hermine; Silberg, Judy L.

    2015-01-01

    We tested two models to identify the genetic and environmental processes underlying longitudinal changes in depression among adolescents. The first assumes that observed changes in covariance structure result from the unfolding of inherent, random individual differences in the overall levels and rates of change in depression over time (random growth curves). The second assumes that observed changes are due to time-specific random effects (innovations) accumulating over time (autoregressive effects). We found little evidence of age-specific genetic effects or persistent genetic innovations. Instead, genetic effects are consistent with a gradual unfolding in the liability to depression and rates of change with increasing age. Likewise, the environment also creates significant individual differences in overall levels of depression and rates of change. However, there are also time-specific environmental experiences that persist with fidelity. The implications of these differing genetic and environmental mechanisms in the etiology of depression are considered. PMID:25894924

  2. Testing Models for the Contributions of Genes and Environment to Developmental Change in Adolescent Depression.

    PubMed

    Gillespie, Nathan A; Eaves, Lindon J; Maes, Hermine; Silberg, Judy L

    2015-07-01

    We tested two models to identify the genetic and environmental processes underlying longitudinal changes in depression among adolescents. The first assumes that observed changes in covariance structure result from the unfolding of inherent, random individual differences in the overall levels and rates of change in depression over time (random growth curves). The second assumes that observed changes are due to time-specific random effects (innovations) accumulating over time (autoregressive effects). We found little evidence of age-specific genetic effects or persistent genetic innovations. Instead, genetic effects are consistent with a gradual unfolding in the liability to depression and rates of change with increasing age. Likewise, the environment also creates significant individual differences in overall levels of depression and rates of change. However, there are also time-specific environmental experiences that persist with fidelity. The implications of these differing genetic and environmental mechanisms in the etiology of depression are considered.

  3. Profound Tissue Specificity in Proliferation Control Underlies Cancer Drivers and Aneuploidy Patterns.

    PubMed

    Sack, Laura Magill; Davoli, Teresa; Li, Mamie Z; Li, Yuyang; Xu, Qikai; Naxerova, Kamila; Wooten, Eric C; Bernardi, Ronald J; Martin, Timothy D; Chen, Ting; Leng, Yumei; Liang, Anthony C; Scorsone, Kathleen A; Westbrook, Thomas F; Wong, Kwok-Kin; Elledge, Stephen J

    2018-04-05

    Genomics has provided a detailed structural description of the cancer genome. Identifying oncogenic drivers that work primarily through dosage changes is a current challenge. Unrestrained proliferation is a critical hallmark of cancer. We constructed modular, barcoded libraries of human open reading frames (ORFs) and performed screens for proliferation regulators in multiple cell types. Approximately 10% of genes regulate proliferation, with most performing in an unexpectedly highly tissue-specific manner. Proliferation drivers in a given cell type showed specific enrichment in somatic copy number changes (SCNAs) from cognate tumors and helped predict aneuploidy patterns in those tumors, implying that tissue-type-specific genetic network architectures underlie SCNA and driver selection in different cancers. In vivo screening confirmed these results. We report a substantial contribution to the catalog of SCNA-associated cancer drivers, identifying 147 amplified and 107 deleted genes as potential drivers, and derive insights about the genetic network architecture of aneuploidy in tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. An ontology for major histocompatibility restriction.

    PubMed

    Vita, Randi; Overton, James A; Seymour, Emily; Sidney, John; Kaufman, Jim; Tallmadge, Rebecca L; Ellis, Shirley; Hammond, John; Butcher, Geoff W; Sette, Alessandro; Peters, Bjoern

    2016-01-01

    MHC molecules are a highly diverse family of proteins that play a key role in cellular immune recognition. Over time, different techniques and terminologies have been developed to identify the specific type(s) of MHC molecule involved in a specific immune recognition context. No consistent nomenclature exists across different vertebrate species. To correctly represent MHC related data in The Immune Epitope Database (IEDB), we built upon a previously established MHC ontology and created an ontology to represent MHC molecules as they relate to immunological experiments. This ontology models MHC protein chains from 16 species, deals with different approaches used to identify MHC, such as direct sequencing verses serotyping, relates engineered MHC molecules to naturally occurring ones, connects genetic loci, alleles, protein chains and multi-chain proteins, and establishes evidence codes for MHC restriction. Where available, this work is based on existing ontologies from the OBO foundry. Overall, representing MHC molecules provides a challenging and practically important test case for ontology building, and could serve as an example of how to integrate other ontology building efforts into web resources.

  5. Risk factors of non-specific spinal pain in childhood.

    PubMed

    Szita, Julia; Boja, Sara; Szilagyi, Agnes; Somhegyi, Annamaria; Varga, Peter Pal; Lazary, Aron

    2018-05-01

    Non-specific spinal pain can occur at all ages and current evidence suggests that pediatric non-specific spinal pain is predictive for adult spinal conditions. A 5-year long, prospective cohort study was conducted to identify the lifestyle and environmental factors leading to non-specific spinal pain in childhood. Data were collected from school children aged 7-16 years, who were randomly selected from three different geographic regions in Hungary. The risk factors were measured with a newly developed patient-reported questionnaire (PRQ). The quality of the instrument was assessed by the reliability with the test-retest method. Test (N = 952) and validity (N = 897) datasets were randomly formed. Risk factors were identified with uni- and multivariate logistic regression models and the predictive performance of the final model was evaluated using the receiver operating characteristic (ROC) method. The final model was built up by seven risk factors for spinal pain for days; age > 12 years, learning or watching TV for more than 2 h/day, uncomfortable school-desk, sleeping problems, general discomfort and positive familiar medical history (χ 2  = 101.07; df = 8; p < 0.001). The probabilistic performance was confirmed with ROC analysis on the test and validation cohorts (AUC = 0.76; 0.71). A simplified risk scoring system showed increasing possibility for non-specific spinal pain depending on the number of the identified risk factors (χ 2  = 65.0; df = 4; p < 0.001). Seven significant risk factors of non-specific spinal pain in childhood were identified using the new, easy to use and reliable PRQ which makes it possible to stratify the children according to their individual risk. These slides can be retrieved under Electronic Supplementary Material.

  6. Rapid Identification of Cell-Specific, Internalizing RNA Aptamers with Bioinformatics Analyses of a Cell-Based Aptamer Selection

    PubMed Central

    Thiel, William H.; Bair, Thomas; Peek, Andrew S.; Liu, Xiuying; Dassie, Justin; Stockdale, Katie R.; Behlke, Mark A.; Miller, Francis J.; Giangrande, Paloma H.

    2012-01-01

    Background The broad applicability of RNA aptamers as cell-specific delivery tools for therapeutic reagents depends on the ability to identify aptamer sequences that selectively access the cytoplasm of distinct cell types. Towards this end, we have developed a novel approach that combines a cell-based selection method (cell-internalization SELEX) with high-throughput sequencing (HTS) and bioinformatics analyses to rapidly identify cell-specific, internalization-competent RNA aptamers. Methodology/Principal Findings We demonstrate the utility of this approach by enriching for RNA aptamers capable of selective internalization into vascular smooth muscle cells (VSMCs). Several rounds of positive (VSMCs) and negative (endothelial cells; ECs) selection were performed to enrich for aptamer sequences that preferentially internalize into VSMCs. To identify candidate RNA aptamer sequences, HTS data from each round of selection were analyzed using bioinformatics methods: (1) metrics of selection enrichment; and (2) pairwise comparisons of sequence and structural similarity, termed edit and tree distance, respectively. Correlation analyses of experimentally validated aptamers or rounds revealed that the best cell-specific, internalizing aptamers are enriched as a result of the negative selection step performed against ECs. Conclusions and Significance We describe a novel approach that combines cell-internalization SELEX with HTS and bioinformatics analysis to identify cell-specific, cell-internalizing RNA aptamers. Our data highlight the importance of performing a pre-clear step against a non-target cell in order to select for cell-specific aptamers. We expect the extended use of this approach to enable the identification of aptamers to a multitude of different cell types, thereby facilitating the broad development of targeted cell therapies. PMID:22962591

  7. Sex-specific predictors of inpatient rehabilitation outcomes after traumatic brain injury

    PubMed Central

    Chan, Vincy; Mollayeva, Tatyana; Ottenbacher, Kenneth J.; Colantonio, Angela

    2016-01-01

    Objective To identify sex-specific predictors of inpatient rehabilitation outcomes among patients with a traumatic brain injury (TBI) from a population based perspective. Design Retrospective cohort study Setting Ontario, Canada Participants Patients in inpatient rehabilitation for a TBI within one year of acute care discharge between 2008/09 and 2011/12 (N=1,730, 70% male, 30% female). Interventions None Main Outcome Measures Inpatient rehabilitation length of stay, total Functional Independence Measure (FIM™) score, and motor and cognitive FIM™ ratings at discharge. Results Sex, as a covariate in multivariable linear regression models, was not a significant predictor of rehabilitation outcomes. While many of the predictors examined were similar across males and females, sex-specific multivariable models identified some predictors of rehabilitation outcome that are specific for males and females; mechanism of injury (p<.0001) was a significant predictor of functional outcome only among females while comorbidities (p<.0001) was a significant predictor for males only. Conclusions Predictors of outcomes after inpatient rehabilitation differed by sex, providing evidence for a sex-specific approach in planning and resource allocation for inpatient rehabilitation services for patients with TBI. PMID:26836952

  8. Sex-Specific Predictors of Inpatient Rehabilitation Outcomes After Traumatic Brain Injury.

    PubMed

    Chan, Vincy; Mollayeva, Tatyana; Ottenbacher, Kenneth J; Colantonio, Angela

    2016-05-01

    To identify sex-specific predictors of inpatient rehabilitation outcomes among patients with a traumatic brain injury (TBI) from a population-based perspective. Retrospective cohort study. Inpatient rehabilitation. Patients in inpatient rehabilitation for a TBI within 1 year of acute care discharge between 2008/2009 and 2011/2012 (N=1730, 70% men, 30% women). None. Inpatient rehabilitation length of stay, total FIM score, and motor and cognitive FIM ratings at discharge. Sex, as a covariate in multivariable linear regression models, was not a significant predictor of rehabilitation outcomes. Although many of the predictors examined were similar across men and women, sex-specific multivariable models identified some predictors of rehabilitation outcome that are specific for men and women; mechanism of injury (P<.0001) was a significant predictor of functional outcome only among women, whereas comorbidities (P<.0001) was a significant predictor for men only. Predictors of outcomes after inpatient rehabilitation differed by sex, providing evidence for a sex-specific approach in planning and resource allocation for inpatient rehabilitation services for patients with TBI. Copyright © 2016 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  9. Characterization of the Fine Specificity of Bovine CD8 T-Cell Responses to Defined Antigens from the Protozoan Parasite Theileria parva▿

    PubMed Central

    Graham, Simon P.; Pellé, Roger; Yamage, Mat; Mwangi, Duncan M.; Honda, Yoshikazu; Mwakubambanya, Ramadhan S.; de Villiers, Etienne P.; Abuya, Evelyne; Awino, Elias; Gachanja, James; Mbwika, Ferdinand; Muthiani, Anthony M.; Muriuki, Cecelia; Nyanjui, John K.; Onono, Fredrick O.; Osaso, Julius; Riitho, Victor; Saya, Rosemary M.; Ellis, Shirley A.; McKeever, Declan J.; MacHugh, Niall D.; Gilbert, Sarah C.; Audonnet, Jean-Christophe; Morrison, W. Ivan; van der Bruggen, Pierre; Taracha, Evans L. N.

    2008-01-01

    Immunity against the bovine intracellular protozoan parasite Theileria parva has been shown to be mediated by CD8 T cells. Six antigens targeted by CD8 T cells from T. parva-immune cattle of different major histocompatibility complex (MHC) genotypes have been identified, raising the prospect of developing a subunit vaccine. To facilitate further dissection of the specificity of protective CD8 T-cell responses and to assist in the assessment of responses to vaccination, we set out to identify the epitopes recognized in these T. parva antigens and their MHC restriction elements. Nine epitopes in six T. parva antigens, together with their respective MHC restriction elements, were successfully identified. Five of the cytotoxic-T-lymphocyte epitopes were found to be restricted by products of previously described alleles, and four were restricted by four novel restriction elements. Analyses of CD8 T-cell responses to five of the epitopes in groups of cattle carrying the defined restriction elements and immunized with live parasites demonstrated that, with one exception, the epitopes were consistently recognized by animals of the respective genotypes. The analysis of responses was extended to animals immunized with multiple antigens delivered in separate vaccine constructs. Specific CD8 T-cell responses were detected in 19 of 24 immunized cattle. All responder cattle mounted responses specific for antigens for which they carried an identified restriction element. By contrast, only 8 of 19 responder cattle displayed a response to antigens for which they did not carry an identified restriction element. These data demonstrate that the identified antigens are inherently dominant in animals with the corresponding MHC genotypes. PMID:18070892

  10. Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.

    PubMed

    Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong

    2018-02-01

    The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.

  11. Sex- and Age-Dependence of Region- and Layer-Specific Knee Cartilage Composition (Spin-Spin-Relaxation Time) in Healthy Reference Subjects

    PubMed Central

    Wirth, Wolfgang; Maschek, Susanne; Eckstein, Felix

    2016-01-01

    SUMMARY Compositional measures of articular cartilage are accessible in vivo by magnetic resonance imaging (MRI) based relaxometry and cartilage spin-spin transverse relaxation time (T2) has been related to tissue hydration, collagen content and orientation, and mechanical (functional) properties of articular cartilage. The objective of the current study was therefore to evaluate subregional variation, and sex- and age-differences, in laminar (deep and superficial) femorotibial cartilage T2 relaxation time in healthy adults. To this end, we studied the right knees of 92 healthy subjects from the Osteoarthritis Initiative reference cohort (55 women, 37 men; age range 45–78 years; BMI 24.4±3.1) without knee pain, radiographic signs, or risk factors of knee osteoarthritis in either knee. T2 of the deep and superficial femorotibial cartilages was determined in 16 femorotibial subregions, using a multi-echo spin-echo (MESE) MRI sequence. Significant subregional variation in femorotibial cartilage T2 was observed for the superficial and for the deep (both p<0.001) cartilage layer (Friedman test). Yet, layer- and region-specific femorotibial T2 did not differ between men and women, or between healthy adults below and above the median age (54y). In conclusion, this first study to report subregional (layer-specific) compositional variation of femorotibial cartilage T2 in healthy adults identifies significant differences in both superficial and deep cartilage T2 between femorotibial subregions. However, no relevant sex- or age-dependence of cartilage T2 was observed between age 45–78y. The findings suggest that a common, non-sex-specific set of layer-and region-specific T2 reference values can be used to identify compositional pathology in joint disease for this age group. PMID:27836800

  12. Effect of oligosaccharides on the growth of Lactobacillus delbrueckii subsp. bulgaricus strains isolated from dairy products.

    PubMed

    Ignatova, Tseteslava; Iliev, Ilia; Kirilov, Nikolai; Vassileva, Tonka; Dalgalarrondo, Michèle; Haertlé, Thomas; Chobert, Jean-Marc; Ivanova, Iskra

    2009-10-28

    Eighteen lactic acid bacteria (LAB) strains isolated from dairy products, all identified as Lactobacillus delbrueckii subsp. bulgaricus, were tested for their ability to grow on three different oligosaccharides: fructo-oligosaccharides (FOS), gluco-oligosaccharides (GOS) and galacto-oligosaccharides (GalOS). The growth of LAB on different oligosaccharides was very different. Study of the antimicrobial activities of these LAB indicated that the system of uptake of unusual sugars influenced in a specific way the production of antimicrobial substances (bacteriocins) specific against gram-negative bacteria. The added oligosaccharides induced LAB to form end-products of a typical mixed acid fermentation. The utilization of different types of oligosaccharides may help to explain the ability of Lactobacillus strains to compete with other bacteria in the ecosystem of the human gastro-intestinal tract.

  13. Concurrently examining unrealistic absolute and comparative optimism: Temporal shifts, individual-difference and event-specific correlates, and behavioural outcomes.

    PubMed

    Ruthig, Joelle C; Gamblin, Bradlee W; Jones, Kelly; Vanderzanden, Karen; Kehn, Andre

    2017-02-01

    Researchers have spent considerable effort examining unrealistic absolute optimism and unrealistic comparative optimism, yet there is a lack of research exploring them concurrently. This longitudinal study repeatedly assessed unrealistic absolute and comparative optimism within a performance context over several months to identify the degree to which they shift as a function of proximity to performance and performance feedback, their associations with global individual difference and event-specific factors, and their link to subsequent behavioural outcomes. Results showed similar shifts in unrealistic absolute and comparative optimism based on proximity to performance and performance feedback. Moreover, increases in both types of unrealistic optimism were associated with better subsequent performance beyond the effect of prior performance. However, several differences were found between the two forms of unrealistic optimism in their associations with global individual difference factors and event-specific factors, highlighting the distinctiveness of the two constructs. © 2016 The British Psychological Society.

  14. Identifying gender-preferred communication styles within online cancer communities: a retrospective, longitudinal analysis.

    PubMed

    Durant, Kathleen T; McCray, Alexa T; Safran, Charles

    2012-01-01

    The goal of this research is to determine if different gender-preferred social styles can be observed within the user interactions at an online cancer community. To achieve this goal, we identify and measure variables that pertain to each gender-specific social style. We perform social network and statistical analysis on the communication flow of 8,388 members at six different cancer forums over eight years. Kruskal-Wallis tests were conducted to measure the difference between the number of intimate (and highly intimate) dyads, relationship length, and number of communications. We determine that two patients are more likely to form an intimate bond on a gender-specific cancer forum (ovarian P = <0.0001, breast P = 0.0089, prostate P = 0.0021). Two female patients are more likely to form a highly intimate bond on a female-specific cancer forum (Ovarian P<0.0001, Breast P<0.01). Typically a male patient communicates with more members than a female patient (Ovarian forum P = 0.0406, Breast forum P = 0.0013). A relationship between two patients is longer on the gender-specific cancer forums than a connection between two members not identified as patients (ovarian forum P = 0.00406, breast forum P = 0.00013, prostate forum P = .0.0003). The high level of interconnectedness among the prostate patients supports the hypothesis that men prefer to socialize in large, interconnected, less-intimate groups. A female patient is more likely to form a highly intimate connection with another female patient; this finding is consistent with the hypothesis that woman prefer fewer, more intimate connections. The relationships of same-gender cancer patients last longer than other relationships; this finding demonstrates homophily within these online communities. Our findings regarding online communication preferences are in agreement with research findings from person-to-person communication preference studies. These findings should be considered when designing online communities as well as designing and evaluating psychosocial and educational interventions for cancer patients.

  15. Comparative transcriptome analysis of papilla and skin in the sea cucumber, Apostichopus japonicus.

    PubMed

    Zhou, Xiaoxu; Cui, Jun; Liu, Shikai; Kong, Derong; Sun, He; Gu, Chenlei; Wang, Hongdi; Qiu, Xuemei; Chang, Yaqing; Liu, Zhanjiang; Wang, Xiuli

    2016-01-01

    Papilla and skin are two important organs of the sea cucumber. Both tissues have ectodermic origin, but they are morphologically and functionally very different. In the present study, we performed comparative transcriptome analysis of the papilla and skin from the sea cucumber (Apostichopus japonicus) in order to identify and characterize gene expression profiles by using RNA-Seq technology. We generated 30.6 and 36.4 million clean reads from the papilla and skin and de novo assembled in 156,501 transcripts. The Gene Ontology (GO) analysis indicated that cell part, metabolic process and catalytic activity were the most abundant GO category in cell component, biological process and molecular funcation, respectively. Comparative transcriptome analysis between the papilla and skin allowed the identification of 1,059 differentially expressed genes, of which 739 genes were expressed at higher levels in papilla, while 320 were expressed at higher levels in skin. In addition, 236 differentially expressed unigenes were not annotated with any database, 160 of which were apparently expressed at higher levels in papilla, 76 were expressed at higher levels in skin. We identified a total of 288 papilla-specific genes, 171 skin-specific genes and 600 co-expressed genes. Also, 40 genes in papilla-specific were not annotated with any database, 2 in skin-specific. Development-related genes were also enriched, such as fibroblast growth factor, transforming growth factor-β, collagen-α2 and Integrin-α2, which may be related to the formation of the papilla and skin in sea cucumber. Further pathway analysis identified ten KEGG pathways that were differently enriched between the papilla and skin. The findings on expression profiles between two key organs of the sea cucumber should be valuable to reveal molecular mechanisms involved in the development of organs that are related but with morphological differences in the sea cucumber.

  16. Genome-wide meta-analysis identifies novel gender specific loci associated with thyroid antibodies level in Croatians.

    PubMed

    Matana, Antonela; Popović, Marijana; Boutin, Thibaud; Torlak, Vesela; Brdar, Dubravka; Gunjača, Ivana; Kolčić, Ivana; Boraska Perica, Vesna; Punda, Ante; Polašek, Ozren; Hayward, Caroline; Barbalić, Maja; Zemunik, Tatijana

    2018-04-18

    Autoimmune thyroid diseases (AITD) are multifactorial endocrine diseases most frequently accompanied by Tg and TPO autoantibodies. Both antibodies have a higher prevalence in females and act under a strong genetic influence. To identify novel variants underlying thyroid antibody levels, we performed GWAS meta-analysis on the plasma levels of TgAb and TPOAb in three Croatian cohorts, as well as gender specific GWAS and a bivariate analysis. No significant association was detected with the level of TgAb and TPOAb in the meta-analysis of GWAS or bivariate results for all individuals. The bivariate analysis in females only revealed a genome-wide significant association for the locus near GRIN3A (rs4457391, P = 7.76 × 10 -9 ). The same locus had borderline association with TPOAb levels in females (rs1935377, P = 8.58 × 10 -8 ). In conclusion, we identified a novel gender specific locus associated with TgAb and TPOAb levels. Our findings provide a novel insight into genetic and gender differences associated with thyroid antibodies. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. A Bottom-Up Proteomic Approach to Identify Substrate Specificity of Outer-Membrane Protease OmpT.

    PubMed

    Wood, Sarah E; Sinsinbar, Gaurav; Gudlur, Sushanth; Nallani, Madhavan; Huang, Che-Fan; Liedberg, Bo; Mrksich, Milan

    2017-12-22

    Identifying peptide substrates that are efficiently cleaved by proteases gives insights into substrate recognition and specificity, guides development of inhibitors, and improves assay sensitivity. Peptide arrays and SAMDI mass spectrometry were used to identify a tetrapeptide substrate exhibiting high activity for the bacterial outer-membrane protease (OmpT). Analysis of protease activity for the preferred residues at the cleavage site (P1, P1') and nearest-neighbor positions (P2, P2') and their positional interdependence revealed FRRV as the optimal peptide with the highest OmpT activity. Substituting FRRV into a fragment of LL37, a natural substrate of OmpT, led to a greater than 400-fold improvement in OmpT catalytic efficiency, with a k cat /K m value of 6.1×10 6  L mol -1  s -1 . Wild-type and mutant OmpT displayed significant differences in their substrate specificities, demonstrating that even modest mutants may not be suitable substitutes for the native enzyme. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Reconstruction of Tissue-Specific Metabolic Networks Using CORDA

    PubMed Central

    Schultz, André; Qutub, Amina A.

    2016-01-01

    Human metabolism involves thousands of reactions and metabolites. To interpret this complexity, computational modeling becomes an essential experimental tool. One of the most popular techniques to study human metabolism as a whole is genome scale modeling. A key challenge to applying genome scale modeling is identifying critical metabolic reactions across diverse human tissues. Here we introduce a novel algorithm called Cost Optimization Reaction Dependency Assessment (CORDA) to build genome scale models in a tissue-specific manner. CORDA performs more efficiently computationally, shows better agreement to experimental data, and displays better model functionality and capacity when compared to previous algorithms. CORDA also returns reaction associations that can greatly assist in any manual curation to be performed following the automated reconstruction process. Using CORDA, we developed a library of 76 healthy and 20 cancer tissue-specific reconstructions. These reconstructions identified which metabolic pathways are shared across diverse human tissues. Moreover, we identified changes in reactions and pathways that are differentially included and present different capacity profiles in cancer compared to healthy tissues, including up-regulation of folate metabolism, the down-regulation of thiamine metabolism, and tight regulation of oxidative phosphorylation. PMID:26942765

  19. Comparison of fracture rates between indigenous and non-indigenous populations: a systematic review protocol.

    PubMed

    Brennan-Olsen, Sharon L; Quirk, Shae E; Leslie, William D; Toombs, Maree; Holloway, Kara L; Hosking, Sarah M; Pasco, Julie A; Doolan, Brianna J; Page, Richard S; Williams, Lana J

    2016-08-26

    Over recent years, there has been concerted effort to 'close the gap' in the disproportionately reduced life expectancy and increased morbidity experienced by indigenous compared to non-indigenous persons. Specific to musculoskeletal health, some data suggest that indigenous peoples have a higher risk of sustaining a fracture compared to non-indigenous peoples. This creates an imperative to identify factors that could explain differences in fracture rates. This protocol presents our aim to conduct a systematic review, first, to determine whether differences in fracture rates exist for indigenous versus non-indigenous persons and, second, to identify any risk factors that might explain these differences. We will conduct a systematic search of PubMed, OVID, MEDLINE, CINAHL and EMBASE to identify articles that compare all-cause fracture rates at any skeletal site between indigenous and non-indigenous persons of any age. Eligibility of studies will be determined by 2 independent reviewers. Studies will be assessed for methodological quality using a previously published process. We will conduct a meta-analysis and use established statistical methods to identify and control for heterogeneity where appropriate. Should heterogeneity prevents numerical syntheses, we will undertake a best-evidence analysis to determine the level of evidence for differences in fracture between indigenous and non-indigenous persons. This systematic review will use published data; thus, ethical permissions are not required. In addition to peer-reviewed publication, findings will be presented at (inter)national conferences, disseminated electronically and in print, and will be made available to key country-specific decision-makers with authority for indigenous health. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  20. The multispecific thyroid hormone transporter OATP1C1 mediates cell-specific sulforhodamine 101-labeling of hippocampal astrocytes.

    PubMed

    Schnell, Christian; Shahmoradi, Ali; Wichert, Sven P; Mayerl, Steffen; Hagos, Yohannes; Heuer, Heike; Rossner, Moritz J; Hülsmann, Swen

    2015-01-01

    Sulforhodamine 101 (SR101) is widely used for astrocyte identification, though the labeling mechanism remains unknown and the efficacy of labeling in different brain regions is heterogeneous. By combining region-specific isolation of astrocytes followed by transcriptome analysis, two-photon excitation microscopy, and mouse genetics, we identified the thyroid hormone transporter OATP1C1 as the SR101-uptake transporter in hippocampus and cortex.

  1. Nonequilibrium Phase Chemistry in High Temperature Structure Alloys

    NASA Technical Reports Server (NTRS)

    Wang, R.

    1991-01-01

    Titanium and nickel aluminides of nonequilibrium microstructures and in thin gauge thickness were identified, characterized and produced for potential high temperature applications. A high rate sputter deposition technique for rapid surveillance of the microstructures and nonequilibrium phase is demonstrated. Alloys with specific compositions were synthesized with extended solid solutions, stable dispersoids, and specific phase boundaries associated with different heat treatments. Phase stability and mechanical behavior of these nonequilibrium alloys were investigated and compared.

  2. Using patients’ experiences to identify priorities for quality improvement in breast cancer care: patient narratives, surveys or both?

    PubMed Central

    2012-01-01

    Background Patients’ experiences have become central to assessing the performance of healthcare systems worldwide and are increasingly being used to inform quality improvement processes. This paper explores the relative value of surveys and detailed patient narratives in identifying priorities for improving breast cancer services as part of a quality improvement process. Methods One dataset was collected using a narrative interview approach, (n = 13) and the other using a postal survey (n = 82). Datasets were analyzed separately and then compared to determine whether similar priorities for improving patient experiences were identified. Results There were both similarities and differences in the improvement priorities arising from each approach. Day surgery was specifically identified as a priority in the narrative dataset but included in the survey recommendations only as part of a broader priority around improving inpatient experience. Both datasets identified appointment systems, patients spending enough time with staff, information about treatment and side effects and more information at the end of treatment as priorities. The specific priorities identified by the narrative interviews commonly related to ‘relational’ aspects of patient experience. Those identified by the survey typically related to more ‘functional’ aspects and were not always sufficiently detailed to identify specific improvement actions. Conclusions Our analysis suggests that whilst local survey data may act as a screening tool to identify potential problems within the breast cancer service, they do not always provide sufficient detail of what to do to improve that service. These findings may have wider applicability in other services. We recommend using an initial preliminary survey, with better use of survey open comments, followed by an in-depth qualitative analysis to help deliver improvements to relational and functional aspects of patient experience. PMID:22913525

  3. Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling.

    PubMed

    Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

    2007-01-01

    T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death.

  4. Impairment of organ-specific T cell negative selection by diabetes susceptibility genes: genomic analysis by mRNA profiling

    PubMed Central

    Liston, Adrian; Hardy, Kristine; Pittelkow, Yvonne; Wilson, Susan R; Makaroff, Lydia E; Fahrer, Aude M; Goodnow, Christopher C

    2007-01-01

    Background T cells in the thymus undergo opposing positive and negative selection processes so that the only T cells entering circulation are those bearing a T cell receptor (TCR) with a low affinity for self. The mechanism differentiating negative from positive selection is poorly understood, despite the fact that inherited defects in negative selection underlie organ-specific autoimmune disease in AIRE-deficient people and the non-obese diabetic (NOD) mouse strain Results Here we use homogeneous populations of T cells undergoing either positive or negative selection in vivo together with genome-wide transcription profiling on microarrays to identify the gene expression differences underlying negative selection to an Aire-dependent organ-specific antigen, including the upregulation of a genomic cluster in the cytogenetic band 2F. Analysis of defective negative selection in the autoimmune-prone NOD strain demonstrates a global impairment in the induction of the negative selection response gene set, but little difference in positive selection response genes. Combining expression differences with genetic linkage data, we identify differentially expressed candidate genes, including Bim, Bnip3, Smox, Pdrg1, Id1, Pdcd1, Ly6c, Pdia3, Trim30 and Trim12. Conclusion The data provide a molecular map of the negative selection response in vivo and, by analysis of deviations from this pathway in the autoimmune susceptible NOD strain, suggest that susceptibility arises from small expression differences in genes acting at multiple points in the pathway between the TCR and cell death. PMID:17239257

  5. Sex differences in discriminative power of volleyball game-related statistics.

    PubMed

    João, Paulo Vicente; Leite, Nuno; Mesquita, Isabel; Sampaio, Jaime

    2010-12-01

    To identify sex differences in volleyball game-related statistics, the game-related statistics of several World Championships in 2007 (N=132) were analyzed using the software VIS from the International Volleyball Federation. Discriminant analysis was used to identify the game-related statistics which better discriminated performances by sex. Analysis yielded an emphasis on fault serves (SC = -.40), shot spikes (SC = .40), and reception digs (SC = .31). Specific robust numbers represent that considerable variability was evident in the game-related statistics profile, as men's volleyball games were better associated with terminal actions (errors of service), and women's volleyball games were characterized by continuous actions (in defense and attack). These differences may be related to the anthropometric and physiological differences between women and men and their influence on performance profiles.

  6. Identifying Conservation and Restoration Priorities for Saproxylic and Old-Growth Forest Species: A Case Study in Switzerland

    NASA Astrophysics Data System (ADS)

    Lachat, Thibault; Bütler, Rita

    2009-07-01

    Saproxylic (dead-wood-associated) and old-growth species are among the most threatened species in European forest ecosystems, as they are susceptible to intensive forest management. Identifying areas with particular relevant features of biodiversity is of prime concern when developing species conservation and habitat restoration strategies and in optimizing resource investments. We present an approach to identify regional conservation and restoration priorities even if knowledge on species distribution is weak, such as for saproxylic and old-growth species in Switzerland. Habitat suitability maps were modeled for an expert-based selection of 55 focal species, using an ecological niche factor analyses (ENFA). All the maps were then overlaid, in order to identify potential species’ hotspots for different species groups of the 55 focal species (e.g., birds, fungi, red-listed species). We found that hotspots for various species groups did not correspond. Our results indicate that an approach based on “richness hotspots” may fail to conserve specific species groups. We hence recommend defining a biodiversity conservation strategy prior to implementing conservation/restoration efforts in specific regions. The conservation priority setting of the five biogeographical regions in Switzerland, however, did not differ when different hotspot definitions were applied. This observation emphasizes that the chosen method is robust. Since the ENFA needs only presence data, this species prediction method seems to be useful for any situation where the species distribution is poorly known and/or absence data are lacking. In order to identify priorities for either conservation or restoration efforts, we recommend a method based on presence data only, because absence data may reflect factors unrelated to species presence.

  7. Echinococcus granulosus sensu stricto, Echinococcus canadensis (G7), and Echinococcus ortleppi in fertile hydatid cysts isolated from cattle in Southern Brazil.

    PubMed

    Urach Monteiro, Danieli; de Azevedo, Maria Isabel; Weiblen, Carla; Correia Ribeiro, Tatiana; Emmanouilidis, Jéssica; Tonin, Alexandre Alberto; de Avila Botton, Sônia; de la Rue, Mário Luiz

    2016-12-01

    Echinococcosis is a cosmopolitan zoonotic infection that affects humans and animals. The aim of this study was to identify and characterize the fertile hydatid cysts from bovine viscera in order to verify different species and/or genotypes present in Southern Brazil. Firstly, cysts were collected from a slaughterhouse, which received animals from different regions of Rio Grande do Sul State (RS), considered an important area of occurrence of cystic echinococcosis. In total, 2396 cysts were analyzed by microscopy to verify the presence of protoscoleces. Protoscoleces were detected in 291 samples and were classified as fertile hydatid cysts. Total DNA was extracted from protoscoleces and amplified by polymerase chain reaction (PCR). Two hundred and fifty-one samples were identified by PCR and characterized as G5/G6/G7 genotypes, of which 40 belonged to Echinococcus granulosus sensu stricto (G1-G3). PCR was also performed, using G5-specific primers to identify 250 samples as Echinococcus ortleppi (G5). Only one sample was identified as Echinococcus canadensis (G7) by DNA sequencing using primers specific for the coxI gene. Phylogenetic analysis was also performed and identified three distinct groups E1 (G5), E2 (G7), and E3 (G1-G3), which were grouped according to similarity of their sequences. The study highlights the fact that E. granulosus sensu stricto, E. ortleppi, and E. canadensis (G7) were infecting cattle in RS, emphasizing the adaptation of different species of Echinococcus to this intermediate host. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Identifying conservation and restoration priorities for saproxylic and old-growth forest species: a case study in Switzerland.

    PubMed

    Lachat, Thibault; Bütler, Rita

    2009-07-01

    Saproxylic (dead-wood-associated) and old-growth species are among the most threatened species in European forest ecosystems, as they are susceptible to intensive forest management. Identifying areas with particular relevant features of biodiversity is of prime concern when developing species conservation and habitat restoration strategies and in optimizing resource investments. We present an approach to identify regional conservation and restoration priorities even if knowledge on species distribution is weak, such as for saproxylic and old-growth species in Switzerland. Habitat suitability maps were modeled for an expert-based selection of 55 focal species, using an ecological niche factor analyses (ENFA). All the maps were then overlaid, in order to identify potential species' hotspots for different species groups of the 55 focal species (e.g., birds, fungi, red-listed species). We found that hotspots for various species groups did not correspond. Our results indicate that an approach based on "richness hotspots" may fail to conserve specific species groups. We hence recommend defining a biodiversity conservation strategy prior to implementing conservation/restoration efforts in specific regions. The conservation priority setting of the five biogeographical regions in Switzerland, however, did not differ when different hotspot definitions were applied. This observation emphasizes that the chosen method is robust. Since the ENFA needs only presence data, this species prediction method seems to be useful for any situation where the species distribution is poorly known and/or absence data are lacking. In order to identify priorities for either conservation or restoration efforts, we recommend a method based on presence data only, because absence data may reflect factors unrelated to species presence.

  9. Variation among Staphylococcus aureus membrane vesicle proteomes affects cytotoxicity of host cells.

    PubMed

    Jeon, Hyejin; Oh, Man Hwan; Jun, So Hyun; Kim, Seung Il; Choi, Chi Won; Kwon, Hyo Il; Na, Seok Hyeon; Kim, Yoo Jeong; Nicholas, Asiimwe; Selasi, Gati Noble; Lee, Je Chul

    2016-04-01

    Staphylococcus aureus secretes membrane-derived vesicles (MVs), which can deliver virulence factors to host cells and induce cytopathology. However, the cytopathology of host cells induced by MVs derived from different S. aureus strains has not yet been characterized. In the present study, the cytotoxic activity of MVs from different S. aureus isolates on host cells was compared and the proteomes of S. aureus MVs were analyzed. The MVs purified from S. aureus M060 isolated from a patient with staphylococcal scalded skin syndrome showed higher cytotoxic activity toward host cells than that shown by MVs from three other clinical S. aureus isolates. S. aureus M060 MVs induced HEp-2 cell apoptosis in a dose-dependent manner, but the cytotoxic activity of MVs was completely abolished by treatment with proteinase K. In a proteomic analysis, the MVs from three S. aureus isolates not only carry 25 common proteins, but also carry ≥60 strain-specific proteins. All S. aureus MVs contained δ-hemolysin (Hld), γ-hemolysin, leukocidin D, and exfoliative toxin C, but exfoliative toxin A (ETA) was specifically identified in S. aureus M060 MVs. ETA was delivered to HEp-2 cells via S. aureus MVs. Both rETA and rHld induced cytotoxicity in HEp-2 cells. In conclusion, MVs from clinical S. aureus isolates differ with respect to cytotoxic activity in host cells, and these differences may result from differences in the MV proteomes. Further proteogenomic analysis or mutagenesis of specific genes is necessary to identify cytotoxic factors in S. aureus MVs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Ethics competences in the undergraduate medical education curriculum: the Spanish experience.

    PubMed

    Ferreira-Padilla, Guillermo; Ferrández-Antón, Teresa; Lolas-Stepke, Fernando; Almeida-Cabrera, Rut; Brunet, Joan; Bosch-Barrera, Joaquim

    2016-10-31

    Aim .To investigate if there are differences in medical ethics education between different schools of medicine in Spain, specifically between private and public schools and between recently founded schools and older ones. The curricula of medical degrees from all Spanish faculties were reviewed for the 2014/2015 academic year, identifying subjects concerning bioethics, deontology, and ethics. We identified the type of teaching, format and method of the course, the number of credits and hours, and the school year of each subject. An analysis with descriptive parameters and the Cohen's coefficient (d) was performed. All medical schools in Spain (n=44) were included. A mean of 3.64 European Credit Transfer and Accumulation System (ECTS) credits was specifically devoted to ethical values teaching in Spain. Private medical schools offered more credits than public ones (6.51 ECTS vs 2.88 ECTS, relevant difference: d=2.06>0.8), and the 10 most recently founded medical schools offered more credits than the 10 oldest (5.86 ECTS vs 2.63 ECTS, relevant difference: d=1.43>0.8). A mean of 36.75 hours was dedicated to ethics education. Although ethics education is incorporated into the training of future Spanish physicians, there is still notable heterogeneity between different medical schools in the time devoted to this topic.

  11. Nonadverse effects on allergenicity of isopentenyltransferase-transformed broccoli.

    PubMed

    Liao, E C; Chen, J T; Chao, M L; Yu, S C; Chang, C Y; Chu, W S; Tsai, J J

    2013-01-01

    Genetically modified organisms (GMOs) provide modern agriculture with improvements in efficiency and the benefits of enhanced food production; however, the potential impact of GMOs on human health has not yet been clarified. To investigate the allergenicity of isopentenyltransferase (ipt)-transformed broccoli compared with non-GM broccoli. Sera from allergic individuals were used to identify the allergenicity of GM and non-GM broccoli. Immunoglobulin (Ig) binding of different lines of GM and non-GM broccoli was identified using immunoblotting, enzyme-linked immunosorbent assay, and the histamin release assay. Positive reactions to broccoli (Brassica Oleracea) were observed in 7.02% of individuals. Specific IgE to broccoli and total IgE fro allergic individuals were well correlated. The different tests performed showed no significant differences in the allergenicity of conventionally raised and GM broccoli, indicating the absence of unexpected effects on allergenicity in ipt-transformed plants. Using Western blot analysis we detected heterogeneous IgE-reactive allergenic components in broccoli-allergic sera, but no significant differences between GM an non-GM broccoli were observed in serum from the same patients. Our study demonstrates that there are no differences between GM (ipt-transformed) broccoli and non-GM broccoli, as determined by specific IgE in sera from broccoli-allergic patients. This indicates that there were no unexpected effects on allergenicity in this GM broccoli.

  12. Hypochondriasis Differs From Panic Disorder and Social Phobia: Specific Processes Identified Within Patient Groups.

    PubMed

    Höfling, Volkmar; Weck, Florian

    2017-03-01

    Studies of the comorbidity of hypochondriasis have indicated high rates of cooccurrence with other anxiety disorders. In this study, the contrast among hypochondriasis, panic disorder, and social phobia was investigated using specific processes drawing on cognitive-perceptual models of hypochondriasis. Affective, behavioral, cognitive, and perceptual processes specific to hypochondriasis were assessed with 130 diagnosed participants based on the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, criteria (66 with hypochondriasis, 32 with panic disorder, and 32 with social phobia). All processes specific to hypochondriasis were more intense for patients with hypochondriasis in contrast to those with panic disorder or social phobia (0.61 < d < 2.67). No differences were found between those with hypochondriasis with comorbid disorders and those without comorbid disorders. Perceptual processes were shown to best discriminate between patients with hypochondriasis and those with panic disorder.

  13. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  14. Cross-cultural differences and sexual risk behavior of emerging adults.

    PubMed

    Thomas, Tami L; Yarandi, Hossein N; Dalmida, Safiya George; Frados, Andrew; Klienert, Kathleen

    2015-01-01

    The authors examined population-specific risk factors that increase emerging adults' risk of acquiring sexually transmitted infections (STIs), including the human papillomavirus (HPV). A cross-sectional sample of 335 diverse, emerging adults ages 18 to 24 years was recruited from a health center at a large university in the Southeastern United States. The mean age was 20.6 ± 1.9 years, majority were females (74.0%), and 61.0% were Hispanic. Findings revealed inconsistent condom use, reasons for not using condoms, and a need for more culturally specific intervention strategies. Healthcare providers should identify culturally specific reasons for inconsistent condom use, examine cultural and geographic differences in sexual risk behaviors among groups and communities, and modify communication, educational programs, and interventions accordingly. By adopting a multicultural approach to the control of STIs, nurses can address specific cultural attitudes and behaviors that may influence exposure to STIs, including HPV. © The Author(s) 2014.

  15. Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

    PubMed

    Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

    2014-06-01

    It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

  16. Methodology capture: discriminating between the "best" and the rest of community practice

    PubMed Central

    Eales, James M; Pinney, John W; Stevens, Robert D; Robertson, David L

    2008-01-01

    Background The methodologies we use both enable and help define our research. However, as experimental complexity has increased the choice of appropriate methodologies has become an increasingly difficult task. This makes it difficult to keep track of available bioinformatics software, let alone the most suitable protocols in a specific research area. To remedy this we present an approach for capturing methodology from literature in order to identify and, thus, define best practice within a field. Results Our approach is to implement data extraction techniques on the full-text of scientific articles to obtain the set of experimental protocols used by an entire scientific discipline, molecular phylogenetics. Our methodology for identifying methodologies could in principle be applied to any scientific discipline, whether or not computer-based. We find a number of issues related to the nature of best practice, as opposed to community practice. We find that there is much heterogeneity in the use of molecular phylogenetic methods and software, some of which is related to poor specification of protocols. We also find that phylogenetic practice exhibits field-specific tendencies that have increased through time, despite the generic nature of the available software. We used the practice of highly published and widely collaborative researchers ("expert" researchers) to analyse the influence of authority on community practice. We find expert authors exhibit patterns of practice common to their field and therefore act as useful field-specific practice indicators. Conclusion We have identified a structured community of phylogenetic researchers performing analyses that are customary in their own local community and significantly different from those in other areas. Best practice information can help to bridge such subtle differences by increasing communication of protocols to a wider audience. We propose that the practice of expert authors from the field of evolutionary biology is the closest to contemporary best practice in phylogenetic experimental design. Capturing best practice is, however, a complex task and should also acknowledge the differences between fields such as the specific context of the analysis. PMID:18761740

  17. Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme.

    PubMed Central

    Motorin, Y; Grosjean, H

    1999-01-01

    Several genes encoding putative RNA:5-methylcytidine-transferases (m5C-transferases) from different organisms, including yeast, have been identified by sequence homology with the recently identified 16S rRNA:m5C967-methyltransferase (gene SUN) from Escherichia coli. One of the yeast ORFs (YBL024w) was amplified by PCR, inserted in the expression vector pET28b, and the corresponding protein was hyperexpressed in E. coli BL21 (DE3). The resulting N-terminally His6-tagged recombinant Ybl024p was purified to apparent homogeneity by one-step affinity chromatography on Ni2+-NTA-agarose column. The activity and substrate specificity of the purified Ybl024p were tested in vitro using T7 transcripts of different yeast tRNAs as substrates and S-adenosyl-L-methionine as a donor of the methyl groups. The results indicate that yeast ORF YBL024w encodes S-adenosyl-L-methionine-dependent tRNA: m5C-methyltransferase that is capable of methylating cytosine to m5C at several positions in different yeast tRNAs and pre-tRNAs containing intron. Modification of tRNA occurs at all four positions (34, 40, 48, and 49) at which m5C has been found in yeast tRNAs sequenced so far. Disruption of the ORF YBL024w leads to the complete absence of m5C in total yeast tRNA. Moreover no tRNA:m5C-methyltransferase activity towards all potential m5C methylation sites was detected in the extract of the disrupted yeast strain. These results demonstrate that the protein product of a single gene is responsible for complete m5C methylation of yeast tRNA. Because this newly characterized multisite-specific modification enzyme Ybl024p is the fourth tRNA-specific methyltransferase identified in yeast, we suggest designating it as TRM4, the gene corresponding to ORF YBL024w. PMID:10445884

  18. Leveraging Genetic-Background Effects in Saccharomyces cerevisiae To Improve Lignocellulosic Hydrolysate Tolerance

    DOE PAGES

    Sardi, Maria; Rovinskiy, Nikolay; Zhang, Yaoping; ...

    2016-07-22

    We report a major obstacle to sustainable lignocellulosic biofuel production is microbe inhibition by the combinatorial stresses in pretreated plant hydrolysate. Chemical biomass pretreatment releases a suite of toxins that interact with other stressors, including high osmolarity and temperature, which together can have poorly understood synergistic effects on cells. Improving tolerance in industrial strains has been hindered, in part because the mechanisms of tolerance reported in the literature often fail to recapitulate in other strain backgrounds. Here, we explored and then exploited variations in stress tolerance, toxin-induced transcriptomic responses, and fitness effects of gene overexpression in different Saccharomyces cerevisiae (yeast)more » strains to identify genes and processes linked to tolerance of hydrolysate stressors. Using six different S. cerevisiae strains that together maximized phenotypic and genetic diversity, first we explored transcriptomic differences between resistant and sensitive strains to identify common and strain-specific responses. This comparative analysis implicated primary cellular targets of hydrolysate toxins, secondary effects of defective defense strategies, and mechanisms of tolerance. Dissecting the responses to individual hydrolysate components across strains pointed to synergistic interactions between osmolarity, pH, hydrolysate toxins, and nutrient composition. By characterizing the effects of high-copy gene overexpression in three different strains, we revealed the breadth of the background-specific effects of gene fitness contributions in synthetic hydrolysate. Lastly, our approach identified new genes for engineering improved stress tolerance in diverse strains while illuminating the effects of genetic background on molecular mechanisms.« less

  19. Variations Among Pilots from Different Flight Operations in Party Line Information Requirements for Situation Awareness

    NASA Technical Reports Server (NTRS)

    Pritchett, Amy; Hansman, John

    1997-01-01

    Current air traffic control communications use shared VHF voice frequencies from which pilots can obtain 'party line' information (PLI) by overhearing communications addressed to other aircraft. Previous studies have shown that pilots perceive PLI to be important. There is concern that some critical PLI may be lost in the proposed data link environment, where communications will be discretely addressed. Different types of flight operations will be equipped with data link equipment at different times, generating a mixed environment in which some pilots will rely on PLI, while others will receive their information by data link. To research the importance, availability, and accuracy of PLI and to query pilots on the information they feel is necessary for global situation awareness, a survey was distributed to pilots. The pilots were selected from four flight operation groups to study the variations in PLI requirements in the mixed data link environment. Pilots perceived PLI to be important overall, with specific traffic and weather information elements identified as critical. Most PLI elements followed a pattern of higher perceived importance during terminal area operations, final approach, and landing. Pilots from the different flight operation groups identified some elements as particularly important. In a free-response question designed to identify the information requirements for global situation awareness, pilots frequently indicated a need for traffic and weather information. The results of this survey reveal specific concerns to be addressed when implementing data link communications.

  20. Subcutaneous and gonadal adipose tissue transcriptome differences in lean and obese female dogs.

    PubMed

    Grant, Ryan W; Vester Boler, Brittany M; Ridge, Tonya K; Graves, Thomas K; Swanson, Kelly S

    2013-12-01

    Canine obesity leads to shortened life span and increased disease incidence. Adipose tissue depots are known to have unique metabolic and gene expression profiles in rodents and humans, but few comparisons of depot gene expression have been performed in the dog. Using microarray technology, our objective was to identify differentially expressed genes and enriched functional pathways between subcutaneous and gonadal adipose of lean and obese dogs to better understand the pathogenesis of obesity in the dog. Because no depot × body weight status interactions were identified in the microarray data, depot differences were the primary focus. A total of 946 and 703 transcripts were differentially expressed (FDR P < 0.05) between gonadal and subcutaneous adipose tissue in obese and lean dogs respectively. Of the adipose depot-specific differences in gene expression, 162 were present in both lean and obese dogs, with the majority (85%) expressed in the same direction. Both lean and obese dog gene lists had enrichment of the complement and coagulation cascade and systemic lupus erythematosus pathways. Obese dogs had enrichment of lysosome, extracellular matrix-receptor interaction, renin-angiotensin system and hematopoietic cell lineage pathways. Lean dogs had enrichment of glutathione metabolism and synthesis and degradation of ketone bodies. We have identified a core set of genes differentially expressed between subcutaneous and gonadal adipose tissue in dogs regardless of body weight. These genes contribute to depot-specific differences in immune function, extracellular matrix remodeling and lysosomal function and may contribute to the physiological differences noted between depots. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  1. Divergently expressed gene identification and interaction prediction of long noncoding RNA and mRNA involved in duck reproduction.

    PubMed

    Ren, Jindong; Du, Xue; Zeng, Tao; Chen, Li; Shen, Junda; Lu, Lizhi; Hu, Jianhong

    2017-10-01

    Long noncoding RNAs (lncRNAs) and divergently expressed genes exist widely in different tissues of mammals and birds, in which they are involved in various biological processes. However, there is limited information on their role in the regulation of normal biological processes during differentiation, development, and reproduction in birds. In this study, whole transcriptome strand-specific RNA sequencing of the ovary from young ducks (60days), first-laying ducks (160days), and old ducks, i.e., ducks that stopped laying eggs (490days) was performed. The lncRNAs and mRNAs from these ducks were systematically analyzed and identified by duck genome sequencing in the three study groups. The transcriptome from the duck ovary comprised 15,011 protein-coding genes and 2905 lncRNAs; all the lncRNAs were identified as novel long noncoding transcripts. The comparison of transcriptome data from different study groups identified 2240 divergent transcription genes and 135 divergently expressed lncRNAs, which differed among the groups; most of them were significantly downregulated with age. Among the divergent genes, 38 genes were related to the reproductive process and 6 genes were upregulated. Further prediction analysis revealed that 52 lncRNAs were closely correlated with divergent reproductive mRNAs. More importantly, 6 remarkable lncRNAs were correlated significantly with the conversion of the ovary in different phases. Our results aid in the understanding of the divergent transcriptome of duck ovary in different phases and the underlying mechanisms that drive the specificity of protein-coding genes and lncRNAs in duck ovary. Copyright © 2017. Published by Elsevier B.V.

  2. Ultrasound-Based Detection of Low Muscle Mass for Diagnosis of Sarcopenia in Older Adults.

    PubMed

    Minetto, Marco A; Caresio, Cristina; Menapace, Tommaso; Hajdarevic, Arnel; Marchini, Andrea; Molinari, Filippo; Maffiuletti, Nicola A

    2016-05-01

    To establish muscle-specific cut-off values for ultrasound-based detection of low muscle mass, and to assess its prevalence in a population of frail older subjects when applying the cut-points of different muscles and those of different sarcopenic indices. Cross-sectional study. Geriatric outpatient clinic and clinical research laboratory. A total of 44 older adults (30 women and 14 men, mean age 82 years, range 67-93 years) and 60 younger individuals (30 women and 30 men, mean age 26 years, range 20-36 years) participated. Body composition and thickness of 4 lower limb muscles (rectus femoris, vastus lateralis, tibialis anterior, medial gastrocnemius) were respectively assessed by bioelectrical impedance analysis (BIA) and ultrasonography. Site-specific cut-points for ultrasound-based assessment of low muscle mass (muscle thickness values 2 standard deviations below the gender-specific means of our sample of younger subjects) and comparative prevalence rates of low muscle mass. The following site-specific cut-points for muscle thickness were identified: rectus femoris: 20 mm in men and 16 mm in women; vastus lateralis: 17 mm in men and 15 mm in women; tibialis anterior: 23 mm in men and 22 mm in women; and medial gastrocnemius: 13 mm in both men and women. The prevalence of low muscle mass in older adults was highly dependent on the muscle being investigated; it varied from 86% for thigh muscles to 30% for leg muscles. Moreover, the prevalence of low muscle mass was highly dependent on the applied diagnostic criterion and on the adopted cut-off value; it ranged from 2% to 75% for different BIA-derived criteria. We suggest that muscle ultrasonography provides physiatrists with a practical and accurate tool for identifying individuals with low muscle mass. However, the usability of cut-off values established in our group of healthy younger subjects of white ethnicity to identify low muscle mass in older individuals of different ethnic groups remains to be demonstrated in future studies. Copyright © 2016 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

  3. Phenotyping and comparing the immune cell populations of free-ranging Atlantic bottlenose dolphins (Tursiops truncatus) and dolphins under human care.

    PubMed

    Nouri-Shirazi, Mahyar; Bible, Brittany F; Zeng, Menghua; Tamjidi, Saba; Bossart, Gregory D

    2017-03-27

    Studies suggest that free-ranging bottlenose dolphins exhibit a suppressed immune system because of exposure to contaminants or microorganisms. However, due to a lack of commercially available antibodies specific to marine mammal immune cell surface markers, the research has been indecisive. The purpose of this study was to identify cross-reactive terrestrial-specific antibodies in order to assess the changes in the immune cell populations of dolphins under human care and free-ranging dolphins. The blood and PBMC fraction of blood samples from human care and free-ranging dolphins were characterized by H&E staining of cytospin slides and flow cytometry using a panel of terrestrial-specific antibodies. In this study, we show that out of 65 terrestrial-specific antibodies tested, 11 were cross-reactive and identified dolphin immune cell populations within their peripheral blood. Using these antibodies, we found significant differences in the absolute number of cells expressing specific markers within their lymphocyte and monocyte fractions. Interestingly, the peripheral blood mononuclear cell profile of free-ranging dolphins retained an additional population of cells that divided them into two groups showing a low (<27%) or high (>56%) percentage of smaller cells resembling granulocytes. We found that the cross-reactive antibodies not only identified specific changes in the immune cells of free-ranging dolphins, but also opened the possibility to investigate the causal relationship between immunosuppression and mortality seen in free-ranging dolphins.

  4. Predictor variable resolution governs modeled soil types

    USDA-ARS?s Scientific Manuscript database

    Soil mapping identifies different soil types by compressing a unique suite of spatial patterns and processes across multiple spatial scales. It can be quite difficult to quantify spatial patterns of soil properties with remotely sensed predictor variables. More specifically, matching the right scale...

  5. COMPETITIVE METAGENOMIC DNA HYBRIDIZATION IDENTIFIES HOST-SPECIFIC GENETIC MARKERS IN HUMAN FECAL MICROBIAL COMMUNITIES

    EPA Science Inventory

    Although recent technological advances in DNA sequencing and computational biology now allow scientists to compare entire microbial genomes, the use of these approaches to discern key genomic differences between natural microbial communities remains prohibitively expensive for mo...

  6. Testing for developmental neurotoxicity using a battery of in vitro assays for key cellular events in neurodevelopment.

    PubMed

    Harrill, Joshua A; Freudenrich, Theresa; Wallace, Kathleen; Ball, Kenneth; Shafer, Timothy J; Mundy, William R

    2018-04-05

    Medium- to high-throughput in vitro assays that recapitulate the critical processes of nervous system development have been proposed as a means to facilitate rapid testing and identification of chemicals which may affect brain development. In vivo neurodevelopment is a complex progression of distinct cellular processes. Therefore, batteries of in vitro assays that model and quantify effects on a variety of neurodevelopmental processes have the potential to identify chemicals which may affect brain development at different developmental stages. In the present study, the results of concentration-response screening of 67 reference chemicals in a battery of high content imaging and microplate reader-based assays that evaluate neural progenitor cell proliferation, neural proginitor cell apoptosis, neurite initiation/outgrowth, neurite maturation and synaptogenesis are summarized and compared. The assay battery had a high degree of combined sensitivity (87%) for categorizing chemicals known to affect neurodevelopment as active and a moderate degree of combined specificity (71%) for categorizing chemicals not associated with affects on neurodevelopment as inactive. The combined sensitivity of the assay battery was higher compared to any individual assay while the combined specificity of the assay battery was lower compared to any individual assay. When selectivity of effects for a neurodevelopmental endpoint as compared to general cytotoxicity was taken into account, the combined sensitivity of the assay battery decreased (68%) while the combined specificity increased (93%). The identity and potency of chemicals identified as active varied across the assay battery, underscoring the need for use of a combination of diverse in vitro models to comprehensively screen chemicals and identify those which potentially affect neurodevelopment. Overall, these data indicate that a battery of assays which address many different processes in nervous system development may be used to identify potential developmental neurotoxicants and to distinguish specific from generalized cytotoxic effects with a high degree of success. Published by Elsevier Inc.

  7. Generation and characterization of antibodies specific for caspase-cleaved neo-epitopes: a novel approach

    PubMed Central

    Ai, X; Butts, B; Vora, K; Li, W; Tache-Talmadge, C; Fridman, A; Mehmet, H

    2011-01-01

    Apoptosis research has been significantly aided by the generation of antibodies against caspase-cleaved peptide neo-epitopes. However, most of these antibodies recognize the N-terminal fragment and are specific for the protein in question. The aim of this project was to create antibodies, which could identify caspase-cleaved proteins without a priori knowledge of the cleavage sites or even the proteins themselves. We hypothesized that many caspase-cleavage products might have a common antigenic shape, given that they must all fit into the same active site of caspases. Rabbits were immunized with the eight most prevalent exposed C-terminal tetrapeptide sequences following caspase cleavage. After purification of the antibodies we demonstrated (1) their specificity for exposed C-terminal (but not internal) peptides, (2) their ability to detect known caspase-cleaved proteins from apoptotic cell lysates or supernatants from apoptotic cell culture and (3) their ability to detect a caspase-cleaved protein whose tetrapeptide sequence differs from the eight tetrapeptides used to generate the antibodies. These antibodies have the potential to identify novel neo-epitopes produced by caspase cleavage and so can be used to identify pathway-specific caspase cleavage events in a specific cell type. Additionally this methodology may be applied to generate antibodies against products of other proteases, which have a well-defined and non-promiscuous cleavage activity. PMID:21881607

  8. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    PubMed

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-07

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

  9. Restricted Authentication and Encryption for Cyber-physical Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirkpatrick, Michael S; Bertino, Elisa; Sheldon, Frederick T

    2009-01-01

    Cyber-physical systems (CPS) are characterized by the close linkage of computational resources and physical devices. These systems can be deployed in a number of critical infrastructure settings. As a result, the security requirements of CPS are different than traditional computing architectures. For example, critical functions must be identified and isolated from interference by other functions. Similarly, lightweight schemes may be required, as CPS can include devices with limited computing power. One approach that offers promise for CPS security is the use of lightweight, hardware-based authentication. Specifically, we consider the use of Physically Unclonable Functions (PUFs) to bind an access requestmore » to specific hardware with device-specific keys. PUFs are implemented in hardware, such as SRAM, and can be used to uniquely identify the device. This technology could be used in CPS to ensure location-based access control and encryption, both of which would be desirable for CPS implementations.« less

  10. Effector profiles distinguish formae speciales of Fusarium oxysporum.

    PubMed

    van Dam, Peter; Fokkens, Like; Schmidt, Sarah M; Linmans, Jasper H J; Kistler, H Corby; Ma, Li-Jun; Rep, Martijn

    2016-11-01

    Formae speciales (ff.spp.) of the fungus Fusarium oxysporum are often polyphyletic within the species complex, making it impossible to identify them on the basis of conserved genes. However, sequences that determine host-specific pathogenicity may be expected to be similar between strains within the same forma specialis. Whole genome sequencing was performed on strains from five different ff.spp. (cucumerinum, niveum, melonis, radicis-cucumerinum and lycopersici). In each genome, genes for putative effectors were identified based on small size, secretion signal, and vicinity to a "miniature impala" transposable element. The candidate effector genes of all genomes were collected and the presence/absence patterns in each individual genome were clustered. Members of the same forma specialis turned out to group together, with cucurbit-infecting strains forming a supercluster separate from other ff.spp. Moreover, strains from different clonal lineages within the same forma specialis harbour identical effector gene sequences, supporting horizontal transfer of genetic material. These data offer new insight into the genetic basis of host specificity in the F. oxysporum species complex and show that (putative) effectors can be used to predict host specificity in F. oxysporum. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Differentiation in MALDI-TOF MS and FTIR spectra between two pathovars of Xanthomonas oryzae

    NASA Astrophysics Data System (ADS)

    Ge, Mengyu; Li, Bin; Wang, Li; Tao, Zhongyun; Mao, Shengfeng; Wang, Yangli; Xie, Guanlin; Sun, Guochang

    2014-12-01

    Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc) strains are closely related phenotypically and genetically, which make it difficult to differentiate between the two pathovars based on phenotypic and DNA-based methods. In this study, a fast and accurate method was developed based on the differences in MALDI-TOF MS and FTIR spectra between the two pathovars. MALDI-TOF MS analysis revealed that 9 and 10 peaks are specific to Xoo and Xoc, respectively, which can be used as biomarkers to identify and differentiate the two closely related pathovars. Furthermore, FTIR analysis showed that there is a significant difference in both the band frequencies and absorption intensity of various functional groups between the two pathovars. In particular, the 6 peaks at 3433, 2867, 1273, 1065, 983 and 951 cm-1 were specific to the Xoo strains, while one peak at 1572 cm-1 was specific to the Xoc strains. Overall, this study gives the first attempt to identify and differentiate the two pathovars of X. oryzae based on mass and FTIR spectra, which will be helpful for the early detection and prevention of the two rice diseases caused by both X. oryzae pathovars.

  12. Mesencephalic basolateral domain specification is dependent on Sonic Hedgehog

    PubMed Central

    Martinez-Lopez, Jesus E.; Moreno-Bravo, Juan A.; Madrigal, M. Pilar; Martinez, Salvador; Puelles, Eduardo

    2015-01-01

    In the study of central nervous system morphogenesis, the identification of new molecular markers allows us to identify domains along the antero-posterior and dorso-ventral (DV) axes. In the past years, the alar and basal plates of the midbrain have been divided into different domains. The precise location of the alar-basal boundary is still under discussion. We have identified Barhl1, Nhlh1 and Six3 as appropriate molecular markers to the adjacent domains of this transition. The description of their expression patterns and the contribution to the different mesencephalic populations corroborated their role in the specification of these domains. We studied the influence of Sonic Hedgehog on these markers and therefore on the specification of these territories. The lack of this morphogen produced severe alterations in the expression pattern of Barhl1 and Nhlh1 with consequent misspecification of the basolateral (BL) domain. Six3 expression was apparently unaffected, however its distribution changed leading to altered basal domains. In this study we confirmed the localization of the alar-basal boundary dorsal to the BL domain and demonstrated that the development of the BL domain highly depends on Shh. PMID:25741244

  13. Mutation-profile-based methods for understanding selection forces in cancer somatic mutations: a comparative analysis.

    PubMed

    Zhou, Zhan; Zou, Yangyun; Liu, Gangbiao; Zhou, Jingqi; Wu, Jingcheng; Zhao, Shimin; Su, Zhixi; Gu, Xun

    2017-08-29

    Human genes exhibit different effects on fitness in cancer and normal cells. Here, we present an evolutionary approach to measure the selection pressure on human genes, using the well-known ratio of the nonsynonymous to synonymous substitution rate in both cancer genomes ( C N / C S ) and normal populations ( p N / p S ). A new mutation-profile-based method that adopts sample-specific mutation rate profiles instead of conventional substitution models was developed. We found that cancer-specific selection pressure is quite different from the selection pressure at the species and population levels. Both the relaxation of purifying selection on passenger mutations and the positive selection of driver mutations may contribute to the increased C N / C S values of human genes in cancer genomes compared with the p N / p S values in human populations. The C N / C S values also contribute to the improved classification of cancer genes and a better understanding of the onco-functionalization of cancer genes during oncogenesis. The use of our computational pipeline to identify cancer-specific positively and negatively selected genes may provide useful information for understanding the evolution of cancers and identifying possible targets for therapeutic intervention.

  14. Semiautomated TaqMan PCR screening of GMO labelled samples for (unauthorised) GMOs.

    PubMed

    Scholtens, Ingrid M J; Molenaar, Bonnie; van Hoof, Richard A; Zaaijer, Stephanie; Prins, Theo W; Kok, Esther J

    2017-06-01

    In most countries, systems are in place to analyse food products for the potential presence of genetically modified organisms (GMOs), to enforce labelling requirements and to screen for the potential presence of unauthorised GMOs. With the growing number of GMOs on the world market, a larger diversity of methods is required for informative analyses. In this paper, the specificity of an extended screening set consisting of 32 screening methods to identify different crop species (endogenous genes) and GMO elements was verified against 59 different GMO reference materials. In addition, a cost- and time-efficient strategy for DNA isolation, screening and identification is presented. A module for semiautomated analysis of the screening results and planning of subsequent event-specific tests for identification has been developed. The Excel-based module contains information on the experimentally verified specificity of the element methods and of the EU authorisation status of the GMO events. If a detected GMO element cannot be explained by any of the events as identified in the same sample, this may indicate the presence of an unknown unauthorised GMO that may not yet have been assessed for its safety for humans, animals or the environment.

  15. The Comparison of Expressed Candidate Secreted Proteins from Two Arbuscular Mycorrhizal Fungi Unravels Common and Specific Molecular Tools to Invade Different Host Plants

    PubMed Central

    Kamel, Laurent; Tang, Nianwu; Malbreil, Mathilde; San Clemente, Hélène; Le Marquer, Morgane; Roux, Christophe; Frei dit Frey, Nicolas

    2017-01-01

    Arbuscular mycorrhizal fungi (AMF), belonging to the fungal phylum Glomeromycota, form mutualistic symbioses with roots of almost 80% of land plants. The release of genomic data from the ubiquitous AMF Rhizophagus irregularis revealed that this species possesses a large set of putative secreted proteins (RiSPs) that could be of major importance for establishing the symbiosis. In the present study, we aimed to identify SPs involved in the establishment of AM symbiosis based on comparative gene expression analyses. We first curated the secretome of the R. irregularis DAOM 197198 strain based on two available genomic assemblies. Then we analyzed the expression patterns of the putative RiSPs obtained from the fungus in symbiotic association with three phylogenetically distant host plants—a monocot, a dicot and a liverwort—in comparison with non-symbiotic stages. We found that 33 out of 84 RiSPs induced in planta were commonly up-regulated in these three hosts. Most of these common RiSPs are small proteins of unknown function that may represent putative host non-specific effector proteins. We further investigated the expressed secretome of Gigaspora rosea, an AM fungal species phylogenetically distant from R. irregularis. G. rosea also presents original symbiotic features, a narrower host spectrum and a restrictive geographic distribution compared to R. irregularis. Interestingly, when analyzing up-regulated G. rosea SPs (GrSPs) in different hosts, a higher ratio of host-specific GrSPs was found compared to RiSPs. Such difference of expression patterns may mirror the restrained host spectrum of G. rosea compared to R. irregularis. Finally, we identified a set of conserved SPs, commonly up-regulated by both fungi in all hosts tested, that could correspond to common keys of AMF to colonize host plants. Our data thus highlight the specificities of two distant AM fungi and help in understanding their conserved and specific strategies to invade different hosts. PMID:28223991

  16. Identifying critical transitions and their leading biomolecular networks in complex diseases.

    PubMed

    Liu, Rui; Li, Meiyi; Liu, Zhi-Ping; Wu, Jiarui; Chen, Luonan; Aihara, Kazuyuki

    2012-01-01

    Identifying a critical transition and its leading biomolecular network during the initiation and progression of a complex disease is a challenging task, but holds the key to early diagnosis and further elucidation of the essential mechanisms of disease deterioration at the network level. In this study, we developed a novel computational method for identifying early-warning signals of the critical transition and its leading network during a disease progression, based on high-throughput data using a small number of samples. The leading network makes the first move from the normal state toward the disease state during a transition, and thus is causally related with disease-driving genes or networks. Specifically, we first define a state-transition-based local network entropy (SNE), and prove that SNE can serve as a general early-warning indicator of any imminent transitions, regardless of specific differences among systems. The effectiveness of this method was validated by functional analysis and experimental data.

  17. Novel domain-specific POU3F4 mutations are associated with X-linked deafness: examples from different populations.

    PubMed

    Bademci, Guney; Lasisi, Akeem; Yariz, Kemal O; Montenegro, Paola; Menendez, Ibis; Vinueza, Rodrigo; Paredes, Rosario; Moreta, Germania; Subasioglu, Asli; Blanton, Susan; Fitoz, Suat; Incesulu, Armagan; Sennaroglu, Levent; Tekin, Mustafa

    2015-02-25

    Mutations in the POU3F4 gene cause X-linked deafness type 3 (DFN3), which is characterized by inner ear anomalies. Three Turkish, one Ecuadorian, and one Nigerian families were included based on either inner ear anomalies detected in probands or X-linked family histories. Exome sequencing and/or Sanger sequencing were performed in order to identify the causative DNA variants in these families. Four novel, c.707A>C (p.(Glu236Ala)), c.772delG (p.(Glu258ArgfsX30)), c.902C>T (p.(Pro301Leu)), c.987T>C (p.(Ile308Thr)), and one previously reported mutation c.346delG (p.(Ala116ProfsX26)) in POU3F4, were identified. All mutations identified are predicted to affect the POU-specific or POU homeo domains of the protein and co-segregated with deafness in all families. Expanding the spectrum of POU3F4 mutations in different populations along with their associated phenotypes provides better understanding of their clinical importance and will be helpful in clinical evaluation and counseling of the affected individuals.

  18. Merging K-means with hierarchical clustering for identifying general-shaped groups.

    PubMed

    Peterson, Anna D; Ghosh, Arka P; Maitra, Ranjan

    2018-01-01

    Clustering partitions a dataset such that observations placed together in a group are similar but different from those in other groups. Hierarchical and K -means clustering are two approaches but have different strengths and weaknesses. For instance, hierarchical clustering identifies groups in a tree-like structure but suffers from computational complexity in large datasets while K -means clustering is efficient but designed to identify homogeneous spherically-shaped clusters. We present a hybrid non-parametric clustering approach that amalgamates the two methods to identify general-shaped clusters and that can be applied to larger datasets. Specifically, we first partition the dataset into spherical groups using K -means. We next merge these groups using hierarchical methods with a data-driven distance measure as a stopping criterion. Our proposal has the potential to reveal groups with general shapes and structure in a dataset. We demonstrate good performance on several simulated and real datasets.

  19. Using cluster ensemble and validation to identify subtypes of pervasive developmental disorders.

    PubMed

    Shen, Jess J; Lee, Phil-Hyoun; Holden, Jeanette J A; Shatkay, Hagit

    2007-10-11

    Pervasive Developmental Disorders (PDD) are neurodevelopmental disorders characterized by impairments in social interaction, communication and behavior. Given the diversity and varying severity of PDD, diagnostic tools attempt to identify homogeneous subtypes within PDD. Identifying subtypes can lead to targeted etiology studies and to effective type-specific intervention. Cluster analysis can suggest coherent subsets in data; however, different methods and assumptions lead to different results. Several previous studies applied clustering to PDD data, varying in number and characteristics of the produced subtypes. Most studies used a relatively small dataset (fewer than 150 subjects), and all applied only a single clustering method. Here we study a relatively large dataset (358 PDD patients), using an ensemble of three clustering methods. The results are evaluated using several validation methods, and consolidated through an integration step. Four clusters are identified, analyzed and compared to subtypes previously defined by the widely used diagnostic tool DSM-IV.

  20. Using Cluster Ensemble and Validation to Identify Subtypes of Pervasive Developmental Disorders

    PubMed Central

    Shen, Jess J.; Lee, Phil Hyoun; Holden, Jeanette J.A.; Shatkay, Hagit

    2007-01-01

    Pervasive Developmental Disorders (PDD) are neurodevelopmental disorders characterized by impairments in social interaction, communication and behavior.1 Given the diversity and varying severity of PDD, diagnostic tools attempt to identify homogeneous subtypes within PDD. Identifying subtypes can lead to targeted etiology studies and to effective type-specific intervention. Cluster analysis can suggest coherent subsets in data; however, different methods and assumptions lead to different results. Several previous studies applied clustering to PDD data, varying in number and characteristics of the produced subtypes19. Most studies used a relatively small dataset (fewer than 150 subjects), and all applied only a single clustering method. Here we study a relatively large dataset (358 PDD patients), using an ensemble of three clustering methods. The results are evaluated using several validation methods, and consolidated through an integration step. Four clusters are identified, analyzed and compared to subtypes previously defined by the widely used diagnostic tool DSM-IV.2 PMID:18693920

  1. Initial proteome analysis of caffeine-induced proteins in Aspergillus tamarii using two-dimensional fluorescence difference gel electrophoresis.

    PubMed

    Gutiérrez-Sánchez, Gerardo; Atwood, James; Kolli, V S Kumar; Roussos, Sévastianos; Augur, Christopher

    2012-04-01

    Caffeine is toxic to most microorganisms. However, some filamentous fungi, such as Aspergillus tamarii, are able to metabolize this alkaloid when fed caffeine as the sole nitrogen source. The aim of the present work was to identify intracellular A. tamarii proteins, regulated by caffeine, using fluorescence difference two-dimensional gel electrophoresis. Specific proteins from two culture media of A. tamarii grown either on ammonium sulfate or caffeine as the sole nitrogen source were analysed by mass spectrometry. Thirteen out of a total of 85 differentially expressed spots were identified after database search. Identified up-regulated proteins include phosphoglycerate kinase, malate dehydrogenase, dyp-type peroxidase family protein, heat shock protein, Cu, Zn superoxidase dismutase and xanthine dehydrogenase. Some of the proteins identified in this study are involved in the caffeine degradation pathway as well as in stress response, suggesting that stress proteins could be involved in caffeine metabolism in filamentous fungi.

  2. An integrative transcriptomic approach to identify depot differences in genes and microRNAs in adipose tissues from high fat fed mice.

    PubMed

    Wijayatunga, Nadeeja N; Pahlavani, Mandana; Kalupahana, Nishan S; Kottapalli, Kameswara Rao; Gunaratne, Preethi H; Coarfa, Cristian; Ramalingam, Latha; Moustaid-Moussa, Naima

    2018-02-06

    Obesity contributes to metabolic disorders such as diabetes and cardiovascular disease. Characterization of differences between the main adipose tissue depots, white (WAT) [including subcutaneous (SAT) and visceral adipose tissue (VAT)] and brown adipose tissue (BAT) helps to identify their roles in obesity. Thus, we studied depot-specific differences in whole transcriptome and miRNA profiles of SAT, VAT and BAT from high fat diet (HFD/45% of calories from fat) fed mice using RNA sequencing and small RNA-Seq. Using quantitative real-time polymerase chain reaction, we validated depot-specific differences in endoplasmic reticulum (ER) stress related genes and miRNAs using mice fed a HFD vs. low fat diet (LFD/10% of calories from fat). According to the transcriptomic analysis, lipogenesis, adipogenesis, inflammation, endoplasmic reticulum (ER) stress and unfolded protein response (UPR) were higher in VAT compared to BAT, whereas energy expenditure, fatty acid oxidation and oxidative phosphorylation were higher in BAT than in VAT of the HFD fed mice. In contrast to BAT, ER stress marker genes were significantly upregulated in VAT of HFD fed mice than the LFD fed mice. For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p, upregulation miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice than the LFD mice. In conclusion, HFD differentially regulates miRNAs and genes in different adipose depots with significant induction of genes related to lipogenesis, adipogenesis, inflammation, ER stress, and UPR in WAT compared to BAT.

  3. Mixture models in diagnostic meta-analyses--clustering summary receiver operating characteristic curves accounted for heterogeneity and correlation.

    PubMed

    Schlattmann, Peter; Verba, Maryna; Dewey, Marc; Walther, Mario

    2015-01-01

    Bivariate linear and generalized linear random effects are frequently used to perform a diagnostic meta-analysis. The objective of this article was to apply a finite mixture model of bivariate normal distributions that can be used for the construction of componentwise summary receiver operating characteristic (sROC) curves. Bivariate linear random effects and a bivariate finite mixture model are used. The latter model is developed as an extension of a univariate finite mixture model. Two examples, computed tomography (CT) angiography for ruling out coronary artery disease and procalcitonin as a diagnostic marker for sepsis, are used to estimate mean sensitivity and mean specificity and to construct sROC curves. The suggested approach of a bivariate finite mixture model identifies two latent classes of diagnostic accuracy for the CT angiography example. Both classes show high sensitivity but mainly two different levels of specificity. For the procalcitonin example, this approach identifies three latent classes of diagnostic accuracy. Here, sensitivities and specificities are quite different as such that sensitivity increases with decreasing specificity. Additionally, the model is used to construct componentwise sROC curves and to classify individual studies. The proposed method offers an alternative approach to model between-study heterogeneity in a diagnostic meta-analysis. Furthermore, it is possible to construct sROC curves even if a positive correlation between sensitivity and specificity is present. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Engineering Bacteria to Search for Specific Concentrations of Molecules by a Systematic Synthetic Biology Design Method

    PubMed Central

    Chen, Bor-Sen

    2016-01-01

    Bacteria navigate environments full of various chemicals to seek favorable places for survival by controlling the flagella’s rotation using a complicated signal transduction pathway. By influencing the pathway, bacteria can be engineered to search for specific molecules, which has great potential for application to biomedicine and bioremediation. In this study, genetic circuits were constructed to make bacteria search for a specific molecule at particular concentrations in their environment through a synthetic biology method. In addition, by replacing the “brake component” in the synthetic circuit with some specific sensitivities, the bacteria can be engineered to locate areas containing specific concentrations of the molecule. Measured by the swarm assay qualitatively and microfluidic techniques quantitatively, the characteristics of each “brake component” were identified and represented by a mathematical model. Furthermore, we established another mathematical model to anticipate the characteristics of the “brake component”. Based on this model, an abundant component library can be established to provide adequate component selection for different searching conditions without identifying all components individually. Finally, a systematic design procedure was proposed. Following this systematic procedure, one can design a genetic circuit for bacteria to rapidly search for and locate different concentrations of particular molecules by selecting the most adequate “brake component” in the library. Moreover, following simple procedures, one can also establish an exclusive component library suitable for other cultivated environments, promoter systems, or bacterial strains. PMID:27096615

  5. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  6. Deep Sequencing-guided Design of a High Affinity Dual Specificity Antibody to Target Two Angiogenic Factors in Neovascular Age-related Macular Degeneration.

    PubMed

    Koenig, Patrick; Lee, Chingwei V; Sanowar, Sarah; Wu, Ping; Stinson, Jeremy; Harris, Seth F; Fuh, Germaine

    2015-09-04

    The development of dual targeting antibodies promises therapies with improved efficacy over mono-specific antibodies. Here, we engineered a Two-in-One VEGF/angiopoietin 2 antibody with dual action Fab (DAF) as a potential therapeutic for neovascular age-related macular degeneration. Crystal structures of the VEGF/angiopoietin 2 DAF in complex with its two antigens showed highly overlapping binding sites. To achieve sufficient affinity of the DAF to block both angiogenic factors, we turned to deep mutational scanning in the complementarity determining regions (CDRs). By mutating all three CDRs of each antibody chain simultaneously, we were able not only to identify affinity improving single mutations but also mutation pairs from different CDRs that synergistically improve both binding functions. Furthermore, insights into the cooperativity between mutations allowed us to identify fold-stabilizing mutations in the CDRs. The data obtained from deep mutational scanning reveal that the majority of the 52 CDR residues are utilized differently for the two antigen binding function and permit, for the first time, the engineering of several DAF variants with sub-nanomolar affinity against two structurally unrelated antigens. The improved variants show similar blocking activity of receptor binding as the high affinity mono-specific antibodies against these two proteins, demonstrating the feasibility of generating a dual specificity binding surface with comparable properties to individual high affinity mono-specific antibodies. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Characterization of Monomethyihydrazine (MMH) Non-Volatile Residue

    NASA Technical Reports Server (NTRS)

    Davis, Chuck; Howard, Philip M.

    2009-01-01

    The Space Shuttle program has a unique propellant purity requirement for determination of nonvolatile residue (NVR) in monomethylhydrazine (MMH). TIis requirement differs from the Military Specification procurement specification by requiring a NVR analysis with a limit of less than or equal to 10 milligrams per liter. In June 2008, a routine MMH replenishment delivery was transferred into a NASA KSC owned tanker for future delivery to the Space Shuffle pad MMH storage tank. Per Shuffle standard operating procedure, the receiving tanker was sampled and analyzed for purity and surprisingly it failed the Shuttle use NVR specification limit. Detailed examination of the NVR revealed that it was fundamentally different than the typical MMH NVR. This paper will examine various aspects of NVR determination in MMH and the analytical characterization processes used to identify the NVR.

  8. Evaluation of molecular markers for Phytophthora ramorum detection and identification: testing for specificity using a standardized library of isolates.

    PubMed

    Martin, F N; Coffey, M D; Zeller, K; Hamelin, R C; Tooley, P; Garbelotto, M; Hughes, K J D; Kubisiak, T; Bilodeau, G J; Levy, L; Blomquist, C; Berger, P H

    2009-04-01

    Given the importance of Phytophthora ramorum from a regulatory standpoint, it is imperative that molecular markers for pathogen detection are fully tested to evaluate their specificity in detection of the pathogen. In an effort to evaluate 11 reported diagnostic techniques, we assembled a standardized DNA library using accessions from the World Phytophthora Genetic Resource Collection for 315 isolates representing 60 described Phytophthora spp. as well as 11 taxonomically unclassified isolates. These were sent blind to collaborators in seven laboratories to evaluate published diagnostic procedures using conventional (based on internal transcribed spacer [ITS] and cytochrome oxidase gene [cox]1 and 2 spacer regions) and real-time polymerase chain reaction (based on ITS and cox1 and 2 spacer regions as well as beta-tubulin and elicitin genes). Single-strand conformation polymorphism (SSCP) analysis using an automated sequencer for data collection was also evaluated for identification of all species tested. In general, the procedures worked well, with varying levels of specificity observed among the different techniques. With few exceptions, all assays correctly identified all isolates of P. ramorum and low levels of false positives were observed for the mitochondrial cox spacer markers and most of the real-time assays based on nuclear markers (diagnostic specificity between 96.9 and 100%). The highest level of false positives was obtained with the conventional nested ITS procedure; however, this technique is not stand-alone and is used in conjunction with two other assays for diagnostic purposes. The results indicated that using multiple assays improved the accuracy of the results compared with looking at a single assay alone, in particular when the markers represented different genetic loci. The SSCP procedure accurately identified P. ramorum and was helpful in classification of a number of isolates to a species level. With one exception, all procedures accurately identified P. ramorum in blind evaluations of 60 field samples that included examples of plant infection by 11 other Phytophthora spp. The SSCP analysis identified eight of these species, with three identified to a species group.

  9. The Cuban scorpion Rhopalurus junceus (Scorpiones, Buthidae): component variations in venom samples collected in different geographical areas

    PubMed Central

    2013-01-01

    Backgound The venom of the Cuban scorpion Rhopalurus junceus is poorly study from the point of view of their components at molecular level and the functions associated. The purpose of this article was to conduct a proteomic analysis of venom components from scorpions collected in different geographical areas of the country. Results Venom from the blue scorpion, as it is called, was collected separately from specimens of five distinct Cuban towns (Moa, La Poa, Limonar, El Chote and Farallones) of the Nipe-Sagua-Baracoa mountain massif and fractionated by high performance liquid chromatography (HPLC); the molecular masses of each fraction were ascertained by mass spectrometry analysis. At least 153 different molecular mass components were identified among the five samples analyzed. Molecular masses varied from 466 to 19755 Da. Scorpion HPLC profiles differed among these different geographical locations and the predominant molecular masses of their components. The most evident differences are in the relative concentration of the venom components. The most abundant components presented molecular weights around 4 kDa, known to be K+-channel specific peptides, and 7 kDa, known to be Na+-channel specific peptides, but with small molecular weight differences. Approximately 30 peptides found in venom samples from the different geographical areas are identical, supporting the idea that they all probably belong to the same species, with some interpopulational variations. Differences were also found in the presence of phospholipase, found in venoms from the Poa area (molecular weights on the order of 14 to 19 kDa). The only ubiquitous enzyme identified in the venoms from all five localities studied (hyaluronidase) presented the same 45 kD molecular mass, identified by gel electrophoresis analysis. Conclusions The venom of these scorpions from different geographical areas seem to be similar, and are rich in peptides that have of the same molecular masses of the peptides purified from other scorpions that affect ion-channel functions. PMID:23849540

  10. Integrating different perspectives on socialization theory and research: a domain-specific approach.

    PubMed

    Grusec, Joan E; Davidov, Maayan

    2010-01-01

    There are several different theoretical and research approaches to the study of socialization, characterized by frequently competing basic tenets and apparently contradictory evidence. As a way of integrating approaches and understanding discrepancies, it is proposed that socialization processes be viewed from a domain perspective, with each domain characterized by a particular form of social interaction between the object and agent of socialization and by specific socialization mechanisms and outcomes. It is argued that this approach requires researchers to identify the domain of social interaction they are investigating, to understand that phenotypically similar behaviors may belong to different domains, and to acknowledge that caregivers who are effective in one type of interaction may not be effective in another.

  11. MS-HRM assay identifies high levels of epigenetic heterogeneity in human immortalized cell lines.

    PubMed

    Putnik, Milica; Wojdacz, Tomasz K; Pournara, Angeliki; Vahter, Marie; Wallberg, Annika E

    2015-04-15

    Immortalized cell lines are widely used in genetic and epigenetic studies, from exploration of basic molecular pathways to evaluation of disease-specific cellular properties. They are also used in biotechnology, e.g., in drug toxicity tests and vaccine production. Cellular and genetic uniformity is the main feature of immortalized cell lines and it has been particularly advantageous in functional genomic research, which has in recent years been expanded to include epigenetic mechanisms of gene expression regulation. Using the MS-HRM technique, we demonstrated heterogeneity in locus-specific methylation patterns in different cell cultures of four human cell lines: HEK293, HEK293T, LCL and DU145. Our results show that some human immortalized cell lines consist of cells that differ in the methylation status of specific loci, i.e., that they are epigenetically heterogeneous. We show that even two cultures of the same cell line obtained from different laboratories can differ in the methylation status of the specific loci. The results indicated that epigenetic uniformity of the cell lines cannot be assumed in experiments which utilize cell cultures and that the methylation status of the specific loci in the immortalized cell lines should be re-characterized and carefully profiled before epigenetic studies are performed. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Region-specific RNA m6A methylation represents a new layer of control in the gene regulatory network in the mouse brain.

    PubMed

    Chang, Mengqi; Lv, Hongyi; Zhang, Weilong; Ma, Chunhui; He, Xue; Zhao, Shunli; Zhang, Zhi-Wei; Zeng, Yi-Xin; Song, Shuhui; Niu, Yamei; Tong, Wei-Min

    2017-09-01

    N 6 -methyladenosine (m 6 A) is the most abundant epitranscriptomic mark found on mRNA and has important roles in various physiological processes. Despite the relatively high m 6 A levels in the brain, its potential functions in the brain remain largely unexplored. We performed a transcriptome-wide methylation analysis using the mouse brain to depict its region-specific methylation profile. RNA methylation levels in mouse cerebellum are generally higher than those in the cerebral cortex. Heterogeneity of RNA methylation exists across different brain regions and different types of neural cells including the mRNAs to be methylated, their methylation levels and methylation site selection. Common and region-specific methylation have different preferences for methylation site selection and thereby different impacts on their biological functions. In addition, high methylation levels of fragile X mental retardation protein (FMRP) target mRNAs suggest that m 6 A methylation is likely to be used for selective recognition of target mRNAs by FMRP in the synapse. Overall, we provide a region-specific map of RNA m 6 A methylation and characterize the distinct features of specific and common methylation in mouse cerebellum and cerebral cortex. Our results imply that RNA m 6 A methylation is a newly identified element in the region-specific gene regulatory network in the mouse brain. © 2017 The Authors.

  13. The impact of structural uncertainty on cost-effectiveness models for adjuvant endocrine breast cancer treatments: the need for disease-specific model standardization and improved guidance.

    PubMed

    Frederix, Gerardus W J; van Hasselt, Johan G C; Schellens, Jan H M; Hövels, Anke M; Raaijmakers, Jan A M; Huitema, Alwin D R; Severens, Johan L

    2014-01-01

    Structural uncertainty relates to differences in model structure and parameterization. For many published health economic analyses in oncology, substantial differences in model structure exist, leading to differences in analysis outcomes and potentially impacting decision-making processes. The objectives of this analysis were (1) to identify differences in model structure and parameterization for cost-effectiveness analyses (CEAs) comparing tamoxifen and anastrazole for adjuvant breast cancer (ABC) treatment; and (2) to quantify the impact of these differences on analysis outcome metrics. The analysis consisted of four steps: (1) review of the literature for identification of eligible CEAs; (2) definition and implementation of a base model structure, which included the core structural components for all identified CEAs; (3) definition and implementation of changes or additions in the base model structure or parameterization; and (4) quantification of the impact of changes in model structure or parameterizations on the analysis outcome metrics life-years gained (LYG), incremental costs (IC) and the incremental cost-effectiveness ratio (ICER). Eleven CEA analyses comparing anastrazole and tamoxifen as ABC treatment were identified. The base model consisted of the following health states: (1) on treatment; (2) off treatment; (3) local recurrence; (4) metastatic disease; (5) death due to breast cancer; and (6) death due to other causes. The base model estimates of anastrazole versus tamoxifen for the LYG, IC and ICER were 0.263 years, €3,647 and €13,868/LYG, respectively. In the published models that were evaluated, differences in model structure included the addition of different recurrence health states, and associated transition rates were identified. Differences in parameterization were related to the incidences of recurrence, local recurrence to metastatic disease, and metastatic disease to death. The separate impact of these model components on the LYG ranged from 0.207 to 0.356 years, while incremental costs ranged from €3,490 to €3,714 and ICERs ranged from €9,804/LYG to €17,966/LYG. When we re-analyzed the published CEAs in our framework by including their respective model properties, the LYG ranged from 0.207 to 0.383 years, IC ranged from €3,556 to €3,731 and ICERs ranged from €9,683/LYG to €17,570/LYG. Differences in model structure and parameterization lead to substantial differences in analysis outcome metrics. This analysis supports the need for more guidance regarding structural uncertainty and the use of standardized disease-specific models for health economic analyses of adjuvant endocrine breast cancer therapies. The developed approach in the current analysis could potentially serve as a template for further evaluations of structural uncertainty and development of disease-specific models.

  14. Rapid Design of Knowledge-Based Scoring Potentials for Enrichment of Near-Native Geometries in Protein-Protein Docking.

    PubMed

    Sasse, Alexander; de Vries, Sjoerd J; Schindler, Christina E M; de Beauchêne, Isaure Chauvot; Zacharias, Martin

    2017-01-01

    Protein-protein docking protocols aim to predict the structures of protein-protein complexes based on the structure of individual partners. Docking protocols usually include several steps of sampling, clustering, refinement and re-scoring. The scoring step is one of the bottlenecks in the performance of many state-of-the-art protocols. The performance of scoring functions depends on the quality of the generated structures and its coupling to the sampling algorithm. A tool kit, GRADSCOPT (GRid Accelerated Directly SCoring OPTimizing), was designed to allow rapid development and optimization of different knowledge-based scoring potentials for specific objectives in protein-protein docking. Different atomistic and coarse-grained potentials can be created by a grid-accelerated directly scoring dependent Monte-Carlo annealing or by a linear regression optimization. We demonstrate that the scoring functions generated by our approach are similar to or even outperform state-of-the-art scoring functions for predicting near-native solutions. Of additional importance, we find that potentials specifically trained to identify the native bound complex perform rather poorly on identifying acceptable or medium quality (near-native) solutions. In contrast, atomistic long-range contact potentials can increase the average fraction of near-native poses by up to a factor 2.5 in the best scored 1% decoys (compared to existing scoring), emphasizing the need of specific docking potentials for different steps in the docking protocol.

  15. Common and unique representations in pFC for face and place attractiveness.

    PubMed

    Pegors, Teresa K; Kable, Joseph W; Chatterjee, Anjan; Epstein, Russell A

    2015-05-01

    Although previous neuroimaging research has identified overlapping correlates of subjective value across different reward types in the ventromedial pFC (vmPFC), it is not clear whether this "common currency" evaluative signal extends to the aesthetic domain. To examine this issue, we scanned human participants with fMRI while they made attractiveness judgments of faces and places-two stimulus categories that are associated with different underlying rewards, have very different visual properties, and are rarely compared with each other. We found overlapping signals for face and place attractiveness in the vmPFC, consistent with the idea that this region codes a signal for value that applies across disparate reward types and across both economic and aesthetic judgments. However, we also identified a subregion of vmPFC within which activity patterns for face and place attractiveness were distinguishable, suggesting that some category-specific attractiveness information is retained in this region. Finally, we observed two separate functional regions in lateral OFC: one region that exhibited a category-unique response to face attractiveness and another region that responded strongly to faces but was insensitive to their value. Our results suggest that vmPFC supports a common mechanism for reward evaluation while also retaining a degree of category-specific information, whereas lateral OFC may be involved in basic reward processing that is specific to only some stimulus categories.

  16. Testing Scientific Software: A Systematic Literature Review

    PubMed Central

    Kanewala, Upulee; Bieman, James M.

    2014-01-01

    Context Scientific software plays an important role in critical decision making, for example making weather predictions based on climate models, and computation of evidence for research publications. Recently, scientists have had to retract publications due to errors caused by software faults. Systematic testing can identify such faults in code. Objective This study aims to identify specific challenges, proposed solutions, and unsolved problems faced when testing scientific software. Method We conducted a systematic literature survey to identify and analyze relevant literature. We identified 62 studies that provided relevant information about testing scientific software. Results We found that challenges faced when testing scientific software fall into two main categories: (1) testing challenges that occur due to characteristics of scientific software such as oracle problems and (2) testing challenges that occur due to cultural differences between scientists and the software engineering community such as viewing the code and the model that it implements as inseparable entities. In addition, we identified methods to potentially overcome these challenges and their limitations. Finally we describe unsolved challenges and how software engineering researchers and practitioners can help to overcome them. Conclusions Scientific software presents special challenges for testing. Specifically, cultural differences between scientist developers and software engineers, along with the characteristics of the scientific software make testing more difficult. Existing techniques such as code clone detection can help to improve the testing process. Software engineers should consider special challenges posed by scientific software such as oracle problems when developing testing techniques. PMID:25125798

  17. The identification of genes specific to Prevotella intermedia and Prevotella nigrescens using genomic subtractive hybridization.

    PubMed

    Masakiyo, Yoshiaki; Yoshida, Akihiro; Shintani, Yasuyuki; Takahashi, Yusuke; Ansai, Toshihiro; Takehara, Tadamichi

    2010-06-01

    Prevotella intermedia and Prevotella nigrescens, which are often isolated from periodontal sites, were once considered two different genotypes of P. intermedia. Although the genomic sequence of P. intermedia was determined recently, little is known about the genetic differences between P. intermedia and P. nigrescens. The subtractive hybridization technique is a powerful method for generating a set of DNA fragments differing between two closely related bacterial strains or species. We used subtractive hybridization to identify the DNA regions specific to P. intermedia ATCC 25611 and P. nigrescens ATCC 25261. Using this method, four P. intermedia ATCC 25611-specific and three P. nigrescens ATCC 25261-specific regions were determined. From the species-specific regions, insertion sequence (IS) elements were isolated for P. intermedia. IS elements play an important role in the pathogenicity of bacteria. For the P. intermedia-specific regions, the genes adenine-specific DNA-methyltransferase and 8-amino-7-oxononanoate synthase were isolated. The P. nigrescens-specific region contained a Flavobacterium psychrophilum SprA homologue, a cell-surface protein involved in gliding motility, Prevotella melaninogenica ATCC 25845 glutathione peroxide, and Porphyromonas gingivalis ATCC 33277 leucyl-tRNA synthetase. The results demonstrate that the subtractive hybridization technique was useful for distinguishing between the two closely related species. Furthermore, this technique will contribute to our understanding of the virulence of these species. 2009 Elsevier Ltd. All rights reserved.

  18. GSK's antigen-specific cancer immunotherapy programme: pilot results leading to Phase III clinical development.

    PubMed

    Brichard, Vincent G; Lejeune, Diane

    2007-09-27

    From the first evidence that the immune system could recognize tumors, different types of tumor antigens have been identified and deeply characterized. Several different approaches aimed at targeting these antigens have already been the subject of clinical studies. In this field, the GSK Biologicals' approach relying on recombinant proteins combined with an immunological Adjuvant System in a specific clinical setting, has entertained hopes of developing a new class of well tolerated anti-cancer therapy. This methodology led to promising advances with MAGE-A3 immunotherapy in NSCLC and has the potential to be applied to all tumor types.

  19. Cuticular Waxes of Arabidopsis thaliana Shoots: Cell-Type-Specific Composition and Biosynthesis

    PubMed Central

    Hegebarth, Daniela; Jetter, Reinhard

    2017-01-01

    It is generally assumed that all plant epidermis cells are covered with cuticles, and the distinct surface geometries of pavement cells, guard cells, and trichomes imply functional differences and possibly different wax compositions. However, experiments probing cell-type-specific wax compositions and biosynthesis have been lacking until recently. This review summarizes new evidence showing that Arabidopsis trichomes have fewer wax compound classes than pavement cells, and higher amounts of especially long-chain hydrocarbons. The biosynthesis machinery generating this characteristic surface coating is discussed. Interestingly, wax compounds with similar, long hydrocarbon chains had been identified previously in some unrelated species, not all of them bearing trichomes. PMID:28686187

  20. Responsiveness of the EQ-5D to HADS-identified anxiety and depression.

    PubMed

    Whynes, David K

    2009-10-01

    The use of generic measures of health-related quality of life enables cost effectiveness comparisons of different health care interventions to be made. Nevertheless, there exists a concern that generic instruments may be insufficiently sensitive to detect the differences or changes in outcome identified by condition-specific instruments. This paper compares the psychometric properties of the EQ-5D generic instrument with a widely used specific measure of distress, the Hospital Anxiety and Depression Scale (HADS). The analysis was based on data obtained from a large sample of women (n = 3119) with low-grade cervical cytological abnormalities detected at routine screening. These women completed EQ-5D and HADS questionnaires at recruitment and at 12 months thereafter. We examined the strength of association between HADS-determined severity of distress and EQ-5D scores at recruitment and between changes in severity and in scores over time. A higher likelihood of HADS-identified anxiety and/or depression was associated with significantly lower EQ-5D index and visual analogue scores. Over time, the EQ-5D score rose significantly when the likelihood of an individual representing a HADS-defined anxiety and/or depression case decreased. We conclude that the EQ-5D has shown itself to be responsive to differing degrees of HADS-assessed distress, although generalization beyond the UK context requires further investigation.

  1. Financial errors in dementia: Testing a neuroeconomic conceptual framework

    PubMed Central

    Chiong, Winston; Hsu, Ming; Wudka, Danny; Miller, Bruce L.; Rosen, Howard J.

    2013-01-01

    Financial errors by patients with dementia can have devastating personal and family consequences. We developed and evaluated a neuroeconomic conceptual framework for understanding financial errors across different dementia syndromes, using a systematic, retrospective, blinded chart review of demographically-balanced cohorts of patients with Alzheimer’s disease (AD, n=100) and behavioral variant frontotemporal dementia (bvFTD, n=50). Reviewers recorded specific reports of financial errors according to a conceptual framework identifying patient cognitive and affective characteristics, and contextual influences, conferring susceptibility to each error. Specific financial errors were reported for 49% of AD and 70% of bvFTD patients (p = 0.012). AD patients were more likely than bvFTD patients to make amnestic errors (p< 0.001), while bvFTD patients were more likely to spend excessively (p = 0.004) and to exhibit other behaviors consistent with diminished sensitivity to losses and other negative outcomes (p< 0.001). Exploratory factor analysis identified a social/affective vulnerability factor associated with errors in bvFTD, and a cognitive vulnerability factor associated with errors in AD. Our findings highlight the frequency and functional importance of financial errors as symptoms of AD and bvFTD. A conceptual model derived from neuroeconomic literature identifies factors that influence vulnerability to different types of financial error in different dementia syndromes, with implications for early diagnosis and subsequent risk prevention. PMID:23550884

  2. Prenatal exposure to polychlorinated biphenyls: a neuropsychologic analysis.

    PubMed

    Boucher, Olivier; Muckle, Gina; Bastien, Célyne H

    2009-01-01

    A large body of literature documents the effects of prenatal exposure to polychlorinated biphenyls (PCBs) on cognitive development of children. Despite this fact, no integrative synthesis has been published yet to identify the cognitive functions that are particularly affected. Our aim is to review this literature in an attempt to identify the cognitive profile associated with prenatal PCB exposure. Studies were identified by searching the PubMed database for articles published before June 2008. We reviewed data from nine prospective longitudinal birth cohorts for different aspects of cognition. Associations between indicators of prenatal PCB exposure and performance on cognitive tasks reported in the selected studies are summarized and classified as general cognitive abilities, verbal or visual-spatial skills, memory, attention, and executive functions. The most consistent effects observed across studies are impaired executive functioning related to increased prenatal PCB exposure. Negative effects on processing speed, verbal abilities, and visual recognition memory are also reported by most studies. Converging results from different cohort studies in which exposure arises from different sources make it unlikely that co-exposure with another associated contaminant is responsible for the observed effects. Prenatal PCB exposure appears to be related to a relatively specific cognitive profile of impairments. Failure to assess functions that are specifically impaired may explain the absence of effects found in some studies. Our findings have implications in the selection of cognitive assessment methods in future studies.

  3. Experiences that develop the ability to think strategically.

    PubMed

    Goldman, Ellen; Cahill, Terrence; Filho, Rubens Pessanha

    2009-01-01

    The ability to think strategically is an admired and a sought-after leadership requirement, yet we know little about how it develops. The purpose of this study is to identify specific experiences that contribute to the development of an individual's ability to think strategically. We identified eight work experiences, including different types of organizational projects, processes, and relationships, that contribute to an individual's strategic thinking ability. We also delineate specific characteristics material to each experience. These characteristics indicate that considerable time and focus are required to develop the ability to think strategically. In addition, the experiences are not all accessed equally: Women are less likely to have nonrelational experiences, while chief executive officers are more likely to have the most challenging ones. In addition, we found differences regarding work-related continuing education activities. Respondents rated nonhealthcare conferences and reading behind all other identified experiences that contribute to strategic thinking ability. Individuals can implement several strategies to improve their strategic thinking ability, including deliberately incorporating the requisite experiences into their development plans, ensuring that the experiences incorporate the required characteristics, and improving the benefit received from attending educational programs in nonhealthcare industries. Organizations can implement several strategies to ensure the experiences are as effective as possible, such as appraising gender differences across the experiences and reviewing the organization's strategic planning processes for the characteristics that best encourage strategic thinking.

  4. Specification and estimation of sources of bias affecting neurological studies in PET/MR with an anatomical brain phantom

    NASA Astrophysics Data System (ADS)

    Teuho, J.; Johansson, J.; Linden, J.; Saunavaara, V.; Tolvanen, T.; Teräs, M.

    2014-01-01

    Selection of reconstruction parameters has an effect on the image quantification in PET, with an additional contribution from a scanner-specific attenuation correction method. For achieving comparable results in inter- and intra-center comparisons, any existing quantitative differences should be identified and compensated for. In this study, a comparison between PET, PET/CT and PET/MR is performed by using an anatomical brain phantom, to identify and measure the amount of bias caused due to differences in reconstruction and attenuation correction methods especially in PET/MR. Differences were estimated by using visual, qualitative and quantitative analysis. The qualitative analysis consisted of a line profile analysis for measuring the reproduction of anatomical structures and the contribution of the amount of iterations to image contrast. The quantitative analysis consisted of measurement and comparison of 10 anatomical VOIs, where the HRRT was considered as the reference. All scanners reproduced the main anatomical structures of the phantom adequately, although the image contrast on the PET/MR was inferior when using a default clinical brain protocol. Image contrast was improved by increasing the amount of iterations from 2 to 5 while using 33 subsets. Furthermore, a PET/MR-specific bias was detected, which resulted in underestimation of the activity values in anatomical structures closest to the skull, due to the MR-derived attenuation map that ignores the bone. Thus, further improvements for the PET/MR reconstruction and attenuation correction could be achieved by optimization of RAMLA-specific reconstruction parameters and implementation of bone to the attenuation template.

  5. Identification of an Na(+)-dependent transporter associated with saxitoxin-producing strains of the cyanobacterium Anabaena circinalis.

    PubMed

    Pomati, Francesco; Burns, Brendan P; Neilan, Brett A

    2004-08-01

    Blooms of the freshwater cyanobacterium Anabaena circinalis are recognized as an important health risk worldwide due to the production of a range of toxins such as saxitoxin (STX) and its derivatives. In this study we used HIP1 octameric-palindrome repeated-sequence PCR to compare the genomic structure of phylogenetically similar Australian isolates of A. circinalis. STX-producing and nontoxic cyanobacterial strains showed different HIP1 (highly iterated octameric palindrome 1) DNA patterns, and characteristic interrepeat amplicons for each group were identified. Suppression subtractive hybridization (SSH) was performed using HIP1 PCR-generated libraries to further identify toxic-strain-specific genes. An STX-producing strain and a nontoxic strain of A. circinalis were chosen as testers in two distinct experiments. The two categories of SSH putative tester-specific sequences were characterized by different families of encoded proteins that may be representative of the differences in metabolism between STX-producing and nontoxic A. circinalis strains. DNA-microarray hybridization and genomic screening revealed a toxic-strain-specific HIP1 fragment coding for a putative Na(+)-dependent transporter. Analysis of this gene demonstrated analogy to the mrpF gene of Bacillus subtilis, whose encoded protein is involved in Na(+)-specific pH homeostasis. The application of this gene as a molecular probe in laboratory and environmental screening for STX-producing A. circinalis strains was demonstrated. The possible role of this putative Na(+)-dependent transporter in the toxic cyanobacterial phenotype is also discussed, in light of recent physiological studies of STX-producing cyanobacteria.

  6. Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades

    PubMed Central

    2009-01-01

    Background Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. Results To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Conclusion Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences. PMID:19821996

  7. Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades.

    PubMed

    Förster, Frank; Liang, Chunguang; Shkumatov, Alexander; Beisser, Daniela; Engelmann, Julia C; Schnölzer, Martina; Frohme, Marcus; Müller, Tobias; Schill, Ralph O; Dandekar, Thomas

    2009-10-12

    Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences.

  8. Specific issues, exact locations: case study of a community mapping project to improve safety in a disadvantaged community.

    PubMed

    Qummouh, Rana; Rose, Vanessa; Hall, Pat

    2012-12-01

    Safety is a health issue and a significant concern in disadvantaged communities. This paper describes an example of community-initiated action to address perceptions of fear and safety in a suburb in south-west Sydney which led to the development of a local, community-driven research project. As a first step in developing community capacity to take action on issues of safety, a joint resident-agency group implemented a community safety mapping project to identify the extent of safety issues in the community and their exact geographical location. Two aerial maps of the suburb, measuring one metre by two metres, were placed on display at different locations for four months. Residents used coloured stickers to identify specific issues and exact locations where crime and safety were a concern. Residents identified 294 specific safety issues in the suburb, 41.9% (n=123) associated with public infrastructure, such as poor lighting and pathways, and 31.9% (n=94) associated with drug-related issues such as drug activity and discarded syringes. Good health promotion practice reflects community need. In a very practical sense, this project responded to community calls for action by mapping resident knowledge on specific safety issues and exact locations and presenting these maps to local decision makers for further action.

  9. Emotion Regulation through Movement: Unique Sets of Movement Characteristics are Associated with and Enhance Basic Emotions.

    PubMed

    Shafir, Tal; Tsachor, Rachelle P; Welch, Kathleen B

    2015-01-01

    We have recently demonstrated that motor execution, observation, and imagery of movements expressing certain emotions can enhance corresponding affective states and therefore could be used for emotion regulation. But which specific movement(s) should one use in order to enhance each emotion? This study aimed to identify, using Laban Movement Analysis (LMA), the Laban motor elements (motor characteristics) that characterize movements whose execution enhances each of the basic emotions: anger, fear, happiness, and sadness. LMA provides a system of symbols describing its motor elements, which gives a written instruction (motif) for the execution of a movement or movement-sequence over time. Six senior LMA experts analyzed a validated set of video clips showing whole body dynamic expressions of anger, fear, happiness and sadness, and identified the motor elements that were common to (appeared in) all clips expressing the same emotion. For each emotion, we created motifs of different combinations of the motor elements common to all clips of the same emotion. Eighty subjects from around the world read and moved those motifs, to identify the emotion evoked when moving each motif and to rate the intensity of the evoked emotion. All subjects together moved and rated 1241 motifs, which were produced from 29 different motor elements. Using logistic regression, we found a set of motor elements associated with each emotion which, when moved, predicted the feeling of that emotion. Each emotion was predicted by a unique set of motor elements and each motor element predicted only one emotion. Knowledge of which specific motor elements enhance specific emotions can enable emotional self-regulation through adding some desired motor qualities to one's personal everyday movements (rather than mimicking others' specific movements) and through decreasing motor behaviors which include elements that enhance negative emotions.

  10. Preference-based Glaucoma-specific Health-related Quality of Life Instrument: Development of the Health Utility for Glaucoma.

    PubMed

    Muratov, Sergei; Podbielski, Dominik W; Kennedy, Kevin; Jack, Susan M; Pemberton, Julia; Ahmed, Iqbal Ike K; Baltaziak, Monika; Xie, Feng

    2018-05-12

    To develop a descriptive system for a glaucoma-specific preference-based health-related quality of life (HRQoL) instrument: the Health Utility for Glaucoma (HUG-5). The descriptive system was developed in two stages: item identification and item selection. A systematic literature review of HRQoL assessment of glaucoma was conducted using a comprehensive search strategy. Purposeful sampling was used to recruit patients with different clinical characteristics. Relevant items were presented to glaucoma patients through face-to-face, semi-structured interviews. Framework methodology was applied to analyze interview content. The recurring themes identified through an iterative content analysis represented topics of most importance and relevance to patients. These themes formed the domains of the HUG-5 descriptive system. Three versions of the descriptive system, differing in explanatory detail, were pilot tested using a focus group. The literature review identified 19 articles which contained 266 items. These items were included for the full text review and were used to develop an interview guide. From twelve patient interviews, 22 themes were identified and grouped into five domains that informed the five questions of the descriptive system. The HUG-5 measures visual discomfort, mobility, daily life activities, emotional well-being, and social activities. Each question has five response levels that range from "no problem" to "severe problem". The focus group comprised of seven additional patients unanimously preferred the version that contained detailed, specific examples to support each question. A 5-domain descriptive system of a glaucoma-specific preference-based instrument, the HUG-5, was developed and remains to be evaluated for validity and reliability in the glaucoma patient population.

  11. Emotion Regulation through Movement: Unique Sets of Movement Characteristics are Associated with and Enhance Basic Emotions

    PubMed Central

    Shafir, Tal; Tsachor, Rachelle P.; Welch, Kathleen B.

    2016-01-01

    We have recently demonstrated that motor execution, observation, and imagery of movements expressing certain emotions can enhance corresponding affective states and therefore could be used for emotion regulation. But which specific movement(s) should one use in order to enhance each emotion? This study aimed to identify, using Laban Movement Analysis (LMA), the Laban motor elements (motor characteristics) that characterize movements whose execution enhances each of the basic emotions: anger, fear, happiness, and sadness. LMA provides a system of symbols describing its motor elements, which gives a written instruction (motif) for the execution of a movement or movement-sequence over time. Six senior LMA experts analyzed a validated set of video clips showing whole body dynamic expressions of anger, fear, happiness and sadness, and identified the motor elements that were common to (appeared in) all clips expressing the same emotion. For each emotion, we created motifs of different combinations of the motor elements common to all clips of the same emotion. Eighty subjects from around the world read and moved those motifs, to identify the emotion evoked when moving each motif and to rate the intensity of the evoked emotion. All subjects together moved and rated 1241 motifs, which were produced from 29 different motor elements. Using logistic regression, we found a set of motor elements associated with each emotion which, when moved, predicted the feeling of that emotion. Each emotion was predicted by a unique set of motor elements and each motor element predicted only one emotion. Knowledge of which specific motor elements enhance specific emotions can enable emotional self-regulation through adding some desired motor qualities to one's personal everyday movements (rather than mimicking others' specific movements) and through decreasing motor behaviors which include elements that enhance negative emotions. PMID:26793147

  12. Milk oligosaccharides over time of lactation from different dog breeds.

    PubMed

    Macias Rostami, Shirin; Bénet, Thierry; Spears, Julie; Reynolds, Arleigh; Satyaraj, Ebenezer; Sprenger, Norbert; Austin, Sean

    2014-01-01

    The partnership of humans and dogs goes back to over 10'000 years, yet relatively little is known about a dog's first extra-uterine nutrition particularly when it comes to milk oligosaccharides. We set out to identify and quantify milk oligosaccharides over the course of lactation from different dog breeds (Labrador retriever, Schnauzer and 3 Alaskan husky crossbreeds). To this end, 2 different chromatographic methods with fluorescence and mass spectrometry detection were developed and one was validated for quantification. Besides lactose and lactose-sulphate, we identified 2 different trisaccharides composed of 3 hexose units, 3'sialyllactose (3'SL), 6'sialyllactose (6'SL), 2'fucosyllactose (2'FL), and a tetrasaccharide composed of 2 hexoses, an N-acetylhexosamine and a deoxyhexose. 3'SL was present at the highest levels in milk of all dog breeds starting at around 7.5 g/L and dropping to about 1.5 g/L in the first 10 days of lactation. 6'SL was about 10 times less abundant and 2'FL and the tetrasaccharide had rather varying levels in the milk of the different breeds with the tetrasaccharide only detectable in the Alaskan husky crossbreeds. The longitudinal and quantitative data of milk oligosaccharides from different dog breeds are an important basis to further our understanding on their specific biological roles and also on the specific nutritional requirements of lactating puppies.

  13. Milk Oligosaccharides over Time of Lactation from Different Dog Breeds

    PubMed Central

    Macias Rostami, Shirin; Bénet, Thierry; Spears, Julie; Reynolds, Arleigh; Satyaraj, Ebenezer; Sprenger, Norbert; Austin, Sean

    2014-01-01

    The partnership of humans and dogs goes back to over 10'000 years, yet relatively little is known about a dog's first extra-uterine nutrition particularly when it comes to milk oligosaccharides. We set out to identify and quantify milk oligosaccharides over the course of lactation from different dog breeds (Labrador retriever, Schnauzer and 3 Alaskan husky crossbreeds). To this end, 2 different chromatographic methods with fluorescence and mass spectrometry detection were developed and one was validated for quantification. Besides lactose and lactose-sulphate, we identified 2 different trisaccharides composed of 3 hexose units, 3′sialyllactose (3′SL), 6′sialyllactose (6′SL), 2′fucosyllactose (2′FL), and a tetrasaccharide composed of 2 hexoses, an N-acetylhexosamine and a deoxyhexose. 3′SL was present at the highest levels in milk of all dog breeds starting at around 7.5 g/L and dropping to about 1.5 g/L in the first 10 days of lactation. 6′SL was about 10 times less abundant and 2′FL and the tetrasaccharide had rather varying levels in the milk of the different breeds with the tetrasaccharide only detectable in the Alaskan husky crossbreeds. The longitudinal and quantitative data of milk oligosaccharides from different dog breeds are an important basis to further our understanding on their specific biological roles and also on the specific nutritional requirements of lactating puppies. PMID:24924915

  14. Sequential detection of different antigens induced by Epstein-Barr virus and herpes simplex virus in the same Western blot by using dual antibody probes.

    PubMed

    Lin, J C; Pagano, J S

    1986-08-01

    A dual antibody probing technique that permitted a color-coded identification of polypeptides representing different classes of Epstein-Barr virus (EBV) antigens as well as differentiation of the polypeptides induced by different herpesviruses in the same Western blot was developed. When the nitrocellulose sheet was probed first with monoclonal antibody against EBV early antigen diffuse component (EA-D) and then stained with 4-chloro-1-naphthol, four polypeptides specific for EA-D were identified by purple bands. Subsequently, the same nitrocellulose sheet was reprobed with human serum containing antibodies against EBV early antigen, viral capsid antigen, and nuclear antigen and stained with 3,3'-diaminobenzidine. Several brown bands corresponding to early, viral capsid, and nuclear antigen polypeptides were detected. The dual antibody probing technique was used in an analysis to differentiate polypeptides resulting from either EBV or herpes simplex virus infection, either in cells infected by individual virus or in a cell line dually infected by both viruses. On the basis of different colored bands in different lanes of the same gel, 20 polypeptides with molecular weights ranging from 31,000 to 165,000 were identified as herpes simplex virus-specific proteins. These results suggested that the dual antibody probing technique may be applicable in clinical diagnosis for detecting antigens and antibodies derived from different pathogens.

  15. Comparative quantitative proteomics analysis of the ABA response of roots of drought-sensitive and drought-tolerant wheat varieties identifies proteomic signatures of drought adaptability.

    PubMed

    Alvarez, Sophie; Roy Choudhury, Swarup; Pandey, Sona

    2014-03-07

    Wheat is one of the most highly cultivated cereals in the world. Like other cultivated crops, wheat production is significantly affected by abiotic stresses such as drought. Multiple wheat varieties suitable for different geographical regions of the world have been developed that are adapted to different environmental conditions; however, the molecular basis of such adaptations remains unknown in most cases. We have compared the quantitative proteomics profile of the roots of two different wheat varieties, Nesser (drought-tolerant) and Opata (drought-sensitive), in the absence and presence of abscisic acid (ABA, as a proxy for drought). A labeling LC-based quantitative proteomics approach using iTRAQ was applied to elucidate the changes in protein abundance levels. Quantitative differences in protein levels were analyzed for the evaluation of inherent differences between the two varieties as well as the overall and variety-specific effect of ABA on the root proteome. This study reveals the most elaborate ABA-responsive root proteome identified to date in wheat. A large number of proteins exhibited inherently different expression levels between Nesser and Opata. Additionally, significantly higher numbers of proteins were ABA-responsive in Nesser roots compared with Opata roots. Furthermore, several proteins showed variety-specific regulation by ABA, suggesting their role in drought adaptation.

  16. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    NASA Astrophysics Data System (ADS)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  17. Forensic Signature Detection of Yersinia Pestis Culturing Practices Across Institutions Using a Bayesian Network

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Webb-Robertson, Bobbie-Jo M.; Corley, Courtney D.; McCue, Lee Ann

    The field of bioforensics is focused on the analysis of evidence from a biocrime. Existing laboratory analyses can identify the specific strain of an organism in the evidence, as well signatures of the specific culture batch of organisms, such as low-frequency contaminants or indicators of growth and processing methods. To link these disparate types of physical data to potential suspects, investigators may need to identify institutions or individuals whose access to strains and culturing practices match those identified from the evidence. In this work we present a Bayesian statistical network to fuse different types of analytical measurements that predict themore » production environment of a Yersinia pestis sample under investigation with automated test processing of scientific publications to identify institutions with a history of growing Y. pestis under similar conditions. Furthermore, the textual and experimental signatures were evaluated recursively to determine the overall sensitivity of the network across all levels of false positives. We illustrate that institutions associated with several specific culturing practices can be accurately selected based on the experimental signature from only a few analytical measurements. These findings demonstrate that similar Bayesian networks can be generated generically for many organisms of interest and their deployment is not prohibitive due to either computational or experimental factors.« less

  18. Use of ITS2 region as the universal DNA barcode for plants and animals.

    PubMed

    Yao, Hui; Song, Jingyuan; Liu, Chang; Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin

    2010-10-01

    The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org).

  19. Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals

    PubMed Central

    Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin

    2010-01-01

    Background The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. Methodology/Principal Findings In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. Conclusions/Significance As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org). PMID:20957043

  20. Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages

    PubMed Central

    Pradervand, Sylvain; Maurya, Mano R; Subramaniam, Shankar

    2006-01-01

    Background Release of immuno-regulatory cytokines and chemokines during inflammatory response is mediated by a complex signaling network. Multiple stimuli produce different signals that generate different cytokine responses. Current knowledge does not provide a complete picture of these signaling pathways. However, using specific markers of signaling pathways, such as signaling proteins, it is possible to develop a 'coarse-grained network' map that can help understand common regulatory modules for various cytokine responses and help differentiate between the causes of their release. Results Using a systematic profiling of signaling responses and cytokine release in RAW 264.7 macrophages made available by the Alliance for Cellular Signaling, an analysis strategy is presented that integrates principal component regression and exhaustive search-based model reduction to identify required signaling factors necessary and sufficient to predict the release of seven cytokines (G-CSF, IL-1α, IL-6, IL-10, MIP-1α, RANTES, and TNFα) in response to selected ligands. This study provides a model-based quantitative estimate of cytokine release and identifies ten signaling components involved in cytokine production. The models identified capture many of the known signaling pathways involved in cytokine release and predict potentially important novel signaling components, like p38 MAPK for G-CSF release, IFNγ- and IL-4-specific pathways for IL-1a release, and an M-CSF-specific pathway for TNFα release. Conclusion Using an integrative approach, we have identified the pathways responsible for the differential regulation of cytokine release in RAW 264.7 macrophages. Our results demonstrate the power of using heterogeneous cellular data to qualitatively and quantitatively map intermediate cellular phenotypes. PMID:16507166

  1. Identifying Key Components for an Effective Case Report Poster: An Observational Study

    PubMed Central

    Paranjape, Anuradha; Estrada, Carlos

    2008-01-01

    BACKGROUND Residents demonstrate scholarly activity by presenting posters at academic meetings. Although recommendations from national organizations are available, evidence identifying which components are most important is not. OBJECTIVE To develop and test an evaluation tool to measure the quality of case report posters and identify the specific components most in need of improvement. DESIGN Faculty evaluators reviewed case report posters and provided on-site feedback to presenters at poster sessions of four annual academic general internal medicine meetings. A newly developed ten-item evaluation form measured poster quality for specific components of content, discussion, and format (5-point Likert scale, 1 = lowest, 5 = highest). Main outcome measure(s): Evaluation tool performance, including Cronbach alpha and inter-rater reliability, overall poster scores, differences across meetings and evaluators and specific components of the posters most in need of improvement. RESULTS Forty-five evaluators from 20 medical institutions reviewed 347 posters. Cronbach’s alpha of the evaluation form was 0.84 and inter-rater reliability, Spearman’s rho 0.49 ( < 0.001). The median score was 4.1 (Q1 -Q3, 3.7-4.6)(Q1 = 25th, Q3 = 75th percentile). The national meeting median score was higher than the regional meetings (4.4 vs, 4.0,  < 0.001). We found no difference in faculty scores. The following areas were identified as most needing improvement: clearly state learning objectives, tie conclusions to learning objectives, and use appropriate amount of words. CONCLUSIONS Our evaluation tool provides empirical data to guide trainees as they prepare posters for presentation which may improve poster quality and enhance their scholarly productivity. PMID:19089510

  2. Biculturalization: Developing Culturally Responsive Approaches to Family Participation

    ERIC Educational Resources Information Center

    Sheehey, Patricia; Ornelles, Cecily; Noonan, Mary Jo

    2009-01-01

    This manuscript describes a process for addressing cultural differences that is effective when applied specifically to collaborating with families in planning an intervention or an Individualized Education Program (IEP). The process, known as biculturalization, is designed to create culturally appropriate interventions by identifying and…

  3. Evaluation of a novel median power spectrogram for seizure detection by non-neurophysiologists.

    PubMed

    Yan, Peter; Melman, Tamar; Yan, Sherry; Otgonsuren, Munkhzul; Grinspan, Zachary

    2017-08-01

    (1) To evaluate how well resident physicians use a novel EEG spectral analysis tool (the median power spectrogram; MPS) to detect seizures. (2) To assess the capability of the MPS to identify different seizure types. 120 EEG records from children with intractable seizures were converted to MPS by taking the median power across leads and using multi-taper spectral estimation. Twelve blinded neurology residents were trained to interpret the spectrogram with a five-minute video tutorial and post-test. Two residents independently assessed each set for presence of seizures. Their performance was compared to seizures identified using conventional EEG. Two blinded neurologists separately reviewed the EEGs and spectrograms to independently categorize the seizures. Their results were used to determine the spectrogram's capability to reveal seizures and visualize different seizure types for the user. Three key MPS features distinguished seizures from inter-ictal background: power difference relative to background, down-sloping resonance bands, and power in high frequencies. Using these features, residents identified seizures with 77% sensitivity and 72% specificity. 86% (51/59) of focal seizures and 81% (22/27) of generalized seizures were detected by at least one resident. Missed seizures included brief (<60s) seizures, tonic seizures, seizures with predominant delta (0-4Hz) activity, and seizures evident primarily in supplementary low temporal leads. The MPS is a novel qEEG modality that requires minimal training to interpret. It enables physicians without extensive neurophysiology training to identify seizures with sensitivity and specificity comparable to more complex multi-modal qEEG displays. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

  4. The casting of semi-permeable membranes in a microgravity environment

    NASA Technical Reports Server (NTRS)

    Vera, I.

    1986-01-01

    The experiment is to study polymeric membranes. Presently, semipermeable membranes are being manufactured from several different kinds of polymers all over the world and specific applications have been identified in fluid separation processes such as reverse osmosis, ultrafiltration and electrodialysis. Although, the ultrastructure of asymmetric and composite membranes have been under intensive study, still there are many questions about the factors affecting this structure and their degree of correlation. Nevertheless, there is indication that the entire morphological structure of polymeric membranes could be affected by the difference in specific gravity between the cast solution and the coagulation liquid normally used in the membranes preparation process. The casting of semipermeable membranes in space might help to identify the effect of gravity upon the structure of these membranes. It is important to recognize that the casting process involves changes of state and that in a microgravity environment, there will be a reduction on buoyancy-driven natural convection and density gradients.

  5. Integrated action of pheromone signals in promoting courtship behavior in male mice

    PubMed Central

    Haga-Yamanaka, Sachiko; Ma, Limei; He, Jie; Qiu, Qiang; Lavis, Luke D; Looger, Loren L; Yu, C Ron

    2014-01-01

    The mammalian vomeronasal organ encodes pheromone information about gender, reproductive status, genetic background and individual differences. It remains unknown how pheromone information interacts to trigger innate behaviors. In this study, we identify vomeronasal receptors responsible for detecting female pheromones. A sub-group of V1re clade members recognizes gender-identifying cues in female urine. Multiple members of the V1rj clade are cognate receptors for urinary estrus signals, as well as for sulfated estrogen (SE) compounds. In both cases, the same cue activates multiple homologous receptors, suggesting redundancy in encoding female pheromone cues. Neither gender-specific cues nor SEs alone are sufficient to promote courtship behavior in male mice, whereas robust courtship behavior can be induced when the two cues are applied together. Thus, integrated action of different female cues is required in pheromone-triggered mating behavior. These results suggest a gating mechanism in the vomeronasal circuit in promoting specific innate behavior. DOI: http://dx.doi.org/10.7554/eLife.03025.001 PMID:25073926

  6. Smelling the Diagnosis: The Electronic Nose as Diagnostic Tool in Inflammatory Arthritis. A Case-Reference Study.

    PubMed

    Brekelmans, Marjolein P; Fens, Niki; Brinkman, Paul; Bos, Lieuwe D; Sterk, Peter J; Tak, Paul P; Gerlag, Daniëlle M

    2016-01-01

    To investigate whether exhaled breath analysis using an electronic nose can identify differences between inflammatory joint diseases and healthy controls. In a cross-sectional study, the exhaled breath of 21 rheumatoid arthritis (RA) and 18 psoriatic arthritis (PsA) patients with active disease was compared to 21 healthy controls using an electronic nose (Cyranose 320; Smiths Detection, Pasadena, CA, USA). Breathprints were analyzed with principal component analysis, discriminant analysis, and area under curve (AUC) of receiver operating characteristics (ROC) curves. Volatile organic compounds (VOCs) were identified by gas chromatography and mass spectrometry (GC-MS), and relationships between breathprints and markers of disease activity were explored. Breathprints of RA patients could be distinguished from controls with an accuracy of 71% (AUC 0.75, 95% CI 0.60-0.90, sensitivity 76%, specificity 67%). Breathprints from PsA patients were separated from controls with 69% accuracy (AUC 0.77, 95% CI 0.61-0.92, sensitivity 72%, specificity 71%). Distinction between exhaled breath of RA and PsA patients exhibited an accuracy of 69% (AUC 0.72, 95% CI 0.55-0.89, sensitivity 71%, specificity 72%). There was a positive correlation in RA patients of exhaled breathprints with disease activity score (DAS28) and number of painful joints. GC-MS identified seven key VOCs that significantly differed between the groups. Exhaled breath analysis by an electronic nose may play a role in differential diagnosis of inflammatory joint diseases. Data from this study warrant external validation.

  7. Serum Biochemical Phenotypes in the Domestic Dog

    PubMed Central

    Chang, Yu-Mei; Hadox, Erin; Szladovits, Balazs; Garden, Oliver A.

    2016-01-01

    The serum or plasma biochemical profile is essential in the diagnosis and monitoring of systemic disease in veterinary medicine, but current reference intervals typically take no account of breed-specific differences. Breed-specific hematological phenotypes have been documented in the domestic dog, but little has been published on serum biochemical phenotypes in this species. Serum biochemical profiles of dogs in which all measurements fell within the existing reference intervals were retrieved from a large veterinary database. Serum biochemical profiles from 3045 dogs were retrieved, of which 1495 had an accompanying normal glucose concentration. Sixty pure breeds plus a mixed breed control group were represented by at least 10 individuals. All analytes, except for sodium, chloride and glucose, showed variation with age. Total protein, globulin, potassium, chloride, creatinine, cholesterol, total bilirubin, ALT, CK, amylase, and lipase varied between sexes. Neutering status significantly impacted all analytes except albumin, sodium, calcium, urea, and glucose. Principal component analysis of serum biochemical data revealed 36 pure breeds with distinctive phenotypes. Furthermore, comparative analysis identified 23 breeds with significant differences from the mixed breed group in all biochemical analytes except urea and glucose. Eighteen breeds were identified by both principal component and comparative analysis. Tentative reference intervals were generated for breeds with a distinctive phenotype identified by comparative analysis and represented by at least 120 individuals. This is the first large-scale analysis of breed-specific serum biochemical phenotypes in the domestic dog and highlights potential genetic components of biochemical traits in this species. PMID:26919479

  8. Peer attachment, specific patterns of internet use and problematic internet use in male and female adolescents.

    PubMed

    Reiner, Iris; Tibubos, Ana N; Hardt, Jochen; Müller, Kai; Wölfling, Klaus; Beutel, Manfred E

    2017-10-01

    Problematic internet use may lead to serious psychosocial dysfunction. Recent studies have found comparable prevalence in both male and female adolescents. We pursue the neglected questions how male and female adolescents differ regarding their patterns of internet use and how gender, peer attachment and patterns of use are related to pathological internet use. In 2410 adolescents (1307 girls and 1103 boys) aged 12-18 years from different types of school we assessed peer attachment, frequency and use of eight specific applications and indicators of pathological internet use. Three patterns of internet use, 'social'; 'sex and games" and 'functional' were identified and connections between variables were modeled by ordered sequences of regression. We found that problematic internet use-sex and games as well as social usage-was more prevalent in boys. Insecure peer attachment predicted problematic internet use in both sexes. Also, excessive usage of internet games and sex mediated the influence of peer attachment insecurity on problematic internet use, but only for boys. Our study identified that adolescents with insecure peer attachment are at higher risk for problematic internet use. With regard to specific types of internet use, the consumption of online games and sex was identified as risk factor in boys with increasing age. Further studies are needed to understand and possibly subgroup problematic internet use behavior in girls. Our findings suggest that increasing the quality of peer relationships may be promising approach in the prevention and treatment of problematic internet use.

  9. Identification and Evaluation of Methods to Determine Ability Requirements for Air Force Occupational Specialties

    DTIC Science & Technology

    1989-08-01

    specific elements identified as useful for selection (Primoff & Eyde , 1988). The JEM approach uses a slightly different scale when test development is not...related to GATB scores and tests developed to measure specific elements (Primoff & Eyde , 1988). Of the ability taxonomies reviewed in this study, the...only formative at this point in time, the results of recent research in cognitive psychology and in use of the computer as a testing medium have not

  10. Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

    PubMed

    Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

    2005-03-15

    Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

  11. Waist circumference cut-off points for identification of abdominal obesity among the tunisian adult population.

    PubMed

    Bouguerra, R; Alberti, H; Smida, H; Salem, L B; Rayana, C B; El Atti, J; Achour, A; Gaigi, S; Slama, C B; Zouari, B; Alberti, K G M M

    2007-11-01

    Waist circumference (WC) is a convenient measure of abdominal adipose tissue. It itself is a cardiovascular disease (CVD) and diabetes-risk factor and is strongly linked to other CVD risk factors. There are, however, ethnic differences in the relationship of WC to the other risk factors. The aim of this study was to determine the optimal cut-off points of WC and body mass index (BMI) at which cardiovascular risk factors can be identified with maximum sensitivity and specificity in a representative sample of the Tunisian adult population and to investigate any correlation between WC and BMI. We used a sample of the Tunisian National Nutrition Survey, a cross-sectional population-based survey, conducted in 1996 on a large nationally representative sample, which included 3435 adults (1244 men and 2191 women) of 20 years or older. WC, BMI, blood pressure and fasting blood measurements (plasma glucose, total cholesterol, triglycerides) were recorded. Receiver operating characteristic (ROC) curve analysis was used to identify optimal cut-off values of WC and BMI to identify with maximum sensitivity and specificity the detection of high blood pressure, hyperglycaemia, high blood cholesterol and hypertriglyceridaemia. ROC curve analysis suggested WC cut-off points of 85 cm in men and 85 cm in women for the optimum detection of high blood pressure, diabetes and dyslipidaemia. The optimum BMI cut-off points for predicting cardiovascular risk factors were 24 kg/m(2) in men and 27 kg/m(2) in women. The cut-off points recommended for the Caucasian population differ from those appropriate for the Tunisian population. The data show a continuous increase in odds ratios of each cardiovascular risk factor, with increasing level of WC and BMI. WC exceeding 85 cm in men and 79 cm in women correctly identified subjects with a BMI of >/=25 kg/m(2), sensitivity of >90% and specificity of >83%. Based on the ROC analysis, we suggest a WC of 85 cm for both men and women as appropriate cut-off points to identify central obesity for the purposes of CVD and diabetes-risk detection among Tunisians. WCs of 85 cm in men and 79 cm in women were the most sensitive and specific to identify most subjects with a BMI >/=25 kg/m(2).

  12. Integrative Analysis of Brain Region-specific Shank3 Interactomes for Understanding the Heterogeneity of Neuronal Pathophysiology Related to SHANK3 Mutations

    PubMed Central

    Lee, Yeunkum; Kang, Hyojin; Lee, Bokyoung; Zhang, Yinhua; Kim, Yoonhee; Kim, Shinhyun; Kim, Won-Ki; Han, Kihoon

    2017-01-01

    Recent molecular genetic studies have identified 100s of risk genes for various neurodevelopmental and neuropsychiatric disorders. As the number of risk genes increases, it is becoming clear that different mutations of a single gene could cause different types of disorders. One of the best examples of such a gene is SHANK3, which encodes a core scaffold protein of the neuronal excitatory post-synapse. Deletions, duplications, and point mutations of SHANK3 are associated with autism spectrum disorders, intellectual disability, schizophrenia, bipolar disorder, and attention deficit hyperactivity disorder. Nevertheless, how the different mutations of SHANK3 can lead to such phenotypic diversity remains largely unknown. In this study, we investigated whether Shank3 could form protein complexes in a brain region-specific manner, which might contribute to the heterogeneity of neuronal pathophysiology caused by SHANK3 mutations. To test this, we generated a medial prefrontal cortex (mPFC) Shank3 in vivo interactome consisting of 211 proteins, and compared this protein list with a Shank3 interactome previously generated from mixed hippocampal and striatal (HP+STR) tissues. Unexpectedly, we found that only 47 proteins (about 20%) were common between the two interactomes, while 164 and 208 proteins were specifically identified in the mPFC and HP+STR interactomes, respectively. Each of the mPFC- and HP+STR-specific Shank3 interactomes represents a highly interconnected network. Upon comparing the brain region-enriched proteomes, we found that the large difference between the mPFC and HP+STR Shank3 interactomes could not be explained by differential protein expression profiles among the brain regions. Importantly, bioinformatic pathway analysis revealed that the representative biological functions of the mPFC- and HP+STR-specific Shank3 interactomes were different, suggesting that these interactors could mediate the brain region-specific functions of Shank3. Meanwhile, the same analysis on the common Shank3 interactors, including Homer and GKAP/SAPAP proteins, suggested that they could mainly function as scaffolding proteins at the post-synaptic density. Lastly, we found that the mPFC- and HP+STR-specific Shank3 interactomes contained a significant number of proteins associated with neurodevelopmental and neuropsychiatric disorders. These results suggest that Shank3 can form protein complexes in a brain region-specific manner, which might contribute to the pathophysiological and phenotypic diversity of disorders related to SHANK3 mutations. PMID:28469556

  13. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    USGS Publications Warehouse

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  14. Review of transmission routes of 24 infectious diseases preventable by biosecurity measures and comparison of the implementation of these measures in pig herds in six European countries.

    PubMed

    Filippitzi, M E; Brinch Kruse, A; Postma, M; Sarrazin, S; Maes, D; Alban, L; Nielsen, L R; Dewulf, J

    2018-04-01

    This study aimed to review the transmission routes of important infectious pig diseases and to translate these into biosecurity measures preventing or reducing the transmission between and within pig herds. Furthermore, it aimed to identify the level of implementation of these measures in different European countries and discuss the observed variations to identify potentials for improvement. First, a literature review was performed to show which direct and indirect transmission routes of 24 infectious pig diseases can be prevented through different biosecurity measures. Second, a quantitative analysis was performed using the Biocheck.UGent™, a risk-based scoring system to evaluate biosecurity in pig herds, to obtain an insight into the implementation of these biosecurity measures. The database contained farm-specific biosecurity data from 574 pig farms in Belgium, Denmark, France, Germany, the Netherlands and Sweden, entered between January 2014 and January 2016. Third, a qualitative analysis based on a review of literature and other relevant information resources was performed for every subcategory of internal and external biosecurity in the Biocheck.UGent™ questionnaire. The quantitative analysis indicated that at the level of internal, external and overall biosecurity, Denmark had a significantly distinct profile with higher external biosecurity scores and less variation than the rest of the countries. This is likely due to a widely used specific pathogen-free (SPF) system with extensive focus on biosecurity since 1971 in Denmark. However, the observed pattern may also be attributed to differences in data collection methods. The qualitative analysis identified differences in applied policies, legislation, disease status, pig farm density, farming culture and habits between countries that can be used for shaping country-specific biosecurity advice to attain improved prevention and control of important pig diseases in European pig farms. © 2017 Blackwell Verlag GmbH.

  15. Population-specific life histories contribute to metapopulation viability

    USGS Publications Warehouse

    Halsey, Samniqueka J.; Bell, Timothy J.; McEachern, A. Kathryn; Pavlovic, Noel B.

    2016-01-01

    Restoration efforts can be improved by understanding how variations in life-history traits occur within populations of the same species living in different environments. This can be done by first understanding the demographic responses of natural occurring populations. Population viability analysis continues to be useful to species management and conservation with sensitivity analysis aiding in the understanding of population dynamics. In this study, using life-table response experiments and elasticity analyses, we investigated how population-specific life-history demographic responses contributed to the metapopulation viability of the Federally threatened Pitcher's thistle (Cirsium pitcheri). Specifically, we tested the following hypotheses: (1) Subpopulations occupying different environments within a metapopulation have independent demographic responses and (2) advancing succession results in a shift from a demographic response focused on growth and fecundity to one dominated by stasis. Our results showed that reintroductions had a positive contribution to the metapopulation growth rate as compared to native populations which had a negative contribution. We found no difference in succession on the contribution to metapopulation viability. In addition, we identified distinct population-specific contributions to metapopulation viability and were able to associate specific life-history demographic responses. For example, the positive impact of Miller High Dunes population on the metapopulation growth rate resulted from high growth contributions, whereas increased time of plant in stasis for the State Park Big Blowout population resulted in negative contributions. A greater understanding of how separate populations respond in their corresponding environment may ultimately lead to more effective management strategies aimed at reducing extinction risk. We propose the continued use of sensitivity analyses to evaluate population-specific demographic influences on metapopulation viability. In understanding the underlying causes of the projected extinction probabilities of each population and identifying broad-scale contributions of different populations to the metapopulation, the process of pinpointing target populations is simplified. More detailed analyses can then be applied to the target populations to increase population viability and consequently metapopulation viability. Based on our research, we suggest that the best approach to improve the overall metapopulation viability is to manage the contributions to population growth for each population separately.

  16. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells

    PubMed Central

    Salopiata, Florian; Depner, Sofia; Wäsch, Marvin; Böhm, Martin E.; Mücke, Oliver; Plass, Christoph; Lehmann, Wolf D.; Kreutz, Clemens; Timmer, Jens; Klingmüller, Ursula

    2016-01-01

    Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC), is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO). However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR) and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid) and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR) in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR). The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in erythroid progenitor cells unaffected. Thus, the proposed modeling strategy can be employed as a general procedure to identify cell type-specific parameters and to recommend treatment strategies for the selective targeting of specific cell types. PMID:27494133

  17. Comparative proteomics of two life cycle stages of stable isotope-labeled Trypanosoma brucei reveals novel components of the parasite's host adaptation machinery.

    PubMed

    Butter, Falk; Bucerius, Ferdinand; Michel, Margaux; Cicova, Zdenka; Mann, Matthias; Janzen, Christian J

    2013-01-01

    Trypanosoma brucei developed a sophisticated life cycle to adapt to different host environments. Although developmental differentiation of T. brucei has been the topic of intensive research for decades, the mechanisms responsible for adaptation to different host environments are not well understood. We developed stable isotope labeling by amino acids in cell culture in trypanosomes to compare the proteomes of two different life cycle stages. Quantitative comparison of 4364 protein groups identified many proteins previously not known to be stage-specifically expressed. The identification of stage-specific proteins helps to understand how parasites adapt to different hosts and provides new insights into differences in metabolism, gene regulation, and cell architecture. A DEAD-box RNA helicase, which is highly up-regulated in the bloodstream form of this parasite and which is essential for viability and proper cell cycle progression in this stage is described as an example.

  18. A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.

    PubMed

    Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin

    2016-07-08

    Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic backgrounds and for the evaluation of their potential for future crop improvement like the adaptation to specific environments.

  19. Biomechanical Differences of Multidirectional Jump Landings Among Female Basketball and Soccer Players.

    PubMed

    Taylor, Jeffrey B; Ford, Kevin R; Schmitz, Randy J; Ross, Scott E; Ackerman, Terry A; Shultz, Sandra J

    2017-11-01

    Taylor, JB, Ford, KR, Schmitz, RJ, Ross, SE, Ackerman, TA, and Shultz, SJ. Biomechanical differences of multidirectional jump landings among female basketball and soccer players. J Strength Cond Res 31(11): 3034-3045, 2017-Anterior cruciate ligament (ACL) injury prevention programs are less successful in basketball than soccer and may be due to distinct movement strategies that these athletes develop from sport-specific training. The purpose of this study was to identify biomechanical differences between female basketball and soccer players during multidirectional jump landings. Lower extremity biomechanics of 89 female athletes who played competitive basketball (n = 40) or soccer (n = 49) at the middle- or high-school level were analyzed with 3-dimensional motion analysis during a drop vertical jump, double- (SAG-DL) and single-leg forward jump (SAG-SL), and double- (FRONT-DL) and single-leg (FRONT-SL) lateral jump. Basketball players landed with either less hip or knee, or both hip and knee excursion during all tasks (p ≤ 0.05) except for the SAGSL task, basketball players landed with greater peak hip flexion angles (p = 0.04). The FRONT-SL task elicited the most distinct sport-specific differences, including decreased hip adduction (p < 0.001) angles, increased hip internal rotation (p = 0.003), and increased relative knee external rotation (p = 0.001) excursions in basketball players. In addition, the FRONT-SL task elicited greater forces in knee abduction (p = 0.003) and lesser forces in hip adduction (p = 0.001) and knee external rotation (p < 0.001) in basketball players. Joint energetics were different during the FRONT-DL task, as basketball players exhibited less sagittal plane energy absorption at the hip (p < 0.001) and greater hip (p < 0.001) and knee (p = 0.001) joint stiffness. Sport-specific movement strategies were identified during all jump landing tasks, such that soccer players exhibited a more protective landing strategy than basketball players, justifying future efforts toward sport-specific ACL injury prevention programs.

  20. EXECUTIVE FUNCTION PROFILES IN CHILDREN WITH AND WITHOUT SPECIFIC LANGUAGE IMPAIRMENT

    PubMed Central

    Marton, Klara; Campanelli, Luca; Scheuer, Jessica; Yoon, Jungmee; Eichorn, Naomi

    2013-01-01

    We present findings from a study that focused on specific executive functions (EF) in children with and without specific language impairment (SLI). We analyzed performance patterns and EF profiles (spatial working memory, inhibition control, and sustained attention) in school-age SLI children and two control groups: age-matched and language matched. Our main research goal was to identify those EFs that show a weakness in children with SLI. Our specific aims were to: (1) examine whether the EF problems in children with SLI are domain-general; (2) examine whether deficits in EF in children with SLI can be explained by the general slowness hypothesis or by an overall delay in development; (3) compare EF profiles to examine whether children with SLI show a distinct pattern of performance from their peers. Our findings showed different EF profiles for the groups. We observed differences in performance patterns related to age (e.g., reaction time in response inhibition) and differences related to language status (e.g., sensitivity to interference). The findings show interesting associations in EFs that play a crucial role in language processing. PMID:25302062

  1. Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification▿

    PubMed Central

    Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon

    2008-01-01

    DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865

  2. Comparative genomic analysis of Helicobacter pylori from Malaysia identifies three distinct lineages suggestive of differential evolution.

    PubMed

    Kumar, Narender; Mariappan, Vanitha; Baddam, Ramani; Lankapalli, Aditya K; Shaik, Sabiha; Goh, Khean-Lee; Loke, Mun Fai; Perkins, Tim; Benghezal, Mohammed; Hasnain, Seyed E; Vadivelu, Jamuna; Marshall, Barry J; Ahmed, Niyaz

    2015-01-01

    The discordant prevalence of Helicobacter pylori and its related diseases, for a long time, fostered certain enigmatic situations observed in the countries of the southern world. Variation in H. pylori infection rates and disease outcomes among different populations in multi-ethnic Malaysia provides a unique opportunity to understand dynamics of host-pathogen interaction and genome evolution. In this study, we extensively analyzed and compared genomes of 27 Malaysian H. pylori isolates and identified three major phylogeographic lineages: hspEastAsia, hpEurope and hpSouthIndia. The analysis of the virulence genes within the core genome, however, revealed a comparable pathogenic potential of the strains. In addition, we identified four genes limited to strains of East-Asian lineage. Our analyses identified a few strain-specific genes encoding restriction modification systems and outlined 311 core genes possibly under differential evolutionary constraints, among the strains representing different ethnic groups. The cagA and vacA genes also showed variations in accordance with the host genetic background of the strains. Moreover, restriction modification genes were found to be significantly enriched in East-Asian strains. An understanding of these variations in the genome content would provide significant insights into various adaptive and host modulation strategies harnessed by H. pylori to effectively persist in a host-specific manner. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Evaluating the effectiveness of behavior change techniques in health-related behavior: a scoping review of methods used.

    PubMed

    Michie, Susan; West, Robert; Sheals, Kate; Godinho, Cristina A

    2018-03-01

    Behavior change interventions typically contain multiple potentially active components: behavior change techniques (BCTs). Identifying which specific BCTs or BCT combinations have the potential to be effective for a given behavior in a given context presents a major challenge. The aim of this study was to review the methods that have been used to identify effective BCTs for given behaviors in given contexts and evaluate their strengths and limitations. A scoping review was conducted of studies that had sought to identify effective BCTs. Articles referring to "behavio(u)r change technique(s)" in the abstract/text were located, and ones that involved identification of effective BCTs were selected. The methods reported were coded. The methods were analyzed in general terms using "PASS" criteria: Practicability (facility to apply the method appropriately), Applicability (facility to generalize from findings to contexts and populations of interest), Sensitivity (facility to identify effective BCTs), and Specificity (facility to rule out ineffective BCTs). A sample of 10% of the studies reviewed was then evaluated using these criteria to assess how far the strengths and limitations identified in principle were borne out in practice. One hundred and thirty-five studies were identified. The methods used in those studies were experimental manipulation of BCTs, observational studies comparing outcomes in the presence or absence of BCTs, meta-analyses of BCT comparisons, meta-regressions evaluating effect sizes with and without specific BCTs, reviews of BCTs found in effective interventions, and meta-classification and regression trees. The limitations of each method meant that only weak conclusions could be drawn regarding the effectiveness of specific BCTs or BCT combinations. Methods for identifying effective BCTs linked to target behavior and context all have important inherent limitations. A strategy needs to be developed that can systematically combine the strengths of the different methods and that can link these constructs in an ontology of behavior change interventions.

  4. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  5. The Self in Movement: Being Identified and Identifying Oneself in the Process of Migration and Asylum Seeking.

    PubMed

    Watzlawik, Meike; Brescó de Luna, Ignacio

    2017-06-01

    How migration influences the processes of identity development has been under longstanding scrutiny in the social sciences. Usually, stage models have been suggested, and different strategies for acculturation (e.g., integration, assimilation, separation, and marginalization) have been considered as ways to make sense of the psychological transformations of migrants as a group. On an individual level, however, identity development is a more complex endeavor: Identity does not just develop by itself, but is constructed as an ongoing process. To capture these processes, we will look at different aspects of migration and asylum seeking; for example, the cultural-specific values and expectations of the hosting (European) countries (e.g., as identifier), but also of the arriving individuals/groups (e.g., identified as refugees). Since the two may contradict each other, negotiations between identities claims and identity assignments become necessary. Ways to solve these contradictions are discussed, with a special focus on the experienced (and often missing) agency in different settings upon arrival in a new country. In addition, it will be shown how sudden events (e.g., 9/11, the Charlie Hebdo attack) may challenge identity processes in different ways.

  6. Lineage-specific co-evolution of the Egf receptor/ligand signaling system.

    PubMed

    Laisney, Juliette A G C; Braasch, Ingo; Walter, Ronald B; Meierjohann, Svenja; Schartl, Manfred

    2010-01-27

    The epidermal growth factor receptor (Egfr) with its numerous ligands has fundamental roles in development, cell differentiation and physiology. Dysfunction of the receptor-ligand system contributes to many human malignancies. Consistent with such various tasks, the Egfr gene family has expanded during vertebrate evolution as a consequence of several rounds of whole genome duplication. Of particular interest is the effect of the fish-specific whole genome duplication (FSGD) on the ligand-receptor system, as it has supplied this largest group of vertebrates with additional opportunities for sub- and/or neofunctionalization in this signaling system. We identified the predicted components of the Egf receptor-ligand signaling system in teleost fishes (medaka, platyfish, stickleback, pufferfishes and zebrafish). We found two duplicated egfr genes, egfra and egfrb, in all available teleost genomes. Surprisingly only one copy for each of the seven Egfr ligands could be identified in most fishes, with zebrafish hbegf being the only exception. Special focus was put on medaka, for which we more closely investigated all Egf receptors and Egfr ligands. The different expression patterns of egfra, egfrb and their ligands in medaka tissues and embryo stages suggest differences in role and function. Preferential co-expression of different subsets of Egfr ligands corroborates the possible subfunctionalization and specialization of the two receptors in adult tissues. Bioinformatic analyses of the ligand-receptor interface between Egfr and its ligands show a very weak evolutionary conservation within this region. Using in vitro analyses of medaka Egfra, we could show that this receptor is only activated by medaka ligands, but not by human EGF. Altogether, our data suggest a lineage-specific Egfr/Egfr ligand co-evolution. Our data indicate that medaka Egfr signaling occurs via its two copies, Egfra and Egfrb, each of them being preferentially coexpressed with different subsets of Egfr ligands. This fish-specific occurrence of Egf receptor specialization offers unique opportunities to study the functions of different Egf receptor-ligand combinations and their biological outputs in vertebrates. Furthermore, our results strongly support the use of homologous ligands in future studies, as sufficient cross-specificity is very unlikely for this ligand/receptor system.

  7. Lineage-specific co-evolution of the Egf receptor/ligand signaling system

    PubMed Central

    2010-01-01

    Background The epidermal growth factor receptor (Egfr) with its numerous ligands has fundamental roles in development, cell differentiation and physiology. Dysfunction of the receptor-ligand system contributes to many human malignancies. Consistent with such various tasks, the Egfr gene family has expanded during vertebrate evolution as a consequence of several rounds of whole genome duplication. Of particular interest is the effect of the fish-specific whole genome duplication (FSGD) on the ligand-receptor system, as it has supplied this largest group of vertebrates with additional opportunities for sub- and/or neofunctionalization in this signaling system. Results We identified the predicted components of the Egf receptor-ligand signaling system in teleost fishes (medaka, platyfish, stickleback, pufferfishes and zebrafish). We found two duplicated egfr genes, egfra and egfrb, in all available teleost genomes. Surprisingly only one copy for each of the seven Egfr ligands could be identified in most fishes, with zebrafish hbegf being the only exception. Special focus was put on medaka, for which we more closely investigated all Egf receptors and Egfr ligands. The different expression patterns of egfra, egfrb and their ligands in medaka tissues and embryo stages suggest differences in role and function. Preferential co-expression of different subsets of Egfr ligands corroborates the possible subfunctionalization and specialization of the two receptors in adult tissues. Bioinformatic analyses of the ligand-receptor interface between Egfr and its ligands show a very weak evolutionary conservation within this region. Using in vitro analyses of medaka Egfra, we could show that this receptor is only activated by medaka ligands, but not by human EGF. Altogether, our data suggest a lineage-specific Egfr/Egfr ligand co-evolution. Conclusions Our data indicate that medaka Egfr signaling occurs via its two copies, Egfra and Egfrb, each of them being preferentially coexpressed with different subsets of Egfr ligands. This fish-specific occurrence of Egf receptor specialization offers unique opportunities to study the functions of different Egf receptor-ligand combinations and their biological outputs in vertebrates. Furthermore, our results strongly support the use of homologous ligands in future studies, as sufficient cross-specificity is very unlikely for this ligand/receptor system. PMID:20105326

  8. Mining for class-specific motifs in protein sequence classification

    PubMed Central

    2013-01-01

    Background In protein sequence classification, identification of the sequence motifs or n-grams that can precisely discriminate between classes is a more interesting scientific question than the classification itself. A number of classification methods aim at accurate classification but fail to explain which sequence features indeed contribute to the accuracy. We hypothesize that sequences in lower denominations (n-grams) can be used to explore the sequence landscape and to identify class-specific motifs that discriminate between classes during classification. Discriminative n-grams are short peptide sequences that are highly frequent in one class but are either minimally present or absent in other classes. In this study, we present a new substitution-based scoring function for identifying discriminative n-grams that are highly specific to a class. Results We present a scoring function based on discriminative n-grams that can effectively discriminate between classes. The scoring function, initially, harvests the entire set of 4- to 8-grams from the protein sequences of different classes in the dataset. Similar n-grams of the same size are combined to form new n-grams, where the similarity is defined by positive amino acid substitution scores in the BLOSUM62 matrix. Substitution has resulted in a large increase in the number of discriminatory n-grams harvested. Due to the unbalanced nature of the dataset, the frequencies of the n-grams are normalized using a dampening factor, which gives more weightage to the n-grams that appear in fewer classes and vice-versa. After the n-grams are normalized, the scoring function identifies discriminative 4- to 8-grams for each class that are frequent enough to be above a selection threshold. By mapping these discriminative n-grams back to the protein sequences, we obtained contiguous n-grams that represent short class-specific motifs in protein sequences. Our method fared well compared to an existing motif finding method known as Wordspy. We have validated our enriched set of class-specific motifs against the functionally important motifs obtained from the NLSdb, Prosite and ELM databases. We demonstrate that this method is very generic; thus can be widely applied to detect class-specific motifs in many protein sequence classification tasks. Conclusion The proposed scoring function and methodology is able to identify class-specific motifs using discriminative n-grams derived from the protein sequences. The implementation of amino acid substitution scores for similarity detection, and the dampening factor to normalize the unbalanced datasets have significant effect on the performance of the scoring function. Our multipronged validation tests demonstrate that this method can detect class-specific motifs from a wide variety of protein sequence classes with a potential application to detecting proteome-specific motifs of different organisms. PMID:23496846

  9. Joint genetic analysis of hippocampal size in mouse and human identifies a novel gene linked to neurodegenerative disease.

    PubMed

    Ashbrook, David G; Williams, Robert W; Lu, Lu; Stein, Jason L; Hibar, Derrek P; Nichols, Thomas E; Medland, Sarah E; Thompson, Paul M; Hager, Reinmar

    2014-10-03

    Variation in hippocampal volume has been linked to significant differences in memory, behavior, and cognition among individuals. To identify genetic variants underlying such differences and associated disease phenotypes, multinational consortia such as ENIGMA have used large magnetic resonance imaging (MRI) data sets in human GWAS studies. In addition, mapping studies in mouse model systems have identified genetic variants for brain structure variation with great power. A key challenge is to understand how genetically based differences in brain structure lead to the propensity to develop specific neurological disorders. We combine the largest human GWAS of brain structure with the largest mammalian model system, the BXD recombinant inbred mouse population, to identify novel genetic targets influencing brain structure variation that are linked to increased risk for neurological disorders. We first use a novel cross-species, comparative analysis using mouse and human genetic data to identify a candidate gene, MGST3, associated with adult hippocampus size in both systems. We then establish the coregulation and function of this gene in a comprehensive systems-analysis. We find that MGST3 is associated with hippocampus size and is linked to a group of neurodegenerative disorders, such as Alzheimer's.

  10. From Connectivity Models to Region Labels: Identifying Foci of a Neurological Disorder

    PubMed Central

    Venkataraman, Archana; Kubicki, Marek; Golland, Polina

    2014-01-01

    We propose a novel approach to identify the foci of a neurological disorder based on anatomical and functional connectivity information. Specifically, we formulate a generative model that characterizes the network of abnormal functional connectivity emanating from the affected foci. This allows us to aggregate pairwise connectivity changes into a region-based representation of the disease. We employ the variational expectation-maximization algorithm to fit the model and subsequently identify both the afflicted regions and the differences in connectivity induced by the disorder. We demonstrate our method on a population study of schizophrenia. PMID:23864168

  11. Does interspecies hybridization affect the host specificity of parasites in cyprinid fish?

    PubMed

    Simková, Andrea; Dávidová, Martina; Papoušek, Ivo; Vetešník, Lukáš

    2013-04-12

    Host specificity varies among parasite species. Some parasites are strictly host-specific, others show a specificity for congeneric or non-congeneric phylogenetically related host species, whilst some others are non-specific (generalists). Two cyprinids, Cyprinus carpio and Carassius gibelio, plus their respective hybrids were investigated for metazoan parasites. The aim of this study was to analyze whether interspecies hybridization affects host specificity. The different degrees of host specificity within a phylogenetic framework were taken into consideration (i.e. strict specialist, intermediate specialist, and intermediate generalist). Fish were collected during harvesting the pond and identified using meristic traits and molecular markers. Metazoan parasite species were collected. Host specificity of parasites was determined using the following classification: strict specialist, intermediate specialist, intermediate generalist and generalist. Parasite species richness was compared between parental species and their hybrids. The effect of host species on abundance of parasites differing in host specificity was tested. Hybrids harbored more different parasite species but their total parasite abundance was lower in comparison with parental species. Interspecies hybridization affected the host specificity of ecto- and endoparasites. Parasite species exhibiting different degrees of host specificity for C. carpio and C. gibelio were also present in hybrids. The abundance of strict specialists of C. carpio was significantly higher in parental species than in hybrids. Intermediate generalists parasitizing C. carpio and C. gibelio as two phylogenetically closely related host species preferentially infected C. gibelio when compared to C. carpio, based on prevalence and maximum intensity of infection. Hybrids were less infected by intermediate generalists when compared to C. gibelio. This finding does not support strict co-adaptation between host and parasite genotypes resulting in narrow host specificity, and showed that hybrid genotypes are susceptible to parasites exhibiting host specificity. The immune mechanisms specific to parental species might represent potential mechanisms explaining the low abundance of parasites in C. gibelio x C. carpio hybrids.

  12. Identification and quantification of flavor attributes present in chicken, lamb, pork, beef, and turkey.

    PubMed

    Maughan, Curtis; Martini, Silvana

    2012-02-01

    The objectives of this study were to use a meat flavor lexicon to identify and quantify flavor differences among different types of meats such as beef, chicken, lamb, pork, and turkey, and to identify and quantify specific flavor attributes associated with "beef flavor" notes. A trained descriptive panel with 11 participants used a previously developed meat lexicon composed of 18 terms to evaluate the flavor of beef, chicken, pork, turkey, and lamb samples. Results show that beef and lamb samples can be described by flavor attributes such as barny, bitter, gamey, grassy, livery, metallic, and roast beef. Inversely related to these samples were pork and turkey and those attributes that were closely related to them, namely brothy, fatty, salty, sweet, and umami. Chicken was not strongly related to the other types of meats or the attributes used. The descriptive panel also evaluated samples of ground beef mixed with chicken to identify and quantify flavor attributes associated with a "beef flavor." Meat patties for this portion consisted of ground beef mixed with ground chicken in varying amounts: 0%, 25%, 50%, 75%, and 100% beef, with the remainder made up of chicken. Beef and beef-rich patties (75% beef) were more closely related to flavor attributes such as astringent, bloody, fatty, gamey, metallic, livery, oxidized, grassy, and roast beef, while chicken was more closely associated with brothy, juicy, sour, sweet, and umami. This research provides information regarding the specific flavor attributes that differentiate chicken and beef products and provides the first set of descriptors that can be associated with "beefy" notes. POTENTIAL APPLICATION: The use of a standardized flavor lexicon will allow meat producers to identify specific flavors present in their products. The impact is to identify and quantify negative and positive flavors in the product with the ultimate goal of optimizing processing or cooking conditions and improve the quality of meat products. © 2012 Institute of Food Technologists®

  13. Diagnostic accuracy of different caries risk assessment methods. A systematic review.

    PubMed

    Senneby, Anna; Mejàre, Ingegerd; Sahlin, Nils-Eric; Svensäter, Gunnel; Rohlin, Madeleine

    2015-12-01

    To evaluate the accuracy of different methods used to identify individuals with increased risk of developing dental coronal caries. Studies on following methods were included: previous caries experience, tests using microbiota, buffering capacity, salivary flow rate, oral hygiene, dietary habits and sociodemographic variables. QUADAS-2 was used to assess risk of bias. Sensitivity, specificity, predictive values, and likelihood ratios (LR) were calculated. Quality of evidence based on ≥3 studies of a method was rated according to GRADE. PubMed, Cochrane Library, Web of Science and reference lists of included publications were searched up to January 2015. From 5776 identified articles, 18 were included. Assessment of study quality identified methodological limitations concerning study design, test technology and reporting. No study presented low risk of bias in all domains. Three or more studies were found only for previous caries experience and salivary mutans streptococci and quality of evidence for these methods was low. Evidence regarding other methods was lacking. For previous caries experience, sensitivity ranged between 0.21 and 0.94 and specificity between 0.20 and 1. Tests using salivary mutans streptococci resulted in low sensitivity and high specificity. For children with primary teeth at baseline, pooled LR for a positive test was 3 for previous caries experience and 4 for salivary mutans streptococci, given a threshold ≥10(5) CFU/ml. Evidence on the validity of analysed methods used for caries risk assessment is limited. As methodological quality was low, there is a need to improve study design. Low validity for the analysed methods may lead to patients with increased risk not being identified, whereas some are falsely identified as being at risk. As caries risk assessment guides individualized decisions on interventions and intervals for patient recall, improved performance based on best evidence is greatly needed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Understanding identifiability as a crucial step in uncertainty assessment

    NASA Astrophysics Data System (ADS)

    Jakeman, A. J.; Guillaume, J. H. A.; Hill, M. C.; Seo, L.

    2016-12-01

    The topic of identifiability analysis offers concepts and approaches to identify why unique model parameter values cannot be identified, and can suggest possible responses that either increase uniqueness or help to understand the effect of non-uniqueness on predictions. Identifiability analysis typically involves evaluation of the model equations and the parameter estimation process. Non-identifiability can have a number of undesirable effects. In terms of model parameters these effects include: parameters not being estimated uniquely even with ideal data; wildly different values being returned for different initialisations of a parameter optimisation algorithm; and parameters not being physically meaningful in a model attempting to represent a process. This presentation illustrates some of the drastic consequences of ignoring model identifiability analysis. It argues for a more cogent framework and use of identifiability analysis as a way of understanding model limitations and systematically learning about sources of uncertainty and their importance. The presentation specifically distinguishes between five sources of parameter non-uniqueness (and hence uncertainty) within the modelling process, pragmatically capturing key distinctions within existing identifiability literature. It enumerates many of the various approaches discussed in the literature. Admittedly, improving identifiability is often non-trivial. It requires thorough understanding of the cause of non-identifiability, and the time, knowledge and resources to collect or select new data, modify model structures or objective functions, or improve conditioning. But ignoring these problems is not a viable solution. Even simple approaches such as fixing parameter values or naively using a different model structure may have significant impacts on results which are too often overlooked because identifiability analysis is neglected.

  15. Student Conceptions of International Experience in the Study Abroad Context

    ERIC Educational Resources Information Center

    Streitwieser, Bernhard T.; Light, Gregory J.

    2018-01-01

    While much of recent study abroad research has focused on identifying and measuring different learning outcomes in terms of specific skills, competencies, perspectives and attributes acquired during study abroad opportunities, less research has considered how students' deeper conceptions and understandings of international experience may change…

  16. Aspects of Cognitive Functioning in Adults with Intellectual Disabilities

    ERIC Educational Resources Information Center

    Perkins, Elizabeth A.; Small, Brent J.

    2006-01-01

    Recently, more attention is being given to identifying aging-related and dementia-related pathological changes in performance and cognition among persons with intellectual disabilities (ID). This literature review examines age-related differences in specific aspects of cognitive functioning and cognitive performance of people with ID and…

  17. A Maslovian Counseling Method.

    ERIC Educational Resources Information Center

    Kirkpatrick, J. Stephen

    1979-01-01

    With Maslow's hierarchy as a basis, the model provides structure for setting goals in counseling cases and overall programs. Different kinds of client concerns are identified, and suggestions are made for using these 14 categories. The article includes specific suggestions for using the model in diagnosis, evaluation, counselor education, and…

  18. A Hierarchy of Management Training Requirements: The Competency Domain Model.

    ERIC Educational Resources Information Center

    Sandwith, Paul

    1993-01-01

    The Competency Domain Model has five domains of management competencies: conceptual/creative, leadership, interpersonal, administrative, and technical. Specific competencies and training plans can be identified in each domain for different levels--first line supervisor, field office manager, assistant manager, area manager, director of operations.…

  19. Pre-Service Educator's Perceptions of Exemplary Teachers

    ERIC Educational Resources Information Center

    Mowrer-Reynolds, Elilzabeth

    2008-01-01

    Sweeping educational reform has focused on re-structuring without examining the basic qualities that educators bring to the classroom. The present study sought to identify specific teacher qualities associated with exemplary teachers as determined by pre-service educators seeking teacher certification. Also examined were: (1) gender differences in…

  20. Brain structure–function associations in multi-generational families genetically enriched for bipolar disorder

    PubMed Central

    Schür, Remmelt; Sjouwerman, Rachel; Service, Susan K.; Araya, Carmen; Araya, Xinia; Bejarano, Julio; Knowles, Emma; Gomez-Makhinson, Juliana; Lopez, Maria C.; Aldana, Ileana; Teshiba, Terri M.; Abaryan, Zvart; Al-Sharif, Noor B.; Navarro, Linda; Tishler, Todd A.; Altshuler, Lori; Bartzokis, George; Escobar, Javier I.; Glahn, David C.; Thompson, Paul M.; Lopez-Jaramillo, Carlos; Macaya, Gabriel; Molina, Julio; Reus, Victor I.; Sabatti, Chiara; Cantor, Rita M.; Freimer, Nelson B.; Bearden, Carrie E.

    2015-01-01

    Recent theories regarding the pathophysiology of bipolar disorder suggest contributions of both neurodevelopmental and neurodegenerative processes. While structural neuroimaging studies indicate disease-associated neuroanatomical alterations, the behavioural correlates of these alterations have not been well characterized. Here, we investigated multi-generational families genetically enriched for bipolar disorder to: (i) characterize neurobehavioural correlates of neuroanatomical measures implicated in the pathophysiology of bipolar disorder; (ii) identify brain–behaviour associations that differ between diagnostic groups; (iii) identify neurocognitive traits that show evidence of accelerated ageing specifically in subjects with bipolar disorder; and (iv) identify brain–behaviour correlations that differ across the age span. Structural neuroimages and multi-dimensional assessments of temperament and neurocognition were acquired from 527 (153 bipolar disorder and 374 non-bipolar disorder) adults aged 18–87 years in 26 families with heavy genetic loading for bipolar disorder. We used linear regression models to identify significant brain–behaviour associations and test whether brain–behaviour relationships differed: (i) between diagnostic groups; and (ii) as a function of age. We found that total cortical and ventricular volume had the greatest number of significant behavioural associations, and included correlations with measures from multiple cognitive domains, particularly declarative and working memory and executive function. Cortical thickness measures, in contrast, showed more specific associations with declarative memory, letter fluency and processing speed tasks. While the majority of brain–behaviour relationships were similar across diagnostic groups, increased cortical thickness in ventrolateral prefrontal and parietal cortical regions was associated with better declarative memory only in bipolar disorder subjects, and not in non-bipolar disorder family members. Additionally, while age had a relatively strong impact on all neurocognitive traits, the effects of age on cognition did not differ between diagnostic groups. Most brain–behaviour associations were also similar across the age range, with the exception of cortical and ventricular volume and lingual gyrus thickness, which showed weak correlations with verbal fluency and inhibitory control at younger ages that increased in magnitude in older subjects, regardless of diagnosis. Findings indicate that neuroanatomical traits potentially impacted by bipolar disorder are significantly associated with multiple neurobehavioural domains. Structure–function relationships are generally preserved across diagnostic groups, with the notable exception of ventrolateral prefrontal and parietal association cortex, volumetric increases in which may be associated with cognitive resilience specifically in individuals with bipolar disorder. Although age impacted all neurobehavioural traits, we did not find any evidence of accelerated cognitive decline specific to bipolar disorder subjects. Regardless of diagnosis, greater global brain volume may represent a protective factor for the effects of ageing on executive functioning. PMID:25943422

  1. Cross-disease transcriptomics: Unique IL-17A signaling in psoriasis lesions and an autoimmune PBMC signature

    PubMed Central

    Sarkar, Mrinal K.; Liang, Yun; Xing, Xianying; Gudjonsson, Johann E.

    2016-01-01

    Transcriptome studies of psoriasis have identified robust changes in mRNA expression through large-scale analysis of patient cohorts. These studies, however, have analyzed all mRNA changes in aggregate, without distinguishing between disease-specific and non-specific differentially expressed genes (DEGs). In this study, RNA-seq meta-analysis was used to identify (1) psoriasis-specific DEGs altered in few diseases besides psoriasis and (2) non-specific DEGs similarly altered in many other skin conditions. We show that few cutaneous DEGs are psoriasis-specific and that the two DEG classes differ in their cell type and cytokine associations. Psoriasis-specific DEGs are expressed by keratinocytes and induced by IL-17A, whereas non-specific DEGs are expressed by inflammatory cells and induced by IFN-gamma and TNF. PBMC-derived DEGs were more psoriasis-specific than cutaneous DEGs. Nonetheless, PBMC DEGs associated with MHC class I and NK cells were commonly downregulated in psoriasis and other autoimmune diseases (e.g., multiple sclerosis, sarcoidosis and juvenile rheumatoid arthritis). These findings demonstrate “cross-disease” transcriptomics as an approach to gain insights into the cutaneous and non-cutaneous psoriasis transcriptomes. This highlighted unique contributions of IL-17A to the cytokine network and uncovered a blood-based gene signature that links psoriasis to other diseases of autoimmunity. PMID:27206706

  2. Intestinal Microbiota Composition of Interleukin-10 Deficient C57BL/6J Mice and Susceptibility to Helicobacter hepaticus-Induced Colitis

    PubMed Central

    Yang, Ines; Eibach, Daniel; Kops, Friederike; Brenneke, Birgit; Woltemate, Sabrina; Schulze, Jessika; Bleich, André; Gruber, Achim D.; Muthupalani, Sureshkumar; Fox, James G.; Josenhans, Christine; Suerbaum, Sebastian

    2013-01-01

    The mouse pathobiont Helicobacter hepaticus can induce typhlocolitis in interleukin-10-deficient mice, and H. hepaticus infection of immunodeficient mice is widely used as a model to study the role of pathogens and commensal bacteria in the pathogenesis of inflammatory bowel disease. C57BL/6J Il10−/− mice kept under specific pathogen-free conditions in two different facilities (MHH and MIT), displayed strong differences with respect to their susceptibilities to H. hepaticus-induced intestinal pathology. Mice at MIT developed robust typhlocolitis after infection with H. hepaticus, while mice at MHH developed no significant pathology after infection with the same H. hepaticus strain. We hypothesized that the intestinal microbiota might be responsible for these differences and therefore performed high resolution analysis of the intestinal microbiota composition in uninfected mice from the two facilities by deep sequencing of partial 16S rRNA amplicons. The microbiota composition differed markedly between mice from both facilities. Significant differences were also detected between two groups of MHH mice born in different years. Of the 119 operational taxonomic units (OTUs) that occurred in at least half the cecum or colon samples of at least one mouse group, 24 were only found in MIT mice, and another 13 OTUs could only be found in MHH samples. While most of the MHH-specific OTUs could only be identified to class or family level, the MIT-specific set contained OTUs identified to genus or species level, including the opportunistic pathogen, Bilophila wadsworthia. The susceptibility to H. hepaticus-induced colitis differed considerably between Il10−/− mice originating from the two institutions. This was associated with significant differences in microbiota composition, highlighting the importance of characterizing the intestinal microbiome when studying murine models of IBD. PMID:23951007

  3. Sport-specific outcomes after anterior cruciate ligament reconstruction.

    PubMed

    Warner, Stephen J; Smith, Matthew V; Wright, Rick W; Matava, Matthew J; Brophy, Robert H

    2011-08-01

    Although anterior cruciate ligament (ACL) reconstruction has been studied extensively in the literature, sport-specific outcomes have not been well-documented. The purpose of this systematic review was to assess sport-specific outcomes after ACL reconstruction in the literature. We performed a systematic review of the literature to identify studies reporting sport-specific outcomes after primary ACL reconstruction. Included studies were required to have reported standardized outcomes after primary ACL reconstruction for a single sport or comparing between different sports. In total 8 studies conformed to all inclusion criteria: 2 Level II studies, 1 Level III study, and 5 Level IV case series. Only 1 study reported comparisons of standardized outcomes between different sports, whereas 7 studies reported standardized outcomes in a single sport. Return to activity was the most common sport-specific outcome reported and varied from 19% (soccer) to 100% (bicycling and rugby), although the methods of measuring this outcome differed. Whereas return to activity after ACL reconstruction appears more likely for bicycling and jogging than for cutting and pivoting sports such as soccer and football, the literature on sport-specific outcomes from ACL reconstruction is limited with minimal data. Further studies are needed to report sport-specific outcomes and return to play after ACL reconstruction. Level IV, systematic review of Level II, III, and IV studies. Copyright © 2011 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  4. Sensitivity and specificity of normality tests and consequences on reference interval accuracy at small sample size: a computer-simulation study.

    PubMed

    Le Boedec, Kevin

    2016-12-01

    According to international guidelines, parametric methods must be chosen for RI construction when the sample size is small and the distribution is Gaussian. However, normality tests may not be accurate at small sample size. The purpose of the study was to evaluate normality test performance to properly identify samples extracted from a Gaussian population at small sample sizes, and assess the consequences on RI accuracy of applying parametric methods to samples that falsely identified the parent population as Gaussian. Samples of n = 60 and n = 30 values were randomly selected 100 times from simulated Gaussian, lognormal, and asymmetric populations of 10,000 values. The sensitivity and specificity of 4 normality tests were compared. Reference intervals were calculated using 6 different statistical methods from samples that falsely identified the parent population as Gaussian, and their accuracy was compared. Shapiro-Wilk and D'Agostino-Pearson tests were the best performing normality tests. However, their specificity was poor at sample size n = 30 (specificity for P < .05: .51 and .50, respectively). The best significance levels identified when n = 30 were 0.19 for Shapiro-Wilk test and 0.18 for D'Agostino-Pearson test. Using parametric methods on samples extracted from a lognormal population but falsely identified as Gaussian led to clinically relevant inaccuracies. At small sample size, normality tests may lead to erroneous use of parametric methods to build RI. Using nonparametric methods (or alternatively Box-Cox transformation) on all samples regardless of their distribution or adjusting, the significance level of normality tests depending on sample size would limit the risk of constructing inaccurate RI. © 2016 American Society for Veterinary Clinical Pathology.

  5. A framework for classification of prokaryotic protein kinases.

    PubMed

    Tyagi, Nidhi; Anamika, Krishanpal; Srinivasan, Narayanaswamy

    2010-05-26

    Overwhelming majority of the Serine/Threonine protein kinases identified by gleaning archaeal and eubacterial genomes could not be classified into any of the well known Hanks and Hunter subfamilies of protein kinases. This is owing to the development of Hanks and Hunter classification scheme based on eukaryotic protein kinases which are highly divergent from their prokaryotic homologues. A large dataset of prokaryotic Serine/Threonine protein kinases recognized from genomes of prokaryotes have been used to develop a classification framework for prokaryotic Ser/Thr protein kinases. We have used traditional sequence alignment and phylogenetic approaches and clustered the prokaryotic kinases which represent 72 subfamilies with at least 4 members in each. Such a clustering enables classification of prokaryotic Ser/Thr kinases and it can be used as a framework to classify newly identified prokaryotic Ser/Thr kinases. After series of searches in a comprehensive sequence database we recognized that 38 subfamilies of prokaryotic protein kinases are associated to a specific taxonomic level. For example 4, 6 and 3 subfamilies have been identified that are currently specific to phylum proteobacteria, cyanobacteria and actinobacteria respectively. Similarly subfamilies which are specific to an order, sub-order, class, family and genus have also been identified. In addition to these, we also identify organism-diverse subfamilies. Members of these clusters are from organisms of different taxonomic levels, such as archaea, bacteria, eukaryotes and viruses. Interestingly, occurrence of several taxonomic level specific subfamilies of prokaryotic kinases contrasts with classification of eukaryotic protein kinases in which most of the popular subfamilies of eukaryotic protein kinases occur diversely in several eukaryotes. Many prokaryotic Ser/Thr kinases exhibit a wide variety of modular organization which indicates a degree of complexity and protein-protein interactions in the signaling pathways in these microbes.

  6. Deep Proteome Profiling Reveals Common Prevalence of MZB1-Positive Plasma B Cells in Human Lung and Skin Fibrosis.

    PubMed

    Schiller, Herbert B; Mayr, Christoph H; Leuschner, Gabriela; Strunz, Maximilian; Staab-Weijnitz, Claudia; Preisendörfer, Stefan; Eckes, Beate; Moinzadeh, Pia; Krieg, Thomas; Schwartz, David A; Hatz, Rudolf A; Behr, Jürgen; Mann, Matthias; Eickelberg, Oliver

    2017-11-15

    Analyzing the molecular heterogeneity of different forms of organ fibrosis may reveal common and specific factors and thus identify potential future therapeutic targets. We sought to use proteome-wide profiling of human tissue fibrosis to (1) identify common and specific signatures across end-stage interstitial lung disease (ILD) cases, (2) characterize ILD subgroups in an unbiased fashion, and (3) identify common and specific features of lung and skin fibrosis. We collected samples of ILD tissue (n = 45) and healthy donor control samples (n = 10), as well as fibrotic skin lesions from localized scleroderma and uninvolved skin (n = 6). Samples were profiled by quantitative label-free mass spectrometry, Western blotting, or confocal imaging. We determined the abundance of more than 7,900 proteins and stratified these proteins according to their detergent solubility profiles. Common protein regulations across all ILD cases, as well as distinct ILD subsets, were observed. Proteomic comparison of lung and skin fibrosis identified a common upregulation of marginal zone B- and B1-cell-specific protein (MZB1), the expression of which identified MZB1 + /CD38 + /CD138 + /CD27 + /CD45 - /CD20 - plasma B cells in fibrotic lung and skin tissue. MZB1 levels correlated positively with tissue IgG and negatively with diffusing capacity of the lung for carbon monoxide. Despite the presumably high molecular and cellular heterogeneity of ILD, common protein regulations are observed, even across organ boundaries. The surprisingly high prevalence of MZB1-positive plasma B cells in tissue fibrosis warrants future investigations regarding the causative role of antibody-mediated autoimmunity in idiopathic cases of organ fibrosis, such as idiopathic pulmonary fibrosis.

  7. Identifying Factors that Influence State-Specific Hunger Rates in the U.S.: A Simple Analytic Method for Understanding a Persistent Problem

    ERIC Educational Resources Information Center

    Edwards, Mark Evan; Weber, Bruce; Bernell, Stephanie

    2007-01-01

    An existing measure of food insecurity with hunger in the United States may serve as an effective indicator of quality of life. State level differences in that measure can reveal important differences in quality of life across places. In this study, we advocate and demonstrate two simple methods by which analysts can explore state-specific…

  8. Biological Sex Differences in Depression: A Systematic Review.

    PubMed

    Labaka, Ainitze; Goñi-Balentziaga, Olatz; Lebeña, Andrea; Pérez-Tejada, Joana

    2018-07-01

    Depression is the leading cause of disability worldwide, and its prevalence is 2 times higher in women than in men. There is, however, a lack of data on sex-specific pathophysiology of this disorder. The purpose of this systematic review is to identify the biological sex differences found in major depressive disorder (MDD) in studies published in the last 10 years. We conducted a literature search using the Medline, PsycInfo, PubMed, and Web of Science databases, selecting English-language studies that included physiological measures compared by sex in addition to MDD. We identified 20 relevant studies, which consisted primarily of mixed methodology and samples. The reported physiological measures comprised a variety of serum biomarkers, gene mRNA expression, and brain activity. Findings suggest different biological patterns in those with MDD depending on sex. Specifically, women presented higher levels of inflammatory, neurotrophic, and serotonergic markers and a stronger correlation between levels of some inflammatory and neurotrophic factors and the severity of symptoms. This review provides information about possible different biological patterns for women and men with depressive disorder and may have important implications for treatment. Future research should include homogeneous samples; make comparisons based on sex, control sex hormone fluctuations and pharmacological treatment; and use consistent criteria for evaluating psychobiological changes in MDD.

  9. Automation in clinical microbiology: a new approach to identifying micro-organisms by automated pattern matching of proteins labelled with 35S-methionine.

    PubMed Central

    Tabaqchali, S; Silman, R; Holland, D

    1987-01-01

    A new rapid automated method for the identification and classification of microorganisms is described. It is based on the incorporation of 35S-methionine into cellular proteins and subsequent separation of the radiolabelled proteins by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein patterns produced were species specific and reproducible, permitting discrimination between the species. A large number of Gram negative and Gram positive aerobic and anaerobic organisms were successfully tested. Furthermore, there were sufficient differences within species between the protein profiles to permit subdivision of the species. New typing schemes for Clostridium difficile, coagulase negative staphylococci, and Staphylococcus aureus, including the methicillin resistant strains, could thus be introduced; this has provided the basis for useful epidemiological studies. To standardise and automate the procedure an automated electrophoresis system and a two dimensional scanner were developed to scan the dried gels directly. The scanner is operated by a computer which also stores and analyses the scan data. Specific histograms are produced for each bacterial species. Pattern recognition software is used to construct databases and to compare data obtained from different gels: in this way duplicate "unknowns" can be identified. Specific small areas showing differences between various histograms can also be isolated and expanded to maximise the differences, thus providing differentiation between closely related bacterial species and the identification of differences within the species to provide new typing schemes. This system should be widely applied in clinical microbiology laboratories in the near future. Images Fig 1 Fig 2 Fig 3 Fig 4 Fig 5 Fig 6 Fig 7 Fig 8 PMID:3312300

  10. Number-specific and general cognitive markers of preschoolers' math ability profiles.

    PubMed

    Gray, Sarah A; Reeve, Robert A

    2016-07-01

    Different number-specific and general cognitive markers have been claimed to underlie preschoolers' math ability. It is unclear, however, whether similar/different cognitive markers, or combinations of them, are associated with different patterns of emerging math abilities (i.e., different patterns of strength and weakness). To examine this question, 103 preschoolers (40-60 months of age) completed six math tasks (count sequence, object counting, give a number, naming numbers, ordinal relations, and arithmetic), three number-specific markers of math ability (dot enumeration, magnitude comparison, and spontaneous focusing on numerosity), and four general markers (working memory, response inhibition, attention, and vocabulary). A three-step latent profile modeling procedure identified five math ability profiles that differed in their patterns of math strengths and weaknesses; specifically, the profiles were characterized by (a) excellent math ability on all math tasks, (b) good arithmetic ability, (c) good math ability but relatively poor count sequence recitation ability, (d) average ability on all math tasks, and (e) poor ability on all math tasks. After controlling for age, only dot enumeration and spontaneous focusing on numerosity were associated with the math ability profiles, whereas vocabulary was also marginally significant, and these markers were differentially associated with different profiles; that is, different cognitive markers were associated with different patterns of strengths and weaknesses in math abilities. Findings are discussed in terms of their implications for the development of math cognition. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Organ specificity in the plant circadian system is explained by different light inputs to the shoot and root clocks.

    PubMed

    Bordage, Simon; Sullivan, Stuart; Laird, Janet; Millar, Andrew J; Nimmo, Hugh G

    2016-10-01

    Circadian clocks allow the temporal compartmentalization of biological processes. In Arabidopsis, circadian rhythms display organ specificity but the underlying molecular causes have not been identified. We investigated the mechanisms responsible for the similarities and differences between the clocks of mature shoots and roots in constant conditions and in light : dark cycles. We developed an imaging system to monitor clock gene expression in shoots and light- or dark-grown roots, modified a recent mathematical model of the Arabidopsis clock and used this to simulate our new data. We showed that the shoot and root circadian clocks have different rhythmic properties (period and amplitude) and respond differently to light quality. The root clock was entrained by direct exposure to low-intensity light, even in antiphase to the illumination of shoots. Differences between the clocks were more pronounced in conditions where light was present than in constant darkness, and persisted in the presence of sucrose. We simulated the data successfully by modifying those parameters of a clock model that are related to light inputs. We conclude that differences and similarities between the shoot and root clocks can largely be explained by organ-specific light inputs. This provides mechanistic insight into the developing field of organ-specific clocks. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  12. Patterns of muscle activity underlying object-specific grasp by the macaque monkey.

    PubMed

    Brochier, T; Spinks, R L; Umilta, M A; Lemon, R N

    2004-09-01

    During object grasp, a coordinated activation of distal muscles is required to shape the hand in relation to the physical properties of the object. Despite the fundamental importance of the grasping action, little is known of the muscular activation patterns that allow objects of different sizes and shapes to be grasped. In a study of two adult macaque monkeys, we investigated whether we could distinguish between EMG activation patterns associated with grasp of 12 differently shaped objects, chosen to evoke a wide range of grasping postures. Each object was mounted on a horizontal shuttle held by a weak spring (load force 1-2 N). Objects were located in separate sectors of a "carousel," and inter-trial rotation of the carousel allowed sequential presentation of the objects in pseudorandom order. EMG activity from 10 to 12 digit, hand, and arm muscles was recorded using chronically implanted electrodes. We show that the grasp of different objects was characterized by complex but distinctive patterns of EMG activation. Cluster analysis shows that these object-related EMG patterns were specific and consistent enough to identify the object unequivocally from the EMG recordings alone. EMG-based object identification required a minimum of six EMGs from simultaneously recorded muscles. EMG patterns were consistent across recording sessions in a given monkey but showed some differences between animals. These results identify the specific patterns of activity required to achieve distinct hand postures for grasping, and they open the way to our understanding of how these patterns are generated by the central motor network.

  13. Health-related quality of life questionnaires in lung cancer trials: a systematic literature review

    PubMed Central

    2013-01-01

    Background Lung cancer is one of the leading causes of cancer deaths. Treatment goals are the relief of symptoms and the increase of overall survival. With the rising number of treatment alternatives, the need for comparable assessments of health-related quality of life (HRQoL) parameters grows. The aim of this paper was to identify and describe measurement instruments applied in lung cancer patients under drug therapy. Methods We conducted a systematic literature review at the beginning of 2011 using the electronic database Pubmed. Results A total of 43 studies were included in the review. About 17 different measurement instruments were identified, including 5 generic, 5 cancer-specific, 4 lung cancer-specific and 3 symptom-specific questionnaires. In 29 studies at least 2 instruments were used. In most cases these were cancer and lung cancer-specific ones. The most frequently used instruments are the EORTC QLQ-C30 and its lung cancer modules LC13 or LC17. Only 5 studies combined (lung) cancer-specific questionnaires with generic instruments. Conclusions The EORTC-C30 and EORTC-LC13 are the most frequently used health-related quality of life measurement instruments in pharmacological lung cancer trials. PMID:23680096

  14. [Identification of Panax ginseng, P. notoginseng and P. quinquefolius admixture by multiplex allele-specific polymerase chain reaction].

    PubMed

    Jiang, Chao; Luo, Yu-Qing; Yuan, Yuan; Huang, Lu-Qi; Jin, Yan; Zhao, Yu-Yang

    2017-04-01

    To achieve a molecular method to identify Panax ginseng, P. notoginseng,P. quinquefolius and their admixture. The ITS,18S and matK sequences of Panax genus were analyzed to develop species-specific SNP marker. Three pairs of species-specific primers were designed to establish a multiplex allele-specific polymerase chain reaction (MAS-PCR) and the samples from different region were tested. The results showed that when the annealing temperature was 60 ℃ and the cycle number was 35, approximately 250, 500,1 000 bp specific band were obtained from P. ginseng, P. notoginseng and P. quinquefolius obtain, respectively. This method could also be used to authentificate admixture samples and could detect 0.5% percent of P. notoginseng or P. quinquefolius adulterated in P. ginseng, or 0.5% percent of P. ginseng or P. quinquefolius adulterated in P. notoginseng. The detect limit of P. ginseng in P. quinquefolius was 0.5% and P. notoginseng in P. quinquefolius was 1%. This results showed that the present method could be used as a promise method to identify Panax ginseng, P. notoginseng, P. quinquefolius and their admixture. Copyright© by the Chinese Pharmaceutical Association.

  15. Host selection patterns of Culex tarsalis (Diptera: Culicidae) at wetlands near the Salton Sea, Coachella Valley, California, 1998-2002.

    PubMed

    Reisen, William K; Lothrop, Hugh D; Thiemann, Tara

    2013-09-01

    The bloodmeal hosts used by Culex tarsalis Coquillett collected along the Salton Sea in Coachella Valley, CA, during 1998-2002 were identified using sequences of the cytochrome c oxidase I gene identified from Barcode of Life database. Overall, 265 (83.3%) of 318 bloodmeals were identified, of which 76.6% fed on birds, 18.1% on mammals, and 5.3% on reptiles. Forty-seven different hosts were identified, none of which comprised > 12.5% of the total. Although Cx. tarsalis exhibits specific host-seeking flight patterns, bloodmeals seemed to be acquired opportunistically, thereby limiting potential arbovirus transmission efficiency in species-rich environments.

  16. Global warming's five Germanys: A typology of Germans' views on climate change and patterns of media use and information.

    PubMed

    Metag, Julia; Füchslin, Tobias; Schäfer, Mike S

    2017-05-01

    People's attitudes toward climate change differ, and these differences may correspond to distinct patterns of media use and information seeking. However, studies extending analyses of attitude types and their specific media diets to countries beyond the United States are lacking. We use a secondary analysis of survey data from Germany to identify attitudes toward climate change among the German public and specify those segments of the population based on their media use and information seeking. Similar to the Global Warming's Six Americas study, we find distinct attitudes (Global Warming's Five Germanys) that differ in climate change-related perceptions as well as in media use and communicative behavior. These findings can help tailor communication campaigns regarding climate change to specific audiences.

  17. [Work-related medical rehabilitation for patients with rheumatic diseases].

    PubMed

    Ehlebracht-König, I; Dorn, M

    2014-02-01

    In recent years work-related rehabilitation has been intensified. Several studies have shown the effectiveness of work-related interventions in medical rehabilitation by improving participation in the work force and reducing sick leave. The German pension insurance fund has developed standardized requirements for medical work-related rehabilitation which include diagnostic procedures to identify patients with specific occupational problems and vocation-related interventions. These requirements address patients across different indications and diagnoses. Rehabilitation centers are assigned to different levels of work-related interventions depending on the intensity and specificity of the profile. Centers providing the complete range of work-related interventions offer differentiated work-related diagnostics, job training and occupational groups in addition to general social advice. In this article four case studies with different priorities regarding vocational interventions are presented.

  18. How Methodologic Differences Affect Results of Economic Analyses: A Systematic Review of Interferon Gamma Release Assays for the Diagnosis of LTBI

    PubMed Central

    Oxlade, Olivia; Pinto, Marcia; Trajman, Anete; Menzies, Dick

    2013-01-01

    Introduction Cost effectiveness analyses (CEA) can provide useful information on how to invest limited funds, however they are less useful if different analysis of the same intervention provide unclear or contradictory results. The objective of our study was to conduct a systematic review of methodologic aspects of CEA that evaluate Interferon Gamma Release Assays (IGRA) for the detection of Latent Tuberculosis Infection (LTBI), in order to understand how differences affect study results. Methods A systematic review of studies was conducted with particular focus on study quality and the variability in inputs used in models used to assess cost-effectiveness. A common decision analysis model of the IGRA versus Tuberculin Skin Test (TST) screening strategy was developed and used to quantify the impact on predicted results of observed differences of model inputs taken from the studies identified. Results Thirteen studies were ultimately included in the review. Several specific methodologic issues were identified across studies, including how study inputs were selected, inconsistencies in the costing approach, the utility of the QALY (Quality Adjusted Life Year) as the effectiveness outcome, and how authors choose to present and interpret study results. When the IGRA versus TST test strategies were compared using our common decision analysis model predicted effectiveness largely overlapped. Implications Many methodologic issues that contribute to inconsistent results and reduced study quality were identified in studies that assessed the cost-effectiveness of the IGRA test. More specific and relevant guidelines are needed in order to help authors standardize modelling approaches, inputs, assumptions and how results are presented and interpreted. PMID:23505412

  19. Ara h 1 CD4+ T cell epitope-based peptides: candidates for a peanut allergy therapeutic.

    PubMed

    Prickett, S R; Voskamp, A L; Phan, T; Dacumos-Hill, A; Mannering, S I; Rolland, J M; O'Hehir, R E

    2013-06-01

    Peanut allergy is a life-threatening condition; there is currently no cure. While whole allergen extracts are used for specific immunotherapy for many allergies, they can cause severe reactions and even fatalities in peanut allergy. To identify short, HLA-degenerate CD4(+) T cell epitope-based peptides of the major peanut allergen Ara h 1 that target allergen-specific T cells without causing IgE-mediated inflammatory cell activation, as candidates for safe peanut-specific immunotherapy. Ara h 1-specific CD4(+) T cell lines (TCL) were generated from peripheral blood mononuclear cells (PBMC) of peanut-allergic subjects using CFSE-based methodology. T cell epitopes were identified using CFSE and thymidine-based proliferation assays. Epitope HLA-restriction was investigated using blocking antibodies, HLA-genotyping and epitope prediction algorithms. Functional peanut-specific IgE reactivity to peptides was assessed by basophil activation assay. A total of 145 Ara h 1-specific TCL were generated from 18 HLA-diverse peanut-allergic subjects. The TCL recognized 20-mer peptides throughout Ara h 1. Nine 20-mers containing the most frequently recognized epitopes were selected and their recognition confirmed in 18 additional peanut-allergic subjects. Ten core epitopes were mapped within these 20-mers. These were HLA-DQ and/or HLA-DR restricted, with each presented on at least two different HLA-molecules. Seven short (≤ 20 aa) non-basophil-reactive peptides encompassing all core epitopes were designed and validated in peanut-allergic donor PBMC T cell assays. Short CD4(+) T cell epitope-based Ara h 1 peptides were identified as novel candidates for a safe, T cell targeted peanut-specific immunotherapy for HLA-diverse populations. © 2013 John Wiley & Sons Ltd.

  20. Automatic detection and classification of artifacts in single-channel EEG.

    PubMed

    Olund, Thomas; Duun-Henriksen, Jonas; Kjaer, Troels W; Sorensen, Helge B D

    2014-01-01

    Ambulatory EEG monitoring can provide medical doctors important diagnostic information, without hospitalizing the patient. These recordings are however more exposed to noise and artifacts compared to clinically recorded EEG. An automatic artifact detection and classification algorithm for single-channel EEG is proposed to help identifying these artifacts. Features are extracted from the EEG signal and wavelet subbands. Subsequently a selection algorithm is applied in order to identify the best discriminating features. A non-linear support vector machine is used to discriminate among different artifact classes using the selected features. Single-channel (Fp1-F7) EEG recordings are obtained from experiments with 12 healthy subjects performing artifact inducing movements. The dataset was used to construct and validate the model. Both subject-specific and generic implementation, are investigated. The detection algorithm yield an average sensitivity and specificity above 95% for both the subject-specific and generic models. The classification algorithm show a mean accuracy of 78 and 64% for the subject-specific and generic model, respectively. The classification model was additionally validated on a reference dataset with similar results.

  1. The RclR Protein Is a Reactive Chlorine-specific Transcription Factor in Escherichia coli *

    PubMed Central

    Parker, Benjamin W.; Schwessinger, Emily A.; Jakob, Ursula; Gray, Michael J.

    2013-01-01

    Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance. PMID:24078635

  2. The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli.

    PubMed

    Parker, Benjamin W; Schwessinger, Emily A; Jakob, Ursula; Gray, Michael J

    2013-11-08

    Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance.

  3. Wheat differential gene expression induced by different races of Puccinia triticina.

    PubMed

    Neugebauer, Kerri A; Bruce, Myron; Todd, Tim; Trick, Harold N; Fellers, John P

    2018-01-01

    Puccinia triticina, the causal agent of wheat leaf rust, causes significant losses in wheat yield and quality each year worldwide. During leaf rust infection, the host plant recognizes numerous molecules, some of which trigger host defenses. Although P. triticina reproduces clonally, there is still variation within the population due to a high mutation frequency, host specificity, and environmental adaptation. This study explores how wheat responds on a gene expression level to different P. triticina races. Six P. triticina races were inoculated onto a susceptible wheat variety and samples were taken at six days post inoculation, just prior to pustule eruption. RNA sequence data identified 63 wheat genes differentially expressed between the six races. A time course, conducted over the first seven days post inoculation, was used to examine the expression pattern of 63 genes during infection. Forty-seven wheat genes were verified to have differential expression. Three common expression patterns were identified. In addition, two genes were associated with race specific gene expression. Differential expression of an ER molecular chaperone gene was associated with races from two different P. triticina lineages. Also, differential expression in an alanine glyoxylate aminotransferase gene was associated with races with virulence shifts for leaf rust resistance genes.

  4. Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation: long-term results from the Bio-CAPTURE registry.

    PubMed

    van den Reek, J M P A; Tummers, M; Zweegers, J; Seyger, M M B; van Lümig, P P M; Driessen, R J B; van de Kerkhof, P C M; Kievit, W; de Jong, E M G J

    2015-03-01

    Drug survival is an indicator for treatment success; insight in predictors associated with drug survival is important. To analyse the long-term drug survival for adalimumab in patients with psoriasis treated in daily practice and (II) to identify predictors of prolonged drug survival for adalimumab split for different reasons of discontinuation. Data were extracted from a prospective psoriasis cohort and analysed using Kaplan-Meier survival curves split for reasons of discontinuation. Baseline predictors associated with longer drug survival were identified using multivariate Cox-regression analysis. One hundred and sixteen patients were included with a total of 208 patient-years. Overall drug survival was 76% after 1 year and 52% after 4.5 years. In patients who stopped due to ineffectiveness, longer drug survival was associated with the absence of specific comorbidities (P = 0.03). In patients who stopped due to side-effects, longer drug survival was associated with male gender (P = 0.02). Predictors of adalimumab drug survival in psoriasis differ by reason for discontinuation. Strong, specific predictors can lead to patient-tailored treatment. © 2014 European Academy of Dermatology and Venereology.

  5. Identification of avian wax synthases

    PubMed Central

    2012-01-01

    Background Bird species show a high degree of variation in the composition of their preen gland waxes. For instance, galliform birds like chicken contain fatty acid esters of 2,3-alkanediols, while Anseriformes like goose or Strigiformes like barn owl contain wax monoesters in their preen gland secretions. The final biosynthetic step is catalyzed by wax synthases (WS) which have been identified in pro- and eukaryotic organisms. Results Sequence similarities enabled us to identify six cDNAs encoding putative wax synthesizing proteins in chicken and two from barn owl and goose. Expression studies in yeast under in vivo and in vitro conditions showed that three proteins from chicken performed WS activity while a sequence from chicken, goose and barn owl encoded a bifunctional enzyme catalyzing both wax ester and triacylglycerol synthesis. Mono- and bifunctional WS were found to differ in their substrate specificities especially with regard to branched-chain alcohols and acyl-CoA thioesters. According to the expression patterns of their transcripts and the properties of the enzymes, avian WS proteins might not be confined to preen glands. Conclusions We provide direct evidence that avian preen glands possess both monofunctional and bifunctional WS proteins which have different expression patterns and WS activities with different substrate specificities. PMID:22305293

  6. Support services for higher degree research students: a survey of three Australian universities

    NASA Astrophysics Data System (ADS)

    Silva, Pujitha; Woodman, Karen; Taji, Acram; Travelyan, James; Samani, Shamim; Sharda, Hema; Narayanaswamy, Ramesh; Lucey, Anthony; Sahama, Tony; KDV Yarlagadda, Prasad

    2016-09-01

    A survey was conducted across three Australian universities to identify the types and format of support services available for higher degree research (HDR, or MA and Ph.D.) students. The services were classified with regards to availability, location and accessibility. A comparative tool was developed to help institutions categorise their services in terms of academic, administrative, social and settlement, language and miscellaneous (other) supports. All three universities showed similarities in the type of academic support services offered, while differing in social and settlement and language support services in terms of the location and the level of accessibility of these services. The study also examined the specific support services available for culturally and linguistically diverse (CALD) students. The three universities differed in their emphases in catering to CALD needs, with their allocation of resources reflecting these differences. The organisation of these services within the universities was further assessed to determine possible factors that may influence the effective delivery of these services, by considering HDR and CALD student specific issues. The findings and tools developed by this study may be useful to HDR supervisors and university administrators in identifying key support services to better improve outcomes for the HDR students and universities.

  7. Sight and sound converge to form modality-invariant representations in temporo-parietal cortex

    PubMed Central

    Man, Kingson; Kaplan, Jonas T.; Damasio, Antonio; Meyer, Kaspar

    2013-01-01

    People can identify objects in the environment with remarkable accuracy, irrespective of the sensory modality they use to perceive them. This suggests that information from different sensory channels converges somewhere in the brain to form modality-invariant representations, i.e., representations that reflect an object independently of the modality through which it has been apprehended. In this functional magnetic resonance imaging study of human subjects, we first identified brain areas that responded to both visual and auditory stimuli and then used crossmodal multivariate pattern analysis to evaluate the neural representations in these regions for content-specificity (i.e., do different objects evoke different representations?) and modality-invariance (i.e., do the sight and the sound of the same object evoke a similar representation?). While several areas became activated in response to both auditory and visual stimulation, only the neural patterns recorded in a region around the posterior part of the superior temporal sulcus displayed both content-specificity and modality-invariance. This region thus appears to play an important role in our ability to recognize objects in our surroundings through multiple sensory channels and to process them at a supra-modal (i.e., conceptual) level. PMID:23175818

  8. A survey of particle contamination in electronic devices

    NASA Technical Reports Server (NTRS)

    Adolphsen, J. W.; Kagdis, W. A.; Timmins, A. R.

    1976-01-01

    The experiences are given of a number of National Aeronautics and Space Administration (NASA) and Space and Missile System Organization (SAMSO) contractors with particle contamination, and the methods used for its prevention and detection, evaluates the bases for the different schemes, assesses their effectiveness, and identifies the problems associated with each. It recommends specific short-range tests or approaches appropriate to individual part-type categories and recommends that specific tasks be initiated to refine techniques and to resolve technical and application facets of promising solutions.

  9. High road utilizers surveys compared to police data for road traffic crash hotspot localization in Rwanda and Sri Lanka.

    PubMed

    Staton, Catherine A; De Silva, Vijitha; Krebs, Elizabeth; Andrade, Luciano; Rulisa, Stephen; Mallawaarachchi, Badra Chandanie; Jin, Kezhi; RicardoVissoci, Joao; Østbye, Truls

    2016-01-20

    Road traffic crashes (RTCs) are a leading cause of death. In low and middle income countries (LMIC) data to conduct hotspot analyses and safety audits are usually incomplete, poor quality, and not computerized. Police data are often limited, but there are no alternative gold standards. This project evaluates high road utilizer surveys as an alternative to police data to identify RTC hotspots. Retrospective police RTC data was compared to prospective data from high road utilizer surveys regarding dangerous road locations. Spatial analysis using geographic information systems was used to map dangerous locations and identify RTC hotspots. We assessed agreement (Cohen's Kappa), sensitivity/specificity, and cost differences. In Rwanda police data identified 1866 RTC locations from 2589 records while surveys identified 1264 locations from 602 surveys. In Sri Lanka, police data identified 721 RTC locations from 752 records while survey data found 3000 locations from 300 surveys. There was high agreement (97 %, 83 %) and kappa (0.60, 0.60) for Rwanda and Sri Lanka respectively. Sensitivity and specificity are 92 % and 95 % for Rwanda and 74 % and 93 % for Sri Lanka. The cost per crash location identified was $2.88 for police and $2.75 for survey data in Rwanda and $2.75 for police and $1.21 for survey data in Sri Lanka. Surveys to locate RTC hotspots have high sensitivity and specificity compared to police data. Therefore, surveys can be a viable, inexpensive, and rapid alternative to the use of police data in LMIC.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cardenas, Ibsen C., E-mail: c.cardenas@utwente.nl; Halman, Johannes I.M., E-mail: J.I.M.Halman@utwente.nl

    Uncertainty is virtually unavoidable in environmental impact assessments (EIAs). From the literature related to treating and managing uncertainty, we have identified specific techniques for coping with uncertainty in EIAs. Here, we have focused on basic steps in the decision-making process that take place within an EIA setting. More specifically, we have identified uncertainties involved in each decision-making step and discussed the extent to which these can be treated and managed in the context of an activity or project that may have environmental impacts. To further demonstrate the relevance of the techniques identified, we have examined the extent to which themore » EIA guidelines currently used in Colombia consider and provide guidance on managing the uncertainty involved in these assessments. Some points that should be considered in order to provide greater robustness in impact assessments in Colombia have been identified. These include the management of stakeholder values, the systematic generation of project options, and their associated impacts as well as the associated management actions, and the evaluation of uncertainties and assumptions. We believe that the relevant and specific techniques reported here can be a reference for future evaluations of other EIA guidelines in different countries. - Highlights: • uncertainty is unavoidable in environmental impact assessments, EIAs; • we have identified some open techniques to EIAs for treating and managing uncertainty in these assessments; • points for improvement that should be considered in order to provide greater robustness in EIAs in Colombia have been identified; • the paper provides substantiated a reference for possible examinations of EIAs guidelines in other countries.« less

  11. Disease-specific health-related quality of life instruments for IgE-mediated food allergy.

    PubMed

    Salvilla, S A; Dubois, A E J; Flokstra-de Blok, B M J; Panesar, S S; Worth, A; Patel, S; Muraro, A; Halken, S; Hoffmann-Sommergruber, K; DunnGalvin, A; Hourihane, J O'B; Regent, L; de Jong, N W; Roberts, G; Sheikh, A

    2014-07-01

    This is one of seven interlinked systematic reviews undertaken on behalf of the European Academy of Allergy and Clinical Immunology as part of their Guidelines for Food Allergy and Anaphylaxis, which focuses on instruments developed for IgE-mediated food allergy. Disease-specific questionnaires are significantly more sensitive than generic ones in measuring the response to interventions or future treatments, as well as estimating the general burden of food allergy. The aim of this systematic review was therefore to identify which disease-specific, validated instruments can be employed to enable assessment of the impact of, and investigations and interventions for, IgE-mediated food allergy on health-related quality of life (HRQL). Using a sensitive search strategy, we searched seven electronic bibliographic databases to identify disease-specific quality of life (QOL) tools relating to IgE-mediated food allergy. From the 17 eligible studies, we identified seven disease-specific HRQL instruments, which were then subjected to detailed quality appraisal. This revealed that these instruments have undergone formal development and validation processes, and have robust psychometric properties, and therefore provide a robust means of establishing the impact of food allergy on QOL. Suitable instruments are now available for use in children, adolescents, parents/caregivers, and adults. Further work must continue to develop a clinical minimal important difference for food allergy and for making these instruments available in a wider range of European languages. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Gut microbiota in patients with Parkinson's disease in southern China.

    PubMed

    Lin, Aiqun; Zheng, Wenxia; He, Yan; Tang, Wenli; Wei, Xiaobo; He, Rongni; Huang, Wei; Su, Yuying; Huang, Yaowei; Zhou, Hongwei; Xie, Huifang

    2018-05-16

    Accumulating evidence has revealed alterations in the communication between the gut and brain in patients with Parkinson's disease (PD), and previous studies have confirmed that alterations in the gut microbiome play an important role in the pathogenesis of numerous diseases, including PD. The aim of this study was to determine whether the faecal microbiome of PD patients in southern China differs from that of control subjects and whether the gut microbiome composition alters among different PD motor phenotypes. We compared the gut microbiota composition of 75 patients with PD and 45 age-matched controls using 16S rRNA next-generation-sequencing. We observed significant increases in the abundance of four bacterial families and significant decreases in the abundance of seventeen bacterial families in patients with PD compared to those of the controls. In particular, the abundance of Lachnospiraceae was reduced by 42.9% in patients with PD, whereas Bifidobacteriaceae was enriched in patients with PD. We did not identify a significant difference in the overall microbial composition among different PD motor phenotypes, but we identified the association between specific taxas and different PD motor phenotypes. PD is accompanied by alterations in the abundance of specific gut microbes. The abundance of certain gut microbes was altered depending on clinical motor phenotypes. Based on our findings, the gut microbiome may be a potential PD biomarker. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Automatic topic identification of health-related messages in online health community using text classification.

    PubMed

    Lu, Yingjie

    2013-01-01

    To facilitate patient involvement in online health community and obtain informative support and emotional support they need, a topic identification approach was proposed in this paper for identifying automatically topics of the health-related messages in online health community, thus assisting patients in reaching the most relevant messages for their queries efficiently. Feature-based classification framework was presented for automatic topic identification in our study. We first collected the messages related to some predefined topics in a online health community. Then we combined three different types of features, n-gram-based features, domain-specific features and sentiment features to build four feature sets for health-related text representation. Finally, three different text classification techniques, C4.5, Naïve Bayes and SVM were adopted to evaluate our topic classification model. By comparing different feature sets and different classification techniques, we found that n-gram-based features, domain-specific features and sentiment features were all considered to be effective in distinguishing different types of health-related topics. In addition, feature reduction technique based on information gain was also effective to improve the topic classification performance. In terms of classification techniques, SVM outperformed C4.5 and Naïve Bayes significantly. The experimental results demonstrated that the proposed approach could identify the topics of online health-related messages efficiently.

  14. QM/MM simulations identify the determinants of catalytic activity differences between type II dehydroquinase enzymes.

    PubMed

    Lence, Emilio; van der Kamp, Marc W; González-Bello, Concepción; Mulholland, Adrian J

    2018-05-16

    Type II dehydroquinase enzymes (DHQ2), recognized targets for antibiotic drug discovery, show significantly different activities dependent on the species: DHQ2 from Mycobacterium tuberculosis (MtDHQ2) and Helicobacter pylori (HpDHQ2) show a 50-fold difference in catalytic efficiency. Revealing the determinants of this activity difference is important for our understanding of biological catalysis and further offers the potential to contribute to tailoring specificity in drug design. Molecular dynamics simulations using a quantum mechanics/molecular mechanics potential, with correlated ab initio single point corrections, identify and quantify the subtle determinants of the experimentally observed difference in efficiency. The rate-determining step involves the formation of an enolate intermediate: more efficient stabilization of the enolate and transition state of the key step in MtDHQ2, mainly by the essential residues Tyr24 and Arg19, makes it more efficient than HpDHQ2. Further, a water molecule, which is absent in MtDHQ2 but involved in generation of the catalytic Tyr22 tyrosinate in HpDHQ2, was found to destabilize both the transition state and the enolate intermediate. The quantification of the contribution of key residues and water molecules in the rate-determining step of the mechanism also leads to improved understanding of higher potencies and specificity of known inhibitors, which should aid ongoing inhibitor design.

  15. Ethics competences in the undergraduate medical education curriculum: the Spanish experience

    PubMed Central

    Ferreira-Padilla, Guillermo; Ferrández-Antón, Teresa; Lolas-Stepke, Fernando; Almeida-Cabrera, Rut; Brunet, Joan; Bosch-Barrera, Joaquim

    2016-01-01

    Aim To investigate if there are differences in medical ethics education between different schools of medicine in Spain, specifically between private and public schools and between recently founded schools and older ones. Method The curricula of medical degrees from all Spanish faculties were reviewed for the 2014/2015 academic year, identifying subjects concerning bioethics, deontology, and ethics. We identified the type of teaching, format and method of the course, the number of credits and hours, and the school year of each subject. An analysis with descriptive parameters and the Cohen’s coefficient (d) was performed. Results All medical schools in Spain (n = 44) were included. A mean of 3.64 European Credit Transfer and Accumulation System (ECTS) credits was specifically devoted to ethical values teaching in Spain. Private medical schools offered more credits than public ones (6.51 ECTS vs 2.88 ECTS, relevant difference: d = 2.06>>0.8), and the 10 most recently founded medical schools offered more credits than the 10 oldest (5.86 ECTS vs 2.63 ECTS, relevant difference: d = 1.43 > 0.8). A mean of 36.75 hours was dedicated to ethics education. Conclusions Although ethics education is incorporated into the training of future Spanish physicians, there is still notable heterogeneity between different medical schools in the time devoted to this topic. PMID:27815940

  16. The pea END1 promoter drives anther-specific gene expression in different plant species.

    PubMed

    Gómez, María D; Beltrán, José-Pío; Cañas, Luis A

    2004-10-01

    END1 was isolated by an immunosubtractive approach intended to identify specific proteins present in the different pea (Pisum sativum L.) floral organs and the genes encoding them. Following this strategy we obtained a monoclonal antibody (mAbA1) that specifically recognized a 26-kDa protein (END1) only detected in anther tissues. Northern blot assays showed that END1 is expressed specifically in the anther. In situ hybridization and immunolocalization assays corroborated the specific expression of END1 in the epidermis, connective, endothecium and middle layer cells during the different stages of anther development. END1 is the first anther-specific gene isolated from pea. The absence of a practicable pea transformation method together with the fact that no END1 homologue gene exists in Arabidopsis prevented us from carrying out END1 functional studies. However, we designed functional studies with the END1 promoter in different dicot species, as the specific spatial and temporal expression pattern of END1 suggested, among other things, the possibility of using its promoter region for biotechnological applications. Using different constructs to drive the uidA (beta-glucuronidase) gene controlled by the 2.7-kb isolated promoter sequence we have proven that the END1 promoter is fully functional in the anthers of transgenic Arabidopsis thaliana (L.) Heynh., Nicotiana tabacum L. (tobacco) and Lycopersicon esculentum Mill. (tomato) plants. The presence in the -330-bp region of the promoter sequence of three putative CArG boxes also suggests that END1 could be a target gene of MADS-box proteins and that, subsequently, it would be activated by genes controlling floral organ identity.

  17. Neptune: a bioinformatics tool for rapid discovery of genomic variation in bacterial populations

    PubMed Central

    Marinier, Eric; Zaheer, Rahat; Berry, Chrystal; Weedmark, Kelly A.; Domaratzki, Michael; Mabon, Philip; Knox, Natalie C.; Reimer, Aleisha R.; Graham, Morag R.; Chui, Linda; Patterson-Fortin, Laura; Zhang, Jian; Pagotto, Franco; Farber, Jeff; Mahony, Jim; Seyer, Karine; Bekal, Sadjia; Tremblay, Cécile; Isaac-Renton, Judy; Prystajecky, Natalie; Chen, Jessica; Slade, Peter

    2017-01-01

    Abstract The ready availability of vast amounts of genomic sequence data has created the need to rethink comparative genomics algorithms using ‘big data’ approaches. Neptune is an efficient system for rapidly locating differentially abundant genomic content in bacterial populations using an exact k-mer matching strategy, while accommodating k-mer mismatches. Neptune’s loci discovery process identifies sequences that are sufficiently common to a group of target sequences and sufficiently absent from non-targets using probabilistic models. Neptune uses parallel computing to efficiently identify and extract these loci from draft genome assemblies without requiring multiple sequence alignments or other computationally expensive comparative sequence analyses. Tests on simulated and real datasets showed that Neptune rapidly identifies regions that are both sensitive and specific. We demonstrate that this system can identify trait-specific loci from different bacterial lineages. Neptune is broadly applicable for comparative bacterial analyses, yet will particularly benefit pathogenomic applications, owing to efficient and sensitive discovery of differentially abundant genomic loci. The software is available for download at: http://github.com/phac-nml/neptune. PMID:29048594

  18. A global analysis of protein expression profiles in Sinorhizobium meliloti: discovery of new genes for nodule occupancy and stress adaptation.

    PubMed

    Djordjevic, Michael A; Chen, Han Cai; Natera, Siria; Van Noorden, Giel; Menzel, Christian; Taylor, Scott; Renard, Clotilde; Geiger, Otto; Weiller, Georg F

    2003-06-01

    A proteomic examination of Sinorhizobium meliloti strain 1021 was undertaken using a combination of 2-D gel electrophoresis, peptide mass fingerprinting, and bioinformatics. Our goal was to identify (i) putative symbiosis- or nutrient-stress-specific proteins, (ii) the biochemical pathways active under different conditions, (iii) potential new genes, and (iv) the extent of posttranslational modifications of S. meliloti proteins. In total, we identified the protein products of 810 genes (13.1% of the genome's coding capacity). The 810 genes generated 1,180 gene products, with chromosomal genes accounting for 78% of the gene products identified (18.8% of the chromosome's coding capacity). The activity of 53 metabolic pathways was inferred from bioinformatic analysis of proteins with assigned Enzyme Commission numbers. Of the remaining proteins that did not encode enzymes, ABC-type transporters composed 12.7% and regulatory proteins 3.4% of the total. Proteins with up to seven transmembrane domains were identified in membrane preparations. A total of 27 putative nodule-specific proteins and 35 nutrient-stress-specific proteins were identified and used as a basis to define genes and describe processes occurring in S. meliloti cells in nodules and under stress. Several nodule proteins from the plant host were present in the nodule bacteria preparations. We also identified seven potentially novel proteins not predicted from the DNA sequence. Post-translational modifications such as N-terminal processing could be inferred from the data. The posttranslational addition of UMP to the key regulator of nitrogen metabolism, PII, was demonstrated. This work demonstrates the utility of combining mass spectrometry with protein arraying or separation techniques to identify candidate genes involved in important biological processes and niche occupations that may be intransigent to other methods of gene expression profiling.

  19. Does the time frame between exercise influence the effectiveness of hydrotherapy for recovery?

    PubMed

    Halson, Shona L

    2011-06-01

    An increase in research investigating recovery strategies has occurred alongside the increase in usage of recovery by elite athletes. Because there is inconsistent evidence regarding the benefits of recovery on performance, it is necessary to examine research design to identify possible strategies that enhance performance in different athlete settings. The purpose of this review is to examine available recovery literature specifically related to the time frame between performance assessments to identify considerations for both research design and practical use of recovery techniques.

  20. A Climate Change Risk and Resilience Assessment Process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Myers, Lisa

    This presentation summarizes a site-specific climate resilience planning process applied at two different U.S. Department of Energy sites, in Colorado and along the Gulf Coast that federal site managers can use to identify and analyze potential climate-related risks and explore resilience options to minimize those risks.

Top